PS1 PCR with PrP by 5Wyc9c19

VIEWS: 0 PAGES: 1

									                               PS1 PCR with PrP Control
                                          (12/8/2009)

This worked well using the MJ Research PCR Machine and Andy’s homemade Taq Polymerase.

Reagent                    Volume/rxn (ul)
ddH2O                      37.0
10X PCR Buffer             5.0
50mM MgCl2                 2.5
5mM dNTPs                  1
50M 237F                  0.2
50M PrPa                  0.2
50M Prps                  0.1
Taq Polymerase             1
Tail DNA                   3

PCR Program, MJ Research PTC-200 (called PS1 in MJ Research Machine)
      1. 94C for 3 minutes
      2. A. 94C for 30 seconds
          B. 64.0C for 1 minute
          C. 72C for 1 minute
          D. 40 Cycles A-C
      3. 72C for 4 minutes
      4. Hold at 4C

Primer Sequences
       237F: CAGGTGGTGGAGCAAGATG
       PrP-Antisense-J: AGCCTAGACCACGAGAATGC
       PrP-Sense-J: GACTATGTGGACTGATGTCGG

Gel Percentage: 2%

Expected Products: PS1
Transgenic animals should produce one band from the PS1 product at approximately 1.2 kb.

Expected Products: Endogenous PrP
All animals, transgenic and wild-type, should exhibit the 750 bp band, indicating successful
amplification of the tail DNA.

								
To top