Supplementary material

Document Sample
Supplementary material Powered By Docstoc
					Xu_Supplementary Methods (Nature #2005-07-07913C) in MS Word (PC format)


Supplementary methods

<meth1ttl> Methods


<meth1hd> Genetics and molecular biology

       trp-4 deletion mutants were isolated by TMP/UV-based mutagenesis

screens and were backcrossed 7 times to N2 prior to behavioral analysis1.

Primers used in deletion screens are: ttcctcctgaaacagaagcatgacac (forward) and

tggttcgcccgtctgtaagctc (reverse). A third primer (ctaccagcctgtcgacgaggac)

residing within the deleted segments was used in conjunction with the reverse
primer to confirm the absence of the wild-type copy of trp-4 gene in trp-4

homozygous mutants. The 5’ and 3’ end of trp-4 coding regions shown in figure 1

were determined by RACE.

       To make trp-4::yfp for microinjection, a 19 kb genomic fragment

encompassing the promoter (extends to the stop codon of the upstream gene)
and coding regions of trp-4 was fused in frame to YFP by PCR, and the resulting

PCR product was directly injected into trp-4 mutant animals. Pdat-1::trp-4 (the

transgene driving expression specifically in the dopamine neurons) and Ptwk-
16(DVA)::trp-4 (the transgene driving expression specifically in DVA) were

generated with a similar strategy; the first exon and intron of the trp-4 gene were

not included in both transgenes to avoid possible enhancer elements. dat-1

encodes a dopamine transporter and is specifically expressed in the dopamine
neurons 3. Ptwk-16(DVA)::trp-4 utilizes the DVA-specific enhancer element in

the first intron of twk-16 to drive expression of trp-4 in DVA4. To make Ptwk-

16(DVA)::GCaMP and Ptwk-16(DVA)::DsRed2, the coding region of GCaMP and

DsRed2 (Clontech) was PCRed from its original plasmid and inserted behind the
twk-16(DVA) promoter, respectively. The same G-CaMP transgene was utilized
                                         1
Xu_Supplementary Methods (Nature #2005-07-07913C) in MS Word (PC format)


for all calcium imaging studies by crossing it into different genetic backgrounds.

Laser ablations were performed on L1 or L2 animals as previously described 2.


       The P values in figure 3 and figure 1 were determined by ANOVA with

Dunnett test by comparing DVA and/or DVC ablated animals and mock ablated
animals (for figure 3), and by comparing trp-4(sy695) or trp-4(sy696) and wild-

type (for figure 1). The P values in figure 2 were determined with Student’s t-test

by comparing animals moving on bacteria and those on agar.




<meth1hd> Calcium imaging


       Calcium imaging was performed on a Zeiss Axiovert 200 microscope

under a 40x objective. Images were acquired with a Roper CoolSnap CCD

camera and processed by Ratiotool software (ISeeimaging). G-CaMP and

DsRed2 (Clontech) fluorescence was excited at 484 nm and 535 nm,

respectively. The fluorescence intensity of DsRed2 slowly decreases because of

its relatively fast bleach compared to G-CaMP. The tail of individual animals was

glued on an agarose pad with Nexaband cyanoacrylate glue (Fisher). Upon
application of solution to the pad (14 mM Hepes [pH 7.4], 4 mM KCl, 145 mM

NaCl, 1.2 mM MgCl2, 2.5 mM CaC12, and 10 mM glucose), animals then began

to bend their body in the liquid, stimulating a robust increase in calcium level in

DVA. To manually bend worm’s body, a glass pipette mounted on a

micromanipulator was used to hold worm’s nose tip. To estimate bending

angles, the experiment was then repeated under a 10x objective to allow for

visualization of the entire animal, which is not possible under a 40x objective;

thus, the estimation was indirect. Other protocols such as gentle touch of the
body and nose did not elicit significant calcium response in DVA (n=5). To do so,

                                          2
Xu_Supplementary Methods (Nature #2005-07-07913C) in MS Word (PC format)


we glued the worm laterally on an agarose pad as previously described 5. A

glass probe with a rounded tip was mounted on a micromanipulator, and the

touch stimuli were delivered by moving the probe against the nose, the anterior

or posterior part of the worm body to cause a deflection of <10 M.



References



1.    Jansen, G., Hazendonk, E., Thijssen, K. L. & Plasterk, R. H. Reverse genetics by
      chemical mutagenesis in Caenorhabditis elegans. Nat Genet 17, 119-21 (1997).
2.    Bargmann, C. I. & Avery, L. Laser killing of cells in Caenorhabditis elegans.
      Methods Cell Biol 48, 225-50 (1995).
3.    Nass, R., Hall, D. H., Miller, D. M., 3rd & Blakely, R. D. Neurotoxin-induced
      degeneration of dopamine neurons in Caenorhabditis elegans. Proc Natl Acad Sci
      U S A 99, 3264-9 (2002).
4.    Salkoff, L. et al. Evolution tunes the excitability of individual neurons.
      Neuroscience 103, 853-9 (2001).
5.    O'Hagan, R., Chalfie, M. & Goodman, M. B. The MEC-4 DEG/ENaC channel of
      Caenorhabditis elegans touch receptor neurons transduces mechanical signals. Nat
      Neurosci 8, 43-50 (2005).




                                         3

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:10/4/2012
language:English
pages:3