Subjects - DOC

Document Sample
Subjects - DOC Powered By Docstoc
					Chapter Three …………………………………Subjects ,Materials and Methods

                           Chapter Three
                Subjects, Materials and Methods
3-1: Subjects:
      The study is done on a total number of 40 subjects including 30
patients and 10 apparently normal individuals.


3-1-1: Patients:
  A prospective study is performed on the 40 subjects. Thirty patients with a
proved diagnosis of Invasive Ductal Carcinoma (Not otherwise specified
"NOS") on histopathological examination presented to different hospitals
(including Baghdad, AL-Yarmook, AL-Kadhemya Teaching Hospitals).
These patients were from different age groups, different geographic
residencies and been examined in different laboratories between November
2008- March 2009.
 The patients were reviewed concerning different breast cancer risk factors
such as gender, age, age at menarche, age at first full term pregnancy, parity,
lactation history, postmenapausal hormone therapy and family history of
breast cancer (Appendix-I).      Then cases subjected to three successive
investigations including hormonal assay (which have been used for all 40
sample cases), histopathological examination and molecular study.


3-1-2: Control:
   Ten apparently normal individuals with different menstrual status and
with satisfactory reproductive history, all were married and at least have one
child with a history of previous lactation (Appendix-II) and all of them
subjected to hormonal assay.


                                      32
Chapter Three …………………………………Subjects ,Materials and Methods

3-2: Materials and Equipments:

The equipments and their sources are given below:


 Equipment                               Company            Country
 Automatic Micropipette                  Slamed             England
 Centrifuge (Minispin)                   Eppendorf          Germany

 Cover slips and Glass slides.           Sail brand         Italy
 Digital camera                          HP                 China
 Electrophoresis power supply            Amersham           Sweden
 Eppendorf tube (1.5,0.25 ml)            Clay Adams         Germany
 Fixed micropipette tips                 Volac              England
 Flasks                                  Simax              U.S.A
 Gama counter                            Beckman coulter    Germany

 Gel electrophoresis apparatus           Amersham           Sweden
 Heater stirrer                          Corning            USA
 Hood                                    Telestar           Spain
 Light microscopy                        Olympus            Japan
 Magnetic stirrer with hot plat          Gallenkamp         U.K
 Microtome                               LEICA              Germany
 Microflow hood class II A2              BioQuell           England
 Microfuge (max12000-14000 rpm)          Beckman coulter    Germany
 Oven shaker                             Thermo electron    USA
 Refrigerator                            Hitachi            Japan
 Thermal cycler (DNA incubator)          PeQlab primus 96   USA



                                    33
Chapter Three …………………………………Subjects ,Materials and Methods


 Equipment                         Company            Country
 UV transilluminator               UVP                USA
 Vortex                            Clay Adams         Germany


3-3: Solutions and Kits:
 Chemicals                     Sources             Country
 Absolute ethanol              Fluka               Germany
 Agarose                       AB analytica        Italy
 Bromo phenol blue             AB analytica        Italy
 Clean DNA kit                 AB analytica        Italy
 DNA ladder Marker (500 bp)    AB analytica        Italy
 Eosin                         Flow laboratories   UK
 Ethidium bromide              AB analytica        Italy
 Hematoxylin                   Flow laboratories   UK
 Low melting agarose           Promega             USA
 Master Mix                    Cinagen             Iran
 Primers                       Alpha DNA           Canada
 Proteinase K                  AB analytica        Italy
 RIA Estradiol Kit             Beckman coulter     Germany
 RIA Progesterone Kit          Beckman coulter     Germany
 RIA Prolactin Kit             Beckman coulter     Germany
 Taq Polymerase I              AB analytica        Italy
 50X TBE buffer                AB analytica        Italy
 Xylol                         Fluka               Germany



                              34
Chapter Three …………………………………Subjects ,Materials and Methods

3-3-1: CLEAN DNA Kit:
     Contents of the kit package are as follow:
                  Binding solution
                  Buffer K
                  DNA Binding Resin
                  Filter columns ,caps and 2ml tubes
                  Proteinase K (20 mg/ml)
                  Washing buffer


3-3-2: RIA (Radio Immuno Assay) Estradiol Kit:
            REAGENTS
           Anti-estradiol antibody coated tubes
           125
              I- labeled estradiol
           Tracer buffer
           Calibrators
           Control serum




3-3-3: RIA (Radio Immuno Assay) Prpgesterone Kit:
           REAGENTS
           Anti-progesterone antibody coated tubes
           125
              I- labeled progesterone
           Calibrators
           Control serum




                                     35
Chapter Three …………………………………Subjects ,Materials and Methods

3-3-4: RIA (Radio Immuno Assay) Prolactin Kit:
                  REAGENTS
                  Anti-prolactin antibody coated tubes
                  125
                     I- labeled antibody
                  Wash solution
                  Calibrators
                  Control serum


3-4: Methods:
3-4-1: Sampling:
3-4-1-1: Blood Sampling:
      Three – five ml of blood were collected in plane tubes from (30)
patients and from the (10) control individuals. Blood samples were drawn at
the morning between 9 and 9:30 a.m from the antecubital vein. All of them
were female (except one case was male) and diagnosed as breast cancer
patients, their ages ranging between 26 -71 years old attended to different
hospitals. The patients were interviewed and questioned according to special
form (Appendix-III). The blood sample tubes were centrifuged at 3000 rpm
for 2-5 minutes then the serum extracted to be stored or used immediately in
the process of hormonal assay.


3-4-1-2: Tissue Sampling:
      A thirty paraffin – embedded tissue samples of patients diagnosed to
be malignant breast tumors (Invasive Ductal Carcinoma)(NOS) (Figure 3-1).
Patient’s age ranging from 26-71 years old, attended between November
2008- March 2009, all were female (except one case) and followed up to the


                                     36
Chapter Three …………………………………Subjects ,Materials and Methods

following variants (definitive histopathological diagnosis, Age at menarche,
Age at marriage, past obstetric history , the history of contraception and the
history of hormonal therapy or chemotherapy).




                 Figure 3-1: Paraffin Embedded tissue samples.


      For each paraffin – embedded block, of every patient, 5 µm tissue
slices is used to prepare slides which is used for histopathological
examination by a pathologist to determine the definite diagnosis (Figure 3-2)
and to determine the slides that contain the highest population of malignant
cells. The selected slides that were shown to have the highest population of
malignant cells are isolated and matched with its corresponding blocks
(Figure 3-3).




                                     37
Chapter Three …………………………………Subjects ,Materials and Methods




        Figure 3-2: The paraffin embedded tissue samples with its
                          corresponding slides.




      Figure 3-3: The matching; the exact shape- matching indicates
               that this slide is originated from this block.




                                38
Chapter Three …………………………………Subjects ,Materials and Methods

 The resultant blocks were exposed for further sliding to confirm the
diagnosis and being examined onceagain. In order to be ready for molecular
study, the nominated blocks were sliced for 4-5 slices each is 15-20 µm in
thickness by a special device (Microtome ) (Figure 3-4 ) , and were used in
DNA extraction .




                            Figure 3-4: Microtome




                                    39
Chapter Three …………………………………Subjects ,Materials and Methods

3-5: Laboratory Work:
      3-5-1: Hormonal Study of Blood Samples.
      3-5-2: Histopathological Work.
      3-5-3: Molecular Study of Tissue Samples.


   3-5-1: Hormonal Study of Blood Samples:
   3-5-1-1: Specimen collection, Processing and Storage:
    The blood samples were collected in dry tubes containing no
      additives.
    The samples were centrifuged to separate plasma from blood cells.
    Then, serum or plasma samples may be stored at 2-8Cº if the assay to
      be performed within 24 hours. For longer storage it should be kept
      frozen (<-18Cº).
    Assay procedure:


   1) Estradiol:
          Step I: (Additions)
   To coated tubes, 100 µl of calibrator, control or sample were sequentially
added and then 500 µL of tracer were added, and mix briefly.
          Step II :( Incubation)
   The mix was Incubated for 3 hours at 18-25Cº with shaking.
          Step III: (Counting)
   The contents of the tubes were aspirated carefully, placed in Gamma
counter, and then the bound cpm and total cpm were counted.




                                     40
Chapter Three …………………………………Subjects ,Materials and Methods

   2) Progesterone :
            Step I: (Additions)
   To coated tubes, 50 µl of calibrator, control or sample were sequentially
added, and then 500 µL of tracer were added to the mix and mix briefly.
            Step II :( Incubation)
  The mix then was Incubated for 1 hour at 18-25Cº with shaking.
            Step III: (Counting)
  The contents of the tubes were aspirated carefully, placed in Gamma
Counter, and then the bound cpm and total cpm were counted.


 3)     Prolactin:
            Step I: (Additions)
      To coated tubes, 50 µl of calibrator, control or sample were sequentially
added and 500 µL of tracer then added, and then mix briefly.
            Step II :( Incubation)
      The mix then was Incubated for 1 hour at 18-25Cº with shaking.
            Step III: (Counting)
   The contents of the tubes were aspirated carefully, washed twice with
washing solution, placed in Gamma Counter, and then the bound cpm and
total cpm were counted.
 The results were obtained by electronically printed sheet containing the
overall results with the corresponding results of the control cases.


   3-5-2: Histopathological Work:
   Slides for histopathological examination and typing were defined
according to the World Health Organization histological classification of


                                       41
Chapter Three …………………………………Subjects ,Materials and Methods

tumors (1982). Slices of 5 µm from each paraffin embedded block were
placed on precleaned sterile slides. The slides then were incubated in oven
for about 15 minutes, and then washed with xylol and different
concentrations of alcohol to eliminate the reminants of paraffin, the slides
then were washed with tap water and placed in eosin for 5 minutes then
washed with tap water and stained with hematoxyline for another 20
minutes. Finally, the stained slides were covered with a coverslip and
examined under light microscope with different powers to determine the
provisional diagnosis and to determine the slides containing the highest
population of malignant cells to be the target of the molecular study,
furthermore, the pathologist would determine another cases with typical
benign conditions (mostly are fibroadenoma and fibroadenosis) and normal
slides to be considered and used as control cases.


      3-5-3: Molecular Study of Tissue Samples:
      3-5-3-1: DNA Extraction:
      Slices were prepared from the paraffin embedded tissue samples
which chosen to be used for DNA extraction. DNA extraction from tissue
samples performed according to manufacturer's instruction of CLEAN DNA
Kit (AB Analytica Co.) (Figure 3-5) as follow:
           Step I: Paraffin Removal.
           Step II: Proteinase K Digestion.
           Step III: Purification.




                                      42
Chapter Three …………………………………Subjects ,Materials and Methods




                        Figure 3-5: CLEAN DNA kit.


  STEP I: Paraffin Removal:
   The tissue slices were incubated with 1 ml Xylol in 1.5 mL Eppindorf
     tubes at 37 Cº for 40 minutes.
   The tubes were centrifuged for 10 min at 14.000 rpm and the
     supernatant were discarded. The previous steps were repeated twice.
   The tissue slices then treated with 1ml of Absolute Ethanol and
     incubated for 30 minutes at 37Cº, centrifuged for 10 minutes at 14.000
     rpm and the supernatants were discarded.
   The tissues suspended then with 1ml of 75% Ethanol, 1ml of 50%
     Ethanol successively (incubations for 10 minutes at 37 Cº for each
     are sufficient).



                                      43
Chapter Three …………………………………Subjects ,Materials and Methods

   Sometimes, a manual removal of the remnants of paraffin been tried to
   minimize the residual paraffin.
    The supernatants were discarded and tissues were washed twice with
       water, incubated for 5 minutes at 37 Cº, then centrifuged and the
       supernatant been discarded.
    The pellets were dried very well at room temperature.


       STEP II: Proteinase K Digestion:
    The tissues were resuspended in 200 µl of Buffer K , and a 20µl of
       Proteinase K were added to the mix , then incubated at 50-55 Cº for
       at least 5 hours ( better overnight) in a heating stirrer.


       STEP III: Purification:
    The DNA samples were placed in a tube.
    To the samples, 450 µl of Binding Solution and 50 µl of Resin were
       added sequentially and the contents were mixed by inverting the tubes
       many times.
      Filter columns were introduced in a 2 ml tubes, the mix then is
       transferred on the filters and centrifuged for 1 minute at 14,000 rpm.
      The filters column were taken off , the filtrates were discarded and
       500 µl of washing solution were added on the filter, centrifuged for
       1 minute at 14,000 rpm.
(To eliminate completely all traces of salt, a further washing with 500µl of
80% Ethanol could be done, with a subsequent centrifugation for 1 minute
at 14,000 rpm.)




                                        44
Chapter Three …………………………………Subjects ,Materials and Methods

   The filter columns were transferred in 1.5 ml clean tube. And to elute
     DNA, a 80-90 µl of water preheated at 65-70 Cº were added directly
     to the filter, the resin were resuspended for about 1 minute by a sterile
     tip then centrifuged for 1 minute at 14,000 rpm, then the filter
     columns were discarded and the tube been plugged .


    3-5-3-2: Agarose gel electrophoresis:
 1) Reagents:
  - Agarose
  - 50 X TAE buffer.
  - Bromophenol blue .
  - DNA marker.
  - Ethidium bromide (10mg / ml)
  Preparation of 1L of TAE Buffer (1X):
  20mL of 50X TAE + 980 mL of D.W


2) Agarose gel was prepared according to Sambrook et al.,( 1989)

          ۞ Preparation of agarose gel:
               A 50 ml of 1 X TAE were placed in a beaker.
               Then a 0.4 gm, 1gm agarose were added to the buffer (as
                required) to prepare 0.8% and 2% agarose gel respectively.(
                the same concentrations used in case of low melting
                agarose gel).
               The solution was heated to boiling (using heating stirrer)
               Then the solution was allowed to cool down. Then a 10 µL
                of Ethidium Bromide solution were added.



                                     45
Chapter Three …………………………………Subjects ,Materials and Methods

              Two concentrations of agarose gel were prepared (0.8%
                and 2%) as needed.

          ۞    Casting of the horizontal agarose gel:
              The gel was assembled to casting tray and the comb was
               positioned at one end of the tray.
              The agarose solution was dropped into the gel tray after
                both edges were sealed with tapes and the agarose was
                allowed to cool at room temperature for 30 minutes (in
                case of low melting agarose gel, left to cool on refrigerator
                for more than 30 minutes).
              The comb was carefully removed and the gel replaced in
                electrophoresis chamber.
              The chamber was filled with appropriate amount of TAE-
                electrophoresis buffer so that it covers 1-2 mm over the
                surface of the gel.

          ۞     Loading and running DNA in agarose gel:
              10 µL DNA was mixed with loading Blue Dye (2 µL) and
                loaded in the wells of the agarose gel.
              The cathode was connected to one side of the unit and the
                anode to the other side.
              The gel was run at 100 volt for 45 minutes.
              The DNA was observed by UV transilluminator


3-5-3-3: Polymerase Chain Reaction (PCR) for D8S1145, D8S1508:
1) Reagents were used in PCR (25µL) at final concentration:
              To a 25 µL PCR tube, a 9 µL DNA was utilized.


                                      46
Chapter Three …………………………………Subjects ,Materials and Methods

                 A 50 Picomoles of primers forward and reverse ( 2µL for
                   each) , were added to the tubes, as shown in table (3-1)
                 Finally, a 12 µL Master Mix (Cinagen Co.) were added.
  The D8S1508 and D8S1145 genotypes were analyzed by PCR, Genomic
DNA was amplified by using 4 sets of primers (Table 3-2).
 Table (3-1): The reaction mix (25 µl) for D8S1508 and D8S1145 genes .

  Chemicals                           Volume
  Primer forward (50 pM /µl )         2µl
  Primer reverse (50 pM /µl )         2µl
  DNA ( 20 ng /µl )                   9 µl
  Master Mix                          12 µl

Table (3-2): The D8S1508, D8S1145             genes Oligonucleotide primer
sequences.
Primer      Primer sequences                              Length    Product Size
D8S1508     F – 5-AAAATTCCTACCTTGCTATGAACA-3                24
                                                                    181-182 bp
            R- 5- CTGCACGTAACTCTCCACCA -3                   20
D8S1145     F - 5- TGCTAACTGGCACGGTCAC -3                   19
                                                                    261-289 bp
            R - 5-CAATCCCAGTAATCTATAACTTCA -3               24

  To enhance amplification of the PCR product, furtherly, 0.1 µl of Taq I
polymerase (5U/ µl) was added to the mix with omission from the size of
DNA.

2) PCR conditions:

   PCR conditions for D8S1145 and D8S1508 were shown in table (3-3)
and (3-4) respectively. The polymerase chain reaction (PCR) products were
subjected to 2% agarose gel electrophoresis. The presence of bands was
indicative of the normal genotypes whereas the absence of one copy was


                                       47
Chapter Three …………………………………Subjects ,Materials and Methods

indicated variable degrees of loss of heterozygosity. β-globin indicated by a
449-458 bp product was used as an internal control, and a negative control
without template DNA was used in each run.

               Table (3-3): PCR conditions for D8S1145 .
  Cycle     Steps               Temperature Time              No. of cycles
                                          °
  Initial     Denaturation 1         95C            5min.           1
      I       Denaturation 2         95C°            30 S
                                                                   35
     II        Annealing             63 C°           30 S
    III        Extension 1           72C°            30 S
  Final        Extension 2           72C°          20min.           1

                Table (3-4): PCR conditions for D8S1508.
   No.      Steps               Temperature Time              No. of cycles
                                          °
  Initial     Denaturation 1          95C           5min.           1
      I       Denaturation 2          95C°           30 S
                                                                   35
     II        Annealing             61.5 C°         30 S
    III        Extension 1            72C°           30 S
  Final        Extension 2            72C°         20min.           1


 Because of the low quality and the low size of the products, another low
melting agarose gel with the same concentrations (2%) was utilized.
Furthermore, a new electrophoresis chamber containing 16 wells was used to
improve visibility for larger number of samples at onetime.
 Control cases were 10, and its derived either from normal tissue samples
of the same patients confirmed by histopathological examination or from
other cases of benign breast conditions because of limitations of getting
normal tissue from normal individuals.




                                     48

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:2
posted:10/4/2012
language:English
pages:17