Hemoglobinopathies

W
Shared by: xiaopangnv
Categories
Tags
-
Stats
views:
14
posted:
10/3/2012
language:
Unknown
pages:
27
Document Sample
scope of work template
							Hemoglobinopathies
          Hemoglobin is the molecule
          that carries oxygen in the
Globin    blood. It is contained in red
          blood cells.




         Heme (porphyrin ring, red)
Hemoglobin
 globin Chains:、、、、、
 -type chains: ,  ----141 amino acids
  -type chains: 、、、 (G、A) -----146 amino acids

 Adult      Hb A          22 97~98%
             Hb A2         22 2~3%
             Hb F          22 <1%
 Fetal      Hb F          22
 Embryonic Hb Gower I      2 2
  (12 weeks) Hb Gower II   22
             Hb Portland   22
 -type chain gene group :

16 p12    2                1                 

                                                     
               Normal:    /                      

-type chain gene group :

         2             G     A    1       
11p12


                    Normal:       /                
                                   G   A    1    



                                                          


    22         22          22       22 22 22
    GowerⅠ GowerⅡ Portland                     F     A2 A

                Embryonic Hb              Fetal Hb    Adult Hb
Hemoglobinopathy is a group of rare, inherited disorders
involving inherited mutation of the globin genes leading
to a qualitative or quantitative abnormality of globin
synthesis.
Structural hemoglobinopathy (qualitative)
Amino acid substitution in the globin chain
471 variants ( 144,  259, other 59, two chains 9)


The Thalassemias (quantitative)
Syndromes in which the rate of synthesis of a globin chain
is reduced.
Beta thalassemia - reduced beta chain synthesis
Alpha thalassemia – reduced alpha chain synthesis
Gene Mutations

1. Substitution (different amino acid)
HbS (Sickle cell anemia)
6 GAA → GUA


2. Substitution (termination)
Hb Mckees-Rock
 144AAGUAUCACUAA→AAGUAACACUAA
                                 Terminator

3. Addition
Hb Constant Spring
 --141CGUUAA→--CGUCAAGCU---- UAA 173
            Terminator
4. Shift
Hb Wayne
   137ACCUCCAAAUACCGUUAA
                         142


                                     147
     ACCUCAAAUACCGUUAAG-----CGGUAG

5. Missing
Hb Gum Hiu
          91            95   98
89AGUGAGCUGCACUGUGACAAGCUGCAC GUG




              89 90 96 97 98
             AGUGAGCUGCACGUG
6. Fusion
Hb Lepore   G        A                




                 G        A               

                 G        A               
  Classification & Terminology
            Alpha Thalassemia
• Normal                          /
• Silent carrier                 - /
• Minor                          -/-
                                 --/
• Hb H disease                   --/-
• Barts hydrops fetalis           --/--

- : Indicates a gene deletion:
      Classification & Terminology
            Beta Thalassemia
    • Normal                             /
    • Minor                              /0
                                         /+
    • Intermedia                         0/+
    • Major                              0/0
                                         +/+
0   :Indicates no production of globin chain by gene
+:Indicates diminished, but some production of globin
chain by gene
                      Lab Tests

CBC (complete blood count)
•the number, size and shape of the red blood cells present.
•how much hemoglobin is in them
•MCV (mean corpuscular volume) is a measurement of the size of the
red blood cells. A low MCV is often the first indication of thalassemia. If
the MCV is low and iron-deficiency has been ruled out, the person may
be a thalassemia trait carrier or have one of the hemoglobin variants that
cause microcytosis (for example, Hgb E).
Blood smear
In this test, a trained laboratorian looks at a thin stained layer of blood,
on a slide, under a microscope.
•The number and type of white blood cells, red blood cells, and platelets
•The red blood cells may be:
         Microcytic (smaller than normal)
         Hypochromic (pale –indicating less hemoglobin)
         Varying in size (anisocytosis) and shape (poikilocytosis)
         Nucleated (not normal in a mature RBC)
         Have uneven hemoglobin distribution (producing “target cells”
           that look like a bull’s-eye under the microscope).
Detection of hemoglobin variants
These tests identify the type and measure the relative amount of
hemoglobins.
hemoglobin electrophoresis, isoelectric focusing, or high performance
liquid chromatography.
These techniques separate different hemoglobins based on their charge.
Most of the common variants can be identified using one of these methods
or a combination.
The relative amounts of any variant hemoglobin detected can help to
diagnose combinations of hemoglobin variants and thalassemia.
DNA analysis
This test is used to investigate deletions and mutations in the alpha and
beta globin producing genes. Family studies can be done to evaluate
carrier status and the types of mutations present in other family
members. DNA testing is not routinely done but can be used to help
diagnose hemoglobin variants, thalassemia, and to determine carrier
status.
Methods


Specimens were drawn into tubes containing dipotassium EDTA. All
specimens were analyzed on the Bio-Rad Variant II HPLC system.

Over a 32-month period, 60,293 samples were analyzed in the
Special Hematology Laboratory at Bellevue Hospital Center for
quantification of hemoglobin fractions and screening for
hemoglobin variants.
Alkaline and acid hemoglobin electrophoresis, and in certain
cases globin chain electrophoresis, isoelectric focusing, and DNA
analysis, were performed to document the identities of the
hemoglobin variants.
          (A), a normal patient.          (B), Hb Ko¨ln elutes at a retention time of
                                          2.26 min and the characteristic denatured
                                          Hb Ko¨ln at retention time 4.87 min.




C), Hb Twin Peak elution demonstrating    (D), Hb Lepore elution
the characteristic hump on the downward   demonstrating the characteristic increased
slope of the Hb A0 elution peak at 2.34   proportion of Hb A2 (11.6%) and hump on
min.                                      the downward slope of the Hb A2 peak at
                                          3.34 min.
(E), Hb A2’ (4.56 min) elution   (F), Hb G-Philadelphia elutes the characteristic
                                 lower proportion of Hb A2 (0.8%) at 3.63 min,
                                 the Hb G-Philadelphia elution peak at 4.24
                                 min, and the presence of the characteristic minor
                                 peak (2G-Philadelphia22 ) at 4.63 min.
(G), Hb Hasharon elutes the characteristic
decreased proportion of Hb A2 (1.5%) at      (H), Hb O-Arab elution demonstrating
3.60 min, a characteristic minor peak at     the characteristic minor peak at 3.98
4.27 min, and the characteristic minor       min, which is absent in Hb C samples.
peaks preceding and succeeding
(2Hasharon2) the Hb Hasharon elution
peak at 4.85 min.
Results:
The mean (SD) imprecision (CV) of the retention time was 1.0 (0.7)% .
Among 60 293 samples tested, we encountered 34 unique hemoglobin variants
and 2 tetramers.
18 variants and 2 tetramers could be identified solely by retention time
3 variants by retention time and proportion of total hemoglobin
4 variants could be identified by retention time and peak characteristics
8 variants by retention time and electrophoretic mobility.
1 variant (Hb New York) was missed on HPLC.

Retention time on HPLC was superior to electrophoresis for the differentiation
and identification of 6 members of the Hb J family, 4 members of the Hb D
family, and 3 variants with electrophoretic mobilities identical or similar to that
of Hb C.
6 variants with electrophoretic mobilities identical or similar to that of Hb S
could be differentiated and identified by retention time and proportion of total
hemoglobin.
HPLC detected two variants (Hb Ty Gard and Hb Twin Peaks) missed on
electrophoresis.
Hb A1C eluted in the P2 (1.24 –1.40 min) window. When the
elution peak was >7% of the total hemoglobin, the patient
records were checked for indication of diabetes and Hb A1C
quantification.
If no quantification was available, the Hb A1C was quantified
in the hospital’s chemistry laboratory by phenol-borate affinity
HPLC (Primus Corpora-tion). If the %Hb in the P2 window and
the Hb A1C values were concordant, i.e., within 15% of each
other, no further studies were performed.
The only hemoglobin variant found to elute in this window was
Hb Hope, which had a mean (SD) %Hb [45.9 (2.2)%] much
greater than would be expected for Hb A1C .

						
Related docs
Other docs by xiaopangnv
Yearlings in Legacy - McQuay Stables
Views: 163  |  Downloads: 0
Weekly Updates - Edublogs
Views: 172  |  Downloads: 0
What Counts as 5 a Day - Webs
Views: 153  |  Downloads: 0
What causes it
Views: 164  |  Downloads: 0
UNIFORM - Guthrie Street Primary School
Views: 153  |  Downloads: 0
Time Field Visitor vs. Home
Views: 176  |  Downloads: 0