PowerPoint Presentation - EVOLUTION by yurtgc548

VIEWS: 11 PAGES: 93

									EVOLUTION
    Basic premises for this
          discussion

 Evolution is not a belief system. It is a
  scientific concept. It has no role in
  defining religion or religious beliefs
 Evolution is a theory…but you don’t get
  any better than that in science
 Theory: a well-substantiated
  explanation that incorporates facts,
  laws, inferences and tested hypotheses.
      Some basic definitions
 Fact: an observation that has been
  repeatedly confirmed
 Hypothesis: a testable statement
  that can be used to build inferences
  and explanations
 Law: a descriptive generalization
  about how the physical world
  behaves
      What is evolution?


Let’s start by seeing what
evolution is not.
          Questions for Thought?
 Earthhas millions of kinds of
 organisms of every imaginable
 shape, size, and habitat.
  – This variety of living things is called
    biological diversity.

 Where  did all these different
  organisms come from?
 How are they related?
  Charles Darwin: The Father of
           Evolution
The Major Contributor
  to the Modern
  Theory of Evolution
 Loved to collect
  plants and animals.
 Astounded By
  Variety of Life
 A naturalist.

 Joined Crew of HMS
  Beagle, 1831

                                  6
       Contributors to Darwin’s
        thinking included: (in
 :       chronological order)
1.   James Hutton - Gradualism
2.   John-Baptiste Lamarck –
     Inheritance of Acquired Traits and
     Law of Use and Disuse
3.   Thomas Malthus – struggle for
     existence (resources)
4.   Georges Cuvier – species
     extinction (Catastrophism)
5.   Charles Lyell – uniformintarianism
     (geologic processes still changing
     Earth)
6.   Alfred Russel Wallace – organisms
     evolved from common ancestors
                  copyright cmassengale   7
Evolutionary Timeline




      copyright cmassengale   8
        James Hutton (1795)
 Theory of Geological
Change

Described  the Geological
Forces that Have Changed Life
on Earth Over Millions of Years
(erosion, earthquakes,
volcanoes…)
Changes in Earth’s crust due
to slow continuous processes
                 Gradualism
Idea Known ascopyright cmassengale   9
       Jean-Baptiste Lamarck
              (1809)
 One Of First Scientists
  To Understand That
  Change Occurs Over
  Time
 Stated that Changes
  Are Adaptations To the
  Environment acquired
  in an organism’s
  lifetime (Law of use
  and disuse)
 Said acquired changes
  were passed to
                copyright cmassengale   10
  offspring (Inheritance
      Lamarck’s Law of Use and
                  Disuse it got
 If a body part WAS used,
  stronger
 If body part was NOT used, it
  deteriorated          Blacksmiths &
                         Their Sons
                         (muscular arms)
                        Giraffe’s Necks
                         Longer (from
                         stretching)




                copyright cmassengale      11
Lamarck’s Inheritance of Acquired
             Traits
 Proposed      That By Selective Use
  Or Disuse Of Organs, Organisms
  Acquired Or Lost Certain Traits
  During Their Lifetime
 These Traits Could Then Be
  Passed On To Their Offspring
 Over Time This Led To New
  Species of dogs could be passed to offspring!
   Clipped ears




                     copyright cmassengale        12
copyright cmassengale   13
     George Cuvier (1760s)
 Idea of Catastrophism
 Studied fossils

 Found some species
  completely disappeared in
  more recent layers
 Stated that species
  disappear due to a
  catastrophic event of the
  earth’s crust (volcano,
            copyright cmassengale   14
           Charles Lyell (1830)
   Proposed theory of
    Uniformintarianism
   Published “Principles of
    Geology” Just Before The
    Beagle Set Sail & read by
    Darwin
    – Which explained why Darwin
      found sea shells at 13,000 ft
      above sea level!
   Explained Geological
    Processes That Shaped
    The Earth
   Proposed that the Earth
    was millions of years old
    instead of a few thousand
    years old        copyright cmassengale   15
Charles Darwin:
   the Naturalist




     copyright cmassengale   16
Darwin Left England in 1831




   He returned 5 years later in 1836
                                       17
   He Visited The Galapagos
           Islands…
     Group of Islands 1000
 Small
 km West of South America
 Each Had Very Different
  Climates
 Animals On Islands Unique
    Tortoise

    Iguana

    Finch

    Booby



                copyright cmassengale   18
The tortoises on each island had different
shaped shells and different neck lengths.




                 copyright cmassengale       20
        Darwin’s Finches
 Finches  on the islands resembled a
  mainland finch
 More types of finches appeared on
  the islands
  – where the available food was different
    (seeds, nuts, berries, insects…)
 Fincheshad different types of beaks
 adapted to their type of food
 gathering


                 copyright cmassengale       21
copyright cmassengale   22
            Publication of
        “On The Origin of Species”
 UponHis Return To England,
 Darwin Developed His
 Observations Into The Theory of
 Evolution
 But   He Did Not Publish For 25
 Years!


              Why?               23
   He Refused To
    Publish Until He
    Received An Essay
    From Alfred
    Wallace
    – Fellow Naturalist
    • Independently came to
      same Conclusion as
      Darwin that species
      changed over time
      because of their
      struggle for existence



                               24
  Definition
      :




• Evolution is the slow, gradual
  change in a population of
  organisms over time
               copyright cmassengale   25
      Darwin’s
     Theory of
     Evolution
Organisms Change Over
        Time
           Darwin’s Theory of
               Evolution
Individuals of a population vary extensively
   in their characteristics with no two
   individuals being exactly alike.


Much of this variation between individuals is
  inheritable.
Individuals who inherit characteristics most fit for
   their environment are likely to leave more
   offspring than less fit individuals- Called it Natural
   Selection

Therefore New Species Evolve

Natural Selection is the driving force for evolution.
                                                        27
              Definitions:

 Natural   Variation
 – Differences Among Individuals Of A
   Species
Artificial Selection
 – Selective Breeding To Enhance
   Desired Traits Among Stock or
   Crops
 –Nature Provided The Variation
  Among Different Organisms,
  And Humans Selected Those             28
copyright cmassengale   29
     Evolution By Natural Selection:
                  Main Concepts
1.   The Struggle for Existence
     (compete for food, mates,
     space, water, etc.)
2.   Survival of the Fittest
     (strongest able to survive and
     reproduce)
3.   Descent with Modification
     (new species arise from
     common ancestor replacing        30
            Darwin’s Struggle for
                 Existence
if nothing happens, the number of organisms
    of each species will increase exponentially,
    generation to generation

Environmental resources are limited
• Production of more individuals than can be
  supported by the environment leads to a
  struggle for existence among individuals
  Each Species Struggles For:
    – Food
    – Living Space
    – Mates


•   Only a fraction of offspring survive each
    generation-Survival of the Fittest
                                                31
          Darwin’s The Struggle for
                 Existence
    Thomas Malthus’ Influence
    (1798):
    – Studied Population growth
    – High Birth Rates & Limited Resources
      Would Force Life & Death Competition
Darwin Realized Malthus’s Principles
  Were Visible In Nature
 Plants & Animals Produce Far More
  Offspring Than Can Be Supported
    – Most Die
    – If They Didn’t –
      Earth Would Be Overrun


                                             32
        Survival of the Fittest:
   Fitness
    –   Ability of an Individual To Survive &
        Reproduce

   Adaptation
    –   Inherited Characteristic That
        Increases an Organisms Chance for
        Survival
         Physical   (Speed, Camouflage, Claws, Quills,
          etc.)
         Behavioral (Solitary, Herds, Packs, Activity,
          etc.)



                                                      33
 Descent With Modification:

 Species Today Look Different
  From Their Ancestors
 Each Living Species Has
 – Descended…
    With   Changes…
     – From Other Species…
         Over Time!




                                 34
Descent With Modification:
 Takes Place Over Long Periods
  of Time
 Natural Selection Can Be
  Observed As Changes In:
    – Body Structures
    – Ecological Niches
    – Habitats
   Implies
    – All Living Organisms Are Related
   Common Descent?
    – All Species, Living & Extinct, Were
      Derived From Common Ancestors

                                            35
Let’s Look At:
  Descent With
 Modification




  copyright cmassengale   36
            Types of Evolution
 CONVERGENT           EVOLUTION:          When
    the process of evolution causes two unrelated
    species to become more similar with regard to
    certain characteristics.
   For example, bats and butterflies. Both have
    wings, but they came from totally different
    lineages, evolved through different
    mechanisms/mutations.
   Convergent evolution produces analogous
    structures
         Types of Evolution
 DIVERGENT    EVOLUTION : When the
  process of evolution causes two related
  species to become more dissimilar with
  regard to certain characteristics.
 For example, bats and horses. Both share
  the same lineage as mammals, but the
  limb of the bat became wings while the
  horse developed hooves.
 Divergent evolution produces homologous
  structures
        Types of Evolution
 Coevolution :two species evolve in
  response to each other.
 For example, predator/prey or
  host/parasite species.
      Major Problem in Darwin’s
               Theory
• No mechanism to
  explain natural
  selection
• How could favorable
  variations be
  transmitted to later
  generations???

  • With the rediscovery of
    Mendel’s work in the
.
    first half of the 20th
    century, the missing          40
    link in the evolutionary
             Speciation
 TheFormation of a New
 Species.
   Species: group of organisms that
    can interbreed and produce fertile
    offspring.
 Asnew species evolve (change
 over time), they become
 reproductively isolated from
 each other.
Reproductive Isolation –
 Members of 2 populations
 cannot interbreed and produce
     Three Reproductive Isolating
            Mechanisms
1.   Behavioral Isolation – Capable of
     breeding but have different
     courtship rituals.

2.   Geographical Isolation –
     Separated by a geographic
     barrier like rivers, mountains, or
     bodies of water.

3.   Temporal Isolation – 2 or more
     species reproduce at different
Table 23.1a
             Behavioral Isolation




Four species of leopard frogs: differ in their
mating calls. Hybrids are inviable.
These squirrels live on opposite sides of the Grand Canyon. This is
an example of Geographical Isolation.
Geographic Isolation of Darwin’s
           Finches
     Evidence of Evolution
Key Concept
  Darwin Argued That Living Things
  Have Been Evolving On Earth For
  Millions of Years. Evidence For This
  Process Could Be Found In:
 1.The Fossil Record
 2.The Geographic Distribution of
  Living Species
 3.Homologous Body Structures
 4.Similarities In Early Development

                                         47
Relative Dating:
    -Performed by
estimating fossil age
compared with that of
    other fossils

  - Looks at rock strata
 in sedementary rock

    Absolute
      Dating:
   Is performed by
 radioactive dating –

   Calculates the
  numerical age of
      fossils
 Carbon-14 Radioactive Dating

1. All living organisms take in carbon-12 and
carbon-14.
2. Carbon-14 is radioactive; when the
organism dies, it stops absorbing carbon.
3. The C12/C14 usually have a constant ratio
until death. The C-14 decays changing the
ratio, and scientists study this to determine
age.
4. This is determined by the half-life of C-14,
which is 5,710 years.
              Definition:
 Half-life is the length of time
  required for half the radioactive
  atoms in a sample to decay.
 This means that after one half-life,
  one half of the radioactive atoms in a
  sample have decayed. At the end of
  the next half-life, one half of the
  remaining radioactive atoms have
  decayed. So on and so forth…
       2. The Geographic
      Distribution of Living
             Species
 Different
 Animals On
 Different
 Continents Have
 Similar
 Adaptations To
 Shared
 Environments
    The Pouch!!!


                               52
      3. Homologous Body
           Structures
 Scientists Noticed Animals With
  Backbones (Vertebrates) Had
  Similar Bone Structure
 May Differ In Form or Function

 Definition: Structures That Have
 Different Mature Forms But Develop
 From The Same Embryonic Tissues
 LimbBones Develop In Similar
 Patterns
     Arms,   Wings, Legs, Flippers   53
Homologous Structures
                        54
Strong Evidence That All Four-Limbed Animals With
Backbones Descended, With Modification, From A Common
Ancestor
      Vestigial “Organs”
 Homologous   structures of
 organisms that have lost all of
 most of their original function
 in a species through evolution.
    Appendix In Man
    Legs On Skinks




                               56
Vestigial
Organs
                  Side Note:
         Anatomy That Does NOT
            Suggest Evolution

Analogous Structures: These features are
similar in function, but they differ in internal
structure.
        3. Similarities In Early
             Development
 Embryonic   Structures Of
  Different Species Show
  Significant Similarities
Definition:
 Embryo – early stages of
  vertebrate development




   Human Fetus – 5 weeks
                                   59
Similarities in Early
  Development
Embryological development
Chicken   Turtle




    Rat



                   62
              Some New Evidence of
                    Evolution:
              Comparative Biochemistry
             • The basic similarity of all living things suggests
               that they evolved from a single common ancestor.

            DNA is the universal genetic code for all organisms.
            • As we have already seen, all living things pass
              on information from generation to generation
              using the DNA molecule.
            • All living things also use a molecule
              called ATP to carry
  DNA for     energy around the
Information organism.                                       ATP for
  Transfer                                                   Energy
                                                            Transfer
        Some New Evidence of
          Evolution:
HUMAN      Similar Genes
             CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE   CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA      CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA



Genetic code of chimps and gorillas is almost identical to humans

  • Expect that closely related organisms will be more similar to one
  another than more distantly related organisms.

  • The human genetic code and the chimpanzees are nearly genetically
  identical (differ by less than 1.2%) whereas the mouse differs by
  ≈15%!
Similarities in DNA Sequence   65
Some New Evidence of
  Evolution:
   Antibiotic Resistance wondered
       Staphylococcus Have you ever
                          why you have to take all of
                          your prescribed Antibiotics?
                          They can become “resistant”!


          Natural selection in action!
          The antibiotic acts as an environmental
          pressure. It weeds out those bacteria with low
          resistance and only those with high resistance
          survive to reproduce.
          If you don’t finish your antibiotics, then you
          leave high resistance bacteria behind to
          multiply!
How natural selection works
          Resistance to antibacterial soap
            Generation 1: 1.00 not resistant
                        0.00 resistant
How natural selection works
          Resistance to antibacterial soap
            Generation 1: 1.00 not resistant
                        0.00 resistant
How natural selection works
            Resistance to antibacterial soap
              Generation 1: 1.00 not resistant
                          0.00 resistant

              Generation 2: 0.96 not resistant
                          0.04 resistant


mutation!
How natural selection works
         Resistance to antibacterial soap
             Generation 1: 1.00 not resistant
                         0.00 resistant

            Generation 2: 0.96 not resistant
                        0.04 resistant

             Generation 3: 0.76 not resistant
                         0.24 resistant
How natural selection works
         Resistance to antibacterial soap
            Generation 1: 1.00 not resistant
                        0.00 resistant

            Generation 2: 0.96 not resistant
                        0.04 resistant

            Generation 3: 0.76 not resistant
                        0.24 resistant

            Generation 4: 0.12 not resistant
                        0.88 resistant
Some New Evidence of
  Evolution:
   Pesticide Resistance
Why do farmers need
to keep coming up with
new ways to get rid of
pests???

They can become
“resistant”!

Now, farmers are growing
crops that are “naturally”
resistant to pests… Which
puts a stop to Super Bugs!
                             72
Some New Evidence of
  Evolution:
  Drug Resistance




   Evolution of drug resistance in HIV.
           This is NOT good!              73
    Evolutionary
    Time Scales

Macroevolution:
  Long time scale
 events that create
and destroy species.




                  copyright cmassengale   74
    Evolutionary
    Time Scales
Microevolution:
    Short time scale
events (generation-to-
   generation) that
change the genotypes
  and phenotypes of
     populations

                         75
    Punctuated Equilibrium
 Normallythe fossil record indicates
 a pattern of slow, steady change
 over time.
  – Gradualism
  – A state of Equilibrium
 Occasionally, something happens
 to disturb this equilibrium.
  – Characterized by brief periods of
    more rapid change in the fossil
    record.
  – Most new species produced during
       Gradualism




Punctuated Equilibrium
      Question for Thought?
 Evolution is not how life began, but
  how life changed over time and how
  new species came into existence.
 How did life begin?
What was early Earth like?
Earth was Hot!!
Little or no oxygen
Gasses in atmosphere:
   Hydrogen cyanide (poison to you!)
   Hydrogen sulfide
   Carbon dioxide
   Carbon monoxide
   Nitrogen
   Water vapor
The First Organic Molecules
Miller and Urey’s Experiment
 Passed sparks (lightening)
through a mixture of hydrogen,
methane, & ammonia (the
atmosphere) and boiling water
(the ocean)
 This produced 21 amino acids
– the building blocks of life!
          “Atmosphere”




           “Lightening”




“Ocean”
Key Concept:

Miller & Urey’s
experiment
suggested how
mixtures of the
organic
compounds
necessary for
life could have
arisen from
simpler
compounds on a
    Formation of tiny proteinoid
          Microspheres
•   3.8 Billion Years Ago
•   200 – 300 million years after the Earth cooled
    down enough to carry liquid water.
•   Cells similar to bacteria were
    very common.

Have characteristics of life:
1. Store and release energy
2. Have selectively permeable membranes
   Evolution of RNA to DNA
• RNA might have
been assembled
from simple organic
molecules present
on Earth.
• RNA is vital to the
replication of DNA
and protein
synthesis.
• Maybe was able to
replicate itself and
eventually form
DNA.
Production of Free Oxygen




• Some came from photosynthetic
bacteria.
• Some came from the chemical
separation of water molecules into
oxygen and hydrogen.
 This “polluted” the
Earth’s atmosphere.
 Oxygen drove some
life forms to extinction
 Others evolved ways
of using oxygen for
respiration
         Question for Thought?
   We have taken care of:
    –   Amino Acids
    –   Oxygen in our atmosphere
    –   RNA and DNA
    –   Prokaryotes


   Where Did Eukaryotic Organisms
    Come From?
Endosymbiotic
Theory
 Eukaryotic cells arose from
living communities formed by
prokaryotic organisms
 Ancient prokaryotes entered
primitive eukaryotic cells and
remained there as organelles

								
To top