Docstoc

تعبير الخبر الوراثي

Document Sample
تعبير الخبر الوراثي Powered By Docstoc
					                                                   ‫ﺍﻟﻔﺼل ﺍﻟﺜﺎﻨﻲ:‬
                                            ‫ﺗﻌﺒﻴﺮ ﺍﻟﺨﺒﺮ ﺍﻟﻮﺍﺛﻲ‬
                                                                                                                     ‫ﺘﻤﻬﻴﺩ:‬
‫ﻤﻥ ﺨﻼل ﺩﺭﺍﺴﺔ ﺘﺠﺎﺭﺏ ‪ GRIFFITH‬ﺘﺒﻴﻥ ﺃﻥ ﻫﻨﺎﻙ ﻋﻼﻗﺔ ﺒﻴﻥ ﺍﻟﻤﺎﺩﺓ ﺍﻟﻭﺭﺍﺜﻴﺔ )‪ ،(ADN‬ﻭﻅﻬﻭﺭ ﺃﻭ ﻏﻴﺎﺏ‬
 ‫ﺼﻔﺔ ﻤﻌﻴﻨﺔ. ﻓﻤﺎ ﻫﻲ ﻫﺫﻩ ﺍﻟﻌﻼﻗﺔ؟ ﻭﻜﻴﻑ ﻴﺘﺤﻜﻡ ‪ ADN‬ﻓﻲ ﻅﻬﻭﺭ ﺼﻔﺎﺕ ﻭﺭﺍﺜﻴﺔ ﻗﺎﺒﻠﺔ ﻟﻠﻤﻼﺤﻅﺔ ﻭﺍﻟﻘﻴﺎﺱ؟‬

                                                              ‫‪ – Ι‬ﻤﻔﻬﻭﻡ ﺍﻟﺼﻔﺔ، ﺍﻟﻤﻭﺭﺜﺔ، ﺍﻟﺤﻠﻴل، ﻭﺍﻟﻁﻔﺭﺓ.‬
                                                                                 ‫‪ ‬ﻤﻔﻬﻭﻡ ﺍﻟﺼﻔﺔ ﺍﻟﻭﺭﺍﺜﻴﺔ.‬
         ‫ﺍﻟﺼﻔﺔ ﺍﻟﻭﺭﺍﺜﻴﺔ ﻫﻲ ﻤﻴﺯﺓ ﻨﻭﻋﻴﺔ ﺃﻭ ﻜﻤﻴﺔ، ﺘﻤﻴﺯ ﻓﺭﺩﺍ ﻋﻥ ﺒﺎﻗﻲ ﺃﻓﺭﺍﺩ ﻨﻭﻋﻪ، ﻭﺘﻨﻘل ﻋﺒﺭ ﺍﻷﺠﻴﺎل.‬
‫ﺒﻌﺽ ﺍﻟﺼﻔﺎﺕ ﺘﻼﺤﻅ ﺒﺎﻟﻌﻴﻥ ﺍﻟﻤﺠﺭﺩﺓ )ﻟﻭﻥ ﺍﻷﺯﻫﺎﺭ ﻤﺜﻼ(، ﻓﻲ ﺤﻴﻥ ﻻ ﺘﺒﺭﺯ ﺃﺨﺭﻯ ﺇﻻ ﺒﻭﺍﺴﻁﺔ ﺍﺨﺘﺒﺎﺭﺍﺕ‬
                                                         ‫ﺃﻭ ﺘﺤﺎﻟﻴل ﺨﺎﺼﺔ )ﺍﻟﻔﺼﻴﻠﺔ ﺍﻟﺩﻤﻭﻴﺔ ﻤﺜﻼ(.‬

                                                                         ‫‪ ‬ﺍﻟﻌﻼﻗﺔ ﺒﻴﻥ ﺍﻟﺨﺒﺭ ﺍﻟﻭﺭﺍﺜﻲ ﻭﺍﻟﺼﻔﺔ.‬
                                                                          ‫ﺃ – ﺘﺠﺎﺭﺏ. ﺃﻨﻅﺭ ﻨﺸﺎﻁ 1، ﻟﻭﺤﺔ1.‬
                                                                          ‫‪ ‬ﻧﺸﺎط 1 ﻣﻔﮭﻮم اﻟﺼﻔﺔ، اﻟﻤﻮرﺛﺔ، اﻟﺤﻠﯿﻞ، واﻟﻄﻔﺮة.‬
                                                         ‫ﻣﻦ ﺧﻼل اﻟﺘﺠﺮﺑﺘﯿﻦ اﻟﺘﺎﻟﯿﺘﯿﻦ ﻧﺤﺎول ﺗﺘﺒﻊ اﻧﺘﻘﺎل ﺑﻌﺾ اﻟﺼﻔﺎت اﻟﻮراﺛﯿﺔ .‬
                                                                                                         ‫♥ اﻟﺘﺠﺮﺑﺔ 1 :‬
      ‫ﻧﺨﺘﺎر إﺣﺪى اﻟﻜﺎﺋﻨﺎت اﻟﺤﯿﺔ اﻟﺘﻲ ﻟﮭﺎ دورة ﻧﻤﻮ ﻗﺼﯿﺮة زﻣﻨﯿﺎ ﻣﺜﻞ ﺑﻜﺘﺮﯾﺎ ‪ .Echerichia-Coli‬إذا ﻛﺎﻧﺖ اﻟﻈﺮوف ﻣﻼﺋﻤﺔ ﺗﻨﻘﺴﻢ‬
  ‫ھﺬه اﻟﺒﻜﺘﺮﯾﺎ ﻓﻨﺤﺼﻞ ﻋﻠﻰ ﻣﺴﺘﻌﻤﺮة ﺑﻜﺘﯿﺮﯾﺔ )‪ (colonie‬ﺗﺪﻋﻰ اﻟﻠﻤﺔ )‪ ،(clone‬ﺗﻜﻮن اﻟﺒﻜﺘﺮﯾﺎ ﺑﮭﺎ ﻟﮭﺎ ﻧﻔﺲ اﻟﺨﺼﺎﺋﺺ واﻟﻤﺘﻄﻠﺒﺎت.‬
      ‫و ﻗﺪ ﺗﺘﻮاﻟﺪ ھﺬه اﻟﺒﻜﺘﺮﯾﺎ ﻓﻲ وﺳﻂ أدﻧﻰ ) أﻣﻼح ﻣﻌﺪﻧﯿﺔ + ﻏﺮاء + ﺳﻜﺮ ( = )‪ .(M.m‬وﻣﻦ ﻣﻤﯿﺰات ھﺬه اﻟﺒﻜﺘﯿﺮﯾﺎ أﻧﮭﺎ ﻏﯿﺮ ﻗﺎدرة‬
       ‫ﻋﻠﻰ اﻟﻌﯿﺶ واﻟﺘﻜﺎﺛﺮ ﻓﻲ وﺳﻂ ﯾﺤﺘﻮي ﻋﻠﻰ اﻟﻤﻀﺎد اﻟﺤﯿﻮي )‪ (Antibiotique‬اﻟﻤﺴﻤﻰ ﺳﺘﺮﯾﺒﺘﻮﻣﯿﺴﯿﻦ ‪،Streptomycine‬‬
                                                                ‫ﺣﯿﺚ ﺗﻌﺘﺒﺮ ﺣﺴﺎﺳﺔ ﻟﮭﺬا اﻟﻤﻀﺎد اﻟﺤﯿﻮي ﻓﻨﺮﻣﺰ ﻟﮭﺎ ﺑـ ‪.Strep S‬‬
           ‫ﺑﻌﺪ زرع ھﺬه اﻟﺒﻜﺘﯿﺮﯾﺎ ﻓﻲ وﺳﻂ ﺑﺪون ﺳﺘﺮﯾﺒﺘﻮﻣﯿﺴﯿﻦ، ﺗﻢ ﺗﺸﺘﯿﻠﮭﺎ ) ﻧﻘﻠﮭﺎ ( إﻟﻰ أوﺳﺎط ﻣﺨﺘﻠﻔﺔ ﻛﻤﺎ ھﻮ ﻣﺒﯿﻦ ﻋﻠﻰ اﻟﻮﺛﯿﻘﺔ1:‬
                                                                               ‫1( اﻧﻄﻼﻗﺎ ﻣﻦ ھﺬه اﻟﻤﻌﻄﯿﺎت، أﻋﻂ ﺗﻌﺮﯾﻔﺎ ﻟﻠﻤﺔ.‬
                                                        ‫2( ﺻﻒ ھﺬه اﻟﺘﺠﺮﺑﺔ، ﺛﻢ ﺣﺪد ﻣﺎ ھﻮ اﻟﻤﺸﻜﻞ اﻟﺬي ﺗﻄﺮﺣﮫ ھﺬه اﻟﻨﺘﺎﺋﺞ؟‬
                                                                                         ‫3( اﻗﺘﺮح ﺗﻔﺴﯿﺮا ﻟﻨﺘﺎﺋﺞ ھﺬه اﻟﺘﺠﺮﺑﺔ.‬
                                                                                                         ‫♥ اﻟﺘﺠﺮﺑﺔ 2 :‬
      ‫ﻧﻀﻊ ﺑﻜﺘﺮﯾﺎ ‪ Strep s‬ﻏﯿﺮ ﻗﺎدرة ﻋﻠﻰ اﻟﻌﯿﺶ ﻓﻲ وﺳﻂ ﻻ ﯾﺤﺘﻮي ﻋﻠﻰ ااﻟﻼﻛﺘﻮز )‪.(Lactose‬وﺗﺘﻄﻠﺐ ھﺬه اﻟﺒﻜﺘﺮﯾﺎ ھﺬا اﻷﺧﯿﺮ‬
  ‫ﻟﻠﻌﯿﺶ وﻟﮭﺬا ﯾﺮﻣﺰ إﻟﯿﮭﺎ ب )- ‪ ، (Lac‬ادن ھﺬه اﻟﺒﻜﺘﺮﯾﺎ ﺳﯿﺮﻣﺰ إﻟﯿﮭﺎ ب ) - ‪ .(Strep s , Lac‬إذا ﺗﺘﺒﻌﻨﺎ ھﺬه اﻟﺘﺠﺎرب ﻓﺈﻧﻨﺎ ﻧﺤﺼﻞ‬
    ‫، ) + ‪,(Strep r , Lac‬‬             ‫) - ‪(Strep r , Lac‬‬          ‫ﺑﺎﻹﺿﺎﻓﺔ ﻟﻠﺒﻜﺘﺮﯾﺎ اﻟﻤﺬﻛﻮرة ﺳﺎﺑﻘﺎ ﻋﻠﻰ أﻧﻮاع أﺧﺮى واﻟﺘﻲ ھﻲ :‬
                                                                                                     ‫) + ‪. ( Strep s , Lac‬‬
                                                                               ‫4( ﻣﺎذا ﺗﺴﺘﻨﺘﺞ ﻣﻦ ﺗﺤﻠﯿﻞ ﻣﻌﻄﯿﺎت اﻟﺘﺠﺮﺑﺔ 2 ؟‬
           ‫5( ارﺑﻂ ﺑﯿﻦ ﻧﺘﺎﺋﺞ اﻟﺘﺠﺮﺑﺘﯿﻦ وﺑﻨﯿﺔ ﺟﺰﯾﺌﺔ ‪ ADN‬ﺛﻢ اﺳﺘﺨﻠﺺ ﻣﻔﮭﻮم اﻟﻤﻮرﺛﺔ ‪ Le gène‬و ﻣﻔﮭﻮم اﻟﺤﻠﯿﻞ ‪. L’allèle‬‬

                                                                                                                     ‫اﻟﻮﺛﯿﻘﺔ1:‬
                                                                                       ‫ﺑﻜﺘﯿﺮﯾﺎ ‪Strep S‬‬
                                                                                ‫ﻓﻲ وﺳﻂ ‪ Mm‬ﺑﺪون ﺳﺘﺮﯾﺒﺘﻮﻣﯿﺴﯿﻦ‬
                                                                     ‫ﻋﻠﺒﺔ ﺑﯿﺘﺮي‬                         ‫ﻣﺴﺘﻌﻤﺮة ﺑﻜﺘﯿﺮﯾﺔ‬


 ‫‪ + Mm‬ﺳﺘﺮﯾﺒﺘﻮﻣﯿﺴﯿﻦ‬                ‫‪ + Mm‬ﺳﺘﺮﯾﺒﺘﻮﻣﯿﺴﯿﻦ‬                                          ‫ﺗﺸﺘﯿﻞ‬


                                                                          ‫‪Mm‬‬                          ‫‪ + Mm‬ﺳﺘﺮﯾﺒﺘﻮﻣﯿﺴﯿﻦ‬

          ‫‪Mm‬‬                                ‫‪Mm‬‬

 ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                        ‫1‬                                            ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
                                                                          ‫ﺏ – ﺘﺤﻠﻴل ﻭﺍﺴﺘﻨﺘﺎﺝ.‬
                          ‫1( ﺍﻟﻠﻤﺔ ﻫﻲ ﻤﺠﻤﻭﻋﺔ ﻤﻥ ﺍﻷﻓﺭﺍﺩ ﻟﻬﻡ ﻨﻔﺱ ﺍﻟﺨﺒﺭ ﺍﻟﻭﺭﺍﺜﻲ، ﻭﻤﻥ ﺘﻡ ﻨﻔﺱ ﺍﻟﺼﻔﺎﺕ.‬

   ‫2( ﻨﻼﺤﻅ ﺃﻥ ﺍﻟﺒﻜﺘﻴﺭﻴﺎ ﻻ ﺘﺘﻜﺎﺜﺭ ﻋﻨﺩ ﻭﺠﻭﺩ ﺍﻟﺴﺘﺭﻴﺒﺘﻭﻤﻴﺴﻴﻥ )‪ ،(Strep S‬ﻟﻜﻥ ﺘﻅﻬﺭ ﺘﻠﻘﺎﺌﻴﺎ ﺒﻜﺘﻴﺭﻴﺎﺕ‬
                  ‫ﺃﺨﺭﻯ ﻓﻲ ﻫﺫﺍ ﺍﻟﻭﺴﻁ، ﻤﻘﺎﻭﻤﺔ ﻟﻠﺴﺘﺭﻴﺒﺘﻭﻤﻴﺴﻴﻥ، ﻨﺼﻁﻠﺢ ﻋﻠﻰ ﺘﺴﻤﻴﺘﻬﺎ )‪.(Strep R‬‬
                       ‫ﺍﻟﻤﺸﻜل ﺍﻟﻤﻁﺭﻭﺡ ﻫﻭ ﻜﻴﻑ ﺃﺼﺒﺤﺕ ﺍﻟﺒﻜﺘﻴﺭﻴﺎ ‪ Strep S‬ﺒﻜﺘﻴﺭﻴﺎ ‪¿ Strep R‬‬

 ‫3( ﺒﻤﺎ ﺃﻥ ﺍﻟﺼﻔﺔ ‪ Strep S‬ﻭﺭﺍﺜﻴﺔ، ﻭﺍﻟﺼﻔﺔ ‪ Strep R‬ﺒﺩﻭﺭﻫﺎ ﻭﺭﺍﺜﻴﺔ، ﻓﺎﻥ ﺍﻟﻤﺘﺤﻜﻡ ﻓﻴﻬﻤﺎ ﻫﻭ ‪.ADN‬‬
    ‫ﻻ ﻴﻤﻜﻥ ﺍﺩﻥ ﺘﻔﺴﻴﺭ ﺘﺤﻭل ﺍﻟﺒﻜﺘﻴﺭﻴﺎ ‪ Strep S‬ﺇﻟﻰ ﺒﻜﺘﻴﺭﻴﺎ ‪ Strep R‬ﺇﻻ ﺒﺤﺩﻭﺙ ﺘﻐﻴﺭ ﻓﺠﺎﺌﻲ ﻋﻠﻰ‬
‫ﻤﺴﺘﻭﻯ ‪ ،ADN‬ﻭﻨﺴﻤﻲ ﻫﺫﺍ ﺍﻟﺘﻐﻴﺭ ﺒﺎﻟﻁﻔﺭﺓ ‪ ،Mutation‬ﻓﻨﻘﻭل ﺃﻥ ﺍﻟﺒﻜﺘﻴﺭﻴﺎ ‪ Strep R‬ﺒﻜﺘﻴﺭﻴﺎ ﻁﺎﻓﺭﺓ‬
                                                 ‫ﺃﻤﺎ ﺍﻟﺒﻜﺘﻴﺭﻴﺎ ‪ Strep S‬ﻓﻬﻲ ﺒﻜﺘﻴﺭﻴﺎ ﻤﺘﻭﺤﺸﺔ.‬

                                                          ‫4( ﻨﻼﺤﻅ ﻓﻲ ﻫﺫﻩ ﺍﻟﺘﺠﺭﺒﺔ ﺼﻔﺘﻴﻥ:‬
      ‫‪ ‬ﺍﻟﻌﻼﻗﺔ ﺒﺎﻟﺴﺘﺭﻴﺒﺘﻭﻤﻴﺴﻴﻥ: ﻭﺘﻅﻬﺭ ﺸﻜﻠﻴﻥ، ﺍﻟﺸﻜل ﺍﻟﻤﺘﻭﺤﺵ ‪ ،Strep S‬ﻭﺍﻟﻁﺎﻓﺭ ‪.Strep R‬‬
             ‫‪ ‬ﺍﻟﻌﻼﻗﺔ ﺒﺎﻟﻼﻜﺘﻭﺯ: ﻭﺘﻅﻬﺭ ﺸﻜﻠﻴﻥ، ﺍﻟﺸﻜل ﺍﻟﻤﺘﻭﺤﺵ -‪ ،Lac‬ﻭﺍﻟﺸﻜل ﺍﻟﻁﺎﻓﺭ +‪.Lac‬‬
                         ‫ﻭﻫﻜﺫﺍ ﻓﺎﻟﺴﻼﻟﺔ ﺍﻟﻤﺘﻭﺤﺸﺔ ﺒﺎﻟﻨﺴﺒﺔ ﻟﻠﺼﻔﺘﻴﻥ ﻫﻲ: ) -‪.( Strep S, Lac‬‬
                                ‫ﻭﺍﻟﺴﻼﻟﺔ ﺍﻟﻁﺎﻓﺭﺓ ﺒﺎﻟﻨﺴﺒﺔ ﻟﻠﺼﻔﺘﻴﻥ ﻫﻲ: ) +‪.( Strep R, Lac‬‬
 ‫ﻨﻼﺤﻅ ﺃﻥ ﻅﻬﻭﺭ ﻁﻔﺭﺓ ﻓﻲ ﺼﻔﺔ ﻤﺎ ﻏﻴﺭ ﻤﺭﺘﺒﻁ ﺒﺎﻟﻀﺭﻭﺭﺓ ﺒﻅﻬﻭﺭ ﻁﻔﺭﺓ ﻓﻲ ﺍﻟﺼﻔﺔ ﺍﻷﺨﺭﻯ، ﻭﻴﻤﻜﻥ‬
                              ‫ﺘﻔﺴﻴﺭ ﺫﻟﻙ ﺒﺄﻥ ﻗﻁﻌﺘﻲ ‪ ADN‬ﺍﻟﻤﺘﺤﻜﻤﺘﻴﻥ ﻓﻲ ﺍﻟﺼﻔﺘﻴﻥ ﻤﺨﺘﻠﻔﺘﺎﻥ.‬

  ‫5( ﺒﻤﺎ ﺃﻥ ﺍﻟﺘﻐﻴﺭ ﻋﻠﻰ ﻤﺴﺘﻭﻯ ﺍﻟﻤﺎﺩﺓ ﺍﻟﻭﺭﺍﺜﻴﺔ ‪ ADN‬ﺃﺩﻯ ﺇﻟﻰ ﺘﻐﻴﺭ ﻋﻠﻰ ﻤﺴﺘﻭﻯ ﺍﻟﺼﻔﺔ، ﻓﻬﺫﺍ ﻴﻌﻨﻲ ﺃﻥ‬
                                  ‫ﻜل ﺼﻔﺔ ﻴﻘﺎﺒﻠﻬﺎ ﺠﺯﺀ ﺨﺎﺹ ﻤﻥ ‪ ،ADN‬ﻴﺴﻤﻰ ﻤﻭﺭﺜﺔ ‪.Gène‬‬
                                                   ‫‪ ‬ﺍﻟﻌﻼﻗﺔ ﻤﻭﺭﺜﺔ – ﺒﺭﻭﺘﻴﻥ / ﺒﺭﻭﺘﻴﻥ - ﺼﻔﺔ.‬
                                  ‫ﺃ – ﻤﺜﺎل ﺃﻭل : ﺘﺠﺭﺒﺔ ‪ :Beadle et Tatum‬ﺃﻨﻅﺭ ﻨﺸﺎﻁ 2، ﻟﻭﺤﺔ1.‬

                                                                                  ‫‪ ‬ﻧﺸﺎط 2 اﻟﻌﻼﻗﺔ ﺻﻔﺔ – ﺑﺮوﺗﯿﻦ – ﻣﻮرﺛﺔ‬
                                                             ‫ﻗﺼﺪ اﻟﻜﺸﻒ ﻋﻦ ھﺬه اﻟﻌﻼﻗﺔ ﻧﻌﻤﻞ ﻋﻠﻰ اﺳﺘﺜﻤﺎر اﻟﻤﻌﻄﯿﺎت اﻟﺘﺎﻟﯿﺔ:‬
                                                                                       ‫♥ ﺗﺠﺮﺑﺔ ‪ Beadle‬و ‪Tatum‬‬
     ‫اﻟﻨﻮروﺳﺒﻮرا ‪ Neurospora‬ﻋﻔﻦ ﻣﺠﮭﺮي ﻋﻠﻰ ﺷﻜﻞ ﻏﺰل ﻓﻄﺮي، ﯾﻨﻤﻮ ﻋﺎدة ﻋﻠﻰ اﻟﺨﺒﺰ. ﯾﻤﻜﻦ ﻟﻠﺴﻼﻟﺔ اﻟﻤﺘﻮﺣﺸﺔ أن ﺗﻌﯿﺶ ﻓﻲ‬
              ‫وﺳﻂ أدﻧﻰ ﯾﺤﺘﻮي ﻋﻠﻰ ﺳﻜﺮ + ﻣﺎء + أﻣﻼح اﻷﻣﻮﻧﯿﻮم. ﺑﯿﻨﻤﺎ ﺗﻮﺟﺪ ﺳﻼﻟﺔ ﻃﺎﻓﺮة ﻏﯿﺮ ﻗﺎدرة ﻋﻠﻰ اﻟﻌﯿﺶ ﻓﻲ ھﺬا اﻟﻮﺳﻂ.‬
     ‫ﻧﻘﻮم ﺑﺰرع اﻟﺴﻼﻟﺔ اﻟﻄﺎﻓﺮة ﻓﻲ وﺳﻂ أدﻧﻰ + اﻟﺤﻤﺾ أﻷﻣﯿﻨﻲ اﻟﺘﺮﯾﺒﺘﻮﻓﺎن ‪ L’acide aminé Tryptophane‬ﻓﻨﻼﺣﻆ أن ھﺬه‬
                                                                       ‫اﻟﺴﻼﻟﺔ ﻗﺎدرة ﻋﻠﻰ اﻟﻌﯿﺶ واﻟﺘﻜﺎﺛﺮ ﻓﻲ ھﺬا اﻟﻮﺳﻂ وﺣﺪه.‬
                                                                                        ‫1( ﻣﺎذا ﺗﺴﺘﻨﺘﺞ ﻣﻦ ھﺬه اﻟﺘﺠﺮﺑﺔ؟‬
                                            ‫ﯾﺘﻢ ﺗﺮﻛﯿﺐ اﻟﺘﺮﯾﺒﺘﻮﻓﺎن ﻋﺒﺮ ﺳﻠﺴﻠﺔ ﻣﻦ اﻟﺘﻔﺎﻋﻼت اﻷﻧﺰﯾﻤﯿﺔ، ﯾﻤﻜﻦ ﺗﻠﺨﯿﺼﮭﺎ ﻓﯿﻤﺎ ﯾﻠﻲ:‬
                                                                                                       ‫أﻣﻼح اﻷﻣﻮﻧﯿﻮم‬
     ‫ﺗﺮﯾﺒﺘﻮﻓﺎن‬                        ‫أﻧﺪول‬                     ‫ﺣﻤﺾ أﻧﺘﺮاﻧﯿﻠﯿﻚ‬                          ‫)وﺳﻂ أدﻧﻰ(‬
                       ‫أﻧﺰﯾﻢ 3‪E‬‬                  ‫أﻧﺰﯾﻢ 2‪E‬‬                             ‫أﻧﺰﯾﻢ 1‪E‬‬
  ‫‪Tryptophane‬‬                       ‫‪Indole‬‬                      ‫‪Antranilique‬‬
            ‫2( ﻣﺎذا ﺗﺴﺘﺨﻠﺺ إذا ﻋﻠﻤﺖ أن ﺑﻌﺾ اﻟﺴﻼﻻت اﻟﻄﺎﻓﺮة ﯾﻜﻔﯿﮭﺎ وﺟﻮد ﺣﻤﺾ أﻧﺘﺮاﻧﯿﻠﯿﻚ ﻓﻲ اﻟﻮﺳﻂ ﻟﻜﻲ ﺗﻌﯿﺶ وﺗﺘﻜﺎﺛﺮ ؟‬

      ‫1( ﻨﻼﺤﻅ ﺃﻥ ﺍﻟﺴﻼﻟﺔ ﺍﻟﻁﺎﻓﺭﺓ ﻏﻴﺭ ﻗﺎﺩﺭﺓ ﻋﻠﻰ ﺘﺭﻜﻴﺏ ﺍﻟﺘﺭﻴﺒﺘﻭﻓﺎﻥ ﻓﻲ ﻭﺴﻁ ﺃﺩﻨﻰ ﻴﺘﻜﻭﻥ ﻤﻥ ﺃﻤﻼﺡ‬
     ‫ﺍﻷﻤﻭﻨﻴﻭﻡ ﻓﻘﻁ. ﻟﺫﺍ ﻨﺭﻤﺯ ﻟﻬﺫﻩ ﺍﻟﺴﻼﻟﺔ ﺏ -‪ ،Try‬ﻭﻨﻘﻭل ﺃﻨﻬﺎ ﺴﻼﻟﺔ ﻏﻴﺭ ﺫﺍﺘﻴﺔ ﺍﻟﺘﺭﻜﻴﺏ ﻟﻠﺘﺭﻴﺒﺘﻭﻓﺎﻥ‬

  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                      ‫2‬                                           ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
‫‪ .Auxotrophe pour la tryptophane‬ﺒﻴﻨﻤﺎ ﺍﻟﺴﻼﻟﺔ ﺍﻟﻤﺘﻭﺤﺸﺔ +‪ Try‬ﻓﻬﻲ ﺫﺍﺘﻴﺔ ﺍﻟﺘﺭﻜﻴﺏ ﻟﻠﺘﺭﻴﺒﺘﻭﻓﺎﻥ‬
                                                                               ‫‪.Autotrophe pour la tryptophane‬‬
                   ‫ﻨﺴﺘﻨﺘﺞ ﻤﻥ ﻫﺫﻩ ﺍﻟﻤﻼﺤﻅﺔ ﺃﻥ ﺍﻟﺼﻔﺔ ﻤﺭﺘﺒﻁﺔ ﺒﺎﻟﻘﺩﺭﺓ ﻋﻠﻰ ﺘﺭﻜﻴﺏ ﺒﺭﻭﺘﻴﻨﻲ ﻤﻌﻴﻥ.‬
    ‫2( ﺇﻥ ﺍﻟﺴﻼﻟﺔ ﺍﻟﻁﺎﻓﺭﺓ -‪ Try‬ﻏﻴﺭ ﻗﺎﺩﺭﺓ ﻋﻠﻰ ﺘﺤﺩﻴﺩ ﺍﻟﺘﺤﻭل ﺃﻤﻼﺡ ﺍﻷﻤﻭﻨﻴﻭﻡ ‪ ‬ﺤﻤﺽ ﺍﻷﻨﺘﺭﺍﻨﻴﻠﻴﻙ.‬
                                                                  ‫ﻭﺫﻟﻙ ﻟﻐﻴﺎﺏ ﺍﻷﻨﺯﻴﻡ 1‪.E‬‬
 ‫ﻨﺴﺘﺨﻠﺹ ﺍﺩﻥ ﺃﻥ ﻜل ﺼﻔﺔ ﻤﺭﺘﺒﻁﺔ ﺒﺘﺭﻜﻴﺏ ﺒﺭﻭﺘﻴﻨﻲ ﻤﻌﻴﻥ، ﻭﺍﻟﺫﻱ ﻴﺭﺘﺒﻁ ﺒﺩﻭﺭﻩ ﺒﺘﺭﻜﻴﺏ ﺃﻨﺯﻴﻤﻲ ﻤﻌﻴﻥ.‬

              ‫ﺏ – ﻤﺜﺎل ﺜﺎﻨﻲ : ﻓﻘﺭ ﺍﻟﺩﻡ ﺍﻟﻤﻨﺠﻠﻲ ‪ L'anémie falciforme‬ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ 1، ﻟﻭﺤﺔ 2‬

                                                                                                                            ‫اﻟﻮﺛﯿﻘﺔ 1‬
   ‫اﻟﺨﻀﺎب اﻟﺪﻣﻮي ﺑﺮوﺗﯿﻦ ﯾﻮﺟﺪ داﺧﻞ اﻟﻜﺮﯾﺎت اﻟﺤﻤﺮاء و ﻟﮫ دورﯾﻦ، وﻇﯿﻔﻲ ﯾﺘﺠﻠﻰ ﻓﻲ ﻧﻘﻞ اﻟﻐﺎزات اﻟﺘﻨﻔﺴﯿﺔ، و ﺑﻨﯿﻮي ﯾﺘﺠﻠﻰ ﻓﻲ إﻋﻄﺎء‬
                                                                                                ‫اﻟﺸﻜﻞ اﻟﻜﺮوي اﻟﻤﻘﻌﺮ ﻟﻠﻜﺮﯾﺎت اﻟﺤﻤﺮاء.‬
‫ﻓﻘﺮ اﻟﺪم أﻟﻤﻨﺠﻠﻲ ﻣﺮض اﺳﺘﻘﻼﺑﻲ ﻧﺎﺗﺞ ﻋﻦ ﺗﺮﻛﯿﺐ ﺧﻀﺎب دﻣﻮي ‪Δϴ Ϩ μ Η ΍Ϥ  ϳ ΍ Ϯ Η ϱΩϋ ϴ Hémoglobine‬‬
  ‫‪Ϡ‬‬          ‫‪ ΤϟΕΎ   ѧ Ϗ‬‬
                         ‫‪ήϜ‬‬
‫ ‪ѧΠ ϣ΢Β ѧ˯ήѧ ΍ ѧ ϟϩ θѧ Ύ ήѧ‬‬
                                 ‫اﻟﺸﻜﻞ( ﯾﺮﻣﺰ ﻟﮫ ب ) ‪ ،( HbS‬ﺑﯿﻨﻤﺎ ﯾﺮﻣﺰ ﻟﺨﻀﺎب اﻟﺪم اﻟﻌﺎدي ب ) ‪. ( HbA‬أﻧﻈﺮ اﻟﻮﺛﯿﻘﺔ1، ﺷﻜﻞ1.‬
‫‪Ϊδѧ ΎΘ ϟ ϔ ϟ˯ήϤ ΍ ϳ ΍ ψ Ϯ  ΍ Ϝ ϰϋ ϳ Ώ΍Ωήϴ  πΨ΍ μ  ϴ ϴ ϸ‬‬
   ‫‪ϭѧ Ϯ‬‬             ‫‪΍‬‬
‫ﻋﻨﺪ ﺗﺤﺮﯾﺮ ) ‪ ΗϬϧϴΪϘΗϲΘ΍ ΤϟΕΎ ϟήϬ ϣϩ θΗήΑ Ϟ η Ϡ ΐ γήΘ  ϭ  Ϗ ΏΎ ϟ΢Β ϳϦ Π δϛ ϟ HbS‬‬
                             ‫ ‪ ήϜ‬‬                ‫‬                ‫‪ϭ‬‬                          ‫‬                 ‫(‬
                                                        ‫اﻟﺸﻌﯿﺮات اﻟﺪﻣﻮﯾﺔ، ﻣﻤﺎ ﯾﻨﺘﺞ ﻋﻨﮫ ﻓﻘﺮ ﻓﻲ إﻣﺪاد اﻟﺨـــــــــــــــﻼﯾﺎ ﺑﺎﻷﻛﺴﯿﺠﯿﻦ.‬
    ‫ﯾﻌﻄﻲ اﻟﺸﻜﻞ2 ﺗﺴﻠﺴﻞ اﻷﺣﻤﺎض اﻷﻣﯿﻨﯿﺔ اﻟﻤﻜﻮﻧﺔ ﻟﺠﺰء ﻣﻦ ﺟﺰﯾﺌﺔ اﻟﺨﻀﺎب اﻟﺪﻣﻮي ﻣﻊ ﺟﺰء ﻣﻦ اﻟﻤﻮرﺛﺘﯿﻦ اﻟﻤﺘﺤﻜﻤﺘﯿﻦ ﻓﻲ ﺗﺮﻛﯿﺒﮭﻤﺎ.‬
                                            ‫1( ﻗﺎرن ﺳﻠﺴﻠﺘﻲ ‪ HbA‬و ‪ HbS‬ﻣﻦ ﺟﮭﺔ وﻣﻮرﺛﺔ ‪ HbA‬و ‪ HbS‬ﻣﻦ ﺟﮭﺔ أﺧﺮى.‬
                                                                                                                   ‫2( ﻣﺎذا ﺗﺴﺘﻨﺘﺞ ؟‬

                       ‫ﺟﺰء اﻟﻤﻮرﺛﺔ اﻟﻤﺴﺆول ﻋﻦ ﺗﺮﻛﯿﺐ ‪HbA‬‬                       ‫اﻟﺸﻜﻞ 2‬         ‫اﻟﻮﺛﯿﻘﺔ 1‬      ‫اﻟﺸﻜﻞ 1‬
                       ‫‪GT GCACC T T AC T CCAGAGGAG‬‬

                       ‫‪C ACG T GGA A T GAGG T C T C C T C‬‬


‫‪ val his leu thr pro glu glu‬اﻟﺨﻀﺎب اﻟﺪﻣﻮي ‪HbA‬‬                             ‫ﺑﺪاﯾﺔ اﻟﺴﻠﺴﻠﺔ ‪β‬‬            ‫ﻛﺮﯾﺎت ﺣﻤﺮاء‬
                          ‫1‬     ‫2‬      ‫3‬      ‫4‬     ‫5‬      ‫6‬      ‫7‬                                     ‫ﻋﺎدﯾﺔ‬
                        ‫ﺟﺰء اﻟﻤﻮرﺛﺔ اﻟﻤﺴﺆول ﻋﻦ ﺗﺮﻛﯿﺐ ‪HbS‬‬
                      ‫‪G T GCACC T T AC T CCAG T GGAG‬‬

                      ‫‪C A CG T GGA A T GAGG T C AC C T C‬‬
                                                                                      ‫اﻟﺴﻠﺴﻠﺔ ‪β‬‬

‫‪ val his leu thr pro val glu‬اﻟﺨﻀﺎب اﻟﺪﻣﻮي ‪HbS‬‬                                                        ‫ﻛﺮﯾﺎت ﺣﻤﺮاء‬
                                                                                                        ‫ﻣﺸﻮھﺔ‬
                         ‫1‬      ‫2‬     ‫3‬      ‫4‬      ‫5‬      ‫6‬      ‫7‬



      ‫1( ﻴﻜﻤﻥ ﺍﻻﺨﺘﻼﻑ ﺍﻟﻭﺤﻴﺩ ﺒﻴﻥ ﺍﻟﺴﻠﺴﻠﺔ ‪ β‬ﻟﻠﺨﻀﺎﺏ ﺍﻟﺩﻤﻭﻱ ‪ HbA‬ﻭﺍﻟﺨﻀﺎﺏ ﺍﻟﺩﻤﻭﻱ ‪ ،HbS‬ﻓﻲ‬
            ‫ﺘﻌﻭﻴﺽ ﺍﻟﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺭﻗﻡ 6 ) ‪ ( Glu‬ﻓﻲ ‪ HbA‬ﺒﺎﻟﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ‪ Val‬ﻓﻲ ‪.HbS‬‬
 ‫ﻭﺃﻥ ﻤﺘﺘﺎﻟﻴﺔ ﺍﻟﻘﻭﺍﻋﺩ ﺍﻷﺯﻭﺘﻴﺔ ﻟﺠﺯﺀ ﺍﻟﻤﻭﺭﺜﺔ ‪ HbA‬ﺘﺨﺘﻠﻑ ﻋﻥ ﻤﺘﺘﺎﻟﻴﺔ ﺍﻟﻘﻭﺍﻋﺩ ﺍﻻﺯﻭﺘﻴﺔ ﻟﺠﺯﺀ ﺍﻟﻤﻭﺭﺜﺔ‬
  ‫‪ ،HbS‬ﺇﺫ ﺍﺴﺘﺒﺩل ﺍﻟﺯﻭﺝ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﻱ ﺭﻗﻡ 71، ﺤﻴﺙ ﺘﻡ ﺍﺴﺘﺒﺩﺍل ‪ A – T‬ﻓﻲ ‪ HbS‬ﺒـ ‪ T – A‬ﻓﻲ‬
                                                                                    ‫‪.HbA‬‬

  ‫2( ﺇﻥ ﺍﺴﺘﺒﺩﺍل ﻤﺘﺘﺎﻟﻴﺔ ﺍﻟﻘﻭﺍﻋﺩ ﺍﻻﺯﻭﺘﻴﺔ ﻓﻲ ﺍﻟﻤﻭﺭﺜﺔ، ﺘﺭﺘﺏ ﻋﻨﻪ ﺘﻐﻴﻴﺭ ﻓﻲ ﻤﺘﺘﺎﻟﻴﺔ ﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﻓﻲ‬
                                        ‫ﺍﻟﺒﺭﻭﺘﻴﻥ. ﻨﺴﺘﻨﺘﺞ ﺃﻥ ﻫﻨﺎﻙ ﻋﻼﻗﺔ ﺒﻴﻥ ﺍﻟﻤﻭﺭﺜﺔ ﻭﺍﻟﺒﺭﻭﺘﻴﻥ.‬
       ‫ﺇﻥ ﻜل ﺘﻐﻴﻴﺭ ﻓﻲ ﺒﻨﻴﺔ ﺍﻟﺒﺭﻭﺘﻴﻥ، ﻴﺅﺩﻱ ﺇﻟﻰ ﺘﻐﻴﻴﺭ ﻓﻲ ﺍﻟﻤﻅﻬﺭ ﺍﻟﺨﺎﺭﺠﻲ ﻟﺼﻔﺔ ﻤﻌﻴﻨﺔ ) ﺘﻐﻴﺭ ﺒﻨﻴﺔ‬
           ‫ﺍﻟﺨﻀﺎﺏ ﺘﻐﻴﺭ ﺸﻜل ﺍﻟﻜﺭﻴﺎﺕ ﺍﻟﺤﻤﺭﺍﺀ (، ﻫﺫﺍ ﻴﺩل ﻋﻠﻰ ﻭﺠﻭﺩ ﻋﻼﻗﺔ ﺒﻴﻥ ﺍﻟﺼﻔﺔ ﻭﺍﻟﺒﺭﻭﺘﻴﻥ.‬


  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                           ‫3‬                                              ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
                                                                              ‫ﺝ – ﺨﻼﺼﺔ.‬
    ‫ﺇﻥ ﻜل ﺼﻔﺔ ﺘﺘﺭﺠﻡ ﻭﺠﻭﺩ ﺒﺭﻭﺘﻴﻥ ﺒﻨﻴﻭﻱ، ﺃﻭ ﻨﺸﺎﻁ ﺒﺭﻭﺘﻴﻨﻲ ﻤﺨﺘﺹ، ﻭﺃﻥ ﻜل ﺘﻐﻴﺭ ﻓﻲ ﺘﻌﺎﻗﺏ ﺍﻟﻘﻭﺍﻋﺩ‬
‫ﺍﻻﺯﻭﺘﻴﺔ )ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ( ﺩﺍﺨل ﺠﺯﻴﺌﺔ ‪ ، ADN‬ﻴﻨﺘﺞ ﻋﻨﻪ ﺘﻐﻴﺭ ﻓﻲ ﺘﻌﺎﻗﺏ ﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﺩﺍﺨل ﺍﻟﺴﻠﺴﻠﺔ‬
‫ﺍﻟﺒﺭﻭﺘﻴﻨﻴﺔ. ﻭﻫﺫﺍ ﻴﻌﻨﻲ ﺃﻥ ﺘﺭﺘﻴﺏ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ ﻓﻲ ﺠﺯﻴﺌﺔ ‪ ،ADN‬ﻫﻭ ﺍﻟﺫﻱ ﻴﺤﺩﺩ ﻁﺒﻴﻌﺔ ﻭﺘﺭﺘﻴﺏ ﺍﻷﺤﻤﺎﺽ‬
                                                                          ‫ﺍﻷﻤﻴﻨﻴﺔ ﻓﻲ ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ.‬
   ‫ﺘﺴﻤﻰ ﻜل ﻗﻁﻌﺔ ﻤﻥ ‪ ADN‬ﺘﺘﺤﻜﻡ ﻓﻲ ﺼﻔﺔ ﻭﺭﺍﺜﻴﺔ ﻤﻌﻴﻨﺔ ﻤﻭﺭﺜﺔ، ﻭﺒﻤﺎ ﺃﻥ ﺍﻟﺼﻔﺔ ﻟﻬﺎ ﻋﺩﺓ ﺃﺸﻜﺎل، ﻓﺎﻥ‬
                            ‫ﻟﻠﻤﻭﺭﺜﺔ ﺍﻟﻤﺘﺤﻜﻤﺔ ﻓﻴﻬﺎ ﻋﺩﺓ ﺃﺸﻜﺎل ﻜﺫﻟﻙ، ﻭﻜل ﺸﻜل ﻴﺴﻤﻰ ﺤﻠﻴﻼ ‪.Allele‬‬
                                        ‫ﻤﺜﺎل : ﺼﻔﺔ ﺍﻟﻌﻼﻗﺔ ﺒﺎﻟﺴﺘﺭﻴﺒﺘﻭﻤﻴﺴﻴﻥ ﻟﺩﻯ ﺍﻟﺒﻜﺘﻴﺭﻴﺎ ‪:E.coli‬‬
                                       ‫ﺍﻟﺤﻠﻴل ﺍﻟﻤﺘﻭﺤﺵ ‪ ، StrepS‬ﺍﻟﺤﻠﻴل ﺍﻟﻁﺎﻓﺭ ‪.StrepR‬‬

                                        ‫‪ – IΙ‬ﺁﻟﻴﺔ ﺘﻌﺒﻴﺭ ﺍﻟﺨﺒﺭ ﺍﻟﻭﺭﺍﺜﻲ: ﻤﻥ ﺍﻟﻤﻭﺭﺜﺔ ﺇﻟﻰ ﺍﻟﺒﺭﻭﺘﻴﻥ.‬
‫ﺍﻟﻤﻭﺭﺜﺎﺕ ﻗﻁﻊ ﻤﻥ ‪ ،ADN‬ﻭﻤﻭﻗﻌﻬﺎ ﺍﻟﻨﻭﺍﺓ، ﺃﻤﺎ ﺘﺭﻜﻴﺏ ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ ﻓﻴﺘﻡ ﻋﻠﻰ ﻤﺴﺘﻭﻯ ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ. ﻓﻤﺎ ﺍﻟﺫﻱ‬
                                                         ‫ﻴﻠﻌﺏ ﺩﻭﺭ ﺍﻟﻭﺴﻴﻁ ﺒﻴﻥ ﺍﻟﻨﻭﺍﺓ ﻭﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ؟‬

                                                                  ‫‪ ‬ﺍﻟﻭﺴﻴﻁ ﺒﻴﻥ ﺍﻟﻨﻭﺍﺓ ﻭﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ.‬
                                                                            ‫ﺃ – ﻤﻌﻁﻴﺎﺕ ﺘﺠﺭﻴﺒﻴﺔ.‬
                         ‫ﺍﻨﻁﻼﻗﺎ ﻤﻥ ﻤﻌﻁﻴﺎﺕ ﺍﻟﻭﺜﻴﻘﺔ1، ﻟﻭﺤﺔ2، ﺤﺩﺩ ﻁﺒﻴﻌﺔ ﺍﻟﻭﺴﻴﻁ ﺒﻴﻥ ﺍﻟﻨﻭﺍﺓ ﻭﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ.‬
                                                                           ‫اﻟﻮﺛﯿﻘﺔ 1: ﺗﺠﺮﺑﺔ اﻻﯾﺴﺎم اﻹﺷﻌﺎﻋﻲ .‬
   ‫‪Ύϼ ϲѧѧ  ϴ ϳ ѧ ΍ ѧ Ϥ ѧ‬‬
    ‫‪ѧ‬‬
    ‫‪ϳ‬‬
   ‫‪ѧ Χ ѧΎϣϦ Θ ΰѧ ϟϊ ѧ Ϯ ΗϦѧ ϒθѧϧ ARN δѧ ADN ѧ ήΗϲ΋ѧ ϴϟΎΒϛ  ѧϳΕΎϳ ѧ Ψ΍ πѧ‬‬
          ‫‪ϓѧ‬‬‫‪ό‬‬   ‫‪Ό Πο‬‬        ‫‪ϋ ѧ‬‬‫‪Ϝ‬‬       ‫ˬ ‪ϰϤ ѧ‬‬
                                                ‫‪Η‬‬‫‪ϭ‬‬         ‫‪ϴ‬‬‫‪ϛ‬‬
                                                         ‫‪ΐ ѧ  ΎϤϜ΍ѧ ϴήΗΏέΎ  ѧ ΰΟΎϼ ϟϢ ѧ‬‬
                                                                   ‫‪ѧ ѧ‬‬
                                                                   ‫‪ϴ‬‬       ‫‪Ϭ‬‬          ‫‪Ϙ Ό ϳ‬‬
                                                                                      ‫‪ѧ ѧ ѧ  Η‬‬
         ‫‪ϥ ѧ ϱάϟϦ ϧ ѧ ΍ ήπѧ ϟϕέ Ύ‬‬
           ‫‪Ϡ ΍ ϭ ϴ‬‬
            ‫‪ϳ‬‬        ‫‪Β‬‬      ‫ ‪Ψ‬‬
   ‫‪ARN Ϯѧ ѧ ϴ ήѧϟϭˬ ѧϤ΍ ί Ϸѧ ADN ϮϠϱάϟϞϴ Ϥ΍ ѧ  ϴ ѧ  ѧ ѧ ϝϤ Θ Αˬ Ύ Ϩ΍‬‬
                                     ‫‪Α‬‬           ‫‪ϳ ΍ Θ  Χ΃ Ϯ ϣ‬‬
                                             ‫‪ϥ ѧ ѧѧϴϟήπѧ Ϧ ϧ Ϡ ϦϣςϴΧΎ ѧ α ѧ Β‬‬    ‫‪Ϡ ό γΎ‬‬           ‫‪ήϜ‬‬
                                                                                                      ‫‪ϳ ϟ‬‬
   ‫‪Ξ΋Θ΍ ѧ μ ΤϨѧΨ΍ ѧ ΩωόηϹ τΗφѧ ϧ Λ ϊ ϣARNϟ ѧϥ ѧ ϳ Ψ΍ έί  γϭϰѧ ϑΎ ϳ Ω ϟΑ‬‬
      ‫‪ѧ  ϋ‬‬
       ‫‪Ϩ‬‬           ‫ ‪Ϡ‬‬      ‫‪ѧ έϮ‬‬
   ‫‪ ΎϟϰϠ Ϟ ѧ ϓΔϴ ϟϞΧ΍ Ύ ΍ ѧ  Σϼ ѧˬ θѧ‬‬ ‫‪Ϣ‬‬             ‫ ‪ѧϲϋϮ  ϣ ѧ‬‬    ‫‪ϼ‬‬
                                                         ‫‪˰ ϧ ϮϜ Ύ ϟω ςѧ  ϟ πѧ  έϮΎ‬‬       ‫·‬     ‫‪ϱ‬‬      ‫‪ѧ‬‬
                                                                                      ‫اﻟﻤﺒﯿﻨﺔ ﻋﻠﻰ اﻟﺸﻜﻞ1 و2.‬
                         ‫ﻣﺎذا ﺗﺴﺘﻨﺘﺞ ﻣﻦ ﻣﻌﻄﯿﺎت اﻟﺘﺠﺮﺑﺔ؟ ﺣﺪد اﻟﺨﺎﺻﯿﺔ اﻟﻤﻤﯿﺰة ﻟـ ‪ ARN‬ﻣﻌﻠﻼ ﻧﻌﺘﮫ ب ‪ ARN‬اﻟﺮﺳﻮل.‬

                                     ‫اﻟﺸﻜﻞ 2‬                                              ‫اﻟﺸﻜﻞ 1‬    ‫اﻟﻮﺛﯿﻘﺔ 1:‬




         ‫ﺻﻮرة إﺷﻌﺎﻋﯿﺔ ذاﺗﯿﺔ ﻟﺨﻠﯿﺔ زرﻋﺖ ﻣﺪة ‪ 15 mn‬ﺑﻮﺟﻮد ﺻﻮرة إﺷﻌﺎﻋﯿﺔ ذاﺗﯿﺔ ﻟﺨﻠﯿﺔ ﻣﻤﺎﺛﻠﺔ ﻋﺮﺿﺖ ﻣﺪة 51‬
          ‫‪mn‬ﻟﻨﻔﺲ اﻟﺒﺸﯿﺮ اﻟﻤﺸﻊ، ﺛﻢ زرﻋﺖ ﻣﺪة ﺳﺎﻋﺔ‬                ‫ﺑﺸﯿﺮ ﻣﺸﻊ ﻧﻮﻋﻲ ﻟـ ‪ARN‬‬
          ‫وﻧﺼﻒ ﻓﻲ وﺳﻂ ﯾﺤﺘﻮي ﻋﻠﻰ ﺑﺸﺎﺋﺮ أﺧﺮى ﻋﺎدﯾﺔ‬

                                                                      ‫ﺏ – ﺘﺤﻠﻴل ﻭﺍﺴﺘﻨﺘﺎﺝ.‬
 ‫ﻨﻼﺤﻅ ﻓﻲ ﺍﻟﻤﺭﺤﻠﺔ ﺍﻷﻭﻟﻰ ﻤﻥ ﺍﻟﺘﺠﺭﺒﺔ ﺘﺭﻜﻴﺯ ﺍﻹﺸﻌﺎﻉ ﻓﻲ ﻨﻭﺍﺓ ﺍﻟﺨﻠﻴﺔ، ﻭﻓﻲ ﺍﻟﻤﺭﺤﻠﺔ ﺍﻟﺜﺎﻨﻴﺔ ﻤﻥ ﺍﻟﺘﺠﺭﺒﺔ‬
                                                                    ‫ﺍﻨﺘﻘل ﺍﻹﺸﻌﺎﻉ ﻨﺤﻭ ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ.‬
 ‫ﻨﺴﺘﻨﺘﺞ ﻤﻥ ﻫﺫﻩ ﺍﻟﻤﻼﺤﻅﺎﺕ ﺃﻥ ‪ ARN‬ﻴﺭﻜﺏ ﺩﺍﺨل ﺍﻟﻨﻭﺍﺓ، ﻭﻴﻨﺘﻘل ﺒﻌﺩ ﺫﻟﻙ ﺇﻟﻰ ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ. ﻭﻫﻜﺫﺍ ﻴﻤﻜﻥ‬
‫ﺍﻓﺘﺭﺍﺽ ﺃﻥ ﺍﻟﻭﺴﻴﻁ ﺒﻴﻥ ﺍﻟﻤﻭﺭﺜﺎﺕ ﻓﻲ ﺍﻟﻨﻭﺍﺓ، ﻭ ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ ﻓﻲ ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ، ﻫﻭ ‪ ،ARN‬ﻟﺫﻟﻙ ﺴﻤﻲ ‪ARN‬‬
                                            ‫ﺍﻟﺭﺴﻭل، ﻭﻨﺭﻤﺯ ﻟﻪ ﺏ ‪.(ARN méssager) .ARNm‬‬
  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                               ‫4‬                                     ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
                                                                  ‫ﺝ – ﺍﻟﺘﺤﻘﻕ ﻤﻥ ﺍﻟﻔﺭﻀﻴﺔ. ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ 2، ﻟﻭﺤﺔ3.‬

          ‫ﻛﻤﯿﺔ اﻷﺣﻤﺎض اﻷﻣﯿﻨﯿﺔ اﻟﻤﺪﻣﺠﺔ‬               ‫ﻛﻤﯿﺔ ‪ ARNm‬اﻟﻤﺤﻘﻮﻧﺔ واﻟﻤﺘﺒﻘﯿﺔ‬
           ‫ﺑﺎﻟﺒﺮوﺗﯿﻦ )وﺣﺪات اﺻﻄﻼﺣﯿﺔ(‬                                                     ‫♥ اﻟﻮﺛﯿﻘﺔ 2 : ﺗﺠﺮﺑﺔ ﺗﺮﻛﯿﺐ اﻟﺒﺮوﺗﯿﻨﺎت ﻓﻲ اﻟﺰﺟﺎج.‬
                                                     ‫ﻓﻲ اﻟﻮﺳﻂ )وﺣﺪات اﺻﻄﻼﺣﯿﺔ(‬
 ‫4‬                                                                                 ‫4‬
                                                                                       ‫اﻧﻄﻼﻗﺎ ﻣﻦ ﻋﺼﯿﺎت ﻛﻮﻟﻮﻧﯿﺔ ﻧﻌﺪ ﻣﺴﺘﺨﻠﺼﺎ ﯾﺤﺘﻮي ﻋﻠﻰ‬
                                                                                               ‫ﺟﻤﯿﻊ اﻟﻤﻜﻮﻧﺎت اﻟﺴﯿﺘﻮﺑﻼزﻣﯿﺔ اﻟﻼزﻣﺔ ﻟﺘﺮﻛﯿﺐ‬
 ‫3‬                                                                               ‫3‬
                                                                                              ‫اﻟﺒﺮوﺗﯿﻨﺎت، ﻣﺎﻋﺪا ‪ .ADN‬ﺑﻌﺪ ذﻟﻚ ﻧﻀﯿﻒ ﻟﮭﺬا‬
                                                                                          ‫اﻟﻤﺴﺘﺨﻠﺺ ﻛﻤﯿﺘﯿﻦ ﻣﻦ ‪ ARNm‬وأﺣﻤﺎض أﻣﯿﻨﯿﺔ،‬
 ‫2‬                                                                                 ‫2‬                                ‫ﺧﻼل ﻓﺘﺮﺗﯿﻦ ﻣﺨﺘﻠﻔﺘﯿﻦ.‬
                                                                                                  ‫ﯾﻌﻄﻲ اﻟﻤﺒﯿﺎن أﻣﺎﻣﮫ، ﺗﻄﻮر ﻛﻤﯿﺔ ‪ARNm‬‬
                                                                                           ‫واﻷﺣﻤﺎض اﻷﻣﯿﻨﯿﺔ اﻟﻤﺪﻣﺠﺔ ﻓﻲ اﻟﺒﺮوﺗﯿﻨﺎت ﺑﻌﺪ ﻛﻞ‬
 ‫1‬                                                                                 ‫1‬
                                                                                                                                    ‫ﺣﻘﻦ.‬
                                                                                   ‫0‬
 ‫0‬                                                                                                          ‫1( ﺻﻒ ﻧﺘﺎﺋﺞ ھﺬه اﻟﺘﺠﺮﺑﺔ.‬
      ‫0‬         ‫01‬          ‫02‬          ‫03‬     ‫04‬         ‫05‬       ‫06‬       ‫07‬
                                                                                                                       ‫2( ﻣﺎذا ﺗﺴﺘﻨﺘﺞ؟‬
                                                                    ‫اﻟﺰﻣﻦ )‪(mn‬‬
       ‫اﻟﺤﻘﻦ اﻷول:‬                        ‫اﻟﺤﻘﻦ اﻟﺜﺎﻧﻲ:‬
     ‫‪ + ARNm‬أﺣﻤﺎض‬                       ‫‪ + ARNm‬أﺣﻤﺎض‬

       ‫1( ﺒﻌﺩ ﻜل ﺤﻘﻥ ﻟـ ‪ ARNm‬ﻭﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ، ﺘﺭﺘﻔﻊ ﻜﻤﻴﺔ ﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﺍﻟﻤﺩﻤﺠﺔ ﻓﻲ‬
                                                ‫ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ، ﻤﻊ ﺍﻨﺨﻔﺎﺽ ﻓﻲ ﻜﻤﻴﺔ ‪.ARNm‬‬
    ‫2( ﻨﺴﺘﻨﺘﺞ ﻤﻥ ﻫﺫﻩ ﺍﻟﺘﺠﺭﺒﺔ ﺃﻥ ﻫﻨﺎﻙ ﻋﻼﻗﺔ ﻤﺒﺎﺸﺭﺓ ﺒﻴﻥ ﺘﺭﻜﻴﺏ ﺍﻟﺒﺭﻭﺘﻴﻥ ﻭﻭﺠﻭﺩ ‪ ،ARNm‬ﺃﻱ ﺃﻥ‬
 ‫‪ ARNm‬ﻫﻭ ﻓﻌﻼ ﺍﻟﻭﺴﻴﻁ ﺒﻴﻥ ﺍﻟﻤﺎﺩﺓ ﺍﻟﻭﺭﺍﺜﻴﺔ ﻋﻠﻰ ﻤﺴﺘﻭﻯ ﺍﻟﻨﻭﺍﺓ، ﻭﺘﺭﻜﻴﺏ ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ ﻋﻠﻰ ﻤﺴﺘﻭﻯ‬
                                                                               ‫ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ.‬

                                                                            ‫‪ ‬ﺒﻨﻴﺔ ﺠﺯﻴﺌﺔ ‪ .ARN‬ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ 3، ﻟﻭﺤﺔ3.‬
‫♥ اﻟﻮﺛﯿﻘﺔ 3 : ﺗﻌﻄﻲ اﻟﻮﺛﯿﻘﺔ اﻟﺘﺎﻟﯿﺔ ﺟﺰء اﻟﻤﻮرﺛﺔ اﻟﻤﺴﺆوﻟﺔ ﻋﻦ ﺗﺮﻛﯿﺐ اﻟﺨﻀﺎب اﻟﺪﻣﻮي ‪ HbA‬و ‪ ARNm‬اﻟﻤﻨﺎﺳﺐ ﻟﮫ. ﻗﺎرن اﻟﺠﺰﯾﺌﺘﯿﻦ.‬

          ‫‪G T GC AC C T T AC T C C AG AGG AG‬‬                                       ‫‪GUGC A C C U U A C U C C AG AGG AG‬‬

           ‫‪C A CG T GG A A T G AGG T C T C C T C‬‬                              ‫‪ ARNm‬اﻟﻤﻨﺎﺳﺐ ﻟـ ‪ ADN‬اﻟﻤﺴﺆول ﻋﻦ ﺗﺮﻛﯿﺐ ‪HbA‬‬

               ‫ﺟﺰء ﻣﻦ ‪ ADN‬اﻟﻤﺴﺆول ﻋﻦ ﺗﺮﻛﯿﺐ ‪HbA‬‬                                                ‫‪ = U‬ﻗﺎﻋﺪة ازوﺗﯿﺔ ھﻲ اﻷوراﺳﯿﻞ ) ‪( Uracile‬‬


     ‫‪ ARN‬ﻫﻭ ﺍﻟﺤﻤﺽ ﺍﻟﻨﻭﻭﻱ ﺍﻟﺭﻴﺒﻭﺯﻱ ‪ ،Acide ribonucléique‬ﻴﺘﻜﻭﻥ ﻤﻥ ﺴﻠﺴﻠﺔ ﻤﻥ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ‬
     ‫ﻋﻠﻰ ﺸﻜل ﻟﻭﻟﺏ ﻭﺍﺤﺩ ) ﺸﺭﻴﻁ ﻭﺍﺤﺩ (، ﻭﻜل ﻨﻴﻜﻠﻴﻭﺘﻴﺩ ﻴﺘﻜﻭﻥ ﻤﻥ ﺤﻤﺽ ﻓﻭﺴﻔﻭﺭﻱ + ﺴﻜﺭ ﺍﻟﺭﻴﺒﻭﺯ +‬
                    ‫ﻗﺎﻋﺩﺓ ﺍﺯﻭﺘﻴﺔ ﺘﻜﻭﻥ ﺇﻤﺎ ﺍﻷﺩﻨﻴﻥ ‪ ،A‬ﺃﻭ ﺍﻟﻐﻭﺍﻨﻴﻥ ‪ ،G‬ﺃﻭ ﺍﻟﺴﻴﺘﻭﺯﻴﻥ ‪ ،C‬ﺃﻭ ﺍﻷﻭﺭﺍﺴﻴل ‪.U‬‬




‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                                    ‫5‬                                             ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
                                                                         ‫‪ ‬ﻤﺭﺍﺤل ﺘﻌﺒﻴﺭ ﺍﻟﻤﻭﺭﺜﺔ.‬
                                                   ‫ﺃ – ﻤﺭﺤﻠﺔ ﻨﺴﺦ ‪ :ARN‬ﻤﻥ ﺍﻟﻤﻭﺭﺜﺔ ﺇﻟﻰ ‪.ARNm‬‬
                          ‫‪ ‬ﺍﻨﻁﻼﻗﺎ ﻤﻥ ﺍﻟﻭﺜﻴﻘﺔ 4، ﻟﻭﺤﺔ 3، ﺤﺩﺩ ﻤﺭﺍﺤل ﺘﺭﻜﻴﺏ ‪ ARNm‬ﺍﻨﻁﻼﻗﺎ ﻤﻥ ‪.ADN‬‬

                                                        ‫اﻟﺸﻜﻞ 1:‬                                                      ‫اﻟﻮﺛﯿﻘﺔ 4 .‬




                                                                                                                      ‫اﻟﺸﻜﻞ 2 :‬
                                         ‫‪ ARN‬ﺑﻮﻟﯿﻤﯿﺮاز‬
                                                                      ‫‪ATGA‬‬                 ‫ﻣﻨﺤﻰ ﺗﻨﻘﻞ ‪ ARN‬ﺑﻮﻟﯿﻤﯿﺮاز‬
                                                                 ‫‪GA‬‬          ‫‪GG‬‬
‫ﻟﻮﻟﺐ ﻏﯿﺮ ﻗﺎﺑﻞ ﻟﻠﻨﺴﺦ‬                                         ‫‪TG‬‬                    ‫‪TC‬‬                                     ‫'‬
   ‫'‬
                                                        ‫‪G‬‬                              ‫‪T‬‬                              ‫3‬
  ‫5‬                                                 ‫‪C‬‬                                    ‫'‬
       ‫‪G T G C A C C T T A C T C C A G A G G A GC A‬‬                                    ‫3‬   ‫‪C C T CG T G C A C C T T A C‬‬

                                                                                      ‫‪CU‬‬                                     ‫‪ADN‬‬
   ‫'‬   ‫‪C A C G T G G A A T G A G G T C T C C T CG T G C‬‬                                     ‫‪G A GC A C G T G G A A T G‬‬
  ‫3‬                                ‫‪AC‬‬                     ‫‪G‬‬      ‫‪GAAU‬‬             ‫‪U‬‬
                                                                                                                         ‫'‬
                                     ‫‪GC‬‬       ‫‪GAGG‬‬                                                                      ‫5‬
‫ﻟﻮﻟﺐ ﻗﺎﺑﻞ ﻟﻠﻨﺴﺦ‬                    ‫‪U‬‬    ‫‪T‬‬              ‫‪G A‬‬
                                          ‫‪TA‬‬       ‫‪CA‬‬
                                 ‫‪G‬‬            ‫‪CTC‬‬
                                ‫‪C‬‬
   ‫'‬
  ‫5‬                          ‫‪CA‬‬           ‫‪A‬‬      ‫‪C‬‬
                        ‫‪GA G‬‬                ‫‪C‬‬        ‫‪U‬‬
     ‫‪GUGCACCUUACUCCAGAG‬‬                   ‫‪G‬‬     ‫‪UG‬‬                                                  ‫ﻧﯿﻜﻠﯿﻮﺗﯿﺪات ﺣﺮة‬
                                              ‫‪C‬‬    ‫‪A‬‬
  ‫ﺟﺰﯾﺌﺔ ‪ARNm‬‬


         ‫‪ ‬ﺇﻥ ﺘﺭﻜﻴﺏ ‪ ARNm‬ﻴﺘﻡ ﺩﺍﺨل ﺍﻟﻨﻭﺍﺓ، ﺜﻡ ﻴﻨﺘﻘل ﺇﻟﻰ ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ ﺤﺎﻤﻼ ﺍﻟﺨﺒﺭ ﺍﻟﻭﺭﺍﺜﻲ، ﺃﻭ ﺍﻟﺸﻔﺭﺓ‬
                                                                          ‫ﺍﻟﻀﺭﻭﺭﻴﺔ ﻟﺘﺭﻜﻴﺏ ﺍﻟﺒﺭﻭﺘﻴﻥ.‬
 ‫ﺇﻥ ‪ ARNm‬ﻫﻭ ﻨﺴﺨﺔ ﻷﺤﺩ ﺸﺭﻴﻁﻲ ‪ ،ADN‬ﻭﺘﺴﻤﻰ ﻋﻤﻠﻴﺔ ﺘﺭﻜﻴﺏ ‪ ARNm‬ﺒﺎﻻﺴﺘﻨﺴﺎﺥ ﻭﺍﻟﺘﻲ ﺘﺘﻡ ﻜﻤﺎ ﻴﻠﻲ:‬
      ‫‪ ‬ﻴﺘﻌﺭﻑ ﺃﻨﺯﻴﻡ ‪ ARN polymérase‬ﻋﻠﻰ ﺍﻹﺸﺎﺭﺍﺕ ﺍﻟﻭﺭﺍﺜﻴﺔ ﺍﻟﻤﺴﺅﻭﻟﺔ ﻋﻥ ﺍﻨﻁﻼﻕ ﺘﺭﻜﻴﺏ ‪ARNm‬‬
                                                                                                           ‫ﻭﻴﻠﺘﺼﻕ ﺒﻬﺎ.‬
 ‫‪ ‬ﻴﻌﻤل ‪ ARN polymérase‬ﻋﻠﻰ ﺘﻔﺭﻴﻕ ﻟﻭﻟﺒﻲ ﺠﺯﻴﺌﺔ ‪ ADN‬ﻋﻠﻰ ﺍﺜﺭ ﺍﻨﻔﺼﺎﻡ ﺍﻟﺭﻭﺍﺒﻁ ﺍﻟﻜﻴﻤﻴﺎﺌﻴﺔ ﺍﻟﺘﻲ‬
                                                    ‫ﺘﺠﻤﻊ ﺍﻟﻘﻭﺍﻋﺩ ﺍﻻﺯﻭﺘﻴﺔ ﺍﻟﻤﺘﺎﻜﻤﻠﺔ ﻓﻴﻤﺎ ﺒﻴﻨﻬﺎ.‬
‫‪ ‬ﺘﻌﻤل ‪ ARN polymérase‬ﻋﻠﻰ ﺒﻠﻤﺭﺓ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ ﺍﻟﺨﺎﺼﺔ ﺒـ ‪ ،ARNm‬ﻭﺫﻟﻙ ﺤﺴﺏ ﺘﻜﺎﻤل ﺍﻟﻘﻭﺍﻋﺩ ﺍﻻﺯﻭﺘﻴﺔ‬
                                                          ‫ﻟـ ‪ G ) ¡ARNm‬ﺃﻤﺎﻡ ‪ C‬ﻭ ‪ U‬ﺃﻤﺎﻡ ‪.( A‬‬

       ‫‪ ‬ﺘﺘﻌﺭﻑ ‪ ARN polymérase‬ﻋﻠﻰ ﺍﻟﻭﺤﺩﺍﺕ ﺍﻟﺭﻤﺯﻴﺔ ﺍﻟﻤﺴﺅﻭﻟﺔ ﻋﻥ ﻨﻬﺎﻴﺔ ﺍﻻﺴﺘﻨﺴﺎﺥ، ﻓﺘﺘﻭﻗﻑ ﻋﻥ‬
                                                ‫ﺍﻟﺒﻠﻤﺭﺓ، ﻭﺘﺴﺘﻌﻴﺩ ﺠﺯﻴﺌﺔ ‪ ADN‬ﺤﺎﻟﺘﻬﺎ ﺍﻷﺼﻠﻴﺔ.‬



   ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                      ‫6‬                                              ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
                                      ‫ﺏ – ﻤﺭﺤﻠﺔ ﺍﻟﺘﺭﺠﻤﺔ ﻓﻲ ﺍﻟﺴﻴﺘﻭﺒﻼﺯﻡ: ﻤﻥ ‪ ARNm‬ﺇﻟﻰ ﺍﻟﺒﺭﻭﺘﻴﻥ.‬
                                              ‫‪ – a‬ﻤﻌﻁﻴﺎﺕ ﺤﻭل ﺍﻟﻁﻔﺭﺍﺕ: ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ1، ﻟﻭﺤﺔ 4.‬

                              ‫‪ ‬ﻧﺸﺎط 4 اﻟﻌﻼﻗﺔ ﺑﯿﻦ ﻧﻜﻠﯿﻮﺗﯿﺪات ‪ ADN‬وﻣﺘﺘﺎﻟﯿﺔ اﻷﺣﻤﺎض اﻷﻣﯿﻨﯿﺔ و أدوات ﺗﻌﺒﯿﺮ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ :‬
                                                                                               ‫♥ اﻟﻮﺛﯿﻘﺔ 1 : ﻣﻌﻄﯿﺎت ﺣﻮل اﻟﻄﻔﺮات‬
                                                                                         ‫ﻛﺸﻔﺖ دراﺳﺔ اﻟﻄﻔﺮات ﻋﻦ ﻣﺎ ﯾﻠﻲ:‬
      ‫‪ ‬ﯾﺆدي ﺗﻐﯿﯿﺮ ﻧﯿﻜﻠﯿﻮﺗﯿﺪ واﺣﺪ أو اﺛﻨﺎن أو ﺛﻼﺛﺔ ﻧﯿﻜﻠﯿﻮﺗﯿﺪات ﻣﺘﺘﺎﻟﯿﺔ ﻓﻲ اﻟﻤﻮرﺛﺔ، إﻟﻰ ﺗﻐﯿﯿﺮ ﻣﺘﺘﺎﻟﯿﺔ اﻟﻨﯿﻜﻠﯿﻮﺗﯿﺪات ﻓﻲ ‪،ARNm‬‬
                                                                             ‫وﺑﺎﻟﺘﺎﻟﻲ ﺗﻐﯿﯿﺮ ﺣﻤﺾ أﻣﯿﻨﻲ واﺣﺪ ﻓﻲ اﻟﺒﺮوﺗﯿﻦ.‬
    ‫‪ ‬ﯾﺆدي ﺗﻐﯿﯿﺮ أرﺑﻊ أو ﺧﻤﺲ أو ﺳﺖ ﻧﯿﻜﻠﯿﻮﺗﯿﺪ ﻣﺘﺘﺎﻟﯿﺔ ﻓﻲ اﻟﻤﻮرﺛﺔ، إﻟﻰ ﺗﻐﯿﯿﺮ ﻣﺘﺘﺎﻟﯿﺔ اﻟﻨﯿﻜﻠﯿﻮﺗﯿﺪات ﻓﻲ ‪ ،ARNm‬وﺑﺎﻟﺘﺎﻟﻲ ﺗﻐﯿﯿﺮ‬
                                                                                              ‫ﺣﻤﻀﯿﻦ أﻣﯿﻨﯿﯿﻦ ﻓﻲ اﻟﺒﺮوﺗﯿﻦ.‬
                                                                                                  ‫ﻋﻦ ﻣﺎذا ﺗﻜﺸﻒ ھﺬه اﻟﻤﻌﻄﯿﺎت ؟‬


                                                                       ‫ﺘﺒﻴﻥ ﻫﺫﻩ ﺍﻟﻤﻌﻁﻴﺎﺕ ﻤﺎ ﻴﻠﻲ:‬
                 ‫‪ ‬ﻫﻨﺎﻙ ﻋﻼﻗﺔ ﺒﻴﻥ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ ﺍﻟﻤﻜﻭﻨﺔ ﻟـ ‪ ARNm‬ﻭﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﻟﻠﺒﺭﻭﺘﻴﻥ.‬
             ‫‪ ‬ﺇﻥ ﺍﻹﺸﺎﺭﺓ ﻟﺤﻤﺽ ﺃﻤﻴﻨﻲ ﻭﺍﺤﺩ ﻓﻲ ﺍﻟﺒﺭﻭﺘﻴﻥ، ﻴﺘﻡ ﺒﻭﺍﺴﻁﺔ ﺜﻼﺜﺔ ﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ ﻓﻲ ‪.ARNm‬‬

                              ‫‪ – b‬ﺘﺠﺎﺭﺏ ‪ Nirenberg‬ﻭ ‪ Matthaei‬ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ2، ﻟﻭﺤﺔ 4.‬

                                                                ‫♥ اﻟﻮﺛﯿﻘﺔ 2 : ﺗﺠﺎرب ‪ Nirenberg‬و ‪( 1962 ).Matthaei‬‬

                                               ‫‪ήѧ Ϩ ΍ ѧ ѧ Ϯѧ‬‬
                                                 ‫‪ѧ ό ϛ ѧ‬‬
                                                 ‫‪λ‬‬
                                               ‫‪ѧ ΎϟϞѧϰѧ ήϓѧϳ‬‬‫‪Ϡ‬‬‫‪ϋ Θ E.coliѧ ΘΑϦѧ ϱϮѧ κ ϠΘ ѧΰѧ‬‬
                                                                                 ‫‪Ύήϴ  ѧ ѧ‬‬
                                                                                  ‫‪ѧ Ϝ ϣ Ϡ‬‬
                                                                                  ‫‪ϳ‬‬              ‫‪Χ Ψδѧ ϝ ѧ‬‬ ‫‪ϣ ϋ‬‬
                                                                                                           ‫‪ѧ ѧ‬‬
          ‫‪ 20 + Poly U‬ﺣﻤﺾ أﻣﯿﻨﻲ ﻣﺨﺘﻠﻒ‬
                                                             ‫‪ˬ ѧ ί Βέ ΕΎ ϭ ϟΐ ϴ ϟ ϣ ϟΔϣ ΑΘ‬‬
                                                                  ‫‪ϣ‬‬         ‫ ‪ˬ Ϩ ΍ ϛ‬‬
                                                                                 ‫‪ϴ‬‬
                                               ‫‪،GTP ،ATPΕΎϭ Ϯϳ ѧΗήΒ ѧήΘΔ ί ϼ΍ ϴί ϼ Ϯϴ ΍‬‬         ‫‬           ‫‪δϟ‬‬
       ‫+‬               ‫+‬                 ‫+‬                            ‫+2‪ ، Mg‬أﻧﺰﯾﻤﺎت (. ﻣﺎﻋﺪا ‪ ،ADN‬و‪.ARNm‬‬
   ‫‪ Val‬ﻣﺸﻊ‬       ‫‪ Phe‬ﻣﺸﻊ‬             ‫‪ Ala ѧˬ ѧΧ΍ ѧ΃  ѧ37°Cέ΍ѧ Ζѧ  ѧ ϟϯϮΘ ϟϊ ѧ ϭ‬ﻣﺸﻊ‬
                                               ‫‪ϢΛ έΎ  Β  ϲѧ‬‬
                                                 ‫‪ Β ΏϮ ϧ ϓ‬‬
                                                     ‫‪Θ‬‬                  ‫‬           ‫ ‪Σ ΤΗ Ψ  ΤϤ‬‬
                                                                                 ‫‪Γ ήѧ ѧ ϱϮϠ ΍ ѧ ΍ ο‬‬
                                               ‫‪ΰѧ ϳ ѧ  ϛ ΃ ϴ ϲѧ ΃ Ϥ  έΎ  Β  Ϝ ϒϴ‬‬
                                                 ‫‪ϴ  ϧϞ  Κѧ‬‬
                                                 ‫‪Ϥ‬‬
                                               ‫΃ ‪ѧ Θ ΏϮΒ΃ ѧ ϥ ѧ  ѧϣ ѧΣ  ѧΧ΍ ѧ΃ ѧ ѧ‬‬
                                                                     ‫‪Σ‬‬       ‫‪ϴ‬‬
                                                                            ‫‪Ϩ ξ‬‬               ‫‪Θ‬‬
                                                                                              ‫‪Β ΏϮ ϧϞ ϟ ο‬‬
                                               ‫‪ϑΎ Η ѧ Ϊό‬‬
                                                    ‫‪ Ϋ‬‬
                                               ‫ﺑﻜﻮن ﺣﻤﺾ أﻣﯿﻨﻲ واﺣﺪ ﻣﻮﺳﻮم ﺑﺎﻟﻜﺮﺑﻮن اﻟﻤﺸﻊ ‪ πѧϚϟ ΑC‬‬
                                        ‫‪‬‬      ‫ ‪Δѧ Η Ϡ ϧ ѧϟΘ Ϋˬϴ Ϩ ѧ‬‬
                                                 ‫‪ϳ Ϯ Ϝ  ϴΘ‬‬
                                               ‫‪ѧΪϴ ϴ ϴ ΔѧΎϣΕ΍ΔϋΎ ѧ ΍‬‬         ‫‪λ‬‬             ‫‪ΕΎ ΰΟςѧ Ϟѧϰѧ‬‬
                                                                             ‫‪τѧ ARNm ѧϳ  ѧ ѧ ѧ‬‬
                                                                                               ‫‪ѧ‬‬‫‪Ό‬‬     ‫‪ѧ ϛ ѧ‬‬
                                                                                                      ‫‪γϭ‬‬         ‫‪ϟ‬‬‫·‬
      ‫‪‬‬              ‫‪‬‬                         ‫‪Γ ѧ  ѧ · ѧ ϻΕ΍ѧϮ Ϝϧ ѧѧ ϣΔϴΘ  Μ ˬѧ ϣ‬‬
                                                 ‫‪ϋΎ Ϡ‬‬
                                               ‫‪Ϊѧ ϗϰѧ ϻ ϱϮΘ  ΪѧϠϴ ϦϣΔϧϜ ѧΎϣϼ ѧΔϓήό‬‬
                                                       ‫‪ϋ‬‬         ‫‪ΤΗ‬‬         ‫‪Η‬‬
                                                                           ‫ ‪ϴϴ‬‬           ‫‪Ϯ‬‬     ‫‪ϟΘ ϣ ϭ‬‬
                          ‫‪ARNm Poly U‬‬          ‫‪Poly UѧϪѧΰѧήϳϚάѧ   ϴγ΍ Ϸ ѧΪѧ ϭΔѧϭ ΍‬‬
                                                          ‫‪˰ ѧ ѧ  ϟѧϭ U Ϟѧ έϭ ΍ ѧ Γ ѧ ѧΗί‬‬
                                                          ‫‪ѧ ϟѧ‬‬
                                                           ‫‪Α ϣ‬‬             ‫ ‪Α‬‬          ‫‪ѧ‬‬        ‫‪ϫ Σ΍ ϴ‬‬
                                                                                                ‫‪ϲѧ ѧ‬‬
                                                                                                         ‫‪.ARNm‬‬
                                               ‫ ‪ΪѧΒΒ ΪϋϠ Ϡ Ϭ ϳρΎ ΍ ѧ ϣΪΣ΍ Α Θ‬‬
                                                 ‫‪Θ ϟΪѧ‬‬          ‫‪γ‬‬          ‫‪γϭ ϩ‬‬
                                               ‫΁‪ϴ ϴ΍ ϳ Δδѧ ήѧψ  ѧ ϷάϫϦ  ϭςγϭΔήΠ ϟήΧ‬‬                   ‫‪΍ ϲϓ‬‬
                                                    ‫ﻣﺸﻌﺔ، ھﺬا اﻟﻮﺳﻂ ﯾﺘﻤﯿﺰ ﺑﺘﻮﻓﺮه ﻋﻠﻰ اﻟﺤﻤﺾ اﻷﻣﯿﻨﻲ اﻟﻔﯿﻨﯿﻼﻻﻧﯿﻦ .‬
                                                                                  ‫1( ﻣﺎذا ﺗﺴﺘﻨﺘﺞ ﻣﻦ ھﺬه اﻟﻤﻌﻄﯿﺎت ؟‬
                                                    ‫ﻋﻨﺪﻣﺎ ﻧﺴﺘﻌﻤﻞ ‪ Poly-C ARN‬ﻧﺤﺼﻞ ﻋﻠﻰ ﻣﺘﺘﺎﻟﯿﺔ ﻣﻦ اﻟﺒﺮوﻟﯿﻦ‬
       ‫1‬               ‫2‬                ‫02‬                                                                   ‫‪.Pro‬‬
                                                ‫ﻋﻨﺪﻣﺎ ﻧﺴﺘﻌﻤﻞ ‪ Poly-A ARN‬ﻧﺤﺼﻞ ﻋﻠﻰ ﻣﺘﺘﺎﻟﯿﺔ ﻣﻦ اﻟﻠﯿﺰﯾﻦ ‪.Lys‬‬
                                                   ‫ﻋﻨﺪﻣﺎ ﻧﺴﺘﻌﻤﻞ ‪ Poly-GU ARN‬ﻧﺤﺼﻞ ﻋﻠﻰ ﻣﺘﺘﺎﻟﯿﺔ ﻣﻦ ﺣﻤﻀﯿﻦ‬
                                                                              ‫أﻣﯿﻨﯿﯿﻦ اﻟﺴﯿﺴﺘﯿﻦ - اﻟﻔﺎﻟﯿﻦ ‪.Val-Cys‬‬
‫رواﺳﺐ ﺑﺮوﺗﯿﻨﯿﺔ رواﺳﺐ ﺑﺮوﺗﯿﻨﯿﺔ‬   ‫رواﺳﺐ ﺑﺮوﺗﯿﻨﯿﺔ‬       ‫2( ﺣﺪد اﻟﻮﺣﺪة اﻟﺮﻣﺰﯾﺔ اﻟﺘﻲ ﺗﻄﺎﺑﻖ ﻛﻞ ﺣﻤﺾ أﻣﯿﻨﻲ ﻣﻦ اﻷﺣﻤﺎض‬
   ‫ﻏﯿﺮ ﻣﺸﻌﺔ‬          ‫ﻣﺸﻌﺔ‬          ‫ﻏﯿﺮ ﻣﺸﻌﺔ‬                             ‫اﻷﻣﯿﻨﯿﺔ اﻟﺘﻲ ﺗﻜﺸﻒ ﻋﻨﮭﺎ اﻟﺘﺠﺎرب اﻟﺴﺎﺑﻘﺔ.‬

‫1( ﻴﺘﺒﻴﻥ ﻤﻥ ﻫﺫﻩ ﺍﻟﻤﻌﻁﻴﺎﺕ ﺃﻥ ﺍﻟﻁﺎﺒﻊ ﺍﻟﻭﺭﺍﺜﻲ ﺍﻷﺴﺎﺴﻲ ﻴﻭﺠﺩ ﻋﻠﻰ ﺸﻜل ﺜﻼﺜﻲ ﻤﻥ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ، ﺤﻴﺙ‬
                                        ‫ﺃﻥ ﺍﻟﺜﻼﺜﻲ ‪ UUU‬ﻴﺭﻤﺯ ﻟﻠﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﻔﻴﻨﻴﻼﻻﻨﻴﻥ.‬
  ‫2( ﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪ CCC‬ﺘﺭﻤﺯ ﻟﻠﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﺒﺭﻭﻟﻴﻥ. ﻭﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪ AAA‬ﺘﺭﻤﺯ ﻟﻠﺤﻤﺽ‬
 ‫ﺍﻷﻤﻴﻨﻲ ﺍﻟﻠﻴﺯﻴﻥ . ﻭﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪ GUG‬ﺘﺭﻤﺯ ﻟﻠﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﻔﺎﻟﻴﻥ، ﻭﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪UGU‬‬
                                                              ‫ﺘﺭﻤﺯ ﻟﻠﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﺴﻴﺴﺘﻴﻥ.‬
‫ﻨﺴﺘﺨﻠﺹ ﻤﻥ ﻫﺫﻩ ﺍﻟﺘﺠﺎﺭﺏ ﺃﻥ ﻜل ﺜﻼﺜﻲ ﻨﻴﻜﻠﻴﻭﺘﻴﺩﻱ ﻴﺸﻜل ﻭﺤﺩﺓ ﺭﻤﺯﻴﺔ ‪ ،Codon‬ﻭﻴﺭﻤﺯ ﻷﺤﺩ ﺍﻷﺤﻤﺎﺽ‬
 ‫ﺍﻷﻤﻴﻨﻴﺔ. ﻭﺒﺎﺴﺘﻌﻤﺎل ﻨﻔﺱ ﺍﻟﺘﻘﻨﻴﺔ ﺍﻟﺘﺠﺭﻴﺒﻴﺔ ﺍﻟﺴﺎﺒﻘﺔ، ﺘﻤﻜﻥ ﺍﻟﺒﺎﺤﺜﻭﻥ ﻤﻥ ﺘﺤﺩﻴﺩ ﺍﻟﻭﺤﺩﺍﺕ ﺍﻟﺭﻤﺯﻴﺔ ﺍﻟﺘﻲ ﺘﺸﻴﺭ‬
  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                         ‫7‬                                           ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
‫ﺇﻟﻰ 02 ﻨﻭﻋﺎ ﻤﻥ ﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﺍﻟﻤﻜﻭﻨﺔ ﻟﻠﺒﺭﻭﺘﻴﻨﺎﺕ، ﻓﺘﻡ ﺘﺠﻤﻴﻊ ﺍﻟﻨﺘﺎﺌﺞ ﺍﻟﻤﺤﺼل ﻋﻠﻴﻬﺎ ﻓﻲ ﺠﺩﻭل ﺍﻟﺭﻤﺯ‬
                                                             ‫ﺍﻟﻭﺭﺍﺜﻲ ﺍﻟﻤﻤﺜل ﻋﻠﻰ ﺍﻟﻭﺜﻴﻘﺔ 3، ﻟﻭﺤﺔ4.‬
    ‫♥ اﻟﻮﺛﯿﻘﺔ 3 : ﺗﺒﻌﺎ ﻟﺘﺠﺎرب ﻣﻤﺎﺛﻠﺔ ﻟﻠﺘﺠﺎرب اﻟﺴﺎﺑﻘﺔ ﺗﻢ اﻟﺤﺼﻮل ﻋﻠﻰ ﻧﺘﺎﺋﺞ اﻟﺠﺪول اﻟﻤﻤﺜﻞ ﻋﻠﻰ اﻟﻮﺛﯿﻘﺔ 3 ) ﺟﺪول اﻟﺮﻣﺰ اﻟﻮراﺛﻲ (‬
             ‫‪ Code génétique‬اﻟﺬي ﯾﻌﻄﻲ ﻣﺨﺘﻠﻒ اﻟﺘﻮاﻓﻘﺎت اﻟﻤﻤﻜﻨﺔ ﻷرﺑﻊ ﻧﯿﻜﻠﯿﻮﺗﯿﺪات ﻣﺄﺧﻮذة ﺛﻼﺛﺔ ﺑﺜﻼﺛﺔ وﻣﻌﺎﻧﻲ ھﺬه اﻟﺘﺮﻛﯿﺒﺎت.‬

                                                                       ‫اﻟــــــﺤـــــﺮف اﻟﺜــــﺎﻧـــــﻲ‬
                                             ‫‪U‬‬                     ‫‪C‬‬                                ‫‪A‬‬                        ‫‪G‬‬
                                    ‫‪UUU‬‬         ‫‪ UCU‬اﻟﻔﯿﻨﯿﻼﻟﻨﯿﻦ‬                   ‫‪UAU‬‬                                ‫‪UGU‬‬                   ‫‪U‬‬
                                                                                             ‫‪Tyr‬‬           ‫ﺗﯿﺮوزﯾﻦ‬         ‫ﺳﯿﺴﺘﯿﯿﻦ ‪Cys‬‬
                                    ‫‪UUC‬‬              ‫‪Phe UCC Ser‬‬        ‫ﺳﯿﺮﯾﻦ‬     ‫‪UAC‬‬                                ‫‪UGC‬‬                   ‫‪C‬‬
                                ‫‪U‬‬
                                    ‫‪UUA‬‬                    ‫‪UCA‬‬                    ‫‪UAA‬‬                                ‫ﻣﻌﻨﻰ‪UGA STOP‬‬‫ﺑﺪون‬      ‫‪A‬‬
                                          ‫‪Leu‬‬      ‫ﻟﻮﺳﯿﻦ‬                                     ‫ﺑﺪون ﻣﻌﻨﻰ ‪STOP‬‬
                                    ‫‪UUG‬‬                    ‫‪UCG‬‬                    ‫‪UAG‬‬                                ‫ﺗﺮﯾﺒﺘﻮﻓﺎن ‪UGG Trp‬‬     ‫‪G‬‬




                                                                                                                                               ‫اﻟـــــــﺤــــــﺮف اﻟﺜـــــــــﺎُﺚ‬
                                    ‫‪CUU‬‬                    ‫‪CCU‬‬                    ‫‪CAU‬‬                                ‫‪CGU‬‬                   ‫‪U‬‬
                                                                                             ‫‪His‬‬           ‫ھﺴﺘﺪﯾﻦ‬
     ‫اﻟــــــــﺤــــــﺮف اﻷول‬




                                    ‫‪CUC‬‬                    ‫‪CCC‬‬                    ‫‪CAC‬‬                                ‫‪CGC‬‬                   ‫‪C‬‬
                                ‫‪C‬‬   ‫‪CUA‬‬
                                          ‫‪Leu‬‬     ‫ﻟﻮﺳﯿﻦ‬    ‫‪CCA‬‬
                                                                 ‫‪Pro‬‬    ‫ﺑﺮوﻟﯿﻦ‬    ‫‪CAA‬‬                                ‫‪CGA‬‬
                                                                                                                           ‫‪Arg‬‬   ‫أرﺟﯿﻨﯿﻦ‬   ‫‪A‬‬
                                                                                             ‫‪Gln‬‬          ‫ﻏﻠﻮﺗﺎﻣﯿﻦ‬
                                    ‫‪CUG‬‬                    ‫‪CCG‬‬                    ‫‪CAG‬‬                                ‫‪CGG‬‬                   ‫‪G‬‬
                                    ‫‪AUU‬‬                    ‫‪ACU‬‬                    ‫‪AAU‬‬                                ‫‪AGU‬‬                   ‫‪U‬‬
                                            ‫ازوﻟﻮﺳﯿﻦ‬                                         ‫‪Asn‬‬          ‫أﺳﺒﺎرﺟﯿﻦ‬         ‫‪Ser‬‬    ‫ﺳﯿﺮﯾﻦ‬
                                    ‫‪AUC‬‬                    ‫‪ACC‬‬                    ‫‪AAC‬‬                                ‫‪AGC‬‬                   ‫‪C‬‬
                                ‫‪A‬‬              ‫‪Ileu‬‬              ‫ﺗﺮﯾﻮﻧﯿﻦ ‪Thr‬‬
                                    ‫‪AUA‬‬                    ‫‪ACA‬‬                    ‫‪AAA‬‬                        ‫ﻟﯿﺰﯾﻦ‬   ‫‪AGA‬‬                   ‫‪A‬‬
                                                                                                                           ‫أرﺟﯿﻨﯿﻦ ‪Arg‬‬




                                                                                                                                                ‫ﻟ‬
                                    ‫‪AUG‬‬   ‫ﻣﯿﺜﯿﻮﻧﯿﻦ ‪Met‬‬     ‫‪ACG‬‬                    ‫‪AAG‬‬                        ‫‪Lys‬‬     ‫‪AGG‬‬                   ‫‪G‬‬
                                    ‫‪GUU‬‬                    ‫‪GCU‬‬                    ‫‪GAU‬‬                            ‫‪GGU‬‬                       ‫‪U‬‬
                                                                                           ‫ﺣﻤﺾ أﺳﺒﺎرﺗﯿﻚ ‪Asp‬‬
                                    ‫‪GUC‬‬                    ‫‪GCC‬‬                    ‫‪GAC‬‬                            ‫‪GGC‬‬                       ‫‪C‬‬
                                ‫‪G‬‬         ‫‪Val‬‬      ‫ﻓﺎﻟﯿﻦ‬         ‫‪ala‬‬      ‫أﻟﻨﯿﻦ‬                                            ‫ﻏﻠﯿﺴﯿﻦ ‪Gly‬‬
                                    ‫‪GUA‬‬                    ‫‪GCA‬‬                    ‫‪GAA‬‬                            ‫‪GGA‬‬                       ‫‪A‬‬
                                                                                           ‫اﻟﻐﻠﻮﺗﺎﻣﯿﻚ ‪Glu‬‬    ‫ﺣﻤﺾ‬
                                    ‫‪GUG‬‬                    ‫‪GCG‬‬                    ‫‪GAG‬‬                            ‫‪GGG‬‬                       ‫‪G‬‬

    ‫ﻴﺘﺒﻴﻥ ﻤﻥ ﻫﺫﻩ ﺍﻟﻭﺜﻴﻘﺔ ﺃﻥ ﺍﻟﺭﻤﺯ ﺍﻟﻭﺭﺍﺜﻲ ﻴﺘﻜﻭﻥ ﻤﻥ 34 ﺃﻱ 46 ﻭﺤﺩﺓ ﺭﻤﺯﻴﺔ ﺘﺘﻜﻭﻥ ﻤﻥ ﺜﻼﺜﻴﺎﺕ ﻤﻥ‬
  ‫ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ، ﺤﻴﺙ ﺃﻥ ﻋﺩﺓ ﺜﻼﺜﻴﺎﺕ ﺘﺭﻤﺯ ﻟﻨﻔﺱ ﺍﻟﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ، ﻭﺒﻌﺽ ﺍﻟﺜﻼﺜﻴﺎﺕ ﻻ ﺘﺭﻤﺯ ﻷﻱ ﺤﻤﺽ‬
                          ‫ﺃﻤﻴﻨﻲ ﻨﻘﻭل ﺃﻨﻬﺎ ﺒﺩﻭﻥ ﻤﻌﻨﻰ ﺃﻭ ﻗﻑ، ﻫﻲ ) ‪.( UGA , UAG , UAA‬‬

                                                                     ‫‪ – c‬ﻤﺭﺍﺤل ﺍﻟﺘﺭﺠﻤﺔ:‬
                                                                       ‫‪ ‬ﺍﻟﻌﻨﺎﺼﺭ ﺍﻟﻼﺯﻤﺔ ﻟﻠﺘﺭﺠﻤﺔ:‬
                                       ‫ﻴﺤﺘﺎﺝ ﺘﺭﻜﻴﺏ ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ ﺒﺎﻹﻀﺎﻓﺔ ﺇﻟﻰ ‪ ARNm‬ﻭ ﺍﻟﻤﻭﺭﺜﺔ ﺇﻟﻰ:‬
 ‫‪ ‬ﺭﻴﺒﻭﺯﻭﻤﺎﺕ ﺍﻟﻭﺜﻴﻘﺔ 4 ﺸﻜل 1 ﻟﻭﺤﺔ 5 ﻭﻫﻲ ﻋﻀﻴﺎﺕ ﺴﻴﺘﻭﺒﻼﺯﻤﻴﺔ ﺼﻐﻴﺭﺓ ﻴﺘﺸﻜل ﻜل ﻭﺍﺤﺩ ﻤﻨﻬﺎ‬
                                                                   ‫ﻤﻥ ﻭﺤﺩﺓ ﺼﻐﻴﺭﺓ ﻭ ﻭﺤﺩﺓ‬
              ‫ﻜﺒﻴﺭﺓ، ﻭﺘﺘﻜﻭﻥ ﻜل ﻭﺤﺩﺓ ﻤﻥ ‪ ARN‬ﺭﻴﺒﻭﺯﻭﻤﻲ )‪ (ARNr‬ﻭ ﻤﻥ ﺒﺭﻭﺘﻴﻨﺎﺕ. ﻭﺘﺘﻜﻭﻥ‬
                                                                  ‫ﺍﻟﺭﻴﺒﻭﺯﻭﻤﺎﺕ ﺩﺍﺨل ﺍﻟﻨﻭﻴﺔ.‬
   ‫‪ ARN ‬ﻨﺎﻗل )‪ (ARNt‬ﺍﻟﻤﻭﺠﻭﺩ ﺒﺎﻟﺴﻴﺘﻭﺒﻼﺯﻡ، ﻭﻴﺨﺘﺹ ﺒﻨﻘل ﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﺍﻟﺤﺭﺓ ﺍﻟﻤﻁﺎﺒﻘﺔ‬
‫ﻟﻠﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ. ﺘﺘﻜﻭﻥ ﺠﺯﻴﺌﺔ ‪ ARNt‬ﻤﻥ ﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ ﻭﺘﺘﻀﻤﻥ ﻤﻭﻗﻌﻴﻥ: ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ 4 ﺸﻜل 2‬
                                                                                   ‫ﻟﻭﺤﺔ 5‬
    ‫‪ ‬ﻤﻭﻗﻊ ﻴﺤﺘﻭﻱ ﻋﻠﻰ ﺜﻼﺙ ﻨﻴﻜﻠﻴﻭﺘﻴﺩﺍﺕ ﻤﻜﻤﻠﺔ ﻟﻠﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ﺍﻟﻤﺸﻴﺭﺓ ﻟﺤﻤﺽ ﺃﻤﻴﻨﻲ ﻤﻌﻴﻥ،‬
                     ‫ﻭﻴﺴﻤﻰ ﻫﺫﺍ ﺍﻟﺜﻼﺜﻲ ﺍﻟﻨﻴﻜﻠﻴﻭﺘﻴﺩﻱ ﻤﻀﺎﺩ ﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪.Anticodon‬‬
                                   ‫‪ ‬ﻤﻭﻗﻊ ﻟﺘﺜﺒﻴﺕ ﺍﻟﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﻤﻨﺎﺴﺏ ﻟﻠﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ.‬
                                               ‫‪ ‬ﺃﺤﻤﺎﺽ ﺃﻤﻴﻨﻴﺔ ﻭ ﻫﻲ 02 ﺤﻤﺽ ﺃﻤﻴﻨﻲ ﻁﺒﻴﻌﻲ.‬
                                  ‫‪ ‬ﻁﺎﻗﺔ ﻟﻤﺨﺘﻠﻑ ﻤﺭﺍﺤل ﺍﻟﺘﺭﻜﻴﺏ ، ﻤﺼﺩﺭﻫﺎ ﺍﻻﺴﺘﻘﻼﺏ ﺍﻟﻁﺎﻗﻲ.‬
                                                                              ‫‪ ‬ﻋﻭﺍﻤل ﻤﻨﺸﻁﺔ‬

  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                                              ‫8‬                                            ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
  ‫ﻣﻮﻗﻊ ﺗﺜﺒﯿﺚ‬                 ARNt ‫اﻟﺸﻜﻞ2: ﺟﺰﯾﺌﺔ‬                      ARNt ‫ و‬ARNm ‫اﻟﺸﻜﻞ1: اﻟﺮﯾﺒﻮزوم وﻋﻼﻗﺘﮫ ﺑـ‬         :4 ‫اﻟﻮﺛﯿﻘﺔ‬
 ‫اﻟﺤﻤﺾ اﻷﻣﯿﻨﻲ‬




                                              ‫ﻣﻮﻗﻊ ﺗﻌﺮف‬
                                             ‫اﻟﻮﺣﺪة اﻟﺮﻣﺰﯾﺔ‬
                                         ‫= ﻣﻀﺎد اﻟﻮﺣﺪة اﻟﺮﻣﺰﯾﺔ‬
        ARNm


                                                                              5 ‫ ﻤﺭﺍﺤل ﺍﻟﺘﺭﺠﻤﺔ: ﺃﻨﻅﺭ ﺍﻟﻭﺜﻴﻘﺔ 5 ﻟﻭﺤﺔ‬
‫اﻟﻤﺒﺘﺪيء‬ARNt                                                                                       .‫♥ اﻟﻮﺛﯿﻘﺔ 5 : ﻣﺮاﺣﻞ اﻟﺘﺮﺟﻤﺔ‬
                            PHE
         MET                                 ‫ ﺛﺎﻧﻲ‬ARNt                                                            ‫ﻣﺮﺣﻠﺔ اﻟﺒﺪاﯾﺔ‬
                          A A A
        U A C
    '
        AUGUUUCUGGCCGCCCAAUAAUAC
   5                    ARNm   3
                                 '
                         ‫رﯾﺒﻮزوم‬
                                                                                                                 ‫ﻣﺮﺣﻠﺔ اﻻﺳﺘﻄﺎﻟﺔ‬
         MET    PHE


        UACAAA
        AUGU U U C UGGC CGC C C A A U A A U AC

                                    LEU
         MET    PHE

UAC                                GAC
           AAA
        AUGU U U C UGGC CGC C C A A U A A U AC



         MET    PHE   LEU


           AAAGAC
        AUGUUUCUGGCCGCCCAAU A                               UAC

                                            ALA
         MET    PHE   LEU

                                           CGG
AAA           GAC
        AUGUUUCUGGCCGCCCAAU AAUAC



    MET    PHE    LEU    ALA       ALA     VAL
                                                                                PHE
                                                                                        ALA                       ‫ﻣﺮﺣﻠﺔ اﻟﻨﮭﺎﯾﺔ‬
                                                                        MET       LEU
                                                                                            ALA   GUU
                                                                                      VAL
                                          G U U STOP                                                             STOP
   A UGU U U C UGGC CGC C C A AU A AU A C
                                                                        A UGU U U C UGGC CGC C C A AU A AU A C


  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                                           9                                          ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬
                              ‫ﻴﻤﻜﻥ ﺘﻠﺨﻴﺹ ﻅﺎﻫﺭﺓ ﺘﺭﻜﻴﺏ ﺍﻟﺒﺭﻭﺘﻴﻨﺎﺕ ﻓﻲ ﺜﻼﺜﺔ ﻤﺭﺍﺤل ﺃﺴﺎﺴﻴﺔ ﻭﻫﻲ:‬
                                                               ‫‪ ‬ﺍﻟﻤﺭﺤﻠﺔ ﺍﻷﻭﻟﻰ:.ﺍﻟﺒﺩﺍﻴﺔ‬
   ‫ﺨﻼل ﻫﺫﻩ ﺍﻟﻤﺭﺤﺔ ﺘﻠﺘﺼﻕ ﻭﺤﺩﺘﻲ ﺍﻟﺭﻴﺒﻭﺯﻭﻤﺎﺕ ﺒـ ‪ ،ARNm‬ﻋﻠﻰ ﻤﺴﺘﻭﻯ ﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪ ،AUG‬ﺍﻟﺘﻲ‬
         ‫ﺘﻤﺜل ﺇﺸﺎﺭﺓ ﺍﻟﺒﺩﺀ، ﻭﺘﺭﻤﺯ ﻟﻠﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﻤﻴﺜﻴﻭﻨﻴﻥ ﺍﻟﺫﻱ ﻴﺭﺘﺒﻁ ﺒـ ‪ ARNt‬ﺨﺎﺹ ﻴﺴﻤﻰ ‪ARNt‬‬
                                               ‫ﺍﻟﻤﺒﺘﺩﻱﺀ، ﻭﺍﻟﺤﺎﻤل ﻟﻤﻀﺎﺩ ﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ‪.UAC‬‬

                                                             ‫‪ ‬ﺍﻟﻤﺭﺤﻠﺔ ﺍﻟﺜﺎﻨﻴﺔ:ﺍﻻﺴﺘﻁﺎﻟﺔ‬
      ‫ﻭﺼﻭل ‪ ARNt‬ﺁﺨﺭ ﺤﺎﻤﻼ ﻤﻌﻪ ﺤﻤﺽ ﺃﻤﻴﻨﻲ ﺜﺎﻨﻲ ﻤﻁﺎﺒﻕ ﻟﻠﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ﺍﻟﻤﻭﺍﻟﻴﺔ ﻋﻠﻰ ‪. ARNm‬‬
‫ﺘﺘﺸﻜل ﺭﺍﺒﻁﺔ ﺒﻴﺒﺘﻴﺩﻴﺔ ﺒﻴﻥ ‪ Met‬ﻭ ﺍﻟﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ﺍﻟﻤﻭﺍﻟﻲ، ﻓﺘﻨﻔﺼل ﺍﻟﺭﺍﺒﻁﺔ ﺒﻴﻥ ‪ Met‬ﻭ ‪ ARNt‬ﺍﻟﻤﺒﺘﺩﻱﺀ‬
                                                                      ‫ﺍﻟﺫﻱ ﻴﻐﺎﺩﺭ ﺍﻟﺭﻴﺒﻭﺯﻭﻡ.‬
     ‫ﻴﺘﺤﺭﻙ ﺍﻟﺭﻴﺒﻭﺯﻭﻡ ﺒﻭﺤﺩﺓ ﺭﻤﺯﻴﺔ ﻭﺍﺤﺩﺓ، ﻟﻴﺼل ‪ ARNt‬ﺜﺎﻟﺙ، ﻭﻫﻜﺫﺍ ﺘﺘﻀﺎﻋﻑ ﺍﻷﺤﻤﺎﺽ ﺍﻷﻤﻴﻨﻴﺔ ﻓﻲ‬
                                                                             ‫ﺍﻟﺴﻠﺴﻠﺔ ﺍﻟﺒﻴﺒﺘﻴﺩﻴﺔ.‬

                                                                    ‫‪ ‬ﺍﻟﻤﺭﺤﻠﺔ ﺍﻟﺜﺎﻟﺜﺔ:ﺍﻟﻨﻬﺎﻴﺔ‬
‫ﻋﻨﺩﻤﺎ ﻴﺼل ﺍﻟﺭﻴﺒﻭﺯﻭﻡ ﺇﻟﻰ ﺍﻟﻭﺤﺩﺓ ﺍﻟﺭﻤﺯﻴﺔ ﻗﻑ )‪ UAA‬ﺃﻭ‪ UAG‬ﺃﻭ‪ (UGA‬ﻻ ﻴﺩﻤﺞ ﺃﻱ ﺤﺎﻤﺽ ﺃﻤﻴﻨﻲ، ﺇﺫ‬
  ‫ﻻ ﻴﻭﺠﺩ ﺃﻱ ‪ ARNt‬ﻤﺘﻜﺎﻤل ﻤﻊ ﻫﺫﻩ ﺍﻟﻭﺤﺩﺍﺕ ﺍﻟﺭﻤﺯﻴﺔ. ﻓﺘﻔﺘﺭﻕ ﻭﺤﺩﺘﻲ ﺍﻟﺭﻴﺒﻭﺯﻭﻡ ﻋﻥ ﺒﻌﻀﻬﻤﺎ ﺍﻟﺒﻌﺽ ﻭ‬
        ‫ﻋﻥ ‪ ARNm‬ﻭ ﻴﺘﻡ ﺘﺤﺭﻴﺭ ﺍﻟﺴﻠﺴﻠﺔ ﺍﻟﺒﻴﺒﺘﻴﺩﻴﺔ. ﻜﻤﺎ ﻴﻨﻔﺼل ﺍﻟﺤﻤﺽ ﺍﻷﻤﻴﻨﻲ ‪ Met‬ﻋﻥ ﺒﺎﻗﻲ ﺍﻟﺴﻠﺴﻠﺔ‬
                                                                                         ‫ﺍﻟﺒﻴﺒﺘﻴﺩﻴﺔ .‬

                                                                               ‫ﻤﻠﺤﻭﻅﺔ:‬
‫ﺇﻥ ﺠﺯﻴﺌﺔ ﻭﺍﺤﺩﺓ ﻤﻥ ‪ ARNm‬ﺘﺘﻡ ﺘﺭﺠﻤﺘﻬﺎ ﻓﻲ ﻨﻔﺱ ﺍﻟﻭﻗﺕ ﺒﻭﺍﺴﻁﺔ ﻋﺩﺓ ﺠﺴﻴﻤﺎﺕ ﺭﻴﺒﻴﺔ، ﺘﻨﺘﻘل ﻋﻠﻰ ﻁﻭل‬
                                  ‫ﺨﻴﻴﻁ ‪ ،ARNm‬ﻤﻤﺎ ﻴﺴﻤﺢ ﺒﺘﻜﻭﻥ ﻋﺩﺓ ﺒﺭﻭﺘﻴﻨﺎﺕ ﻓﻲ ﻨﻔﺱ ﺍﻟﻭﻗﺕ.‬




  ‫اﻷﺳﺘﺎذ: ﯾﻮﺳﻒ اﻷﻧﺪﻟﺴﻲ‬                           ‫01‬                                 ‫ﻃﺒﯿﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ‬

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:261
posted:9/24/2012
language:Unknown
pages:10
Description: تعبير الخبر الوراثي