IDO2 CHI Appendix sample by 70eaO6

VIEWS: 0 PAGES: 17

									Information sources for the target analysis of IDO2


Section                      Source
Other genetic alterations-   MicrocosmTarget
miRNA targets in IDO2 gene   TargerScan
(human)                      miRNAMap
                             TarBase
Chromosomal aberrations
(human)                      HDAC

                             Mitelman Database of chromosome aberrations
                             Database of Genomic variants


                             GoogleScholar
Orthologs
                             UniProtKB

                             NCBI Blast
                             ORTHOMCL
                             Homologene
                             Inparanoid
                             Ensembl
                             Evola
Protein domain               CDD
                             CDART
Method
Queried for IDO2 targeting miRNAs
Queried for IDO2 targeting miRNAs
Queried for IDO2 targeting miRNAs
Queried for IDO2 targeting miRNAs
Queried for breakpoints in IDO2 cytobands (8p11)

Queried for chromosomal aberrations in IDO2
cytobands (8p11)
Queried using cDNA clone EF052681
Query -[[INDOL1] and
[[DELETION]OR[DUPLICATION]OR[COPY NUMBER
VARIATION]OR[CNV]]
Performed BLAST analysis against the UniprotKB
database to identigy orthologs
Performed BLAST analysis against the RefSeq database
to identify orthologs
Queried for IDO2 orthologs
Queried for IDO2 orthologs
Queried for IDO2 orthologs
Queried for IDO2 orthologs
Queried for IDO2 orthologs
Queried for IDO
Queried by IDO2 protein sequence
Results
The databases Microcosm target, TargetScan, miRGen and miRNAMap
computationally predict miRNAs targeting IDO2 gene. However, IDO2 is not
registered in TarBase, which records experimentally proven miRNA targets. No
article could be retrieved reporting IDO2 targeting miRNAs.
There were no reports of chromosomal aberrations specifically associated with the
IDO2 gene in any databases. Aberrations are reported in cytoband where IDO2 lies
(8p11). Nowak et al (2009) describes deletion breakpoint involving IDO2.




BLASTp anlaysis against UniprotKB and NCBI databases report homology with the
IDO2 protein in chimpanzee, rhesus monkey, cow, dog, rat, mouse. BLAST results
are provided in the data worksheet. The other gene/protein homology databases
also listed orthologs.




IDO2 is a single domain protein with IDO as its major domain. The IDO domain is
shared by several other single domain proteins in mammals.
SNP-ID
Color                  Upstream/Dow
Codes                  nstream      intronic                     Synonymous coding



                       Positional Information

                                                      Position
                                      Position        relative to
                                      relative to     the
                       Chromosome     transcription   coding
Sl.No.   SNP_ID (rs)   Position       start site      sequence Sequence (NCBI)




    10   62512638      37.1 : 39790265 62512638       -          GGGGTAGGGT GGGATCACCA GATGGTGAAG GTGGT
    11   6992375       37.1 : 39790408 6992375        -          GCATTTTCTG CACATCGCAG TGAGTGCTCC TCCAGGG
    12   11432816      37.1 : 39790483 11432816       nearGene-5 TATGTATTTT AAGTAACATG GTTCCTATTT GAATGAA
    13   6991530       37.1 : 39790600 6991530        nearGene-5 GTAACATGGT TCCTATTTGA ATGAAATTAA AGATAAT
    43   72643911      37.1 : 39795241 72643911       intron
    44   10958572      37.1 : 39795373 10958572       intron     TCAAAATTCT AGTTTTCATC AATTAAAACT TTATTTAG
   307   73619581      37.1 : 39821219 73619581       missense GCTCACCAGCTTCAAGCTCATGTGGA[C/G]AAGG
   783   2981161       37.1 : 39872866 2981161        cds-synon TTCTGGTGCA TTCTTGTCTG AAAAAGCAGA GAAGAT
   827   13280333      37.1 : 39875980 13280333       -          ggcattgaat ctataaatta ccttgcgcag aatggccatt tccacga
   828   7018120       37.1 : 39875993 7018120        -          CTTTCCACGT GGTACCTAGA TTTGCAAATT CTATTGTA
   829   6474203       37.1 : 39876177 6474203        -          CTTTCCACGT GGTACCTAGA TTTGCAAATT CTATTGTA
   830   4469437       37.1 : 39876257 4469437        -          CTTTCCACGT GGTACCTAGA TTTGCAAATT CTATTGTA
Non-Synonymous coding       Non-sense Frameshift           5'UTR or 3'UTR



Functional Information                Predicted Functional Effect

                                                                       Predicted result on
                            Amino                                      transcription binding
                            acid                                       sites (FastSNP)
Position relative to        change     Location/Function   Risk        Allele1:   Allele2:
the Gene Structure Allele   (Position) (FastSNP)           (FastSNP)   Transcrip Transcription




-                  A/G      -                              Unknown risk (0)
                                      Upstream with no known function A:           G:
-                  C/T      -                              Very         C:AP-1,AP-1,
                                      Promoter/regulatory regionlow-moderate (1-3) T:
nearGene-5         -/A      -                              Unknown risk (0)
                                      Upstream with no known function -:HFH-2, A:HFH-2
nearGene-5         G/T      -                              Very         G:CdxA,
                                      Promoter/regulatory regionlow-moderate (1-3) T:
intron                      -         intron
intron             A/C      -         Intronic enhancer                 A:GATA-1,CdxA,GATA-3,GATA-1,
                                                           Very low-low(1-2)       C:
missense                    77        missense             Low to moderate (2-3)
cds-synon          A/C      336                                         A:c-Ets-,
                                      Coding synonymous Low to moderate (2-3) C:c-Ets-
-                  A/G      -                              Unknown risk A:
                                      Downstream with no known function (0)        G:
-                  A/G      -                              Unknown risk A:
                                      Downstream with no known function (0)        G:
-                  A/G      -                              Unknown risk A:Oct-1,CdxA,
                                      Downstream with no known function (0)        G:GATA-1
-                  A/T      -                              Unknown risk A:
                                      Downstream with no known function (0)        T:
Predicted results on splicing regulatory
sites (FastSNP)                            Predicted result on protein
                                           structure - damage & effect
SR protein- Motifs                         (FastSNP)
Allele 1: Allele 2: No. of       No. of    Amino      Amino      Functional
SR        SR        ESE          ESS       acid       acid       Prediction SNP_ID (rs)



-          -          ,          ,                                          62512638
-          -          ,          ,                                          6992375
-          -          ,          ,                                          11432816
-          -          ,          ,                                          6991530
                                                                            72643911
-          -          ,         ,                                           10958572
                      ..:1, G:4            D         E          benign ;    73619581
A:0                   ,         ,
           C:SF2/ASF, SC35, SRp40          S         S          benign      2981161
-          -          ,         ,                                           13280333
-          -          ,         ,                                           7018120
-          -          ,         ,                                           6474203
-          -          ,         ,                                           4469437
Summary of splice variants reported from various databases

                               mRNA                  Number
Database     Transcript ID     Length   CDS length   of Exons
             ENST00000343295   4264bp    No report      11
Ensembl
             ENST00000421393   1635bp    No report       7


             H8C5126.1         4270bp     519bp         11
ECGene


             H8C5126.2         1634bp    486bp           7
Splicenest   Hs356236.1        3929bp   No report    No report
             Hs356236.2        1732bp   No report    No report
databases


                   Protein Size
            No protein product reported
            No protein product reported


                      172aa


                     161aa
                    No report
                    No report
Tissue Expression
No evidence
No evidence
neoplastic lung, neoplastic cerebellum, fetal cerebrum, colon, cardiovascular
(benign hyperplasia), lymph node, leucocyte, placenta, brain, eye, heart, prostate,
BMR, STC
neoplastic lung, neoplastic cerebellum, fetal cerebrum, colon, cardiovascular
(benign hyperplasia), lymph node, leucocyte, placenta, brain, eye, heart, prostate,
BMR, STC
UniprotKB-BLAST result for IDO2

Accession Protein names                                                               Score    E-value

A6RSP6    Putative uncharacterized protein Botryotinia fuckeliana       (strain B05.10) 200        3.00E-49
C5PF62    Indoleamine 2,3-dioxygenase family protein Coccidioides                          198
                                                                          posadasii (strain C735) 1.00E-48
C0NQ12    Indoleamine 2,3-dioxygenase subfamily Ajellomyces                                198     1.00E-48
                                                                    capsulata (strain ATCC 26029 / G186AR / H82 / RMSCC
C4Q305    Expressed protein Schistosoma mansoni                                            112     9.00E-23
Q22MG7    Surface protein with EGF domains, putative Tetrahymena          thermophila SB210104     2.00E-20
A6S7E9    Putative uncharacterized protein Botryotinia fuckeliana       (strain B05.10) 88.2       1.00E-15
A7E6D3    Putative uncharacterized protein Sclerotinia sclerotiorum                         87     3.00E-15
                                                                          (strain ATCC 18683 / 1980 / Ss-1)
B8MU20    Indoleamine 2,3-dioxygenase family protein Talaromyces                           84.7    2.00E-14
                                                                          stipitatus (strain ATCC 10500 / CBS 375.48 / QM
Q4P835    Putative uncharacterized protein Ustilago maydis                                 84.3    2.00E-14
C1GAP3    Indoleamine 2,3-dioxygenase family protein                                       (strain 3.00E-12
                                                             Paracoccidioides brasiliensis77.4 Pb18)
C5GBY6    Indoleamine 2,3-dioxygenase Ajellomyces dermatitidis         (strain ER-3)       75.5    1.00E-11
A4Y2F5    Putative uncharacterized protein Shewanella putrefaciens                          ATCC 8.5
                                                                           (strain CN-32 /35.8 BAA-453)
C7DEG9    Glutamine synthetase, type I Thalassiobium sp. R2A62                             35.8    8.5
A3XAI5    Glutamine synthetase Roseobacter sp. MED193                                      35.8    8.5
B6HSP3    Pc22g08480 protein Penicillium chrysogenum (strain ATCC                          1075 8.5
                                                                            28089 / DSM 35.8 / Wisconsin 54-1255)
                               Identity (%) to
Query coverage Positives       human IDO2

     33%       141/418 (33%)   215/418 (51%)
     32%       138/427 (32%)   214/427 (50%)
     31%       143/458 (31%)   220/458 (48%)
     23%       108/453 (23%)   180/453 (39%)
     23%       72/302 (23%)    136/302 (45%)
     24%       83/342 (24%)    143/342 (41%)
     24%       94/391 (24%)    164/391 (41%)
     23%       101/428 (23%)   177/428 (41%)
     27%       84/306 (27%)    128/306 (41%)
     25%       79/314 (25%)    129/314 (41%)
     24%       77/309 (24%)    128/309 (41%)
     22%       43/190 (22%)    76/190 (40%)
     28%       22/77 (28%)     37/77 (48%)
     27%       21/77 (27%)     37/77 (48%)
     29%       33/112 (29%)    54/112 (48%)
NCBI-BLASTn Result for IDO2 mRNA (nr/nt)

    Accession                                      Description
NM_194294.2      Homo sapiens indoleamine 2,3-dioxygenase 2 (IDO2), mRNA
XM_528116.2      PREDICTED: Pan troglodytes hypothetical LOC472744 (LOC472744), mRNA
                 Homo sapiens indoleamine 2,3-dioxygenase 2, mRNA (cDNA clone
BC113498.1       IMAGE:8322550), complete cds
                 Homo sapiens indoleamine 2,3-dioxygenase 2, mRNA (cDNA clone
BC113496.1       IMAGE:8322548), complete cds
                 PREDICTED: Equus caballus indoleamine-pyrrole 2,3 dioxygenase-like 1 (INDOL1),
XM_001490331.2   mRNA
AC007991.7       Homo sapiens, clone RP11-44K6, complete sequence
    Organism-                             Total     Query
                       Gene   Max score                       E value       Max ident
  common name                             score    coverage
Human           IDO2              4237      4237      100%              0       100%
Chimpanzee      LOC472744         1792      1792       44%              0        97%

Human           -                  915       915       21%              0       100%

Human           -                  915       915       21%              0       100%

Horse           IDO2               795      1287       52%         0             87%
Human           -                  488      1851       42% 5.00E-134            100%
List of miRNAs predicted to target the IDO2 gene as reported in various databases
(miRNAs highlighted in red are represented in more than one database)

Target Scan      Microcosm Targets          miRNA
miR-182          hsa-let-7b                 hsa-miR-143
miR-34a          hsa-let-7d                 hsa-miR-146a
miR-34b-5p       hsa-let-7e                 hsa-miR-146b
miR-330          hsa-miR-449b
miR-330-5p       hsa-miR-455-5p
miR-544          hsa-miR-504
IDO2 References (PubMed)

PMID          Authors
              Huang Y, Fernandez SV, Goodwin S, Russo PA, Russo IH,
18056439      Sutter TR, Russo J.
              Jacquemier J, Charafe-Jauffret E, Monville F, Esterni B,
              Extra JM, Houvenaeghel G, Xerri L, Bertucci F, Birnbaum
19405945      D.

19058140      Jariwala U, Cogan JP, Jia L, Frenkel B, Coetzee GA.


17522209      Joo CH, Shin YC, Gack M, Wu L, Levy D, Jung JU.


8702590       Konan KV, Taylor MW.

2236042       Kozak M.


9171361       Kozak M.


10938111      Lin R, Génin P, Mamane Y, Hiscott J.

12766158      Littlejohn TK, Takikawa O, Truscott RJ, Walker MJ.
              Lob S,Konigsrainer A,Schafer R,Rammensee HG,Opelz
18045970      G,Terness P,
              Lob S,Konigsrainer A,Zieker D,Brucher
18418598      BL,Rammensee HG,Opelz G,Terness P
15459668      Mellor AL, Munn DH.

              Metz R,Duhadaway JB,Kamasani U,Laury-Kleintop
17671174      L,Muller AJ,Prendergast GC,
Journal

Cancer Res. 2007 Dec 1;67(23):11147-57


Breast Cancer Res. 2009;11(2):R23. Epub 2009 Apr 30.

Prostate. 2009 Mar 1;69(4):392-400.


J Virol. 2007 Aug;81(15):8282-92. Epub 2007 May 23.


J Biol Chem. 1996 Aug 9;271(32):19140-5

Proc Natl Acad Sci U S A. 1990 Nov;87(21):8301-5.


EMBO J. 1997 May 1;16(9):2482-92.


Mol Cell Biol. 2000 Sep;20(17):6342-53.

J Biol Chem. 2003 Aug 8;278(32):29525-31. Epub 2003 May 24.

Blood 2008;111(4):2152-4

Cancer immunology, immunotherapy : CII 2008;58(1):153-7
Nat Rev Immunol. 2004 Oct;4(10):762-74.


Cancer research 2007;67(15):7082-7
Title
Epithelial to mesenchymal transition in human breast epithelial cells transformed
by 17beta-estradiol

Association of GATA3, P53, Ki67 status and vascular peritumoral invasion are
strongly prognostic in luminal breast cancer.
Inhibition of AR-mediated transcription by binding of Oct1 to a motif enriched in
AR-occupied regions.
Inhibition of interferon regulatory factor 7 (IRF7)-mediated interferon signal
transduction by the Kaposi's sarcoma-associated herpesvirus viral IRF homolog
vIRF3.

Importance of the two interferon-stimulated response element (ISRE) sequences
in the regulation of the human indoleamine 2,3-dioxygenase gene
Downstream secondary structure facilitates recognition of initiator codons by
eukaryotic ribosomes.

Recognition of AUG and alternative initiator codons is augmented by G in position
+4 but is not generally affected by the nucleotides in positions +5 and +6.
Selective DNA binding and association with the CREB binding protein coactivator
contribute to differential activation of alpha/beta interferon genes by interferon
regulatory factors 3 and 7.
Asp274 and his346 are essential for heme binding and catalytic function of human
indoleamine 2,3-dioxygenase
Levo- but not dextro-1-methyl tryptophan abrogates the IDO activity of human
dendritic cells.
IDO1 and IDO2 are expressed in human tumors: levo- but not dextro-1-methyl
tryptophan inhibits tryptophan catabolism.
IDO expression by dendritic cells: tolerance and tryptophan catabolism
Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of
the antitumor indoleamine 2,3-dioxygenase inhibitory compound D-1-methyl-
tryptophan.

								
To top