Docstoc

Genomics

Document Sample
Genomics Powered By Docstoc
					How to characterize a single piece of DNA


- Isolate a small fragment of DNA

- Insert DNA into plasmid (or phage vector)

-Transform recombinant DNA molecule into bacteria

-Amplify DNA by culturing transformed bacteria

-Select for transformants

-Use transformants for variety of purposes (e.g.expression studies,
sequencing, mutational analysis, etc.)
LE 20-2
                        Bacterium                                  Cell containing gene
                                                                   of interest
                                             Gene inserted into
                                             plasmid



                 Bacterial       Plasmid
                 chromosome                                    Gene of
                                  Recombinant                  interest
                                  DNA (plasmid)                                DNA of
                                                                               chromosome
                                                         Plasmid put into
                                                         bacterial cell

                           Recombinant
                           bacterium
                                                                     Host cell grown in culture
                                                                     to form a clone of cells
                                                                     containing the “cloned”
                                                                     gene of interest


                           Gene of                                 Protein expressed
                           interest                                by gene of interest
                 Copies of gene                                           Protein harvested

                                            Basic research and
            Basic                           various applications                    Basic
            research                                                                research
            on gene                                                                 on protein




          Gene for pest         Gene used to alter      Protein dissolves      Human growth hor-
          resistance inserted   bacteria for cleaning   blood clots in heart   mone treats stunted
          into plants           up toxic waste          attack therapy         growth
      Restriction Enzymes Used to Make
               Recombinant DNA

• Bacterial restriction enzymes

  – cut DNA molecules at specific DNA sequences
              called restriction sites
       LE 20-3
                                                Restriction site


                                 DNA 5                              3         Memorize
                                     3                              5
                                                                                EcoRI restriction site
                        Restriction enzyme cuts
                        the sugar-phosphate                  EcoRI
                        backbones at each arrow.
                                                                                       palindrome


                                                        Sticky end




                        DNA fragment from another
                        source is added. Base pairing        Fragment from different
                        of sticky ends produces              DNA molecule cut by the
                        various combinations.                same restriction enzyme
Catalyzes phosphodiester
bond between                                                                               Ligation
5’ phosphate &
3’ hydroxyl group of sugar                   One possible combination

                        DNA ligase
                        seals the strands.



                                             Recombinant DNA molecule
Do restriction digests and ligations always work?


 What are the other possible undesirable outcomes?
What is a common strategy to select for transformed bacteria?
  Grow bacteria on antibiotic: only plasmid carriers will survive

  Clever way to select for recombinant clones
  Plasmid
         contains LacZ gene-->-galactosidase
                                            X-gal (substrate:one
                                            product is blue)
                                    Blue colonies

         Restriction site in LacZ gene
                if insert DNA fragment    -galactosidase
                                                    X-gal

                                           White colonies
LE 20-4_3
                                                     Bacterial cell    lacZ gene          Human
            Isolate plasmid DNA                                        (lactose           cell
            and human DNA.                                             breakdown)

                                                                       Restriction
                                                                       site
                                           ampR gene      Bacterial
                                           (ampicillin    plasmid              Gene of
                                           resistance)                         interest
                                                                         Sticky
            Cut both DNA samples with                                                        Human DNA
                                                                         ends
            the same restriction enzyme.                                                     fragments




            Mix the DNAs; they join by base pairing.
            The products are recombinant plasmids
            and many nonrecombinant plasmids.
                                                                  Recombinant DNA plasmids

            Introduce the DNA into bacterial cells
            that have a mutation in their own lacZ
            gene.

                                                             Recombinant
                                                             bacteria
            Plate the bacteria on agar
            containing ampicillin and X-gal.
            Incubate until colonies grow.



                                                       Colony carrying non-           Colony carrying
                                                       recombinant plasmid            recombinant
                                                       with intact lacZ gene          plasmid with
                                                                                      disrupted lacZ gene


                                                                                            Bacterial
                                                                                            clone
Different goals in creating recombinant clones




 1. To examine/utilize the structure and function of a single
   piece of DNA.


 2. To package small pieces of an entire genome:
        genomic DNA library

 To have available all the sequences in the genome for
 examination and use.
      LE 20-6


DNA libraries created using plasmids and phage and bacterial hosts

                                                   Foreign genome
                                                   cut up with
                                                   restriction
                                                   enzyme
                                              or


   Bacterial                      Recombinant
   clones                         plasmids                           Phage
                                            Recombinant
                                            phage DNA                clones




                Plasmid library                             Phage library

   Note: practical limit on the size of DNA cloned into a vectors
   (plasmid: 5-10 kbp, phage: 45 kbp)
How to distinguish one DNA molecule from another?

       Characterization of DNA by Size


  Agarose Gel Electrophoresis

              Digest DNA with restriction enzymes

               Load DNA into wells of agarose gel

               Apply electric current to fractionate
               DNA fragments by size

 In electric field with positive and negative poles, which pole
 will DNA be attracted to? Why?
LE 20-8




                               Mixture               Longer
                               of DNA                molecules
      Cathode                  molecules
                               of differ-
                               ent sizes



                                                     Shorter
     Power                                           molecules
     source
                               Gel

                               Glass
                               plates


          Anode
                  -DNA stained
                         with fluorescent
                         dye (ethidium bromide)

                  -DNA fluoresces upon exposure to
                  ultraviolet (UV) light
How would you determine whether a particular gene or
   DNA sequence is present in your cloned DNA?



                  Southern Blot
      LE 20-10
                                                                                                                          Heavy
           DNA + restriction enzyme          Restriction                                                                  weight
                                             fragments           I   II      III              Nitrocellulose
                                                                                              paper (blot)

                                                                                              Gel


                                                                                            Sponge

     I Normal    II Sickle-cell III Heterozygote                                                                              Paper
     -globin    allele                                                                       Alkaline                        towels
     allele                                                                                   solution

       Preparation of restriction fragments.          Gel electrophoresis.                     Blotting.




Labeled nucleic acid probe:
RNA or DNA                                           Southern Blot Analysis


                                                                Probe hydrogen-
                                                                bonds to fragments
         Radioactively                                          containing normal                          I   II   III
         labeled probe                                          or mutant -globin
                                  I     II    III
         for -globin
         gene is added
         to solution in
         a plastic bag                                                    Fragment from
                                                                                                                           Film over
                                                                          sickle-cell
                                                                                                                           paper blot
                                                                          -globin allele

                                                                          Fragment from
                                                                          normal -globin
                           Paper blot                                     allele

       Hybridization with radioactive probe.                                                    Autoradiography.
Why are globin DNA fragments different in size?
LE 20-9
                                        Normal -globin allele



                                   175 bp      201 bp          Large fragment

Restriction enzyme          Ddel        Ddel            Ddel                    Ddel


                                   Sickle-cell mutant -globin allele



                                        376 bp                 Large fragment

                            Ddel                        Ddel                    Ddel
                     Ddel restriction sites in normal and sickle-cell alleles of
                     -globin gene


                                            Normal      Sickle-cell
                                            allele      allele



                            Large
                            fragment



                                                                      376 bp
                               201 bp
                               175 bp


                     Electrophoresis of restriction fragments from normal
                     and sickle-cell alleles
     Restriction Fragments Length Polymorphisms (RFLP)

- useful in detecting disease alleles



 -forensics
        to identify individuals
        no two individuals are alike

 (exception?)
LE 20-17
           Defendant’s   Blood from defendant’s   Victim’s
           blood (D)             clothes          blood (V)




                                                              Do the RFLPs
                                                              suggest the
                                                              defendant was
                                                              in contact with
                                                              the victim?

                                                              By themselves,
                                                              do RFLPS
                                                              prove she’s guilty
                                                              of assault?
Ch 20
  Genomics and Molecular Techniques
 • Characterization of entire genomes

 • Human Genome Project (HPG):
 •       ambitious goal to sequence the entire human genome
   (initiated 1990; mostly complete 2003)

 • Other genomes also sequenced

 • Evolutionary relatedness of key interest
    ->sequence comparison
   LE 20-11
              Cytogenetic map                       Chromosome
Steps         (chromosome map)
                                                    bands

in genome                           Genes located
mapping                             by FISH


                Genetic (linkage)
                mapping



                                       Genetic
                                       markers


                Physical mapping



                                           Overlapping
                                           fragments




                DNA sequencing
         DNA Sequencing
• Short DNA fragments sequenced by dideoxy
  chain-termination method
LE 20-12
           DNA                  Primer      Deoxyribonucleotides   Dideoxyribonucleotides
           (template strand)        3                             (fluorescently tagged)
            5

                                    5                                                       DNA chain
                               DNA                                                           terminators
                               polymerase




            3

                    DNA (template              Labeled strands
           5       strand)                                                             3




           3

                 Direction
                 of movement
                 of strands




                 Laser                                Detector
• Other approach to genome sequencing:

  – Shotgun method
     • Sequence random fragments of DNA
     • Computer program orders overlapping fragments
       into single continuous sequence
LE 20-13
           Cut the DNA from
           many copies of an
           entire chromosome
           into overlapping frag-
           ments short enough
           for sequencing




           Clone the fragments
           in plasmid or phage
           vectors




           Sequence each fragment




           Order the
           sequences into one
           overall sequence
           with computer
           software
Can we learn important information from
       the genome sequence?

• Genome organization
• Gene expression patterns in response to
          - environmental change e.g.
                     pollution, global warming
          -Development
                embryogenesis->
                senescence
          -Disease/Health
Computer Analysis: Key Tool
          Bioinformatics
                  -analysis and storage of biological data by
                 computing techniques


                 -key to management & analysis of huge
                 data sets
Example:
     Identification of proteins coding sequences (ORF)
     in genomes

agatactagcagctctttcgagcatcagcatcaccgatgcatcgatcacgcgctgtttg…
Think of a sequence feature that a program could search for
to identify ORFs.
?   ?
?
    ?

?
    ?
?

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:9/7/2012
language:Unknown
pages:27