Docstoc

Eli

Document Sample
Eli Powered By Docstoc
					Multi-Discipline Analysis of Gene Silencing:
Complimentary use of Multiplex RT-qPCR, 2-D
electrophoresis and Western blotting for RNAi
based pathway analysis.




Eli Hefner, Ph.D.
Sr. Scientist
Gene Expression Division


2007
Presentation outline




              Introduction to RNAi and initiators of silencing


              Key considerations when designing RNAi experiments


              Convergence of technologies: The b-Actin story.
Putting RNAi in perspective



                                            Comparison of publications with RT-PCR and RNAi
                                    10000
           Number of publications




                                    8000
                                                                                 RT-PCR
                                    6000                                         RNAi

                                    4000


                                    2000


                                       0
                                             1990
                                                    1991
                                                           1992
                                                                  1993
                                                                         1994
                                                                                1995
                                                                                       1996
                                                                                              1997
                                                                                                      1998
                                                                                                             1999
                                                                                                                    2000
                                                                                                                           2001
                                                                                                                                  2002
                                                                                                                                         2003
                                                                                                                                                2004
                                                                                                                                                       2005
                                                                                                                                                              2006
                                                                                                     Year


 There is a lot of room for growth in the area of RNAi and RT-PCR. It is likely that
 use of these two technologies will increase in unison.
Where did it all begin?


         1990 Cosuppression described in petunia

         1992 Quelling reported in fungi

         1998 dsRNA identified as causitive agent in C. elegans

         1998 RNAi used for gene knockout in Drosophila

         2001 siRNA mediated gene silencing in mammalian cells

         2002 Mammalian gene silencing in vivo

 Dicer   2005 Synthetic dsRNA Dicer substrates enhance RNAi efficacy
    siRNAs vs. Dicer substrates




Small interfering RNA (siRNA), are produced in vivo when long dsRNA molecules
are cleaved into 20-22 base duplexes having 2-base 3’ overhangs.


RNAi can be activated by synthetic siRNAs or by longer dsRNA that require Dicer



                                         Synthetic siRNAs, 21 bases long
                                         with 3’ overhangs

                                        Dicer substrates, >25 bases long
                                        Can have a variety of end structures
Cellular mechanism of RNAi mediated gene silencing


        Long dsRNA >25nt                                                21 mer siRNA

                                    Cell membrane




     Dicer   Dicer                                     Argonaut                        One strand
                                                                                        removed




                                                    RISC Assembly                              RISC
                                                                                              Complex

                     Dicer + TRBP




     mRNA cleavage
                                                          mRNA recognition
Increased Potency with Longer Duplexes




                                              EGFP Site-1 at 200 pM ds
                                                                    siRNA
                                 120

                                 100

                                 80
                      EGFP (%)




                                 60

                                 40

                                 20

                                  0
                                       mock

                                              21+2



                                                            25+2



                                                                          26+0

                                                                                 26+2



                                                                                               27+0

                                                                                                      27+2

                                                                                                             29+0

                                                                                                                    30+0
                                                     25-2



                                                                   26-2




                                                                                        27-2
                                                                    siRNA Duplex




Data Courtesy Integrated DNA Technologies
 Dicer cleaves 23mer and longer duplexes but 21mer
 duplexes are not a substrate.




                                                                         21   27   21   27   RNA
                                                                         -     -   +    +    Dicer




                         RNA duplexes were incubated
                          overnight with recombinant
                            human Dicer with Mg++



                                     RNA duplexes were incubated with
                                     recombinant human Dicer with EDTA




                          Dicer binds (gel-shifts) longer duplexes better than 21mer


Data Courtesy Integrated DNA Technologies
siLentMer Dicer Substrates




 siLentMer Dicer Substrates are 27 nucleotide RNA antisense sequences
        annealed to a 25 nucleotide RNA / DNA sense sequence.




                                Sense
                                                    2 nt DNA cap
             3’
                               Antisense
      siLentMers vs siRNAs



                                                                                                                          21 base siRNA

                                                                                                                          27 base siLentMer
                                                      140
120

                                                      120
100
                                                      100


                                                                                                                                                  27 mer
 80

                       AKT1-2                         80                                CDK2-3
 60
                                                      60

 40
                                                      40

 20                                                   20

  0                                                    0
        NC    100pm      1nm     5nm     50nm                NC           100pm           1nm               5nm          50nm




                                                                                                                                                      + Dicer
       Analyzed 5 paired 27 and 21 mer dsRNAs
                                                                                                      120
                                                                                                                                   TP53-1
                                                                                                      100


                                                                                                      80


                                                                                                      60


120                                                                                                   40
                                                120
100
                                                100                           ACT-9                   20
                                                                                                                                                  21 mer
80                    RAF1-4                    80
                                                                                                       0
                                                                                                              NC           100pm     1nm    5nm        50nm
60
                                                60

40                                              40

20                                              20


 0                                               0
       NC    100pm      1nm     5nm    50nm             NC        100pm           1nm           5nm               50nm
                                                -20
Key considerations when performing
        RNAi experiments
Transfection efficiency


                Microscopy
                 HeLa Cells


                                 Flow cytometry
    Light
 Microscope


                              0.99%

   Nuclear
    Stain


                              96.06%

 Fluorescent
Non-silencing
  siLentMer
Optimizing lipid and dsRNA concentrations


                     Analysis of transfection efficiency with increasing
                              lipid and dsRNA concentration with 11k
                                 Mean fluorescence of culture plated

                     1600

                     1400

                     1200

                     1000                                                  no siRNA
               RFU




                     800                                                   5nm OG488 siRNA
                                                                           20nM OG488 siRNA
                     600

                     400

                     200

                       0
                             0.1       0.2           0.3     0.4
                                       uL siLentFect/well



    Samples were transfected with a fluorescently labeled dsRNA and a
    measurement of total fluorescence was taken 24 hours after transfection.
Evaluate toxicity



 Visual Analysis
 • Morphology changes
 • Detachment
 • Lysis

          Low           Moderate   High




  Recommended dosage
   Check quality of RNA


The quality of the extracted RNA can have an impact on experimental results.


      Scrambled
        siRNA




       GAPDH
        siRNA




      RT-qPCR




     CT CONTROL     17.9              20.5              17.9

      CT GAPDH      24.7              24.7              26.7

         DCT        6.8               4.3               8.8
Case Study: b-actin Gene Silencing



 β-actin Gene Silencing via RNAi and its Effects on the Protein Profiles
 Teresa Rubio, Ning Liu, Katrina Academia, Tim Wehr, Yuan Yan, Joseph Terefe, Todd Yeck, Eli Hefner Keith
                               Hamby, and Aran Paulus (Bio-Rad Laboratories)




  Background:
  • Actin filaments – major cytoskeleton structures in cells
  • Cell physiological behaviors – migration, proliferation, & differentiation
  • Proper function depends on dynamic filament assembly and disassembly
  • Studies have identified many proteins interacting with actin to regulate the
    cytoplasm by cross-linking, bundling, capping, or severing actin filaments.
Experimental design




                                        HeLa Cells
                                        HeLa Cells


                                       Transfection
     Protein Quantitation
                            Protein                     RNA
                                      Cell Harvesting          RNA Quantitation
                                      and Extraction
      Sample Cleanup
                                                              Quality Check of RNA
                                                              Quality Check of RNA

           2-DGE
                                                               Design of Primers

        Spot Excision
                                                                   RT-qPCR

          Protein ID


      Western Analysis
siLentMer Duplex Design



Collaborated with Integrated DNA Technologies (IDT)

   • IDT synthesized 9 Dicer Substrates (siLentMers)
       9-sequences cover b-actin mRNA sequence

   • Bio-Rad designed primer pairs and screened sequences
     for efficacy using RT-qPCR
        Screen performed with 10nM and 100pM to assess potency


   Goal: Select two effective sequences for use in the study
   (phenotypic confirmation)
siLentMer Screen



  Using RT-qPCR, we tested nine anti-actin siLentMers
  Tested at 10nM and 100pM to assess efficacy
                           120                                                    10 nM
       % mRNA Expression




                           100
                                                                                  100 pM
                           80
                           60
                           40
                           20
                            0
                                 Con   A1   A2   A3     A4    A5   A6   A7   A8     A9
                                                      RNA Duplex
RT- qPCR Assay Validation
PCR baseline subtracted RFU




                                                                         100

                                                                          80




                                                          % Expression
                                                                          60

                                                                          40

                                                                          20

                                                                           0
                                                                                 48hr
                                                                               Control 48h   24hr
                                                                                             24h          48hr
                                                                                                          48h         72hr
                                                                                                                      72h
                                           Cycle
                                                                                Control             β-actin siLentMer
                              β-actin mRNA, CT = 21
                              eGFP (control), CT = 14.9                                  > 95% Knockdown
                              DCT = 6.1
Measuring gene silencing efficiency of b-actin



                    Immuno-fluorescence
                Hoechst dye          b-actin antibody


  anti-eGFP
  siLentMer




  anti-actin
  siLentMer
Experimental design




                                        HeLa Cells
                                        HeLa Cells


                                       Transfection
     Protein Quantitation
                            Protein                     RNA
                                      Cell Harvesting          RNA Quantitation
                                      and Extraction
      Sample Cleanup
                                                              Quality Check of RNA
                                                              Quality Check of RNA

           2-DGE
                                                               Design of Primers

        Spot Excision
                                                                   RT-qPCR

          Protein ID


      Western Analysis
Transfection Protocol




 Day 1: Seed 0.675x106 HeLa cells in 10ml of media on a 100mm plate

 Day 2: Transfection.
 Prepare siLentMer complexes with siLentFect and incubate 20 min.
 Add complexes to culture.

 Day 3: Change media to remove complexes, and add 10 ml of fresh media

 Day 3 and 4: Extract protein
 Remove media, wash cells with PBS.
 Add 1ml of Laemmli buffer per plate.
 Collect the extract into eppendorf tubes.
 Boil for 3min, and keep it at -200C
2-DGE Time Course Study


            24hr. Control     48hr. Control
           Spot count: 343   Spot count: 344




             24hr. (Test)      48hr. (Test)
           Spot count: 348   Spot count: 340
2-DGE - A Closer Look



              24hr. Control




                  b-actin, pI 5.5, MW 41.7kDa
2-DGE Analysis




             24hr. Control   24hr. (anti-actin siLentMer)




             48hr. Control   48hr. (anti-actin siLentMer)
2-DGE Analysis


                                                pH 5               Control           8

 2-DGE Protocol                         100kD
                                         75kD


• 80ug of protein load (in duplicate)    50kD


                                         37kD
• 11cm, pH 5-8 IPG strips                              5
                                                           3
                                                               4
                                         25kD
• 8-16% Tris-HCl Criterion gels          20kD
                                                                             1
                                                                                 2
• Flamingo Pink stain                    10kD



                                                           β-actin siLentMer
• PDQuest analysis                      100kD
                                         75kD

                                         50kD


Four spots identified through 2DGE       37kD
                                                           3
                                                       5    4
gel analysis relative to internal
                                         25kD
control (5).                             20kD
                                                                             1   2
                                         10kD
2-DGE Analysis


                 Control       β-actin siLentMer



    Spot #1
                                                   Spots 1-4 were up-
                                                   regulated in β-actin
                                                   siLentMer treated culture.

                                                   Spot 5 served as an internal
    Spot #2
                                                   control. It’s protein level
                                                   remained unchanged in
                                                   both control and siLentMer
                           3                 3
                                                   treated cultures.
                               4             4
Spots #3,4,5
                  5                  5
LC-MS-MS spot Analysis




     Sample              P1       US2     % Coverage   Database Mass (kDa)        Identity

     Control          1.9 e-013   114.3      32.6           41786.7               β-actin

  siRNA-treated       2.7 e-012   102.2      26.4           41786.7               β-actin

      Spot 1          2.2 e-014   70.4       36.1            18492                Cofilin

      Spot 2          2.2 e-008   58.2       36.4            18494                Destrin
                                                                                  Annexin
      Spot 3          1.6 e-012   66.3       25.5            36354
                                                                                    A3
                                                                                  CAPZB
      Spot 4          1.2 e-009   40.3       31.1            21094
                                                                                  protein
      Spot 5          4.5 e-010   38.3       18.8            29787               Prohibitin
   Internal control


 • Reversed-phase nanospray LC-MS-MS using an LTQ linear ion trap mass spectrometer
 • Protein search in the human database using TurboSEQUEST with BioWorks 3.2 software
 2- DGE Spot Summary


        pH 5            Control            8
100kD
 75kD
                                               Spot 1: Cofilin
 50kD
                                                       ~2-fold increase
 37kD
                   3
               5    4
                                               Spot 2: Destrin
 25kD
 20kD                                                  ~3-5 fold increase
                                  1
                                       2
 10kD
                                               Spot 3: Annexin A3
                   β-actin siLentMer                   ~2-fold increase
100kD
 75kD

 50kD
                                               Spot 4: CAPZB
 37kD
                                                       ~2-fold increase
               5   3
                    4
 25kD
 20kD
                                               Spot 5: Prohibitin
 10kD
                                  1
                                       2               no change
Protein function


   Cofilin, an actin-binding protein, is an actin depolymerization factor; it binds to
    actin filaments and induces cleavage of the filaments.2 It plays important role in
    remodeling the highly dynamic structure of actin filaments.3

   Destrin is an actin depolymerization factor; it has a function similar to that of
    cofilin.3,4

   CAPZB is a subunit of the Cap Z protein. “Cap Z is a widely distributed, highly
    conserved, heterodimeric protein that binds to barbed end of actin filaments but
    does not sever filaments”.6


   Annexin A3, also known as lipocortin 3, is a calcium- and membrane binding
    protein located in early endosomes with unclear functions.5


   Prohibitin is localized to the mitochondria and may have a role in the
    maintenance of mitochondria function and protection against senescence.7
Experimental design




                                        HeLa Cells
                                        HeLa Cells


                                       Transfection
     Protein Quantitation                     48 hr
                            Protein                     RNA
                                      Cell Harvesting          RNA Quantitation
                                      and Extraction
      Sample Cleanup
                                                              Quality Check of RNA
                                                              Quality Check of RNA

           2-DGE
                                                               Design Primers
                                                               Design of Primers

        Spot Excision
                                                                   RT-qPCR

          Protein ID


      Western Analysis
Multiplex RT-qPCR Results



                     Normalized to input RNA
   Fold Expression




                              Condition
Multiplex RT-qPCR Results



                                Normalized to geometric average of reference genes
   Normalized Fold Expression




                                                         Condition
Multiplex RT-qPCR Results




                                          Cofilin
                                          ~1.5 fold increase
 Normalized Fold Expression




                                          Destrin
                                          ~2 fold increase

                                          Annexin A3
                                          ~5 fold increase

                                          CAPZB
                                          ~2 fold increase
                              Condition
Validate ‘Hits’ with qPCR


                      Multiplex
  Control                         Cofilin (FAM)
                                  green

                                  Destrin (CalOrange560)
                                  orange

                                  Annexin (CalRed610)
                                  Red
  b-actin siLentMer
                                  CAPZB (Quasar670)
                                  Pink

                                  Normalization: GAPDH
                                  Tubilin and 18S RNA
Spot #1: Close-up




                    Control




                    Anti-actin
Spot #2: Close-up




                    Control




                    Anti-actin
Spot # 3 & 4: Close-up




                         Control




                         Anti-actin
Comparison: 2-DGE vs qPCR




 Target            2-DGE Analysis    RT-qPCR Analysis

  Cofilin            2      Fold ↑     1.5   Fold ↑

  Destrin           3 – 5 Fold ↑        2    Fold ↑

  Annexin A3         2      Fold ↑      5    Fold ↑

  CAPZB              2      Fold ↑      2    Fold ↑
Experimental design




                                        HeLa Cells
                                        HeLa Cells


                                       Transfection
     Protein Quantitation                     48 hr
                            Protein                     RNA
                                      Cell Harvesting          RNA Quantitation
                                      and Extraction
      Sample Cleanup
                                                              Quality Check of RNA
                                                              Quality Check of RNA

           2-DGE
                                                               Design Primers
                                                               Design of Primers

        Spot Excision
                                                                   RT-qPCR

          Protein ID


      Western Analysis
Western Analysis




Down-Regulated Expression           No Change in Expression
                  β-actin                           β-tubulin


    20 8      2       20 8 2 (µg)
                                                    Destrin
    Control           β-actin
                      siLentMer



                                                     Cofilin


                                      20 8      2        20 8 2 (µg)
                                      Control            β-actin
                                                         siLentMer
Western Analysis




Down-Regulated Expression            No Change in Expression
                   β-actin                           β-tubulin


    20 8       2       20 8 2 (µg)
                                                     Destrin
    Control            β-actin
                       siLentMer
      Phosphorylation
      Phosphorylated Cofilin                          Cofilin



     20 8      2       20 8 2 (µg)     20 8      2        20 8 2 (µg)
     Control           β-actin         Control            β-actin
                       siLentMer                          siLentMer
Spot #1: Close-up




                    Control




                    Anti-actin
Conclusions




Knocking down β-actin expression in Hela cells:

   • Induced protein level changes in several proteins that
     directly interact with the actin filaments.
          • Cofilin (actin depolymerization factor)
          • Destrin (actin depolymerization factor)
          • CAPZB (actin filament capping protein)
   • Cofilin protein is inactivated through phosphorylation rather
     than transcription down-regulation.

   • This process demonstrates the benefit of using three types
     of analysis methods to interpret gene knockdown.
Conclusions




Knocking down β-actin expression in Hela cells:

   • Like cofilin, is destrin phosphorylated when actin is
     silenced?

   • Why is cofilin phosphorylated and not down-regulated at
     the expression level when its target protein, actin, is
     suppressed?
   • How do kinases LIMK and TESK and phosphatase
     Slingshot respond to actin silencing?
Acknowledgements




Team Members:

      Bio-Rad Laboratories, Inc. - Teresa Rubio, Joseph Terefe, Eli
      Hefner, Michael Sturges, Steve Kulisch


      Integrated DNA Technologies, Inc. (IDT) - Mark Behlke, Scott Rose,
      Andy Peek, John Havens
Conclusions



Select Appropriate Mediators and Delivery Method
    Spend time selecting a good lipid reagent
    Optimize your delivery conditions
    Be sure of your siRNA design

Assess RNA quality prior to mRNA analysis

Use a detection methodology appropriate to your needs
   qRT-PCR provides fast silencing assessment
   Protein electrophoresis and blotting look at protein

Consider Multidiscipline analysis of gene silencing
Spot # 3 & 4: Close-up




                         Control


   Spot #3 Profile
   pI: ~6
   Mass: ~36,000 kDa
                         Anti-actin
   Spot #4 Profile
   pI: ~9
   Mass: ~21,000 kDa
RT-qPCR siLentMer validation




      24 hr                    48 hr




                               72 hr
     Evaluated sequence
      efficacy for 3-days

     Data for Actin 9 shown
Spot #1: Close-up




                       Control




                       Anti-actin

   Spot #1 Profile
   pI: ~8
   Mass: ~18,000 kDa
Representative 2D Gels of Total Protein HeLa Cell
Samples of Both Control & β-actin siLentMer Treatment


              pH 5             control           8
      100kD                                          • 80µg of total protein
       75kD
      50kD
                                                     loaded onto an 11cm, pH 5-8
                                                     IPG strip and run in the 2nd
      37kD                                           dimension on an 8-16% Tris-
                          3
                           4

      25k
                      5                              HCl Criterion gel.
      D
      20kD
                                         1   2       • Spots 1-4 indicates
      10k
      D                                              differentially expressed
                                                     protein spots.
              pH 5   β-actin siLentMer           8
      100kD
       75kD                                          • Spot 5 served as an
      50kD                                           internal control.
      37kD                3
                          4                          • β-actin is indicated by red
                      5
      25k                                            box.
      D
      20kD
                                         1   2
      10k
      D
Representative 2D Gels of Total Protein HeLa Cell
Samples of Both Control & β-actin siLentMer Treatment

        pH 5             Control           8                Control          + siLentMer
100kD
 75kD

 50kD                                          β-actin
 37kD
                   3
               5    44
 25kD
 20kD
                                                          3 to 5-fold increase in spot intensity
                                   1
                                       2
 10kD

                                               Spot #1
                   β-actin siLentMer
100kD
 75kD

 50kD
                                                                      No change
 37kD
               5   3
                    4                          Spot #5
 25kD                                          internal
 20kD                                           control
                                   1
                                       2
 10kD
Summary of MS Protein Identification



     Sample              P1       US2     % Coverage   Database Mass (kDa)   Database pI    Identity

     Control          1.9 e-013   114.3      32.6           41786.7             4.25        β-actin

  siRNA-treated       2.7 e-012   102.2      26.4           41786.7             4.25        β-actin

      Spot 1          2.2 e-014   70.4       36.1            18492              8.33        Cofilin

      Spot 2          2.2 e-008   58.2       36.4            18494              8.33        Destrin
                                                                                           Annexin
      Spot 3          1.6 e-012   66.3       25.5            36354              6.00
                                                                                             A3
                                                                                            CAPZB
      Spot 4          1.2 e-009   40.3       31.1            21094              9.20
                                                                                            protein
      Spot 5          4.5 e-010   38.3       18.8            29787              4.25       Prohibitin
   Internal control


 • Reversed-phase nanospray LC-MS-MS using an LTQ linear ion trap mass spectrometer
 • Protein search in the human database using TurboSEQUEST with BioWorks 3.2 software
Multiplex RT-qPCR Results


                      Different reference genes
   Fold Expression




                               Condition
Conclusions


Knocking down β-actin expression in Hela cells;
  Induced protein level changes in several proteins that
    directly interact with the actin filaments.
         • Cofilin (actin depolymerization factor)
         • Destrin (actin depolymerization factor)
         • CAPZB (actin filament capping protein)
   Inactivated cofilin through phosphorylation rather than
    transcription down-regulation.
Multiplex RT-qPCR Results


                                Normalized to 18s
   Normalized Fold Expression




                                      Condition
Target: b-Actin mRNA



                1 ccgcgtccgc cccgcgagca cagagcctcg   cctttgccga   tccgccgccc   gtccacaccc
               61 gccgccagct caccatggat gatgatatcg   ccgcgctcgt   cgtcgacaac   ggctccggca
              121 tgtgcaaggc cggcttcgcg ggcgacgatg   ccccccgggc   cgtcttcccc   tccatcgtgg
              181 ggcgccccag gcaccagggc gtgatggtgg   gcatgggtca   gaaggattcc   tatgtgggcg
              241 acgaggccca gagcaagaga ggcatcctca   ccctgaagta   ccccatcgag   cacggcatcg
              301 tcaccaactg ggacgacatg gagaaaatct   ggcaccacac   cttctacaat   gagctgcgtg
              361 tggctcccga ggagcacccc gtgctgctga   ccgaggcccc   cctgaacccc   aaggccaacc
              421 gcgagaagat gacccagatc atgtttgaga   ccttcaacac   cccagccatg   tacgttgcta
              481 tccaggctgt gctatccctg tacgcctctg   gccgtaccac   tggcatcgtg   atggactccg
              541 gtgacggggt cacccacact gtgcccatct   acgaggggta   tgccctcccc   catgccatcc
              601 tgcgtctgga cctggctggc cgggacctga   ctgactacct   catgaagatc   ctcaccgagc
              661 gcggctacag cttcaccacc acggccgagc   gggaaatcgt   gcgtgacatt   aaggagaagc
              721 tgtgctacgt cgccctggac ttcgagcaag   agatggccac   ggctgcttcc   agctcctccc
              781 tggagaagag ctacgagctg cctgacggcc   aggtcatcac   cattggcaat   gagcggttcc
              841 gctgccctga ggcactcttc cagccttcct   tcctgggcat   ggagtcctgt   ggcatccacg
              901 aaactacctt caactccatc atgaagtgtg   acgtggacat   ccgcaaagac   ctgtacgcca
              961 acacagtgct gtctggcggc accaccatgt   accctggcat   tgccgacagg   atgcagaagg
             1021 agatcactgc cctggcaccc agcacaatga   agatcaagat   cattgctcct   cctgagcgca
             1081 agtactccgt gtggatcggc ggctccatcc   tggcctcgct   gtccaccttc   cagcagatgt
             1141 ggatcagcaa gcaggagtat gacgagtccg   gcccctccat   cgtccaccgc   aaatgcttct
             1201 aggcggacta tgacttagtt gcgttacacc   ctttcttgac   aaaacctaac   ttgcgcagaa
             1261 aacaagatga gattggcatg gctttatttg   ttttttttgt   tttgttttgg   tttttttttt
             1321 ttttttggct tgactcagga tttaaaaact   ggaacggtga   aggtgacagc   agtcggttgg
             1381 agcgagcatc ccccaaagtt cacaatgtgg   ccgaggactt   tgattgcaca   ttgttgtttt
             1441 tttaatagtc attccaaata tgagatgcgt   tgttacagga   agtcccttgc   catcctaaaa
             1501 gccaccccac ttctctctaa ggagaatggc   ccagtcctct   cccaagtcca   cacaggggag
             1561 gtgatagcat tgctttcgtg taaattatgt   aatgcaaaat   ttttttaatc   ttcgccttaa
             1621 tactttttta ttttgtttta ttttgaatga   tgagccttcg   tgccccccct   tccccctttt
             1681 ttgtccccca acttgagatg tatgaaggct   tttggtctcc   ctgggagtgg   gtggaggcag
            1741 ccagggctta cctgtacact g      1761
Validate ‘Hits’ with qPCR




                                         Individual Targets
                             6
                                                                                   Cofilin
Normalized Fold Expression




                                                                         Annexin
                                                                         Cofilin
                             5
                                                                         CAPZB
                                                                                   ~1.5 fold increase
                                                                         Destrin
                             4
                                                                                   Destrin
                             3                                                     ~2 fold increase
                             2                                                     Annexin A3
                             1                                                     ~5 fold increase

                             0
                                 Anti-eGFP   Anti-actin    Lipid     (-) Control
                                                                                   CAPZB
                                  GFP 48      Act 9 48    Lipid 48   Negative 48
                                                                                   ~2 fold increase
                                                    Condition
 Duplexes >30 are Less Potent



                                        RNAi Activity
                                                                             Dicer substrate
                           120
                                                                    50 pM     24hr in vitro
                                                                    100 pM
                           100
                                                                    200 pM
                           80                                       1 nM
                EGFP (%)




                           60


                           40


                           20


                            0
                                 27+0   30+0   35+0   40+0   45+0




Data Courtesy Integrated DNA Technologies
  27mers have longer duration of silencing




                           120

                           100
                EGFP (%)




                           80                                       21+2
                           60                                       27+0

                           40

                           20

                            0
                                 0     2     4    6     8      10

                                     Days after Transfection




Data Courtesy Integrated DNA Technologies
   End modification with FAM interferes with Dicing and
  reduces potency. 3’-end is more sensitive than 5’-end.



                                                              - Dicer                     +Dicer


                       S
                                    1
                       AS

                                    2
                                                        1 2       3   4       5   1       2   3       4   5
                                    3
                                                       100

                                    4                   90
                                                        80
                                            EGFP (%)    70
                                    5                   60
                                                       50
                                                       40
                                                       30
                                                       20
                                                       10
                                                        0
                                                              1           2           3           4       5
                                                                      F-RNA Duplex, 200 pM




Data Courtesy Integrated DNA Technologies
siLentMer Dicer Substrate design




• Blunt ends are unpredictable.




• 3’-overhang is a “start point” and
directs cleavage 21 bases away; it
“attracts” Dicer and encourages
binding/cleavage.


• 3’-DNA is a “repellant” which                                                                                  s
encourages Dicer to bind the other
end.                                                                                                            AS



Rose, S.D., Kim, D.-H., Amarzguioui, M., Heidel, J.D., Collingwood, M.A., Davis, M.E., Rossi, J.J., and Behlke, M.A. (2005)
Functional polarity is introduced by Dicer processing of short substrate RNAs. Nucleic Acids Res., 33:4140-4156.
siLentMer Dicer Substrate design


 Asymmetric Design: results in a
                                 single21mer product


                                      Sense

                                   Anti sense




Rose, S.D., Kim, D.-H., Amarzguioui, M., Heidel, J.D., Collingwood, M.A., Davis, M.E., Rossi, J.J., and Behlke, M.A. (2005)
Functional polarity is introduced by Dicer processing of short substrate RNAs. Nucleic Acids Res., 33:4140-4156.
 EGFPS2
 “R” 27-mer vs. “L” 27-mer


                                                              120
21-mer
5’   GCAGCACGACUUCUUCAAGUU                                    100                                         1 nM
3’ UUCGUCGUGCUGAAGAAGUUC                                                                                  2.5 nM




                                            % EGFP Activity
                                                               80                                         5 nM
27-mer + 0                                                                                                10 nM
                                                               60
5’ AAGCAGCACGACUUCUUCAAGUCCGCC
3’ UUCGUCGUGCUGAAGAAGUUCAGGCGG                                 40

                                                               20
27-mer
                                                                0
“L” v2.1
                                                                    Control   21+2    27+0    27 L v2.1   27 R v2.1
5’ CAUGAAGCAGCACGACUUCUUCAAGUC
                                                                                     EGFPS2
3’ gtACUUCGUCGUGCUGAAGAAGUUC

27-mer
“R” v2.1                                          “R” > “L” – even though dicing
5’     GCAGCACGACUUCUUCAAGUCCGcc
3’ UUCGUCGUGCUGAAGAAGUUCAGGCGG                      results in the same 21-mer



Data Courtesy Integrated DNA Technologies
Transfection Protocol

Final Protocol

Day 1: Seed 0.675x106 HeLa cells in 10ml of media on a 100mm plate

Day 2: Transfection.
Prepare siRNA complexes with siLentFect and incubate 20 min.
Add complexes to culture.

Day 3: 24h post transfection
Change media to remove complexes, and add 10 ml of fresh media

Day 4: 48h post transfection
Remove media, wash cells with PBS.
Add 1ml of Laemmli buffer per plate.
Collect the extract into eppendorf tubes.
Boil for 3min, and keep it at -200C
Spot #2: Close-up



                      Control




                      Anti-actin


  Spot #2 Profile
  pI: ~8
  Mass: ~18,000 kDa
Key considerations when designing RNAi experiments
siLentMer sequence homology




             Distribution of siLentMers along the mRNA sequence

                                               siLentMer #
                8          4             6       7 59        1               3      2
        5’          300           600           900          1200            1500
       UTR                 Translated region                        3’ UTR
   1     41                                           1167                          1761




                          <10%
                          10-20%        Remaining expression
                                        after transfection with 10nM
                          20-40%
                                        Anti b-Actin siLentMer
                          >40%
Selecting your transfection
method
 • Lipid reagents –most common approach;
   low cost, simple, good for high throughput                  siLentFect™




 • Electroporation – option for difficult to                    Gene Pulser® Xcell
   transfect cell lines




 •Biolistics –excellent for plant, and in vivo
  applications                                   Helios® Gene Gun   PDS-1000/He™
Measure transfection efficiency


                Microscopy
                 HeLa Cells


                                     Flow cytometry
    Light
 Microscope


                                  0.99%

   Nuclear
    Stain


                                  96.06%

 Fluorescent
Non-silencing
  siLentMer
RT-qPCR to determine gene
expression level
                                 siLentMer against BRCA1




                                                            BRCA1
                                          NC                siLentMer
                                       ct = 25.28           Ct = 30.75




                          Delta ct = 25.28 – 30.75 = -5.5
   % gene silencing in cells transfected with BRCA1 siLentMer = 1 – [1 x (2-5.5)] = 97.74
    Exogenous initiators of RNAi




Routs to activation of RNAi include short hairpin RNAs (shRNAs) synthetic small
inhibitory RNAs (siRNAs), and longer dsRNA that require Dicer.



                                           shRNAs, stems and loops can vary in
                                           length and can have a variety of end structures



                                        siRNAs, 20-22 bases long with 3’ overhangs



                                            Dicer substrates, 23 bases and longer
                                            Can have a variety of end structures
27-mers have Greater Silencing Longevity



                                Control     21+2   27+0



                    Day 3




                    Day 6




                    Day 9




Data Courtesy Integrated DNA Technologies
         siLentMer Dicer-Substrate Technology



                              Key publications
Kim, D.-H., Behlke, M.A., Rose, S.D., Chang, M.-S., Choi, S., and Rossi, J.J. (2005)
Synthetic dsRNA dicer substrates enhance RNAi potency and efficacy. Nature
Biotechnology, 23:222-226.

Rose, S.D., Kim, D.-H., Amarzguioui, M., Heidel, J.D., Collingwood, M.A., Davis,
M.E., Rossi, J.J., and Behlke, M.A. (2005) Functional polarity is introduced by
Dicer processing of short substrate RNAs. Nucleic Acids Res., 33:4140-4156.
dsRNA concentration and quality




     High concentrations of dsRNA transfected into the cell can lead
     to off target effects and interferon induction.
               Use the lowest concentration of dsRNA necessary to
               achieve desired gene silencing.


     Make sure dsRNA is of high quality to avoid toxicity associated
     with contamination.
             If possible HPLC purify the RNA before use.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:16
posted:9/6/2012
language:English
pages:77