The Human Genome Project

Document Sample
The Human Genome Project Powered By Docstoc
					The Human Genome Project
     at UC Santa Cruz
    Phoenix Eagleshadow

      November 9, 2004
       The Human Genome Project
             Began in 1990
• The Mission of the HGP: The quest to
  understand the human genome and the
  role it plays in both health and disease.
“The true payoff from the
HGP will be the ability to
better diagnose, treat, and
prevent disease.”
--- Francis Collins, Director of the HGP
and the National Human Genome
Research Institute (NHGRI)
The genome is our Genetic Blueprint

• Nearly every human
  cell contains 23 pairs
  of chromosomes
  – 1 - 22 and XY or XX
     • XY = Male
     • XX = Female

• Length of chr 1-22, X,
  Y together is ~3.2
  billion bases (about 2
  meters diploid)
         The Genome is
     Who We Are on the inside!
• Chromosomes                 Information coded
                              in DNA
  consist of DNA
  – molecular strings of A,
    C, G, & T
  – base pairs, A-T, C-G
• Genes
  – DNA sequences that
    encode proteins
  – less than 3% of
    human genome
 5000 bases per page
CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCC
AAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATC
AGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAA
CTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCC
CTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAAT
GAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTT
CTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGT
CATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAA
ATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGA
TTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACC
AGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCT
AAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCT
CAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAG
AACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATAT
TTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAAT
TAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAA
TTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTG
TCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTAC
ATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCT
ATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCC
ATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGG
TACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCA
TTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTC
ATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAA
CATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAG
AACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATG
CTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACT
GGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTT
CATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTC
TGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATA
TCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGG
GGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAA
CTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTT
TTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGA
TTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTT
ATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGT
ATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAA
GAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTG
TATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT
TGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCT
TTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTG
GCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT
      How much data make up the
          human genome?
• 3 pallets with 40 boxes per pallet x 5000
  pages per box x 5000 bases per page =
  3,000,000,000 bases!
• To get accurate
  sequence requires
  6-fold coverage.
• Now: Shred 18 pallets
  and reassemble.
    The Beginning of the Project
• Most the first 10 years of the project were
  spent improving the technology to
  sequence and analyze DNA.
• Scientists all around the world worked to
  make detailed maps of our chromosomes
  and sequence model organisms, like
  worm, fruit fly, and mouse.
  UC Santa Cruz gets Involved
Because of the work Professor David
Haussler was doing in the field of
computational biology, UC Santa Cruz
was invited to participate in the HGP in
late of 1999.


 Computational biology (or
 Bioinformatics) is a research
 field that uses computers to
 help solve biological problems
The Tech Awards honors the UCSC Genome Bioinformatics Group in 2003!
           The Challenges were
              Overwhelming
• First there was the
  Assembly
 The DNA sequence is so long that
 no technology can read it all at
 once, so it was broken into
 pieces.
 There were millions of clones
 (small sequence fragments).
  The assembly process included
 finding where the pieces
 overlapped in order to put the
 draft together.
             3,200,000 piece puzzle
    The “Working Draft” of the
         human genome
ACCTTGG
CCTGAAT
CTAGGCT    Freeze of sequence data     Clone layouts generated
TTGCATC      generated by NCBI        By Washington University
CCTAGTC
CTGATCG


sequence                                                         Clone
                     Assembly generated by                       maps

                            UCSC



                         Working draft assembly
  UCSC put the human
genome sequence on the
   web July 7, 2000      Cyber geeks
                         Searched
                         for hidden
                         Messages,
                         and
                         “GATTACA”

  UCSC put the
 human genome
sequence on CD in
October 2000, with
  varying results
       The Completion of the Human
            Genome Sequence
• June 2000 White House
  announcement that the majority
  of the human genome (80%)
  had been sequenced (working
  draft).
• Working draft made available
  on the web July 2000 at
  genome.ucsc.edu.
• Publication of 90 percent of the
  sequence in the February 2001
  issue of the journal Nature.
• Completion of 99.99% of the
  genome as finished sequence on
  July 2003.
     The Project is not Done…
• Next there is the Annotation:
 The sequence is like a topographical map,
 the annotation would include cities, towns,
 schools, libraries and coffee shops!
  So, where are the genes?
 How do genes work?
 And, how do scientists use
 this information for scientific
 understanding and to
 benefit us?
     What do genes do anyway?
• We only have ~27,000 genes, so that means that
  each gene has to do a lot.
• Genes make proteins that make up nearly all we
  are (muscles, hair, eyes).
• Almost everything that happens in our bodies
  happens because of proteins (walking, digestion,
  fighting disease).
           OR
                                     OR


 Eye Color and Hair Color
 are determined by genes
    Of Mice and Men:
   It’s all in the genes
Humans and Mice have about the same
number of genes. But we are so different
from each other, how is this possible?
           Did you say
            cheese?

                          Mmm,
                         Cheese!



One human gene can make many different
proteins while a mouse gene can only
make a few!
         Genes are important
• By selecting different pieces of a gene, your
  body can make many kinds of proteins. (This
  process is called alternative splicing.)
• If a gene is “expressed” that means it is turned
  on and it will make proteins.
     What we’ve learned from our
          genome so far…
• There are a relatively small number of human
  genes, less than 30,000, but they have a complex
  architecture that we are only beginning to
  understand and appreciate.
       -We know where 85% of genes are in the
  sequence.
        -We don’t know where the other 15% are
  because we haven’t seen them “on” (they may only
  be expressed during fetal development).
        -We only know what about 20% of our genes
  do so far.
• So it is relatively easy to locate genes in the
  genome, but it is hard to figure out what they
  do.
    How do scientists find genes?
   • The genome is so large that useful
     information is hard to find.
   • Researchers at UCSC decided to make a
     computational microscope to help
     scientists search the genome.
   • Just as you would use “google” to find
     something on the internet, researchers
     can use the “UCSC Genome Browser”
     to find information in the human genome.
Explore it at http://genome.ucsc.edu
The UCSC Genome Browser
The browser takes you from
early maps of the genome . . .
. . . to a multi-resolution view . . .
. . . at the gene cluster level . . .
. . . the single gene level . . .
. . . the single exon level . . .
. . . and at the single base level




  caggcggactcagtggatctggccagctgtgacttgacaag
  caggcggactcagtggatctagccagctgtgacttgacaag
         The Continuing Project
• Finding the complete set of genes and annotating
  the entire sequence. Annotation is like detailing;
  scientists annotate sequence by listing what has
  been learn experimentally and computationally
  about its function.
• Proteomics is studying the structure and function
  of groups of proteins. Proteins are really important,
  but we don’t really understand how they work.
• Comparative Genomics is the process of
  comparing different genomes in order to better
  understand what they do and how they work. Like
  comparing humans, chimpanzees, and mice that
  are all mammals but all very different.
  Who works on this stuff anyway?
• Biologists and Chemists understand the
  physical sciences-they take biology and
  chemistry classes.
• Computer Scientists program the computers
  (the same people who make video games!)-they
  take math and computer classes.
• Computer Engineers try to build better, faster,
  smarter computers-they take math, physics and
  computer classes.
• Social Scientists try to understand how this new
  information and technology will impact our lives-
  they take sociology and philosophy classes.
      UCSC Summer Workshop on
       Human Genome Research
• Held annually in July
• It’s a free event for
  students and teachers
• Workshops by faculty and
  researchers on a wide
  array of topics
• Tours of our laboratories
  and kilocluster
• Free breakfast and lunch
• Travel funds are available
• RSVP: 831-459-1702 or
  phoenix@soe.ucsc.edu
 How can I work on this project, or
       something like it?
• Read about it, online at www.genome.gov,
  or in Nature, Science, or other scientific
  magazines.
• Take classes in biology, chemistry, math,
  physics and English classes at high school.
• OR take classes at your local community
  college or University-Extension in biology,
  bioinformatics, or genetics.
• Go to college and get a degree in science,
  engineering, math, or social sciences.
Bioinformatics Opportunities
                                 Director/Professor -
Bioinformatics         PhD
                                 University
Biochemistry                     Company
Biology                          National Laboratory
                                 Research Foundation
Computer Science
Computer Engineering
                                 Research Staff -
Mathematics            MS (MA)   Company/University
Ocean Sciences                   National Laboratory
Physics                          Research Foundation
                                 Teaching -
(Education, Sociology,           Community College
Philosophy,                      Public Schools
Psychology,
Community Studies)     BS (BA)   Entry-Level -
                                 Company
A research degree in             National Laboratory
any of these majors              Teaching –
will take you far!               Private Schools
Thank you for letting us come
 talk to you today and share
          what we do!
                            Come to
               Bye!        UCSC, Slugs
                            are cool!

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:6
posted:9/3/2012
language:Latin
pages:32