Mutations Worksheet - Download as PDF by Gallows

VIEWS: 248 PAGES: 2

									                                     Mutations Worksheet
                                             Activities One and Two

Activity One: What is a Mutation?
  1.   Go to learn.genetics.utah.edu/archive/mutations/index.html
  2.   Read this page.
  3.   Click on the “Mutate a DNA Sequence Activity” (yellow box; upper right)
  4.   Read the yellow boxes to the right and define the following terms:

       Point mutation:



       Missense Mutation:



       Nonsense Mutation:



       Silent Mutation:



       Frameshift mutation (insertion/deletion):



  5. Transcribe and translate the gene below. Use the genetic code I gave you. DO NOT USE THE
     GENETIC CODE ON THE WEBSITE! Use the definitions above to help you with the questions below.

       DNA SEQUENCE               GCATACGCTGCGAAAGTTTGGCTGACTGGGCAATTG

       RNA TRANSCIPT             ______ ______ ______ ______ ______ ______ ______ ______

  a. What is the amino acid sequence encoded by the DNA sequence? (assume this is in the middle of a gene)

       _______ - _______ - _______ - _______ - _______ - _______ - _______

  b.   What does a missense mutation look like? How does it change the amino acid sequence?



  c.   What does a nonsense mutation look like? How does it change the amino acid sequence?



  d.   How do frameshift mutations change the amino acid sequence?
  e.     Notice how a single amino acid can be encoded by a number of different codons. What are some
        examples of silent mutations in the DNA sequence?



Activity Two: The Mighty Mutation Maker
   1.   Go to www.nature.ca/genome/04/0413_e.cfm#010
   2.   Read the introductory paragraph (starts with “Turn your name into a DNA sequence”).
   3.   Enter your name and click the “DECODE” button.
   4.   Write down your DNA “codon” sequence.

What is your name code for? ___________________________________________________

   5. For each mutation at the left, see how it affects your “protein”. Report the codon changes.
      Make sure you click the “DECODE” button in between each mutation to reset your name.

Missense: ____________________________________________________________________

Nonsense: ____________________________________________________________________

Silent: _______________________________________________________________________

Insertion: _____________________________________________________________________

Deletion: _____________________________________________________________________

   6. Summarize the explanation given in the “What Happened?” box in one-two sentences for each.

Missense: ____________________________________________________________________

_____________________________________________________________________________

Nonsense: ____________________________________________________________________

_____________________________________________________________________________

Silent: _______________________________________________________________________

_____________________________________________________________________________

Insertion: _____________________________________________________________________

_____________________________________________________________________________

Deletion: _____________________________________________________________________

_____________________________________________________________________________



                                                       Homework

Complete any activity you were unable to finish in class today. Complete a Clock Question 10 about the topic of mutation.

								
To top