Learning Center
Plans & pricing Sign in
Sign Out



									Additional file 6. Candidate QTN examined for an association with carcass weight
                           SNP       SNP                    Reference
                           position  position    PhastCons allele on
Name                  BTA (Btau40)   (UMD3.0) score         Btau4.0     Q allele
PhastCons_SNP1          14 22822729 24627194 0.952756 C                 C
MOS_e1                  14 23189480 24977053               0G           G
FJX_250879              14 23215765 25003338 0.897638 C                 C
PLAPROTRI               14 23264810 25052396 0.992126 (CCG)11           (CCG)11
PLAPROSNP               14 23264854 25052440 0.992126 G                 G
SDR16C5_e1              14 23329947 25117469               0A           G
SDR16C6_3UTR            14 23365698 25153852 0.0227244 TTA              TTA
PENK_e3                 14 23430793 25218997 0.992126 G                 G
PhastCons_SNP4          14 23476203 25263876 0.968504 G                 A
PhastCons_SNP5          14 23476204 25263877 0.968504 A                 G
PhastCons_SNP6          14 23506780 25294447 0.991134 G                 T
                     Amino acid
q allele   Gene      change       Forward primer
T                                 GGCTGAGAGCAGCACAAACT
C          MOS       5'-UTR       GCGAGGGCATCTCTCCTG
G                                 ATGGGATCACCACAGACCAT
(CCG)9                            TGGAAATTGTTTCCTTACGC
A                                 TTCCAGCAGCCATTGTAGTG
---        SDR16C6   3'-UTR       GGTCATCCAGCTCCAGTAGG
A          PENK      synonymous GGGGCTTCAGGTCACTGAT
G                                 GCTGTGGATCTATTATTGAGTTAGGA
A                                 The same as above
G                                 AAGGCCCAAAGAAATGTTCC
Reverse primer            Comment
TCTTAACACTTGGGCTTGACG     PCR was performed using GC buffer II
CAATCGGAGCGCGAGGCT        (Takara, Japan).
The same as above

To top