1471-2156-13-40-s6 by lanyuehua


									Additional file 6. Candidate QTN examined for an association with carcass weight
                           SNP       SNP                    Reference
                           position  position    PhastCons allele on
Name                  BTA (Btau40)   (UMD3.0) score         Btau4.0     Q allele
PhastCons_SNP1          14 22822729 24627194 0.952756 C                 C
MOS_e1                  14 23189480 24977053               0G           G
FJX_250879              14 23215765 25003338 0.897638 C                 C
PLAPROTRI               14 23264810 25052396 0.992126 (CCG)11           (CCG)11
PLAPROSNP               14 23264854 25052440 0.992126 G                 G
SDR16C5_e1              14 23329947 25117469               0A           G
SDR16C6_3UTR            14 23365698 25153852 0.0227244 TTA              TTA
PENK_e3                 14 23430793 25218997 0.992126 G                 G
PhastCons_SNP4          14 23476203 25263876 0.968504 G                 A
PhastCons_SNP5          14 23476204 25263877 0.968504 A                 G
PhastCons_SNP6          14 23506780 25294447 0.991134 G                 T
                     Amino acid
q allele   Gene      change       Forward primer
T                                 GGCTGAGAGCAGCACAAACT
C          MOS       5'-UTR       GCGAGGGCATCTCTCCTG
G                                 ATGGGATCACCACAGACCAT
(CCG)9                            TGGAAATTGTTTCCTTACGC
A                                 TTCCAGCAGCCATTGTAGTG
---        SDR16C6   3'-UTR       GGTCATCCAGCTCCAGTAGG
A          PENK      synonymous GGGGCTTCAGGTCACTGAT
G                                 GCTGTGGATCTATTATTGAGTTAGGA
A                                 The same as above
G                                 AAGGCCCAAAGAAATGTTCC
Reverse primer            Comment
TCTTAACACTTGGGCTTGACG     PCR was performed using GC buffer II
CAATCGGAGCGCGAGGCT        (Takara, Japan).
The same as above

To top