Learning Center
Plans & pricing Sign in
Sign Out



									supported by :


                                     Brassica Microsatellite Information Exchange

                                     prepared by Charlotte Allender, HRI, Wellesbourne; Jan 2003

v1.1         Summary of microsatellites described in Kresovich et al (1995) and Szewc-McFadden et al (1996).

             In total, 24 microsatellites are described in these two papers, all were originally isolated from B. napus .


             Kresovich, S., A. K. Szewc-McFadden, S. M. Bliek and J. R. McFerson (1995). Abundance and characterisation of s
             Szewc-McFadden AK; Kresovich S; Bliek SM; Mitchell SE; McFerson JR (1996) Identification of polymorphic, cons

c-McFadden et al (1996).

isolated from B. napus .

 Abundance and characterisation of simple-sequence repeats (SSRs) isolated from a size-fractionated genomic library of Brassica napu s L.
6) Identification of polymorphic, conserved simple sequence repeats (SSRs) in cultivated Brassica species. Theoretical and Applied Genetics
enomic library of Brassica napu s L. (rapeseed). Theoretical and Applied Genetics 91: 206-211.
es. Theoretical and Applied Genetics 93 : 534-538
Name     Reference                Forward primer
BN6A2    Kresovich et al (1995)   CTTTGTGTGGACTTTTAGAACTTTA
BN6A3    Kresovich et al (1995)   GCTACCCACTCATGTCCTCTG
BN9A     Kresovich et al (1995)   GAGCCATCCCTAGCAAACAAG
BN16A    Kresovich et al (1995)   CGACCGTGGAAGCAAGTGAG
BN18A1   Kresovich et al (1995)   TCAATCCCACCAACCAGACAAA
BN20A    Kresovich et al (1995)   GACAATCAATCCCACCAACCAG
BN25A    Kresovich et al (1995)      CACGTGGTATGTTGGTATTGGG
BN12A    Szewc-McFadden et al (1996) GCCGTTCTAGGGTTTGTGGGA
BN19A    Szewc-McFadden et al (1996) CACAGCTCACACCAAACAAACCTAC
BN25C2   Szewc-McFadden et al (1996) AAACCTCCTCAAAAACCCCTAAACG
BN26A    Szewc-McFadden et al (1996) TAAACTTGTCAGACGCCGTTATC
BN27B2   Szewc-McFadden et al (1996) CCGGATCCAAGCTTATCGACA
BN34B1   Szewc-McFadden et al (1996) GACGAAAATCAATGGGAGGAAAAA
BN35D    Szewc-McFadden et al (1996) GCAGAAGGAGGAGAAGAGTTGG
BN38A    Szewc-McFadden et al (1996) TGGTAACTGGTAACCGACGAAAATC
BN40C1   Szewc-McFadden et al (1996) CCCCTCTTTGATTCTCCTCCGA
BN50F    Szewc-McFadden et al (1996) CGTTGAAGCATCTCTGTATCTCTCC
BN59A1   Szewc-McFadden et al (1996) TGGCTCGAATCAACGGAC
BN68/1   Szewc-McFadden et al (1996) TCGCATGCTCCTCTAGACTCG
BN72A    Szewc-McFadden et al (1996) GCCCACCCACCTTCTTGTCCT
BN75A    Szewc-McFadden et al (1996) ACCCCGGGTTCGAAATCG
BN80/3   Szewc-McFadden et al (1996) GACCCTTGTTTGAGCTGCCTCCTA
BN83B1   Szewc-McFadden et al (1996) GCCTTTCTTCACAACTGATAGCTAA
BN92A1   Szewc-McFadden et al (1996) ACCGCCCGTGACCAAA
Reverse primer             Repeat         Genbank Accession Number
CGCAGCTTTTGGCCCACCTG       (GATT)4        not given
CGTGGAAGCAAGTGAGATGAT      (GA)27         not given
CCATGATTACGCCAAGCTATTTA    (CT)28         not given
TAAGACAGGTAAGGTTTGGCCC     (CT)15         not given
TAAAAGAAGAGTGCCAATCCCAT    (GA)28         not given
TGATTCTCCTCCGACGCATGC      (CT)10         not given
CCCCGGGTTCGAAATCG          (GA)8          not given
CCCGTAAATCAAGCAAATGG      (GA)13          not given
TCCGGFATCCAAGCTTATCGAAA  (GT)11(AAG)3     not given                  Error in original paper (F?)
TTGAGCCGTAAAGTTGFTCACCT    (GA)13         not given                  Error in original paper (F?)
ACGCTGTCTTCAGGTCCCACTC     (TG)11         not given
TTTCTCTCCGCACCAAAACAC      (GA)10         not given
CAATCCCACCAACCAGACAACC     (GA)14         not given
TCAGGTGCCTCGTTGAGTTC       (GA)11(AAG)4   not given
CCCACCCCGTTAACATATAAGTC    (A)28          not given
Error in original paper (F?)
Error in original paper (F?)

To top