Bordetella_pertussis_genelist by dandanhuanghuang

VIEWS: 4 PAGES: 287

									plate   well   oligo_id      oligo_sequence                      gene_id
1       A01
1       A03    BP0001-771                                         BP0001
                             TGGCGGTCTGGACCGTTCGCCCATGTACAGTGGGGTCATCGAAGGAGTGGG
1       A05    BP0002-421                                         BP0002
                             CATACCCGTATCGAACAGCTCGAACCGGCGCAATGCGACGTGGTGATATCGC
1       A07    BP0003-416                                         BP0003
                             CGCTGCTTACCCTTAACGGGCTGGCTGCCGCGCACGGCGTCATCATTCCGA
1       A09    BP0004-171                                         BP0004
                             CAATGTACTCGGGTTATCCACACGTCCGCTCGATGAGCGGCTGGCGTACTGT
1       A11    BP0005-806                                         BP0005
                             CGCTGAAGGTCGGGGCGCGTGAAAAAGGCCAGATCGTGATCGATTTCCATG
1       A13    BP0007-601                                         BP0007
                             TACATTCCGACGCCGGAGCGCGCGGTCGACGGTGCGTTCCTGATGCCGGTG
1       A15    BP0008-221                                         BP0008
                             CGTACAACGAAGTCAAGCGAGTCTCGTGGCCCACGCGCAAAGAGACGATCC
1       A17    BP0009-81                                          BP0009
                             GCGCGCGGAGCTGCAGACGTCTTTTGGCCGCATTCTTGTTCCCTCCGAAGAA
1       A19    BP0010-201                                         BP0010
                             CACCTTCATCATGAAGACCCCGCCCGCGACGGTCCTCATCAAGAAGGCGTCC
1       A21    BP0011-451                                         BP0011
                             ACCGCCGTGAAGAACGCCAAGGCCGGTCAGATCCAATACCGTACCGACAAG
1       A23    BP0013-146                                         BP0013
                             GCGTTTACCTGCGTGTTCTGAAGAACACGCTGGTCCGTCGTGCGGTTGCTGG
1       C01    BP0014-51                                          BP0014
                             GCTCGAGCTGTCCGAGCTGATCAAGGAAATGGAAGAAAAGTTTGGCGTGTCG
1       C03    BP0015-61                                          BP0015
                             GTTCAAAACGTTCCCTTCCTGTTGGCGACACAGCTTCAATCCTACCTAACTTT
1       C05    BP0016-2151                                        BP0016
                             ATCGTTCAACTCGATCTACATGATGGCCGACTCGGGCGCCCGTGGTTCGGC
1       C07    BP0017-246                                         BP0017
                             GGCATTCAGCTACTGCGTGAGCAATTACACCCAGCTGTGCGAAGACGCATTC
1       C09    BP0018-1021                                        BP0018
                             ACGGTACGCATCAACGTGCAGCCGTGGGGCGAGATCTGGATCAATGGCGTG
1       C11    BP0020-86                                          BP0020
                             TGGGAGAGAATTTTCTTTACCGAGTGCGTTCTGGCGACACGCTTATAGCGTT
1       C13    BP0022-46                                          BP0022
                             GCTTTCCCTTTTGAGCGCCTGAAAGCCGGCCGCGAACCCGCGGACTGGCAG
1       C15    BP0023-786                                         BP0023
                             GTGGGCTTACGCTCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATG
1       C17    BP0025-256                                         BP0025
                             TGGGCCTCTATCGTTCCCTATACCGTGGGTTTCGTCGAAATGGACGAAGGGT
1       C19    BP0026-681                                         BP0026
                             GGTCACATCGGTCGACAACGCAAGGACAGCGCAAGATCCGGTCTATGTAATG
1       C21    BP0027-186                                         BP0027
                             GGTGCAAGGGTCGTTGACGTACTCGATCGTTACCGGATTGATTCAGTTCGGC
1       C23    BP0028-71                                          BP0028
                             CGGCACTGCGTGAGAACATTGCGCCGTCGGCTGCGACAAAACGCATCCAGG
1       E01    BP0029-581                                         BP0029
                             TCGCGATTGCCGCGAAGCTGGCGCGGGGCAGCCAGACAGCCATCCGCGCG
1       E03    BP0030-816                                         BP0030
                             CTTCCAGGTCGCGACCGTCTGGCTCAAGGCCTATTGCGCCTGCTACTGCACG
1       E05    BP0032-701                                         BP0032
                             AGGTGGTGATCCCGCTGTGGGCCGACCACCTGGGCGTCAACCCGGCGACC
1       E07    BP0033-611                                         BP0033
                             CCTACAACTTCGAGCACGCGTCGGCCGACATGCTGTTTGCGCACTTCAACGA
1       E09    BP0034-841                                         BP0034
                             GAACAGTTCCTGCAAGTGCCGCAGGAGTGCCTGATCCTGACCATGCGGCTG
1       E11    BP0035-41                                          BP0035
                             AGGACAGCGATGCCTTCGTCAAATCGCCGGACGAATGGATCGCGCTGCCTG
1       E13    BP0036-591                                         BP0036
                             CCCCGGCCTGATTACCGTCTCGATCGGCCCCGCGATAGAATCGCAGGACGT
1       E15    BP0037-746                                         BP0037
                             ATTACGTCATCGCCCACGAACTGGCCCATCTGCGCGAGATGAACCACAGCCA
1       E17    BP0038-41                                          BP0038
                             ATAAATCCATCGATTTCTATACCAGCGTGCTGGGCATGCGCGAACTGCGCCG
1       E19    BP0039-416                                         BP0039
                             TGCAGCACGAATGCGACCACCTCATCGGCCGGCTCTACCCCACCCGTATCC
1       E21    BP0043-1                                           BP0043
                             ATGATTTCAACGCTGTTTCGTTTCATGCTCAAGAAACGCGTGCGGATCCTGTG
1       E23    BP0044-76                                          BP0044
                             GAAACCGCCCGCATCCTGGGCATCGCCGCGCGCACGGTCGATTTCCACCTG
1       G01    BP0045-56                                          BP0045
                             TGGCATGCGCGGGAATCGGCGCCTATTGGGCCAAGCGCGATTACCCCTTCG
1       G03    BP0047-176                                         BP0047
                             CCTACGGCACGCTCAATGCGCAGCGCACCAACGCGGTTCTGGTCTGCCACG
1       G05    BP0048-176                                         BP0048
                             ACAACTACGTGATCGCCTGCGTGCAGCGCGGCGTCGAGGTCATCCAGCAGA
1       G07    BP0049-481                                         BP0049
                             GTTGAGGGGGCCGGCTGGGACTTCGTCTTCGTGGCCATAGATGACCACGCC
1       G09    BP0050-91                                          BP0050
                             GTCTCGTTGCAGAGCATAGGCTTCCTGACGCTGGCCGGCACCGCCTATACG
1       G11    BP0053-261                                         BP0053
                             GATCGCCATCCCCTGCAATACCGCTCACGTCTGGTATCCGCAACTGGCGCAA
1   G13   BP0055-386                                         BP0055
                        AGACCTCGGCCGCCTACGCCATCGGGCTCAATTACTGGCAGACGATGGCTT
1   G15   BP0056-666                                         BP0056
                        CGGCGCGACGCTTTGCTACTTCCTGCTCAACCTGATCGTGCTGCGCGCAATG
1   G17   BP0057-111                                         BP0057
                        CGGGCATCGCGACGCCTCCATCCCGTTTTCGTACCTGGACGACAAGCAGAA
1   G19   BP0060-1011                                        BP0060
                        TCGCCGCGAGAGCAAGACATGGTTGACGGAGGATTCCGGGCCGATTGAGAG
1   G21   BP0061-106                                         BP0061
                        CGCCGTGTGCGTCGCTTGAGCCAGGAAGACTTGGCGCAGCGTGTTGGCACT
1   G23   BP0062-516                                         BP0062
                        ACAGGTAAGAGGGTTGCTGTGCTATGGTTTCCCATTTGTGGGTTTAGTACAT
1   I01   BP0063-586                                         BP0063
                        GGCATTTCGTATGATGATGTAGGTTGGTTTGGCTTGTTTGCTCCAGCAGGCC
1   I03   BP0064-351                                         BP0064
                        CTGCCACGGCATTCAAATTCTCAGTACTGCGGGTGTGTTGGAAGGGTATAAA
1   I05   BP0065-156                                         BP0065
                        GTTCAAGAAAACAAAATTGATATGTACCAAGCATCTCTGGCAGTGGGATCTTG
1   I07   BP0066-756                                         BP0066
                        TGTTCGAGACACATCGCCCATCGACCTTATCGGAGTGTTCAATCGATATGCG
1   I09   BP0067-66                                          BP0067
                        TTCGTTAAAGAACTATACATTCCTGGCAGTACCTTTATTTATTGCTACGGGGG
1   I11   BP0069-561                                         BP0069
                        AGCGGATATCACATCGCCCGATGCACTCAACGGCGCCAAGATCCGAATTACG
1   I13   BP0072-61                                          BP0072
                        GTGCTGGACATCATCCAGGGCAAGACCACCGTGGCCGAAGCGAGCCGTCAA
1   I15   BP0074-1266                                        BP0074
                        GACGGTGTCGTTCGCGGATTATGTGGGCCGCATGAAGGATGGCCAGGACAA
1   I17   BP0075-281                                         BP0075
                        ACCGCTGGATGGACTGGCAGACCACCGAATGGCAACCCAGCATGCTGGCCG
1   I19   BP0076-301                                         BP0076
                        GCCTGGCACGCCGGCGTATCCCGCTTCAGGGGCCGCGACAACTGCAACGAC
1   I21   BP0077-1                                           BP0077
                        GTGGGCAAGCTGATCTTCTGGTTCGTCGTCATTCTGGCCGTGCTGTTCATCG
1   I23   BP0078-641                                         BP0078
                        CCGGCAAATTCCTGCCGTTCGACCACAAGACCATCTTCACGCTGCTGTCCTG
1   K01   BP0079-511                                         BP0079
                        GATTTTCTGCCGTCGGACGTTAGCCAGAAGCCGGAAGACATCGCCCGCAAC
1   K03   BP0082-1081                                        BP0082
                        CACGGCGTACAGACCATTTATCACGCCGCCGCGTACAAGCACGTGCCCATCG
1   K05   BP0085-476                                         BP0085
                        TGGTGTTTCACGAGTATCGAAGTACGATTTCGCAACTGTCAGGATTGATCAAC
1   K07   BP0086-366                                         BP0086
                        CGACATTTACGAGTTTCCGAACTCCAGTACCTGGCACAAGGCATTGCTGCAG
1   K09   BP0087-481                                         BP0087
                        CGCGAAATCATTCTTCCGGAAAAATTGCGTATCCAGGCCGAATATGTCCAAAC
1   K11   BP0088-1061                                        BP0088
                        TGCCGTTGCACCTGCAGCCCTATTGGCGCGACCGATATGGCCTGACGCCTG
1   K13   BP0089-51                                          BP0089
                        GGAGTTCCGGCCGTATTACTTCGGCCGCGAATGGATCGGGCATGGGCATCA
1   K15   BP0090-821                                         BP0090
                        TGGAGAAATACGCCGCCCTCATCGCCACCGACTCCGGCGGCGTGCAGAAGG
1   K17   BP0091-721                                         BP0091
                        CTGGAGCGTTTCGATTGGGAAATCGCCCAACGCATCAAGATCGGCGCGCGC
1   K19   BP0092-196                                         BP0092
                        GACAACGTTTTCCTGGAGGACGACGTGTTCTGCGGTCCGAGCATGGTGTTCA
1   K21   BP0093-856                                         BP0093
                        ATCCGCGAAGCCAATTACGAAACCACGTCGGTCTACGGTTTCGGGCACCCGC
1   K23   BP0094-46                                          BP0094
                        TTGGTGCATATGCTGCCTGCTATTTCCGATATCGCCCGATACGTTCCCGATAC
1   M01   BP0095-306                                         BP0095
                        GATCGGACGCGGGCAATTGCAGCAAGCCTGGCTGCCCTACGATTTTCCTGG
1   M03   BP0096-86                                          BP0096
                        ACGAAGGACGCGACGCCGCTCGCCTGAACCAGGAAATGAAGGCCGACCAGG
1   M05   BP0097-381                                         BP0097
                        CAGTTTCGGCACGGCCACCACGCTGGACACCATCGGGCCCGACAATGTCTT
1   M07   BP0098-796                                         BP0098
                        TTGCTGGTGCAGGCTGCCGATGGAATGCGGCCCGTCTCCGTCGGCGAAATT
1   M09   BP0099-1006                                        BP0099
                        CTGTGCATCCAGCCCAATACCGAAAGCCTGGGGCGCGGCACCACCACGTCG
1   M11   BP0100-711                                         BP0100
                        CGTCTGCGATACCGTGCGGGAAGTGCTCAAGGTCGATCATCCTTTCATCCGC
1   M13   BP0101A-166                                        BP0101A
                        CCGTATCTGTCCGATACCGGCGTGATCTGGCGGGTGGGCGACAGCGCCAGC
1   M15   BP0101B-416                                        BP0101B
                        TGATGCTGATGGGGCCGGCGGTCAACCGTTTCGAGCGTTCGGCCACCGAGG
1   M17   BP0102-691                                         BP0102
                        CACTACTACAAGCAGAAAAGCTACACGTACAACAAGATCACCCAGCCCAACC
1   M19   BP0103-141                                         BP0103
                        TGGTATCTATGAAGTCGTGCCGGTCTATGACGGCAAGGTGTTCCGCATGACC
1   M21   BP0104-46                                          BP0104
                        GACTTCCCCATCAAGGTAATGGGCAAGCAGCATCCGGAATTCGCCCAGACCC
1   M23   BP0105-231                                         BP0105
                        GGTACTCGCCTACACCTTGTTCGACCTGCGCCGCGCCGGGCTGTACGTGCG
1   O01   BP0106-286                                         BP0106
                        ACGGCCACCTTCATGATCATGGGCGACAAGTGCACGCGCCGTTGCCCGTTC
1   O03   BP0107-356                                         BP0107
                        GCTTCCTGGCGTTGTCCGACGATACCGAGTGCCTGTACAAGGCCACCGACT
1   O05   BP0108-411                                         BP0108
                        CAGCGGCTGCCCGCACCTGATACTGCGCACCAGCTGGGTCTACGCCAGCCA
1   O07   BP0109-496                                         BP0109
                        AGCGACCACATGGTGCGCTCGTACCGCCACACCTACGGGCTGCCCGCCATC
1   O09   BP0110-881                                         BP0110
                        GCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACAAATACAACCT
1   O11   BP0112-236                                         BP0112
                        AGGAGCTGGAAGCCGGCACGCACTGCTACCTGGCGTCTTCGGGCATGGGCG
1   O13   BP0113-91                                          BP0113
                        CAGCAGTACGTGAACATCAACCCGCCGATGCCGTCCGACACCCCGGGCAAG
1   O15   BP0114-566                                         BP0114
                        TCAACGGCGTACAGGTCAACCGGGTGCGCGTCGGTCCATTCGGACGCCTGG
1   O17   BP0115-1071                                        BP0115
                        CGTGCCCGACGTGGCCTATCACAAGGTCAAGTGGGAGCGCGGCTTTCACCA
1   O19   BP0116-266                                         BP0116
                        ATCCGATCGAGCTCGCCGTGGGCCTGCACCAGCGCGCCTTTCCGCTGCTGG
1   O21   BP0117-46                                         BP0117
                        CGCAGCGAAGTGACCGTTGTTTTCGATGCCCGCCGCACCGTCGACCTGAGC
1   O23   BP0118-61                                         BP0118
                        GTATCAAAGGCCAAGCTGGATTGCACGTTGCTGACGGCTGAGGCTGACAAG
1   A02
1   A04   BP0119-511                                        BP0119
                        CAAGTGCTCATGAAAGTCTATGTGCCGCTGGCGCGTCCCATCTACGTGGCCT
1   A06   BP0120-351                                        BP0120
                        GGTGGCCAATATCTGGCTGTTCTTCTACACGCCGCAGTACGGACTGATTGCG
1   A08   BP0121-766                                        BP0121
                        ACCATCGACTGGGGCACCACGCCCAAGGACTTCCTCGAGAAGAAAGCCGCC
1   A10   BP0122-496                                        BP0122
                        GCACAGCTGCGCCATGACATGCGGCGCGAAATCCGCGCGCTGCAGCAGGAG
1   A12   BP0123-691                                        BP0123
                        TTCGTCATGGAACCGCCCGGCTTTCACCTGCACGAATGGCGCGATGGCGCG
1   A14   BP0126-411                                        BP0126
                        CATCTGGTTCATCGTGATCGGCCACGTGCTTTTCACGCTGCCCTTCATGGTG
1   A16   BP0128-301                                        BP0128
                        AAGCCGGCGCATTGGGACGCAATCCCCGACGGCATGAAGGATCCCGACGGC
1   A18   BP0130-221                                        BP0130
                        TGAAGGATATGTTCGACACAGCCGATCTGCCCACCGCCTATGGGTCCGGCAT
1   A20   BP0131-1021                                       BP0131
                        CACCAGGACGCCATCAAGAAGGGCTTCGCGCAACAGCAGGCCGACGCTCCC
1   A22   BP0132-211                                        BP0132
                        GACATGCTGACCCGCGTCAACCCCTACTTCTGGTGGGGCGTGGTGGCGATC
1   A24   BP0133-1141                                       BP0133
                        AAGTACATGCTCACACCGTTCGGTACGCTGGAGCTCAAGCGCTTCTTTGGCG
1   C02   BP0134-96                                         BP0134
                        CGATCTCCAGTTCGAACTGGGCGTGGCCACGTGCTGCGGCTGCTGCGCGGC
1   C04   BP0135-46                                         BP0135
                        CATTTTCCGGAGCGAACCGCCGTGGACCTGGACCTGCTGCACAGCTTTGTTT
1   C06   BP0139-1366                                       BP0139
                        AACCAGGGCGCCGACTACGGCAACATCCTGATCGGCATCCAGGTTCCGCCC
1   C08   BP0141-2601                                       BP0141
                        GGTCGAAGCCTTCCTGTACGAAGAGCAGACCCGCCGCGGCATCAGCCTGAA
1   C10   BP0142-311                                        BP0142
                        CTGAAATCCGGCAGGTCTACATGCTGTACGCCGAACTGGAGGCCTACAGCAT
1   C12   BP0143-156                                        BP0143
                        CCTGAAGAACGCGCACGGCGAGGAAACCACCGATGCCGCCTACTTCCTCAG
1   C14   BP0144-816                                        BP0144
                        GCTTTTCGCCGCACGGCTGGATGCCGCCGATGCCGCCATCGCGGAACTCGC
1   C16   BP0145-676                                        BP0145
                        GAAATGCAGGGCTTGCGCAGCGCGATCGACGCGCACTTCGACACGCACCAG
1   C18   BP0148-696                                        BP0148
                        TCCCGACATCCAGACCACCGTCGAAGTCGGCTCGAAGAACTCGGGCATGCC
1   C20   BP0149-646                                        BP0149
                        CCGTACCGGCCGTCGTCCGGCGGCGAGCTCTATGTATTCAACTGCGTGCTC
1   C22   BP0151-611                                        BP0151
                        CCTCGCGCCAGGCCTTGCTGGACCAGGCCTTCCGTATCGGTGCGCAATCCG
1   C24   BP0152-426                                        BP0152
                        CATGGTCTACATGCTGGGCTTCGCGCCGGGCCATTCCTATATCGGCGTGCAC
1   E02   BP0153-321                                        BP0153
                        CCGCTTCAAGGGCGAGGTGGGCGAGCAGGCCACCATGTTCTTCCTCGATCC
1   E04   BP0154-71                                         BP0154
                        TCGGCCTGACGCAGTCGGCCGTCAGCGCACAGATCAAGCGCCTGGAAGAAC
1   E06   BP0155-936                                        BP0155
                        CTTCCTGCAAGCAGGCACCACCAAGAGCGCCGTCAATTTCCCCGAGCTGTCG
1   E08   BP0156-116                                        BP0156
                        GCTGCTGCGAAGACTGGCTGCAGCACCTGCGCAGCAACGGCTTCGAAGTCC
1   E10   BP0157-96                                         BP0157
                        CTGGACGCTGAAACAGGAAGTGCAGCGCCAGGAAATCACCGAGGCGCGCGG
1   E12   BP0158-41                                         BP0158
                        ACTATCTGCACAAGGGCCTGTCCGAGCAAAGCCATATCGTCGACGTCGCGCG
1   E14   BP0159-541                                        BP0159
                        GGCTACGCCAGCAACCAGCGCCTGCTGATTTCCCGCGATGTCACCCAGATC
1   E16   BP0160-461                                        BP0160
                        CCATCGGGCCCACCGAGTTCCGCCTGCTGCACTTCTTCATGACCCACCCGG
1   E18   BP0161-561                                        BP0161
                        GGCCTACGACTGGTATTCCTTCAATGTGCTGCCCTGGATGGGCAAGAAGGTC
1   E20   BP0162-76                                         BP0162
                        TCGTTTGACGCGGAGGCCCGCCGCATGGGCGGTGGCTCCAGCTTTGGCCG
1   E22   BP0163-521                                        BP0163
                        TTTCCGAATACCTGGCCGAGGAAAGCGCGGTGCTGGTGGGCCGGCCGCAAT
1   E24   BP0164-981                                        BP0164
                        GCAGAATTTCCTGGCCTTTTTCCACCGCGACTATCGCCGCGTGGCCCAGCTG
1   G02   BP0168-251                                        BP0168
                        CGGAAACCATCGAGCAGTACGCCACGCGCGCCTTCGAGAAGTGGAAGATAG
1   G04   BP0169-441                                        BP0169
                        CGAGCGCTATGTGCGCTCGGTGCAGGCCTATAACGTGCTGGTGCGGCAGTT
1   G06   BP0170-936                                        BP0170
                        CCTGGACATCGACCAACTGCCGCAAGTGGTCAACTTCGAACTGCCCAACGTC
1   G08   BP0171-311                                        BP0171
                        ATCCGCATCGCGCCTCGATTCGCGAACTGGTGGGCCGCGGCTTCCTGATCA
1   G10   BP0172-1171                                       BP0172
                        TTTACCGGACTGCCGTTCTTCGCCCCGGAACTGTTCCAGGCGGTGGAAGTCA
1   G12   BP0173-556                                        BP0173
                        GAACTGGCCCACTGCGCCACGCAGGGCTTTTTCGAGCGCCCCAGTTGCTCC
1   G14   BP0174-66                                         BP0174
                        CAACCAATATTTCCTGCATGCCCGCATGCTGCGCCACTGGGGCTTCAACAAA
1   G16   BP0177-211                                        BP0177
                        AACGGCGAGCCGATCTTCCTGACCTTTTTCGCGCAGGGCAAGCAGTACCGG
1   G18   BP0178-646                                        BP0178
                        TGGTACGGGGACATCACCGGTTTCGCCTTCCAGCCCGGCATCGAATACCGG
1   G20   BP0179-221                                        BP0179
                        CCAAGTACAGCGAATCCGCGCGCATGCCGTTTCGCAAGCTGCTGGTCAAGG
1   G22   BP0180-456                                        BP0180
                        CGGCGATTCGTGTGAAGTGTGCGGCGCCGTGTATGCGCCCACCGAGCTGAT
1   G24   BP0181-61                                         BP0181
                        GGGATGATGATGGCCCTGGTGTTCATGGCCTCCACGGCCATCGCGGTGGGC
1   I02   BP0182-46                                         BP0182
                        GTTGCCGATCCGCAGACCGGCCTGGAGCTGAATGTTTGTGTAAAAGATCGTG
1   I04   BP0183-651                                        BP0183
                        CCGCTATGTGAAGTATTCCGAGGGCGCGGCCTACGACCAGGACAAACTCGA
1   I06   BP0184-2921                                        BP0184
                        CCCAAGGCGACGGTCCGCCGCTGCAGATCGACATGAACCTCAAGGTCGACA
1   I08   BP0185-286                                         BP0185
                        TACTTCCGCATCCCGCGCAGCGTGCTGACGATCTGCCTGGGCAAGAGCACC
1   I10   BP0186-136                                         BP0186
                        ATCGTGCATGCCCAGCTGACGCTGGGCAGCGGCATGATCATGCTGGCGTCG
1   I12   BP0187-326                                         BP0187
                        GCATCGCGCATCTGTCCGACCCCTACGGCAACGGCGTGTGCATCCTGCAGT
1   I14   BP0189-51                                          BP0189
                        GTTCGGTTTCCGCAGGAAAGACACGCAGCAGTACGACCAGGAGGCGCAGGA
1   I16   BP0190-686                                         BP0190
                        TCCATGCCGACCACTGCTTCTTCGTCACCAACGGCACCTCGACGTCGAACAA
1   I18   BP0191-261                                         BP0191
                        GGATTTCCTCGGCCTGTTGCGCCGCCATCGGGTGCATTGGCATGAAAAGCA
1   I20   BP0193-56                                          BP0193
                        TCGATGCACGCACGATGGAAATACACCATACGCGCCATCACCAGACCTACGT
1   I22   BP0194-746                                         BP0194
                        GGCTGGGTTTCGCGGCCGGCGCCATGCTGTTCGTCATCAGCCACGAGATCA
1   I24   BP0195-706                                         BP0195
                        GCGGGCATGAATCTCTACGGCCAGGACATGGACGAACTCGTCCATCCCGAC
1   K02   BP0196-241                                         BP0196
                        GACGAACTCGAAGCCAACCCCAGCCTGATCAACGAATCGGCCTATACCGCCT
1   K04   BP0197-1891                                        BP0197
                        AGGATCGCGCAAGTGGGCGAACGCCTGGCGGCGCTGATGATCACCTATCCC
1   K06   BP0198-466                                         BP0198
                        GATCTCAACGTGCGCTGGTACTTCGCGCTGGCCGACGCCTGCCACAACGAC
1   K08   BP0199-601                                         BP0199
                        GTCACCGTGGACGCCTCGCTGTTCGATACCGCGCTCGGTTTCATGGGCTAC
1   K10   BP0200-276                                         BP0200
                        GTCGAACTCCACGTTGTCGGCCGCGCCGTTCCTGTTCAAGAAGCTGCCGTAC
1   K12   BP0204-426                                         BP0204
                        CTTCCGCCTGAGCCGCACGGCCCTCAATCCCAAGGACTACAAGGTGCCGTC
1   K14   BP0205-341                                         BP0205
                        ATGACATCAGCAGCAAGAATATCGGCAATATGCTGGCATTGGTGATCGATCG
1   K16   BP0206-1701                                        BP0206
                        GTTCCACGACGAGACCCTGCCCAAGGACTCGATGAAAGTGGCGCACTTCTG
1   K18   BP0207-1201                                        BP0207
                        GATACGGAGTTCGGGTTGTCGTCGGGCATCGTCACCACCTCGCTGCGGCAC
1   K20   BP0208-776                                         BP0208
                        ATTGCCTGGACCTGGTGCTCACGCATGTCGACGGCTTGCACGAGCCGTTCG
1   K22   BP0209-446                                         BP0209
                        CCATCGCCACGGCGACCGCCAATCCCTATTACCTGCAGTTGCTGCAATACCT
1   K24   BP0212-336                                         BP0212
                        CCTTTGGTTCGCGGAGATGGCGGGGGATCGTATCGGCCGCATCACGATCGA
1   M02   BP0213-216                                         BP0213
                        CTACGCCTACGCCACGCCATACCGGCCGCGCCCGGCCTACCGCCATACGGT
1   M04   BP0214-396                                         BP0214
                        GTGCGAAACCGATTTTTCCGGGTACCCGGACTGCCGCGACGACACCATCAAG
1   M06   BP0215-76                                          BP0215
                        GGCGCCCCGACGGATCCCTTTCAGATGAACGCAATCCGCCAGCAGTCCGAC
1   M08   BP0216-941                                         BP0216
                        CCGCCGTACTGGTGCAGGATCGCTTTCGCTGGATGGACAACGACAACCTGC
1   M10   BP0217-691                                         BP0217
                        CAGCGCGACATGAATGGCATCGACGTGCACTACGCGATCGCCAGCTATCTCT
1   M12   BP0218-1236                                        BP0218
                        GGCGCTGTCGAAGCTGAAACTGCGCGACGTGATGGGCTATACCGTCATCAT
1   M14   BP0219-526                                         BP0219
                        ACCGAGCTGTTTCGCAACAGCAACCCCGAAGGCGCGCCGCGCACGCAGCGC
1   M16   BP0220-741                                         BP0220
                        GAACGTCAGCGGCCATGCCAACCGGTACTCGCGCGAAGAGATGCTGCAGGC
1   M18   BP0221-191                                         BP0221
                        CGCTGCTGGGCGCCGGGCGGGTGCGCAAGATCATCTGCTCGTTTCCGCGCC
1   M20   BP0222-426                                         BP0222
                        CTTCGTCATGATGGAACTGCAGACCCGCGACGGCCAGAGCAAGCTGGTGCA
1   M22   BP0223-146                                         BP0223
                        GCTACGCCAACGTCAGCATCTTCGACGCCGCCGACAACGACGAGCTGCACC
1   M24   BP0224-56                                          BP0224
                        AGCACCGCAATGCGCACCTGCAGTTCCTCGACCAGCACAAGCACCTGCTGC
1   O02   BP0225-666                                         BP0225
                        GCTGGCCGCCGCCATCCCCGGCGCGCGCTATGTCGAGCTCGACACCTCGCA
1   O04   BP0226-276                                         BP0226
                        CGACGCGGTCGATGTGCTCAGCGACGACCAGGTGCTGCTATCGATGCAGTA
1   O06   BP0227-61                                          BP0227
                        GCCGCCTGGGCCCAGGCCTCGGCCAGCAAGGAACTGACGCCACAGCAAAAA
1   O08   BP0229-426                                         BP0229
                        CATCAATCTGTCGTCGGTCTATGGCGCGGGAGCCGCGGCCAACCGGGTCGG
1   O10   BP0231-86                                          BP0231
                        ATAAATCGCTCAATAGCGCCGATGACCTCACGGCTTCCCTGCAGAAGCTGGT
1   O12   BP0233-46                                          BP0233
                        GCGCCAGAAGGTGAATTCAAGGTCCAGCGTGTCGCTTCCGTACTGCGCCAT
1   O14   BP0234-911                                         BP0234
                        CTAAACTAATGCAGCAGCAATATATCGGTCCTTCCTACGAGGCGTGGAACAA
1   O16   BP0235-176                                         BP0235
                        CGATGTGCTATGAGATCTTCTCGCGCTACCTCTTCAACGCGCCCACGGCATG
1   O18   BP0237-561                                         BP0237
                        GTTCATGGACCTGATCAGCGGTGAAGTGGACCTGATGATCGACAACCCGGC
1   O20   BP0238-271                                         BP0238
                        CCCTACCGCAATGCGCCGCGCACCCTGGACCTGGACCTGCTGCTGTATGGC
1   O22   BP0239-71                                          BP0239
                        TCGGCGCGGAACGCCATGGCATCGATCGCCGCAATGTCTCGCGCCACGCCA
1   O24   BP0240-531                                         BP0240
                        TTTCGCCGAGTCGTACTTCTACAGCGATTCGGTCAACGATGTTCCCTTGCTG
1   B02
1   B04   BP0241-536                                        BP0241
                        TGGCGCCCGAGGTCATCAACTGGATGCTCACCCACCACGAACGCGACATCC
1   B06   BP0242-806                                        BP0242
                        CCGCGCAATTGCAGCGCGACGGCTGGGAAATGCCCAAGCTGTTCCAGTGGC
1   B08   BP0243-716                                        BP0243
                        GGCTGCCGTCGGTGCGCTGCGTCGGTTACCGGCAGATGTGGTCGTACCTGG
1   B10   BP0244-746                                        BP0244
                        AGTACCTGTACGTCAATGGCCGCTTCGTGCGCGACCGCACCGTCAGCCATG
1   B12   BP0245-256                                        BP0245
                        ACGATAGGGCGCTACATCGGGCCGCGCGTGTTCTCGATGAACCTGCGCTTC
1   B14   BP0246-1101                                       BP0246
                        GACGGCCTTCATCAGCAATCCGAAGGAAGAAGCCCTGCTGCGCAGCGCGGC
1   B16   BP0247-196                                        BP0247
                        GGCCGGATCAAGAGTCCCAGCTACGCGCTGCTTGAATCCTATAAAGTTTCTA
1   B18   BP0248-371                                        BP0248
                        GCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAACG
1   B20   BP0249-46                                         BP0249
                        CTGTCAATTTTCCTTCCAGGTTCCATGTCGGTTGCCCTGCTGGTTTTGCCCG
1   B22   BP0250-391                                        BP0250
                        GTCGTGGCGGTCAATCCCAAGTTTCCCGCCAAGGATTTCAAGGGCTTCCTGG
1   B24   BP0251-76                                         BP0251
                        CATATTTCTCAGCCCGCGGCCAGCAAGCTGCTGGCGCACGCCGAGGCCCAG
1   D02   BP0252-1291                                       BP0252
                        ATCTTCGTGCGCGGTTTCCTGCTCAACAACGAGATGACGGACTTCTCGTCCT
1   D04   BP0253-596                                        BP0253
                        AGTTCCTGGACATCACGCTGTACGACTGCGCGCTGTCGCTGCTGCATCCGC
1   D06   BP0254-326                                        BP0254
                        AGAACTACGACCCGCGCACCAGCTTCGCGCCCATCGTGCGCATCGGCCACC
1   D08   BP0258-261                                        BP0258
                        GGATGTTTGGGAAATTTTCCGCATCCTGATGGAAGAGAAGCGCAAGCGCGAA
1   D10   BP0259-861                                        BP0259
                        GATCGCCATTCCCAACCAGGAAGAGCGCAGGAACGAGTTCGCGATTTCCATT
1   D12   BP0260-456                                        BP0260
                        CGGCTTCGACGCGGCGACGCTGCGGCCCGAATACGAAGGCCACTTCTACCA
1   D14   BP0261-41                                         BP0261
                        GTGCGTTCGGCATCCTGAATGCGATGTGGTTCGAGTTGCGCGAAGGCCATG
1   D16   BP0262-851                                        BP0262
                        CCTACCTGGGCTTTCTCGATGTGCGGGCATCGGTGCTGACCTTGCAGGGCG
1   D18   BP0263-161                                        BP0263
                        TGTTCAATCTGTTCGTGCCGTCGTCGCTGGTGCGCGGCCTGTCGTTCATCCG
1   D20   BP0264-271                                        BP0264
                        TACCGTACCGTGGCCGAGGAATATTCGCTGGAATATGGCAATGCCGCGGTC
1   D22   BP0266-1                                          BP0266
                        ATGAAACGCCACGCCCTGGCCACTGCACTCATGGTTTCCGTTACGCTGGCGG
1   D24   BP0270-41                                         BP0270
                        TCACCCGTAAGAAGCGCCGCCAGGCACAGGCCAAGGTGCTGAAGGCGCTGG
1   F02   BP0271-56                                         BP0271
                        GGATGATCTATCTGCCCGAGGCGAAGGCGGGTGCCAGGGAGCAACCCATTA
1   F04   BP0273-46                                         BP0273
                        GAGTGGTGCACGGACAACGGCTACACGCCGTACATCACCGTGCAGGTCGAC
1   F06   BP0274-91                                         BP0274
                        GACATCGACCTGTACAACAAACCCGAAGACATTTCGGTCATGAACCCGTACG
1   F08   BP0275-716                                        BP0275
                        CGTTCATGTCCTGGATGGCCGAACCGGTCCAGCTGTACCGCAAGCAGCTTG
1   F10   BP0276-81                                         BP0276
                        GGCGCATCTGTCCGAGTACTACGCCCCGAAGAATTTCAATTTCTGGTATTTCT
1   F12   BP0277-366                                        BP0277
                        CGAGTACCGCTCGCGCAAACCCGAGCTCTTTGTCTGTGTCGGCATCTGCACG
1   F14   BP0278-121                                        BP0278
                        GTCAAGGATGTGGTGATGCCCCTGGTCAACTTCATCCTGGGTGGCTCGGTC
1   F16   BP0279-61                                         BP0279
                        CGATTCAAGGACTATTGTCCCAACGGGCTGCAGGTCGAAGGCAAGGCCGAG
1   F18   BP0280-561                                        BP0280
                        GGGCATCGTGTCGGCGCTGGGGCGCAATGGCCTGGGTATCAATACCTATGA
1   F20   BP0282-481                                        BP0282
                        CCCATCGCCCGGCTCGAAGGCAAGGTGAAACTGAACCAGGACAAATCCCCG
1   F22   BP0283-236                                        BP0283
                        CGGACGTGCCGCTGTGCCGGGTGGTCGATGCCGAATTGAACCTCGGCATGG
1   F24   BP0284-1301                                       BP0284
                        TGTACCTGTCGAGCAACCGCGTCAAGGGCACGCCGTTCGGCAACAACCAGG
1   H02   BP0285-616                                        BP0285
                        ACCGTCAAGTACGGCGGCGGCGAATACCTGCTGTCGACCCAGCAGATGGTG
1   H04   BP0286-456                                        BP0286
                        CCATATCCGGGCCTTGATCCTCGACGAGATGCGCCATGTGTGCGCGGCTCC
1   H06   BP0287-141                                        BP0287
                        GATAGAACCCATGGACGGCGCCCGCAAGCTGCGCCTGTTCGAACAGCTGGT
1   H08   BP0288-216                                        BP0288
                        AATATGGCTGCCGGCGGGCATGGCGCACAGCATCCGCATGCATGGCCAGCC
1   H10   BP0289-1481                                       BP0289
                        AGATGCTCTATCCCACGTCCTACCTGAAGTCCAAGGGGCTGGGCAAGACTTG
1   H12   BP0290-631                                        BP0290
                        GGCTTTGGCGGCGTATTCACCACCTTCACCTACATCGCGCCCATCCTCACCG
1   H14   BP0291-331                                        BP0291
                        CACGTCGAGGAATTCAGCCGCCGCTATCCGGAAATCCAGCTGGAGCTCACC
1   H16   BP0294-111                                        BP0294
                        CAAGTCGTTCCATATCCGCGAAGACTATGCGCCCGAATTGCGGGGCCTGGC
1   H18   BP0296-141                                        BP0296
                        CGAAGTGGTTGGAATGGCAAAAACCTGCCATTCGATTCGAGAACTTAGGGAT
1   H20   BP0298-441                                        BP0298
                        CTGGTCGGTCACGCTTGACGGCAACCAGCGCATCGACGGCTGGCTGTGCTC
1   H22   BP0299-261                                        BP0299
                        CGAAAAGGAAGGGCTGGTGGTGCGCACCAAGGTGGAGAGCGACCGGCGCA
1   H24   BP0300-46                                         BP0300
                        CAATACAACGCACGCGCGACAGTACCCGACATCCAGCCGATTCTCAAGCGCT
1   J02   BP0301-336                                        BP0301
                        GATCCCCTACCTGTCTAACAACCCCGGCCCCAGCCAGTACGCGGGCGCGCA
1   J04   BP0302-311                                        BP0302
                        TCCTGATCGCCAATGACCTGGTCAAGATGATCTGGGGGCCGGCGCCCGTCA
1   J06   BP0303-421                                        BP0303
                        AACCTGTCGGGCTATTCCACGCTTCCCGGGCTGGACCTGGCCAATGACCTG
1   J08   BP0304-226                                        BP0304
                        CTCAATGCGCACCAGCGCGTGGCCGCCGGGCTGTCGCGCTCGTACCAGATC
1   J10   BP0305-506                                        BP0305
                        TCCGTGAGGAAATCTGGACCTGCCTGGCGCGGCTGCGCGAAGCCGGCCAG
1   J12   BP0309-546                                        BP0309
                        CGCCAGCGAGCTGCTGTACACCGGCCGCGCCATGAATGCCGACGAGGGCC
1   J14   BP0310-286                                        BP0310
                        TTCGCGTTCGCCATGCAGGGGCTGGGCAGCGGCGCCATTTCGCTGATGGGT
1   J16   BP0311-886                                        BP0311
                        ATCTCGTTCACCGCGCCGACCTTCTATCGCCAGATGGCCGCGCTCGCGCCC
1   J18   BP0312-91                                         BP0312
                        ATCAATGACTTTGTCGAAGAGTGGTTCGACAAGGGCATGGGCCTGCCGTTTC
1   J20   BP0313-251                                        BP0313
                        AGGCGGAGTACGTGGCGTCCTATCCGGAAATCGGCAAGCACTATCGCGAGC
1   J22   BP0314-126                                        BP0314
                        GGCGCGCGGATGGCCGGCCACGGTGCTCGACCAGATCAGCGCCATCGTGT
1   J24   BP0315-1121                                       BP0315
                        ACACCGAGGCCTTCAAGCGCTTCTTCCATGCCATGCTGGAGCGCGGCATCC
1   L02   BP0316-181                                        BP0316
                        TGCCGCGAGCTGGGCGTGGTGTTCCTGGTCAACGATCACTGGAAACTGGCC
1   L04   BP0317-196                                        BP0317
                        GAAGAAGTCCACCCGGTGGCCCCCGAATTGCTCGACGACCAGGCACGCTGC
1   L06   BP0318-41                                         BP0318
                        ACGAAGAGGCTGGCCTGCCCGATGAAGGAATTGCCCCCGGCACCCGCTGGG
1   L08   BP0319-451                                        BP0319
                        CAGCTGGAAAGCGAAATGGCGCAGAACTCCTGGCTGAGCGTGGGCGCCGAC
1   L10   BP0320-51                                         BP0320
                        CATTGCCATCGGCAATACCCTGACCCGCCAGGCGCGCCCGCTGGAAATCAT
1   L12   BP0321-461                                        BP0321
                        ACACCATCCGTCACCACAAGGGCGATTTCAACCAGCTGACGGTGGCCATCGT
1   L14   BP0322-776                                        BP0322
                        CCCACCAGATCCACCTGACCGATGTGGACATCGGCTTTTTCGACAGCCGCTT
1   L16   BP0323-326                                        BP0323
                        CGGGTACCTTGTTCATCGACCGGACGCAGCGCCACGCGGTGCATGCCATGG
1   L18   BP0324-521                                        BP0324
                        TGCGCGTCATCATCAATGCCCTGACCCGCATCCGCCTGTGCACCCCGTCCG
1   L20   BP0325-311                                        BP0325
                        TCATTACCATTCCGCTGATGATAGGCGCGACGCTGCTGTCCGAATTCGTCAC
1   L22   BP0326-146                                        BP0326
                        AGTACCAGTGGGTGCCCTACGACCGCATCAGCAATACGCTCAAGCAGGCGG
1   L24   BP0328-46                                         BP0328
                        GTCGAAGGACGCGAACAGGAGTTCGACGACTGGTACATGAATACCCACATGC
1   N02   BP0329-646                                        BP0329
                        CACTTCTGGGGCGAGCAGAACATCCGCTACCGCCACTTCCTGCCTGGCGAG
1   N04   BP0330-536                                        BP0330
                        TGGCGACCGCGCTCAAGAACGCCACCGGGGCGCGGCTGAACATCGTGCCC
1   N06   BP0331-216                                        BP0331
                        GTATTCGTACAGCGTGATGCGCGCCGCGCCGCAGCCCTATGCCATTGCCTA
1   N08   BP0332-431                                        BP0332
                        AGGCGCCTTATCGCTGGACGGTGGCAGGCATCTACGGCAATTTCGCGCGCC
1   N10   BP0333-621                                        BP0333
                        CCATATGTGCCACTACGTCTCGGGCACCGCCCCCAGCAAGACCTTCGCCGC
1   N12   BP0334-146                                        BP0334
                        GCACCGGCGACGTCATCGCCAGGCTGGTCGCGAAGAAACTGGGCGAGCAAT
1   N14   BP0337-171                                        BP0337
                        CGTGCTGGGCGCCAATTACCGCCAGGTGTTCCCGGCCGGCGATCACACGCA
1   N16   BP0338-536                                        BP0338
                        TGTGGATCGTCAGCGTGCAATTGCCGCTCTACCTGGCCAGCATGACGGTGG
1   N18   BP0339-46                                         BP0339
                        CAGGAGCGCATCATGCAATTCTTTCAGGCCCAACTCGAATCGCCCCTCGGCG
1   N20   BP0340-356                                        BP0340
                        GCCTGGTCAACCGCTATGCGCCCGGCGCGCGCATGTCGCTGCACCAGGACA
1   N22   BP0341-391                                        BP0341
                        CTGCTGCTCAAGTATGGGCCGGGCGATTACAACTGCCTGCACCAGGACCTG
1   N24   BP0342-306                                        BP0342
                        CCGCGTTGCCGTGCTCAAGGAGGGCAGCCCGTCGTGCGGCAGCGGGTACA
1   P02   BP0343-446                                        BP0343
                        TGCTGGCGCAGTGCCATGCCATGCACGCGCCCGGCCAGACCCGCTACCTGA
1   P04   BP0344-421                                        BP0344
                        AGCGTGATCGGCCTGCTGACCTTCATGGCCTCGGACGCGCAACTGCGCGAC
1   P06   BP0345-116                                        BP0345
                        TTACCGAAATCGTCTATGCGCTGGGCCAGGGCGGCCGCCTGGTCGGCGACG
1   P08   BP0346-831                                        BP0346
                        CCCGCGCTTCAACCTGCACCTGAACACCGAGACCGTCGATTCGGCCTGGGT
1   P10   BP0347-1806                                       BP0347
                        GTACACCAACTACGGCGGCCCGGGAACCTATCTGCGCGTGGGCAATCCCTC
1   P12   BP0348-816                                        BP0348
                        CGACATCCTGCGCGCCCTGCCGGCGCTGCTGCCGGTGCAACTGTCCTATGT
1   P14   BP0349-46                                         BP0349
                        TACCGCGAACATCACGGCTGGCTGCAAAGCTGGCTGCGCAAGAAGCTGAAT
1   P16   BP0350-56                                         BP0350
                        AACTGCGCCGCACGATCCCGCTGTTTCCGTTCACGCTGGCCGAACTGCTGG
1   P18   BP0351-91                                         BP0351
                        CAGTTTCCCTATCCGAACCTGCGCTACCAGTGCGGGATGGGCAAGTGCGCC
1   P20   BP0352-166                                        BP0352
                        CCCGGCGCGGTGGTCAACCACGTGCCTTCCAAGTTCCTGGAGAAATTCGAAT
1   P22   BP0353-106                                        BP0353
                        ATTCCCTTCAAGTGCGGCGGCGGGCTGTGCGGGACCTGCAAGTGCCTGATC
1   P24   BP0354-821                                        BP0354
                        CGGATGAAGATATCGTGATCTACAAGTCGGTGGGCGTGGGGCTGGAGGACG
1   B01
1   B03   BP0356-386                                        BP0356
                        TGCGCAAGTTCCTCGACGATGGGACCGAAGCGGCGCGCAGCGACGACCTGC
1   B05   BP0357-581                                        BP0357
                        AGTTCCTGCTCAGCGTCGGCCTGCTGCCGTTCCTGCTGCTCGGCTTCTCCTG
1   B07   BP0358-56                                         BP0358
                        TGGCCATCATTCTGACGATGGTCTTGCGGGCCAATGCCGTGGTTCCGTCGG
1   B09   BP0359-611                                        BP0359
                        AGCAGCGCTGCCTGCGGATCTGCGAAGTCGGCGCCCAGATGCGGCTGCTCT
1   B11   BP0360-1261                                       BP0360
                        ACCACCAATGCGCAGTACGCGCACCGTTTCGCGCGCGATATCCAGGCCGGC
1   B13   BP0361-61                                         BP0361
                        GCCAAGTCGGAGGAAATCGGCGTGCTGGAATCGATCTGCATCGTCGATGAC
1   B15   BP0362-821                                        BP0362
                        GCCGCAGCGGCTATGTGCAGGATGCGGTGCTGCAGGACTTCGACGACCTTT
1   B17   BP0363-246                                        BP0363
                        CATCGATCCGGCGCGCGGCGCGGGCATTGCCTTCACCGGCCCCTATGTATT
1   B19   BP0364-301                                        BP0364
                        CCGGACATGAAGTGGTTCGTCACGGCGGCCAACCGGCTTGACCATATCGAT
1   B21   BP0367-446                                        BP0367
                        TGCTGTTTCGCAGCGAACTCTACGCCAGCGTTTCGGCAGTGACCGGCGGCC
1   B23   BP0368-66                                         BP0368
                        ATTCATGCAGGCAGTCCAAGAGGTCATGCTGAGCCTCTGGCCCTTCATCGAG
1   D01   BP0369-611                                        BP0369
                        ACCAGTACACCTGGTGGAGCAATCGCGGCCAGGCCTGGGCCAAGAACGTAG
1   D03   BP0370-66                                         BP0370
                        TTTCGGCAGCTTCAAGGTCAAGTCCGGCCGTATCAGTCCCTATTTCTTCAACG
1   D05   BP0371-571                                         BP0371
                        ATGCAGGAAGGCTCGTTCCGCTGCGACGCCAACGTCTCGGTACGCCCGGTG
1   D07   BP0372-371                                         BP0372
                        AGCTGAACTGCGATGAGTTCGCCATGGGCTCGGGCAACGAGAACTCGGCCT
1   D09   BP0373-81                                          BP0373
                        CCAGGCCGAACTCAACGGCATCCTGCACCTCATCGAGCGCTTGCAGGCCGT
1   D11   BP0374-766                                         BP0374
                        GAGATCCTCGAATCGCTTACCGATCCGCTCAACCAGATCGTCTCGGCCGTCA
1   D13   BP0375-341                                         BP0375
                        GCGTGACCGACACGGTGGCGCAGTCTGCGGTGGTGGTCGAAGTGCTGTACG
1   D15   BP0376-226                                         BP0376
                        ATCGCGCTGCATCGCCGCCTGCAGCGCTTCGACCTCTGGAGCCAGGCCATG
1   D17   BP0377-1146                                        BP0377
                        GTCGTCCGATACCTATTTCTATTCGCTCGGCCCCGAGATCGGCGTGAACGCG
1   D19   BP0378-706                                         BP0378
                        GGCTTCCATACGATCCAGTCCATGATCGCGGTGGGGTCGGGCGGCCTGTAC
1   D21   BP0379-766                                         BP0379
                        CCGGAACATCCCCGCAATGGCGTGGCGACCAACAACATGTTCGCCATCCTG
1   D23   BP0380-141                                         BP0380
                        CATGCTTGCCATCCTGGCCTTCGCGGTGGTGGTGTGGATCACGGAGGCCGT
1   F01   BP0381-141                                         BP0381
                        TTTCGCCAGCAAGGCGCAGATGTTCGAAGGGCTGATCGAGTTCATCGAAACC
1   F03   BP0382-86                                          BP0382
                        GGCTGTTCGACCTCGACAACACGCTGCACGACACCTCGCACGCCATCTTCCC
1   F05   BP0383-81                                          BP0383
                        CCGACGATTCCACGGCAAGACCATCGTGGTGAAGTACGGCGGCAACGCGAT
1   F07   BP0385-291                                         BP0385
                        GTCGGTGGGCCTGGTCCATGTCGAGCCCTTTGGCGGTTATTCGAAGAAAATC
1   F09   BP0386-256                                         BP0386
                        GCGGTCGCGATGAACTACGACCCGCCCAATTACGTGCTGAACTTCGCGCAAA
1   F11   BP0387-591                                         BP0387
                        CAGCCGCGAAGAGGCCATCCGCCTGTCGGGTTCGGGAACCAAATCCGGCGA
1   F13   BP0388-371                                         BP0388
                        GCGGCAATTCGCCCAATGTGGTGCGCGCCATGGAAACCGCGCGCGAACGCG
1   F15   BP0390-626                                         BP0390
                        CGCGGCTGTTGACCGTGGCCCGCGAGTTGACCAAGCGCTTCGAGGAAATCG
1   F17   BP0391-381                                         BP0391
                        CAGGAATCCGATTTCCATCCTGATCCCCTGCCACCGCATCATCGGCCATGAC
1   F19   BP0394-131                                         BP0394
                        CGGGGCTGACCTTCGGCTTTCGCCGCACGATCCCCCACCTGCTGGGGATCT
1   F21   BP0395-321                                         BP0395
                        CTACTCGATGCTGGCGATCGATTATCGCGGCTTCGGCCAGTCGACGCCGCT
1   F23   BP0396-321                                         BP0396
                        CATCAGCTTCTGGGAAGCCTTCATGCTGGACATCGGCCTGCTGATGTTCTAC
1   H01   BP0397-131                                         BP0397
                        GCAATGAACCAGGCAATCTGTCGCAGCAGGCCGCGCATGTCGAAGAGGTGT
1   H03   BP0398-721                                         BP0398
                        CCCTGGTTCTGGCTGATGCAGGTACGCTACCCGGGCTTTTTCCAGTACTTCT
1   H05   BP0399-626                                         BP0399
                        CCCGCTTCATGAAGGGGCTGTATGCCTGGGTGGGCTTCAAGTCGCAGGCCG
1   H07   BP0402-761                                         BP0402
                        CCGGCGCGATCATCCGCAACTTCGGCGGATACGTCGGCATACGGCTGGACG
1   H09   BP0403-686                                         BP0403
                        TCGGGCGCAACGAGCAGGTGCGCGTCATTCCCCTCATTACCGGCGGCAGCG
1   H11   BP0404-1021                                        BP0404
                        TTCTGGACCTTCATCAGCGCCGGCATCGTGAACATCTTCATTCCGTCGGGCG
1   H13   BP0405-101                                         BP0405
                        TGCTGGGCATCGGCCTGATCGCCGCGCTCGCGACGATCGCCTACAAGGCAT
1   H15   BP0406-61                                          BP0406
                        ATCGTCGAAATCGGTTGCGTCGAGATCGTCAACCGGATGGTCACGGGCAAC
1   H17   BP0410-176                                         BP0410
                        ACGAAGACTACGAAAAGGCCTCGGCCGAACAGGCTGAGAAATACCTCAAGCT
1   H19   BP0411-91                                          BP0411
                        TACAAGAGCGTCATCATCAACCGGCCCGATTTCGAAGGCGGCCCCGACCAG
1   H21   BP0412-536                                         BP0412
                        TGCTCACCACCAATGGCGTGACGCATGGCCTGGACATCGTGGCGCGCCATC
1   H23   BP0414-276                                         BP0414
                        CATCGGCTTCCTGGGCGCGGGCGTCATCATCAAGCTGGGCAACGAGGGCGA
1   J01   BP0415-96                                          BP0415
                        CATATTCATCTCCATACTCACCAACAAGCTGCCGCCCCAGCACCAGACCAAG
1   J03   BP0416-701                                         BP0416
                        ACCGGCGGCCCTACGCCACCCGAAACGGCCACATCTGCGTCCTGCTCTATG
1   J05   BP0417-156                                         BP0417
                        GGTGCTGACAGGCTCGCATGGCGTGTTCTCGTCCGGCGGCAATCTCAAGAC
1   J07   BP0418-721                                         BP0418
                        AGCGGCAACAAGGGGTTCGAAGCCTATGCCTGGACCGCCGCCTTCTTTCCC
1   J09   BP0419-561                                         BP0419
                        GGCGGACGAACCGTTCATCGGCTATTCGCGCACGCACGTGCCGGGCATGCA
1   J11   BP0420-1031                                        BP0420
                        AGCCGGCGCCCGACGATGTGCTGATGCGTACGCTGGCCTACCTGACGCTGA
1   J13   BP0421-836                                         BP0421
                        ATGCGGTGCATGGCGCCATCGGTATCACCGAGGAATTGCCGCTCGGCCTGT
1   J15   BP0422-376                                         BP0422
                        CCGCATCTGATCCCCAAGGCGCGCCAGGGATATCGGCTCGGTGACGGCCAG
1   J17   BP0425-716                                         BP0425
                        CCATGGTGTACCGGCTGGAAATGGAACAGGGGCTGCTGTCGGCAACCCCTG
1   J19   BP0426-71                                          BP0426
                        GCCCCGATCTTTTCGCTCACTACTCTGAAATCCAGGGCGAAGGCCACAAAGT
1   J21   BP0427-126                                         BP0427
                        GATCCTGTCGCCTTGGCGCGTTTACCGGATATATGCTCGCCCGGGGCACCT
1   J23   BP0428-461                                         BP0428
                        CCCGGATGATCATGCATCTGCGCGCCGACATGCGGCTCTACGGCATCAATTC
1   L01   BP0429-521                                         BP0429
                        TCAACCGGCTCGACTACCGTCCGCTCGAGGGATTCGTCTATGCCGTCACCCC
1   L03   BP0430-1326                                        BP0430
                        GATACTGCGCCTCAAATCCAAGGACCTGGTCGGCTATACCGCCATGCAGTTC
1   L05   BP0431-1956                                        BP0431
                        CGCATACCCGCTGGTCATGAGCACGGCCAAGAGCGGCTGGTTCGTGCATTC
1   L07   BP0432-116                                         BP0432
                        GCCAGGAAGACGGCTCGCCGAAACAGGGGCTGCAGGAACAGGTCCGCCAG
1   L09   BP0433-771                                         BP0433
                        GATACGGCTGTTCGGCGACTGGCGGCTCGACCCCATGCCCCTGTATATCGC
1   L11   BP0435-701                                         BP0435
                        CCCGCGACGGAAACCGGGTCATGGTCGCGGCCATTTCGAAAGGGCAGTGGC
1   L13   BP0436-56                                         BP0436
                        TCAAGACCGGTGATCAGTACGCGCACTGGCCCGGCCGGACGATCACCGAGG
1   L15   BP0437-371                                        BP0437
                        TCGAGCGCGACTATCCCGGCGTGGAAGTGTTCGTGCGGGAGCTGACCTCGG
1   L17   BP0438-66                                         BP0438
                        GGCCTTGTCGGGGTTGCGGGTATTGGATATCGCAACCTTTCTCGCCGCGCC
1   L19   BP0441-41                                         BP0441
                        ACATTACGCCACGCACGATTCGTTTCTACGAAGACCAGGGCATCGTCAGCCC
1   L21   BP0442-341                                        BP0442
                        TGTGGATCAGCATGACCGATTTCATGGTGGCCAGCCTGTGGTCGCGGCGTA
1   L23   BP0447-671                                        BP0447
                        AGATCCCGACGCTCAAGCCGGCTTTCAAGAAGGATGGCACCGTCACCGCCG
1   N01   BP0448-951                                        BP0448
                        ATTCGACGAATTCAAGGCGCGCTACGGCACCACCCTGGTCACCGGCTTTGCC
1   N03   BP0449-606                                        BP0449
                        CCTGCAGAAGCCTCGCCACATCGAAATCCAGGTGTTCGCCGACAGCCACGG
1   N05   BP0450-41                                         BP0450
                        ACAAGGGCGATCATTACCTGGCCCTGGGCCTGGCGCGCGCCGACGAAACGG
1   N07   BP0451-446                                        BP0451
                        GCTGGGACACGATGTTCGCGCCGCAGGTGGAGGGCTTTCCCAAGGCCGAGA
1   N09   BP0452-571                                        BP0452
                        GATTTCCTGGGCCACCAGGTGCCGTTGATGGTGGATTCGGTCACCGCCGGC
1   N11   BP0453-731                                        BP0453
                        TATTCACGGAGTTGCAGGCGGGCTCATACCCGTTCATGGACGCCGACTATGG
1   N13   BP0454-816                                        BP0454
                        GCTCTACAGCGACGCCACCCGCAAGACGCTGGACAATGGCCATGCCAAGGG
1   N15   BP0455-1741                                       BP0455
                        GTGTTCTCGCCATCGCTGCTGATCTCGGTGCAGGGCTTCACCTGGTACGACT
1   N17   BP0456-1481                                       BP0456
                        GCACCTGGCGCGCACCCGTCATCGACGAACAGTACGAAGTGCAATATGCGA
1   N19   BP0457-216                                        BP0457
                        CGAATACCAGCAGTTGGGTACCGAGTCGATCGGCTTCATCACCTTCCTCGAA
1   N21   BP0459-1251                                       BP0459
                        CCAGATCCTGGTGATGGTGGGGCTATGGGACAGCGCCTCGTTCGCCAGCGC
1   N23   BP0460-46                                         BP0460
                        GATATATCACGCGCCTTGGGAGGCTTTGCGCGCGAGGGCGACTATTTTGAAA
1   P01   BP0461-626                                        BP0461
                        CCGTCCAGGAAGGCTGGGGCATGCCCATCTTCGACGCCACCACGGAAGCCT
1   P03   BP0462-506                                        BP0462
                        CCAAGACCCATCTGCATCGCGAGCTGGGCGAGATCTGGCGCAAGCTGGGCC
1   P05   BP0463-101                                        BP0463
                        GCGCCTGGGAAGGCCTGACGCGCGTTCCCTGGTTCGTGCAGAACACGATCT
1   P07   BP0464-251                                        BP0464
                        GCATCGACGCCGAACACGGCCGGCTCGACATCCTGGTCAACAATGTCGGGG
1   P09   BP0465-1271                                       BP0465
                        GCAAAGTGCGCAGCGGCCAGGTCTTCATCAACAACTACGGCGCGGGCGGCG
1   P11   BP0466-486                                        BP0466
                        GGTCACCACCAGCAAATCGATGGCCGCCGAGCTGGGGCCGGACAACATCCG
1   P13   BP0467-106                                        BP0467
                        ATCGAGCGTGGCGTCGACACGGTGTTCGGCTATCCGGGCGGCGCCGTGTTG
1   P15   BP0468-181                                        BP0468
                        ATCGGCTTTACCGATACCGTCATCGTGCATGTCACGCTGGAAAGCCACAGCG
1   P17   BP0469-236                                        BP0469
                        TCCTGGGTTTTCGCAACAACGTCTGCTACGACCGCTGGTGGGAGGCCCGCA
1   P19   BP0470-146                                        BP0470
                        CCGATCGCCGGCACCCCACCAATCCGGACGATCCGTTCCATACCTTCTTCTT
1   P21   BP0471-66                                         BP0471
                        GCGCGCCCTGCAGCACCTGCGCATCGGCCGCCCCGTCATCCTGATGGACGA
1   P23   BP0474-791                                        BP0474
                        GCAACGTTTCCGTGCCGTATGGCATTACCACGCCCGACCAGCCCAATATTTC
2   A01
2   A03   BP0475-66                                         BP0475
                        GAAACTGATCGATCTCGACATCGAGACTGCCGGTCGCGAACAACGCAAAGGC
2   A05   BP0477-91                                         BP0477
                        TTCCTGCTCAGGCTGTGCAAGGGCGTCCCCAAGAGCCATATCTACAAGGCCA
2   A07   BP0478-401                                        BP0478
                        CCGATGAAACCTTCAGCAAACCCCACCCGGCGATGTTGCAGGAACTCATGCA
2   A09   BP0479-181                                        BP0479
                        CGCTATGCGGTGGTGGACAAGCCCACGTCCTTCAAGGACGTCACCACCTAC
2   A11   BP0480-246                                        BP0480
                        GTGCGGGTTGTTTGCGTTTTTCTACGGCAGCCTGCATTTCCTGGCCTGGGTA
2   A13   BP0483-326                                        BP0483
                        ATCGTGCGAAACGCTCCAGCCCTTTCAACCCCGAGGAGCTGCGCATGTACCC
2   A15   BP0484-66                                         BP0484
                        GCCGCGCATGTTCTACGACTACGCCGATTCAGGCGCCTGGACGGAAAGCAC
2   A17   BP0486-291                                        BP0486
                        GACGTACACGACCAATTCCCTGCTGTACGCCAACCTGAACTACGACCCGATC
2   A19   BP0487-866                                        BP0487
                        GCTGGGAAGAGCTGGGTTGCCGGGTCGACCAGGCATGTCCGGACTTCGGC
2   A21   BP0488-61                                         BP0488
                        GCCGCTTTGCTTGCCGAGCGTGCCGACCACCCCCTGTATGTCGCTTCCGTG
2   A23   BP0489-656                                        BP0489
                        GCCAGGGCAAGGAGGAGAACTTTGCGTTCTCCGGCGGCGTGAAAGGGTTTG
2   C01   BP0490-406                                        BP0490
                        ATGCTGCGCCACCTGTTCAACATGGTGCACTTCGCCATGGCCCAGCAGGATA
2   C03   BP0491-41                                         BP0491
                        AGGAACTCCCCCCCCAACAAATCAGCGCGTGGATCCGACCGCTGGTCCCGC
2   C05   BP0492-1                                          BP0492
                        ATGAAACGCACCTACCAACCTTCCGTTACCCGCCGCAAACGCACCCACGGCT
2   C07   BP0493-66                                         BP0493
                        CAAAGGCCGGCGACTGGCCCGAGGGGCTTTCTTTATTGTCAGCGCCTCGCC
2   C09   BP0494-106                                        BP0494
                        ATCGAAGCCATTGAACGTCATGGCGCATGGCGCGGTCTATGGTTGGCGGCG
2   C11   BP0495-686                                        BP0495
                        CCTCCAGCTTCTATCACACGTTCACCGGCGTCGCGGTGTACTCCGAGCAGG
2   C13   BP0496-661                                        BP0496
                        GCCTTTCGCAGCCGCGCCTTCGCCGCGCTGTGCCATGAGCTGGGCATCAAG
2   C15   BP0498-446                                        BP0498
                        TGGATACCGATGCCGAGCTGGTGGTCAAGCATCTGGGCATAGCCAGCGGCA
2   C17   BP0499-51                                         BP0499
                        TGGCGCCGACGAGCCGGTCACCTCCCTGGCCATCGATGAGCAATGGGCGGT
2   C19   BP0500-646                                        BP0500
                        GGCCTGGACACCATACGCCCCAACCTGACGGCCGAGGAAAACGGCGTCGCC
2   C21   BP0501-101                                        BP0501
                        AGATGCCGCGTCCTCCGTACTGGCCGCGCAGCAACGGGCAGCCGGTCTTCT
2   C23   BP0502-146                                        BP0502
                        GGGGAATCACCCCGAAATCTGTTGCGCAAGTGCTACAGCGGTACTGCGACG
2   E01   BP0503-41                                         BP0503
                        TCCTGCAGCTGAATCCCGCGCATGTGCGTGACAGGCTGACCAAGCGGAAGG
2   E03   BP0504-41                                         BP0504
                        TGGGCGCCGTAGTGGTGCTCGCCCTGGCACTGCACCGCTGGCTGAACCGAG
2   E05   BP0505-186                                        BP0505
                        TGTCGATGACTATGGTGGCTCTGCACGGCGCCCCGGCGATACCTGGTTTGG
2   E07   BP0506-636                                        BP0506
                        CAGCGCCTATGGACATAAGCCTGAGCCTCTGGACACAAGCCCTGGACATAGC
2   E09   BP0507-321                                        BP0507
                        GATGGACCCTGTAGACGTCGACGGTTTCCAGGCGGAACTGCACGAAGGCGG
2   E11   BP0508-371                                        BP0508
                        AGACGAAGTGCCCGAAAAGCACCACGCACATCCGCTATCTGGAAGCGGGCA
2   E13   BP0509-481                                        BP0509
                        CCAATGAGCCGGGACGAAATCGACGGGATCATGAACCGGTCCCAGTCGGTG
2   E15   BP0510-111                                        BP0510
                        GACCCTCGACGCCCGATCCACCCTCACCGCCTGCGAAGGCTGCGGCAAGAC
2   E17   BP0511-251                                        BP0511
                        GAGAGTCCGCGGTGTCGGTCGGCACGCTGTTTGTCGAGTGGACCAAGCTGG
2   E19   BP0513-51                                         BP0513
                        GCGCCGCGATGGTGCATGTTTCGAGGGCTACAACAAGGTCGTCCGTGCCGT
2   E21   BP0514-786                                        BP0514
                        GTGGGCTTACGCTCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATG
2   E23   BP0515-41                                         BP0515
                        AGTTTCAAGCCGCCTGCCAGCGCTATGCGCATGGCAACGGCTCTTCGATGG
2   G01   BP0516-446                                        BP0516
                        CTCGAATGGACTACTTGCTCGGGCTTTCAGATCAGTGGATGACATGCGAAGA
2   G03   BP0518-236                                        BP0518
                        TCCAGGTGCGCGTGTACGTGGACAGCGTGGAGAACTGGCCGGCCTTCGACG
2   G05   BP0519-481                                        BP0519
                        CGCTGGAGCTACGCCGACCTGTCGCTGTATCACGTGGTCGAAGGCCTGCTG
2   G07   BP0520-156                                        BP0520
                        CGATTTCAAGACTCCCTTCATCGATTCGGTCAGCACCGTGTCGGTGCGGGAT
2   G09   BP0521-181                                        BP0521
                        AAGGACGGTTCGCCCTATTTTTCGCTGACGGCGACCAATGGGCAGTCGATCG
2   G11   BP0522-851                                        BP0522
                        TGGCGATGAGCCGCGACCGCGGCACGCAGAAGCAAAAGCAGGATTTCGGCT
2   G13   BP0523-376                                        BP0523
                        GATTGGGACGCGATCGTGACGGCGGAAGAAGCCGGCTTCTACAAACCCGAC
2   G15   BP0525-56                                         BP0525
                        GCTTCGTCTACCAGGGCAGGACTTGCGTGCGGCGCCTGCGCATGAAACCCA
2   G17   BP0526-41                                         BP0526
                        AGACCTGCATCCATGCCCTTGCCGCCGTATCGGGCGATGCTCGGGACCAGC
2   G19   BP0527-61                                         BP0527
                        TGCAACACCATGTCGGGCGCCGGCAAGGACATCGAGCGCGGCGGCGAAAAA
2   G21   BP0529-1366                                       BP0529
                        ACGCGTGCATTGACGCTCGCTGGAAACGAAAGCATAGACGTCGCAGCCACC
2   G23   BP0530-436                                        BP0530
                        GAAGTGACCTGCCTGATGCTGACACGCCGATCGACCACCCTGGACCTGGTG
2   I01   BP0531-421                                        BP0531
                        GATCTGAAGACGGTCCTGGACTCGGCCAGGCAGAGTCCCGGCCGCTACACC
2   I03   BP0532-1411                                       BP0532
                        GAGGTGTCGGAACCGGAGCTGGTGCAGTGGTGCCGCGAACGCATGGCCAA
2   I05   BP0533-401                                        BP0533
                        ACAAGTGCTCGTCGAGCAAGGCCATCCTGGCCTACCTGGATCCGGCCCGCA
2   I07   BP0534-636                                        BP0534
                        GTCCAAGCAAAGCATCAACGCGTATGCCAACGCGCTGAACCACCTGGGCAG
2   I09   BP0535-66                                         BP0535
                        CCCGGAAACCGTCAAGGGCTATCAACAGCTTTCGGCGGCCGGCAAGCAGAC
2   I11   BP0538-541                                        BP0538
                        GGCATCCGCAGCGTGGACGAAGGCGAACGCAACCTGGTCTACGACGCCGGG
2   I13   BP0539-1121                                       BP0539
                        GCCAGACCCTGCGCCTGTCGCCGCCCTTGATTGTCACGCGCGAACAGATAG
2   I15   BP0541-356                                        BP0541
                        CGCGCCGCCTGCTCGATGCCTACAGCAGGCACGAGAACGCGTCCGAATGGA
2   I17   BP0542-611                                        BP0542
                        GACACGTGGAGTCGATGTTCTCCGGCGCGGCGTCTGCCATTCCGCATGTCA
2   I19   BP0543-61                                         BP0543
                        GCAGGCGCGATGAATCCCGACCGACTGCTGGGCGAACCCTTGCGGTTGCCC
2   I21   BP0544-56                                         BP0544
                        GCTATATGCAGGAAGTCACGCGCCTGACGGTGGAGATCCTCAAGTGCCCGG
2   I23   BP0545-391                                        BP0545
                        GTCAAGCTGACGCCGCGCCATTATGCCTACCTGAAGATTTCCGAAGGCTGCA
2   K01   BP0546-336                                        BP0546
                        CGAGCCCGATCTCTCGCCGGTCGGCCTGCTCGAACGCAGCCACGCCGAATA
2   K03   BP0547-386                                        BP0547
                        AGAAGCCATGCGGCCTGCTCAATATCGCCGGCTATTACGACCTGCTGGGTCA
2   K05   BP0548-356                                        BP0548
                        GCTATGACTGGGTGTTCCAGGCCGAGCCGCACCTGGTCAAGCGGCTGACCA
2   K07   BP0549-151                                        BP0549
                        CGCGAGATCATGGCGTTCCTGGAAGTGCCGGTCTGGAAGCTGCCGGCCATC
2   K09   BP0550-46                                         BP0550
                        CAGGCCCGGTACGGCACGCCGGCCCCGAACTCGCTGACCAAGGAAGTCGAT
2   K11   BP0551-821                                        BP0551
                        CCGATGCGCAAGGCATAGATATCGCCACCGGGCAGGGCGTGCTGCGCCTGC
2   K13   BP0552-216                                        BP0552
                        GCTGATCAACCCCGAGATCACCTGGAAGAGCGACGAACGCCAGACCTACGA
2   K15   BP0553-386                                        BP0553
                        TCCCGACCGACCTGTACATGATCCAGGGCATGATAGACCTGCTGCGGCAGG
2   K17   BP0554-241                                        BP0554
                        TTCGAGGCCATCGTGCACGTATCGCTGGATCAATCCCAGGCTGGCTGGCAC
2   K19   BP0555-221                                        BP0555
                        AAACGCTGCAATGGGCCGAGCAACCCGGCCACCACATCCTGACCCTGGCCG
2   K21   BP0556-281                                        BP0556
                        GCGCCGACGAAATCGTGATTTTCGGCGCGGCCAGCGAGGCGTTTTCGCAGA
2   K23   BP0557-296                                        BP0557
                        GGATCACCCGCCGCGAAGTCGCCTGGCAGGACATCCAGTTCGCCAAGTTCG
2   M01   BP0558-521                                        BP0558
                        TCGAAACCTTCAACGAAGTGGTCAATGCCTTTGCCTCGGGGCGCTGCGACG
2   M03   BP0559-526                                        BP0559
                        TCGTTTTCCAATCCATGCGGGGCCACCATCAGCCGCGAACGCCGCCTCAGG
2   M05   BP0561-326                                        BP0561
                        ACCCGGCCAAGTTCACGTATATCGGCGGCATCGCCCGGTTCCCGCTGATGC
2   M07   BP0562-136                                        BP0562
                        AACGGCGCGGGCTATATGGAGATCGAGAACGACGCCAAGGCTGCCGACCGC
2   M09   BP0563-786                                        BP0563
                        CGCCTGGGAGGACGTGCCGCTGTACTGGCAGCATTGGCGGGTAAACTCGCA
2   M11   BP0564-126                                        BP0564
                        GCACCTGCTGAGCATCCTGGCCGTGTGCGCCCTGATCGACGCTGTCTTCATC
2   M13   BP0565-881                                        BP0565
                        GCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCT
2   M15   BP0566-366                                        BP0566
                        CCTGCACTTCGAGACGGTCATGCTGGGGCACGACCTGTATCCCGGCCTGAC
2   M17   BP0567-571                                        BP0567
                        ATCGGCTTTGACCGTACGCGGGTCGAGATGCTGATCGATCCCGATGCGACG
2   M19   BP0568-201                                        BP0568
                        GTCCGAACCGGCCTTCCAGGCCCTCAAATGGATCGGCGCTGGCTATCTGGC
2   M21   BP0569-1261                                       BP0569
                        CCTGTTGCCATCGATGCAACACCGCAGGCGCAACACGACGGTTTTTTCTATG
2   M23   BP0570-241                                        BP0570
                        GACCTGCAGATCACCCGGTCGCGCTGGTGGTGGTTCGATCACACGCTGGTC
2   O01   BP0571-2196                                       BP0571
                        CGCCAATCGCAAGGAAGGGGGCGCGCGGATCTCCATATTGTTGACCCGCCT
2   O03   BP0572-156                                        BP0572
                        CATCTGGATGCCAGATACCGACGGCGTCAGTCTGCTCAAGGAGTGGGCGTC
2   O05   BP0573-1246                                       BP0573
                        CGTGGCGACGAGATCATCGTTCCCGACGCCGACACCGAAATCCAGTCGGAC
2   O07   BP0574-866                                        BP0574
                        GCCTGGTGATCTCCGTATTCCTCTATATCAAGGGCGTATACGGAGACCCCTG
2   O09   BP0575-266                                        BP0575
                        CCAACGACAAGCGTTCGCGCCAGGCCGTGATCACGCAGGAAGGCCTGCGCA
2   O11   BP0576-446                                        BP0576
                        ATTTCGACGGCCGCATGTTCCGTGCCGTGTACGGCCCGCACTGGCGCCTGC
2   O13   BP0577-291                                        BP0577
                        GAATATGCCGCAGCGGGCCGATGTCTGCCTGGTGGCGCTGGCCGATATGCC
2   O15   BP0578-721                                        BP0578
                        CTGCAGCGCGCGCCGTCCGAGTACATCGGCTCCAATATCCTGATCACGACTT
2   O17   BP0579-1                                          BP0579
                        ATGCAGAAGACCTACCGCATTGGCCAGATCGTGCCGAGTTCGAATACGACGA
2   O19   BP0581-841                                        BP0581
                        CTGTACGACCGGGAGGCGACCATCGGCATGGATGCGCGGGCCTACGAGGG
2   O21   BP0582-521                                        BP0582
                        ATCGCGCGCTGGGCCCGCACGAGGCCAACCTGTTCGACATGCGCCAGAAAT
2   O23   BP0583-316                                        BP0583
                        AGCGAAACGCCAGACGGCGAGATCGCCGCATCCAGCACTTTCCTGCTGATG
2   A02
2   A04   BP0584-1006                                       BP0584
                        CCCGACAGCATGATCATGCAATGGACCATGTTCGGGTACGAGGACGACACC
2   A06   BP0585-976                                        BP0585
                        ACCGACCAGTACGGCTGCAACATCCAGATCCTGGGCTTGCCGCAACCCGGC
2   A08   BP0586-61                                         BP0586
                        ACCGCCGGCGAGGCGAAATTGGCCCTGTATCGCAGCGAAGGCGAATACTTC
2   A10   BP0589-241                                        BP0589
                        GCGCAGAACATGGACGCGGTCAGCAACGGCACCGTGGAATGCAACCATGTG
2   A12   BP0590-1171                                       BP0590
                        GGCCGCGAGCCTTGGGAAGTGCGCCTGGAGAACCTGGTGCAACCCGAGCA
2   A14   BP0591-726                                        BP0591
                        GATCGATGAAGCGGTGGCGCAGGCCATGCCCGGCAAGGATGCCCTGCATCG
2   A16   BP0592-191                                        BP0592
                        CCTATGCGGTGGCGTGCGAAGGCCGCCAGGTGACCACCATCGAAGGCTATG
2   A18   BP0593-481                                        BP0593
                        CTGAAGAAAAGCGATCTGGAGCTGATCAACGTCGATGCCGCCAGCAAGGCC
2   A20   BP0594-601                                        BP0594
                        TTCCTGGGCGACGAAGTGATGGTGTTCTCGCCGCGTCCCGGACGGGTGCTC
2   A22   BP0595-131                                        BP0595
                        AGATAGCGCTGGAGCTGGCCGCGGAATGGCGCTGGTACGCCGACCAGGCC
2   A24   BP0596-1                                          BP0596
                        ATGTGGGCATTGCTTGCCTTATCGCGCGGCATAGACGCGCTGAACCTGCGG
2   C02   BP0597-1586                                       BP0597
                        GCGTGAAGATCGAAGTGGAGGGGGGCTACGGCGGCAGCGTATACGGGGGA
2   C04   BP0598-66                                         BP0598
                        GGTCGATCCCCGCAGCTTTGACTTGGCTGCCGCGTCTGACGAGTTGTTGGC
2   C06   BP0599-586                                        BP0599
                        ATGCACGATTTTGGCGACCTGCTGGTCGAGAACGGTTTTGCCGATCCGGTAA
2   C08   BP0600-121                                        BP0600
                        GCGCTCGATTACGCCGGGCCCTACCGCGGGCTGATCTCCCGCTACAAGACC
2   C10   BP0601-341                                        BP0601
                        CGCTGTTCGGACCAGCCCAGCAACTGCGGCTGCCCATGCGGCCGGGCCAG
2   C12   BP0603-926                                        BP0603
                        CCCGCGCACTGAACATCGAATTGCCGATCACCGAGGCCGTCTGCGCCGTGC
2   C14   BP0604-71                                         BP0604
                        ACCTGAAGGACTTGTCGCTGGAAATGCCCAATGCGCCGCACGTGTTCCTGG
2   C16   BP0605-86                                         BP0605
                        ATCTCGAAATCATCCGTATCGACCAGGATCCGTCGCAACGCGACATCATGAT
2   C18   BP0606-116                                        BP0606
                        CGGTGGGTACGTCCGAAGCCATCCAGATGGTCAACCAGCGCCAGGCCGTCT
2   C20   BP0607-566                                        BP0607
                        TGATCAAGCACCTCGACAATGTTTCCGATGATGACATCGTGGGCGTGAATAT
2   C22   BP0608-1456                                       BP0608
                        GATACTATTGCTACGGTAGGCGCGACCGGCGGCCAAGTGGAATCGGGCCTA
2   C24   BP0609-881                                        BP0609
                        GCTGGGTCAAGACCGTGCCGATGGTGGTGCTGGTCAACGTGGGTTCGGCTT
2   E02   BP0610-371                                        BP0610
                        ACTGTTCGGACAACTTCGCCACCCGCCACGCCATCAACCGCGCCTGTGTACG
2   E04   BP0612-636                                        BP0612
                        CATCCACGCCGGCCGCCTGAAACTGCTCGCGGTCAGTTCCAGCGAACGGGT
2   E06   BP0613-121                                        BP0613
                        CCCGGCAAGGTCCACCCCTATCTGGTCAGTTTCATGAAAGTGGGTTTCGTGG
2   E08   BP0615-676                                        BP0615
                        TCGCGCCTGGCGCCGTCGGTGCCGTCGCTGTCCGAATCCCTGAAGGACTAC
2   E10   BP0616-251                                        BP0616
                        CCAAGGCGTATCCGGACAAGTTCCATCCCGTGGGCTCGATCGAGGCAGCCA
2   E12   BP0617-446                                        BP0617
                        TCTTCTCGATATTCGGCGCGGTCAACTGGGTGCCCAAGTGGTTCTCGGATTC
2   E14   BP0618-1056                                       BP0618
                        GGTGGCCTGGGTAGGCCTGACCGAAACCGCGGCGCAGCGCGACGGCATTG
2   E16   BP0619-521                                        BP0619
                        TCGATTTCATCAAGCAATACTGCGCGCAGGGCGGACGGGTGGTGCTGCTGA
2   E18   BP0620-206                                        BP0620
                        TTTTCGCCATCGGCGCCTACGTCAGCGCCATTGCGCTGAAATCCTGGGGCG
2   E20   BP0621-76                                         BP0621
                        AACCTGACGTTCTGGACGACCCGCGTGCTCAATTTCGGGCAAGGGTCCGTC
2   E22   BP0622-1081                                       BP0622
                        TACCAGGGCGTCAACACGGCCTACACCTTCTCGAAGGAACGCCACCACGGC
2   E24   BP0624-481                                        BP0624
                        ACGTCGCGGCCCAAGGGCGTGATGCACTCCTACGGCAACCTCCACTGGAAA
2   G02   BP0625-61                                         BP0625
                        GAGGACTACGGTGTGGATTACTGGCACGACCTGGACCGCAGGAAAGCGTTT
2   G04   BP0627-341                                        BP0627
                        CCGAGCTGCTCCTGTGCCTGGACCTGCGCATCGTGGCCGATAACGCCGCCA
2   G06   BP0628-451                                        BP0628
                        CCGGCCGACGCCTATGGCTTGCTGAAGTCCGCCATCCGCGATCCCGATCCC
2   G08   BP0629-536                                        BP0629
                        AGTTTTCGCCCACCCACAAGCAATTCGTCGCGCCGCTGGACAAGCTGTCGGC
2   G10   BP0630-191                                        BP0630
                        ACTTCCTCAAGACCCTGGTGTACGAGGGCCTGGTCACGTTCGACGAATCGAC
2   G12   BP0633-96                                         BP0633
                        GCAGGCCTATCCTTCCAAGCCCATCGAGATCATTGTTGCCTCGTCGGCCGGG
2   G14   BP0634-211                                        BP0634
                        GACTGCATTGTGCGCGAAGAACTCAGTTATCTGTCGCAGGCATTCGCCTCGA
2   G16   BP0635-621                                        BP0635
                        GGGCATGTCCAAGAACATCCTCAACCGCTCCTTCAACCTCGACCAGAACACC
2   G18   BP0636-136                                        BP0636
                        GACGGGGTGCTGTGCGCCTATTCGTTCACCGAACCGCACCTGATGCTGGGT
2   G20   BP0637-226                                        BP0637
                        TTCAAGGCCGACACGCCCTATGCCATCGCCCTGGTGGACCTGGACGAAGGC
2   G22   BP0638-326                                        BP0638
                        AAGTCAGCGGGGTGGGCGAACGCGAACGCAACCTCTACACCGGGCGGATGA
2   G24   BP0639-51                                         BP0639
                        CCAGGCGGATATCGACATCTACGCCGAGCTGACCGACGATTTCAACCCCCTG
2   I02   BP0640-961                                        BP0640
                        AAGTATTGCGCGGGCAGGCTGTCGATGCGGATTCCCAACGAGTGCCTGCAG
2   I04   BP0641-451                                        BP0641
                        AAGGCGCCCAGCTATGCGTCGGCCGGCAACGCGACCACCTCGCACCTGACC
2   I06   BP0642-931                                        BP0642
                        CAGACCTACGACCAATTCCGTCAGGACCCGCAGGTCCGTACCTACGAACTCT
2   I08   BP0643-321                                        BP0643
                        CATCCCCGCCGCGATCGCCCAGTACCGCCAGGCGCATCCGCAGGTCAAGCT
2   I10   BP0644-686                                        BP0644
                        AAATGCTGGTGCAGGTGTGCCGGCTGTTCGCGGCGGGCAAGGCCGAGGCC
2   I12   BP0647-126                                        BP0647
                        CGGGCACAGCGCGGAAGGCGAATCCATCAAGGATCGCATCCTCGTCATCCC
2   I14   BP0649-411                                        BP0649
                        TTCGGTGGCCGACCTGCTGGCCCAGATCAAGGGCAAGGACGGCGCGGCGA
2   I16   BP0650-41                                         BP0650
                        TATTCAAATCACGGCTGCGGATGAAGCACCTGGAACTCTTTCGCAATCTCTG
2   I18   BP0651-1461                                       BP0651
                        GATGAAGCTGTACTACGGGCATTTTTTCTGCCACGTATTCCACCAGGACTATA
2   I20   BP0652-831                                        BP0652
                        GCATCGCATGGCGGACATGCTGGTACAGAAAGAGCTCGCGCTTTCAATGGC
2   I22   BP0653-86                                         BP0653
                        GCGAGAAAGTGCTCGCGCACCAGCATCTGCTGCGCGATGACTACATCCGCT
2   I24   BP0654-731                                        BP0654
                        TGAAGGAAATGCCTTCGTTGCCGACCAGCGCCAAAGCGGGCTATCCCGATC
2   K02   BP0655-956                                        BP0655
                        AATGGTGCGGTTCGGACGATTTCGGCACCGCGGCCTATGGCTCCGAAGGGG
2   K04   BP0656-326                                        BP0656
                        CGGAAAACTGTGTCGCCGCGGGCAACCTGCTGAGCAATACCGCCGTGATCG
2   K06   BP0657-271                                        BP0657
                        CGCTACCGCGAACCGGTGTACCAGGAGGTGGGCAAGTGGCTCAAGGGAGTG
2   K08   BP0658-1016                                       BP0658
                        CGTCGATCATCTGGGCAACCGGATATGCCGCCGAGTACGGCTGGTTGAACG
2   K10   BP0659-86                                         BP0659
                        ACGTGACCGTCGACATCCATTACTCCACGCTCAACTACAAGGACGGCCTGGC
2   K12   BP0660-346                                        BP0660
                        CAGGGTTTTTCGCGCGCCCATCCGCAAGTCCAGGTGACGCATGTGGAAGAC
2   K14   BP0661-1061                                       BP0661
                        TGGGCACGGTGATGAACCCCAGCCATGCCTTCAATCCGGTGGACCTGGGCA
2   K16   BP0662-346                                        BP0662
                        ATCGGCGATATCCGCATCGCCTCGGACACCGCCAAGTTCCGCGCGGGGGAC
2   K18   BP0663-781                                        BP0663
                        ACCACCCACGTGAACAAGGAGGGCTTCGATCGCCTTGCCTGCAGCTTGCAC
2   K20   BP0664-746                                        BP0664
                        CGGACGTGGCGACCTTTACCGAACTCGGATTGCCCAAGATGGTCTCCAGCAC
2   K22   BP0665-41                                         BP0665
                        TGAACCTCATCGAGCAACTGCTTGAACGCGGCGAAGACGTCGTGGCGTTCG
2   K24   BP0666-46                                         BP0666
                        ATCCTGATTGAAGGCCTCAAGCGCCTCGAGTACCGCGGCTACGATTCGTGCG
2   M02   BP0667-376                                        BP0667
                        TACCACGCCCTGGCCCACCGGGTGTTCACCGCCCAGGCCAATGTGCGCAAC
2   M04   BP0668-931                                        BP0668
                        ATCGATCTGTGGGAACTCAACGAGGCCTTTGCCTGCCAGGTGCTTTATTGCC
2   M06   BP0669-1626                                       BP0669
                        GCGTGGCAAGGGAGCACGCTCCCCCATTGCCGATGCCCTGTGCGAACTTGG
2   M08   BP0670-611                                        BP0670
                        CCGGGATCGGCACCCATGCCCGGTTCGACGGGAGCGCATGGAAGATATATG
2   M10   BP0671-451                                        BP0671
                        CGCAAGGATCCCGAAAAACGCGTATTCAGCTCCGCGGCGATCGGCACGACC
2   M12   BP0672-1701                                       BP0672
                        ATCCATGATGGCGCGAGTGCGGCGCAACTGTCCGCAAGCGCGCATCGACGG
2   M14   BP0673-686                                        BP0673
                        TCGCCAGGAAGTTCAGCGTCCTGACGCACTACCTGGAAGAAAAGGGGCAGA
2   M16   BP0674-46                                         BP0674
                        GCGTTCGTTCTTTCGGGTCTCCAAACCATGACCAACGAAGTCAAATCGGCCG
2   M18   BP0675-361                                        BP0675
                        GGCGGCTCATACGGATGGTCCAGCGCGGGGCGCTTCCACCATGCGCAAAGC
2   M20   BP0677-406                                        BP0677
                        CTGGGCACGCTGCTGCATCAATTGTTCCAGCGCACATTCTCGGTGGCCAAGG
2   M22   BP0678-416                                        BP0678
                        CGGAAACGCGGGGTTGGCGCGTGGAGATCATGTCGGAGAGCGAGTCGGAG
2   M24   BP0679-476                                        BP0679
                        CGGGCGACTGGTACGAGGCCTTGCCGGCGCAGGACCGCTACGACCTGATCG
2   O02   BP0680-191                                        BP0680
                        AGACGTTTTCCAACTGGCCGACGATTCCGCAGCTGTACGTCGGCGGCGAAT
2   O04   BP0681-356                                        BP0681
                        TCATGATGGTGCGCGAAACGCCGTTCAACCTGGCCCACTTGCGCAATATGAC
2   O06   BP0682-881                                        BP0682
                        ACCTGGGCTACAGCACCGCCAGCGACGGCCCGGAAGTGTTCCAGAAAATGG
2   O08   BP0683-216                                        BP0683
                        ATACATCGCCATTCCGGCGTTCCTGTCGCGCGTGTTCCGCCATTCGGGCATT
2   O10   BP0684A-166                                       BP0684A
                        TGTACCGTGCTGGTCGATGGCTATTCGACGCGCAGTTGCCTGATGCTGGCG
2   O12   BP0685-2081                                       BP0685
                        TGAGCACTACGTTTGCCGAATACCTGCTGCCCACCGCGCCGGAAGTGCCGC
2   O14   BP0689-301                                        BP0689
                        ACCTCCAACGGCGAGTCGTACGACATGTACGCCATGACGGCGGCGCATCCG
2   O16   BP0690-731                                        BP0690
                        GCAACTACCTCACCGTCGCCATCGGCTGCACGGGCGGGCAGCACCGCTCGG
2   O18   BP0692-371                                        BP0692
                        CCTTTCCGTACACCGAATACACCCGCATGACGCGCGCCGACGCCGATGCGC
2   O20   BP0693-131                                        BP0693
                        TGAACCTGATCCACCCGTCCCGCATCCAGGTGTTCGGCCAGGAAGAACTGG
2   O22   BP0694-86                                         BP0694
                        CCGGCCTACTTTTTGAAAACCATCACGGATTGGCCCGCTCGGTCGTGTTCGA
2   O24   BP0697-416                                        BP0697
                        ACCTCGAAGCCCTGCTGGAAGAACTGCAGATCGGCCATATCCGCGCCAACAC
2   B02
2   B04   BP0698-111                                        BP0698
                        CGAAGAGCCGAGCACGCTGATCCTCTCGGACACGCTGCACTACGACGACAT
2   B06   BP0699-266                                        BP0699
                        GCCAACAGGCCGGCAACCCGATCACCATCGGGGTATCGAAAACCGCCATCA
2   B08   BP0700-141                                        BP0700
                        CCTGTACTATGGCGAGCACGGCGAAATGTTCAAGCGTTTCCATGCGCTGGAC
2   B10   BP0701-256                                        BP0701
                        GCCATCCACGGCGACCTGGGGATGGTCACCCGCGACGATGTCCTGATCGCG
2   B12   BP0702-451                                        BP0702
                        ATCGACGGCGGCATCGGCTATCCGTGCGTGATCAAGCCGGTCATGTCCTCC
2   B14   BP0706-111                                        BP0706
                        CGGCGTATGGCACCTGCTTTCCGAGGTCGAGGCCGTCTTTGGCGTATGGGC
2   B16   BP0707-106                                        BP0707
                        ACGTATTCCAAGCAGGTGACGGCCGCCGGCTTCCAGCTCAAGGGCTCGGGC
2   B18   BP0708-121                                        BP0708
                        GTTCCCGGCTTCTTGTCATCGCAGTCGTTGTTTGGCGTGGATATCCCCGGGT
2   B20   BP0709-716                                        BP0709
                        TCCTGAACGAAGTCGAGATCCGTGAAATCTTCGAAGGCATGATCCGCCATGT
2   B22   BP0710-216                                        BP0710
                        CCGCAATGCCATCCGTACCGGCACCGATCACGGCAATGCCTTGCTGTCGCG
2   B24   BP0711-896                                        BP0711
                        AGATCTACGAATACATGCCGGGCTACCTGCACGCCAAGGTCGCCGTCATCGA
2   D02   BP0712-671                                        BP0712
                        CCTATATCGTGTTCTTCCGCCTGATCGCCCGTGTCGGCCCGACCGCCGCGG
2   D04   BP0718-271                                        BP0718
                        AACGCGGTCAATGTATGGCATACCGTGCGGGTGCTGGAGCGCGCCGGGGC
2   D06   BP0720-106                                        BP0720
                        CACGCCACCACCGTGCACAAGCACGCCGACACCCCGGAGTTGCGCGCGCAA
2   D08   BP0721-406                                        BP0721
                        TCCGCGCGCCACCATGCCGGCAGGAAATACAAGATCCTGTTTCGCGAGCGG
2   D10   BP0722-271                                        BP0722
                        ACCACCATGGGCATCCGCAAGCTGAAGGACCACCGCGCCGCGGCCAACAGC
2   D12   BP0723-1066                                       BP0723
                        GATGCCGATATCGCGCGGCTGGGCCCCAGGCAGCTCAAGCCGTTTCGCAAG
2   D14   BP0724-146                                        BP0724
                        TGTACATCCCGCACGATCCGATCGCGATCAACCCGCTGATGCGCCTGAAGCC
2   D16   BP0725-511                                        BP0725
                        TTCCAGGATCCGCAGCAGTTCCTGTGCACGGCGGTCCTGCCCTGCATGACG
2   D18   BP0726-601                                        BP0726
                        CCGTTCCGCTTCGTCCTGGACGAGTTCTCGCCCGGCGTGAAGGTGGCGTAT
2   D20   BP0727-241                                        BP0727
                        GGACGCGGCTACGTCCCCGGCATACGCATCCTCGACCATGCGCTGGACTAC
2   D22   BP0728-381                                        BP0728
                        CGGCAAGTTCTCGGCGGAAACTCAGGAAGAGCGGCTGTTGCGCATTGCTTT
2   D24   BP0731-911                                        BP0731
                        TCAGCTTCGAATCGCCGCTGCAACCCGGTTCGCGGATTTCCATCCAGGACGC
2   F02   BP0732-566                                        BP0732
                        CCACCAACTTCGATCCCGAGATCAACTTCCGCGAGTTCACCGGATCCGTCTG
2   F04   BP0734-41                                         BP0734
                        TCCATTGGTGCCGGCAGCGCAACGCTGTGGCCGTTTCGTACGGCTACCGCT
2   F06   BP0735-296                                        BP0735
                        AGGCAGCCAGGTATCCCGATATCCGCTTCAAGAGCACCTCGGTGACCGACC
2   F08   BP0736-1831                                       BP0736
                        ACGCCCTTCGACCCGACCAAGGGCAAGCAGTGGGAAGCCGGCGTGAAGTAC
2   F10   BP0737-496                                        BP0737
                        CATCCCTTCGTGGTCGAAGCCGGGGCCGGGACGATCACCGTTACCGGCACG
2   F12   BP0740-621                                        BP0740
                        GGAAAAACCCATCGTCTATCTCTGGACCTACCGCCACGCCTGTCCGCAATGC
2   F14   BP0741-161                                        BP0741
                        TGCAGGTAAACCTGGACTGGTTCGAAACCGGCGTGGGCCCGATGGAGCTCG
2   F16   BP0744-196                                        BP0744
                        GGCTCGATGGAAAGCCTGGCCGACTACAGCGCTTCGCCCGCTGGCGGCGC
2   F18   BP0745-541                                        BP0745
                        GGCGCGCCTGTCTCGTCCGAGGTGCTGCCTTCGTGGACGGCCAATTCTTCG
2   F20   BP0746-671                                        BP0746
                        CATCAGGCCGCGAACGCAATGTGCTGACCCGCCTGGCGCAAGGCGAATGCA
2   F22   BP0747-371                                        BP0747
                        GCATGGGCAACATCCATTTCAAGTCCAGCACCAATCGCGCGCCGCGCCAATG
2   F24   BP0748-46                                         BP0748
                        TCGGAATCGAAACGACTGGGCGTCAAGGTGTATGGCGGCCAAAGCATCCTG
2   H02   BP0749-46                                         BP0749
                        ACCGGCGAAAAACTCAAGGTAGAACAGATACCTGCTGACATTGGGCAAGAAA
2   H04   BP0750-911                                        BP0750
                        GCGGCGGCCATCATCAGTATCCGGATGGGTTTATGCTTTTCCTTGGCACCAT
2   H06   BP0751-856                                         BP0751
                        GCCGAAAACGAGGCCGAACTTGCCCGACAGGCGCTGTCGGCCTTCCCGGTT
2   H08   BP0752-751                                         BP0752
                        TTCTCGACGTACCTGGTGTATCCGTCCAGCAGCCCGCTGAGCCTGCTGGCC
2   H10   BP0753-41                                          BP0753
                        CGGACTTTGCCGTGCTGGATGAATCCACGCGAACAATTCAAACCCTGAAAGT
2   H12   BP0754-1486                                        BP0754
                        ACCGCGCACGAGGAGGACCTGGGCGTGCACGATTTCATCCACTGCCAGCCG
2   H14   BP0755-956                                         BP0755
                        AGTTTCGCTACTTCCACCTCGACAGGCCTCCCTATGCCCGCCATCGGGTGCT
2   H16   BP0757-231                                         BP0757
                        CATCAAGCGCTGGAATGCCCTGTTGCACGAGAACGCCGAAGACCTGGCCCG
2   H18   BP0758-46                                          BP0758
                        GACTTCGCGGCACTGGGCAATATTGCCTGGCTGTGGATGAACTCTCCCATGC
2   H20   BP0760-906                                         BP0760
                        GAACAATCCTTTCCCGGAGGCAGATGAGAAGATTTTCGTCGTATCGGCCACC
2   H22   BP0761-1271                                        BP0761
                        CGCAACCCGTGATCCGGTTGGCGCAGCTGTGGAACGATTTCCAGCAGACCG
2   H24   BP0762-631                                         BP0762
                        CAGATCGCCCATGCTCATCGTGGCCTGCGGCGCGACGGCGACGTATCGCAG
2   J02   BP0763-901                                         BP0763
                        CAGGTCGATGTGGCGCGGGCCACGGATATGCCGACGGTGGATCTTTCGCTG
2   J04   BP0764-431                                         BP0764
                        ACCTGCTGGTGTGCTTTCGCCATGCCGTGGAGGACATCCAGCTCGATGCGC
2   J06   BP0765-131                                         BP0765
                        ACCGCGAGACTTCGATCCCGTTCTCGTACTATGACGCCAACCAGAAGCCGGT
2   J08   BP0767-216                                         BP0767
                        GATTTTCCTGATCTATTTCATCCTGCCCTATCTGCTGCAGTGGATCACCCAGG
2   J10   BP0768-271                                         BP0768
                        TTCGAGCTGTTTCCGCACCTGAGCGTATTGGAGAACGTCTGCCTGGGCCAGA
2   J12   BP0769-331                                         BP0769
                        CCGACCGTCATGCTGTTCACCAGCGAGAAAGACCTGCGGGTCAATCCGCTG
2   J14   BP0770-56                                          BP0770
                        CCCAGCGGCTGTTCTCCGAGGGCTTCACCAAACAGGACGTCCACGTCTTCTA
2   J16   BP0771-291                                         BP0771
                        GGCCATCATGCCGCACCTGATGAAACTGCCCTACACCATGGACGACTTCGAT
2   J18   BP0772-286                                         BP0772
                        CGCTCGTCGGGCATCCTCGAAGTCAGCGAGGAGGAATGGGCGCAGGTACTG
2   J20   BP0773-886                                         BP0773
                        AACCGCACCAACCAGAACGGCACCGACTCCTGGCAGCTCTATCCGAAAAATG
2   J22   BP0774-41                                          BP0774
                        CACCTTCCATGAACATGCCGCTCGCGCCCATGGCGCGCGAAAACATTGCCG
2   J24   BP0775-511                                         BP0775
                        ACGTCGCAGACCCTGACGGCGGATACCCATGGCAGCACCTTCCAGGCCTTC
2   L02   BP0776-471                                         BP0776
                        GCACAACGTCAACGAACGCATCCGCTTCATCCGCTGGATCAACATGGAACGC
2   L04   BP0777-56                                          BP0777
                        CCGCATTTCCCGATCCGAAGGCGGGCGAAGGCGACGTGATCCTGCGCGTCA
2   L06   BP0778-251                                         BP0778
                        TGAACTACCGGCTGCCGCCGGACAGCATCGACTTCATCCTGCGCGACAGCG
2   L08   BP0779-391                                         BP0779
                        AACTTCATCGACCACGGCCAGCCGCACCCCGCCAACCCGGATTACGCCATC
2   L10   BP0780-136                                         BP0780
                        CTGCGGATCGGCTATGTCGAAGGCCAATACTGGCCGCACTTCCTGTTCACGC
2   L12   BP0781-141                                         BP0781
                        CAGCAAGGGTCCGATCACGGCCGTCGACAATCTGTCGCTGCAGCTGGGCGC
2   L14   BP0782-911                                         BP0782
                        AAGGTCCGCAGCAAATGGGCTACTACACCGAGCAATCCTGGCATGACTATGT
2   L16   BP0783-456                                         BP0783
                        CATGCCGGAAGGACTCATCCTGACCTTGCGCCACGAAACGCCGGAACTGCT
2   L18   BP0784-866                                         BP0784
                        CCACCGAACACTGGCGCTTCCCCAGCCGCGAGGTGCCCATCCTGCACATCG
2   L20   BP0785-61                                          BP0785
                        GTCGTGGTGTATGTGTTCCATGCGTACCTGTTCCAACGCTATCTGCCGGGAT
2   L22   BP0789-46                                          BP0789
                        GAAGGCGTGGAACACGTTTTCGGCTACCCTGGCGGCGCGGTGCTTTACATC
2   L24   BP0790-371                                         BP0790
                        TGACCGGCGTTCAGGAGAAAATCCAGGCTTTCATCGAAGCCCTCGACCGCAG
2   N02   BP0791-726                                         BP0791
                        CATCGCCAACATGAACTACTCGATCTCGAACAACGCCGAATTCGGCGAGTAC
2   N04   BP0792-551                                         BP0792
                        GCAACGCCTCGTTTTTCAGCGGCAAGAACTTCGCCTTGGGCCGCAGCGTGC
2   N06   BP0793-146                                         BP0793
                        CCAATTTCGCCTGCGATCTGCCCAATGGCGGGCAGCGGGTGATCTGGACCC
2   N08   BP0794-71                                          BP0794
                        CCCCTGAAGTTCAGGTGGCACTGCTTACCGCTCGCATCAACGAACTGACCGG
2   N10   BP0795-1496                                        BP0795
                        AGGTGGCGGGTACCGAAACCGGTATCACGGCGCTGCAGATGGACATCAAGA
2   N12   BP0796-596                                         BP0796
                        GCGAATTCGGCGCTATCATCGGCAGGCTGGACTTGATTGCCAACCTGCTCGG
2   N14   BP0798-46                                          BP0798
                        GGACAGGTCCTCAATACGCCGTTCACGCATTCCCGCACGCTGTCCGATATCC
2   N16   BP0799-256                                         BP0799
                        ACGCAGCCTTACGAAACGGGGCTGCGCTACAGCGACCCCAAGGATTTCCATG
2   N18   BP0800-706                                         BP0800
                        ATCATCGCGCTGCTGGGCGGCGCGCATGCAAACGTGGATTGCAATCAGGTG
2   N20   BP0801-386                                         BP0801
                        TTTGCGTCGGCGAATCGCTGCAAGAGCGCGAAGGCGGCAACACCCTGGGCG
2   N22   BP0802-231                                         BP0802
                        CCACAAGGGGCCGTCCGGTCCCGCCATCGATTCGGGCGTGATGCAGAATTT
2   N24   BP0804-1011                                        BP0804
                        CACCGGGCAAACGGCATTCCTCCTGAATGCGCTATCGGAGAACATCGGCCG
2   P02   BP0805-631                                         BP0805
                        ACCGGGGGACACGTCATCGGTTGCTTCTCGCTGTTCATCCCCCGCATCCGC
2   P04   BP0806-491                                         BP0806
                        ACACGCCGTGCGACCTGTTGGGTTCCTGCGGCGGCAACTGGTACGAGAACG
2   P06   BP0807-241                                         BP0807
                        GGCACGCAGGATGTGGCCAAGTCCAGGCCGGACGGACACACGCTGCTCATC
2   P08   BP0808-781                                         BP0808
                        GGCGAGCGCTGGTCCATGCACGACATTCTCTACAAGCCGCACGCCTCGTCC
2   P10   BP0810-331                                         BP0810
                        CTTCCCTATGACGCGGTCGACAGCTTCGAGGAAGTCAGCCTGATCGGCTACA
2   P12   BP0813-576                                         BP0813
                        CATCAACAACATCCTCCCGGGCAGGTTCGACACCGACAGGCTGAAGAGCAC
2   P14   BP0814-61                                         BP0814
                        TTTTCCGCCACCGCGGAAAAGCTGTTCAAGACACAGCCGGCCATTACCCACC
2   P16   BP0815-406                                        BP0815
                        CTGGTCCGCCCCGATACCTCGGTCGTGTACTGCGAGAGCCCTGGTTCGCTG
2   P18   BP0816-401                                        BP0816
                        CCTCGTGCCTGGTGAACATGCATACGATGGGCTCGATCCACGACAGCAAGC
2   P20   BP0817-396                                        BP0817
                        GACCAAGCCGGGAGAAAGCCGCTGGAACAGCGTGCAGGACGTGATCGACGG
2   P22   BP0818-1966                                       BP0818
                        TGGTACCGCCCCTATGACCGCGAGACCGGCATCGAGGAAGCCATGCACCAG
2   P24   BP0819-571                                        BP0819
                        TACAAGGACATGACGGCGATGTCCGACCTGGCGGCCGGACGCAATACCTTC
2   B01
2   B03   BP0820-1221                                       BP0820
                        CGATATGGGGGAAATTCCAGGCCATCCTTTCTACTTCGGCAACCCGTGGTTC
2   B05   BP0821-206                                        BP0821
                        ATGGCCGGGTCATCGCCATGTTCGACGATTATCGCGAAGGCGACATCTATCT
2   B07   BP0822-1581                                       BP0822
                        ATGGCTGGCGCAGGAACAGGGACACGCCGAGGAGGCCGAGCTGGTGTACT
2   B09   BP0823-126                                        BP0823
                        TCTGACCACGCTCGAGAGCGAAGGCTATGTGCGCAAGGAAGGCACGTTGTG
2   B11   BP0824-46                                         BP0824
                        AGCGCGCCGGTTCTCGCGGCCGAATGCTCGGTGGACATTGCCGGCACGGAC
2   B13   BP0825-501                                        BP0825
                        TCACTGTCCCATCTGTGCGGCCGCGCAAGCCTGCATGGCCTTCTGCCGCAG
2   B15   BP0826-1326                                       BP0826
                        GGACGCGCAGCGTACTCTTTTGCGCGCACAGGATGCCGTGGCGCAATCCGA
2   B17   BP0827-1431                                       BP0827
                        CCTGACCCTTTCGCCCGTGATGAGTTCGTTCCTGCTGAACAGCCGTGTCTCC
2   B19   BP0828-836                                        BP0828
                        TCATCACCGTGCCGGAAACCGCGGTGAGCTACAGCGCCTACGGCGACTCGG
2   B21   BP0829-106                                        BP0829
                        CCCAAGCGCTTTACCGACCTGCGCAAGGGATTGCCAGGCATCAGCCCCAAT
2   B23   BP0831-901                                        BP0831
                        AACCTCTATGCCTATGAGCCGACCGACTGGATCGGCGGCTGGACCTTGTTCT
2   D01   BP0832-341                                        BP0832
                        GCCGCTATCCGGGGCTGGCGCTCGAACCCTATGTGGATGTCGGCCAGGTGC
2   D03   BP0834-686                                        BP0834
                        ACCTGATCGATTACGCGGCGCAAGCCGACAGCCCGGCCTGTACGGTGCAGC
2   D05   BP0835-41                                         BP0835
                        TTGACCCCATGGAATCCTACGCAGTCTGGATTGCTGCCCACCCCATCATCAT
2   D07   BP0836-161                                        BP0836
                        CCGAGGCATTGCGCGAGTCGGCCGTGATCGTGCTGGCGCTTACCGATGAAC
2   D09   BP0837-46                                         BP0837
                        GAGTTCCACCGGCTGCTGGCCGACCAGCATCCCTTCGCCCAGGTGCTGGGC
2   D11   BP0840-41                                         BP0840
                        TCGCCGGTGCCGCTCAGGCAGAAACGTCGGTCACCCTGTACGGTATCATCG
2   D13   BP0841-116                                        BP0841
                        AACTGTCGCCCTATGAATGCGGCTTCGAAGCCTTCGAAGACGCGCGGATGAA
2   D15   BP0842-61                                         BP0842
                        AACTGGGCCAAGACCGGTTCGATGTGGCCCATGACCTTCGGCCTGGCCTGT
2   D17   BP0843-66                                         BP0843
                        GCTCACCGAGTCGCTTGGCGAATTGACGCTGGAAGTCGCCGCCGAGCAGTG
2   D19   BP0844-976                                        BP0844
                        ATGAAGTCCAACATGGAAGAGCTGATCCACCACTTCAAGCTGTTCTCCGAAG
2   D21   BP0845-71                                         BP0845
                        AGTCGGCCATCATGGCCTCGCTTGCCATCGCGCAAGAAGAGAAAGGCTGGT
2   D23   BP0846-1086                                       BP0846
                        GCGGCTGTCGTATTTCTATTTCGAGGAAAGCTGCGGCCAGTGCACGCCGTG
2   F01   BP0847-246                                        BP0847
                        GCAGAAATCGGTGATGGAGTTTCTGCTCATCAATCACCCGCTCGACTGCCCC
2   F03   BP0848-936                                        BP0848
                        GTGGTTCCGCGCGTCGTTCCCGCGCTACCGCTACGACCAGATCATGCGCTT
2   F05   BP0849-306                                        BP0849
                        CATTTTCTGCGGTTTCTGTGAAGAGAGCTGCCCGGTGGACTCGATCGTGGAA
2   F07   BP0850-366                                        BP0850
                        TGTCGCCGGCGACTACAACAACGCCCGCGCGCTGGGCGAAGTCATGTACAC
2   F09   BP0851-96                                         BP0851
                        TCTGCTGATGTCCATCGAGCTGGTGCTCCTGGCCGTCAACATGAACTTCGTG
2   F11   BP0852-1886                                       BP0852
                        CCCGCGTGGTGGGCTGGGTGGCCGCGATCAGCCGCCATCTGCAGTCCGGC
2   F13   BP0853-566                                        BP0853
                        TCGTCTACCTGTGGAACGTGTCGGGCGGTTCGTTCGACATCCAGACCTGGC
2   F15   BP0854-56                                         BP0854
                        TTCTCGGGCTGGCCATCCTGCTCATCGACGCGGTCAGTTCCCATCCTGAACG
2   F17   BP0855-211                                        BP0855
                        AACCGCTTTGCGCAGGCCTGGGAGTTCTATGCCATTACGTTCAGCCTGTTCC
2   F19   BP0856-101                                        BP0856
                        CGGTCCAGCTGCCATCCGTCACGGTCGAGGGCGAGTACTCGTCCTATCAAC
2   F21   BP0857-1366                                       BP0857
                        ACGATCAAGTTCAACGAGCAATGGCAGGCCAGCGTCGGACTGCGTTGGGAC
2   F23   BP0858-116                                        BP0858
                        GCGATCTCACCGAGGACCAGGCATGGTTGCGCCTTTGCGCGCGGCAGGGAA
2   H01   BP0859-546                                        BP0859
                        CGAAGTGGCCGAATTCGGCATCCGCATCAACTGCGTCGCCCCAGGACGCAT
2   H03   BP0860-716                                        BP0860
                        ATCCGCTCTCCCTGGGGGTGATCGGCAACGCCATGGGCACGCGCAGTCCGG
2   H05   BP0861-281                                        BP0861
                        GCACCAGCGCGACCCATGGAACGAACCCCAGCACCTACGCCAACCTGCCGT
2   H07   BP0862-551                                        BP0862
                        TGGTCCGCTGGAGCGAGTTGGCGGAATCGCCCTTGATAGGCATGAGTTACC
2   H09   BP0863-221                                        BP0863
                        CCGACTGCCGCATCCTGGCGATGGACATGGACTCGACGCTGATCAACATCG
2   H11   BP0864-3316                                       BP0864
                        CAGCGCCAGCGCCATATCAAGCTGTCCGGCCAGGACAAACTGCGGGTGGAG
2   H13   BP0865-596                                        BP0865
                        GCCATGCCCCGCGCCTGGTGGCGGGCGCGTTGCGCAATTTCAAGGTGACCT
2   H15   BP0866-366                                        BP0866
                        CGATCTGGCGTTGGACGCCGGCGCGGTCAACATCAAGGCCAAGACCAACGA
2   H17   BP0868-556                                        BP0868
                        CGCGAGATGGGTTCGTGGGTGCTGACGCACGAATCGATGCGCATCCCCGAG
2   H19   BP0869-311                                        BP0869
                        GGCCCGCCGCCAATTCCACCCTGATGGGGCTGTATGTCTCCGGCGGCAATT
2   H21   BP0870-326                                        BP0870
                        CGCAGACCCAGGTTATGGTGCGGCGCGCCTATGATCCCTATTTCTACGGCG
2   H23   BP0872-41                                         BP0872
                        AGGCCGTTCTCGGCTTTACTTTCAGGCACTGGGCCAGGCAACCCTGGCGCA
2   J01   BP0873-481                                        BP0873
                        GACCAGATGGAAGGTCCGCCCTTTTCCGTGGACGACGCCGAAGTGCAGGCG
2   J03   BP0874-1                                          BP0874
                        ATGGGCATGAAATCGATACTCGGGCTGTTGCTTGCCGCGGCGCTGCTGGGC
2   J05   BP0875-1                                          BP0875
                        ATGAAATTCTGCATGGCGACATTGATGCTGGCGGCCAGCCTGGCGCTGGCC
2   J07   BP0876-236                                        BP0876
                        CGGCGCAGGTGTCGATGGAAACGCTGACCGAACTGCAGAACTACCTGGACC
2   J09   BP0877-161                                        BP0877
                        AGGTCGTGCTGGACGCGGCCCAGGACGACACCCTCAATCAGCGCCTGGCCG
2   J11   BP0878-621                                        BP0878
                        GTACTTCGACATCGGCACGCGCGAGCAGACCACCGCGCGCTTCCAGATCAG
2   J13   BP0882-746                                        BP0882
                        AGCACTGGGGCAGGCCGTACCGCCTGATGGAAATCGGCATCAAGTCCTATC
2   J15   BP0883-41                                         BP0883
                        AAGACATTGATCGGATTCTCGAAATCGTGAACCGGGTCGACGACATCGACCT
2   J17   BP0884-186                                        BP0884
                        CCCGTTCGAGAAGGCGCGCCACTTCCGCAAGCGCTTTCGCAACACGCCCAT
2   J19   BP0885-146                                        BP0885
                        GCCGCTACGAGGTGCTGGACGGGCCGCAAGCCTGCCGCAAGTACCTCGCC
2   J21   BP0886-651                                        BP0886
                        GAACATGTTCCTGGAGGACCGCACCCTGTTCGGCACCGCGTATCCGGTCAA
2   J23   BP0887-666                                        BP0887
                        CATGGCCTGGTCGGTGGATGTCGCGGCCTGCGAGAACGAGGCCTTCAATTT
2   L01   BP0888-531                                        BP0888
                        GCGCGACGCCACCATCTATGACTTCTACCGCGAACAGTACGGCATCAATATC
2   L03   BP0889-66                                         BP0889
                        CCGGGAGATGGACATACGGACCGTCCAGGTCTACTCCAGCGCGGATGAGGA
2   L05   BP0891-681                                        BP0891
                        CGCCGCGCTGTGCCATGAGCTGGGCATCAAGCGCCGCTTTACCCGACCTTA
2   L07   BP0892-96                                         BP0892
                        GCAGTTCGTGACGGCATTGACCACGCTGCGCTGCATCGAACGCAATGCACA
2   L09   BP0893-71                                         BP0893
                        TGCTGTTGACGGTGACTGCCGAAGGCGGCACCGAAGTCGATGCAGCGTTTT
2   L11   BP0894-336                                        BP0894
                        TGCGCAGGGGCAGCCGCTTGACGACACGCAGGACCTCTACACGCATGCCTT
2   L13   BP0895-81                                         BP0895
                        GGGTTTCACGAATCCCAGCCAGAAGGGGCGCGAGGCCAACCGCGAAGACCA
2   L15   BP0896-76                                         BP0896
                        GCGTTCATCCAGACCGCGCCCATGGACGGGGCCGGGCAGGCCGAGCCGCA
2   L17   BP0897-756                                        BP0897
                        CGAACGCTTCATCCAGTCGGCCTTGCGTGAGTGGACTTACGCTCACACCTAC
2   L19   BP0898-166                                        BP0898
                        GGCGTCGAGCTGGACTGGGAGAACAGTTTTTTCACGCGCGCGGGCGATCTC
2   L21   BP0899-651                                        BP0899
                        TACCAAGGCGGTCGAAAGCCTGCTGAACTACGAGACCGTCAAGTATTTCGGC
2   L23   BP0900-631                                        BP0900
                        AAGTCGGCGGCGCAGGTGACGCTGCGCTGGCATCTGCAGAATGGCCTGATC
2   N01   BP0901-476                                        BP0901
                        CCTCGATGCATGCCTGGCAGTTCGCCAAGGCGCTGTACCTGGCCGACCGGC
2   N03   BP0902-11                                         BP0902
                        GCCAGCATTTCTATTTCGTCTGGGGCATGCCCATCGTGCTGGGCGCGCTCAG
2   N05   BP0903-651                                        BP0903
                        CAACGAGTTGTCCACGCCGCTGTTCCGCCTCTGGCAGCAGACCGAACTGCA
2   N07   BP0904-591                                        BP0904
                        CAGCGAGCCCGTGGTGCTGGGCAATGTCTATCACATCGACACCCAGGGCTG
2   N09   BP0905-2056                                       BP0905
                        GCGGTCGATGTCTGGTTCTCCGGCTACACCGCGCAGCAGACCACCACGGTC
2   N11   BP0906-806                                        BP0906
                        AGCAACCCGTATTCGAACCGGACGAGGTGGACCTCGACGCGGCCGGCTATT
2   N13   BP0908-226                                        BP0908
                        ACCATCGACATGAACACCAGCTTCATGTCCCCGGGGCGCGGCGACCTGGTC
2   N15   BP0909-221                                        BP0909
                        ACGTTCCCCCCGATTTCAATCGCTACCGCGAGGTGTCGCGCCAGGTGCGCG
2   N17   BP0911-351                                        BP0911
                        GGGCGACCGCCAATTGGTCCAGGTACGGGTATGGCAGACCATGCGCCCGAT
2   N19   BP0913-136                                        BP0913
                        TGGGCCCAGCCCTACGGGCTGAAAACGGAAATCTCGACCTACAGTTCGGCC
2   N21   BP0914-306                                        BP0914
                        GCTCATCGGGATACCGCTGGGCTTCTGCCTGGGCCTGATGCCGTCGGTCCA
2   N23   BP0915-466                                        BP0915
                        AACGTAGTGGCCGGCATCGAGAACATGAACGTCAAGGTGTTCTGGGTCGCG
2   P01   BP0918-611                                        BP0918
                        GCATCCAGTCATACCTGGACGATCCGTGCATGGCCAAGCCGTTCAGTCCCGG
2   P03   BP0919-686                                        BP0919
                        AGCAGGATGTGGCGTTCTATACATTCACGGGCAGTACCCGGGTCGGGCGCA
2   P05   BP0920-286                                        BP0920
                        CGGCCGTGGATGCGCAGCCATGGCGTACGGTTTCAGAACTCGCTGTCCGGA
2   P07   BP0921-161                                        BP0921
                        CGATGACGCGGCGCCTCGACTTCGTGAAAGAGGATGTGCACTATCTCGCCA
2   P09   BP0922-971                                        BP0922
                        AGGAGCAATTGCGCGGCGATACCGGCAGCGAGATCCGGCTTGGCCATCCAT
2   P11   BP0923-616                                        BP0923
                        ATTGCCGCCCGGGACTGGTTTCGCAATATATTCATCGAGGCGGACCCGTACG
2   P13   BP0924-196                                        BP0924
                        GTGCAGGCGGTTTCGGAGAATCCGGTCAAGTATGTCGCCGTCGATCCCAAC
2   P15   BP0925-501                                        BP0925
                        GAAGAAAACACCGCAATGGACCGTGGGCAAGAATTTCGACCGTACCGGCGG
2   P17   BP0926-451                                        BP0926
                        AACCGGCTTCCGTATCACACGGATTCATCGGACATCGTGGGCCTGCTGTGCG
2   P19   BP0927-476                                        BP0927
                        CCGGCATCGGATCGGCCAATCATCTTTCCGGCGAGTTGCTGGCCCTGATGA
2   P21   BP0928-656                                        BP0928
                        AATTGATCGAAGAGGAGTTCGTCAGCGCAGGGCTGCGGCCGCCCGTGCCGA
2   P23   BP0929-106                                        BP0929
                        TCCACACGGCCGACGTTCACCGCGGTCCTGTTCTTCGCCGCCCTGCCCTTTC
3   A01
3   A03   BP0930-616                                       BP0930
                        ATCATGATTCCGCACGGGGCGGCCTGGCACTGGGGCAAGCACAGCGTGCAC
3   A05   BP0931-576                                         BP0931
                        ATTGATCAGCGACAGCATCGCCGGGCACGTTCCCATGGTCCTGTCCGCGCT
3   A07   BP0932-101                                         BP0932
                        TGCTGTTGCCCCAGTGCGTCCGGTGCGAATGCTTCCATTGGCATCCCCGCG
3   A09   BP0934-46                                          BP0934
                        ATGGAAGATCAGTTCGATGAATGGTATGTGAACCAGCATCTTCCCGACGTGC
3   A11   BP0935-326                                         BP0935
                        ACATTCCCTATCAACCCCTGACGGACTTCGAGCCCATTTCCATGCTGGGCGG
3   A13   BP0936-436                                         BP0936
                        GTGCGCTATCCGCTGGATGCGTTTCCGGGCCTGGAGCTCGAACTCGTGGAC
3   A15   BP0937-226                                         BP0937
                        AACTGGATTTGGGCGATCGCTGATGTCGATCCTGCAGTCTTGGATGAAACTG
3   A17   BP0939-71                                          BP0939
                        ACCACGTTTTCACCCACCCAGACCGCCCCGGACATATCAGCGTCCCTCACCC
3   A19   BP0940-596                                         BP0940
                        CCAGGCTGCTGGGCCATGTGATGCTGTCCCTGCTTGTCTTCACCGGCATGTT
3   A21   BP0941-176                                         BP0941
                        TGTTGCCCGACCATCCCGACTACGAGCCGACGCGGCTGCAGTTCCTGGAAG
3   A23   BP0942-616                                         BP0942
                        GCCGGCCTGGAACCCACGGGCATGCGCGGCATGGAGTACAACCCCATTACC
3   C01   BP0943-51                                          BP0943
                        GGCCTCTGGTGCAGCTTCCGCGCAAACCGTGGACAACTGGCGCAATCCGTT
3   C03   BP0944-156                                         BP0944
                        GCACGAACTGAACAACGATTGGAACCGTGCCTATAAGAAGTCCGCGCGTATC
3   C05   BP0945-451                                         BP0945
                        CGCAAGGATTCGGCCTATCTGCACCTGTGCAGCAACGAAACCATAGGCGGC
3   C07   BP0946-956                                         BP0946
                        GCCAGTGGGAATACTATTTCTACGTCGACGTGCTGGGCCATCGCGATGACGC
3   C09   BP0947-691                                         BP0947
                        GATTTCACGCGCATCGCGGCCGGTTCGCCGGAAATGTGGCGCGATATCTTTT
3   C11   BP0948-576                                         BP0948
                        CATCACCATCGAGGTGGTGGGCGAGCTGATTTCCAAACCCTATATCGAGATC
3   C13   BP0949-411                                         BP0949
                        CGTGTTTCCTGATGCGTCCCTGAAAATATTTCTGGTGGCCGATGTCGAGGCG
3   C15   BP0950-1081                                        BP0950
                        ATGAAGCAGTGCCGCCAGAACCCGTGGGAAGAGTTCGCCACCAACTTCAAG
3   C17   BP0951-71                                          BP0951
                        ACGCTGTCAAGACCATGCTCGATGCAATGACCCAGGCCCTGGCCTCGGGTC
3   C19   BP0952-46                                          BP0952
                        GTTCTGATGTTCGCGCTCAAGAACACCAATCCCGTCGCCGTGACTTTCTATG
3   C21   BP0953-491                                         BP0953
                        TCAAGACCTTGCACGGGCTGGTCGACGAGCCCGTGCCGCAGATCGTGCACT
3   C23   BP0954-711                                         BP0954
                        CATGACCCTCTTTACCGACGCGGGGCGCGACCATGCCGACGCCGCCGCGCA
3   E01   BP0955-576                                         BP0955
                        CGAAGGCCATGTGCGCCTGTTCGCCGGCTGGGATGGCTACGAGGACGGCG
3   E03   BP0956-316                                         BP0956
                        CGCTTCCTGTCGCTCGAAGACCTGTCCGAGCGGGTCAGCGGCATCGGCCAC
3   E05   BP0958-526                                         BP0958
                        GTCACGCATTTCGTCAGCGCGATGGGCACCACCGGCACCATCATGGGCGTG
3   E07   BP0959-1031                                        BP0959
                        AATACCGTACCGCCACGCCCAATTTCTTTGCCCTGACGCAATACAACCGCAG
3   E09   BP0960-41                                          BP0960
                        ATGAAATGGGCGACTGGCATCCCGAGAGCCCGCAGAGGCTCGATGCCATTT
3   E11   BP0961-91                                          BP0961
                        GTGAAGATGTCCATGAACCCGTTCGACGAGATAGCGGTCGAGGAGGCCACG
3   E13   BP0962-391                                         BP0962
                        AACGCGATCGCCACGGTGCAGTCGGGCGATGCGGTCAAGGTGATCACGGTG
3   E15   BP0964-1541                                        BP0964
                        AATTCATTCTGGCGCACGCCGCGTCCAATGTGCGCGCGGTGTATTCGAGCAG
3   E17   BP0965-206                                         BP0965
                        CCTTGTCGGTGGATCCGGTCGATTCGCACACCAAGTGGATCGACGACATCAA
3   E19   BP0966-351                                         BP0966
                        GCGCAACAGCTCGCCCTATACCTCGACCATCGTGTTCCTGGTGCGCAAGGG
3   E21   BP0969-256                                         BP0969
                        TTCAAGCACATGACGGTGTTCGAGAACGTGGCCTTCGGCCTGCGCGTGCGG
3   E23   BP0970A-446                                        BP0970A
                        TTTCCTTCCGCGACGAGTTCGGCCAATGGGACCCCAAGGCCCAGCGCCCGG
3   G01   BP0972-951                                         BP0972
                        CCAGCGTGTGCTGCACCGTATCGAAGATCTGCGCAACGGCCGGCGCAACGA
3   G03   BP0973-216                                         BP0973
                        GCAAGCCGCCACGCAAGTATTGAGCACCAAGGCCAAGATCATCGACGTGCTG
3   G05   BP0974-751                                         BP0974
                        GAAATGTCGATGATGCTGGGCACACTGGCGGGAATGTTCCTGCTACGGGAA
3   G07   BP0975-166                                         BP0975
                        AACCGCGGCCTGAACTCGTCGTTCATCGTGCGCAAGATCTCGTCGGGCGAA
3   G09   BP0976-461                                         BP0976
                        ATGCGTTCGAAGTGGCCGAGGTGTTCGAGGTGCCGCTGTCGTTTCTCATGG
3   G11   BP0977-361                                         BP0977
                        CTCAAGCGCCTGCAGACCGATTACCTGGACCTCTACCAGCTGCACTGGCCCG
3   G13   BP0981-316                                         BP0981
                        CGCCTGCTGACGCGCCCGCTGGCCGACATGCTGTACCACGATCCCGGCATC
3   G15   BP0982-186                                         BP0982
                        GCGTGTCACCATCTTGCTGCACAAGCCCGTGGGCTATGTATCGGGACAGGC
3   G17   BP0983-396                                         BP0983
                        CGCCGAGCGGGTTTTCCAGACCTGCGATGTGTCGATCGAAATCGGCGATCT
3   G19   BP0985-91                                          BP0985
                        CCGGTCGCGCAATATCCGAACATCGCGCCGCCCGCCATCAGCATCAACGTG
3   G21   BP0986-1196                                        BP0986
                        CGCAGCAGCGTTACCAGCAGGGCATCGACAACTATCTCAGCGTGCTGGATTC
3   G23   BP0987-66                                          BP0987
                        GGGAGACCAGAACATGGGCTACATCATGACGACGATCCTGGGCATCATCGG
3   I01   BP0988-76                                          BP0988
                        GAACGTTCGGCGGATTGGTCGCTGTACAACGTCAAGGGCCATCTGCCCGAC
3   I03   BP0989-1766                                        BP0989
                        CGTGGCATCGCCTGCCCCACAGCTTCTCGCACCTGTTTGCCGGCGGTTATG
3   I05   BP0990-386                                         BP0990
                        TGCTCATGACCGGCCAGCCGCTGTTTCGCCCCTGCACGCCCTACGGCGTGA
3   I07   BP0991-276                                         BP0991
                        GATGGCGGTGTCGACCATGAAAAAGGGCGCCGTGGACTTCCTGGAAAAGCC
3   I09   BP0992-1601                                        BP0992
                        GGCTGAACATTTGCCGTACCATTATCGAGTCGCACCACGGCCGTCTGTGGGC
3   I11   BP0993-41                                          BP0993
                        ATGACGAAGACACCCTCGAGACACAGGAATGGCTGGAAGCATTGGCCGCCG
3   I13   BP0994-946                                        BP0994
                        TGGCCCAAGATCGATTTCACCAAGTTCGGCCCCATCGAAGCCAAGCCGCTGT
3   I15   BP0995-1031                                       BP0995
                        TGTGGCAGAAGATGAACGCGCCGCGCTTCGACAACATCATGCTCAAGACCAA
3   I17   BP0996-281                                        BP0996
                        AACTGACGGTTCAGGCCTCCAACGGCACGAACTCGGCTTCGGACATCGACTC
3   I19   BP0998-221                                        BP0998
                        AATTGCCGGGCCGCATCACGCTGGTCCAGGGCCTGCCGGCCGGCGACAAG
3   I21   BP0999-1646                                       BP0999
                        CGCAGAAAGCGATTGTTCGCGGTGGTTACGTCTTGCGCGACGCACACGACG
3   I23   BP1000-876                                        BP1000
                        GGCCTCCAGCAACTTCGACGCGACCCTGACCAAGGTGTCCGGCAAGCTGGT
3   K01   BP1001-371                                        BP1001
                        AGAAAAAGGACGACGAAGGCTTGTCGCGCAAGATGGCGGCGCTGTGCGATG
3   K03   BP1002-431                                        BP1002
                        TCTGCATGACCTACTACGGCTCGCAGATGGTGGTGGAGCACTACAACATGAT
3   K05   BP1003-751                                        BP1003
                        GTGCTGTGGATGATGGAGCGCGGCATGAGCCACGACGACATCGAGCATCTG
3   K07   BP1004-376                                        BP1004
                        ATCAGCCATGTGTTCATCATGGACGTGCCCACCTATCCCGAGCCGCTGTTCA
3   K09   BP1005-801                                        BP1005
                        GCAGTACAACCTCTACGCCAAGGTCGATACCGAAGCGCCGCGCTACCTGGA
3   K11   BP1006-186                                        BP1006
                        GCATGCCGGCTTCCATCTCACCGAGTCCAGCGCCATCCAGGAATACCTGGAA
3   K13   BP1009-426                                        BP1009
                        CTTCTTCAACCACCAGACCCACCACCGCGGCCAGGCCACCACCCTGCTGTCG
3   K15   BP1010-216                                        BP1010
                        CGAAGGCTTTTCCACCTTTGCCTGCCGCCCCCTGCTCAACCTGCACGACCTG
3   K17   BP1011-256                                        BP1011
                        CAGGGCTTCGAGTTCCACTACGCGCGCGATGGCGAGGGCGACCAGCAGTTC
3   K19   BP1012-51                                         BP1012
                        ATTGAGCGCCGAGGAACTGGCCCATGCCTGCGACGCGGAAGTCGAGTGGGT
3   K21   BP1014-311                                        BP1014
                        CCATCGCCTGGAACCTGGGCACCTGGTATTTCGGCATCCCGGCCTCCAGCT
3   K23   BP1015-541                                        BP1015
                        GTGCCCTATTGCATCGACCTGATCGGCGGGCCGTACGCCGAAACCGATCCG
3   M01   BP1016-56                                         BP1016
                        ATGTGAAGGATATCCGTGACCGCGAGCCGGCCTTCTACGGCTCGCCCCAGC
3   M03   BP1017-656                                        BP1017
                        TCGTCGACCACGGGCAGGGCTTCATCAGCATGTTCTGCCACATGTCGGAGA
3   M05   BP1018-136                                        BP1018
                        ACCGGCCTCACCTACGCCCAGGCCCAGGTCAAGTACGACAACTGCCTGGAC
3   M07   BP1019-151                                        BP1019
                        GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
3   M09   BP1021-401                                        BP1021
                        TCCTGCACTACGAAGATTTCAATACCGACGGCGACAGCGACAGCCCGTGGG
3   M11   BP1022-41                                         BP1022
                        AAGTCAATCTTTCGTATCTGTTGCTGGCCCAGCGCATGCTGCGCGACGACTA
3   M13   BP1023-176                                        BP1023
                        TCTCGGTGGACTGGTTCATGACCTGGCTGCCGAACATCCATTCCTCGCTGTT
3   M15   BP1024-286                                        BP1024
                        GCCATCGAATCGCACATCGAGGATCCGCTGTCCAGCCCGATCTTCAATGAGT
3   M17   BP1025-771                                        BP1025
                        CCCGTTTGCTGCCGTTAACAGACGTATCAGTCTGGTGGTGCTCAATGCATCG
3   M19   BP1028-286                                        BP1028
                        GAAACGAAAGACGTGCTCAAAAGCCAACTGGACGCCTACCGGGCCTCCGAA
3   M21   BP1029-221                                        BP1029
                        GCATCAAGTTCAACCTGGGCAGCGTCGAATACAACGAGCAGACCGTCGTCAT
3   M23   BP1030-301                                        BP1030
                        GGCTTGCTGCAGCGCGCCAAGGCTTCGCTCAACCGCGCCGAGACCGAATAC
3   O01   BP1032-76                                         BP1032
                        CATCCGGACATGGAGGTGGTCGCGACCGCGCCCGATCCGCTGGTGGCGCG
3   O03   BP1033-56                                         BP1033
                        GCATCATACGCAACCTGCTCAAGGAGCTGGGTTTCGAGAACGTCGACGAGG
3   O05   BP1034-406                                        BP1034
                        GCGCAGGATTTCCAGGACCTGACCGGCCAGGTCATCATGCGCATGATGGAC
3   O07   BP1036-896                                        BP1036
                        AGCAGGTCGATGGCTGGCTGGGCGCGGCGACGCTGGAGCTGGATTCCGAT
3   O09   BP1038-591                                        BP1038
                        ATTCGACGAGGACGAGGAAGAATCGATCTTCCCCGAAGGCGAGAACCAATGG
3   O11   BP1039-156                                        BP1039
                        GAACCGCGAATTCCGTGGCCGCGACTACGCCACCAACGTGCTCACGTTCGA
3   O13   BP1040-791                                        BP1040
                        TGAAGATGTTCCTGACCCGGATCGGTTTCGGCAGCAAGGCCGTCATTACCGG
3   O15   BP1041-941                                        BP1041
                        ACTTCCAGAAGACCATGAAGCTGATCGAGGACGTCGGCTTCGACACCTCGTT
3   O17   BP1044-61                                         BP1044
                        GTATCAAAGGCCAAGCTGGATTGCACGTTGCTGACGGCTGAGGCTGACAAG
3   O19   BP1045-61                                         BP1045
                        ATCATCAGCCTGGTCACGTTCCTGGCGGCCGTGTTCTTCATCATCACGCGCG
3   O21   BP1046-1351                                       BP1046
                        AACATCGCCAAGGGTTTCTACTCGACGCTGTATGGCTTCATCGCGATCGCCA
3   O23   BP1047-91                                         BP1047
                        ATGTTCGTGATCCTCTATTTCCTGATGATCCGCCCGCAGATGAAGCGCCAGA
3   A02
3   A04   BP1049-216                                        BP1049
                        CATGGAAAAGCACGGCGGCCTGCACGGCTTCATGCAATGGGACAAGCCCAT
3   A06   BP1050-631                                        BP1050
                        TTCCAGCCGGTGCGGGTGCAGAACCTCGCCGAGCACATCATGCACGCCGAG
3   A08   BP1051-191                                        BP1051
                        TCAACGCCAAGGAGCCGCGCAATCCGGCTTCCGTCATGAAGCTGGTGACGA
3   A10   BP1052-71                                         BP1052
                        GCACCAAGAGCTTTCGCGAGCTGTCGCAGGAAGTCGCGGCCCTGCTGACCT
3   A12   BP1054-1836                                       BP1054
                        GGCGGTCAACACGGGTGGGGTGGGCCTGGCCAGCACGCTCTGGTACGCCG
3   A14   BP1055-301                                        BP1055
                        AACGTGGTCGACGATGCCGAACTGTCGTCCTTCCAGGTGCCGTCCGTCGTC
3   A16   BP1056-581                                        BP1056
                        AGGGCCTGACCTTGCCGATTCCCGGCATGGACACCACGGTGACCGATTGGT
3   A18   BP1057-46                                         BP1057
                        GACAGCGTCAAGACCAGCCTCAATGATGCCGAGACCTTGCTGCGCGAAGCC
3   A20   BP1058-46                                         BP1058
                        GGACTGACGCGTACACGCCTCGAACTACTGGCGCTGGAAGCCGCCGGCGAA
3   A22   BP1059-161                                        BP1059
                        AGGCCAATACCTCGCGGCTGTTCTGGCAGGCGTTCGCGCTGGTACGGCGCT
3   A24   BP1060-981                                        BP1060
                        GGACTGGTTCCCGGTGTTCACGGTGGACCGCATCACCATGCGGCGCAACCC
3   C02   BP1061-346                                        BP1061
                        CCGAACCGTCCGTCCGCCGCCTCGAGCGCGCAGGTGGAGGCATTGCGCAA
3   C04   BP1062-581                                        BP1062
                        GCGAACGCCAGGGCTTCAGCATCGTGGACGAAATCTACCTGGGGCTGTCGT
3   C06   BP1063-641                                        BP1063
                        GCGAACCGGCAGGCGTCAATCTGGCGCATCTGTTGCTCGGGCATGACAGCG
3   C08   BP1064-41                                         BP1064
                        AGCATGGCCGCCCCGGCAAGATTTCGGTCACCCCCACCAAACAGCTGAGCA
3   C10   BP1066-301                                        BP1066
                        GATCCGGCATTGCACGAAGACAGCAATCTCATCGATGGCGTATGCGCCGATA
3   C12   BP1068-556                                        BP1068
                        GACCCGATCTCCACCGCCAAGATCGAGGAACTGATCGCCGAACTCAAGCACG
3   C14   BP1069-316                                        BP1069
                        ACGCGCTTTCTCAACGACGTGCTGCTGTCGGCGCCGTCCATCATCATCGGCC
3   C16   BP1070-71                                         BP1070
                        CTTCGCCTATGAAGCAAAACAATAACGCGCTGATGGATGCGCTGTTCAAGAA
3   C18   BP1071-116                                        BP1071
                        ACGCCAAGTGGGCCTCCGACTACAAGGCTGCCACCAACAACGCCGTCAACT
3   C20   BP1072-1761                                       BP1072
                        TATCCGGGTGCGTTCCATCGTGGGGCGCTTTCTGGAGCACTCGCGCGTGTT
3   C22   BP1073-41                                         BP1073
                        GCTTTCGACTTTCTATCGGCCGCGTCGTCCAGCAGGATGGCACCGCCCAGA
3   C24   BP1074-156                                        BP1074
                        CGCCGTGTTTCCCCAGGCACAGGACGGCGTGGAGCAGGACCGCTTCGACCA
3   E02   BP1075-316                                        BP1075
                        GGTATCGTGATCAGCGCCTCGCACAATCCGTACCAGGACAACGGCATCAAGT
3   E04   BP1076-536                                        BP1076
                        ACCCCCGGCGCATCGTGCTGGACCCGGGCTTCGGGTTCGGCAAGACCATGG
3   E06   BP1077-226                                        BP1077
                        GACCTGTGGATGGTGTCGGACCTGCTCAAGTACGGCGTGCAGGTTTCGGGC
3   E08   BP1078-486                                        BP1078
                        GTTGATCGTCAAGGCTTTCCACGGCAGCGGGTTTTCCCAGATCGTGCAGTCG
3   E10   BP1079-316                                        BP1079
                        AAGCGCCGCCCTTCCGAGCCTCATACGCCCAAGAAGATGGCCGCCGAAGGC
3   E12   BP1080-536                                        BP1080
                        TGGCCTTCACCGACATCCACCCCGACGAGCGCTTTCCCAGCGCCGTCCAGT
3   E14   BP1083-536                                        BP1083
                        TCTCGGGTATTGCCTGCTGGCGCAACAAATGGCCGTTCCTGGTGTACGGCG
3   E16   BP1084-646                                        BP1084
                        TTCTATTTCGCGGGCTGCGATACGTGGCTGTTCGACGTGGCGGTCAGCGTC
3   E18   BP1085-726                                        BP1085
                        CTTGCAATGGTGGCCGGCCATACGGCTGCCCAGCGACGCGCAGGTGGTCGA
3   E20   BP1087-346                                        BP1087
                        ATCTCGTTCTACGACATGGCCCAGGCCATCGTGGCCGCCCAGCAATTCGAAA
3   E22   BP1088-361                                        BP1088
                        CTGATCGTCACCTCGCTCTTGTTGATCATGACCATCGACAAGACCTTCAACGA
3   E24   BP1089-261                                        BP1089
                        GCTGTCGGCGGCCCTGGGCGGCGTTGAAATCGTGTTGTCCGGCGGTTTTTT
3   G02   BP1090-731                                        BP1090
                        GTTTCTGCCACGGCGTGATGAATACCGACAACATGTCCATTCTCGGCCTCAC
3   G04   BP1091-86                                         BP1091
                        GGTACGGGTTCAACGTGGTGTGCGCGTGCGGCGACGCGCCGTCCCTGTATC
3   G06   BP1092-116                                        BP1092
                        AGCGCCATGTCGAAACAGCGGCTGCTTCGCTGGCCTGGGTGCTGTCGCAAT
3   G08   BP1094-401                                        BP1094
                        TGCGCGCCGATATCGAGACGCGCATCATCGACTTCCTGGAGATCGACCATAT
3   G10   BP1095-251                                        BP1095
                        TGGCGATCCGCCCGATGCTGGGCGAGTCGCCGATCTCGGTGTTCATGATCA
3   G12   BP1097-241                                        BP1097
                        GTCAATTTCTACTACGGCGATTCGACCGGCTTCTCCAAGACCATCAACGCCG
3   G14   BP1098-531                                        BP1098
                        CCTGTCGCCCATGCTGGTCGAGAGCATTTTCTCGATCATCGCGCGCATCAAT
3   G16   BP1099-761                                        BP1099
                        CCGAACAGATGCTGTCGACCTTCGTGCCCGTCTACCTGGGCTCGCAGGTCA
3   G18   BP1100-156                                        BP1100
                        GTTCCACCATTTCCGCAGCAAGGAGGAGATCCTGGTGGCGGTGATGTCGGA
3   G20   BP1101-196                                        BP1101
                        TATCGCGGCCAGGCCGATTTCCTGCAACAGGTCGCCATCGTGCTGCTGGCC
3   G22   BP1102-786                                        BP1102
                        GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
3   G24   BP1103-461                                        BP1103
                        GCGTCTATTGCGCCGCCAAGGCCGCGCTCGACATGTACAGCCGCGTGCTCA
3   I02   BP1104-51                                         BP1104
                        GGAGCGCGAACAGGCTCTACGGAGGTATCTTGACTACGATGCCAAATCGGA
3   I04   BP1105-286                                        BP1105
                        GCCCTGTCGGCCATGGGCGCCGACGTGGATTTCCTGGTTCCCAACCGCTTC
3   I06   BP1106-561                                        BP1106
                        CGTCGCCATGCGCCCGTGGCGCCGCCTGCTCAACGAAATCCAGATGGTCTG
3   I08   BP1107-126                                        BP1107
                        TTTCCAGAAGGAAGTGCGCGACCGCATGCTGTCGGTGTTGCCGCATATCGAA
3   I10   BP1108-546                                        BP1108
                        TCGCCATACGGCGCACAATATGTTCGAGCTGCTCACGCGCGTGAACCGCGA
3   I12   BP1109-116                                        BP1109
                        AGCGCGCCAACTTCGCAACCGTACGCCAGCTTGCCCATGCCGTGGATAGCG
3   I14   BP1110-146                                        BP1110
                        CCCATTATTCGGGCACGAACCTGAGCGCCAATCGGGAATGGGTGGTGTACG
3   I16   BP1111-6                                          BP1111
                        GGCCTTTTGCTTGTTCGAGGAATGTGTTGCCGGCATTGCGAGCCGGCACCC
3   I18   BP1112-436                                        BP1112
                        CTGCAAGGCGGGTTGAGCCACGATTTCGAGTCGGGCCGCACGTCGCTGCAA
3   I20   BP1115-51                                         BP1115
                        TCATCGCATGGCCTATTGGGAATGGGGCGACCCGCTCAATGATCGCGTGCT
3   I22   BP1116-581                                        BP1116
                        CGCATCCGGGACGCTACAAGTACAGCCCCATGCAGTTCGACGCGTTGTACG
3   I24   BP1117-186                                        BP1117
                        GTCCAACGGCGACCGCTCCGAGAATGGCGATTACCTGTACGGCAAGAAGCG
3   K02   BP1119-296                                        BP1119
                        ATTTCGAACCGGGCCCGACCACTGACTACAGCACCGGCGACTTGCGGGCAT
3   K04   BP1120-1246                                       BP1120
                        TATCGCCAGAAGCTGATGGGCTTCGTGTATCACTCCGGCCAGTTGATGCGTC
3   K06   BP1121-1631                                       BP1121
                        TCCGCCAGGTAGGCATCTACTCGGCGCAGGGACAACTGTACGAACCGGAAG
3   K08   BP1122-186                                        BP1122
                        GCAACTGGGCCTGAACCTGAATGTGTTCATCCAGGTCAGCCTGGAGAAGCAG
3   K10   BP1123-71                                         BP1123
                        GGGCGCTGATCACCGTCATCTTCACGGCTTCCAATGTCTTTCTGGGCCTGAA
3   K12   BP1124-66                                         BP1124
                        AGAGCTCTACGAATCGTATCTCGACAATCCCGGCTCGGTGCCCGACAACTGG
3   K14   BP1125-66                                         BP1125
                        CTGGAAGAAGCAGGCGGGCGCCGCGGTCGAGGCCGACGAAATCCTGATCG
3   K16   BP1126-336                                        BP1126
                        GAACAAGGTCACGTATTTCCACGGCAAGGGCGCGTTCGCCGGCCAGGTCGA
3   K18   BP1127-966                                        BP1127
                        GTTCTACGACCACAAGGTCAAGCTGATCATGTCGGCCGAAGTCGAGCCCGAG
3   K20   BP1128-231                                        BP1128
                        GTGGTGGGAGAACCTGGCCATCGTGGTGAACAATGCCGGGATTTCGCCCAA
3   K22   BP1129-706                                        BP1129
                        GCCGGGGTGGGGGTATGCATCATTCCGGAAACCTCGCGCATGGTTCATATC
3   K24   BP1131-681                                        BP1131
                        CACCGGCCCGGACCGCGAAAGCAGCGCCAAGGATATCCCCACCGTGAAGGA
3   M02   BP1132-491                                        BP1132
                        CGGTCAACTGCGTGGCGCCAGGTCCCGTGGCCACGGAAATGTTCCAACGCA
3   M04   BP1136-421                                        BP1136
                        CTCGAAGGGCTGGGCTATGCCGAGATCGCGCAACGCCTGCGCATTTCGCTC
3   M06   BP1137-421                                        BP1137
                        CTGCGTATCGACGCGACGCGGCGCGCCATAGCGCTGCTGCGTGGCGAAATG
3   M08   BP1138-1496                                       BP1138
                        ACGTGTTCGATCCGGACTATCACATGGGTATCGAGCGGCCGCCGTTTACGTC
3   M10   BP1139-146                                        BP1139
                        ACGCGGTCGTGGCCGCGTTGATGCTGTCGTTCGTCGTCTATACGTGCGCCG
3   M12   BP1141-171                                        BP1141
                        GGGCGCTTGGGGATGGAACTACGGCACGGTCGAATGGATCGGCATCCTGAG
3   M14   BP1143-1091                                       BP1143
                        GTTTCCGTTTCCGGCTGCTTGCCGCCGACGGGGAAGAGTTGCTGTGCTCGG
3   M16   BP1144-611                                        BP1144
                        ATTCGAAAATGGTCGAGGGCAAGGAAACCGACGGCGCGAACTTCCGCGACT
3   M18   BP1145-1266                                       BP1145
                        GCCCTTGTCGGTGGCACAGGCATTCTCGCGCTATCGCAAGCCCGGCCAAGC
3   M20   BP1146-426                                        BP1146
                        CGCGTCCTACGATGCGTTCAACGAACTGGTCCAGCGCTTCCCCAACAGCAAG
3   M22   BP1147-121                                        BP1147
                        CATTCGCGCAGCCGGCTGCAGGGCTGGATCGAGGCCGGTTACGTTTTGGTA
3   M24   BP1148-586                                        BP1148
                        GGCGTACAGGCGCAATCCTGCGGTTTGTGCACGGTGCAGGACTCGCGATTT
3   O02   BP1149-1066                                       BP1149
                        GTCTCCAATTACCTGAAAGGCAAGACACCGCCTGCGTTCGACCTGCTGTTCT
3   O04   BP1150-331                                        BP1150
                        AACCTGAACAGCCTGTTCAACGTGACCAAGCAGGTGCTCGACGGGATGGTG
3   O06   BP1151-136                                        BP1151
                        CAGGTTGTCGATGCCAAGAGCGGAGAGGATCTCACGCGCAGTATCCTGCTG
3   O08   BP1152-336                                        BP1152
                        CCCGCACTATGGCGACAACGTCAAGCTGGACGGTCCCGGCAAGTACAAGCT
3   O10   BP1153-136                                        BP1153
                        GTGCCGGCGGGGCGCTTCAAGATCGAACTGATCAACGCCAGCAACGAACCG
3   O12   BP1154-481                                        BP1154
                        GGTTTCCTGATCGCACTGCTGACGTTCTGGCTGCTGCAATTGGGTGGCAAGC
3   O14   BP1155-86                                         BP1155
                        GCATCGTCGCTGCGTATGCGTTCCTGTTGATCGTGCCGGTGTTCCTGCCCTT
3   O16   BP1156-41                                         BP1156
                        AATCCTGTTTCGGCGGCAACCCGCTGTGCGTGTTCGAGGACGCGCGCGGTT
3   O18   BP1158-116                                        BP1158
                        CGCCTTCGTTGTGCTGGGTGCGGGCCGGCACGAGCCTGCCGCGCTTTTTCG
3   O20   BP1159-171                                        BP1159
                        GGTCCATCCGAGTGTGTACGGCGCCGACCACAGCAGTTATGAAGACGCGCT
3   O22   BP1160-246                                        BP1160
                        GGATGGCAGCACGCTGCTTTCGGCGACGCCGGGCCAATTGGGGACCTTGCC
3   O24   BP1161-591                                        BP1161
                        GCTGGACTGCAACAACGGCTGGGTGGATACCGTGCAGGCGATGGAATACCT
3   B02
3   B04   BP1162-431                                         BP1162
                        TGCACCCGAATTTCGAGCTGCACAAGACCTGCGCCTGGAGCCTCATCCGGG
3   B06   BP1163-336                                         BP1163
                        GCCCGAGGTCTCCCCGCAGGACTTCGACCGGATCATCCAGGTCAACCTGAA
3   B08   BP1164-656                                         BP1164
                        GCTACGATGCCGTCGCGGGCCTGCTGTGCGCGCTGTTCCTGGCCTTGCTGG
3   B10   BP1165-1211                                        BP1165
                        GGGGAGCCATCGTGTTTCCCGTCATCGCCAGCTTCTACTGGGACCGCGTCA
3   B12   BP1165A-51                                         BP1165A
                        CCTGCTGGTGCTGATCGTCACCCTGTGGCGTGACATCCGCGACGCGCGCGC
3   B14   BP1166-256                                         BP1166
                        TCGTGGCGGGTGCTCGACCAGATCGACTACGGCCTGCTGCGCCGGCACGCC
3   B16   BP1167-541                                         BP1167
                        GTGGTGTGCGGCGAACGCATCGACTACGCGTTCGATGACCTCTACTACCTCG
3   B18   BP1168-331                                         BP1168
                        GTGATCGCCCGCTATGTGAACGAGCACCCCCGGGTGCGCCTGAAATACCAC
3   B20   BP1169-491                                         BP1169
                        GCGCGGCCATCATCCACACCGGCGCGGTCGGCTCGGCGCACGCCATGAAG
3   B22   BP1170-356                                         BP1170
                        AAACGCCGTACCTGCTGGTGGGCGGGCAGGATGTCGCGGGCAAGACGGTG
3   B24   BP1171-366                                         BP1171
                        GGCCACGGCCGGCTATCGCATGATGGTGCCGGTGCACTACATCCATGCCTC
3   D02   BP1174-71                                          BP1174
                        ATGGCGATTTAATCCGCCTGCCTCTGCACTTTTACAAATTTCCCGCCGCGGA
3   D04   BP1175-46                                          BP1175
                        GCGCAGGCCCAGTATGTCGGCCCGTCCAGCAACCAGCAGATGAGCGTGAAG
3   D06   BP1176-241                                         BP1176
                        GACCGCAATCTCAATCGCAACCTGCGCGTATGCGCGACGCCGACCGATTAC
3   D08   BP1178-41                                          BP1178
                        CGGCGCTTTTCGTGCTGCTGTGGAGCAGCGGCGCGATCTTCGCCAAATGGG
3   D10   BP1180-446                                         BP1180
                        CCTTCTGGAGCTACGAGTACGACTGCGTACAGCTCGGCTCGGTGACCAACG
3   D12   BP1181-266                                         BP1181
                        TTCCGCACATGAGCGTGCTGGACAACGTGACGTACGCGCCGCTGCACATCC
3   D14   BP1182-231                                        BP1182
                        CTTCTGGGCCTACTTCGCCGTGCCCAAGCTGACGGGCGGAAGCATCAGCGG
3   D16   BP1183-111                                        BP1183
                        GGTCGTGATACGCACCACCAACCTGGCGCCGTGCCGCTGGTTCGTGGACGC
3   D18   BP1184-231                                        BP1184
                        CGCCTTCAGCCACACCTATTACGTCAGCCCGCAGAAGCTGCTGGTGCGCAAG
3   D20   BP1185-486                                        BP1185
                        GCCACGCACCAAGTGGCTGATGATGAACGCGCCCAGCAACCCCACCGGCGC
3   D22   BP1186-166                                        BP1186
                        GTCGGCCGCGCCATCACGGTCAAGACGCGCCCGGGCGACAACCTGATGATC
3   D24   BP1188-516                                        BP1188
                        GGTGGTCAGCGGCGGCATTCTGAAATGCGAGCAAGGCATCCGCGCGGGGC
3   F02   BP1188A-96                                        BP1188A
                        CTGCCAGAGCGGCTGCATTCCGTGCGTCTACGATCTCTACGACGAGGCGCG
3   F04   BP1189-316                                        BP1189
                        GGCGATCACTACCGTTACCAGGTCGGCGAAAACCGGCTGACCATGATGTCG
3   F06   BP1190-176                                        BP1190
                        CGCGCAGGCAGGGCGAGAGCGAGCTGCGCCTGCAATTGCTCAATGCCTGGC
3   F08   BP1191-166                                        BP1191
                        ACGCTGGACAATGCGCGCGCGTTTCTCTCGCGCATCGCGACCCGCCTGTGC
3   F10   BP1192-91                                         BP1192
                        CAATACCAGTATCCCAGCGCGCCGTCCAAGGATGGCAGCCAGTCCCCGCCC
3   F12   BP1193-46                                         BP1193
                        TACGGCAAGTACAAGGGCCGTCTGATGGCCGACCTGCCGGGCCATTACCTG
3   F14   BP1194-41                                         BP1194
                        ATCCGTCCGATTCCTCCCATCTCGTCGAAACCCTGGTCAGCAGCGAAACGCT
3   F16   BP1195-166                                        BP1195
                        GAAGTCGCCTATCTGGTCGAATGGCCGGGCGTCAGCGCCGACGAGAAGGCG
3   F18   BP1196-831                                        BP1196
                        GCGCTATGCCCAGCGGCACGTCACCTATCTGCTGGGATCGGCCGACAACAA
3   F20   BP1197-611                                        BP1197
                        CCGTAAGCCGATTATTCTCGCGCTTCGGCCGCGAGGGCTTGATCCGCATCAA
3   F22   BP1198-1701                                       BP1198
                        CATGGAAGATTTCCTGCACAAGCGCGTCGTGGGCCAGGACGAAGCCGTGCG
3   F24   BP1201-1726                                       BP1201
                        AAGCTGAGCTGGGTGCAGGAGTTCGACGGCAAGGGCACGGTGCGCACCAAC
3   H02   BP1202-506                                        BP1202
                        CCTTGTCCTTGCTGTATGGCACGGAAGTCTTCCTGATCCTCAAGGATATCTG
3   H04   BP1203-376                                        BP1203
                        ACCATGGCCTCGGGCAACGTGGCGCCTTATGTCGGGCCGTCCGACATCGCC
3   H06   BP1204-291                                        BP1204
                        CGATCCGTTCTGCAATTTCGACGCCTTTCTCGACGAGCTCGCCCGGGTCGGT
3   H08   BP1205-136                                        BP1205
                        GACGATGCGCCGGGCACGGTGCGCTTCCTGTCGCTCAATCCATCGGGCTAC
3   H10   BP1206-66                                         BP1206
                        AAGCAGTTTCACGCATGCGGCGCGCCGCCTGTTCCAGACGCAATCCTCGGT
3   H12   BP1207-181                                        BP1207
                        GGTTTCATCGATGTGCACGGCCACGACGACCTGATGTTCGTCGAGAAGCCG
3   H14   BP1208-471                                        BP1208
                        CGTGAACGACCTGGGCATGATCTGGTTCCTGCAGCTGATCGGCGGCAAGAT
3   H16   BP1209-736                                        BP1209
                        ATTGCCGAGATCGGCCCGCGCGATGCGCCCGACAGCCCGCTGCATGCCCAT
3   H18   BP1210-821                                        BP1210
                        TGGCCTCGGTCACGGTGATCCATCCCGAATGCATGCTGGCCGATGGCCTGG
3   H20   BP1211-256                                        BP1211
                        ACCTTCGACCTGCAGCTCAAGCAGAACGGCACGTATCGCGTGGCGGTGGTC
3   H22   BP1212-76                                         BP1212
                        AGCGTCGAAATTCCCCGCCTGGACGTGGCCGAGTACCACCGCCCGTACGTG
3   H24   BP1213-46                                         BP1213
                        ACGCTGCATCAATGGCACTGGATCAGTTCGGCGCTCTGCCTGCTGGGCATG
3   J02   BP1214-446                                        BP1214
                        TGAAGCGGCGCCTGACGCTGGCGCGCGCGCTCATCAACGATCCCGACCTCA
3   J04   BP1215-471                                        BP1215
                        CCTGGCTTTCGCGTCCATGGCGCTGGTGGTCAGCGCACTGGCGCGCGGCTA
3   J06   BP1216-301                                        BP1216
                        TACATCATCGCGTTCTGGGCCGTGATCGGCGGGGTGTTCCAGATTGCCGCG
3   J08   BP1217-196                                        BP1217
                        TGGATACGGCTGGCCGCGGTAACCGGCTTCCTGGGCGGACTGACCACGTTC
3   J10   BP1218-836                                        BP1218
                        TCGATTACGAACCCATCGCCACGTTGAATTTGCGCCTGGCCGGCCCCTGGC
3   J12   BP1219-96                                         BP1219
                        CATTACTGCGCTGTACGCGTTCTGTCGCGAGGTCGACGACGTGGTCGACGA
3   J14   BP1220-316                                        BP1220
                        GAGCAGGACATCTCGGTCAAGCGCTACGAGTCCCATGACGATCTGCTGGAC
3   J16   BP1221-261                                        BP1221
                        GCTCGAAGGCTTCTTCCAGCCGTCCGACCTGGAAATCGTCGACCGCTATCAT
3   J18   BP1222-66                                         BP1222
                        GTTGACCGATCTGGGTTGCCACGTAGTGGGTATCGCGCGCAATACCGCCGA
3   J20   BP1223-466                                        BP1223
                        GTGCGGGCCGAAAAACAGCAACAGGAAAATCTGGCGGCGTCAGCGCGCCAG
3   J22   BP1225-416                                        BP1225
                        AACAAAGACTGGCAATGCTGCTGCGACTGGAGCACGATCTGGATGTGGAAG
3   J24   BP1227-1246                                       BP1227
                        AAGCTGGGGTTCAGCGTTGCGCTGATTCCCAAGGCCAATGCGCCGCGCCAG
3   L02   BP1228-656                                        BP1228
                        GCCTGGTGTTCGTGCCGGTGGGGGTACGGCTGGCCTATCGGCTGCCTGAAC
3   L04   BP1229-151                                        BP1229
                        AAGAGCGAGAAACACGCCAAGAGCGGCGCGCATCACGGTGCCCACCACGCC
3   L06   BP1230-616                                        BP1230
                        ATCTCGGGCTGGCTGAGCCTGGCTGCCGGCCTGTGGATCATCACGCACGAC
3   L08   BP1231-796                                        BP1231
                        GGCAGCGACTACTGGATACGCAACTGGAAAACCTGGACCCTGGCCTCGTAC
3   L10   BP1232-126                                        BP1232
                        CCCGCTCTTCAAGTGCGACGTGACGTCCGAATCGCACCCGTTCTACACCGGC
3   L12   BP1233-341                                        BP1233
                        AATACTCGGCCCTGCGCCCCTACCTCGCGCACTCCAGCGGCTTCCAGAGCT
3   L14   BP1234-61                                         BP1234
                        GACACGCCATATCGCCAGCAATGGAAATGGTCGCTGACGCCGGATTGCCCG
3   L16   BP1235-361                                        BP1235
                        CGCAAGGTCGAGCACTGCATCGCCCTGTACCTGGACGCGCGGCTCAAGCTG
3   L18   BP1236-41                                         BP1236
                        ATTACCGCATCGTGCTGGCCTCGGGGCCTGCCGAGGGCTCGGTGTTCACGG
3   L20   BP1237-561                                        BP1237
                        CAAGGCGCGCTTTCCGGGCATCGTCGAGCCCAAGAAAAGCGACATCTGCTA
3   L22   BP1238-176                                         BP1238
                        ACGGCGACGCGGTCCTGACCCAGTCGCTGGCCATTGTCGAATATCTCGAGG
3   L24   BP1239-166                                         BP1239
                        AGCGCGATCACCATCCAGTGCCTGGAAGGCGCCGTCATGCTGACCGCGCAG
3   N02   BP1240-146                                         BP1240
                        TAGGCGTGGACCACCATCTGGTACGCAATGTCGATGACCGTATCGTGCTGCT
3   N04   BP1241-266                                         BP1241
                        AGGACACCCAGTTCTATGAGCACCTGCCGACGCAGTTCAGCGCCTACGACG
3   N06   BP1242-771                                         BP1242
                        TGATTGCGCGCCGCCGGTGCTGGGAATACATGGGGTCTACGTGTCGCGCAA
3   N08   BP1243-46                                          BP1243
                        TGCGCGTCCCAGCCGATGCAGTTCGCCGAAATGCGCAAGCTGTTCGGTGAT
3   N10   BP1244-836                                         BP1244
                        CTTTCGGTTCTTTCGAATACCTGGGGGGCGACGGCAGCAATCGCTGGTATCG
3   N12   BP1245-246                                         BP1245
                        GTTCCGCCGTTTCGCGGGCGAACGTATCGAGATCAAGCTGCGAGAGGCGCT
3   N14   BP1246-1026                                        BP1246
                        GCCGGAGGAAAGCCTCAATCGCCAGGAAACCGAGCGTGCCGCGTTGCGCGC
3   N16   BP1247-581                                         BP1247
                        AAGCCGCTCCTGCCCAGGCAGTCGCCGAGCCGGTCGAACCTGCAAAGAATG
3   N18   BP1248-231                                         BP1248
                        CTGGCTGCATTCGCAGCTGTACAAGCTGCTGCACATCCATACTGTTCCCACC
3   N20   BP1249-61                                          BP1249
                        TTGTCCAGCAACCACGCCTTGCAGCGAGCCAAGCGCACCGTGGACGCGGCC
3   N22   BP1250-66                                          BP1250
                        CGACCAATTGCTACGCCAATCCGGCACTTTCCGCGAGAACCAATCGGTGGCC
3   N24   BP1251-91                                          BP1251
                        CTGATCCTGGTGCGCGGCTATGGCAATTGCCCTTCCGGCTACGCCCCGCTG
3   P02   BP1252-216                                         BP1252
                        ACGCTACGGCAAGGCGCGCCGCCACTTCGACGAACACGTCGCGCGCATCAT
3   P04   BP1253-261                                         BP1253
                        CGAATACCAGACCATCAGCCTGTCGTTCGAGTACTTCTACTCCCGCAAGGCC
3   P06   BP1254-156                                         BP1254
                        GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
3   P08   BP1255-521                                         BP1255
                        CATTTTCGCTGATCCTGTTCACCAGCCTGTGCACGGCGGCAGGCGGCGTTG
3   P10   BP1256-221                                         BP1256
                        ACGATGGCTATCTGGCGGTCTCGGTCAACCTGTACCAGCGCCAGGGCGACG
3   P12   BP1257-1141                                        BP1257
                        AAGCTGGAGACCGCCATCACCACCTACCTGGCCACGCTCGACCAGGAAAAC
3   P14   BP1258-326                                         BP1258
                        AAAAAGAGCATATGTTGTTCTATCGCCGCGAGGCGTTGGCCGAACATCCTAA
3   P16   BP1259-131                                         BP1259
                        TCTACTTCTACAACCCGAATATCCATCCGGTCAAAGAGTACGAGATCCGCAAG
3   P18   BP1260-1146                                        BP1260
                        AGCCGCCTATCGCTTCCTGCGCCGCACCGAGCATGCCCTGCAATACCGCGA
3   P20   BP1262-251                                         BP1262
                        CGCAGATCCGCCGCTTCAACCTGCACACCGGCGACTCCATCGAGGGCGAAG
3   P22   BP1263-81                                          BP1263
                        GAATCCGAGAATCACCATCATGAGCGAGCAAATCAAGAACGTCAGCGACGCC
3   P24   BP1264-161                                         BP1264
                        AGCAGATTCAAGTCACGCTGCACGGCGACGGCAGCATTTCGGTCGAGGACG
3   B01
3   B03   BP1265-416                                         BP1265
                        GCGGTACCATGCCATGGGAGGCGGTGGGCCAGGTCGAGGAAACCGCCAGC
3   B05   BP1266-1006                                        BP1266
                        CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
3   B07   BP1267-181                                         BP1267
                        CTGTTCGAATCCAAGTTCTACCTGCTGTTTTCGTTCCTGTTCGGCTACAGCTT
3   B09   BP1270-81                                          BP1270
                        CTATACCCTGACGGACTTGCCCTATCTGAAGCCGGGGCCGGGCCGCGACCG
3   B11   BP1273-161                                         BP1273
                        GCGAAGGCGTCATCACCTTCGAGGGCAAGGACATCACGCATGCCGAGACGC
3   B13   BP1274-641                                         BP1274
                        TGAGCCTGATCATGGGAATATCCGACCGCATCCTTGTCATGGAACACGGCAA
3   B15   BP1275-416                                         BP1275
                        GCTTTTACGCGGTCGGGGCCTATACCTACGCCTTGCTTTACCACTGGGGCGG
3   B17   BP1276-516                                         BP1276
                        GCTGTTCATCAAGTATTCGCGCATGGGGCGCGCCTCGCGCGCCTGCTCGCA
3   B19   BP1277-111                                         BP1277
                        GACCGGTCCCAATACCCAATACGGCGACCAGATCCAGGCCGGCGCGCTCAC
3   B21   BP1279-81                                          BP1279
                        GGTGGGGTCCAATATCCTGGTGCAGGTGCCCCTGAACGACTGGCTGACCTG
3   B23   BP1280-71                                          BP1280
                        CCGGCAAGGTCTGCCCGGCAGCCAATATCCATGTCGTCGACATCAATGCGG
3   D01   BP1281-76                                          BP1281
                        ACTGAAATCCAGTTCTGGCACTCGATGGAAGGCGCGCTCGGCGATCGCGTC
3   D03   BP1282-726                                         BP1282
                        CACGGCCACTTCCATCCTGGTCTACAAGGTCTACAGCGACGGCTTCCGCGG
3   D05   BP1283-591                                         BP1283
                        GTCGCGCACCAGCATCGCGGCCCTGTTCGTGATCCAGTTCATCTATGGCTGG
3   D07   BP1284-501                                         BP1284
                        CAAGCTGCGCGTGGCGATGCGGCTGGAAATCCTCAAGCTGCATCGCCGCCT
3   D09   BP1285-371                                         BP1285
                        TGGTGACGCCTTCGGCCACCTCGCCGGCGGTCACCGACGGCAAGAACTACG
3   D11   BP1286-446                                         BP1286
                        TGCAGGGCGCCGGCCATATCAACGCCGACAGCCAATTGGGCGCATGGCCGC
3   D13   BP1289-196                                         BP1289
                        TCGCCGCTGCTGTCGATGGCCGGCCTGGTCATGTTCATCGGCATCCTGCTG
3   D15   BP1290-171                                         BP1290
                        GCGCCTGCTCGACGACGCGGCCGATTACCTGCAAGTGCCCAAGTCCGAGAT
3   D17   BP1291-266                                         BP1291
                        AGGTCGACGCGCTGCACAAGCGCCATCCCTTCTGGGACGCGGTGCCGTTTG
3   D19   BP1292-261                                         BP1292
                        TTTCCTGCAATTGTTCAACCGCAGCCGGGGCACGCACCTCACGCCGATCGCG
3   D21   BP1293-511                                         BP1293
                        ATTCCAGTCTCGGCCAACCGCGAGAACAATGTGCGCACGGGCTTCTCCACCC
3   D23   BP1294-106                                         BP1294
                        AAGAACCGCATGATTGCGCGCTTCGTACGCCGCTACAACGTCGACATGAGCG
3   F01   BP1295-131                                         BP1295
                        TCATCAAGGATCCGCACAGCGGCATCAAGTTCGTCTATCGCGTCGAACACGA
3   F03   BP1296-716                                         BP1296
                        TCAAGTACGACGCCTATACCATCGCGCCGTATTCGCACGGACAGCCGGAAAT
3   F05   BP1297-286                                        BP1297
                        ATCACCTATTCGCTGAGCGTGCCGCAGGCGCTGGTGGCCGGCATGAGCTTC
3   F07   BP1298-56                                         BP1298
                        TCGTCATAGACCTGGAGGTCGCGCAGGGCCGCCTGCGCCAGGTGCGCCTG
3   F09   BP1299-156                                        BP1299
                        TCCCAACCAGCTCCTGGCGGTGGTCGAGCGCGCCGGCCAGATCATCGGCTG
3   F11   BP1300-286                                        BP1300
                        GACGTGCTGCAGTGGCTGTTCTGGCAGATGGGCGGACTGGGCCCCATGGCC
3   F13   BP1301-141                                        BP1301
                        ACTGTACCGCTCGTACCGCAACGAAGGCTTTGTCGTCCTGGGATTTCCGTGC
3   F15   BP1302-131                                        BP1302
                        CCAGCCTGCTCGTGCCCACGACCAGCGAGTTCTATTACGAGTCCCGTCCGC
3   F17   BP1304-226                                        BP1304
                        TGGGAAAGCGGACTGGCGGCCGCGCAGTCGCGCGGCGACCAGCAAGTGGT
3   F19   BP1305-281                                        BP1305
                        CGGCGCAGGAGTGCCGCAGCTACTTCAAGATCAACGGCGTGACGCCCAATA
3   F21   BP1306-71                                         BP1306
                        TGCTGCAAATGCTGCGCGACGCGGGCATCGAGCCCACCATCATCGAATACC
3   F23   BP1307-371                                        BP1307
                        TGAAGGCCTACGATGCCGTGCACGACAGGCGGCCCGAATACGCCCAGCGCA
3   H01   BP1311-116                                        BP1311
                        TGTCTTCGCATGGCTTGCCCGGTTTCCTCGCCTACTTCGCCTACGTCGGCGA
3   H03   BP1313-191                                        BP1313
                        GAGACCAGCGCTATTTTCGCGTCGAGGTGCATTTTGGCGCCGGGTCGCGCG
3   H05   BP1314-461                                        BP1314
                        AATGGCAGGCCGCCGGCCGCATCCGCTACGTCGGCATCAGCCATTACACGG
3   H07   BP1315-251                                        BP1315
                        CCGAAATGCGCACCGGGCAGTACGGCGAGACCATCGCCAACTACGCCAAGG
3   H09   BP1318-131                                        BP1318
                        TAAGCGGACTGTTCTGCGCCTGGCGCTACCTGGTCGACTTGCGGCCGGTTC
3   H11   BP1319-736                                        BP1319
                        CCGCATGTCATGGTCATCGCCGACGACCACTTCGCCCACCTGTCGGCCTCG
3   H13   BP1320-436                                        BP1320
                        GTGCAGGTCAATACTTCGGGCGAGGCCAGCAAGTACGGCCTGCATCCGGAC
3   H15   BP1321-661                                        BP1321
                        CTGGAGCATGCCCATGTCGACACGGCGCCCAAGGGAACCGGCGATATGTTC
3   H17   BP1323-1031                                       BP1323
                        CCGGCACCTGGCCACACTGGCGCGAACAATTGCGGCGGATACGTCTACGGT
3   H19   BP1326-1231                                       BP1326
                        GCGCCGCACATTCCCCTGCTCTTCATGGGCGAAGAGTACGGCTCGACCGCG
3   H21   BP1327-1336                                       BP1327
                        CGGCCCTGGAGCAGCATCAATTTCGCCGCCGCCCATGACGGCTTCACGCTG
3   H23   BP1328-261                                        BP1328
                        CTACCGACTGTGCATCGAATGGGAGGGAGGCATCCAGCACACCGCCGACCC
3   J01   BP1329-496                                        BP1329
                        GCCTATTTCTGGCACCGCTTCTATTCGCACCAGCCCGACCTGAACTACGACA
3   J03   BP1333-61                                         BP1333
                        CAGCGCAGCCACGGCAGCCAGCAGGCACGCACTAAGAAGGACGGCCATGTA
3   J05   BP1334-526                                        BP1334
                        GACTACATTCCGCACTCGACCATCATGAGCTACCGCGGCGCGTTCCTGCATT
3   J07   BP1335-801                                        BP1335
                        TTACGACGAACAGGCGTTCGCCTGCTATCCGCGCCTGTACGCGTCGCGCCG
3   J09   BP1339-276                                        BP1339
                        CCATGTATTCGATCCGCGCCCGCGCCTGCTGGGCATGCGCACCAATCTGTTT
3   J11   BP1340-246                                        BP1340
                        CCGCAACGCCGTCTACCCCGATGGCCACCATGGCAACGCCGTATTGTCCAA
3   J13   BP1342-121                                        BP1342
                        CGCAAGTTTTCGGCCGACGACCTGCAGTTGATGATCCTGGCGCTGCTCGAC
3   J15   BP1344-341                                        BP1344
                        TGGTGGGTTTCGGCGACAACAACCAGTTGATCAACCGCGGATCGATCACGAC
3   J17   BP1345-2786                                       BP1345
                        TCCTGGACACCTCGTACCGCATGCATCCGGAGATCTGCGGTTTCATTTCCGA
3   J19   BP1346-146                                        BP1346
                        TCCAGCGCTCGACGCGCCACTTCTCCGTCACCGACATCGGCCAGACCTATTA
3   J21   BP1347-386                                        BP1347
                        AGACCCTGACGACCTTGCGCATGGTGCCCATCTTCGAATACGTGGCCATCCC
3   J23   BP1348-121                                        BP1348
                        CGCGAACTCGACGCCGATGCGCTGATTCTCGACCTGGAAGACGCGGTCGCG
3   L01   BP1349-201                                        BP1349
                        GAGCATTCCCAACCAGACCACCATGGTGCGCCGCTATTCGAAGGCGGAAATG
3   L03   BP1350-1041                                       BP1350
                        GGACTATATCTCGGTGCACAACCCGATCGACATCACCGCGCTGGGCTACGAG
3   L05   BP1352-56                                         BP1352
                        GCGGGCACGACCTGAACCACGAGATCATCGGCCACCTCAACCTGGGCGACT
3   L07   BP1353-1036                                       BP1353
                        CGTTTCGATGGCGACAATCACAGCGCCTTCGCGCCGCCGCCGGCATTCGGC
3   L09   BP1354-261                                        BP1354
                        CACCATAGGCCTGGTGACCAGCACGTATTCGATCAACTGGGTTCTGGACGCC
3   L11   BP1355-296                                        BP1355
                        AGCTGGCGCTGAGCATCACCGAGGACAACCCCGAGCGCGAGTTCAACGACT
3   L13   BP1356-271                                        BP1356
                        CAGGGATACGGCATACGCGCCATCGTCGCGGCCAGCTATGGCCCCATCTTC
3   L15   BP1358-326                                        BP1358
                        CCACGCTGTACAGCCAGTTGCCATTCAAGCCCGAAAGCGACTTCGCGCCCAT
3   L17   BP1359-851                                        BP1359
                        CCGGCCGCGATATCCTGCAGATGGACCCGGGGCTGTCGTACGGCTTGACCG
3   L19   BP1360-771                                        BP1360
                        CATGCTGGACCACGAACAGCGGCGCGTCAGCGAAATCGACTACATCAACGG
3   L21   BP1362-271                                        BP1362
                        TTCCAGCTGTTTCCCCACCAGAGCGTGATCGACAACGTCATGGAAGGCCTGG
3   L23   BP1363-506                                        BP1363
                        TGCCCGAAATCTTCCAGGCCGCCCAGCGCATCGCGGCGGTGACCTACGAGC
3   N01   BP1364-531                                        BP1364
                        CATGTCGGGCCGCGTCGAGGCCACGGTCAACGACAACCTGTCGTTTCTCGA
3   N03   BP1365-91                                         BP1365
                        CTGACGGCTGAGGCTGACAAGCGTAAGACCAAGGCGGTGGTCAACACCGCC
3   N05   BP1366-341                                        BP1366
                        TTGTCTTCTCGACCAAGCCGCTGGAGCCGAATTTCTCGAAATTGAGCCTTTG
3   N07   BP1370-306                                        BP1370
                        CGAGCACAACCAGCGCAACGGCACCCTGATCGCGGTGAACCTGCGCCATAC
3   N09   BP1371-221                                        BP1371
                        GCCAGTTGCGGATCGACCCCACCCGCATCGCCGACAGCCTGATCGCCAGCG
3   N11   BP1372-121                                        BP1372
                        GCCGAAAGCTATCTGCGCCAGCAATTGGCCGCCCTGCCCGGCGAGCCATCC
3   N13   BP1373-246                                        BP1373
                        CGAACTGATGTACCGCCTGCCTTACCAGCCCAGCCTGGACGGCAATACCGTC
3   N15   BP1374-301                                        BP1374
                        GATCCGGTGGCCGAGACGGTCAACATGATCGCCGCCTCGCGCTCGTACCAG
3   N17   BP1375-186                                        BP1375
                        GGTGGAAGGCATCAACAACCTCAAGAACACCATGCTCGCCATCAGCGGGCA
3   N19   BP1376-46                                         BP1376
                        AACCTGGATGTAATCGGCAATAACATCGCCAACTCGGGCACGGTCGGCTTCA
3   N21   BP1377-651                                        BP1377
                        CGCCATGGTGGGCATGATCCAGAACGCGCGGCGGTTCGAGATGCAGATGCA
3   N23   BP1378-41                                         BP1378
                        GCCAGCAGACGTCGATGGACGTCATTTCCAACAACCTGGCCAACGTCCAGAC
3   P01   BP1379-551                                        BP1379
                        GATCGATCACCGGCAGCAATACGGTGTCGTCGACCCGGGTGGCCGACGCGC
3   P03   BP1380-866                                        BP1380
                        ACGGCAACCTGTCGGTGATCATCAATCGCCAGAACCAGGTGTTCCAGCCCGA
3   P05   BP1381-661                                        BP1381
                        CTGCGCCACGAGGACGGCAGCACCAGTTACAACCTGTTCGGCATCAAGGCG
3   P07   BP1382-1506                                       BP1382
                        CACCGCCCACCTGTCGGTGTCGGGCGTGAACCTGAACGAAGAGTACGTCAA
3   P09   BP1383-376                                        BP1383
                        AACGCCACGGATGGCAACGGACAGTACCTGTTCTCCGGCTACAAGGGCTTTA
3   P11   BP1384-81                                         BP1384
                        AATGGCCTGGCTGGGCATGAGCTCGAGCAACGACAAGCTGGAGCGCGTCAA
3   P13   BP1385-256                                        BP1385
                        GAGCGCACCGTCAAGCAATTGATGGGCGAAGCCAAGGCCAGGATCGAAGCG
3   P15   BP1389-336                                        BP1389
                        GTCGTTCTTCGACCCCGCCACCGGCGCCAACACCGCGGTGCTCTCGCGGCT
3   P17   BP1390-86                                         BP1390
                        TCATCGTCGGCCTGGTCATCAGCATCTTCCAGGCCGCCACGCAGATCAACGA
3   P19   BP1391-96                                         BP1391
                        TGGCTCGGAGACCTACTCGCTCAGCATGCAGACCCTGCTGCTGATGACCTCG
3   P21   BP1392-166                                        BP1392
                        GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
3   P23   BP1393-331                                        BP1393
                        GGCTCGGTCGTGGAACTGGACGGCCTGGCCGGCGAACCGATGGACATCTTC
4   A01
4   A03   BP1394-496                                        BP1394
                        TACGGCAAATCCTGGGACCCGGTCTACCCGATCGAGTTCGAGTACGTGCGC
4   A05   BP1395-351                                        BP1395
                        CATCGAGAAGTACATGCCCGAGGTGCGCAGCCGCATCCTGATGGTGCTGTC
4   A07   BP1399-261                                        BP1399
                        GCACCGGGCCGAGGCGCACCTGAACGACGGGCGCCTCAACTGGCAGCAGC
4   A09   BP1400-1151                                       BP1400
                        ATATCGAAGCCTCGATCTCGCGCGCCATGACCTCGCTGATCACGACCGAGCA
4   A11   BP1401-551                                        BP1401
                        ATCCCGACGACCTGGAACTGGTGCGCACGCATCTGGCCGACGAACTGAACG
4   A13   BP1402-86                                         BP1402
                        TCTTCAAGTACCTGAGCGCGCGCGAAGTCCAGCAGGTGGGCGCGGCGATGG
4   A15   BP1403-791                                        BP1403
                        ATGCCCAGGCCAGCGCCGAGATCGACTTCGCCCGCCGCGAAGAGACTTCCG
4   A17   BP1404-181                                        BP1404
                        CAGGCCAAGGCGTTCGAGCTGGGCGCGCCCGGCATTTCGCTCAATGACGTG
4   A19   BP1405-276                                        BP1405
                        CCATTTCTGCGTGGACAGTCCGGTCACGCTGCGCTTTGGCGACGGCAGCAT
4   A21   BP1406-176                                        BP1406
                        ATGAATCGCGCGAACTGGTCGGCCTGCTGATGCAGGTGGACCTGGATGCCC
4   A23   BP1408-51                                         BP1408
                        TGCCAACCTGACCAGCAGGATGCTGGCGGCGGCCAATGCCAGCAATTGGGA
4   C01   BP1409-276                                        BP1409
                        GGCGCGCCTGTATGACTACATTACCCGTACGCTGCTGACCGCCAACCTGAAG
4   C03   BP1410-1196                                       BP1410
                        TGGAGGAAACGCTCGAGTCGCTGCAGAACCAGTACGACCGCCAGAAACTGA
4   C05   BP1411-256                                        BP1411
                        GTGGTCTCGATCGTGGACGCCGAAACGGGGGATGTGCTGCGCACCATTCCG
4   C07   BP1412-921                                        BP1412
                        GGCGCACAATCCCCATGCCGCCGCGGTCCTGGCCCAGAACCTCGACAACAT
4   C09   BP1413-536                                        BP1413
                        ACCAGGCCGGCGTCACCAATGCATTCGTCGAGCAGGCCTCGATCAACGGCA
4   C11   BP1414-106                                        BP1414
                        CTGGCGTTCGTCGCGGCGATCTGGTGGGGGCCCACGGTCTATGTCTGGCTT
4   C13   BP1415-711                                        BP1415
                        CCGCATGACCAGCCGCCAGTGCGCCGACAATGCGCAACTGGTGCCGTGTAT
4   C15   BP1416-296                                        BP1416
                        CCGATCGTTTCATGAGCGCCACGGGACTGGACGGCGCCCTGCCCTGGCTGT
4   C17   BP1417-1251                                       BP1417
                        GCCGGTGTTCCGGCGCATCGTCGGCCAGATGCAGCACGACCTGTTCCATGT
4   C19   BP1418-46                                         BP1418
                        GCCTGCCAAGACGCCGCCAAAATCCTCGACTTCATTACGCCGTACGTCAAAC
4   C21   BP1419-51                                         BP1419
                        GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
4   C23   BP1420-646                                        BP1420
                        CCCGCCGAAATCGTCGCCAAGATGGTCGAAGGTTCCGTGCAGAAATTCCTGA
4   E01   BP1421-581                                        BP1421
                        TCGAGGTCATGGACGCCACGGCGTTCGCGTTGTGCCGTGACCAAAAGCTGC
4   E03   BP1422-436                                        BP1422
                        GACAAGGAAATCTCCGAGGATGACGAGCGTCGCGCCCAGGATGATGTCCAG
4   E05   BP1423-201                                        BP1423
                        ATTCAGTTCCGAGAACTGGCGCCGTCCGGCCGACGAGGTGTCGCTGTTGAT
4   E07   BP1424-596                                        BP1424
                        GGATCGCCCTGAGCAGCCAATGGGATGGAACTTATGGCCAGGCGCTGGTCG
4   E09   BP1425-621                                        BP1425
                        CTGCGCACATCCCAACTGGAGCATGGGGCGCAAGATTTCGGTCGATTCGGC
4   E11   BP1426-1166                                       BP1426
                        CGATACCCATGTTGGACGGAGGGCATCTGCTGTACTATCTCGTCGAAATTGT
4   E13   BP1427-1316                                       BP1427
                        GCGTGGGCTACGGTTCGTCCGAAAAGGCGATTCTGTCGGCCGGTATCAGCG
4   E15   BP1428-391                                        BP1428
                        GAGGATTTCAACCGCCGCCGCAACGAAGAGTTCTCGAGCATCGTCACCAAGG
4   E17   BP1429-981                                        BP1429
                        CTACACCGGCGTGTATCCTTACGCCGAACACAGCGAATGGCAGCGCAATGC
4   E19   BP1430-101                                        BP1430
                        TTGCCATCAAGAACGTCTCGATCAACGAGCCGTTTTTCACGGGCCATTTTCCG
4   E21   BP1431-171                                         BP1431
                        CCGCTTCTACCGCTTTTGCTCCATCGGCGGCATGCCGCAGGACAAGAAGTAC
4   E23   BP1432-876                                         BP1432
                        GGTCATTTCGTACGTGCTGTCGCCGTGGATGCGGCGCATCATGGCCTGGAA
4   G01   BP1433-216                                         BP1433
                        CTGGTTCGTGGCCAGCGCCAGCGTGCAGGAAATCGACAGCCTGAACATCCT
4   G03   BP1434-306                                         BP1434
                        ACCCGCGCTGCCTGAACGCATCGACGAGAACTGCGTGCTGTTCGACCGGAT
4   G05   BP1435-321                                         BP1435
                        CTTGAAGTCCAGCCACTCCATCGGACGCTCGCACATGGCGGCCAACTCCGA
4   G07   BP1436-251                                         BP1436
                        AGATCCGTCAATGGGTGATCGATGCGCCTTTCTCGCCTGAATTCGAACAGGC
4   G09   BP1437-516                                         BP1437
                        GCACCAGATACTGCGCCTGGCCCCGCGCATCTATACAGCCCAGTTCCACCC
4   G11   BP1438-246                                         BP1438
                        GGATATCGGCCAGTCCGTCATGGTGGATGCGTGGTCCGACGCGGGCACGAC
4   G13   BP1440-266                                         BP1440
                        GCGTGCTGTACTTCCAGGTCACCGATCCGATGCGCGCTTCGTACGGCTCGT
4   G15   BP1441-386                                         BP1441
                        TGCTGTGGGGCGGCAGCGCATGGACCATCTATCGCAACATGCCGCTGCGGC
4   G17   BP1442-121                                         BP1442
                        AAGGAAAGCTACGTCATCGTGCGCGATGGCGAAATCTACCTGCTGGGCATGC
4   G19   BP1443-206                                         BP1443
                        ATTATCCGCAGCGCATCGATCTCGAGCTGGTCGACGGGCCTTTCTCGATGCT
4   G21   BP1444-166                                         BP1444
                        GCCGACGCGCCGCTGGCCGATGGCGACCGGGTGGAAATCTACCGGGGCCT
4   G23   BP1445-971                                         BP1445
                        ACATGGGTTTCCAGATCTGCCTGGACGCGCAGCAGATCCATGGCGGATATG
4   I01   BP1446-266                                         BP1446
                        CCAATACCCATGCGCGCCGCTTCTTCGAGCACGAGTACCGGCTGGACTACC
4   I03   BP1447-596                                         BP1447
                        AGGTGCTGTCGGACATCATCAGCAAGAGCTCGGGCCGCAACTGGGCCACCG
4   I05   BP1448-206                                         BP1448
                        GGGGCTATGCCGCCTATACGCTGTTCGGACCCGGCGAAGACGTGCTGACAT
4   I07   BP1449-196                                         BP1449
                        TACGTATCGGTGAAGTCCCAGGCCGATATCGAGGCGGCCGATCTGCGGCTG
4   I09   BP1451-571                                         BP1451
                        GATGCGCGCCGCGGCGCCAACGATCCGGGCGTGCAATCGGTCAGCCGCAT
4   I11   BP1452-151                                         BP1452
                        CACATTGGCAATACCGGCGTCAATCCTGAAGACGTCGAGGCCAATCGTGTGT
4   I13   BP1453-181                                         BP1453
                        GCGGACGTCACCTATATCGAGCCCATCACGTGGCAAGCGGTCGAGAAGATC
4   I15   BP1455-531                                         BP1455
                        GCTGCTCAACGTCAGCATCAACCGCGTCGCGATCGCGCAGCGCAAATGGGA
4   I17   BP1456-611                                         BP1456
                        TGCGCGATATGTTCGAGCGGCACGGCCTGGCGCCGCGGGTGGTGATGCAG
4   I19   BP1457-41                                          BP1457
                        CCTATGGCAGGAACGAAGTCCTCAAGGACATCAGCATCCATATCGAGCCCGG
4   I21   BP1458-416                                         BP1458
                        TCATGGACGGATTGAACGGCGTCATCTTCGTCGAATCGCTGCATTACTTCCC
4   I23   BP1462-276                                         BP1462
                        CAAGGATTACTCCAATATCGCCGACACCTTCCGGCCCGGCCACGCCGACTTC
4   K01   BP1463-551                                         BP1463
                        CGTCCGACCTGGGCGGCAAGCTGACCGAAGTCATGTTCACCTTGCCCAACA
4   K03   BP1464-71                                          BP1464
                        CGTGCCTGAAGGCACGCGGCCACAGCGTCTCCACGCTCAAGCACGCCCACC
4   K05   BP1465-836                                         BP1465
                        ACACCAAGAAAGTGATGGCCAAGCTGGGCGACGTGCTGTTCTGGAAGATCG
4   K07   BP1466-461                                         BP1466
                        AGTTCCTGCACAGCGGCCAGCGCAAGACCGAGATCTGGGCCAACCAGCACC
4   K09   BP1467-71                                          BP1467
                        TCACCACGCGGGCGATCCGCAATCTCGAGGTCAACGGCGCGGACGTGACGT
4   K11   BP1468-206                                         BP1468
                        TGTTCAAGGACGACGCGGAAGGGTATCTGCTCAATGTTTCGGCGCCGGCGC
4   K13   BP1469-386                                         BP1469
                        TCTACATCGACGACTACACGCAACTGGAGGGTCTGCCCCAGGAGACCGTGC
4   K15   BP1470-876                                         BP1470
                        ATTCGAAAAGCCCAAATTCTTCGACTACCGCCAGCAACTGTGCGCGCATAGC
4   K17   BP1471-381                                         BP1471
                        CATGTCCGAGACCGAGGACCACATCGCCTATCTGTGCGAGGTGATGCGCTA
4   K19   BP1472-136                                         BP1472
                        GCCATCGGCAATACCAAGATCGAAGTCCGCCGCACGGTCTGTACGCACTGTT
4   K21   BP1474-121                                         BP1474
                        ACGGGCAGCAATTTCGTCGCTCCGGGCTGGAAGCAGGGCGACAAGAACAGT
4   K23   BP1475-1036                                        BP1475
                        GATGAAACGTGGGCGCGCGAGCACCACGAGCTGTGGTACGACGATATCAAG
4   M01   BP1476-121                                         BP1476
                        TCGGGAAAAATGGATGCCTTCCGGCTGTGCCGCGTGCAGGACGAGGTGGCG
4   M03   BP1477-886                                         BP1477
                        TTCATTCCGTTGGTGCGCGAGAACTATTTCCTGGTGTGCCTGAAATCGACGC
4   M05   BP1479-541                                         BP1479
                        ATGATCTTCAGCAGCCACAACCTGGGCCAGGTCAAGCGCCTGGCCCGGCGC
4   M07   BP1480-466                                         BP1480
                        CGGTTCTGGAAGCAGACCGGCTCGGACAGCAAGGGCAGCGGCTACAAGGAA
4   M09   BP1481-1161                                        BP1481
                        CGAGCGCGAGGGGCTGGACAAGATCTTCATCGAAGCCGGCTTCGAGTGGCG
4   M11   BP1482-291                                         BP1482
                        GGCGCTGACGCAGTACGGTTTTCGCGCCATCATCGCGCCGTCCTACGCCGA
4   M13   BP1483-496                                         BP1483
                        GAGTCGGAAGTGCGGCGCATTGCCCGCATCGGCTTCGAGTCGGCCCGCAAG
4   M15   BP1484-41                                          BP1484
                        TCGGTTCCGTTCTCATGCAGCGCATGCGTGACGAGAACGACTTCGCACTCAT
4   M17   BP1485-1461                                        BP1485
                        TTCGGCGGCCTATCCCGAGCCCACGCTGGACACGGCTGCGCTCACGCGCAA
4   M19   BP1486-241                                         BP1486
                        GTCAACGCCTTTCTGCCGCCCAGCATCGTCGTGCAATGGGCGCGTCCGGTG
4   M21   BP1487-196                                         BP1487
                        AAGTTCAGCATCCGCGCGTTTCCCGCCGGCGAGATCGTGCCCGCGCTGCAA
4   M23   BP1488-1                                           BP1488
                        ATGAAAGCATTACTCGCCTTATCGCGCGGCATAGACGCGCTGAACCTGCGGG
4   O01   BP1489-1591                                        BP1489
                        AAGATCGAGATCGAAAGCAATTATGGAACTAATATCTATGGAGACGAAAGCTC
4   O03   BP1490-71                                          BP1490
                        CCGATGCCATCGGCTTCGTGTTCTATCCGGCCAGCAAGCGCCATGTCGATCC
4   O05   BP1492-706                                        BP1492
                        CATGACGTGGGAGATGTCGTTCTCGCCTTTGTCGGAAAGATGATGAATGAGT
4   O07   BP1495-146                                        BP1495
                        ACAATGCCACGGTACGCGAGCGCCTGCATCGGGCCAAGGGCGCCATTTGCA
4   O09   BP1496-526                                        BP1496
                        TCCGGCCGCCTATTGCGCAGCAAGAAAACGGTCAGCACCCACAAGCGCCGC
4   O11   BP1497-1701                                       BP1497
                        AAAACAAGGCTTTAGAGTGCAGGCTGATTTGCGTGGTGAAAAAATCACTCGT
4   O13   BP1498-106                                        BP1498
                        AATGCCGATCCCCCGGTTTGCCGCTTGATGGATTACGGTAAGTTCAAGTACC
4   O15   BP1499-366                                        BP1499
                        GATCCGCAATCATCCCGAGAAGCTGGCGATCACCGAGTTTCCCGATCTGACC
4   O17   BP1500-101                                        BP1500
                        ACGATATCCATCCCGAGGATTTGCCCGACGACGCGGCGCCCCGGGTACTGG
4   O19   BP1501-86                                         BP1501
                        TCAGCAGCGAGATCTTCATTTCGCGTGGCGCCCAGCGCGTCAACGCCAAGA
4   O21   BP1502-776                                        BP1502
                        CTGTCACCCTGGATGGTATCGATATCGTGCTGCATGCCAACATCGAGCTGCC
4   O23   BP1503-86                                         BP1503
                        GAAATCACCGGATGCTGGCGCCGGCCCTCGTCCATGGCATGCAGGACTTCG
4   A02
4   A04   BP1505-186                                        BP1505
                        CGTCAAGGTCATCAATATCTTTCCCGCCAACACCCACCAGGGGCTGCCCGGC
4   A06   BP1506-666                                        BP1506
                        GCCTTCGGCGTTGCCGCAGAAGACCCTGCTCGAACGCGGCTACGCCGGCAA
4   A08   BP1507-406                                        BP1507
                        CCGACCTATGGCGTGGGGCAGGCTTTCCTGGTGCAGAAGGGCAACCCCAAG
4   A10   BP1508-486                                        BP1508
                        CACGATTACCGATCTGACGTTCAGGGGGCAGTTGCTGCGCAGCGAGACCTT
4   A12   BP1509-456                                        BP1509
                        CAACTACCTGGTGGCCATGTTCAAGGACACGCCGCTGCTGTCGGCCATTACG
4   A14   BP1510-186                                        BP1510
                        GATCGATGGCGAATCCATGTGGCATGACGCGCAAGGGCGCGAAATGGGGCC
4   A16   BP1512-136                                        BP1512
                        GCCGAGCATTTCGCCTTTGTCCGTGGCGAAAGCGACATCACCTGGTACAGCT
4   A18   BP1513-406                                        BP1513
                        CATGGCCTGACCGTCGCCGAGGTGACCTACAGCAACAGCATCAGCGTCTCC
4   A20   BP1514-116                                        BP1514
                        CGGTCACCGCGCCGTTCCTGGCCGACATGAATCCGGCCGTGCGCCAGGCG
4   A22   BP1515-56                                         BP1515
                        TGTGGCTGCTCGAGAAGATCGGCGACAAGGAGATCTGGATCATCAACATTTT
4   A24   BP1516-46                                         BP1516
                        GACCAGGCGACCAAGACCCACAACCGCTGGCACCCGGATATTCCCATGGTC
4   C02   BP1517-941                                        BP1517
                        ATTTCGCGCTCAGTCCGGCCGAGGAAAAGGTCAGCGCCCTGATCCTGCAAG
4   C04   BP1518-286                                        BP1518
                        TTGTACCTGGGCGGCCAGGCCATCGTGCGCATCACCGGCCTGCGCAATCCG
4   C06   BP1519-41                                         BP1519
                        CCGAGCACGGCTACGGCATTCCCGCTTTCAACGTCAACAACCTGGAGCAGG
4   C08   BP1520-251                                        BP1520
                        TGCGCAGCTTCTGCGCCGACTGCGGCACGCCGCTGTTCGGCCATACCGAAG
4   C10   BP1521-731                                        BP1521
                        TCAGCCCGCCTTCGTTCGACAAGCAGTTCGTGCGCGACTGGCTGGAAACCC
4   C12   BP1522-56                                         BP1522
                        CCCATGCCGACCATCGCATTTGGCAGGACGTCTATTGCCCGGTGACAGCGA
4   C14   BP1523-51                                         BP1523
                        TGTGCCCTATAGCTACAAGGGCGAGACCATCACGATTGCGGCGGTGACGGG
4   C16   BP1524-86                                         BP1524
                        TGCCATTTCTGAGCGGAGCACTGGCCGTCTGGTTCGGCATCCTGGGCAAGC
4   C18   BP1525-336                                        BP1525
                        GCTGGTGTATTGCACCCTGATGCTGGCGGCCGACCGCAAATGGGGCGACAA
4   C20   BP1526-266                                        BP1526
                        TGCGCGGCGAGGACTCGCTGCTTTCCATCGTGCAGATGCCCAAGGGCGTGC
4   C22   BP1527-821                                        BP1527
                        TCAACGAAATCGCGCCGCGGCCGCACAACAGCGGCCACTACACCATCGACG
4   C24   BP1528-161                                        BP1528
                        GCCGGCCGTCGAATCATCCGGTCATCGTCCATATCGCTCCCGAAGGCGATG
4   E02   BP1529-361                                        BP1529
                        GCCAGTTTCTACGATGGCCAGGGCGTGCTGGTGCGCAAGGCGCTGGGCGTG
4   E04   BP1530-676                                        BP1530
                        AATATCTCGGTGCCGTCGAGCCGCTGGAGCTTCGAGGAAGCGCAGGCGGTT
4   E06   BP1531-616                                        BP1531
                        GGCCAATTGGGCGACCGGCCGGTCTACCTGTGCTTCGACATGGATATCTTCG
4   E08   BP1532-591                                        BP1532
                        GATCCGCACCAAGAAGATTCCCGGCGTGAAGCTGGCCACGCAGTACCAGCC
4   E10   BP1533-531                                        BP1533
                        GGGCGCCACCTTCCAGGCCCTGACGGTCTACACGATGGTCGGCGCCATCTA
4   E12   BP1534-201                                        BP1534
                        CGTCGTCAACGGCATCACGCTCGACGGCGAACTGCGCAATATCGAGCGCAT
4   E14   BP1535-1301                                       BP1535
                        GGCTGGACTGCCTGACCATCATCTACGCCAACCGCACCTACGCCACGCTGC
4   E16   BP1536-41                                         BP1536
                        GCGGCCCGCTCCAGGTGACCGAGGCAGAGATCCTGGAGTTCGCGCGCAAG
4   E18   BP1537-296                                        BP1537
                        CGATGATGAGCGTGCAGTCGTCGCTGGTGATGGTGCCCATCAATGAATTCGG
4   E20   BP1538-826                                        BP1538
                        CTGGTGCTGATGGTGGGCGGCCGCATGTCGGAAAACCCCAGCCAGGCCTAC
4   E22   BP1539-341                                        BP1539
                        TGGCCGATTTCCAGCGCGTCCAGCCCGACATCACCGTCAGCCTGTCGGTGC
4   E24   BP1540-436                                        BP1540
                        CGCGATCGCGCCATGCTCGAAACCCTGTACGCCACCGGATTGCGGGTGTCC
4   G02   BP1541-351                                        BP1541
                        GGTGTGGGTCGAGGCCAGCGTGCTGGATTTTCCGCAGATCTACGTCAATGG
4   G04   BP1542-186                                        BP1542
                        CGGCCACAATTTCACCCTCAACCATGACTTCGCCAAGGTCGAGCCGCAGCAC
4   G06   BP1543-176                                        BP1543
                        ACGAACTGGTGCAGTATCGCGGCGAGGCCGCCAACTTCACGTCGTTCCTGC
4   G08   BP1545-41                                         BP1545
                        CGCTGCGTTCCAGCACCGCCTACGTACAGGACCTGGAAACCTCCACGGTGC
4   G10   BP1545A-131                                       BP1545A
                        CGGATTTCTTGCTGGAGGCGGTCTTGGCGGGGGCTTTCTTGGCCGAGGCCT
4   G12   BP1546-1041                                       BP1546
                        CGGCAGCTTCATCGGCGTGTGGATGGGCGGGGCCGTGTATGCGCGCACGG
4   G14   BP1547-2116                                       BP1547
                        AACTGGTTCGACAGCGAGGCGCAGCGCCAGCCGTTCGAGGTGGCGCAGATC
4   G16   BP1548-3261                                       BP1548
                        GACGCCCGAACAATTCGCGATCCGCATGCGCCAGCGCCATGGCGAGCAACT
4   G18   BP1549-181                                        BP1549
                        TCGCTCAATTGCGAGAACGGCATCACGTCCAAGCCTTGCGGCCAATGCCGC
4   G20   BP1550-191                                        BP1550
                        ACAAGGACATGCTCGAAGACCTGGTGGCCGCGGCGTTCAACGACGCGCTGC
4   G22   BP1551-206                                        BP1551
                        AAGACGAGGTCTGCGCGACCTGTGCCAATCCCAAGCGCGATCCCGGCCTGC
4   G24   BP1553-516                                        BP1553
                        GACTTCCATGACCTACATCGAACCCATCGCGCTGAAGGCCGGCCGCAAAGTC
4   I02   BP1554-191                                        BP1554
                        AATTCAGCTGCGCGTGCCGGCTCAAGGGCGATGTGCGCGAAGACATCCTCT
4   I04   BP1555-261                                        BP1555
                        CTGGGGCGCCATCTTCACGCAAAGCCTCAACCGCAATTACGTGCCGCCCAAG
4   I06   BP1556-41                                         BP1556
                        CACGCTTGATCAAACAGGCTGCGCAATGGCTGTCCGACGGCGGGCTGGTGG
4   I08   BP1558-561                                        BP1558
                        CGACTACGGCAAGCTGGAACTGAACCTGGACAGCATGCGCGCGTCGCTGGC
4   I10   BP1560-506                                        BP1560
                        TGGCGCTCAATGGCGGCGAGACCGCCACCCTGATGAAACCCGCCTACCGGA
4   I12   BP1561-631                                        BP1561
                        CCCCATACCGATTTCGATCCCCGGCAGTGCACCGGCGGCAATTGCGAGCGC
4   I14   BP1562-46                                         BP1562
                        ACCCGCCATATCTCGCCTGACCGCTACGGGGATTTCCTGGCGTGGATGCGC
4   I16   BP1563-381                                        BP1563
                        GCGCAATATCCTGGCGGCCGAAGGCGTGAACGTGCTCACCACTCCGGAAGT
4   I18   BP1565-91                                         BP1565
                        TCCGATACGCTGCGGCACCTGGATTGGTTCGAGGTGACCGAGACGCGCGGC
4   I20   BP1566-1851                                       BP1566
                        CAACGGCTGTCGCCTGGACCAGACCCGCCGCATGCTGTTGATCACCGGCCC
4   I22   BP1567-936                                        BP1567
                        AGTCGACCTGGAAGACAGTTGGCCCGCGAGCGGCGCGCTCGTGCTGGATAG
4   I24   BP1568-166                                        BP1568
                        CAACTGCCCAAGATTTCCAAGAACGCGCTCAGGAACGACGGCGACACCGCC
4   K02   BP1569-166                                        BP1569
                        AACAACGATCCGCGCTACAAGGCGCCTGCCTCCGGAACCGCGACCTACTCG
4   K04   BP1570-691                                        BP1570
                        CGTGAACTCAATGCACGGTTAGCCCGTCTCAACAAGGCCTTGTTCATCGAGG
4   K06   BP1573-446                                        BP1573
                        TCATGAAGTCGCAGGTGCCCGACGCCAAGCTGAAACTGTTCCCCAATATCGA
4   K08   BP1574-526                                        BP1574
                        CAGGGCCAGGAAATCATGGCCAGCAATTTCCGCGCGGTCGAGATCTGGTCG
4   K10   BP1575-586                                        BP1575
                        CACGAAATGGAGTTCGCGCGCAAGGTGGGCAGCCGCCTGATCTTCATCGAT
4   K12   BP1576-866                                        BP1576
                        GCGTCTACCGCAAGATGACCGAACAGAAGAAATCGTTTTCCGAAGTCCTGGA
4   K14   BP1577-131                                        BP1577
                        CCACGGTCACCGCGCTTCGGGAAATCGCCTCCGGTCTCACCGGCCTGGAAA
4   K16   BP1578-466                                        BP1578
                        GAGATCGCGCACGCGCCTGAATGCGAATATGTTATTATTAATCAAGAATTTAG
4   K18   BP1579-361                                        BP1579
                        AGCATGAATGGCGAATCCCCGCCGGCCGACGACCCCACGCTGGTCGCCCTG
4   K20   BP1580-196                                        BP1580
                        GGTTTTCCGCATTTGGCGGGCCTGGGTTCGGGCTATCTGTACGAGCAGCTC
4   K22   BP1581-431                                        BP1581
                        TCAACAACGGTTCGATTTCCGCGCATGCGCCGCGGCCGTTCTCGATCGCCTA
4   K24   BP1582-426                                        BP1582
                        GCATGTAGGCATCTATATCGGCCAGGACCAGTTCGTGCACGCCCCCACGCG
4   M02   BP1583-621                                        BP1583
                        CACGCACTTCCAGAATTTCGTGCTGTTCACGAACTACCAGTTCTATGTGGACG
4   M04   BP1584-81                                         BP1584
                        CGTGCATCGCCCCCGCCAGGTCGATGTCAAGGCCGTGCGTGCCAAAGTGGG
4   M06   BP1585-51                                         BP1585
                        GACCAAAGCCGAGCGTAATGAGCTGGCCGGCCTGGTCGATGTGTTGGTGAA
4   M08   BP1586-46                                         BP1586
                        AAGCTCTTGGGCCCGCAAGAGCGCCAAGACCTGATCGGCTATCTGGCCGTA
4   M10   BP1587-636                                        BP1587
                        CCTGACTCAGGAAGCCACCCTTTTCGCGTTGCGCATCGACGTCGCCGAAGAA
4   M12   BP1588-556                                        BP1588
                        TACCAGGAAGATTCGGCCTGCGCGGCCGACGTCAATGTGGTGATGACCGGC
4   M14   BP1589-436                                        BP1589
                        ATCGGCGAATTCCTCGGCCGTTCGCACTACAGGATCTTCCATACCACCGCCA
4   M16   BP1590-436                                        BP1590
                        GATATCGGCGTGGTCGCCGGCTGCGCCCCGGACCAGAAACTGCAGTTCATC
4   M18   BP1591-1331                                       BP1591
                        AGATCGTGCAATCGATCGACCGTGTGACGCAACTGGTGGCCGGTATTTCGG
4   M20   BP1592-1026                                       BP1592
                        GTTCGGGCGCAATCCATGCTCGACGTTCATGAACCCCGACCCTGTGCTGGTG
4   M22   BP1593-456                                        BP1593
                        CGAGATCGTCGATGCGCCGGCCGGCGAGCATGGCTTCGGCTACGACCCGC
4   M24   BP1595-101                                        BP1595
                        CGGTCTATGTGCACGTGCCCTGGTGCGTGCGCAAGTGTCCCTATTGCGACT
4   O02   BP1596-686                                        BP1596
                        CGCTGGTGCAACGCGCGGACTGGAACCAGGTCATGAAGTACGTGATCCACA
4   O04   BP1597-961                                        BP1597
                        CTGGGCCTGAGCCTGGCCCAGGATTTCGTGCAGCAGCACGGAGGCATCATC
4   O06   BP1598-851                                        BP1598
                        AGCCGCTCGAACAGCGCGTCGAGCAGGGCCTGTTCCGGGAGGACCTGTTCC
4   O08   BP1599-351                                        BP1599
                        GCCGCTGTACGATCTGATCGAGGATTTTCGCGCCCTGGCCGGCGCCACCAC
4   O10   BP1600-41                                         BP1600
                        ACCACGGCTGGCTCGATACGCACCATACGTTTTCCTTCGCCAATTACTATGAT
4   O12   BP1601-766                                        BP1601
                        CGCTTCATCTGGTGGAACTTCGTCTCCAGCAGCAAGGACCGCATCGAACAGG
4   O14   BP1604-651                                        BP1604
                        GCTCGAGACGCTCAACGACATCGGCGCCTCCGAATTCCTGGGCGTGCAGAC
4   O16   BP1605-261                                        BP1605
                        GGTCGACATCGGCAACCTGATCGACCTGGTCAATGGCGGCGTCACCCAGAA
4   O18   BP1606-126                                        BP1606
                        GGAAATCGAAGGCAAGCCGTTGATGCGCGCCTACAGCATCGCCAGCGCCAA
4   O20   BP1607-761                                        BP1607
                        TGCAACTGTTCGCCAGGCAGACTCTGGACGTGCGCCAGCCGGTCAACGCGG
4   O22   BP1609-471                                        BP1609
                        CTATCTGCAGAGCGCCAGGCTGACGGCTTTCCTCAGGGAGCAGGGTATTGC
4   O24   BP1611-81                                         BP1611
                        CAAGACGGTCTACCTGTCGGGCCAGATCGGCCTGGAGCCGGGCACCGGCG
4   B02
4   B04   BP1612-1346                                       BP1612
                        CGTACTGGGTCTGTCCCCTGGTGGAAGAGAGCGAGGCGCTGGAGCTGCAGA
4   B06   BP1613-586                                        BP1613
                        AGCGGCCACTGTTTCCGCGACCAGGTGCTGGAAGTGTGTCCGGAGCTGTCG
4   B08   BP1614-731                                        BP1614
                        ACCTGGAGCCGGTCCTGCCGCAGTGGGACTGCTATGCGGGATTCGGGCGC
4   B10   BP1615-1411                                       BP1615
                        GATCTGCACGTGTACGGCGAAGAGGGCGTGCGCTTCTACACGCGCCAGAAG
4   B12   BP1616-126                                        BP1616
                        GATGACGCACAACTTCCATTGGAACGTGACCGGGCCGCTGTTCAATACGCTG
4   B14   BP1617-151                                        BP1617
                        ATCATCGAGGCCAGCCCGCTGGACCGCGACGCCAACATCGAGCTTGCAGTG
4   B16   BP1618-61                                         BP1618
                        CAGCGTAGTTTCGTACTGGATAACCGGCTGTTGTACGGATTCACCCACAACA
4   B18   BP1619-466                                        BP1619
                        CCGGCCGAAGTACGCGCCAAGGTCTTCTGCGAAGTGGCCAAATGGGCCCGC
4   B20   BP1620-136                                        BP1620
                        AATGCGCTGCAATCCATACAGGCGCAAACCTATCCTAATATTGAAATCATTGC
4   B22   BP1623-601                                        BP1623
                        CTGGTCTGGAATCCGCTGGTGCATGCCATCGAGTGGTTCCGCGCCGGGTAT
4   B24   BP1624-41                                         BP1624
                        GCAATGTCTGCAAGGGCTATCGCTCCAAGAAAGGCATCAGGCGCATTCTCGA
4   D02   BP1625-361                                        BP1625
                        CCGATGATCGATTTCTGGTACGGCATGAACCAGGACGAGACCGAGGAAGGC
4   D04   BP1626-806                                        BP1626
                        GCAATGCGGAATACGATGCCGGGCCGGAATCGTTCGTCGGTCCGGTGCTGA
4   D06   BP1627-261                                        BP1627
                        CGCGGTGCTGGTCGAGGCGGCTTCGGAGCGCAGCGTGAGCGTCAATGGCG
4   D08   BP1628-656                                        BP1628
                        AGGTGCAGCGCATTCCTTACCAGCAATTGCTCAACGGCCGCAACGTGGCGG
4   D10   BP1629-6                                          BP1629
                        GAAGAAGTTTTCCAATCCTGCAGATGTTCATCTCGCCGTCGTTGGCCTGGGG
4   D12   BP1630-956                                        BP1630
                        ACGAGCCGGCCTACGACATCCTGCGCGGGCTGGAAGCCGCCATGCCCTGG
4   D14   BP1631-1891                                       BP1631
                        CTGTACTGGGATTGGGAACTGCGCGGATACACCACGTGCGAGGCGGTGCTG
4   D16   BP1635-866                                        BP1635
                        ACGGGCCCAACCAGTTCAGCTGGCCGGACGCCGCCACCACGCCGTTTCGCA
4   D18   BP1636-201                                        BP1636
                        TTTCGTCGCCGCCGACGAACGCATCGCCGTGTTCGACAACGATGGCACGCT
4   D20   BP1637-246                                        BP1637
                        CGAACTGGTGCGCGCCGAACACAACGGCGTGGCGTACAGCGGGCTGCGCT
4   D22   BP1638-821                                        BP1638
                        AGGATGCGCAGTCCGGGCCGGTGCATTGGAAGGACGCGGGATACTGGCTG
4   D24   BP1639-256                                        BP1639
                        ACGCACGTGGAGCCCATGCGCGACATCCTGCTGGTCGTGGATATCTCGCAG
4   F02   BP1640-246                                        BP1640
                        CTATACCGAGGAGCGCGACCGGCCCGCGATGATCGTGGCGGACCAGCGCA
4   F04   BP1641-466                                        BP1641
                        GGCACGTATCCGCTGCCGGAAGCGCAGATGGACCGTTTCCTGATGAAGATC
4   F06   BP1643-631                                        BP1643
                        AACGTGCAGTTCTATACCCGCAATACGGCCACCGACTACCGCAACGCGCCGA
4   F08   BP1644-876                                        BP1644
                        AGCGCTGGGCATGGACATCAAGACGCTCGATGGCCCGGCCTTCGGCCAGTT
4   F10   BP1645-276                                        BP1645
                        CGGCTCCAGCCTGAACGACCGCTCGGTGGTGGAATTCGCGCTGGAGGAATT
4   F12   BP1646-161                                        BP1646
                        CGGTGCTGCTGCGCGTGCTGCTGATCGCCTTCGCGCTGGTCCTGCTCGACA
4   F14   BP1649-586                                        BP1649
                        GAGGTCGCCGCCACGGGCGTCGCCATCCTGCTGGTCGAACACGATATGAAA
4   F16   BP1650-261                                        BP1650
                        CTTCACCAACCTCAGCGTCGAGGAAAACCTGCGGCTGGGCGCCTACCTGTA
4   F18   BP1651-61                                         BP1651
                        GCGGCAATGTTTGCGCGCCAAGGCTACTCGGAAACATCCATTGGCGATATCG
4   F20   BP1652-726                                        BP1652
                        GGGCGAGTCGCATTGGTACTTCCGCGCCGACCGCTTGATTTCGGTCGATGC
4   F22   BP1654-991                                        BP1654
                        CATCCCTTCCACGCCAGCTTCTACGGCCGTGACCGGGTCATGCCCTGGCTG
4   F24   BP1655-541                                        BP1655
                        GTGAATGTCATCATGCCGGGCTACGTGGCCTCGCCGATGTGCGCGGCCATG
4   H02   BP1657-341                                        BP1657
                        TCCCCGCCAAGTGGAACAGCGTCTCGGCCACCGGCGGCATAGGCTGGGATT
4   H04   BP1658-1601                                       BP1658
                        TCCTGCAGGAGGTGTTCACCAATATCCTCAAGCATGCGCGAGCGCGCCGCC
4   H06   BP1659-561                                        BP1659
                        CGAAGTTTCGCGCCATACGGTGCAGACCTTCGTGCGGCGCATCTACCGCAA
4   H08   BP1660-1196                                       BP1660
                        GCAACACCTTCGAACTGCACGCAGGGTCCGTCCTGCAAGGCAATGCCGTCG
4   H10   BP1662-111                                        BP1662
                        GGATGTGAAGGCAACGCGCGAAAAAACGCACATGTCTCAAACGGAATTCGCC
4   H12   BP1664-486                                        BP1664
                        CGGCTATCTGTACACCGTCGGCAGCTGGATGGAAGGCGACAGCGTCGACAT
4   H14   BP1665-241                                        BP1665
                        CGCCCGCATCTGCTGGACATCACGACGGTCGATGAACATGGCGAGCCGCTC
4   H16   BP1666-421                                        BP1666
                        CGCACCGATATCGGCGTATTCCATACGCCATCCAGACTGGACAGCAAGCTGT
4   H18   BP1667-371                                        BP1667
                        AAATAAACTACGTTTTCGCCACGCGCACGGATTTCCCCGCCCAGGATCTGGC
4   H20   BP1668-436                                        BP1668
                        GGCTCGCGCGTCGGACGCTCTCCGACAGGCACCTCGGCATTGGCAAGCATG
4   H22   BP1669-501                                        BP1669
                        GTCGCCCAACCGCGAATACAACGTCAGGAACCATTTCACCCTGCCGATGCAA
4   H24   BP1670-596                                        BP1670
                        AAATGAAGAACCAGATGATCGCGATGGGCAAGAACTTCCCGGGCGCCGGAC
4   J02   BP1671-431                                        BP1671
                        AGACGGCCTTCGCTTGTTCGATGAGCGGACTGATAGGGCTGGCCAGGTCGA
4   J04   BP1672-261                                        BP1672
                        GGCCATTTCACCGAAGCGGGCAGGCCGCCGGGTGACGTTGTCCGAAACCGA
4   J06   BP1673-41                                          BP1673
                        CTTCGTTCTCGTTCTTGATACCCGGGGCCGGCAGCCACGCCGCCGACCTGC
4   J08   BP1674-816                                         BP1674
                        GAAGGTACTGGACATCGCGCTGGGGGTGGCGCCGATGCAGGTCTGCCTGAT
4   J10   BP1675-431                                         BP1675
                        GCAAGGAACCGGGAACCATTGCTTTCGGCACCTCCGGCCTGGGCACGTCGC
4   J12   BP1680-406                                         BP1680
                        AAGACGCTGGCGGTCATGCAGGTATCGGGGGGATCCCAGTCATTCAACGCC
4   J14   BP1682-351                                         BP1682
                        CGCCTTCTCCAGCCTGGTACGCCTTTATGGCCATCACGCCCGCGGGGCCAT
4   J16   BP1683-186                                         BP1683
                        CAGCGTCGAGCAACAGGGCCGCAATCTGATCTACCGCGCCGATTTCTTCCGG
4   J18   BP1685-391                                         BP1685
                        AACCCCGAGAGCAAGATCCAATCGGTGGCGGATCTGGCCGACTATGCCAGG
4   J20   BP1686-166                                         BP1686
                        GACCTGGCCTTGCTCGACGTCGATCTCAACGACGTCGCCAGCACGCGCCAT
4   J22   BP1687-96                                          BP1687
                        GCACGTCACCCAGGCGGGCCTGAGCTCCATGATCAACGAACTGGAGACGCA
4   J24   BP1688-211                                         BP1688
                        GCGTCGATCCTGCAAGGCCGGTACGGGGTCGCCATCCATCTCGCGCTGGGC
4   L02   BP1691-991                                         BP1691
                        AACCACGCCACCTTCAAGGCCTCGCTCTTCATGGCCGCGGGCATCGTCGAC
4   L04   BP1692-231                                         BP1692
                        GCTGACCGCGATCGTGATCGGTTTCGCCACCACGGCGCTTTTTCTCGTGGTG
4   L06   BP1693-346                                         BP1693
                        GTGCATTTCCATTCGCTGTACCAGTTCCTGCTGATGGGGCTGAACGGCGCCT
4   L08   BP1694-276                                         BP1694
                        CTTCATCGCCATTCCGCTCGACCTGCACGACCCGCACGGCCTGGCCATCCTG
4   L10   BP1695-131                                         BP1695
                        TGTACGTCAGCGGCATGCTGACCATGCTGGTGTTCGGCATCCGCGCCGGCA
4   L12   BP1696-206                                         BP1696
                        TGCGGCCGGTGGTGCACGAATTCGTGATCGGCATGCTGCTGGTGCTGACTT
4   L14   BP1698-101                                         BP1698
                        AGAGCCAGTACCAGATGGACGTGCAGCGCTGCAATAGCGGCGACACCAGCC
4   L16   BP1699-41                                          BP1699
                        CGCTGGCCTCCGACAGCACCACCGGCTTTCTCGAGAGCATCGGCGTCGATA
4   L18   BP1700-181                                         BP1700
                        GACAATTACCGCTTGCCCGGCGTGTCGCTGTACGTCACGCTGGAGCCCTGC
4   L20   BP1701-496                                         BP1701
                        CTGGCGAAAACCGATGAACTGACCGTGGCGCTGTTTGGCGAGATCATGCGC
4   L22   BP1702-526                                         BP1702
                        ATCGGGCTGGTGCACGAACTGTGCGAGGCGGACCGGCTCGACGGCCAGAT
4   L24   BP1703-1421                                        BP1703
                        ACCTGACGGCCAAGACCAGCGCCATGGTGTGCTGGCTGTTCGTCGGCTCGT
4   N02   BP1704-56                                          BP1704
                        TTGCCTGGCTCATTGTCGTCCTTACCCTGCACATATGCTGGGAAGTCTCGGC
4   N04   BP1705-956                                         BP1705
                        AGATCTGGGACGAGATGATCGCCAAGCGCTCGGCCGAGAATCCGTTGTTCA
4   N06   BP1706-46                                          BP1706
                        CTTTTCGAAAACGTCAGCGTCAAGTTCGGGGAAGGCAACCGGTATGGTCTGA
4   N08   BP1707-231                                         BP1707
                        CCAGGAGCACGCCCTCTATCCGTGGCTGACGCTGCGCGACAACGTGGCGCT
4   N10   BP1708-586                                         BP1708
                        CAGATCTACGAAGTGGGGCAGGCCTGGCCGTTCCCCTGCATGGTGGTGATC
4   N12   BP1709-271                                         BP1709
                        TTCTTCTTCCGCGAAGTGCTGCGCAGCGCCATCGTCATCCTGCAGTCGATCC
4   N14   BP1712-116                                         BP1712
                        CGCACAGCGACCCGGCGGCCACGCATAATTGCTGGGCCTACCGCATCGGCA
4   N16   BP1713-206                                         BP1713
                        TCCGCTCGATCCCGACCTTGATGGTGTTTCGCGAGAAGGTCCTGCTGTTCTC
4   N18   BP1715-71                                          BP1715
                        CGACATTCCTCACCATGTCGTACATCATCTTCCTGAACCCCGACATCCTGTCG
4   N20   BP1716-621                                         BP1716
                        GGATTTCAGCTTCAGCGGATTGAAGACCGCGGTCCTGACCCGTGTGAAAGC
4   N22   BP1718-76                                          BP1718
                        GGCTCCATCCCCTTTGCCGTCGTGGTCAGCAAGCTGATGGGGCTGCAGGAT
4   N24   BP1719-281                                         BP1719
                        CCAACATGGGCGACGACACGCTTTATTCCGGCACGGTGGCCGCGGCCAGCG
4   P02   BP1720-431                                         BP1720
                        CGTTCGATGCTATTGTTGTGGCTGCGGCGGGCCTGGCCATTCCGCAGGCCT
4   P04   BP1721-236                                         BP1721
                        GCGCCAACAATGTCGATATCGAAAACCTCAAGCGCTGGAACAACCTCACCGA
4   P06   BP1722-371                                         BP1722
                        CGCCGCGCTATTGGGATACGGGCGACGAAGACCGCGATTTCAAGTTCAACA
4   P08   BP1723-311                                         BP1723
                        ACGCGCTGAAAGCGCAACTCGACAGCGGCAAGCTGGATCCGCGCGCGCTGT
4   P10   BP1724-396                                         BP1724
                        CCTGGGCGTGAGCTATGCGAACTACTCGCTGAAGTACTCGTACACGCCCGG
4   P12   BP1725-1271                                        BP1725
                        ATACCGGCCATGTCGAATCGATCGCAGTGTTCGAGTCGCTCGACGAGGCGA
4   P14   BP1726-46                                          BP1726
                        ATGATCCGCTACTACGAAAGCATCGGACTGATCGGCCCTGCCGCGCGCACC
4   P16   BP1727-41                                          BP1727
                        ACTGCGTCAAGAGCATCACGCAGGCGGTGCAGCAGGCCGTGCCCCAGGCG
4   P18   BP1728-41                                          BP1728
                        CGTTTCCCGTCCGTGAAAACAATGCCTGGAAGCAGGTGACGACCGACGACG
4   P20   BP1729-96                                          BP1729
                        GCTGATCGAAGGCGGCCAGTACGGCACGACTTGCGCGCGCGTGGGTTGCAT
4   P22   BP1730-51                                          BP1730
                        CAAGCACGCCATTCTGGTCCACGTGCTGGACTACATGAATCGCAAGGAAGCG
4   P24   BP1731-101                                         BP1731
                        GCGCGGCCCATGGGTTCACCATGTTCGAATTCGACGTCAAGCTCAGCCGCG
4   B01
4   B03   BP1732-91                                         BP1732
                        GGTTACGACAGTTTCATCAATCGTGAACCCGAACTGGCCACCGTGGCCGGG
4   B05   BP1733-421                                        BP1733
                        CAGGTCTTTCCAGCCGTGGCCGAACAGGAAAAAGCCCGGCTGGTGCCGTTC
4   B07   BP1736-76                                         BP1736
                        GGCGAAGACAAGCCCAAGCAATCGGTGGGCGAGTACGCCTCCGATGCCACG
4   B09   BP1737-81                                         BP1737
                        GGCCGGCATCGCCAAGATCCTGTTCTTCGTGTTCCTGGTGCTGGCGCTGCT
4   B11   BP1738-76                                         BP1738
                        GACGACGAGCTCACTCGCACCGAAGGCAATGCCGAACGGCTGGCTGGCCTG
4   B13   BP1739-2126                                        BP1739
                        CGGCCCCGGGACGCTTCAACGTCTTCGATTTCCGCGGCGCGACCCTGATCG
4   B15   BP1740-576                                         BP1740
                        GTTCGAGGGCAACCTGGTGCAGTTCGGCTACGGATCGCGGCAACGCCGCAT
4   B17   BP1743-266                                         BP1743
                        AGATCCGGCGCATTGTCTCGGTGTCCACATTCGCCACGCCATCGTCCTGGCA
4   B19   BP1744-391                                         BP1744
                        ATCCAGCTGGCCCGGCAGTTCGAGGTATCGTCGCTGCATGTCCTGTTCCCG
4   B21   BP1745-411                                         BP1745
                        TCTGTCCGGGTTGGGCCATGCCTATGGCGACTTTCCGGCCCACAATGGCCT
4   B23   BP1746-441                                         BP1746
                        GCTGACGTCGCTTTCGACGCTGTCGTGCTTCGGGCGCCGGCAAAGCTATTT
4   D01   BP1747-86                                          BP1747
                        CGTTGCTGCCCGTCCTGGTCGCGCAATTGAACAATTACCCCGGCGGCCTGA
4   D03   BP1749-271                                         BP1749
                        GAGCCCGCCGTCACCCAATGCTATATGGTCACCGGCGAGGTCTCGTGCGTA
4   D05   BP1750-406                                         BP1750
                        GTCTCGTGGTTCTGCCACGCCACCGGATGGCTCGATGAGCCGGTGTCGCTG
4   D07   BP1751-91                                          BP1751
                        GAACAGGGTGCGGTCGTCGATGTCGTCATGACCGAGGCCGCCACGCACTTC
4   D09   BP1752-381                                         BP1752
                        GTTCTACTGGCGCGACTGGCACTATCCCGCATTCAACCTGGCCGACGTGGC
4   D11   BP1753-496                                         BP1753
                        GGCCGCATTCTGGAAAAAGGCTATGTGTTCCGCGGCCTGAAACCGGTCAACT
4   D13   BP1754-811                                         BP1754
                        GACGAGAGCCTCGACGCATACGGTAAACTCGTGCGAGTCGAGTTCCTGCAC
4   D15   BP1756-496                                         BP1756
                        ATGCCTTATTCGCCGTGGGGCATTCGCCTGGCGGGGCACCCATCGGTCAAT
4   D17   BP1757A-246                                        BP1757A
                        CGTGACGCAGATCGTGTACCGGGGCACGCAACCGGGCCAGGACACGGTGG
4   D19   BP1758-621                                         BP1758
                        CGGCGAAGAGCTGCACAACAACCACCACGCGCACGGCACCTCGGCCAAGTT
4   D21   BP1759-1921                                        BP1759
                        ACGCGTTACGCCATGCGTTCGCGTTTTCTCGAAGAAATTCCCGAGCAGCATC
4   D23   BP1760-2361                                        BP1760
                        GTTCGTGGACACAGGGCCCGCCCCCGAGTACCTCGACATGTACGAATCGCT
4   F01   BP1761-866                                         BP1761
                        CGCCTATCCATGCCGAATCGGGCATCGATATCCGCATCCCCTCGCCCGACCA
4   F03   BP1762-461                                         BP1762
                        TTGCGCAAGTCGACGCCGTCGACGTTTCGTCCGATGCGCTGGAAGTCGCCG
4   F05   BP1763-481                                         BP1763
                        ATCGTCGGCGAACCGACCTCCACCGAGGCGTTGGGCGACGTATGCAAGAAC
4   F07   BP1764-51                                          BP1764
                        CAACCTGTCGCCCGTCGACGCGAGCGCCGAAGTGCGCGATGCCGTCGAACA
4   F09   BP1766-161                                         BP1766
                        CGCAAGCCAAGGCCAACGGCCAATACACGTTTGGCGAGCTGGAATATCCCG
4   F11   BP1767-691                                         BP1767
                        GACATCATGCACGGCCGGATCGAAAGCCGGTTCCTGGGCACGTACCTGACT
4   F13   BP1768-201                                         BP1768
                        CGCGTTCATGTTCTGCCTGATGATCGGCGGCGCGGCAACACTGGTTACGCG
4   F15   BP1769-41                                          BP1769
                        GCGTTTGCCTGGAAACCCGCGTGGATGGCCAGACCATCGGCACCTATGTGG
4   F17   BP1770-66                                          BP1770
                        GGGCGGCAAGGATTTGTTCGCGCACTTCTCGGAAATCCAGGCCAATGGCTTC
4   F19   BP1771-321                                         BP1771
                        CCGGCAGGGGCCGGAAGATTTGCGGCAGTTCTATTACATGCCGCTCGAACA
4   F21   BP1772-61                                          BP1772
                        GATGACGGCAGTAAAGATCTTTTTGCACATTATTCCGAGATCTGCAGCGAGG
4   F23   BP1773-46                                          BP1773
                        ATCTTCAGTTCGCGCTGGCTGCAACTGCCGCTCTACCTGGGCCTGATCGTCG
4   H01   BP1774-611                                         BP1774
                        CGCTCGGCCTGAAGGCCGGCGAGAGCAAGGTGTTCCCGCTCAAGTTCCCTG
4   H03   BP1775-66                                          BP1775
                        GGGCTACATCCCGATGGTCATCGAGCAATCGGGCCGGGGCGAGCGTGCCTA
4   H05   BP1776-41                                          BP1776
                        ATTGCTCGTTTTGCAACAAGAGCCAGCACGAAGTCCGCAAGCTGATTGCAGG
4   H07   BP1777-966                                         BP1777
                        CGACGACGACCACTACGGGCTGGAAAAGGTCAAGGAACGCATTCTCGAGTA
4   H09   BP1778-546                                         BP1778
                        CGACATCAGGATGGAAGAACTGGCGACCGAATCGTTCGTGTTCTATTCCCGC
4   H11   BP1779-951                                         BP1779
                        GGAAGCCGCCAATGTGCCTTGCGGCCCCATCTACAACATGCAGCAGATGTTC
4   H13   BP1780-861                                         BP1780
                        CATCGGTGCGCAGCCCATGCCGGGCTCGCAGCAGGATTTCGCCCGCTTCAT
4   H15   BP1781-111                                         BP1781
                        GTTCGGCACCACCATTGCCCACGGCTTGCTCACGCTTTCGTTGATCACGGGG
4   H17   BP1782-626                                         BP1782
                        GCATCGTCAAGTCGGTGATGAACCACGCGTTCGAGTCCGACCGCCGTACCG
4   H19   BP1783-51                                          BP1783
                        TTTCGCGCATCTGGCCGACGGCCGCTTCATGATCCAGCGTTCGCGCAGCAG
4   H21   BP1784-196                                         BP1784
                        CTGAGTTTCACGGAGTACCTCGGCATCTCGCCGCGCCTGACCGACAACAACC
4   H23   BP1785-606                                         BP1785
                        GACCATACGCGGCGAGAAATTTCGCGACACGTATCTCAGCCAGATTCCGTTG
4   J01   BP1788-221                                         BP1788
                        TGATCGCTTCTTTTCCGTCGCAGCCGGATTCGCACCATTATTTCGCCGCGTA
4   J03   BP1789-521                                         BP1789
                        TCTATACGGAACTGGGGATATTCGAATGCGCGGGCGATGCCTTCATCGTACG
4   J05   BP1794-521                                         BP1794
                        AGCGCCAGAACGGCCGCATCGAGCTCCTGCCCGAGAACCCCGACTTTGCTC
4   J07   BP1795-41                                          BP1795
                        ACCCCATTCTTGGCCTGAACGAACAGTACAACGCCGATACCCGTCCCGGCAA
4   J09   BP1796-266                                         BP1796
                        TCTTCCCCCGCAACGCGGTGGAGTATTTCGTGTCGTACTACGACTATTACCA
4   J11   BP1797-306                                         BP1797
                        CAAGGCCTATCAGCACAAGCTGATGCTGCTGATGCGGTTTGCCAACGAGTTC
4   J13   BP1798-56                                          BP1798
                        TGCGGCAGCATAGCGGCCCGGTCACTCTCGCGGCGATCAGCCAGCGCCAG
4   J15   BP1799-61                                          BP1799
                        GTCGAGAAAATGATTCCCTGGTTGTACGAGAGTTTCGGCAATCCGGCCTCGC
4   J17   BP1800-296                                         BP1800
                        TGCCGCCCGTGAAGATCCACTGCTCGATCCTCGCCGAGGACGCGATCAAGG
4   J19   BP1801-151                                         BP1801
                        GACGACGTGGTGTTCGACAGCTTCGGGGTCAAGGTTTTCATCGACCCCAAGA
4   J21   BP1802-401                                        BP1802
                        CGGAGCTGATCGACGAGCGCGGCGACTACCAGCAGGCCGGCACCAAGGTG
4   J23   BP1803-626                                        BP1803
                        GCACGTTCGATATTTCCATTCTGCGCCTGACCCAGGGCGTGTTCGAAGTGAT
4   L01   BP1804-56                                         BP1804
                        TCGAGGACGCGCCCAAGGGCGTGTCGATCTGCCGGGTGATGCTGGATAACC
4   L03   BP1805-61                                         BP1805
                        GATCCGCAGACCGTGCGCTTCACGCAGTTGCGCGAGTGGGTGCTGGGCCTG
4   L05   BP1806-66                                         BP1806
                        GGCCCTGTTTACCTGGCTGCGCGCCTGCTCGGCCACGATCCGCGAGATGGG
4   L07   BP1808-46                                         BP1808
                        CAGACCGATGGCGCGCTCGCCATCCTTACCCTGGACCGCCCCGCCGCGCTC
4   L09   BP1812-236                                        BP1812
                        CCGCCGGCGTGCAGCGCCTGTACAAGAAGGTCGATTCGACCTTGCGCGGCG
4   L11   BP1813-471                                        BP1813
                        CAAGACCTTCTCGCTGGTGCTGTCGGCCGGCGACCTGTATATCTTCCACGCC
4   L13   BP1814-636                                        BP1814
                        GCTGCTGATGCTGGAAGGGCAGGGGCTGGACCAGGACGGCCATCCGCTGG
4   L15   BP1815-436                                        BP1815
                        CACCCCGAGTGGGCCGAGGATTTCGCGGGCGACCATTTCTTCGGCTTTGCC
4   L17   BP1816-146                                        BP1816
                        TCACCAACGGCGAACGCTTCGACACCTACATCATCAAGGCGGCCCGCGGCA
4   L19   BP1817-261                                        BP1817
                        CGAGTCCACCGAAGTGCGGCTGGCCAGCGACATCCAGATCCGCAAGCTGCC
4   L21   BP1818-1126                                       BP1818
                        GTATCCAACCTGTACCTCAATACCGGACATGGTACGCTGGGCTGGACGATGG
4   L23   BP1819-731                                        BP1819
                        TCTCGCTGATGGTGAGCTGGAAGCGTTCGCTGCTGTTGACCGCGTATTCGG
4   N01   BP1820-706                                        BP1820
                        GGCATGATCGAAGCCGGGCTGGGCATCAGCGTCGTGCCGACCTTCACGCTG
4   N03   BP1822-81                                         BP1822
                        GGATCGCGCCTTGTATCCCTTGCTGGTCGAGCAGCTGACGCCCGAGGTGGT
4   N05   BP1823-1426                                       BP1823
                        CAGATCGCCGCGAAGATACAGCAGCTGGCCTATGACCAGGTCTTCTATATTC
4   N07   BP1824-186                                        BP1824
                        GCTGGGCCAGTATGCCCAATGGCTGTGGGATCTGTTGCAGGGCAACCTCGG
4   N09   BP1825-206                                        BP1825
                        ATGGCAGCCGCATGTCCCTGGCCATCGGCGCGCTGGTGGTCCTCATCACGA
4   N11   BP1826-1111                                       BP1826
                        GATCCCTACCGGTCGCTGAACCCGCGCCGCAGGATTCTGCATGCCTTGATC
4   N13   BP1827-86                                         BP1827
                        AGGTGACCGACGTCTTCCTGCGCCGCATCCAGGACCTGAATCCCGCGATCG
4   N15   BP1829-1421                                       BP1829
                        AGCCCGTCATCCTGTCGGGCTTCGACCACAGCGAAGACCAATACGAACGCC
4   N17   BP1830-1201                                       BP1830
                        GCGACGCTGCGCGCCAGCGTGCTGTCGCTGCATCTTCAAGGATCCCTCTAT
4   N19   BP1831-116                                        BP1831
                        CCGACCGCATCGTATTGCTGGCCATCTACGGCGTCGGCGCTGCGCTGCGCG
4   N21   BP1833-861                                        BP1833
                        CGATGCCAGCGTGTTCGATACCGGGCTGTTCGAACCCGCGCACGCCTGGTT
4   N23   BP1834-101                                        BP1834
                        CCGCCATCGGCTCGTATGTCATCGAAAGCAAAGTGCCCCGGGTCGGAGAGG
4   P01   BP1835-646                                        BP1835
                        AACTCCCACGTGGGCTGCCGCTCGTACAGCGGCCATACCAGCCGCAATCCG
4   P03   BP1836-61                                         BP1836
                        ATCGTTCCGTCGTCGTCCCTGGTGCCGGCCAACGACCCCACGCTGCTCTTTA
4   P05   BP1837-46                                         BP1837
                        GTCGATGCCAGCGGGCTGACCTGTCCGCTGCCCATCCTGCGCGCCAAGAAG
4   P07   BP1838-221                                        BP1838
                        GCAATTTCGACCGCATCAAGGTAGGCGACACCATGCGTGTGGACTACTACGA
4   P09   BP1839-46                                         BP1839
                        TTTTACAACCTGGTAGCTACCGATTCGCGCAATCGTCGCGATGGCCGTTTCG
4   P11   BP1840-56                                         BP1840
                        GCATTGCATCGGCCTACGGTGTCAAAGGCTGGGTAAAGGTGCAGCCCCACT
4   P13   BP1841-341                                        BP1841
                        TCATCTGCGGACGCTACGAAGGCGTGGACCAGCGCTTCATCGAGCGCTGTG
4   P15   BP1842-506                                        BP1842
                        CCAATGGCGGATTGGTCAATCCGGCTGCCGCCGTCGGGCGCATTGCGCGGC
4   P17   BP1843-311                                        BP1843
                        CGGACTTCAATCGCCACAGCGCCATCGCGAACGGCGCGTCGGACCTGATGG
4   P19   BP1845-626                                        BP1845
                        CCACGCAGGACGTCTTCATTCCGCAGACCGTCAATCTCGACCTCATCGGCGG
4   P21   BP1846-471                                        BP1846
                        TCCCGAGGGCATGTTCTTTCCCGACACCTATGTGTTCACTCCGGGCAGCACG
4   P23   BP1847-266                                        BP1847
                        AGTGGGTGGTGTGCGACCGCTTCACCGATGCGTCCTATGCCTATCAGGGCG
5   A01
5   A03   BP1848-421                                        BP1848
                        GCGCTGCTGTATCCGGCGCATGCGCTGAACGTGATATCGGCCAACGCCTTG
5   A05   BP1849-136                                        BP1849
                        CTGATGCAATTGGTCGAGCCGCACGGCAATCTCTGGGCGTCGGTGGGGGTG
5   A07   BP1850-176                                        BP1850
                        CCAATGTGCGCTACGACAATGGCCAGCCGGCCATCATGCGGGCGGTGGTCG
5   A09   BP1851-316                                        BP1851
                        GCCATGTCCGACCAGGCGGTCTGCCTGGAGATGGTCGAAAGCCGGCATCCG
5   A11   BP1852-431                                        BP1852
                        TCAACTATCTGAAGGAGCACTTCCCCAAGGTGCAGCGCGTCGAGGTGGAGA
5   A13   BP1855-181                                        BP1855
                        GGCACCATCGATATCTGCGGCCACAACCTGCTCAAGGATGGCCGGCTGCTG
5   A15   BP1857-456                                        BP1857
                        CAAGGACATCCCGGCCCCGGACGTGAACACCAACGCCCAGACCATGGCCTG
5   A17   BP1859-946                                        BP1859
                        CATGCCGTATCGGTGCAGTGCGAGCAGGTGCAGTACTTCGCGCCGACGCCC
5   A19   BP1860-1436                                       BP1860
                        CCCACCAGGAACGCGAATTCCCGGGCCGCGCCATTGCCCTGGACTTCCAGA
5   A21   BP1861-671                                        BP1861
                        GCATCGGCCTGAAATCCAAGTGCGCCGTGTTCGCCGAACAGGTGCCCGCCA
5   A23   BP1862-761                                        BP1862
                        GCTTTTTCTGGTACCGCACGCTCAGCCTGAAGTCCCTGTGGGAGAGCCTGAA
5   C01   BP1863-66                                         BP1863
                        CTTGCTGGCCGCACTGATCACCTACGTTGTGTTCGAACGCTTCGTGATGCAC
5   C03   BP1864-691                                        BP1864
                        GGTCATGTGTGGGGTCCGGCAAGCCTGATCGTCTCCAAGCCGATCTGGAAC
5   C05   BP1865-516                                        BP1865
                        CAGCGCCACCAGCCCGGTGTTCAGCCGGCTCGAACAGCATTTCGTCACGAC
5   C07   BP1874-791                                        BP1874
                        ATGTGTCGGCCACTTTTGCCGCGACGCTGGCGAAACTGGCCGAGGCGGGAG
5   C09   BP1875-401                                        BP1875
                        TCCGCCACATCGAGCAGGGCTGCAACGTGCCCATGTACCGTACCAACATCG
5   C11   BP1876-346                                        BP1876
                        AACCGCCATGTGGGGCTGTTCATCCAGCCAGAGCCCATATGCCTCATGAGCC
5   C13   BP1877-3131                                       BP1877
                        CGCCCGGTTACGGACGTACGCGGTGCATTCTGTTCGGCTTCACGGCTTCGG
5   C15   BP1878-391                                        BP1878
                        AGCGAGATGCGCATGGGCGACAACGCCAAGAGCGACAGTACGCTCATCAGC
5   C17   BP1879-9311                                       BP1879
                        CGCCCGTGGGGTCTGCCGGCTTCAATTTCAATACGGAACACGACAATTCGCG
5   C19   BP1881-286                                        BP1881
                        TTGCGCATTTTCTTCAATGGCTACCCGGATGGCAAGACGCTGCCGTCCGACC
5   C21   BP1882-186                                        BP1882
                        CGACATTTACGCCAACAACTATCCGCTGATCCGGCAGCAGGTTCGATTCGTC
5   C23   BP1883-976                                        BP1883
                        GCGCAGCAGACTGAGTCGGCGACGTTCTCGCTGCCCATGAAGGCGCAGTAC
5   E01   BP1884-1016                                       BP1884
                        GTTTCGGACTGAAGGCCACCCGCCTGCTTTACCGCGATACGCGGTCGCAGT
5   E03   BP1886-386                                        BP1886
                        TTCCCCAGCTGACCATGGCCGCCGGCACCATCCTGTTCTTCATCGCCCTGCT
5   E05   BP1887-591                                        BP1887
                        CGTGATCGACTCGTACATGTCGTCCGGCTCGACCGGTTTCGACACCAAGACC
5   E07   BP1890-181                                        BP1890
                        GCCATGCTGCGCGGCGACCATATCCGCGTGACCCTGTTGCTGCAGTTCCTG
5   E09   BP1891-151                                        BP1891
                        ACCGCCGGCGCGCTGGAGATCAAGGTGCAGTCCAACAGCACCCTGCTCAAG
5   E11   BP1892-56                                         BP1892
                        TGTTCATCTGGACGGACATCGACCCCGCGCACGAAGAAGACTTCAACCAGTG
5   E13   BP1894-301                                        BP1894
                        GGCGATCGCAGCGGCAAGGAGGTGTTCTACAGCGTTACGCCGAAAGGAGCC
5   E15   BP1895-541                                        BP1895
                        CGCGAGATCGGCTTTACGCAGGTGTCGACCTCGCACGAGGCCAGTCCGCTG
5   E17   BP1896-761                                        BP1896
                        AGATCGTGACCGATTCGTCGCGCAGCCGCCAGCGCCACATCGAGAACCTGA
5   E19   BP1898-481                                        BP1898
                        AGCACGGTCTGGAACGCCACCATCATCAATTACAGCCGCAACGCCAACCGGC
5   E21   BP1899-326                                        BP1899
                        GGGACGGCGACGACTCGGTCAGCCTGCACCGGGAAATCGGCAGCTACCCCG
5   E23   BP1900-811                                        BP1900
                        GTCGTGAACACGCTGAACGCGGCCATGGTCAAGGCGCTGGACAAGCCGGAG
5   G01   BP1901-381                                        BP1901
                        CGGGCTGACCAATGCCCAGATCGAGCTCTGTCACCGTATTTGCCATATCCCG
5   G03   BP1902-51                                         BP1902
                        CATCATCAACCGCGCCAGTCTCGACCTGGAGCGCCTTACCGTGGCCCGCAA
5   G05   BP1903-1451                                       BP1903
                        GCGAATTCGAAGGATCCCATCATCGGCGCGTGCGCTTCGAAGTGCTGCAGA
5   G07   BP1904-616                                        BP1904
                        GAGTTCTCGTTCTTCCTGGCCATGCCGACCATGCTGGGCGCGGCGGTCTAC
5   G09   BP1905-296                                        BP1905
                        AGCCGGTGCTGCTCGAAACCGACTACGGCCGCATCCTGCTCACGCACGGCG
5   G11   BP1906-66                                         BP1906
                        CGAAAAGGCGCCCAAGAGCGTGGAAAACTTCGTCGCCTATACCAAGGACGG
5   G13   BP1907-226                                        BP1907
                        TCGCAGATCACCGACCGCATCGAGGAGCTGCTCAACCGCGGCGCCAACGAA
5   G15   BP1908-576                                        BP1908
                        GGACGACACCAAATGGGAGTCGCCCTATGGGCTGGGCCGCCCGGGCTGGC
5   G17   BP1909-481                                        BP1909
                        CTGGATGATCTTGGGCTGCTGAAGGCAATCTCGTTACACTATTTCAGCGGCG
5   G19   BP1910-641                                        BP1910
                        TGCTGATGCTGCAGTACGCAACCTATTCGGTGATTTCGCCCGAAGGCTGCGC
5   G21   BP1912-851                                        BP1912
                        AACTGCAGCGCCAGTTGCGCCAATTGCACGCGCTGGGCCACGACCGCCACT
5   G23   BP1913-691                                        BP1913
                        TCGCTGACCGACCCGCTTATCCCGCTCGAAGAAGAAATGCGTTCGGGCACG
5   I01   BP1915-291                                        BP1915
                        GGGCAAGTCGCGCAAGCACAGCTTTCTCAATGCCGGGCCCGAGCCCCTGTC
5   I03   BP1916-61                                         BP1916
                        ACCTACGAAGCGCACGGCCTGGCGCTGCAGAAGAAGTACCTGGGCCGCTTC
5   I05   BP1917-546                                        BP1917
                        GATTCCGGGCTTCGTGCTCAACCGGCTGCAAGGCGCCTTGCTGATGGAGAT
5   I07   BP1918-71                                         BP1918
                        GCATGACATTGTGCACGCTGTGGCAGGTGTCGGTGCGCTTCCTGCTTACCG
5   I09   BP1919-811                                        BP1919
                        TCGTCGGCGGTGACCTCCGGCATCGTCCTGTTGATCGTGGGCTTCGCGTCG
5   I11   BP1920-651                                        BP1920
                        TGCCGAAGTGATCAAGTATTACTCGGTGACCGCCGCCCACCAGCTGCCCAG
5   I13   BP1921-736                                        BP1921
                        CATTTCTTTCCCATTGTGCGCGGCGCCGATTACGTCGCCGCGCTGCTCGATT
5   I15   BP1922-676                                        BP1922
                        CCGTTGGGCGAGATGCAGATCGAGCTGGTCAACGCGCCGTCGCCGGCCAAT
5   I17   BP1923-361                                        BP1923
                        CTGGGCTGCAAGTACGTCATCCCGATCATGCAGCGCCAGGGGGCCGGCGTG
5   I19   BP1924-141                                        BP1924
                        CTATCACTACCGGCACAAGCACGAGTTGGTGGAAGACGTCACGATCGAGTAT
5   I21   BP1925-491                                        BP1925
                        ACATCACCCCGTCGGTGTCCACGCTCAATGAAGACCTGGGCCTGCAGCATG
5   I23   BP1926-806                                        BP1926
                        GGTCGACCATCGATTTCACCTGGAACCAGGGCATCCTGATCCCGGCGGGGT
5   K01   BP1928-656                                        BP1928
                        TTGGAGGAGGCAAGACCGTGATGGTGGCGCAATACATAGAATTCGGTATCAG
5   K03   BP1929-91                                         BP1929
                        ATCCCGGTGTCGTTCACCGACCGCTCCTATCTGTCGTTCCCGGCCGAGTCAT
5   K05   BP1930-926                                        BP1930
                        CCATCAGCTATGCGGGCAACCTGATGAACTATCTGCTGCGCACGCCGCGCG
5   K07   BP1931-111                                        BP1931
                        AACGGCCGCCTACTATGCCCGTTACGCGCGCCATGGCGCCGGACTGGTCAT
5   K09   BP1933-1751                                       BP1933
                        TCGTCGCGTCCATGGTCAAGCCCCGGCGCGAATTCATGATCGGGGCGCGCT
5   K11   BP1934-771                                        BP1934
                        GCCCATCGTCGAACGCCTGAACAAGGAAATCAACGCCGCCCTGCAGGCGCC
5   K13   BP1935-41                                          BP1935
                        ATCCGAACTCGACCTTCTCGCCCGCGGTCCGGGCGGGCGGATTCCTCTATA
5   K15   BP1936-281                                         BP1936
                        TCATGCGTCCGGTGTACGTGGACGAAACGGTGCAGTGCGTCTACCGGGTCG
5   K17   BP1937-51                                          BP1937
                        CATCAACGGCGACAACGACATCATCCACTACGACCACGACTACGCGGTGCAG
5   K19   BP1938-191                                         BP1938
                        CCAACGTCATCCTGCCTTACATGACCGTGCCGGTGTACCAGACCTACCCGCC
5   K21   BP1939-186                                         BP1939
                        CATCCTGCAGCGCGCCGGTCTCATCCACAGCCGCCGGGTCGGCCAATGGGT
5   K23   BP1940-531                                         BP1940
                        GCATGCCGCCAATGGCTACCTGCTGGACCAGTTCCTGCGCTCGGGCAGCAA
5   M01   BP1941-101                                         BP1941
                        ACATCCATCACTCGCTGGTCACGGTGGGCGGCACCGCCGCGCAGATCGCCG
5   M03   BP1942-41                                          BP1942
                        TCTATTACCCGTTCTTCATGTCGTATTTCTGGATCGTGGGCGGGCTGCTGCA
5   M05   BP1943-366                                         BP1943
                        GGTGTTTCCCTTGCTGAAGAAATTCAACTATCCCGCGGTGGTCGCCGTCGTC
5   M07   BP1944-676                                         BP1944
                        CGCATCGAGAAAACCTCGCCGCAATACGTGGAGAACGCGCCGGTCGCCGAA
5   M09   BP1945-141                                         BP1945
                        TGCCTACCTGCTGAACTGGGCCGCCGGGTTGATGGCCCTGATCGGCTGGGG
5   M11   BP1946-316                                         BP1946
                        ACGCTCACGCCCGACGGGCGTGCGCTGGTCGAGGAAATGGTGCCGTTTGCC
5   M13   BP1948-436                                         BP1948
                        ACCTCGACCTACATGCAGGTGGCCATGCTGGTGCCCGAGGCGCTGAAGCTG
5   M15   BP1949-1801                                        BP1949
                        GTCATCCTCCTGCTGGTGCTGGTGTTCCCGCAAGGGATCGCGGGATTCTGC
5   M17   BP1950-561                                         BP1950
                        CAAGCGGCTGGTGGTCGATCGGGGCATGGCGGTGCTGTTCACCGAGCACAG
5   M19   BP1951-656                                         BP1951
                        CCGAACTGGTTTCCGATCGCGTCTATGTGCTGGAGAAGGGCCAGATCCGCT
5   M21   BP1953-91                                          BP1953
                        ACGGCGGACCCCGACACCCCGCTGCTTTACATCCTGCGCAACGACCTGTGC
5   M23   BP1954-611                                         BP1954
                        GGTGGTCGGACGATCGCCATATGATGGTTTACTTCGTCACCGGCAAGCGCG
5   O01   BP1955-381                                         BP1955
                        AGCGCGGAAGATCGCGGTGGTGGCGCCGTACATGAAGCCGCTGACCGAGC
5   O03   BP1961-451                                         BP1961
                        CTGGCCCTGTACAAGCGCTTTCCGTACCGGCACTTCTTCCGCACGCACCGG
5   O05   BP1962-1241                                        BP1962
                        TGGACCTGTACCAGCCGGTCTACGGCACCCTGCCCGACTATGCCATGTCGG
5   O07   BP1965-426                                         BP1965
                        ATGGATCGCCGCGCATCCGAAGCAATTGACGGTGGGGGTGCCGGCCACCGG
5   O09   BP1969-151                                         BP1969
                        GAACTGGCGATCCTGGGCTGTTCGGGCGTGAGCGAGCACGACCAGCTGATG
5   O11   BP1970-336                                         BP1970
                        CGTGACAGGCCGGCGCGACGGGCAGGCCCACAGCAGTTTCAAGATCATGAT
5   O13   BP1971-326                                         BP1971
                        AGCAGTGCGACATCGAGGTCGAGATCGAATACGCGCGCATGCTGGAGTTCG
5   O15   BP1972-691                                         BP1972
                        CGGCTCTACCAGATGGTCACGCTGGGCGCCAAGCGCTTTCCGCCGGGCGAG
5   O17   BP1973-646                                         BP1973
                        GCCCTGGGCAACCGCGACCTCTGGCTGCTATGGCTGGGTTTCATGGCTTGC
5   O19   BP1974-101                                         BP1974
                        GCATTCCCGACTACCGCGACGGGCAGGGGCAGTGGAAGCGCAAGCCGCCG
5   O21   BP1975-611                                         BP1975
                        ACGAGTACCGCCTGGCCGCCTCGGGCCATTGCCATGTGCTGCTCTACAACA
5   O23   BP1976-711                                         BP1976
                        CGGCTCGACCGAAGTCGGCCGCACGCTCATGGAGCAATGCGCGCCCACCAT
5   A02
5   A04   BP1977-1146                                        BP1977
                        CCTGATTTTGCTAAGCTGCGGTGTGTACGGAAACGTTCTGCGTTTCCTGTAT
5   A06   BP1979-191                                         BP1979
                        GCACGCCGCCGGGCTTTGTCTTCAATATCAAGGCGTTTCGCCTGTTCACGGG
5   A08   BP1980-1666                                        BP1980
                        AGCGACGAGTCCGGTCCGCCGCTGCGCGACGAAGACTATATGATCCTGTCC
5   A10   BP1982-361                                         BP1982
                        GCCGGCAAGACCCTGACCGCGCAATGCTACGAGCGCGACCAGTTCGACCGC
5   A12   BP1983-116                                         BP1983
                        ACAATGCGCTCTACACCGCGTTCGTCAAGCGTTCGCCCAAATACCTGGATCC
5   A14   BP1984-606                                         BP1984
                        CCGGCTGGGGCCCGAGGCGCGCTTCTACCGCACGCTGTTTCTCGAGGAAAT
5   A16   BP1985-1231                                        BP1985
                        GTGGATCCCAGCATGAACTCCTTCGGCTCGATGATCGACAGCGCGCGCCTG
5   A18   BP1986-731                                         BP1986
                        CGTTCTTCGAGCGGCCGCGCCATCCCTATGCGCGCGAACTGTTCGAGGCCA
5   A20   BP1987-171                                         BP1987
                        GTCGTTGACCGAACTGAAGGCCCTGGACCTGGTGCTGGAGTTCGATGCCCT
5   A22   BP1989-961                                         BP1989
                        AGCTATCCGTTCCTCTTGAACAATCAGCGCTCGCTGACCGGTACGCTGGGCA
5   A24   BP1990-376                                         BP1990
                        GTGGCGGCGATGCACTACATCGGCATTGGCGCCATGCGCATGCCGGCGATG
5   C02   BP1991-61                                          BP1991
                        GGCCTCATCGTGGGCCTGATCGCGGTCGTCATCATTGGCTCGGTGTCGCTG
5   C04   BP1992-41                                          BP1992
                        ATGTCGCCTTCAACTTGCTGGTCGTCTTTTACGATCTGCGCGTGCGCCGCGT
5   C06   BP1993-296                                         BP1993
                        AGATCGAAGTGCTGGTGCGCTATCCCTACGCGCAGGCGCCGCTGGTGCCGC
5   C08   BP1994-61                                          BP1994
                        TTTGCGCTGGTGATCCTGCTGATGCTGGCGCTGATGCTGGGAGTGCTGGGC
5   C10   BP1995-221                                         BP1995
                        GGCCGGTGCAGCCGGCCAATGGATACGCCGAATCCGAGGCGTTGCTGGGG
5   C12   BP1996-956                                         BP1996
                        CCAACGGCATTTCCAGCATCGACAGCAACAATCGCATCACGGTGATCCCGGC
5   C14   BP1997-671                                         BP1997
                        ATTGCCTGCTTTACCTGAACATCAGCAGCGACTTCGATTTCGCCGAAGCCGC
5   C16   BP1999-781                                         BP1999
                        GCGCTGTTCATCATCATCTTCAACAACCAGCTGTTCATGGGCATGTGGCACG
5   C18   BP2001-226                                         BP2001
                        TACTTCGCCTCGCTGGCCTACCTCGATGCCTACCGCCAGAATTTCGGCGACT
5   C20   BP2003-116                                         BP2003
                        ACTTCTTCTATATGAAGCGCGAGCTGCAGAAGACCGCCGATCTGGCCGCGCT
5   C22   BP2004-41                                         BP2004
                        ATGTCTGGGAAGGCACTTCGGACATCGCCTTTCGCGCCGAGCGCGCCCTGG
5   C24   BP2005-286                                        BP2005
                        GACGAGCTCACCTATTATGTCGCGCTTTTCCAACAAAAGGATTTCTGGCGCG
5   E02   BP2006-116                                        BP2006
                        TCTGCGAGTCATCCCGCATCACCAAGCGCCTGTCCGCGCCGCGCCTGAACG
5   E04   BP2007-86                                         BP2007
                        AGGACAGCGCGTTCGAAACCATCATGCGGCGCCACAACCGCCTGCTGTTTC
5   E06   BP2008-346                                        BP2008
                        TATGCGTTCCCGACCAGCCAGTTGAAGTCGCAGGCCGACGTATTGCGTTTCG
5   E08   BP2009-201                                        BP2009
                        TTTCGCCTATACGCAAGCCATGAAGGACTCCGGCCTGACCTGGGACGCCGC
5   E10   BP2010-201                                        BP2010
                        CAAGGAATGCACGTACTCGTACTTCGGCGATCCGATGTACGTCTTCATGGAC
5   E12   BP2011-351                                        BP2011
                        GGAAACCTGCCACGGCCTGCCCTCGCAGCGCGCCGACGGCCTGGTCAAGC
5   E14   BP2012-906                                        BP2012
                        CGAATACCGTATCGGCTTTACCGCGCGCAACAGCAACGACGTCTATTACGGC
5   E16   BP2013-461                                        BP2013
                        ATGACGGCGTGCTGGTGATCGGATCGGGTTCGCTGACGCACAATCTGCGCG
5   E18   BP2014-1151                                       BP2014
                        AGATCGGCAACGTCAAGAACACCTTCACCGAGCTGTTCTCCAAGCCCATCGC
5   E20   BP2015-406                                        BP2015
                        AACGGCGTCTCGAAATGGGACGCCTACGGCCAATACCTGAACTACCATGAGG
5   E22   BP2016-211                                        BP2016
                        GGCACGCGCGACAACCTGGAAACCCCGTTCTCCATCACCGCCTACACCAACG
5   E24   BP2017-171                                        BP2017
                        TGCCGCCATCGAGCCGATCCGCGCCGGACAGCGAGCCTTTGCCCCTCTCGA
5   G02   BP2019-91                                         BP2019
                        AAGAGCACGATACTGGGCTTGCAGGCGACCATCCTGGACCTGAAGGGCTTG
5   G04   BP2020-161                                        BP2020
                        AAGATAGCAACGATGTACCGCTGACGAATCCCAAGGTACTGATACGGACGTC
5   G06   BP2021-461                                        BP2021
                        AATGGTTCACCAGCCGTCCGGAAGTGCCGCAAAGCCTGACCGTCACGGTCT
5   G08   BP2022-46                                         BP2022
                        ATCAATATGGCCTATTTCCGTCGCTACACCACGCCCCATCCCTATGGGCAGA
5   G10   BP2023-266                                        BP2023
                        ATCAGCTTGGGCTGGACATCCCCGCCGCCGTGGCCGCCAAGATGCGCAAGA
5   G12   BP2024-136                                        BP2024
                        GCGCCGCAGCGCTACACCCTGGTGGTGGACTGGGAGACGGTGGACAACCA
5   G14   BP2025-211                                        BP2025
                        TACGTGCGCGAAGGACTGGTAACCCATTGGCGCGTGCGTCCATGGACCACG
5   G16   BP2026-251                                        BP2026
                        TCACGCCGGGGATGGCCTCCCTGCTGGTCCAGTCCCAGGTCTTCTTCACCA
5   G18   BP2027-491                                        BP2027
                        TGCCGCTGGCCACCATACGCAACAGCCTGCTGATCCTGTTCTCGTGCAATGC
5   G20   BP2028-241                                        BP2028
                        CATCGCGACGGGGTCGAGGTATGGACCGATACGTCGCAATACTCGAAGACC
5   G22   BP2030-301                                        BP2030
                        ATCAACCTGCTGTTCACGCCGGTCGTCAAGCGCTTTCGCGAACGCCATCCGC
5   G24   BP2031-1206                                       BP2031
                        CAAGTCCATGGCCAGGAACGGCGATATTTCCAGCGTGGTGCCCATGGTCTC
5   I02   BP2034-366                                        BP2034
                        GCACCACCCGGACATCGCCCTGGAGATCGAAACCTCGCAGCAGGTCGTGGA
5   I04   BP2037-46                                         BP2037
                        ACCGTCGACGGCCAGCGCTGCGAGCTGGACTACGTCCTGCGCGACCACATC
5   I06   BP2038-521                                        BP2038
                        CCATGGCCTTCTACCGCAGCCTGGGCAAATACCCCATCCGCATCGACAAGGA
5   I08   BP2039-261                                        BP2039
                        CTTTGCGACCAGCAACGGCGTCGCGTTGCAGAAAGACGTGATTGCCCAGGC
5   I10   BP2040-226                                        BP2040
                        CCGCGCACCAAGTGGTGGCTGATCGGCCATGCCAACAAGCAGCTGGCGCAT
5   I12   BP2041-1061                                       BP2041
                        CGCAGCGCTTCCAGCGCGAAGTGGACTCCAGCTCGGTGTACGTCAACCTGC
5   I14   BP2042-216                                        BP2042
                        GCAAAGCGTCTCGCTGTTCGGCGACCGGCGCCTGCTGGAACTGAAAATCCC
5   I16   BP2043-281                                        BP2043
                        AGGTTTCGCTCAATGCGCAGGGCCGGGTCGAGGAATACGAACTGGGCATCG
5   I18   BP2044-81                                         BP2044
                        CGAGCACGCCAAGAACCCCGACGGGTCGGAAAAACCCAAGTTCTACGCCTG
5   I20   BP2045-71                                         BP2045
                        TGGCCAGCAACTATTACGCCCAGCCGCTGCTGCATACCATCGGCGCCGAATT
5   I22   BP2046-41                                         BP2046
                        ACGAACGCCCCGACCTGGACGTCTCGTCCATGGCCGTGCTGGCGCGTATTT
5   I24   BP2047-126                                        BP2047
                        GGTCGACAAGAAGGGCGCTGGCGAATTCACCCTGCCCGGCCTGTTCAAGGT
5   K02   BP2049-926                                        BP2049
                        GCGGACTGTTCTCGTCGTACCTGTCATGCGGTTCGCTCAATCGTTCGGTGCC
5   K04   BP2050-56                                         BP2050
                        ACTTCTACACGACCACCAAGAACAAGCGCAACATGCCCGAAAAGATGCTGAT
5   K06   BP2051-51                                         BP2051
                        TGTTTCGCACGCGAACAACAAAACCAAGCGCCGCTTCCTGCCCAACCTGCAA
5   K08   BP2052-556                                        BP2052
                        ACGATGAAGGAGACGCTGGCTCCCGAGCGCGTGTTGCCGCTGCGGGCAGG
5   K10   BP2055-696                                        BP2055
                        GTACGATGCGGAAAAGCACAAGTGCCTGACGGCGCCCAAATGCAGCGATCC
5   K12   BP2056-51                                         BP2056
                        ATTCGTCGATCATCTCGTTACCAACTACGCCGACACGCTGGAAGCGATGTCG
5   K14   BP2057-721                                        BP2057
                        GAGCTGGTGCAGGAAGGCACGCCGGAAGACATCCTGCTCAATCCCGCCACC
5   K16   BP2058-176                                        BP2058
                        GGCAAATGGCGCTGGTGACGGTGGACATGATCGCCGGCCGCACCGACGAG
5   K18   BP2059-451                                        BP2059
                        TCCGATCCGTTTGGCCGCATGCACATGGGCGTGACGGCCGAGAACGTGGCG
5   K20   BP2060-506                                        BP2060
                        TGTCGGTCAACCTGTTCGGCCGCCACGAGAGCTACGGGCGCAACATCGACA
5   K22   BP2061-436                                        BP2061
                        AACCGCTGGCTGTCCGACATGGTCGACAACCTGCGCAAGGTGCTCAGCCTG
5   K24   BP2062-731                                        BP2062
                        ACAAGGCGCGCTGGGCGATCTTCTATTCCATCTCGAATACGCAGCCCGGCCT
5   M02   BP2063-696                                        BP2063
                        GCTGGGCGAAGACGAATACCTGGATTTCTTTTCCTATGCCGAAAGCCGCGAC
5   M04   BP2066-271                                        BP2066
                        ATGGGGGGCGCCCACCATGCCCTGGCGCCATCGCTGTACAAGAACCTGAGC
5   M06   BP2067-51                                         BP2067
                        CGCCCAGTCCGTCGAAATGTCCCTCCTGAGTCCCAAGGGCGACGACCAGAA
5   M08   BP2068-141                                        BP2068
                        CGACGGCGTACAGGACGCCCTGAAGCAGGCGGGTTACGAATCGGGCAAGAA
5   M10   BP2070-241                                        BP2070
                        CGCGTGGCGCGGGTTTTCCAGGACCCCATGGCGGGCACCTGCGAAGACCTG
5   M12   BP2071-361                                        BP2071
                        ATCATGAGGCGATTCATGCTCAAGACCAGCGCCCGCAACCGCCTGCTGGGC
5   M14   BP2072-61                                         BP2072
                        TCGGGCCCCACGCTACGCAGCGATTATGACCACAGCGCCAACTTCGCGCAG
5   M16   BP2073-1001                                       BP2073
                        AGGCCAACCAGTTCGAACGCCATTCCAAGGACTACGAGTTCAATACCGAGTC
5   M18   BP2074-106                                        BP2074
                        GCCATCGTGCATCTGTCGGCCGCCGAACGCATCTGTATGCTGGGCCTGCTT
5   M20   BP2075-476                                        BP2075
                        CCAACCTGACCAATGCCAAGATCAACCTGGGCTATACCGACGTGACCTCGCC
5   M22   BP2076-2396                                       BP2076
                        CGACCTTCGTGTCGGCCAAGTGGGTGCAAGGGCCGGTCCAGGTGGTGCGC
5   M24   BP2078-606                                        BP2078
                        GGCGCTCGACGGCATCGCCGAACTGAACATCGGCCATGCCATCGTGGCCCA
5   O02   BP2079-226                                        BP2079
                        GCCAAGGAAGCCTTTTCCAAGGCCATCGGGCTGGGCATGCGCATGCCCATG
5   O04   BP2080-661                                        BP2080
                        ATGCCGGCTGTCATGCCGGCGCATGTGATCTATCCGAAGGTCGATGCCCAG
5   O06   BP2081-111                                        BP2081
                        CGATCTCAAGAAACGCGTATCGTCGTATTTCCAGAAGAACCTGGCCAGCCCG
5   O08   BP2082-291                                        BP2082
                        TTCGCTGATCATCATCGGCCGGGAAATCACCATTTCGGCGTTGCGCGAATGG
5   O10   BP2084-231                                        BP2084
                        CAACATCGTCGAATCCAAGTCGTTCAAGCTGTACCTGAATTCGTTCAACCAGA
5   O12   BP2085-151                                        BP2085
                        GCGACCCGCTTGTGGGATTCGTTGCATAGCGAGCCCTTCGTCAATTCGCTGG
5   O14   BP2086-501                                        BP2086
                        CATTCCCTGGCTGGGCTGGACGGCTTTCTTCCTGTTGTTCATCGGCGCGGCC
5   O16   BP2089-306                                        BP2089
                        GATCTTCATCCGGGGCGCGGTGCAAAGCCTGTTCGGCAAGCAGATCCACAG
5   O18   BP2090-421                                        BP2090
                        ACCGACCGCATGGCATGCCAGAAGGTGTTTGCCGACATGCGCAAGAACGGC
5   O20   BP2091-111                                        BP2091
                        CTGGCACAGGACCTGGGTATACGTGGGTCACGTCAGCGAAGTGCCCAACAA
5   O22   BP2092-81                                         BP2092
                        GCAGTTTCTCTATCACGAGGCCCGGCTGCAGGACACGCACGACTACCAGGG
5   O24   BP2093-451                                        BP2093
                        ATGGCGCCGGACGCGGGCAGCTCGGTCATCCTGCCGCATCTGATCGGTTTT
5   B02
5   B04   BP2094-201                                        BP2094
                        CGCCGCGCCGTTCGACATCCTGGTCAACAATGTCGGCGCCGACCAGCACGC
5   B06   BP2095-201                                        BP2095
                        GGAGCGCGACATGCTGGACTTCGCCAACGATGTCCGCGCCGAGTCGCGTCT
5   B08   BP2096-676                                        BP2096
                        TATTTCTACGCCACCTATGCCTGCGTCGACGGGCGCTTTCTGGCCGTGGCCT
5   B10   BP2097-526                                        BP2097
                        GATCTGTCCATGCAAGGCCGCAGCTACGTGGAGCTGGCCGAACAGGACATT
5   B12   BP2098-626                                        BP2098
                        TGGGCGGCCAGTCGGTCTCGGCCGAATTCCGCGCCCAGCTGGAAGCGGAA
5   B14   BP2099-41                                         BP2099
                        TGGGCTGTTCCCGTTTCGGCGAACGCTGGGACGTGGGCCAGGAAGAATTGA
5   B16   BP2100-1286                                       BP2100
                        TTTCGCCGTGCCCGCCGAATTGCTACGGGCTGGTCGACATCGATGGCGGCG
5   B18   BP2102-341                                        BP2102
                        TGGTGGCCTTCAATCAGCGGCACCCCAATATCGAATTGATCGTGGTCGATTG
5   B20   BP2103-316                                        BP2103
                        GTCATGGGGTCCAATGGCACATGGGCGATCAACCTGGGCCTGTACGAGAAG
5   B22   BP2106-41                                         BP2106
                        AGTATTGCACGCAGTGCCAGTGGCTGCTGCGCGCGGCCTGGATGGCGCAGG
5   B24   BP2107-116                                        BP2107
                        ACTGGGACGTCCACCTCGCCAAGCTGGTCGACTTCTGGTCGTCGATACTGCG
5   D02   BP2108-601                                        BP2108
                        ATCATTCCCTTTTTCGCCATGCGCGCCATCGCCGGCCTGCAGATCCCCATGC
5   D04   BP2109-61                                         BP2109
                        GTCTTCTTCGAAGTCCTCATCCTCGAAAGCGTGCGGCGGCAAGTGCCGCGC
5   D06   BP2110-301                                        BP2110
                        GACGTGCGCGTGATCTGCGCCTATTGCCCCAACGGCCAGTCGGTCGACAGC
5   D08   BP2111-1321                                       BP2111
                        GCCATCCTGGTCGTCAAGAGCTCGGTGCACTTTCGCGCCGACTTCGAACCC
5   D10   BP2114-391                                        BP2114
                        CCAGGCCTGCGCAACAGCCAGGCTTCGACCTGGCTCGAACGAGTGGCCGAA
5   D12   BP2115-651                                        BP2115
                        GGACTTCCTGTACCTGAAGGAGAACTTCGACTGGGGCGTCATCACCTACACC
5   D14   BP2116-261                                        BP2116
                        CTACACCGTGCTGGGCGGCGACCTGTCGATGCTGGTCAACCCTTCGCTGAT
5   D16   BP2119-146                                        BP2119
                        GCATGAGCCCGTCGGTGTTCAATTTTGCCTTGCTGGTGCTGGGCCTGCTCCT
5   D18   BP2120-221                                        BP2120
                        GCCGCCCGGAGTTCGACTGGCCCACGCTGATCGCCAACAAGAACCGCGAAA
5   D20   BP2124-136                                        BP2124
                        GAACGCATGGCGCAATTGGGGCCGCGCGTCATCCGCGACTACATGCCGCAG
5   D22   BP2125-796                                        BP2125
                        CCGGTGCATGTGGTGTATCCGGAAGGGCGCAAGGGCGCCGCCAAGGTGCG
5   D24   BP2125A-141                                       BP2125A
                        CCCGGACTGCGACGCCCAGCCGGTGCAGAACCTGGTGGGGCAGAAATATTC
5   F02   BP2126-341                                        BP2126
                        CCAATCCCGCCCCCACCGACCGCGACATCGACGACGCCATGAACGGCAATA
5   F04   BP2127-1006                                       BP2127
                        GTCATCGAGGCCGAATACACGTATCCGTATCTTGCGCATGCGGCCATGGAGC
5   F06   BP2128-536                                        BP2128
                        CCGGCCAGCTGTCGCGCTACCTGTGCGAAATGGCGATCGCGCTGGACTTCG
5   F08   BP2129-111                                        BP2129
                        GCCGGGCCTGAACTTCTACCGTTCGTCCAGCCCGACCGAACTGAACGTCAG
5   F10   BP2130-181                                        BP2130
                        CACGGTATCGCTTTCAATACGGTGCAGAACACGCGCCTGCAGTCCATGGACG
5   F12   BP2131-56                                         BP2131
                        TGCGCCTGCGGGTGTTCGAGATCCGTTATCTCGACATGGTCAGGCGCTGCA
5   F14   BP2132-171                                        BP2132
                        GGCCTCCGACAGCAACAGCCAATGCCCGTACGAAGGCAAGAAAGGCTTTTCG
5   F16   BP2133-1156                                       BP2133
                        ATGAGCGATGTGGACCCCAGCGAAGCGGGCCTGGCATCCGGCGTGGTCAAC
5   F18   BP2134-41                                         BP2134
                        TCGACGTGGAAGGCGAACTGACAGGCGCCATGTCCTGCAATTGCTCGATATG
5   F20   BP2138-276                                        BP2138
                        GGCATTGCAGGAATACGTCACGCGCCTGGTGGTGCAGAAACTGGGCACGCA
5   F22   BP2139-86                                         BP2139
                        ACGGCCACCATGGGTACTACGGCGGCTACGGCCACTCGCACGGCAGTTCAT
5   F24   BP2140-796                                        BP2140
                        GCCGGGGCGATGATCTTCGTGGTCTCGCACGAAGTGATTCCCGAGACGCAT
5   H02   BP2141-76                                         BP2141
                        CTGCCCCTGATCCTGCCTCTGCTGCTTGCCGCCTGCTCCGATGCCGTGCAAA
5   H04   BP2142-116                                        BP2142
                        TGTACAAGGTCAGCCGCACCAAGATCCGGGCGGCCTTGCTGATGCTGTCCA
5   H06   BP2143-486                                        BP2143
                        CGGCACGCACTTCCATGAAAAACTGTGGCAGCTCGTGCACAGCCTGCCGCA
5   H08   BP2144-176                                        BP2144
                        AGACCTTCGAGCTGCATTTCAATCACGCCGCGCTGACGGCCGAAACCGCGC
5   H10   BP2145-96                                         BP2145
                        ACACAATATCCGCGCGCTGGCCGCGCCGTTCGCCATGTCGTTCACGGCCGC
5   H12   BP2146-551                                        BP2146
                        ATGTCGATTCGACCTTCGCATCGTGGACCGACACCTGGCTGGACCCGGCCT
5   H14   BP2147-121                                        BP2147
                        TTTGCCGCCACCGTGGCGCGCCTGCAGGATGCCTTGCGCGCCAAGGGAATG
5   H16   BP2148-66                                         BP2148
                        ATCCAGGGTGAGCGACCTCAAGGGCGCCTCGCGCGACATGTACGACTCGAT
5   H18   BP2149-546                                        BP2149
                        CAAGTACACCGATCGCGAGACGGCGATCTGGTGCGCCAAGCTGTTCCAGCT
5   H20   BP2150-41                                         BP2150
                        ACGACAAGCTGGACACCTACCGGCAGATGGCCACCAAGGCCGGCGCGATCT
5   H22   BP2151-176                                        BP2151
                        CCTATGGCGGCTGGCGGGTACGCTATTTCGCGCCGGAAGCGGAAGTGCCAT
5   H24   BP2152-601                                        BP2152
                        CTGGACGGCGGACGCATTCCCTGGCGCAGCGTATTCGAGAACGGCAATGCC
5   J02   BP2153-1086                                       BP2153
                        GCGCAAGCTGACCGACAGCCTGCGCAGCGGCGTGACCGAGCATATCTCGCG
5   J04   BP2156-256                                        BP2156
                        TGCACGCCGGTGTACTGGTACGGCATGTCGGCCCAGGCCAAGGCCTTCTTC
5   J06   BP2157-1151                                       BP2157
                        AGGGTTTCTATGTCCAGCCGACCATGCTGCTGGGCAAGAACAGCATGCGCAT
5   J08   BP2158-581                                        BP2158
                        TCATCGAGCAGGCCGGCGAGCGCTGCCTGTACCTGGTCTTCCACAAGCAGG
5   J10   BP2161-161                                        BP2161
                        CGGCGCAGTTCCTGCTGTCGCACCTGTCGCTGCTGTTCGTGCCGGTCGGCG
5   J12   BP2162-671                                        BP2162
                        TGTCGCCCGCCGCCTTCCGGCGCGTGCTGGCCCAATTCGATCGACAAGGAA
5   J14   BP2163-171                                        BP2163
                        CGGCCATTCGCTCGGCTTTCTGAAAATCCTGCAGTCTCCTGCGCCGGGCTGC
5   J16   BP2164-236                                        BP2164
                        TGGTATGCGGCAACCTGGACCTGCACGAACAGGTCGAAGCCAAGCTGGCGC
5   J18   BP2165-331                                        BP2165
                        TACACCGATTCGGGTTCGGTGGCGGTGGAGGTGGCCATGAAAATGGCCGTG
5   J20   BP2167-346                                        BP2167
                        AGCGTGCATGCCACCTGGACGGGCCGTGGCGAGGTGTATTTCGATTCGGTC
5   J22   BP2168-66                                         BP2168
                        GTGGTGGGCCGTGTTCAGCGGCCAGTACGACGACACCGAGGACCAGGGCG
5   J24   BP2170-71                                         BP2170
                        CCAGCATCCTGGTGGTGTCCGTCGCCGGGCTGGTGCAGATCATCCCGCTGT
5   L02   BP2171-41                                         BP2171
                        TGGGAACGTTTCTTGGCATCGTATGGTGGGCCTGGTCGAGCCACCGCCAGA
5   L04   BP2172-506                                        BP2172
                        TGTACGGCGGTACGCCGGAGATCATCGCCGAAACCATTGCCAAGGGGCGCC
5   L06   BP2173-371                                        BP2173
                        TCGCCGGTCGGCTGTTCTGCGGCTATGCCTGCCCGCAGACGGTCTATACCG
5   L08   BP2174-21                                         BP2174
                        CATCATCGGCTGCGTCATCACCATCTACCTGGCGATGACGCGCTACGGCGAC
5   L10   BP2175-126                                        BP2175
                        CCGGACCGGGTTCTATACCGTGTCCTTCTTCGTGCTGTGGCTGGTGACGGC
5   L12   BP2176-491                                        BP2176
                        AGCGCTCCATCATCCAGAACTTCAATCTGGGCACGCTCTTGGTTACCATGGC
5   L14   BP2177-41                                         BP2177
                        TCTTCGACGTGACGCAGGCGGCGTTTCGCGGCCATCCGCACAGCGAGCAGA
5   L16   BP2178-251                                        BP2178
                        CGCAGGAACTCACCACCGACGCGTTCGAGACGGTCTGGAACACGGTCAGCT
5   L18   BP2179-461                                        BP2179
                        GCTTCATCATCGGCATCTGGGCCGATGGCTTCGAGAAACTGCAGATCATCCC
5   L20   BP2180-396                                        BP2180
                        GCACGAAATCTGGCTGCAGGCGATGACCAACCTGCAGGACGTGCTCAAGCC
5   L22   BP2183-86                                         BP2183
                        CATTCCCCGATACCTTCGAGGACTGGGAGAAGCGTGCCGAGGAAAGGAGGG
5   L24   BP2184-1141                                       BP2184
                        TATGAGAAGGAAGGCTATAAGTCGGACGCCTATCTCAAGGCCCAGGACATCA
5   N02   BP2185-156                                        BP2185
                        CAAGCAGTTCTATCACTGTTTCGGTTGCGGCGCCCACGGCAGTGCCATCACC
5   N04   BP2186-46                                         BP2186
                        CTGCGTCGCTTCAAGCGCACCATCGAGAAAACCGGCTTGCTCACCGAACTGC
5   N06   BP2187-316                                        BP2187
                        ACCGGCCATACCTTCAACAAAGTGCATACCCATCTGAGCGAGCAGTTCCCCG
5   N08   BP2188-1121                                       BP2188
                        CGGTGCTCGAAGAACTGCCGGGCTGGACCGAGTCCACCGTCGGCATCACCG
5   N10   BP2189-116                                        BP2189
                        TGGTCGCGCCGCCGCTGGTCGAATACATCGATTCGCTGCTGTCGAGTACCG
5   N12   BP2190-746                                        BP2190
                        CCGAGTTCTACACCTATTACAAGAGCCTGGAAGCCTATCGCGCCGCGTTCGG
5   N14   BP2191-966                                        BP2191
                        TAATGCCTCGCGCTTCTCGTCCATCCTCAACGAGTACGAGAAGGCGCCCCAG
5   N16   BP2192-986                                        BP2192
                        CGCGAGTATTCGTAAGCGCTACCGAGCGCGCCGGTCTGGATGCGTTGCGCG
5   N18   BP2193-51                                         BP2193
                        CAAGGAACACGTGCCCGTGTCCATCTACCTGGTAAACGGCATCAAGCTTCAG
5   N20   BP2194-281                                        BP2194
                        TCATGGCGCTGTTCAGGCACGGCCGGCCGGTGCGTTTCCCGGATATCAGCT
5   N22   BP2195-1201                                       BP2195
                        CCCCTGATCGTGATCCATGGCAACGCGCTGGACGCGGTGCCCGATTCGTAC
5   N24   BP2196-811                                        BP2196
                        ATCTGGGCCAAGGATTTCTCCAGCGCCAGCGGCATGGTCATCGACGACCGC
5   P02   BP2197-116                                        BP2197
                        GGTCGGGCTGGAAGGCCTACCAGAACTACCGCGCCAACCAGGCCATGGGCT
5   P04   BP2198-621                                        BP2198
                        CCGCATGTACAGCAACCCCTTGCGGGTGCTGGACACCAAGAACCCTGCCAT
5   P06   BP2199-1176                                       BP2199
                        GCCGGTTTTCATCGACGGCGAGCGCACGGTCACGCTCAAGGGCGACCATAT
5   P08   BP2200-381                                        BP2200
                        CGGCTCCTGGGGATGGCTGCTCGCCATCCTCGTGGTGGTCGCCGCCGCAG
5   P10   BP2201-286                                        BP2201
                        ACCGTTTTCATCCCCGAAGACGACCGCGGCACCCTGTGCATTTCCAGCCAGG
5   P12   BP2202-116                                        BP2202
                        TGCAGCAACTGTCGCGCACCGACGCCGAGCGTTTCTACGCCGTGCACAAAG
5   P14   BP2203-346                                        BP2203
                        CAGAAGGTTTCGCGCCATGACCTCGGCCGCGAGAAGTTCGTGGAAAAGGTC
5   P16   BP2204-116                                        BP2204
                        ACGAGGGCGCCAAGGACTACCGCTTCCTGCCGGTGCCGCTCATCCATTACG
5   P18   BP2206-221                                        BP2206
                        AGACCAGCGAGCTGCGCATGAGCTTCCAGATCTGGAGCATGGCGTCGCGCC
5   P20   BP2210-411                                        BP2210
                        GCTGATCGCCTATCGGGACCATGCCTTGCTGGAGAAGGCCCGTCGGCTGGT
5   P22   BP2211-46                                         BP2211
                        TACCTGACGCAATGCCGCGACCGCACCGTACCCGTGACGATTCCCGAAATCG
5   P24   BP2212-916                                        BP2212
                        GGCGTGCATGCGATGAAGGAACATATCAACGCGCTGGCCGCCAAGCGGCCG
5   B01
5   B03   BP2213-116                                         BP2213
                        GCGAAGTCGACGAGCGCCGCGAACTGAGCGACGCGGAAATCACCGCCGTCA
5   B05   BP2215-331                                         BP2215
                        GCCATGCTTGGCCACATCCTGGAACGCCAGGAGTGCAGGCATGTTCGACAT
5   B07   BP2216-66                                          BP2216
                        CCGCATTACGCGTTCCATCGCGCTGCATTCCCGGCAATTGGCGGCCGTCAG
5   B09   BP2217-511                                         BP2217
                        GGCATCGCGCACCAGATGCGCTACGCCTACCAACTGGTACGCCGCAATGGC
5   B11   BP2218-651                                         BP2218
                        GCTGACCGCCGTGCCCGGATACTTCCGCCGCATCCGCGAGATCTGCGACCG
5   B13   BP2219-721                                         BP2219
                        AAGTATCCGTATTACGCGCTCGCCACCATCCCCGGCGGCCTGTATCCCAATA
5   B15   BP2220-556                                         BP2220
                        CACATGTGGCTGACCACCGAAGGGGTTTACGGCGTGGCGCTCGGCGTGTCG
5   B17   BP2222-136                                         BP2222
                        ATCCAGGATACGGGTGACGAGTACCCCGTACCGTATTTTGCCGACGGCGGT
5   B19   BP2224-61                                          BP2224
                        GCCGCAAACTGTGCTTATCCCGCGAACGCCCAATCGGTTTCTGGTTCCGGTC
5   B21   BP2225-406                                         BP2225
                        ATGATGCAGGCGATACGCGAGGCGCGCGTCTCGATCGCCATGCAAAGCTAT
5   B23   BP2226-211                                         BP2226
                        GTCCAGGGCGAACTGGTGCTGTGCGAACTGAAGCCGCACGTGCGAGAAGTA
5   D01   BP2227-146                                         BP2227
                        TGAACAACATCGTGTCCCATGCGTTCACGCCCGGCCACCCGGCCGCGATAC
5   D03   BP2228-926                                         BP2228
                        GCGTGCTGACACGGACGGTGGGCAGGATTTCGATGGACCTGATGGCTGTCG
5   D05   BP2229-316                                         BP2229
                        GGGTTGCTGGAGGAGTCCCATGGTGTCACCGGAGTAGCGGTTGTGCTGAAA
5   D07   BP2230-591                                         BP2230
                        CGCCTATTTCGTGTACTTCCCCGCGTGGAAGTGGGTTCTCGCCATCTCCGAT
5   D09   BP2231-1041                                        BP2231
                        CAATGGGGAAAAGCCGCGCAGCATCAGCCAGGTCTGGAATGCCCCCGCCAA
5   D11   BP2232-501                                         BP2232
                        GCTGCATCGCCTGCCTGCAAGGCCGTTTCGCGATCTCGGCGATTATTTCCGC
5   D13   BP2233-81                                          BP2233
                        TAGAACGCGATACACCCAAGGATTCGAGACAACGGCCCACCGCATGAACTTC
5   D15   BP2234-76                                          BP2234
                        GAGCGATCGGACCAGCAGTTGCTGAGCAGCCTGGTAGCCGAACATGCCGGC
5   D17   BP2235-226                                         BP2235
                        AATGCGCGCACACCCACGGAGTTCATCGAGCGTCTCAGCGGCATCTATGGG
5   D19   BP2236-236                                         BP2236
                        CCCCTGCGACCGATGCGTACTGCGGCATAGACCAGGGCGAAACCGCGTTGT
5   D21   BP2237-516                                         BP2237
                        GCTGGACGGGTTGCGAACGGGCGTAGGCCGCATTCTGCAGGTCATGGTCTG
5   D23   BP2238-621                                         BP2238
                        CCTGATCAGCCGCTTCGCGCCTCAACTGCAGGTGTTCTTCCTGGCTCTGCCG
5   F01   BP2239-156                                         BP2239
                        CGTGAAGCTGATAGCCGTGTTCGCCACGCTGATGCTGGCGGCCCGGTGGAT
5   F03   BP2240-446                                         BP2240
                        TGACGCCCGCATTTCTGGTTTCGGAGCTGACCGCCGCATTCCAGCTTGGCTT
5   F05   BP2241-756                                         BP2241
                        GTCTTTTCGTGTAACTCAAGGTTGGACTCCCATCATGACGGAACCCGCGACA
5   F07   BP2243-66                                          BP2243
                        CACGCCGTATGCGCGTCAGCCGGATCGGGATGCGCAGCGTGCCTTCGAGCG
5   F09   BP2244-166                                         BP2244
                        CTATATGCCGAGCTGTGCCGGCGCATCGTCAAGACACGCGACATCGACGAG
5   F11   BP2245-1211                                        BP2245
                        CGACCGATGAGGCGATACAGAAGATCGGACAGATCAATGCGTTTCTCAGACA
5   F13   BP2246-181                                         BP2246
                        CGCGAGCGCAGGCGAGGCTATGAGGAGGGGCGCCGCGAAGCGCTTACGGA
5   F15   BP2247-196                                         BP2247
                        CTGAACCAGCCGGTCCTGAGCCTCGATCCGCCGCAGTTGAAGGTCGCGCTA
5   F17   BP2248-661                                         BP2248
                        GCGGACGGATCGGTCCTGAGATTTTCGCTGTTGCTGCTGTTGTTGCCGGTG
5   F19   BP2249-286                                         BP2249
                        ACCGTGGTGGGTATGCTCGATCTGCAGGCCAGGTTGCTACAGGCATCCGTG
5   F21   BP2250-66                                          BP2250
                        GATACATCCATCGGAACCGATACAGCCGATGGAGCATGTGCTCGAGGAGGC
5   F23   BP2251-206                                         BP2251
                        TGGCGCTATGCCTGCAGAAGACCGACCGTCCCGACGAGGCGCGCAATATCT
5   H01   BP2252-996                                         BP2252
                        TCGCAAACAGGCCGATCTCCTGGTCGCCGACAAGGCGGATCTGGCGGCGAG
5   H03   BP2253-816                                         BP2253
                        GGCCTCGCGGCGGGCCGACGAAGCCATGCAGCAGATGCTCGACATCATCCG
5   H05   BP2254-301                                        BP2254
                        GCGGCTTTGCAGTTGGACTCCCCCAGGCCCCTGTTGCATGGCGCCGAGTGC
5   H07   BP2255-86                                         BP2255
                        AGATCTACGCCCACGTTGGCGTCGACCCCGCTCGCCTGCGCAATCTGGCGG
5   H09   BP2256-431                                        BP2256
                        ATAAGGAACTCGAAAGTGCCTACACCACCGTAAAGGGGATGCTGGATACGGC
5   H11   BP2257-831                                        BP2257
                        CTCGCAGGAGTGTGCGGACGCCCAGGGCCTGATGCGCGATCTTGTGGGAAT
5   H13   BP2258-231                                        BP2258
                        CGCATCCATCCAGACGTCACTCTGGTCGGAGGGCAGCGAGGACTGGATCGT
5   H15   BP2259-281                                        BP2259
                        TGTCCCGGGCCATGGAACTGCATGCCGGCAACACCGCGCCAGCCTTAAGCC
5   H17   BP2260-41                                         BP2260
                        GCGAACTTCTGCAATTGCTTGCGCACCACTACCAGTTGCAGCGCCAATGGAG
5   H19   BP2261-1691                                       BP2261
                        TGGTCGAATGGGGCCAGAAGGAAAAGGATACCGTCCTGCTTACGGAGTATG
5   H21   BP2262-631                                        BP2262
                        GACGAGACGGAATTCGCTCGGGTCGCCAGGGCGTTGGCGCAACTTGCGCCA
5   H23   BP2263-91                                         BP2263
                        CTTGGCGAACTGGAGACACGTTTGCGCGTCCGCCTGCACGATGGCGTGGGG
5   J01   BP2264-156                                        BP2264
                        GCTGATCGTGCAACAGGAAATGCAATCGTGGGTCGTGATGATCGATCTACAG
5   J03   BP2265-121                                        BP2265
                        TTGATTTTCGAACCGTGCGCACCGGTCTTCATCGCACCGGTGCACGCCCGG
5   J05   BP2267-41                                         BP2267
                        TGCAGCAAGAACTGCATCGGCTTAAGACCGTTGAGCGTCCTGCGGTGATCAG
5   J07   BP2268-376                                        BP2268
                        GCCGAACATGCATTCCAGCGCGACATGGAAGCCTTTCTGGCCAGGGTACAG
5   J09   BP2269-156                                        BP2269
                        GCTGATGGGTTTCGACCCCAATGTGGCGATCCTCATGTCCGGCATCGGCAC
5   J11   BP2271-526                                        BP2271
                        GTGGAAACGATCCTGCAAGGCGAAGGCTGGAATGACGGCTGGGGCACCCTG
5   J13   BP2274-896                                        BP2274
                        ATCTGCCGGCCAATCTGTCCGAGCGCATGATCAAGAACGACTTCGTGTGGGC
5   J15   BP2275-176                                        BP2275
                        GCAAGTGGGATCACATCCGTGCGCTGTGCAATGACGCGGCGATCGCGCGGC
5   J17   BP2276-936                                        BP2276
                        GGCGGTGTGGGCGTCGTTCGTCAAGATGTGGCCGTACAACCTGTCGCTGTC
5   J19   BP2277-206                                        BP2277
                        GCCGCGATATCTCGAACGAGCCGCCGCAGGCGCGCGACTACGGCATCCTGT
5   J21   BP2278-366                                        BP2278
                        CATCGGCAACTCGCAGAGCATGCTGCAGGCCCTGCACGACTACCGGATCGA
5   J23   BP2279-231                                        BP2279
                        GTACTTCGTGCTGCCCTTCCTGCGCGGCTTGTTCGGCAATGCCGTGCTGGA
5   L01   BP2280-491                                        BP2280
                        CCAACATCGGCCAGCCTGCCTTTACCGTGATCGATGCCCGCGCGGCCAATC
5   L03   BP2282-471                                        BP2282
                        CACCCTCACCCTGATCCAGGGCGTGGTCAACACCTTCGTCGTGTTCCTGGCG
5   L05   BP2283-136                                        BP2283
                        TTCATCGACATCTACTTCCGCACCGGCCTGTATCCGCATCCGCTGCCGCATG
5   L07   BP2284-516                                        BP2284
                        GACAGGGTCTTTCTTCGTTTTTTGCTCCGCGCTCAGCTATTCTGTGTACCTGA
5   L09   BP2285-296                                        BP2285
                        TTGCCAGCTTTCCCGCCTTCATCACCTTGTTCGAGGGCCTGGTGTTCCGCGA
5   L11   BP2286-316                                        BP2286
                        CGGCGCGTCATCAAGATCGAACTGACGCCCGAGGGCCAGACCAAGGCGCGC
5   L13   BP2289-86                                         BP2289
                        ATGCCGTCTGGTGGGCGCTGTTCGGCTCGCACTTCGAGAGCACCGACGACG
5   L15   BP2290-1071                                       BP2290
                        GTGCTTCATGCGCGCGGGCTTCAATACGCAGACCGACGTGCGCACACTGAT
5   L17   BP2291-261                                        BP2291
                        GCTGTGGGGGTCGCTGTTTCGCTTTCGCCGCGATTTCGACCAGTACATCAAC
5   L19   BP2292-186                                        BP2292
                        GCTGCACGCCTACGACCAGTTGCTGGCCGAGGGGTACCTCGTGTCGGCCTT
5   L21   BP2293-401                                        BP2293
                        AATTCCTCGACAAGGTCGAAAAGGTCGACGACCACACGGTCGTGGTGCGCC
5   L23   BP2294-206                                        BP2294
                        TGACGCAGCTGGGCATCTACCTGAAAGGCGTGCTGCAGTTCGACCTGGGGT
5   N01   BP2295-301                                        BP2295
                        GGCTATTGCGGCGGGCGCATCGACGATGCCCTGATGCGCTTTACCGAGTTC
5   N03   BP2296-841                                        BP2296
                        CTGGCGGTCGACAAGCTGTGCAAGACCTATGTCACCGGCCATGGCTGGTTC
5   N05   BP2298-476                                        BP2298
                        GTCCGTTTCCGGCCGACATCTACCATGTGCCGTATCCGAACGCGCTGCACG
5   N07   BP2299-171                                        BP2299
                        GGTCACCAGCCAGCTCACCCGCGGCGTTTCCTATACCCGCCCGGAGGGCGT
5   N09   BP2300-551                                        BP2300
                        AACGCTGCGAGCGCGTCGTGGTGCTGGACGTCGACGCGCATCATGGCGATG
5   N11   BP2301-426                                        BP2301
                        GTCCGGCGTGTTCTGCAATATCTTCCCGCTCGAAACGGCGCTGGCGGCCAC
5   N13   BP2302-86                                         BP2302
                        CCTTCGACGCGGCCTGCAAGTACATGCTGCAGTTCTATCCGGCGCCGTTCCT
5   N15   BP2303-1121                                       BP2303
                        TGCGCGCCGACAGCGGCGGCTACTACATAGAACCCACCATCTTCGAATGCG
5   N17   BP2304-601                                        BP2304
                        GAGACGCGCGACCTGTTGCGCCGCGATACCCTGTCGCAATTGCTGCCGGGC
5   N19   BP2305-136                                        BP2305
                        GCGCGCCAGTTCCAGGAACTGCCCTACTACCATACGTTCACGCACAAGTCGC
5   N21   BP2306-1136                                       BP2306
                        GCGAGCGCTGTTGGGAATACCTGACGGGTGTGCGGGCGATCCTGCCGTTTC
5   N23   BP2307-201                                        BP2307
                        GGTGCTCGCCGAGGCGTTTTCCCGTATTGGCACGCCGGTTTTCATGGCTGA
5   P01   BP2308-46                                         BP2308
                        CGCCAGGACGCCAAGCGGGGCAAGCTCTGGACCAAGATCATTCGTGAAATC
5   P03   BP2309-291                                        BP2309
                        GAAGATCTTCGGTCCGACCAAGGCGGCCGCGCAGCTGGAAAGCTCGAAGGA
5   P05   BP2310-481                                        BP2310
                        GCCGATTACTACCCGCGCTACAAGCAGTGGTGCGACGAATACTTCTTCCTCA
5   P07   BP2311-76                                         BP2311
                        ACCGCCAGGCAGTTCCTCGGGCTGGACCAGGTACAACTGATACCGGCCGCC
5   P09   BP2312-276                                        BP2312
                        CGCCATCCGCCAGTACTACAACCTCGAAGAGATCTGGGGCGGCAAGCCGGT
5   P11   BP2313-91                                         BP2313
                        TGCGCGCTCGAACTGCGCGAAATCAAGCCCGAACCGCGCACCAGCGGCAAG
5   P13   BP2314-421                                        BP2314
                        GTGCGCATGCGCGCGCTCGAACAAGCCGAACTGCAACGCTACTGCGACAGC
5   P15   BP2315-1491                                       BP2315
                        GCCCAAGGGCGCTTTCAAGACACTGGTCGCGACGCAGGGCATTTCCGGTAC
5   P17   BP2317-386                                        BP2317
                        TGCCGCACGATCCCCACATCGGCATTTCGCAAAAGATCGATTCCGAGTCCGA
5   P19   BP2318-511                                        BP2318
                        GCCGCCAGTGCCACGCAGGACAAGGCATCGTTCGGCCCCAGGGTCGGGGC
5   P21   BP2319-131                                        BP2319
                        TCCAGTACTGCTACGGCAGCAAGGACGCCATGATCGAGGCGCTGTTCGAGC
5   P23   BP2320-66                                         BP2320
                        CGATACGACTGTACTGTATGCGGCATTGCCCCGCCTGACCCACGACCTGCAT
6   A01
6   A03   BP2321-1141                                        BP2321
                        AAGGTCGAATTCCGTGCGGTCAGCCATCGCTTCCCGGACGCCGATCGCGAT
6   A05   BP2322-766                                         BP2322
                        GCCCTGGTTGTGTGCAATGATTCAGGCGTGTCCCATGTGGCGGCGGCGGTC
6   A07   BP2323-281                                         BP2323
                        ACTGGTTCCTGCCGTATGACAAGGAAACCGCGGTAGTGCGCGTGGACACCG
6   A09   BP2324-106                                         BP2324
                        AGATGCGTGCAGCTCGACGACGACATGCGCTGCCGGATTTTCGGCCATCCC
6   A11   BP2325-846                                         BP2325
                        GGCCATGTCGCATGGCTTGCCCGTGGTGGTGAGCAGCGCCGATTATTGCGG
6   A13   BP2326-296                                         BP2326
                        TCGATGGCGGCAACGTGTGGGATCTCGAAAAAGGCATCCCGTTCTCGGCGC
6   A15   BP2327-286                                         BP2327
                        TACCAAGCCTATGGCCAGCGCTTCAACTTCGGTTTTGCCTACAGCATCCTGA
6   A17   BP2328-401                                         BP2328
                        ATCACAGCATCGCGGTCAGCGCCTATGTGCACGGCCTGCTGGCCGATTCGC
6   A19   BP2329-316                                         BP2329
                        GAAATCGCCCGGCTGTCGGATTTCTGCGGCCGCTTCATCCGTCACAGCGGC
6   A21   BP2330-171                                         BP2330
                        GGTGCCCGAGAAATCGGTGCTGATCACCTTCGACGACGGATACCTGAACAAC
6   A23   BP2331-416                                         BP2331
                        ACGTGCGCCAGCACCTCATCGAACGCGGCGTACCCGCCGGCCATATCGCCA
6   C01   BP2332-966                                         BP2332
                        GCGCGACCAGTACTACGAACGCCTGCGCTGGGAGTGCAAGACCATCATCCA
6   C03   BP2333-321                                         BP2333
                        CAACTCGTTCTTCAAATATGGCTGGAAACGCTTCTACCTGAAGTGGTACGACG
6   C05   BP2334-1616                                        BP2334
                        ACAAGTCCGAATTCCTGTCGTTCCTGAAGCTGTGGCGCTGGTATGGCGAGCA
6   C07   BP2335-101                                         BP2335
                        CCCCCGCGCAATTCGTCCGATGGTTCCGCGAAGTGGCGCCCTACGTGCATG
6   C09   BP2336-66                                          BP2336
                        CCCGGGCGAACTGGGCACCCGCATCTGGCAACAGATCTCCAAGGAGGCCTG
6   C11   BP2337-426                                         BP2337
                        GCGCGCCTTCACGCTGTGCGAGGCCTACCACTGTTCGATGCACGCCGGCAC
6   C13   BP2338-366                                         BP2338
                        GAACGACCAGCGTCACATTCCCCTGATCGAACTGCGCCACATGGCCGTGAAC
6   C15   BP2339-231                                         BP2339
                        TGTCCAGAGCATGCCGATCTACGTGGACGGCGCCGACGAGATCGATCCCAA
6   C17   BP2340-636                                         BP2340
                        CCAGGCCTACCTGCTGACCGGCCATAAATGGTTCCTGTCGGTGCCGCACGC
6   C19   BP2341-756                                         BP2341
                        CGAGGGCGGCGGCCCGGTGTGGCTGCCCATCGACGCCAAGTTTCCCAAGG
6   C21   BP2342-176                                         BP2342
                        GCTGGTACAAGCAATTCCAGCGGGAAAGCGCCTACCGCGTCTACCTGAACG
6   C23   BP2343-586                                         BP2343
                        GACGAGCACCTGCCGTACCGCTACGTCGATCCGGCCTATGCGGCGTTCTGC
6   E01   BP2344-81                                          BP2344
                        GGCGCATGACTTTGTCGATTATCGCGACCATCCCGTGCCGGCGGCCACGCT
6   E03   BP2345-66                                          BP2345
                        GCCCATCATCAGCCTGATGGTTTTCTCGTTCAACGATTCGCCGGTGGTGACA
6   E05   BP2346-226                                         BP2346
                        AGCCTGTATGTCGCCACTTACCTCAATTCGGTCAAGATGGCGGCGATCACCA
6   E07   BP2347-931                                         BP2347
                        CACAACTGGGCGCATGGCATGGTCACCCACATGGCCTGGATGGGCAGCTAC
6   E09   BP2348-871                                         BP2348
                        GCCTTCATCAACTATATCGAGACGCCGCAGGTGCACGCGGCCATCACCAACA
6   E11   BP2349-506                                         BP2349
                        ATGCCGACCTGAACGCCTTCAATATCCTGCTGGACCCGGGCGGGCTGGCAT
6   E13   BP2350-281                                         BP2350
                        TCTCGATCGGGGAGATCGAGCGCGACCAGTGGGTGGCGTGCATGGGCCGC
6   E15   BP2351-301                                         BP2351
                        TCGGTTTCCAGTACCTTGCAGTTCCCGTCCATGGCCAGCGCCAACGGCAATG
6   E17   BP2352-76                                          BP2352
                        ACCACCCTGAAAATGGCCTATGCCCTGTCGACCTCGTCGCATTACGGCGCGG
6   E19   BP2353-41                                          BP2353
                        TGGTTTCGGCAATTGCCCAGATCCTGCTGATTGCCGCCGCCTGCGCCGCGT
6   E21   BP2354-746                                         BP2354
                        TAGGCTGGCTGGTCTACCGCCGCCTGTCGTTCGGCCTCATTTCGACCACCCT
6   E23   BP2358-46                                          BP2358
                        AGCGCTCCTATCGAATTCCCAGTCTACAAGGGTACGGTCGGCCCGGACGTG
6   G01   BP2359-96                                          BP2359
                        TGCCTGCGAAGACCAGCTTACCGACGAAGACGTAACGGCGCTGACGCAGCT
6   G03   BP2360-606                                         BP2360
                        CCTGTTCCGCTGCCACACCATCATGAACTGTGTCGACGTCTGTCCCAAGGGT
6   G05   BP2361-166                                         BP2361
                        GGCGGCGTGAGCGCGTCGCTGGGCAACATGAGCGAAGACAACTGGTACTGG
6   G07   BP2362-141                                         BP2362
                        GCCGGCTTTCACGTATGAAAACTGGAAGGCCCTGTTCACCTTCCACGTGTTC
6   G09   BP2363-56                                          BP2363
                        AAATCCTTAGTTACCGATTGCCGCTGGCTGGAAAACTGTCCATCCTGCACCG
6   G11   BP2364-586                                         BP2364
                        GCGCCCCTGTATGGATTGTTCGAGTCCGAATTCGGGGTCAGTATGGTCCGAG
6   G13   BP2365-46                                          BP2365
                        CAAATCGGTTACGCCCTGCTGTTTCGCATCGCCTCTGGCGAAATGCTGGGTA
6   G15   BP2368-76                                          BP2368
                        AAACCCAAGAAATCGGTTGCGCTGTCGGGCGTGGTCGCCGGCAACACCGCG
6   G17   BP2369-76                                          BP2369
                        CATGCCCATAGAGACACGCCTGTCATGAACACGAAATACCGCAAGAATCTGC
6   G19   BP2370-656                                         BP2370
                        TCCCGACGATCTTCGTCGACGCGCAGGCCGTCGGCTATACCGGCAGCGAAT
6   G21   BP2371-761                                         BP2371
                        CGCCGACCTGGGGTTTCTACGACGTGCTCTTCAAGGGCCAGCCGTTCAGGT
6   G23   BP2372-56                                          BP2372
                        TGTTCTACCTGCCGCGCATCTACGTCAACCTGGCGCAACAATCCGATCCGGC
6   I01   BP2373-1161                                        BP2373
                        CTATGGCGAGCGCATGGAAACCGAGGACGACTCCGAAATGTGGCGCGACTG
6   I03   BP2374-41                                          BP2374
                        CCGACGAACTCGAACGCCAACTGATGCTGCAAGCCATGGAAGACCAGTTCCG
6   I05   BP2376-41                                          BP2376
                        CCACGCATTGGCGCACGCTGTGGATTTCCGACATTCACCTGGGAACGGCCG
6   I07   BP2377-1561                                        BP2377
                        CGCCTGGCTCCCTACGAATACCCCAAGGAAATCGAATACGTCGATGCCTTGC
6   I09   BP2378-211                                         BP2378
                        CCGATGACCGTGGGGCCCAACGTCACCATCGGCCACCAGGCCATGCTGCAC
6   I11   BP2379-771                                         BP2379
                        CGAATCGATTCTTGCCGAACAGGGCCGGGTCGAAGTGTCGTGCGACTTCTG
6   I13   BP2380-631                                         BP2380
                        CCGATACGGCTCGAACTGGAAATGGACATGCAATCCGATCCGGCGCTCTGG
6   I15   BP2381-256                                         BP2381
                        GTCACCCTGGGTCCGGGGCAGACCTTCCACGAGGGACCGGACGATGTGCAC
6   I17   BP2382-356                                         BP2382
                        AACTCTCCGATCTCACGTTCCTGGTGATGTCGATCAATGCCTGGAACCGCGT
6   I19   BP2383-366                                         BP2383
                        GGTGCCTTACACCATTCTGCGCGCGACCCAGTTCTTCGAGTTCATCGAGAGC
6   I21   BP2384-571                                         BP2384
                        GTGCGCTATGTACTGGAAGGCAGCTGGCGCAAGGAGCGGAACCGTGTGCGG
6   I23   BP2385-56                                          BP2385
                        TCTGGCTGGGCAAGGGCGGCTGGTTCAAGGTATGGGATCTGCAGCGGCAGG
6   K01   BP2386-1126                                        BP2386
                        ATTGCCGACATCGCGGTGGCTACCAACGCCATGCAGATCAAGACCGGTTCG
6   K03   BP2387-166                                         BP2387
                        ATGGAGTTTCCGTCCGTCGACAAGGCGCAGGCCTTCTATGACTCCTATCAGT
6   K05   BP2388-546                                         BP2388
                        CATGCGTTCGCTCGCTATCATGCGGGAAACCGACTGTCCCGTCGTGTTCGAT
6   K07   BP2389-691                                         BP2389
                        TTCTCGAACGTACCGCTCGATGCCGTGATTTCGGTCTGGGACGTCGATTCCA
6   K09   BP2391-781                                         BP2391
                        GGTTCGCTGCATACCGACCAGACGCTGCTGATCGATCCGGCGCGCGTCACC
6   K11   BP2393-271                                         BP2393
                        AATGGTTTCGGCAAGAGCTGTGGCCTGATCCAGGTGGAAGAACTGGGCGTG
6   K13   BP2394-596                                         BP2394
                        CTTCCGATTGGACTATCATCATGCGGCATATCCTGCCGGGCACGATATCCCC
6   K15   BP2395-226                                         BP2395
                        GATCTCGGGACGTCGCTGCGTACCAAGCGCCCGGTGTCCACCGAAATCGCC
6   K17   BP2396-1436                                        BP2396
                        CCCCGTGGGCGTTCCTGGTGACCCAGAACAATGTGTACGTGAAGTCGAAGA
6   K19   BP2397-1761                                        BP2397
                        GCGGCATATGTCGCGGACGCTGCTGTCGGACGAGATTCCCAGCCCGATCCG
6   K21   BP2398-681                                         BP2398
                        GATCGGCGCGGGCACGTATGCCAGCAACCGGACCTGTGCCGTTTCCACCAC
6   K23   BP2399-661                                         BP2399
                        GACAAGCCGACTTCGCCGCTGGCGCCGTGCGCCACCGTGGCCTTGTATGCC
6   M01   BP2400-541                                         BP2400
                        GTCATGAAAGTGACCGAAGACGGCCTGAAGCTGCTGGAGCTGGCGCCGGGT
6   M03   BP2402-81                                          BP2402
                        TTCGGATTGCCTCAATCATGTCAACAACACGATTTATTTCCGGATGATGGAGG
6   M05   BP2403-56                                          BP2403
                        TCCGCCTCAAGCAGCTTGCCGCGGAAAAGAACCACGAAGTCAGCGTCTGTG
6   M07   BP2404-621                                         BP2404
                        GAAGCTCTACCTGGGCTGCGACGATACCACGCTGCCCCTGCACGAACTGTA
6   M09   BP2405-451                                         BP2405
                        ATGGGCTTGCCGGACGAGGTCGCGGCATCCTGTGCGCGAGAAATCGAGGCG
6   M11   BP2406-241                                         BP2406
                        AACGGCGTATTCCAGGACTATCGGCTACGCGTCGCGCACGTATTGCGCGAC
6   M13   BP2407-206                                         BP2407
                        ATTGCGCCCGCGGCGACGAGTATCTGGTGGGGCAGCAGGCCCATACGTACA
6   M15   BP2408-476                                         BP2408
                        GCTGGGGCCTGGGCACGGTATTGTCCAAGCGCATGTTCGAGCGCCATGCGC
6   M17   BP2409-911                                         BP2409
                        CCGATGATGTGTACTGGTGCACGGCCGACGTGGGCTGGGTGACCGGCCATA
6   M19   BP2411-196                                         BP2411
                        GCGCTGGGCCGCCGTGAATCGCGCGTCTACGAGGAGATCATCAACAACGGC
6   M21   BP2413-481                                         BP2413
                        CTGGGCCGGCGCTACTCGCATGTCGGCATCTACATGGGCGAAAACCGCTTC
6   M23   BP2414-66                                          BP2414
                        CAAAGGGCACAACATTTCGATCACCCATCACATCAGCGGGCGCGATCCATCC
6   O01   BP2415-881                                         BP2415
                        GCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGGCGAATACAACCT
6   O03   BP2416-51                                          BP2416
                        CAACCTTACCGAAGCCGCCCGGATGCTCTATACCTCGCAGCCGGGCGTCTC
6   O05   BP2417-626                                         BP2417
                        ACCCGGATATCAAGGCGGTGTCGTTCATCGGTTCGACCCGCGTGGGCACCG
6   O07   BP2418-841                                         BP2418
                        TACTGGGACTATGACGACGCGACGCGCCAGTGGTCGGCGCGCTTCGAGAAG
6   O09   BP2419-186                                         BP2419
                        CGGGCAACGCCTGTTCGTCTTCGCCGAGCAGATGGAAAGCACCGTGCACAC
6   O11   BP2420-416                                         BP2420
                        GCTCCGATCTTTCCAAGGTGACGGCGGGGCAGTTCGCCGAATCGGGGCGCG
6   O13   BP2421-406                                         BP2421
                        GCGGCCTACCATTACGATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGC
6   O15   BP2422-276                                         BP2422
                        CCCCTGGCTGCTGAACCTGGATGACGGCTGCCCGCCCAACTTCGATGGCTA
6   O17   BP2423-1                                           BP2423
                        ATGCCCCACCACTACTCCGACTCCAGCATCCCCACCCTGACCGACCGCGTCG
6   O19   BP2424-61                                          BP2424
                        GAAGTCGTCCGGAACAAGGTGCTGCGCAATACGTACTGGCTGCTCGCGCTG
6   O21   BP2425-271                                         BP2425
                        GTCGGCACCCTCGTCCTGCACCGCTTCCTGTTCAAGGAGCAGATGTACGACA
6   O23   BP2426-206                                         BP2426
                        GCGGCTATACCGAAGCCGTGGCGCATGCCCTGCAGACGCGCATCCTGCCGC
6   A02
6   A04   BP2428-366                                        BP2428
                        CCGTTATCCCGATACGCCGCTGTACCTGCAGGTGCGCGATTCCAATACCTTG
6   A06   BP2429-86                                         BP2429
                        AGGCGTTCTCGCGCGAGTACGGCTGCATTGCGCTGGTGGCCAAGGGCGCC
6   A08   BP2430-86                                         BP2430
                        TCGGCACCAAGATATCGATCGTGTCGCGCAAGGCCCAGACGACCCGCCATC
6   A10   BP2431-91                                         BP2431
                        AGCCACGGTGCGCGCCATAACGAGCGGCTGGAGTTTCTCGGCGACTCGGTG
6   A12   BP2432-751                                        BP2432
                        GCCATGGGAGACAACCGTGACAATAGTGCGGACAGCCGCTACTGGGGATTC
6   A14   BP2433-101                                        BP2433
                        GCGAAATGTCCGCGCAAGTGCTTGATTCCATGGATATCGAGCGCGAACGGG
6   A16   BP2434-121                                        BP2434
                        CCCGCGGTGGCGTTACCCGATTTCACCGGGATCGTCGAGAAAGTCGAGCCC
6   A18   BP2435-446                                        BP2435
                        AGAACTACCACATCCGGGCCGAATCGCAGTTGCACCGCGTCGCGGATCGCC
6   A20   BP2436-91                                         BP2436
                        GAGGACTTTTTCCCCGAGATGTCGCACCCGCATGGGCGCCAGACTTGGGAT
6   A22   BP2437-446                                        BP2437
                        TCCTGCGTGAGATTGAAGGTATGAGTTACGAAGACATCGCCCAGAGCATGGA
6   A24   BP2438-371                                        BP2438
                        CTCGGGTTACAAATAGCAAAATCATCTGCACCGTCTGGCGGCCGGCATTGCC
6   C02   BP2439-406                                        BP2439
                        GCGTCGTTGATCAATCTCATTTCCGGCCAGCTCTCCATCGCCTATGGCATGA
6   C04   BP2440-46                                         BP2440
                        CTTGGCGTGAACGAAGCCGAGATCAAGAACGAGTCCTCCTTCCTTGACGACC
6   C06   BP2441-386                                        BP2441
                        GCGGCATGATGAAGGCGCGTTGGGGCCGGATCATCAATATCACGTCGGTGG
6   C08   BP2442-786                                        BP2442
                        GAAGGAACTTGGCGTCACCCACGTGATCGAATGCGGTCCGGGCAAGGTGCT
6   C10   BP2443-46                                         BP2443
                        TACCTTCCCGAACGCGTCGTCACCAACGACGATCTGGCCGCCGAGCTGGCG
6   C12   BP2444-51                                         BP2444
                        CACGATTCCGGCCGCGATCGAGTTCGCCCGGCAATTTCCGGATACCCGGCT
6   C14   BP2445-56                                         BP2445
                        ACGATTTTCTGGTCAACCCGGCAACGGCCATCGAGCCCAACACCGGCGAAAC
6   C16   BP2446-436                                        BP2446
                        GCCCAGGTTGAGGACGAGCTGATTCTGAGCGTCCCCTATGTGCCCCGGCAT
6   C18   BP2447-361                                        BP2447
                        GCGGATATTGTCACGCTGTGCCGTTTCCGCACGTTGACCGATGCGGCCATCG
6   C20   BP2448-161                                        BP2448
                        GGCCGCTGCAGGAAATCACCATCCACACCCTGACCGACGCCGTGCCGGCCG
6   C22   BP2449-496                                        BP2449
                        AACATCGTTGGCCACAGCGACATTGCCCCGCAGCGCAAGGTCGACCCCGGC
6   C24   BP2451-1046                                       BP2451
                        CCATCTTCGTGTGCCAGGTCACGTTCGGCTGGATCGTCGAACTATGGCCGCG
6   E02   BP2452-381                                        BP2452
                        CCGCCTTGAAATGGGCACCCGCCTGCACACGCCCAAGGGCAAGAACCTGTA
6   E04   BP2454-301                                        BP2454
                        GACTTTCCCGCCGACAAGTGGGACGCCATCATCGCGCTGAATCTCTCGGCG
6   E06   BP2455-971                                        BP2455
                        CGCAGGGCGGCGAATTCAGCTTCGTGATTTTCAACGAGGCCTGGGACAATC
6   E08   BP2456-296                                        BP2456
                        AGTACACCCGCTATTGCCAATGGGTAGCTGCACGCTTGCCGAACCTGCGTTT
6   E10   BP2457-151                                        BP2457
                        TTCTGGTCCATGCAAGACTCTAGCGTGCACCAGGTGCGCGACTTCTACACTG
6   E12   BP2458-1251                                       BP2458
                        ACTGGATGCAGGGACTTGGCTGGAGCGCTATGTGGACGCTTATCTGACTCCA
6   E14   BP2459-381                                        BP2459
                        CCACGAGCCGTTACGCGGTTGTCTGGAACAGCGCAAGCAGGCAGTTGCCGC
6   E16   BP2460-731                                        BP2460
                        TCTATCGCGGCTGGCATGACAATCTCATGCGCTACCGGGGCGGGAGGACCC
6   E18   BP2461-751                                        BP2461
                        CTGGCCTGCATGAGTCCAAGCACGCTGCGTGCAAAGTTCCATGCCGTGTATC
6   E20   BP2462-456                                        BP2462
                        GCCCGTCATCGGAGGTCAATTGGCCGTCCATCATGGTTGGCGTTCGATCTTC
6   E22   BP2463-481                                        BP2463
                        ATCTACGATCACGTGGAAATCGTACGTGGCGCCACAGGCCTGATGACAGGC
6   E24   BP2464-456                                        BP2464
                        CCTGGCGTCGGTCCTGATCACCATGGCGGTAGCCGCCACGGTATATCTCGC
6   G02   BP2465-281                                        BP2465
                        AACGCGTGCGCGGCGGCGGGCTGGCGCTGTGCCTGTTCGATATCGACAATT
6   G04   BP2466-51                                         BP2466
                        GACGTTGATGGGTACCGACTACCGCGTGGAGCCCGAAGGCGTCGCCAGCAT
6   G06   BP2467-156                                        BP2467
                        CTGGATCGCCGCCACGGCTCGCCCGGATGACGCGACCCCCGCACAGACCG
6   G08   BP2468-196                                        BP2468
                        CCGCAGGTGGTGTATCCGGCGCCCGTCTACTATGGCGGCCCCCGCTACTAC
6   G10   BP2469-101                                        BP2469
                        CTTCGCGAATGATTGGCGATTTTCGCGTCAGGTGTACCGTCGTTCAGGAAGA
6   G12   BP2470-1091                                       BP2470
                        TGGAGGTCTGGCTGCCGGCGCAGGATACCTGGCGCGAGATCTCCTCGGTTT
6   G14   BP2471-1131                                       BP2471
                        CACCAAGCTGATGAAGCAGCTCGGCCATGGCAAGGCATATCGCTATGCCCAC
6   G16   BP2472-191                                        BP2472
                        GCACTTTCGCGTTCCAGCGCCCGGGCAAGTTCAAGTGGGCCGTCCAGCTGC
6   G18   BP2473-2241                                       BP2473
                        GCGCCATCTGCGTATTGGTTACAACCGTGCCGCACGGTTACTCGAACAGATG
6   G20   BP2474-266                                        BP2474
                        ACCTCTCCAGGCGTCCGTTCACCCTGACCGGCGACACCGGCAACCTGTACA
6   G22   BP2475-431                                        BP2475
                        TGCGCGTCGAACAGGCCCGCCATGCGGTGCTGTCGTTCCTGGACGAATGCC
6   G24   BP2476-176                                        BP2476
                        CCTACGCCATCTGGTCCGGCGTGGGCATCGTGCTGATCTCGCTGGTTGGCG
6   I02   BP2478-1316                                       BP2478
                        TGGTCGGCACCAGTTTCCTCAGCCTGCCATCGTGGGTGCACGCCTGGAGCG
6   I04   BP2479-161                                        BP2479
                        CGTTCTGGATGGCTGCCTATGGCGCCCCGCTGGCCTATTTGATCCTCATCGT
6   I06   BP2480-816                                        BP2480
                        TTCCGCCCACCCGTACGAAAACCCCAACGCCTGGTCCAACCTGCTGGAAATG
6   I08   BP2481-161                                        BP2481
                        AGTTGCGCAACCCCGTCATGTTCGTCGTCTACGCCGGCAGCATCCTGACCAC
6   I10   BP2482-191                                        BP2482
                        TGATCGGCCAGTCGTTCACCGATCCGCGCTATTTCTGGGGCCGGCCATCGG
6   I12   BP2483-1981                                       BP2483
                        ATCGCCATCGAACGGCTGCACTATGTGGAAGTCGCCCAGCAGGCGCTGCTC
6   I14   BP2484-571                                        BP2484
                        GTGGAAAGCCACCATTACCTGCGCATCTACATGGGCCACCTGCGGCAGAAG
6   I16   BP2486-1081                                       BP2486
                        GACCGCGTCATACGGACGGGCGCGCAGATCGGCCTGTTGTTCTGCCTCGGT
6   I18   BP2487-186                                        BP2487
                        CATCTTCGGCGACTATATCCACGGCTTGCGCGACTGGTTCCCGGGCCTGGA
6   I20   BP2488-651                                        BP2488
                        GTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCAA
6   I22   BP2489-316                                        BP2489
                        CATGAAATCATGGAATGCCTGGGCCAGGTGGTATGGGAGGCTCAACGCCTG
6   I24   BP2490-146                                        BP2490
                        TCCAGCCGGAGTATCCGGTGCTGGCCGGCCAGCATGCCGATTACCTGGCGC
6   K02   BP2491-201                                        BP2491
                        TGCCAAGTACATCGAAGCGGCGCTCAATGAGTACAGGAAGGGCGCGCGCAG
6   K04   BP2493-561                                        BP2493
                        TTTCCACTACATCCGCTTTCCGGACCGCGACACCATGCGCGATATCGTCGGC
6   K06   BP2494-766                                        BP2494
                        GCGCGCAGCGAGTTCCGCCACCTCGACGTCTATTACTTCCACAACTGCCCGT
6   K08   BP2495-226                                        BP2495
                        AGCTACGGCACGTTTCGCGCCTGGCCGGCGTACAAGTACTCGGTCGAGCAC
6   K10   BP2496-46                                         BP2496
                        AATTCCCTGTCGGGCGACGTCATCAAAGGGCGCTTTCGCTACGCTTATGCCA
6   K12   BP2497-2571                                       BP2497
                        GGCCGATACCTGGGTGAACTACATGCAGACCGGCCGCAGCTTCCAGTGGTC
6   K14   BP2498-516                                        BP2498
                        CAAGACTTGCCGGACTTGCGGCGGTTCGGGCGCGGTGCGCATGCAGCAGG
6   K16   BP2499-816                                        BP2499
                        CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
6   K18   BP2500-126                                        BP2500
                        GTGGGGCCAGGATTGTTACAACTGTGGCATTTTCAAGCAGACCGCCTTGCTC
6   K20   BP2501-321                                        BP2501
                        CGAAGGCGTGGAAGTCACGCTCAAGCAGCTGACCGCCGCCTTCGAGCGCAA
6   K22   BP2502-51                                         BP2502
                        TGCCAACCTGGAAGAAGACCAGCTCGAGCGCGAACTCGACGAGGCGCTGCT
6   K24   BP2503-906                                        BP2503
                        CGTGGTGTGTCCGGGGTTCGTGGCCGACTGCCTGGAAACGCTCGAGGAAAT
6   M02   BP2504-61                                         BP2504
                        CAACCGGTCGGCTCACGCACGCTTTCCAAAGTGTTCGATCTGTCGCCGGCC
6   M04   BP2505-601                                        BP2505
                        ATGAATGCCATGGTGCTGGTGCCGGTCGCGCCCCAGACCCTCTCCAACCGC
6   M06   BP2506-741                                        BP2506
                        CCACCAATTGCAGCAGATGCTGCGCCACGACCCCGCCCTGCAAGGCATCGG
6   M08   BP2507-271                                        BP2507
                        ATCTGCACCAATTGCGGTACGGTATTCGAGTTTTCGGATCCCGATATTGAGA
6   M10   BP2508-316                                        BP2508
                        CACCTGGTACGCTGGAGCGGGGATGAACAGCCCGACCTCCAGCCGTTCCAG
6   M12   BP2509-656                                        BP2509
                        ACACGGTGTTCTTCTGCGGCACGGGCGAACGCATCGAGATCTCGCACCGTT
6   M14   BP2510-491                                        BP2510
                        AGATGGGCGCCGCCGAATGCCGCTTTGCCTATCGCGACAGTTTCTTCAAGCA
6   M16   BP2511-91                                         BP2511
                        GGGCCGCAATCTCGTCAGGAAATGATCGCGCAGCTTGCGCGCGAGTATTCC
6   M18   BP2512-1171                                       BP2512
                        GCGCTTCGTACCCGCGTGACCTTGTGCGATGGCACCATACTGGAACGCGTA
6   M20   BP2513-451                                        BP2513
                        GCCAAGGCACGTCCTGGTGCGGTCAACTACGGTTCGGGCGGAAACTACTCG
6   M22   BP2514-61                                         BP2514
                        TCCGGCGGTCTCTTTCAGGAGGGTTGCAACATCGAAGAGAGCGCTCAGTTCT
6   M24   BP2515-96                                         BP2515
                        GGCCAGCATTCAGCTTTCCGGCTTTGGCAGCGGTTCGGCGCTTGCCGCATG
6   O02   BP2516-2196                                       BP2516
                        CACGTTGCGGGTCCGGGTTACCTCCGTGACGGATCACTACGCCCAGATTGC
6   O04   BP2517-151                                        BP2517
                        CACGAGGAATACTGGCAGCATGTTCTGGGTTGCCGCGCATGGGTGCGAGTC
6   O06   BP2518-236                                        BP2518
                        TTCGTTCGAATTACCTGCTTGCGGGGAATTCCCGGTTTTACGAATGGTCGAT
6   O08   BP2519-641                                        BP2519
                        CCAAGGGCGGAATCATGGGTATCTGCGGGTTGCCCAAGACAGTACACCCGG
6   O10   BP2520-766                                        BP2520
                        GAGCACGCCAAACGGGTCGGGATAGGTTTCCTGCAGTCGAGCGGAGACTCC
6   O12   BP2521-771                                        BP2521
                        ATTCTCGTCGGAAATAGACCAAAGCTCCCACCCCGGCGCTCAGACGTCCAGG
6   O14   BP2522-221                                        BP2522
                        CGGAGCGCTATCCCTCTGCCTGGACGGAGAATCAACTGCTCGACCGGATTG
6   O16   BP2523-776                                        BP2523
                        TGGAACTGCTGTCCAGGGAGATATACAAGATTGCGTCGGATCCTGCGTTTGC
6   O18   BP2525-76                                         BP2525
                        CCCGCGGCAAGGCGCTATCGCGCCGTGTACACGCAACAGGCCGGGGCGCA
6   O20   BP2526-866                                        BP2526
                        AGGAAGGCAACGGCACGACCCTGTTCAAACCGTATGGCGTGTCCTTGCAGA
6   O22   BP2527-476                                        BP2527
                        TCACGCATCGGCAGCGGCAACTCACCATGCCGTTGCTTGCGGGCAGCAAAG
6   O24   BP2528-91                                         BP2528
                        ATGTTCGGCGTGCCGGCCGAGGTACGCGTATTTCACGCCCCGCAGGGCATC
6   B02
6   B04   BP2529-656                                        BP2529
                        TCGATTTTCTGCAGCCGCGCGACTTCACCCGCGAGGGAAACTGGATCGTTTC
6   B06   BP2530-41                                         BP2530
                        AATACATCATCGTGGTTGCCCTGGTGGCGGTCGCCGCGATCGCCGTGTATC
6   B08   BP2531-41                                         BP2531
                        GATTCGTCCTGCAGGGCTGCAACACCGTTGCAGGAATGGGCAAGGACATGT
6   B10   BP2532-471                                        BP2532
                        CGCCATCTGGCTGGACGTCAATGGCGAGCGCAAGCAATCCAGCGACATTTC
6   B12   BP2533-406                                        BP2533
                        CAGCATTTCTTCGAGCACTACAAGGATCTGGAAAAGGGCAAGTGGGTCAAGG
6   B14   BP2534-1226                                       BP2534
                        CCGACACCAAGGCCGACCCCGCGTGGCTGGACGCCGAGCGCGAGTACGTG
6   B16   BP2535-431                                        BP2535
                        TGATCACCATCGCCAGCCAGCAACTGCGCCTGGCCGGCAATGTCAGCAATG
6   B18   BP2536-601                                        BP2536
                        GACGCGCTGGTTCAGGGCCTGCGCGAGGAGCAATTGCTGGACTGGTGGCTG
6   B20   BP2537-281                                        BP2537
                        TCGAGCTGAGCTGCGTGCTCGAGCGCGCCGATCCGCGCGATGCGTTCGTCT
6   B22   BP2538-561                                        BP2538
                        GCTGATTACCGACGTGTTTGTCGTGCGTCAATTCGGCGAACAGCCCAGCGCG
6   B24   BP2539-581                                        BP2539
                        GGATCGACACCATGCTGGGTGTCACGCAACACGATTTCGCGCTGATGGTAG
6   D02   BP2540-296                                        BP2540
                        TTACCGAAGGCATTCCCGTGCGCGACATGCTGGAAGTGAAGAACCGCATGC
6   D04   BP2541-1016                                       BP2541
                        TCAACCTGAATGTGCCGCTGGTCGTGCGCATGAAGGGCACCAACGAAGAGC
6   D06   BP2542-41                                         BP2542
                        ACACGCGTTCGATACGCGTGCAGTCTTATGGGCGCGAGGATGGCCTGTGGG
6   D08   BP2543-2016                                       BP2543
                        GATCACTATCGAGACATCGCGTTCCAACATGGAGCTGCTCAAGGCGTTCGAG
6   D10   BP2544-816                                        BP2544
                        GGTGCGCACGGAAGACAGCGACAGTTCCTATATCGACGAGTTTTTGACGATT
6   D12   BP2545-236                                        BP2545
                        CGGTGCTCGATGATCTGCAGCGCGAAGGGTGGTTGTCGAATGCGCGTTTTG
6   D14   BP2546-801                                        BP2546
                        GTTCGACATCATGTATGGCAGCGGCATCTCGCGCGAAGGCGAAATCATCGAC
6   D16   BP2547-476                                        BP2547
                        AGATCCTGCTGGCGCGCAGCGGCCGCATGGTCAGCAAGACGCAACTGGTCG
6   D18   BP2548-866                                        BP2548
                        AAAACCCGGACTCGCCCGGCCAGGCGCTGACCGACCTCAACGCCATCGCCT
6   D20   BP2549-116                                        BP2549
                        ACTTCTACCTCTACGGTTCGCTCGCAGCCATCATCGCGCAGCACTTCTTCTC
6   D22   BP2550-461                                        BP2550
                        GCCTGGCGGAGAATCTGGGGGCGCAACGAGTACGGGACATGGTGTTTTCCG
6   D24   BP2551-511                                        BP2551
                        CATCTGCGCGAGGAGATGCGCTACGAGATCCGCCAGGTGCACGATCTTCTG
6   F02   BP2552-416                                        BP2552
                        ACTCGGGTTGGCTCAACGTCTGGCTCAGGCAATGGCTGGGCGGGGATTCCC
6   F04   BP2553-136                                        BP2553
                        AACCTGTATTGGGGCTCCTACGAACAGAAGTCCATCGAGGACATTCGTGACG
6   F06   BP2554-311                                        BP2554
                        CCGAATGGAGCGCCGTCATCGACGTGAATCTGCGCGGTACCTGGCTGGGCT
6   F08   BP2555-311                                        BP2555
                        TGGAGCTGCGGCCCAGCCGGTCCAAGCCTTTCGGCGTGGTCAAGGTATCCA
6   F10   BP2556-156                                        BP2556
                        GCCGCGCTGGGTGCAGGCCAGCGGGCGCGCTCGTTTGTTTTCCTACACCGT
6   F12   BP2557-971                                        BP2557
                        TGCCCTGCAATACGGACGGTGGCGGCCTTTCCTCCAACCATCCTGGGAAGC
6   F14   BP2558-151                                        BP2558
                        ACGCGATTGGTGAAAAAGGACGGCCGAGGCCTGGCCCTTACGCGCGAAGGC
6   F16   BP2559-611                                        BP2559
                        CGATGATGGATTGCCAGATGGCGCTGATGGAAAACGCGATTTCGCGCTACCT
6   F18   BP2560-71                                         BP2560
                        TCTCGTACACGTCGGAGGAGACCGTGCTGCAAGTCGGGTCCGTCAAGGCCA
6   F20   BP2561-56                                         BP2561
                        GCGACCAGCTGGAAGAATGCCTTGCCCGCTTTGCCTACCAGGGCGGCAATA
6   F22   BP2562-1036                                       BP2562
                        TACTGCGGTCCGGATACCATCGTCATGCACCCCTTGCCGCGCGACAGCCGG
6   F24   BP2563-331                                        BP2563
                        TTTGGCGCGGGCTGCTGGCTGGCGGTCGCTCCGGCCGATACCGACTACGAC
6   H02   BP2564-46                                         BP2564
                        TTGAGCGGGTGCGCCAGCCAGGGCCTGCTGTCGGGCGATACGCCCGGACT
6   H04   BP2565-41                                         BP2565
                        CCGCGCTGTCCGCGGGTTGCAATACGGTTGCCGGTGCGGGCAAGGATATCG
6   H06   BP2566-506                                        BP2566
                        GCCAGTGCGAAACCATCGTGGACTTCAAGACCCGCCGCATACAGCCGCGCA
6   H08   BP2567-211                                        BP2567
                        GACGGCGTATTCCAGTCCATGCCCGACGACATGGAAACATTGTGCCGGCGC
6   H10   BP2569-166                                        BP2569
                        TCGAAACTCTACACCGCTTCGCCGCAGGCCAAGGATCTGGTGCAGCGCGCG
6   H12   BP2570-576                                        BP2570
                        GACGCTTTCATATCGGGAATTCGTAAAACAGCCCCTCACCGAAAAGCTACGG
6   H14   BP2571-46                                         BP2571
                        GCCAAACGCTATTTCACCATCGGTGAGGTCAGCGATCTCTGCGGCGTAAAAC
6   H16   BP2572-131                                        BP2572
                        GCGACGCGCTTGCGCGCGGTGACTCGGTGAAATTGTCGGGGTTCGGCAATT
6   H18   BP2573-2266                                       BP2573
                        GTGGCCGGGCAAACTGTTACCGAGAAAAGCCTTGCTTTCCGATTCTGGCTAC
6   H20   BP2574-651                                        BP2574
                        CTCGCCCATGTTCCACCAGGTCGAGGGGCTGTGGATCGCCGAGGACATTTC
6   H22   BP2575-166                                        BP2575
                        ACGTTCCGTGCCCTGTGGATCACCCGTATCAACGCCGCCGTGCGTGAGCAG
6   H24   BP2576-41                                         BP2576
                        TTAAGGTTCGCGGCAGCGGATCCATCAAGCGTGGTCAGGCGTTCAAGCGTC
6   J02   BP2578-216                                        BP2578
                        CCACAAGCACGGCATCGTGCTGGGCAACCTGGTCGGCCTCATCGACTCCGA
6   J04   BP2580-926                                        BP2580
                        TCAAATCATGGGACGACAGCGGCAACGTGATCTATTGCGCATCGCTGCACAA
6   J06   BP2581-121                                        BP2581
                        GCGTCGGTGTTGCACCTGGTCAAGGGGTCGCCTGGATTGCGCGAGGCGATC
6   J08   BP2583-61                                         BP2583
                        CATGAGTGGACCGACACGCTGAAAGATGTCTATACAGCGCGCGCGGCCAAC
6   J10   BP2585-51                                         BP2585
                        TTGGGCCGGTCCGATCACTTTCCTGCTGACCTTCGGCGAGTCCATGGTCCTG
6   J12   BP2586-121                                        BP2586
                        GTGCTGATGCGTTATCCCGACCCCGTGTCGCTGATGACCTACCATCGCGGAT
6   J14   BP2589-261                                        BP2589
                        GGCGCAGATCGTCGGCGTGTCGCGGCAGAACATGCGCAAGCTGATGCTGGC
6   J16   BP2590-431                                        BP2590
                        AGGAGCTGGCTACGCTGAACGCGCCGTTCGTGCTGGTCAACCGCTACCTCG
6   J18   BP2591-561                                        BP2591
                        CATCCTGGACCTGCTGGATGAGCTGCGGGTGCAGCGCGGCCTGAGCATGGT
6   J20   BP2592-356                                        BP2592
                        TGGCGTCCACCGATCCCAGCCTGTGGAAGGCCGCGCTGGCCGTGGGCATCA
6   J22   BP2593-811                                        BP2593
                        ATCTTCGCCGTGGAGCAGAAGGACCTGCCCGTGCTGCAGGCCGGCGTGCTC
6   J24   BP2594-1131                                       BP2594
                        GCAGCGGGTGCCTTACAACCGCTATTCGGCTGGCGTGGCGGGAATCGCGCC
6   L02   BP2596-246                                        BP2596
                        CTTCTACGGCTTCGAGGGCGAGGGCTGGTTTCTCAGCTTCCATTGCATGACG
6   L04   BP2597-436                                        BP2597
                        CTGGGATGCATCTGCGTTACGCTCAATACCTTGGTCGATGTGATGGCGGTGG
6   L06   BP2598-496                                         BP2598
                        ATCACGTCGTTGGTCGGCAAGCGCAAGCTGAGCCAGAACAAGGACGAGCGC
6   L08   BP2599-906                                         BP2599
                        CCGCTACGGACAACGTCCCATCGACGCCTTGCAATCGATCGACACCGATGG
6   L10   BP2600-751                                         BP2600
                        GCCATGCATCTGTGCGGACACTCGCAGCAATCAGCCAATCTGGGCTTGCAAT
6   L12   BP2601-791                                         BP2601
                        GCAAGTCTGCGTTGCAGGTTTCCGCCGGACTGTTGGTCGGTGGGCAACGCA
6   L14   BP2602-611                                         BP2602
                        GGGCCGCTTGCCAGACGTGGATGGCGCCGCATGCGAAGTACCTGGCGGTC
6   L16   BP2603-116                                         BP2603
                        AAAAGGGCCGCGCGACCAGTATCGTGCGCTATGCCCCTGGAGCCTGTTTTC
6   L18   BP2604-291                                         BP2604
                        CCTGACCGTTACCGTCAGTCCGGCTTTCGCGGCCAAGTGGCTATTGCCCAG
6   L20   BP2605-396                                         BP2605
                        GGCATTCGCTCGCCGATTTCCTGATGTCTTGTTCCGTCCCGACGTCCTGTAT
6   L22   BP2606-611                                         BP2606
                        ACCAGGCACTGAGCCGGCACCGCCCCGGGGTCGTCGTGATCAATGCCGGAT
6   L24   BP2607-856                                         BP2607
                        TTCAACTATGCGCTGGGCCAGGTCACGGTGACGCCGATGGCGCTGCTGATG
6   N02   BP2608-536                                         BP2608
                        TGGCCTTCACCGACATCCACCCCGACGAGCGTTTCCCCAGCGCCGTCCAGT
6   N04   BP2609-516                                         BP2609
                        CATCGGCGGCATGCGCGTGGTTTTCTCCGGCGATCTGGGCCGCTACAACGA
6   N06   BP2610-706                                         BP2610
                        CGCGGCGTCCAAGTATTGGGCGAGATCCCGCAGGGGCTGCCCGGTTTCACC
6   N08   BP2612-126                                         BP2612
                        CGTGCGCCCGTCGCATGACCTCTATGGTCAAAGCATTTCTGGCAAGGTGCTG
6   N10   BP2613-396                                         BP2613
                        GGGGTGGGGTGACACAGGCTCGGTCATTTACGCCAATTCGGTTTACGGTGC
6   N12   BP2614-526                                         BP2614
                        CACGTCGTCATTCCCTCGACGGTGAGCCCCATTCTTACCGGGATGCGTGTCT
6   N14   BP2615-251                                         BP2615
                        TCTTCCAGGGAGACGACTCCCTGTATCACTGGCTGACTGCCCTGGAGAACGT
6   N16   BP2616-846                                         BP2616
                        CGATCTGGTTCGCGCGGGAGGGTGGTTGAAGGACAAGGGTTTGATCCAGAG
6   N18   BP2617-716                                         BP2617
                        ACATCGAATTATTGATGCGGTTTCGTCACGAATTGCCGATACACGTGGTCCC
6   N20   BP2620-816                                         BP2620
                        GCCGTTCGTGGCGGGGATCGGCGCCGTGTTTTTCTTTTTCTCGGCGATCAG
6   N22   BP2621-521                                         BP2621
                        AAGCCAAAGCCCAGGGCCAGCTCGCCGCCGACACCAACGAAGCCAGACTGG
6   N24   BP2622-1166                                        BP2622
                        AAGTTGGTTATGGCCCGACGGCGGAGCCGATCATTGAAGACCTGTTGGCCC
6   P02   BP2623-51                                          BP2623
                        TCTGCTCACTACCGGCCAGCTTGGCGCGGTCTTGCAGGCTGCACGCAAAGC
6   P04   BP2624-1001                                        BP2624
                        CCATCTACCCCGACGTCATCGAATCGGCCGGCGCCAAGACCGGCAAGGCCA
6   P06   BP2625-46                                          BP2625
                        GTGCCTGCTTACTCCGAAGTGTTGCCGCGCGACACCTCGCTGACCACCCGC
6   P08   BP2626-121                                         BP2626
                        GTGTTCATTTACGAGGATGCCACCGGACGCGCCATCGATGTGGACACCCGG
6   P10   BP2632-216                                         BP2632
                        CTCGGTGACGGTGGATTTCACGCACGACGGCCACGCGTATTCGCTGCGCAA
6   P12   BP2633-731                                         BP2633
                        AGGTCGGCAAATATCGCTGGTCGCACTGGGTCGAGCGGCTGGACCTGGCTT
6   P14   BP2635-296                                         BP2635
                        ATCTGGTCTCGGGCGATTTCGATTATCTGGTCAAGGCGCGGCTATCGGAAAT
6   P16   BP2636-281                                         BP2636
                        ATTCGTCGCTCAAGAGCTTCGCCGATTATTTTTCGCCCAGCGCCAAGACCAG
6   P18   BP2637-796                                         BP2637
                        GACCGCCTGTGGTTCCGCAACCCGGACGAGCATTCGTCCAACGTCGAAGGC
6   P20   BP2638-706                                         BP2638
                        CTCGATGGCAAGCGGGTCTATGGCCACATGGACTACGGCAAGAAGGATCCC
6   P22   BP2639-166                                         BP2639
                        ATGATCGCGGCCTGGATCAATCTCGCCTACGTGGGGCTGGGCAGCAAGGCG
6   P24   BP2640-131                                         BP2640
                        TGTGGCCCAGCGACTTCACGGTCGAGCACTATCGCACCATCTTCACCGATCC
6   B01
6   B03   BP2642-206                                        BP2642
                        GCCAGGATGTGACCGGCCGCACGCCGCAGCAACGCAACATCGCCCAGGTCT
6   B05   BP2643-346                                        BP2643
                        GGCCTGCGCGTCATCACCAACAACCTGCACGTGGCCGACATCCTGTCCGAC
6   B07   BP2644-1126                                       BP2644
                        CTGGTCACGGTCACCGGCGGCAAATGGACCACCTACCGCAAGATGGCCCAG
6   B09   BP2645-176                                        BP2645
                        AGTACCGCCCCACCTTGCGGCTCTGGGAGCTGGGCAACGTCGTCGTGCAGC
6   B11   BP2647-861                                        BP2647
                        GGTCGACGGTTTTCTCAGGAATCCTGCGGTCATCCAGAAGATCGAACAGGTC
6   B13   BP2648-1136                                       BP2648
                        CGTTCCCCCTCGAACATCCCCGTTACTACGCCTACGCCACGGTTCCCTATAT
6   B15   BP2649-596                                        BP2649
                        TGGAGATGATCGGCGTCTGCCTGACCTGTCCCAATGTCTGGCTGTCGCCCG
6   B17   BP2651-616                                        BP2651
                        AGCAGCCCCTTCATCGTCAGCCCCGACTATGGCACCCGCAGCGCCTGCATC
6   B19   BP2652-161                                        BP2652
                        CCGCGGTGCAACAACAAGGCAGTGTCCAATTCGTTACCGGCGGCGTCGGCC
6   B21   BP2653-476                                        BP2653
                        GAACCGGCAACATCACCCACCTGGTCAGCGAGTACTTCCTGAGCAGCGCCG
6   B23   BP2654-761                                        BP2654
                        ATCCCATGGCCAGCTGCTTCTACAGCGCGCCGACGCTCGACATGCACACGC
6   D01   BP2655-256                                        BP2655
                        GCCGAACATTGCGACATCCGGGGCCTGTGCGGCGATTCGCTGGACCGGTTG
6   D03   BP2656-256                                        BP2656
                        TGGCTGGTGGCGCGCCTGGTCTACGTGGCGCTGTACATCGGCGGCCGGGG
6   D05   BP2657-236                                        BP2657
                        TGGGCGCGCACTACACCTATTCGCTGGTGCCCTACGATGCCTGGTGGCAAC
6   D07   BP2658-156                                        BP2658
                        CAAGGAAACGGTGCTGGCATTGGCGGACCGGCGCATTTCCAGCGATGGCGT
6   D09   BP2659-91                                         BP2659
                        TGCAATCTCTGGACCGGGCGCGAAAGCGACCGCGCCGGCGCCGCCTGTAC
6   D11   BP2660-111                                        BP2660
                        CAGCGGCGACGTCGTGCAGGCGCCCGGCGCCTCCGACAATGGCATGCTGA
6   D13   BP2661-286                                        BP2661
                        GCCGGTTTCTACTACATGGGCAAGGAGCCCGCGCTGGTGTTCGATACCGGC
6   D15   BP2662-326                                        BP2662
                        GCTTCCACATCTGGATTTACCGGCACCGGCCCAACGTGCAGTGCATCGTCCA
6   D17   BP2663-346                                        BP2663
                        GAACACATCTATGAAGCCATCACCCTGGGCAGCTCGCACAGCGGCCTGTCG
6   D19   BP2664-311                                        BP2664
                        AGTCCCTGCGCGAACAGGTCGAGAACGTGCTGGTGCAACTGCGCCGCCAGC
6   D21   BP2667-3706                                       BP2667
                        ATCCAGGCCGTCGGGCATGCCTACATCGACGGCGATGTGGAGAACCGTTCC
6   D23   BP2668-2806                                       BP2668
                        AACCTGGACATGCTCACCTTCGATCCGCAGTCGGCCGACTGGGGCGATTAC
6   F01   BP2669-176                                        BP2669
                        TCACCTTCCTGAACGTGCTGGTGCGCTACCTGACCGACCAGTCCTTCGCCTG
6   F03   BP2670-1021                                       BP2670
                        ATCTTCCTGATTTTCGTCCCGCTGCTCATGCCGATCGCCAATGCCTATGGCT
6   F05   BP2671-636                                        BP2671
                        GGAGAACCCGCTGTCTATCTACACCGGCTCCAAGCTGTACACGGTGGGCCA
6   F07   BP2673-476                                        BP2673
                        AGAACCGCAACCGCGGCATTGGCTGGGACGCTGTGCACCTGGCCATCGATG
6   F09   BP2674-311                                        BP2674
                        AAGCCTATAAGCAGGCTTGGTACGTCGACGCCGCAACGCTGCTCAAATCGCC
6   F11   BP2675-561                                        BP2675
                        GCCGTCCTATTACTGCAATATCCTGGAGGAACAGCGCCGCCAGGGCATGGA
6   F13   BP2676-226                                        BP2676
                        GCGTTCGCGTTTTCGTGCAACTCGCGCAACGTCAGCACCGTGGCGTCGGGC
6   F15   BP2677-386                                        BP2677
                        CCGCCAGTTTCATCCAATCGTTCTGCAGGCTGGGGTTGATCCCCGACACCGG
6   F17   BP2678-491                                        BP2678
                        CGCGCATCCCCGGGGTGGCGCTCTGGGAAAAGCCGCAGGGCAAGCACGAC
6   F19   BP2681-381                                        BP2681
                        CATCGAATGCCCGCACTGCGGTTCGCTCGATACGCGGCTGATCAGCCATTTC
6   F21   BP2682-251                                        BP2682
                        TGGTCGAGCGGCCCAATGGCCACTATGGCGACACCATGGCGCGCCAGTTCC
6   F23   BP2683-96                                         BP2683
                        AATGGCCATCAACCATGCGCGCGATGTCTATACGCGCCGCAACGAGGGCCT
6   H01   BP2684-671                                        BP2684
                        ACAGCGCGCAGTCGATGCAATGGAAGATCAAGCTGTTCTCCAACGACGAATT
6   H03   BP2685-581                                        BP2685
                        GACAATGCTGGAATCTCGATGAGGTGGCGGACCAATACCGCCTGTTCTCGCG
6   H05   BP2686-561                                        BP2686
                        GGGCGCCGCGGCCTGGTGCGGCGAACAGTATCTGTCCCTGCTTGGTTTGAC
6   H07   BP2687-311                                        BP2687
                        TGTGTGGCAATACCATCAGCCAGGACCGGCGCTTCATGTACGCCTACATGCC
6   H09   BP2688-1156                                       BP2688
                        CTGTACGATGACAACGCCGCCACCCTGACGCCCGATCCTGTGCACTCCGCC
6   H11   BP2689-216                                        BP2689
                        AATGCGCGTCAAGCAATTCGCCGCCAACGTCGACCAATTGCTGATCGTCGTG
6   H13   BP2691-56                                         BP2691
                        TGATCCTGGTGTCGATGATCGTCTTCATGCTGCAGAAAATCCTGCCCGGCGA
6   H15   BP2692-791                                        BP2692
                        GTTACCAGGAGGTCTTCTTCAATACGGGCAACGGCAAGCGCGCCGAGACCA
6   H17   BP2693-1071                                       BP2693
                        CATCTACCTGACGGCCGCCGACGAGAACGGCATGATGATTTCGTTCATCCAG
6   H19   BP2694-291                                        BP2694
                        CATCGTGTCGTGCATGGGCACCCTGTCCAAGGTGGTTTCGCAGTTGAAGCG
6   H21   BP2698-121                                        BP2698
                        GTGCAGCCGGCCGCCTACACGCTGGGCAAGGGCCATCTGCTGTTCTTCTAC
6   H23   BP2699-171                                        BP2699
                        CAAGATCCGCGTCGAGGTCGTGCTGGCCGACGACATGGTCGATCCGGCCAT
6   J01   BP2700-1196                                       BP2700
                        GCAACAAATCCGAAATGACCACCGGCTATTGCACGCTGTATGGCGACATGGC
6   J03   BP2701-731                                        BP2701
                        CCTACAAGCTGTTTTCCGAAAGCTACCGCAACTACCGCCACATGTTCGAGTC
6   J05   BP2702-51                                         BP2702
                        GGCGTGGTCCGCCCGTTTCTCGGAACCCGTTTCCGACCTCGTCAAACGCTAC
6   J07   BP2703-296                                        BP2703
                        AGAAGATTTCGCATGACAACACCCGCATTCCCGAGCAGGAACAGCTGCTGGC
6   J09   BP2705-781                                        BP2705
                        CAGGGTTACCAGAACAATGAATTCACGCACATGGCGGTCGCCGCCCATATCG
6   J11   BP2706-111                                        BP2706
                        GCGCGACCTGCGCATTTCCGTCACCGACCGCTGCAACTTCCGCTGCACGTA
6   J13   BP2707-851                                        BP2707
                        ACGGCAAGCCGGTCGTGTGCCTGCCGGGCAACCCGGTCTCCAGCTATGCGG
6   J15   BP2708-291                                        BP2708
                        CGAGGGTTTCGGCGAGCTGTTCCGCCAGCTCTCGTACGAGGAGATCGGCAG
6   J17   BP2709-141                                        BP2709
                        CACCGAGACGCTGTATCTCGACCACTATCCCGGCATGTGCGAACGCGAGCT
6   J19   BP2710-126                                        BP2710
                        ACGCTATCCGCAGCTGGAGCCGGCCGAGCGCCTGAAGCTGGCCGTCAACCA
6   J21   BP2711-301                                        BP2711
                        CATATCCGCGCCACCTGCCGCACCCAGTACAAGACCGGCGTGGAAATGGAG
6   J23   BP2712-2546                                       BP2712
                        TCACCACGTATTCGGCCAAGTACGTGGGCTATCCGATCAAGCGCGGCAAGC
6   L01   BP2713-221                                        BP2713
                        GCAAGAAGGACCTGCCGACCCTGCTGGTGGTGTCCGAGATATTCGGGGTGC
6   L03   BP2714-201                                        BP2714
                        GCGGCGCTACGCCGATGAGTACCACTATGCCTTCGACAGTTTCGACGAGCG
6   L05   BP2715-381                                        BP2715
                        CATGGGCGTGCGCTCGCAGCGCTATTCGGCGCTGATCGACGACGGCGTAGT
6   L07   BP2716-316                                        BP2716
                        ATCGTGATGGTCACCGAGTTCATGGTGATCGAAAGCTGGCTCAACGAACAGA
6   L09   BP2717-456                                        BP2717
                        TCGCCGCGCGGCATGGATGTGGCCGCTGGCGGTATGGGCCGGCTACGGCG
6   L11   BP2718-191                                        BP2718
                        TGTCGATCAAGACCGGCGGCTGCCCGGAGGATTGCGCGTACTGTCCGCAAT
6   L13   BP2719-71                                         BP2719
                        ACTATCCGCCCGCCATCGAAAGCGCCAGCGCCCTCAGCCACACCCAAGTGC
6   L15   BP2720-76                                         BP2720
                        TGCAATGGCTTCAGCTATCGCGACCTGGCCGATCACGTGGGCGTCAAGACG
6   L17   BP2722-961                                        BP2722
                        GAAAGCCTGCCGGTGGAAAAAGGCCCGGACGACGACGTCTACGCCGGCACC
6   L19   BP2723-41                                         BP2723
                        TGGAAACCGTGCGCTATTACGAGAAGGAAGGGCTGTTGCCCGCGCCCGAGC
6   L21   BP2725-151                                         BP2725
                        TACGATTTCGTGCGCGCACGCGGCGTCACGCTGATGGCGGCCACCCACTCG
6   L23   BP2726-381                                         BP2726
                        CAGCATCGTCAATATTTCCACCTACGCCACCTTCGAACCCGAAGCGGCGTTC
6   N01   BP2727-676                                         BP2727
                        ACGGTGCTCAGCTTCCCCAACAACCACCTGGGCTATGCCATCACCTGGTTCG
6   N03   BP2728-206                                         BP2728
                        CGTTCGCAGTGGTGCAGATCGTCGTGCACCTGGTTTATTTCTTGCACATGGA
6   N05   BP2729-526                                         BP2729
                        GGCCTGATCCCCGAGAACCGGCGCCGCCTGATGTGCCTGTCGATGTTCTGG
6   N07   BP2730-1331                                        BP2730
                        GCATCACCTACTGGTTTCCCAAGGCGTTCGGCTACCGGCTCGACCCGTTCTG
6   N09   BP2732-171                                         BP2732
                        GGTGTTTCCCAGCGTGTTCTTTCCGTTCGAGAGCGAACTCGACGGCATGCTG
6   N11   BP2734-971                                         BP2734
                        AGACCGGCAAGGTCGTCATCTCCCGGGCGCTGCACAGCGTCGAGTATCCCG
6   N13   BP2735-111                                         BP2735
                        GACGTTCGCCCGGCTGGATCTGATCACCCGCGAAGAATTCGAGGTGCAGGT
6   N15   BP2736-211                                         BP2736
                        GACCAGGTGATCGAAGCGATCGAACAGTCGGCCCGCACCGGCAAGATCGGG
6   N17   BP2738-2386                                        BP2738
                        ACCGACAGCGCGCATATCGGGGCCTACGCGGCGTACGTGGCGGACAACGG
6   N19   BP2741-146                                         BP2741
                        TCACCAAGCCCAGCCTGTACCGCAGCTTCTCGTCCAAGGACGAACTGGCCG
6   N21   BP2742-706                                         BP2742
                        GCAGCGCGCACCCGCACGTTCTGGTATCTGTTCGCGACCTTCTTCGTGTGCG
6   N23   BP2743-236                                         BP2743
                        TGGTGCGCAAGGGCCTGGTGATGGTGCCGGAAGGCCGCGGCATCTTCGGT
6   P01   BP2744-136                                         BP2744
                        CTGTTCAACGTGCTGACCGGGCTGTACGTCCCCGAAGAGGGACAGTGCGAG
6   P03   BP2745-406                                         BP2745
                        ATCCGCATTTTCCTCAACAACCTGAATGCGCCGGTCAACATCACCAACGGGC
6   P05   BP2746-331                                         BP2746
                        GTATCCATCATCCTGCAGAACGTGGCGATGATGGTGTGGGGCCGCAATTACC
6   P07   BP2747-386                                         BP2747
                        CCTCGCCCGAATATACCAACCAGCAGTACGAGACGACCTTCCGCATGATGAC
6   P09   BP2749-66                                          BP2749
                        GCAGAAACTGAACTGCACCCCGCACTGGCTGCACAAGCAGGCCATTCTTTCC
6   P11   BP2750-146                                         BP2750
                        TCATGATCGAGATCCTGCCGGTCAACGTGCCGGCGCAGGCCGACCAGCCGC
6   P13   BP2751-566                                         BP2751
                        ACATCGGTTCACCCGTGTATTTCCGCCGCATTCCCGTCGGCCGGGTCATCGG
6   P15   BP2752-756                                         BP2752
                        CGGGGTGGTCGAACTCTGGGAGATGGGGTCGTGGGATATCGCACTGATCGT
6   P17   BP2753-106                                         BP2753
                        GACAACGCTTCGGCAGTCGAAGTGCTGCGTGCCTGCGCCGCCAATCTGGAT
6   P19   BP2754-216                                         BP2754
                        CCAGGTATCGCCGCACTATCTCGAAACCCTGCTCACGTACGAGGACCGCTGG
6   P21   BP2755-2126                                        BP2755
                        AGGTGGTGCCCGTCCAGCAGGCCCAGGTTCGCCTGTACCATGAAGAGCGGC
6   P23   BP2756-156                                         BP2756
                        CAGCGAAGACGCCACGCGCATCATGCTGCAGGTGCACCACGAAGGCCGCGC
7   A01
7   A03   BP2757-106                                        BP2757
                        GACGGCGGTGAAGATCTGTTCGCGCATTTCTCGTCCATCCAGATGAACGGTT
7   A05   BP2758-281                                        BP2758
                        TGCTGTTCGTCTTCGAGGCTCCCGACCAGCAGTGCTTCTGGATGCGCAACAC
7   A07   BP2759-421                                        BP2759
                        ATCTACGACACCACCATCGGCTGGCGCTTCGTCAACAAACTGATGAAGGCCC
7   A09   BP2760-61                                         BP2760
                        GTTGCGCTGGTGTCGTTGGGCTTTACGCAATTGGCCGACCTGGCGCTGCAC
7   A11   BP2761-176                                        BP2761
                        AGTCCTCGGGTGGCGTTTTCAACAATGCCGCCCAAGTCTGGAACCACACGTT
7   A13   BP2762-126                                        BP2762
                        GATTTCCAATTTCACCCAGGCGGCCTCGGGCCACTGGTATTTCACGCTCAAG
7   A15   BP2764-126                                        BP2764
                        GCTGAACGAACAGGTCCTGGAGATGCTGCGCAACCAGCAGGACACCCCCGA
7   A17   BP2765-61                                         BP2765
                        ATCGATGTCCTGCTGGTGATCCTGATCTTCCTGGCCGCCACCACGTCGTTCG
7   A19   BP2766-866                                        BP2766
                        ATGCGCAGTCGCCCTTTACCGCGCTGGATGCCGACCTCATCCTGGTTACCGC
7   A21   BP2767-41                                         BP2767
                        GCAAGGGCCGCCTCGAATTTCAGCGCGCGCAGGCCGAACTGGTCTGCAACG
7   A23   BP2768-616                                        BP2768
                        CTGGAACGCTACGAATCGCTGGAACAGCTGCGCGCGATGGAGCACGGCCAC
7   C01   BP2769-481                                        BP2769
                        GAGGAAACCGTGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCG
7   C03   BP2770-131                                        BP2770
                        CGCTGGCCAAGGAGCTGAACCAGCGCTACGTGCACTGCGACGTGACGCAGG
7   C05   BP2771-436                                        BP2771
                        GTGATGTTCCCGTACATCCTGTGCATGTCCCTCATCGCCTTCGCATCCGGCG
7   C07   BP2772-876                                        BP2772
                        CCTGCCGGTCTCGGGAACCTTCCCTCTGGACGACAGTGATGCTACGCTTGTG
7   C09   BP2773-151                                        BP2773
                        CTGCGTAAAGCCACGAGCGTGATTGACAGCGTGGCTGACAAGAACATCATCC
7   C11   BP2774-231                                        BP2774
                        GCCTTCCTGGAACGATCCGGTCGAGATCAAGCGCATGCTCGATATCGGCTTC
7   C13   BP2780-821                                        BP2780
                        CCCGGCGCAGGCCGGACGATCCCGATGATGTCGGTCATTTCTTCCTGGCGC
7   C15   BP2782-66                                         BP2782
                        ATCGCCCTCGGTGGTACAGCAGCGCGATGGCAGTCAGGTCGTGACGCCCGA
7   C17   BP2783-731                                        BP2783
                        CCAAGGGTGGCGAGGTGTCGTTCGCGGTGCCTTCGGGCAACTTCGGCAACA
7   C19   BP2784-1191                                       BP2784
                        CTTCCTGACGCACGAAGCCGTCGAAGGCAATGTGAACCAGGCCATCGAGCA
7   C21   BP2785-931                                        BP2785
                        GCAGGTTGGAATGTGGAGATCCCGAAGGCGTCCATGTATATCTGGGCGCAG
7   C23   BP2786-51                                         BP2786
                        TGGTGACGGCTACATCGAAGTCAACCAGGTCCGCTTTTCCCACGCCATCGCC
7   E01   BP2787-196                                        BP2787
                        CTGGGGGTATCGCGCGACTCGCTCAAATCGCACGAGAATTTCAAGACCAAGT
7   E03   BP2788-821                                        BP2788
                        AAGACTTCTGGAACAAGCACGGCAAGGACGTGGAATCCTGGCAACAGGGCG
7   E05   BP2789-771                                        BP2789
                        GTTCGACATCGTCGTGGCGCAATACCACGACCAGGGCCTGATACCCGTGAA
7   E07   BP2790-181                                        BP2790
                        GTGGCGGGAGTCACGCACTGGCGCCTGCACCTGACGATCTTCTCGGCCACG
7   E09   BP2791-556                                        BP2791
                        CACCGCGAAAGCGAGTCCGATGTCACCGGCGTGCCGACCGGCTTCGCTGAT
7   E11   BP2792-561                                        BP2792
                        CCTGGCGCAGGCCTATGATCTCTACCAGACGCTGGCGTCGCTGGTGAGCCT
7   E13   BP2793-206                                        BP2793
                        CCGAGCGTCTGAACGGCTTCCAGCTGAAGATCTCGCAGAAGGCTGGCGTGG
7   E15   BP2794-136                                        BP2794
                        GACTTCGTGCAAGAAAACGGCAAGATCATCCCGGCCCGCCTGACCGGCACC
7   E17   BP2795-56                                         BP2795
                        CTCCCGCCGGATTGCCTGCGTTGGAATTGCTGTTGGTCCACGAGTCCGAGG
7   E19   BP2796-91                                         BP2796
                        GGCCAGAGCGGCACGGTGCATCGCCTGGAAGACTGGGGTCGCCGTCAACTG
7   E21   BP2797-456                                        BP2797
                        CACCAGCCTGTGCCCGTGTTCGAAGGCCATCTCCGAATACGGGGCGCACAA
7   E23   BP2798-171                                        BP2798
                        GCTGCATTATGTCTTCGACACGCCGCATGACCGCATCGTCTGGGACGTGGG
7   G01   BP2799-501                                        BP2799
                        CATCGACCTGCACAGCGTGGGCCGCATGCTCACGCGCGACGAACTGCAGAC
7   G03   BP2800-51                                         BP2800
                        GCAGGATTTCGAAACCGCGCTCGCCGAACTCGAGTCGCTGGTGTCCGCCAT
7   G05   BP2801-211                                        BP2801
                        GGCAATCTGGACCTGGCGCGCCTGACCGGTCTGCCCAAGCCCACCATCAGC
7   G07   BP2802-591                                        BP2802
                        CGTGGACCTGTTCTTCGACATGGTCGCCACCGGCATGCCGCAGGCCGAGGC
7   G09   BP2803-681                                        BP2803
                        CTGGGGAGTCAGCGCCCTGTCCGATTCGCGCGCGCTGGATCTGTACTTCTA
7   G11   BP2804-281                                        BP2804
                        GCAACGTCAGCGGCAACGCCAATACGCGCGGCAGCCTGAAGGACACCGGCG
7   G13   BP2806-241                                        BP2806
                        GCCTTCATCCTGGAATCGCTGCCCAAGGACGAACGCCAGACGGTGTGGCGG
7   G15   BP2807-191                                        BP2807
                        CCGTCAACGCATTCCAGTTCAAGCAACCGGTATTCGTCGGCGACCTGCTCAG
7   G17   BP2808-121                                        BP2808
                        CGGCAATTCGGCTTCTCGCCCCTGGTGGTCGGCATCGTCTGTGGCATGCTG
7   G19   BP2809-361                                        BP2809
                        GGCGTGCATCTGTCGGACGGCAATACGCGCCAGATCGTCGAGCGGCTGCCG
7   G21   BP2810-816                                        BP2810
                        CATGGGCGAAATCACGCGCCTGACCTGTGCCGCCCTCGATTGCGAGGGCGA
7   G23   BP2811-1511                                       BP2811
                        CGGTCAAGGTATTCGTCGTGAAGAAGGATCCGGCCCTGACGGCCGAAGCGG
7   I01   BP2813-551                                        BP2813
                        TTTTCACCGCCGTCCATGGCATCGGCTCGTGGCTCAACGGCCATCGCATCTC
7   I03   BP2815-2081                                       BP2815
                        CGGTGGTCATGCGCAATAAAATCCGCGTAATGCAAATGCAGGGTTCCAGCTA
7   I05   BP2816-41                                         BP2816
                        CGCATGGCCGCTTCGAAGCGCTGCGGGGCATCAACCTGCACATCCAGCAGG
7   I07   BP2817-461                                        BP2817
                        TGGGCGATCTGGGCATCCGTTATGGCTACCAGCGCTTCCTGCCTGAAGTCAT
7   I09   BP2818-126                                        BP2818
                        CTTCGAGGTGGTCAAGCAGGAGGCCGCCAAGCAGGGCCTGAATATCCAGGT
7   I11   BP2820-296                                        BP2820
                        GTTCTTCGATGGATGTGGCCAAGCTGGCTGCCGCATTCGCCGGGACGACGC
7   I13   BP2823-206                                        BP2823
                        ACGCGCCCGCGGCGATGATCCAGGTAGAGATGGACCCCGTGACCGTCATGG
7   I15   BP2824-1126                                       BP2824
                        GTCACCAATGCGGTCAAGCAAGGCAACTATCTACAGGGAATGACCGGCCACG
7   I17   BP2825-126                                        BP2825
                        GCTGGGTATCAGCCGTCCGGTGATACGCGAGAGTCTTTCGAGACTGGAATC
7   I19   BP2826-856                                        BP2826
                        CGCACCCGTTATGCTGAGGTCGGTGCTACCTTGCATGGCGGCCCCCCGGAA
7   I21   BP2827-261                                        BP2827
                        CGACTGGGATACGGTGCTCAGCGGCGAGCGTTCCATCATGAGCAAGGTGCT
7   I23   BP2830-531                                        BP2830
                        CTTGCAGGGGATCAGCGACGAGGACTATCACGCAGCCAGGGTCTCGGGGGG
7   K01   BP2831-106                                        BP2831
                        CCCGGCGCGCTCGACATGGCGAACATCCAGTCGGCCTGGTACGAGAAATCG
7   K03   BP2832-926                                        BP2832
                        ACGCCCAGGGGGAGTTCCTGTTTCTTTCTTCCGAGTATCTCGGCGGAAAGAC
7   K05   BP2835-56                                         BP2835
                        CGATGGCTGATGGTTCCATCGTCGTGTGGATGACGGACTCCCGTCCAGGCT
7   K07   BP2836-76                                         BP2836
                        TACGTCAGCGAGCAGCTCGGCCTGTCGCTATCGACGGCGTATCGCTGGATA
7   K09   BP2837-86                                         BP2837
                        CCCTGCATTTCTACGAAGCCAAGGGGTTGATCGCCAGCACCCGCACGGCCG
7   K11   BP2838-76                                         BP2838
                        GGCCTGACCCGCTGCGGCTGGCTGGATCATTCCGTCGATTATGTGGCCTAC
7   K13   BP2839-1771                                       BP2839
                        GTGTTCGTGATCGACACCGAGAACGCCGTCGTCAACATCACCGGCTCGATCG
7   K15   BP2840-126                                        BP2840
                        CAATGCGCCCAGCCTGTACGCGGCGTTCGGCTCGAAAGAGGCCTTGTTCCG
7   K17   BP2841-316                                        BP2841
                        GACATCTCGGCCGACGACTACGACCGCTCGATGGACATCAACGTGCGCGCC
7   K19   BP2849-471                                        BP2849
                        GTCGGTGCAATTGACGCCGGGACGGTTTCGCTACATGACCCTGGGCATCGA
7   K21   BP2850-141                                        BP2850
                        GGGCGACTCGCTGGGCATGGTCATCTACGGCATGGAAACCACCCTGCCGGT
7   K23   BP2851-766                                        BP2851
                        GGCTGGTTCTCCGGCTACTCGATGGGCACCAACCCCAGCTTCGCCGGCTAC
7   M01   BP2853-531                                        BP2853
                        GGGAGTGCGGGTAAATACCGTGTGCCCGGGCCTGGTCGAGACGCCCATGAT
7   M03   BP2854-566                                        BP2854
                        CGCCCATGAGCAGTTGGATGCACGGCGATGCGCAGACCTACACCGAGTACA
7   M05   BP2855-596                                        BP2855
                        CGCTGCTGGGCGTCTATGCGCTGTACATGCGCCGCAGCGCCAGCGAAAGCG
7   M07   BP2856-176                                        BP2856
                        AAGACTATGCCGCGGCGGTGGTCAATCGTGGTCTGGCCGCGCTGACGTTCG
7   M09   BP2857-321                                        BP2857
                        GCCGCTGGTGGCCGAATTCACGGCCGCGCATCCGGGCGTCGAACTGGACTT
7   M11   BP2858-46                                         BP2858
                        CTGAACGAGGATTTCCAGAAAGATCCCCGTGTCGGCAAGGTCAACCTGACCA
7   M13   BP2859-186                                        BP2859
                        GCTGGTCGTGCTGGCCGCCAGCTACCTGCACGATCTGGTCAACCTGCCCAA
7   M15   BP2860-491                                        BP2860
                        TGGAAATGGGCTCGCACATGATCCCGGCCTTCCACCATGCCGTGGCCGGCA
7   M17   BP2862-156                                        BP2862
                        GTGGGAGAGCACCAGCGGCAGCTTCCAGTCCAACACCACCGGCTACATCGA
7   M19   BP2863-166                                        BP2863
                        CATTGCGCCATGTTCCGCAACGGCTACTTCGAACTGCTGGGACTGGTGGAG
7   M21   BP2864-581                                        BP2864
                        TGACCGAGCTGGGAGCCGATCACGTGATCGACTACAAGCAGGAAGACTTCAT
7   M23   BP2865-41                                         BP2865
                        TCGAGGCCATCTTCGCCCGTTCCCGGTTCATCAGCGCGATGAACCTGGAGA
7   O01   BP2867-671                                        BP2867
                        TGCTGCGCGAGATCGACATCGACCTGCCTTTCCCGCGGACCGAGGAAACGC
7   O03   BP2868-131                                        BP2868
                        CGGCGCTGTACCGCGGCTATGTGCAGGGCGATTTCTGGGGAGATTTCGGCT
7   O05   BP2869-436                                        BP2869
                        GCGCGCGACCACTGGGACGAGCAGGACGTCGAGGCGATATTCCGCAAGCTG
7   O07   BP2870-676                                        BP2870
                        CATCGCTTCATCGAGGCGCTGGGACGGCACGAAGTGACGTGGATCACCTCG
7   O09   BP2871-276                                        BP2871
                        GCCGGTGCATGGCCATTTCACCTGGTGCGCCTACGCCGTGCTGCGCGGCGC
7   O11   BP2872-41                                         BP2872
                        AGAACGCGGAGACGCCGATCCAGTCCATTGCGGACCAGGTCAGCCTATCGA
7   O13   BP2873-286                                        BP2873
                        TACATGAGCTCGATCAACACGCACGCCATCAATCCGGGCCTGTACCAGAACC
7   O15   BP2874-386                                        BP2874
                        CGTTTCGCAAGTATGTGTTCGCCAAGGGCTATATCGCCGTCAACGGCGCCAG
7   O17   BP2875-911                                        BP2875
                        TCGCGCAAGCGGGCGCGCTGTCGATGCGCCTGATTTCCTGGGAGCACCACT
7   O19   BP2878-751                                        BP2878
                        GTCACGCCCTTCGACCTGAGCGTGGACCAGAGCGACTACACCTATTACTTCG
7   O21   BP2879-1091                                       BP2879
                        GCTGGACGATGCACCTGGCGTGCGTGGCGATCGCGTGCCTGCTGATCCAGC
7   O23   BP2880-281                                        BP2880
                        CTTGCCCGATGTGCCTGGCGGCCATGCGCATGAGCGGCGTGGCGCGCGCG
7   A02
7   A04                                                   BP2881
          BP2881-361 GACCTGAAAAGCACCAACCGCTACGGCGGCACGGCGCTCATTCCGGCCTGC
7   A06   BP2882-71                                       BP2882
                      AACACCTGCACCTGACCCAGTCCACGGTCAGCCAGCACGTGATCCGCCTGG
7   A08                                                   BP2885
          BP2885-581 ACGAGCATCACAAGCAGCACCTGTTTCGCAAGTTCACCACGGTGATCCGCGC
7   A10                                                   BP2886
          BP2886-601 GATACCGATGGTCCGCTGACCCAGGTGCGCGATCCCTCGGTGCGCAGCGAG
7   A12                                                   BP2887
          BP2887-166 ATCCGGGCGCGCGTGATCTACAACGCGCCGATCAACGGCACCACGACGTAC
7   A14                                                   BP2888
          BP2888-391 GGCCACGTCAGCGAGGCAACCGCCAACACCCTTACCGGCCTGCACCAGGCC
7   A16   BP2889-81                                       BP2889
                      CGCCAAGCCCCAGGACGCGATCAAATACCGCCAATCGGCCCTCACGCTGAT
7   A18                                                   BP2890
          BP2890-356 TCATCCATTTCGCGTGCACCTCCGAAGACATCAACAATACTTCGCATGCGCTC
7   A20   BP2891-91                                       BP2891
                      GAGAACGTCTGGTCGCCTGATTCGCAGGTACAGAAGTACAACCCGCTGGGC
7   A22                                                   BP2892
          BP2892-181 ATCCTGTTCACCTCGGTGTCCAGCGTGCGGGCCCACCAGAAGCGCGGCACG
7   A24                                                   BP2893
          BP2893-601 TCGACCGGCATCTGCTTCATCGGCGAGCGGCCGTTCCGCGAGTTCCTCAAT
7   C02                                                   BP2894
          BP2894-791 GCCAGGGGTACTACCTGTGCTATCCGGAGCAGAAGGCCAGCTCGCCGACCT
7   C04                                                   BP2895
          BP2895-876 CCTGGGTGCCGCGCCCGTGGCCAACACGCCCGCCGAATACGCCAAGCAGAT
7   C06                                                   BP2896
          BP2896-461 CAGTCCTGGACCAGGCACATGCCCGCTTTGGCAAGGTCTGGCACATCAATTG
7   C08   BP2897-46                                       BP2897
                      GTCGCGGCAACGCCAGAGACCGTCAAGAAGTACATAGGCGGCAAACACAGC
7   C10                                                   BP2900
          BP2900-791 CCCGCCATGCCTGCCTGAGCGTCAATACGCTGCAGCGTCATTTTCGCGCCG
7   C12                                                   BP2901
          BP2901-1826 CCTACATGATCCAGTCCAAGGAAAAGGCTACCGGCGAACCCTTGAGCGTGAT
7   C14                                                   BP2902
          BP2902-626 GTCCATCCTTGTGGTGGCATGCGCCTTACATGATGCGGCGCGCGTCCGACG
7   C16                                                   BP2903
          BP2903-211 CACCTGGACCGCTGCCTGACCTGCCGCAATTGCGAAACGACCTGTCCATCG
7   C18                                                   BP2904
          BP2904-391 GATTCGCAGGGCCATATCCTGGCGTTTGGCGGGGAAGTCATGAAGAACGTG
7   C20                                                   BP2905
          BP2905-1276 ACCGTGACCGGAGAGCACGGTGTGGGTATGGAGAAAATAAATCAAATGTGCG
7   C22                                                   BP2906
          BP2906-1216 ACCATTAATCACAATTTGGTCCGTCGCGCGATTGCCGCCGACGGCACCTGCA
7   C24                                                   BP2907
          BP2907-11151GCAGCCGGACATGGATCTCGCACAGGCTGCGCCAGGCTCCGAAATCAGGCT
7   E02   BP2908-71                                       BP2908
                      GCGAGTTTCCGTGCTCGAAGGATGTTTCTGAAATCGTCTACGCCGCCCGCCA
7   E04                                                   BP2909
          BP2909-111 CACGCACAAGGTCGATTACGCCGATCTGTATTTCCAGTACACCCGCAGCGAA
7   E06                                                   BP2910
          BP2910-136 CGGCTGGTTGCGTTGCCCGAATATTTCTGTTTTATGGGGCATACCGATACCG
7   E08   BP2911-76                                       BP2911
                      GCCCTGCATACACGGCGCCGCAAGCCCGTGATCGCGTCGATCGTCAAGTCG
7   E10                                                   BP2913
          BP2913-691 CCGGTGCGGGTGTTCTACTGGGTGGAGGGCAAGTTCGGCTATGCCCTGTCG
7   E12                                                   BP2914
          BP2914-126 GAGCCGGTTTTCGCGCTGGCAGCGGCGCGGGGAGTTGCGCGCCTGGATGT
7   E14                                                   BP2915
          BP2915-121 CTGTATACGTTCGACAAGGACGCCGGCGGCAAGAGCGTCTGCAATGACCAA
7   E16   BP2916-76                                       BP2916
                      CTGTCCACCCGTTTCGATTTCAAGGGCACCAATGCCAGCTTCGAACTGGAGG
7   E18                                                   BP2917
          BP2917-146 GCCGGTTCCTGCGCGCCACCCAGTATGCGGTGCTGATCGTCCTGGCCACCG
7   E20   BP2918-71                                       BP2918
                      TGGGCTATGCGTTCAATCCGCAGTTCACCGACGAGAACGCCACCTGCATGAT
7   E22   BP2919-366                                        BP2919
                        CGCGCCGATACGCGGCATTACGCTGATATGGCCGGCCGACGGCAAGGTCAC
7   E24   BP2920-946                                        BP2920
                        ACGGCACTGATTTTCCTGCCCGGCGCGCTCTTGCTCGTGGGCGCGCTGCCC
7   G02   BP2921-811                                        BP2921
                        ACCTGGATATTCAGCGGCCTGATGTCGATGAATCCGTGGCAGGTCTTCGGCA
7   G04   BP2922-2006                                       BP2922
                        CCAATACGGTGTGGGCGCCGGCCTATACCGTGTTCGACGCGGCGCTGTCGC
7   G06   BP2923-306                                        BP2923
                        GCTGCCGGTGATGCCGCGCGTGCAGCCCTTGCCGGCGCGCGCGATTTCCTA
7   G08   BP2924-161                                        BP2924
                        GCACCTCGAAGGTCGACTACCAAGGCAATGCCTGGAAGCAGGTTCCGAAAG
7   G10   BP2925-721                                        BP2925
                        GTGGACGAAGCGGTCTGGGATCTGTACGAATACACCCTGGCCCTGACCGGA
7   G12   BP2926-91                                         BP2926
                        GCGCAACGCTACGCCATCTACCGCAACAACGTCGTGGCCTCGCTGATCCAG
7   G14   BP2927-341                                        BP2927
                        TGCTGATGACCCTGGTCATCCAGGTATTCGTGTATCCGGACGCCTACGCCAC
7   G16   BP2928-131                                        BP2928
                        GCCTGGGCTTTTCCGAACAGACCCTGCAATGGGTGGTCAGCGCCTATACGG
7   G18   BP2929-106                                        BP2929
                        GGGGAATGCTCGTGCAGCGCCGTGCTGCAAGGCATCCCCAAATCGACGCTG
7   G20   BP2930-166                                        BP2930
                        CTGTGCGTGGCCCAGCTGCTGGTGCAGCTGGTGTTCTTCCTGCACATGGGC
7   G22   BP2931-41                                         BP2931
                        ATCACGGTCACCACGACGATGGATCCAAGACCGTCCTCGGTTTCTGGATCTA
7   G24   BP2932-96                                         BP2932
                        GGGGGCGGTCACTTACTTCGGTAAGTGGAAATACCTGTGGACCGAATGGTTT
7   I02   BP2933-786                                        BP2933
                        GACCCTGTACTCGACCGCGCCCACGGGCATGTTCGATTTCATTATGCATAAC
7   I04   BP2934-356                                        BP2934
                        TGCTGAAGGCAGAAAGCGTTACGATTGAGTCCACCATGACGCCGTTGCACCG
7   I06   BP2935-706                                        BP2935
                        GACACGCTGCAGCAATTATTGACCCTGTGCCGGGAACGTATCCGCAATCTGG
7   I08   BP2936-476                                        BP2936
                        GGATGAGCGAATTGCTGGCGCTGGACTACAGCGCCTGCCCCGGCGTGCAAC
7   I10   BP2937-51                                         BP2937
                        TGACGGCTTCCCTGTCCGCTCGCTGTTTTCGTACCACAGCCTGGGCCGTGAG
7   I12   BP2939-161                                        BP2939
                        ATGCGCACGAACTGGGCGAAGGGGTCGAACTGGGCCTGTCGCTGGCGGTC
7   I14   BP2940-801                                        BP2940
                        GCGGCTGTACGCGATGCTGTTCGGCCTGTATACGGCGGCCTATTTTTCCATC
7   I16   BP2941-936                                        BP2941
                        TGCATGGTGCGCCTTGCTCGAGGGTTCGGATGTCTGCTTCGCGCCGGTCCT
7   I18   BP2942-471                                        BP2942
                        GCTGATCGACCTGGAGCAGGACCATTTCATCCTCGCGGTGCCGGCCGACCA
7   I20   BP2943-716                                        BP2943
                        CCGACGTGCCGACCCTGGCCGAAACCGTGATTCCGAAATTCGCGGCGACCA
7   I22   BP2944-266                                        BP2944
                        TCCTGAACGCCGAGCTGGACATCAAGGGGCCGACGTTCGTCGGCGATACCC
7   I24   BP2946-581                                        BP2946
                        AGTGTTGCCTGCAGCATGGTTGGGTAGAGCAGCAGCTGGATTCGCGCGCCT
7   K02   BP2948-876                                        BP2948
                        CCAGGAAATCAACGAAGTGCACGTGGAAGCGGGGGCCGGATTGTCAGGCGC
7   K04   BP2949-196                                        BP2949
                        TGCCGGCAACGCGATATCCCCGTACTGCAAGTGTTCCATGTCAACGCCGCCA
7   K06   BP2951-351                                        BP2951
                        GCGCCTGGACAAGGTGGCCTACGTACGCTATGCCTCGGTCTACAAGAGCTT
7   K08   BP2952-41                                         BP2952
                        ACGTCTGGGCCGCCATCCAGAAAGAAGACGTACGCCAGGAACAGCACATCG
7   K10   BP2953-466                                        BP2953
                        CGCGTGCACCATTATGTGTTCACGCTGTACGCGCTGGATGTCCCCTCGCTGA
7   K12   BP2954-236                                        BP2954
                        ACGTCATTTTCCTGATCGGCGATTTCACCTCGACGATCGGCGACCCCAGCGG
7   K14   BP2956-931                                        BP2956
                        ACCTTCGGCATGCGCATGCATCCCATCCACAAGACCTGGACCGGCCACAAGG
7   K16   BP2957-741                                        BP2957
                        CAAATCGACCGGACGCGACCTGTTCAACCTGGATTGGCTGCTGGCACGGCT
7   K18   BP2958-121                                        BP2958
                        AAGCTGCGCGTGTTCGTGCAAGGCGGCGGCTGTTCCGGCTTCCAGTACGGC
7   K20   BP2959-391                                        BP2959
                        GATATCCGCGGCGTGGCCTTTGAGCGTGAAGGCCAGGGCCTGCGCTACAAG
7   K22   BP2960-321                                        BP2960
                        TTTCCGCCTGCAGGACACGGCCGTGTTCGAGCGCTGGTACAAGATTCCGCA
7   K24   BP2961-41                                         BP2961
                        CCTCGGTGGCTCGTGTTTTCATCAAGAAGGGTTCGGGCAAGATCGTCGTCAA
7   M02   BP2962-101                                        BP2962
                        ACCGTCTGCGTGGCAAGCACAAACCCGAATTCACGCCGCACGTTGATACCGG
7   M04   BP2963-401                                        BP2963
                        TGAAGCTGACCCGCGAAATGTTCAAGCCGCTGAAGATCGTCAACTTCCCGAT
7   M06   BP2964-116                                        BP2964
                        AAGTCTCCGAAAGCCTGGGGCTGTCGGTTTCCGTGCGCAAGAACGATATCG
7   M08   BP2965-91                                         BP2965
                        GTCGGCGAAGAAAATTTCGACGATTCCGAATACGACCGCCCCAACAAATCCC
7   M10   BP2966-311                                        BP2966
                        AGAACGAGCGCGGCATTCCCGCCTCGAAGATCGTGCTGGCCGGCTTTTCGC
7   M12   BP2969-101                                        BP2969
                        AGGCCCTGTCCAAGGTGTCGTTCTCGCTCGCGCCAGGCGAATTCGTCAGCC
7   M14   BP2970-336                                        BP2970
                        GTGGTGGTCGGACTTTCTCTACAAGGTGATCGATCCCTTCCTGGTCGTGGCC
7   M16   BP2971-251                                        BP2971
                        ACTCGTTCTGGTCGCACCACCATGGCGTGATGCTGACGCCCGAACGCAGCA
7   M18   BP2972-51                                         BP2972
                        GCGTTTCTATACCGACGTGCTGGGGTTCACCAAGAAGCACGACATCCCGGCC
7   M20   BP2973-1126                                       BP2973
                        AAGTCCGACCGCCCCTTGCGCGCGCCCATGATCACCCTGTGCATCCAGGGC
7   M22   BP2974-51                                         BP2974
                        CGTGGTCGTCATCGTGATCACGATGATCTTTCGCGCCAACGTCGTCGTTCCA
7   M24   BP2975-56                                         BP2975
                        GCAAACGCATCCTGAGTGGCGCCTATGCCCAGGGCGAACGCCTGGTCGAGG
7   O02   BP2977-1741                                       BP2977
                        ATGGTGTCCGAACTGCCCGATATCGAGTCGGTGGATATCGATCCCCTGTACG
7   O04   BP2978-866                                        BP2978
                        ACACCCGCCACCTGTCGAAGTCGGCCTCGCAATGGGACCCGAAGAAGCTGA
7   O06   BP2979-121                                         BP2979
                        ACGACGGGGCAGGCCGCCTACGCGGTGACCGCGTTCGCCATCGCGTATGG
7   O08   BP2980-251                                         BP2980
                        CGGTGCTGTCCGCCGACGGAACGATGCGTTATGAAACGCAACTGAAAGTTGG
7   O10   BP2981-261                                         BP2981
                        CGATGCGCCGGAAATCCTCGAATGCTATGCCGTGACCGGCGATTCGGATTTC
7   O12   BP2983-2371                                        BP2983
                        GAACCCACTTTCCAGAACTTGTACGTCAAATCGAATCTCTCCGGCGAGTTCAC
7   O14   BP2984-1081                                        BP2984
                        CAGGAAGAAAACCCCTTCCCGTGGATGGCGGAAATGATCGACCTTAAGAAGG
7   O16   BP2985-46                                          BP2985
                        GCAGCGAAGAAGGCTGCCGCCAAGAAGGCCACTCCGGCCAAGAAAGCTGCG
7   O18   BP2986-331                                         BP2986
                        ATGGTCCTGAAATGGACCCTGAACCTGATGGTGTGGATGACGCTGATCCAGG
7   O20   BP2987-1351                                        BP2987
                        TATATGGTGCCGTCCGAACTGGTGGCCTGTCCGGATTTGCCCGTATCGAACA
7   O22   BP2988-626                                         BP2988
                        ACGCCAGCCTCTACAGTTTCTACCTGTTCTTCGATTTTGCCGGGTACAGCAG
7   O24   BP2989-56                                          BP2989
                        TGCTGCAGGCGCAGCCCACCACGGGCAGCGGCGGACCGATCAAGGTCGAG
7   B02
7   B04   BP2990-241                                         BP2990
                        TATCGATTCTTTCCGCAGGAACTGAAGGTGCCGACCCTGGCGTACGGCCATG
7   B06   BP2991-46                                          BP2991
                        GAGTCGATCATCCTCAAGAAAGTCACCCCCGACACTGCCCTGATCTCTTCCG
7   B08   BP2992-341                                         BP2992
                        CCATCGAGAACCGCGCGGGCAAGTCCTCCGGCTACGAAATCACGGTGCGCC
7   B10   BP2993-56                                          BP2993
                        TCGAAGGCCGTTTCAAAGAACACATCCTTGCCGAGCGCATTCAATCATTGAG
7   B12   BP2994-521                                         BP2994
                        GCGAAGTCCGTACGCGCTATTCCAACGCCGTCGACAGCGGCCGTACGCCGC
7   B14   BP2996-986                                         BP2996
                        AGTTCAAGGGCCATGCCCTGGAATGCCGGATCAACGCCGAGGATCCGTTCC
7   B16   BP2997-321                                         BP2997
                        GCTGTGCATCATCGAGGCGATGAAGCTGCTCAACGAGATCGAAGCCGACAAG
7   B18   BP2998-281                                         BP2998
                        TGGCCATACCGTTTATTGAAGTACATTTGTCCAACCTGTATAAGCGCGATTCA
7   B20   BP2999-281                                         BP2999
                        AAATGCCCGAACTGGACGCCCTGCAGAAAAAATATCCGCAGGTACGGTTTGT
7   B22   BP3000-561                                         BP3000
                        GGAATACGATCACGCCGACATCTTCCCCGATCTGGCCGCCATCGAGACCCAG
7   B24   BP3001-321                                         BP3001
                        CGGCGAACATCGCATGTATCATTCCGACGCGCCGTTCCACTTCCTGCCCGAG
7   D02   BP3002-1641                                        BP3002
                        GGCTGATTTCCAGAACGCCATGGAGCGCTATTGGTGCATGCGCTGGCTCAAG
7   D04   BP3003-491                                         BP3003
                        AGAACGCCCAGATCGCCACGCTGGCCAACCGCGTGCAAGCCTACAACGCCC
7   D06   BP3004-271                                         BP3004
                        GCTGTCAATACCTTGTCGTGGCGCGACGGCGCCTGGCACGGCTGCAATACC
7   D08   BP3006-116                                         BP3006
                        TATGGAATGAGGGCGGCAACGACCTCTACCTGACCGGCTACTCGTGGCACA
7   D10   BP3007-506                                         BP3007
                        TGGGGCGTTCGGGCGCATGCCTGGATTACGTGCGGGAAACCCATCGGGCG
7   D12   BP3008-356                                         BP3008
                        CGTACGACCGGTTCTACCGGCGTCTCATCGAAGCGGTCGACTTGCTGGACG
7   D14   BP3009-381                                         BP3009
                        GCTGCCGATTTCGTTCGACTTCCACCAGGATGGCACGCTACAGCTGTTTCGC
7   D16   BP3010-326                                         BP3010
                        TGGACGCGATGATGCTGGGACCCATCGACATGATCCGCCGGGTGGTCGATG
7   D18   BP3011-66                                          BP3011
                        GCGCACGCCACCGCTTGTATCCGTCCCTATTTCACCCAGCCTGCAGAATTTG
7   D20   BP3012-331                                         BP3012
                        GGCAACACCCTGCTGGTCAGCTTCGACAATCATGCGATCAACCCGGCGGTC
7   D22   BP3013-371                                         BP3013
                        GCTTCCATACCGTGCGTTTCGCCGAGCAGCCCATCCCGGGAATCCGGATGT
7   D24   BP3014-56                                          BP3014
                        AATATCGCAAGCAGGTAGCTCAGATTAATAGCCTGGAGCCCAAGATTTCGGC
7   F02   BP3015-506                                         BP3015
                        ACCTCAGTTCATCGTATGGCTGGCGCCGCAACCCGGTGACGGGCCGCTACG
7   F04   BP3016-196                                         BP3016
                        CTGACAGGTCAAGGTTGGAACGTAAACGAAATCAGCGTCCGGGTGCAAGCC
7   F06   BP3017-381                                         BP3017
                        CTTCATCCGCGTGTTGAAGCCCATCGAGGTGCGCGAAGGCGAGGGCCGCAA
7   F08   BP3018-811                                         BP3018
                        AAGATGCGCGAAACGCGCGAAATCATGGAAACGATCCGCAGCTACGCTTCGG
7   F10   BP3019-211                                         BP3019
                        GCCGACTGCAAGATCCGCGACGTGTACGCCGGCATCGCCGGCAGCCATATC
7   F12   BP3020-96                                          BP3020
                        GCAGCGTCCCTATTTCACGTTGGCGGCCATCGAGATCGAGTCCATGCCCGA
7   F14   BP3021-406                                         BP3021
                        CCGCTGATACTCAAGCCGCCGCACGAGGGCTCGACCGTCGGCATCACCAAG
7   F16   BP3022-626                                         BP3022
                        TCTATGGCAGCGCCATTCTTTGCGCCGACGACGCCAACGTGCGCGAGATCA
7   F18   BP3023-306                                         BP3023
                        CTATGTGGCTTTCCCGGGCGGCGTCATGGCAGCGCTGCGCCGCACGCCGC
7   F20   BP3024-121                                         BP3024
                        TTGATGGTGTATTCGGCTTCCATCGCGTTGGCCGACGGGCCGCGCTACGCC
7   F22   BP3025-536                                         BP3025
                        ACCAGGATGATCTGCCTCAGGTGTGGGTGCTGGAACTCTCCAGCTTCCAGCT
7   F24   BP3026-881                                         BP3026
                        TCGTGCGCCAGGAAATCGTGCTCTTCATCATGGGTGGCGTGTTCGTGGTCG
7   H02   BP3027-2716                                        BP3027
                        GGCCTGCGCCCGTCCAGCATTTTGATCAAGGGTTCGCGCTTTATGCGCATGG
7   H04   BP3028-1491                                        BP3028
                        CGGAAAGTACAGCGCTCAGCGCCACCGCAGCTCGTTCGTGGGTTTTGCGCC
7   H06   BP3029-86                                          BP3029
                        TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
7   H08   BP3030-491                                         BP3030
                        CCAGCGTGGATGAGATGCGGGAGGTCATAGCAGATTATGGCGAAGAACGGT
7   H10   BP3031-106                                         BP3031
                        CTGACCCGTCATCCCGATGGCTGCCTGTTGGTGTATCCGCGTCCCGAGTGG
7   H12   BP3034-226                                         BP3034
                        CAGGAACCCGCACTGGATGAAACCGGCACGGTGTTCGACGTCGTGTGCGAC
7   H14   BP3035-806                                        BP3035
                        GCCTGAAGGAACATGCCTGTGGTTGCGCGGGCTGCTATACGGCCCTGCATG
7   H16   BP3036-341                                        BP3036
                        TGCTGATCGGGGCGGCGAAGTATCTTGCGCAAACCCGCAATTTCGATGGCA
7   H18   BP3037-86                                         BP3037
                        CTGTCATCGGCTCGGAAGCCGTGCCGCGTACCGAGGTCACCAAGAAGATCT
7   H20   BP3039-376                                        BP3039
                        GCGCACTTCTCCCGGTTCGCCATGGACACCCTGATGCAGCATCCGGCCGTG
7   H22   BP3040-656                                        BP3040
                        CCATGACCTCGCCCTGCGGCAATATCCGTATCCCGATCAACGAGGAAGGCAC
7   H24   BP3041-121                                        BP3041
                        TATGCCGGCGGCCACGTCGAGCATCCCACCTACGAACAAGTCTGCGGCAAG
7   J02   BP3042-91                                         BP3042
                        GCGCGCAACAAGAACTGTATGGCCTGCCATCAGGTCGACAGCAAGCGGGTG
7   J04   BP3043-1146                                       BP3043
                        ACTCAAGGGCAATCTTTCGCCGGAAGGCTGCGTGGCCAAGATCACCGGGTT
7   J06   BP3044-571                                        BP3044
                        TGGTGGTATTCGAGCAAGCCCCGCGCGGCGGGGCAGGTAAGCGCCATGTTC
7   J08   BP3047-196                                        BP3047
                        ATGAAGGCGCCGGATGGTCCGCTGGGTGGTTTGGCGGTGGGCGACTTCAAG
7   J10   BP3048-46                                         BP3048
                        GAGGCCCGTTCGGTTCCCGGATGGTTTACGATAGCGCCCATGCTGCAAGAC
7   J12   BP3050-66                                         BP3050
                        TTCCTGGCAAGCCAGCAGCTACCAAATGGGTACTGCCGCCCGCATGGGGCC
7   J14   BP3051-1166                                       BP3051
                        GCATCCTGTTCCCGGCCATCCTGGTGTTCTGCACCATCGGCGTGTACTCGTT
7   J16   BP3052-851                                        BP3052
                        AACATCCGGATACCCAGCACATCCTGATCGAAGCCATGAAGCTGGCGTTTGC
7   J18   BP3053-596                                        BP3053
                        GCGCCGCGCAAAGCTGGCAGATGGAAAACCGCGGCGCCACGATGGTGGAC
7   J20   BP3056-391                                        BP3056
                        CTGCTGCTCAATACCTCGCTGACGGTGGAAGACGGCCAGCCCGGCTCGCAT
7   J22   BP3057-41                                         BP3057
                        CTTTCGAAGACTTGGGCTTGGCGCCCACTATTCTCTCGGCCCTGAGCGAGGC
7   J24   BP3058-476                                        BP3058
                        ACCTGATCGTGGAAGTCTCGGCCGATCTGCGGCAACGACAGCAGTCCCGCC
7   L02   BP3059-196                                        BP3059
                        AAAGAGGAATACGCGCTGGCGCGCACCGAACGCAAGTCGGGACGCGGCTAC
7   L04   BP3060-1936                                       BP3060
                        TACGTCAAGAACGTCATGTCCAACGCCGTGTACTACGCCGCCATGTTCAGCG
7   L06   BP3061-191                                        BP3061
                        CCTTCTGGCCCATGGAAGACGAACCCGACCTGCTGCCCCTGCTGGAGCAAT
7   L08   BP3062-101                                        BP3062
                        CCATGATCGAGTGGTACGACTTCTATATCTACGCCACGGCAGCCGCCCTGGT
7   L10   BP3063-586                                        BP3063
                        GGCCAGGGTATCCAGGAAATCTTCTACGAGCGCAGCGACGTGCTGTACGTG
7   L12   BP3064-311                                        BP3064
                        AGGACGATATCGCGGGCACCTTGCGGCTGCTGGTGATGAGCAAGATCCAGA
7   L14   BP3066-391                                        BP3066
                        GACTGGTTCCATATCGAGGTGGCCGCCTACCCCGAGATGCATCCGCAAGCC
7   L16   BP3067-171                                        BP3067
                        CACCATAGTCACGCTCGGCCTGTTTCTGATCATTCTCAACGCCCTGTTGTTCT
7   L18   BP3068-651                                        BP3068
                        CGCCATCAACGTCAATGACTCGGTCACCAAGTCGAAGTTCGACAACCTGTAC
7   L20   BP3069-286                                        BP3069
                        GGCTGGCGCTTCACCACTTCGTTCCACACGATGTTTCCCGACTACCTGCAGG
7   L22   BP3070-111                                        BP3070
                        CACCCTGTTCGACGATATCTGCCGCGGCTGCGGCCGCACGGCGATGGAAGT
7   L24   BP3071-376                                        BP3071
                        CTGATGTTCGGCTATGCATGCGACGAGACCCCCGACCTGATGCCGGCGCCG
7   N02   BP3072-176                                        BP3072
                        GCGAAATCGGGGCCATGATCCTGGAAATGCCCAAGGTGTGGTTTCGCAACG
7   N04   BP3073-476                                        BP3073
                        GCTTCAACGAAGTATTCCTGGTCAGCCGCAAGGACGGCGTACGCGACCTGG
7   N06   BP3074-206                                        BP3074
                        GCATTTTCAACGCCGACGGCAGCGAAGTCGAACACTGCGGCAACGGCGCGC
7   N08   BP3075-196                                        BP3075
                        TGGCGCCTGAGTGAACTGATCCGCAACGCCAACAGCAACGAAACCATCGGC
7   N10   BP3076-871                                        BP3076
                        GGCCATGCCAACATATCGACCACCCAGGTCTACACGCGGCTGGATTTCCAGC
7   N12   BP3077-2021                                       BP3077
                        AGATCTACCTGCGCGGCAACAACCTGCTGAACAAGCTGGCGTTCAACCATGC
7   N14   BP3078-211                                        BP3078
                        TCGTTCGCGTATGGCGTCTTCCATGCGCTGGGCCCCGGCCACGGCAAGGCG
7   N16   BP3079-146                                        BP3079
                        ACGTGCTGCGGACCATGGCCGAGGACTGGATGAAGGCGCTGGGCGAGCCG
7   N18   BP3080-401                                        BP3080
                        ATCATGGCGACCTTGACCCGCACGCGTGGCAGGACCTGGCCAATGGCGCGA
7   N20   BP3081-266                                        BP3081
                        TGGTGGCGCGCCTGACGCCGCTGCGGGAGGACGCCAGTTTCGCGTCCTTCT
7   N22   BP3082-541                                        BP3082
                        GAGCAGCATGCCGAAGGCCGCACCGTCATCGCCGTGCTGCACGATCTCGAC
7   N24   BP3083-371                                        BP3083
                        ACATGAGCCGGCAATTGGCCGAGCGCGTGGCCCGCACCGGCTTCGCACTGG
7   P02   BP3084-971                                        BP3084
                        TCCAGGGTGTGCACATGATGATGGGCGCCGAACCCGGCAAAGCATGGACCG
7   P04   BP3085-91                                         BP3085
                        CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
7   P06   BP3086-166                                        BP3086
                        ACCGCCGATGCCTTCACGCTGCAGGAACGTTTCGAAGCCAAGCTGGAAAAAC
7   P08   BP3087-1031                                       BP3087
                        TCCTGTCCGAGACGGACGCTTCGCTGATCAAGCAATACACCGCCCTGCTCGG
7   P10   BP3088-191                                        BP3088
                        CGCTGGTCTATCAGATAGATCCTGCGCTGCTGGCCGGCATCAAGCCGGGCG
7   P12   BP3090-176                                        BP3090
                        ACGCCGACCTGTCGACCATCCAGCACGACCTGTTCGACATGGGCGCCGAGC
7   P14   BP3092-441                                        BP3092
                        GCATCCCAACGCCGAAGTGCGGCTGTTCAATCCGTTTCCCACGCGCTCGTTC
7   P16   BP3093-231                                        BP3093
                        GCGCCGCGCCGTACCCACGCACAAGCGCGCGCTGGGCTATGTATTCCAGGA
7   P18   BP3094-491                                        BP3094
                        TCGGCGTGGTGCTGATGATAGGCGGCAACATCCCGGGCAAGACCCGTGTCG
7   P20   BP3095-511                                        BP3095
                        GCGTACCAGTTCGTCGCCAGCAGCAATGCCGAGCTGGGCTTCGTGGCCCTC
7   P22   BP3096-216                                       BP3096
                        CACGGAATCGCCGGCACGGGACGCCTACGCCTATACGTTCGACAACATCAC
7   P24   BP3097-471                                       BP3097
                        GGTTTTCCTGGATGTCACCAAGTCGCACCGCCGGCGCTGGTGCAGCATGGC
7   B01
7   B03   BP3098-1                                           BP3098
                        ATGAAGCAGTTTGCCGTTACCTTGTTGGCCCTGTTCGGCGTCGACGCCCAGG
7   B05   BP3099-1                                           BP3099
                        ATGAGAACCTTCACGTCCGCCGCCCTGCTCGCCGCCGCCCTGTTCGGCTTC
7   B07   BP3100-251                                         BP3100
                        TGCTGTTCAGCGCCGACGCCGTGCCCCTGTCGGGCAACGCGCTGATGCAAT
7   B09   BP3102-346                                         BP3102
                        TTCGACCGCGTGCTGCGCGACCTGCGCAGCATCGACGGCGTGGCCAACTCG
7   B11   BP3105-556                                         BP3105
                        CTGTCCCAGGTCTACGCCAACGGGAAACTCCAGCGCGGGTCGGCATGGCTG
7   B13   BP3106-361                                         BP3106
                        CCGTTCGACTTCAAGCAGGCCTTCGAGCCGGTGACCCAGCTGGTGGAACTG
7   B15   BP3107-1466                                        BP3107
                        CGCTGTTCGGCATGGATCCGCAGACGGCGATCGAAGCGCCGCGTTTCATTT
7   B17   BP3108-131                                         BP3108
                        CCGGCATCTGGGAATGCCAGCCGGGCCTTTTCCGCCGCACCATCATGCAGC
7   B19   BP3109-856                                         BP3109
                        GAACTGGGCTGGCGCGGCAACGAAGCGATCACCGACTCGCAATTGCTGGTG
7   B21   BP3110-651                                         BP3110
                        CTCGCACGAAGGCGAAGAATTCATCCATGTGCTGCATGGGCGCTTCCATATC
7   B23   BP3115-596                                         BP3115
                        ACATCGCTAGCGTGATCGGACATTTGGAGAAGGTAGCACCTGCCCAGATGGC
7   D01   BP3116-861                                         BP3116
                        CTGCGTGAGTACGATTGTTTTTGCAAAAACATCAAGCTCCACGGGTGATTTTA
7   D03   BP3117-266                                         BP3117
                        AAGTGGATGCCTGGCGTAAGCTACCCCCGTCGCAGTGGCGCGTCACCCCTG
7   D05   BP3118-161                                         BP3118
                        CCACCGAGTCGTCCAACCGGCTGGAAGGTGTTGTCGTAGCGCCTTCGCGGC
7   D07   BP3120-361                                         BP3120
                        CCGATGAGCGACATTGGGGTCAAACAGATTCGTCCGCTGCTGGAAGAGTGC
7   D09   BP3121-746                                         BP3121
                        AGGAAGACCGCCAGGCCTTCCTGTCGGACATGGGCATGGAAGAACCCGGCC
7   D11   BP3122-491                                         BP3122
                        TGGCCGGCTGGGACACCAGCTGGCGCCGCTACTACAGCTACCGTTTCGGGC
7   D13   BP3123-126                                         BP3123
                        GCTGGAGAAAGGGTTCTTCGGCATGCTCGCCAAGGCGCGCCACGCGGGCG
7   D15   BP3124-221                                         BP3124
                        AAGAAGTGCTGCTGCGTTCGGTTCAATGGCACGCCTACAAGCCGCAAGTCAT
7   D17   BP3125-176                                         BP3125
                        AGCCCACCTGTGCGCCCACGAACGACAACCTGATGGAAATCATGGTGATGG
7   D19   BP3126-711                                         BP3126
                        GTCGGGATCTGGGGCGTGTCTTTTCGCCGAATTTCCCACCCTGCCGGAAGC
7   D21   BP3127-201                                         BP3127
                        TTTCGCGTGGCGCGACGATGGCGGCAGCTATCTGCTGGACCTGACCAATCC
7   D23   BP3128-196                                         BP3128
                        CCGAGCAAGCAGCCCGAGACCGAAGTCATCCGCCTGCGGCCGGGGCAACTG
7   F01   BP3129-146                                         BP3129
                        CCGTGCTCGAATGCGGGCGGCGCGGCAAATACCTGCTGCTGCGCTTCGACC
7   F03   BP3130-776                                         BP3130
                        AGACGATTTACCGCGAGGTCTACGATTTCATGAAGCCGCGCTACAGCCAGTG
7   F05   BP3131-831                                         BP3131
                        GGACGCCGACTTCGAACTGGAGTGGGTGAGCGTCTACACCTTCGCCTGCGA
7   F07   BP3132-56                                          BP3132
                        TGATCGACACGCACCGCGACCTCAGCGACGAACAGAGCCGCGAGCTGAACG
7   F09   BP3133-566                                         BP3133
                        TGAAGGCGTTCCGGGCCGCGCATCATCTGGTGGTGTCGCACGCCACCCCTT
7   F11   BP3134-1146                                        BP3134
                        GGCCCACTACATTCGCGATACCATGGCCTTCATGTTCGAGACGCGCCGCGTG
7   F13   BP3135-776                                         BP3135
                        GCCCCTTCCTGGCCAAGAACTTCGCCTCCACGATTTCGCCCTGGATCGTCAC
7   F15   BP3136-286                                         BP3136
                        AGCGCCACGGCATGGTGGTATCGCGTCTGGTGGATGCTGTTTGTGTTGCTG
7   F17   BP3137-636                                         BP3137
                        GAACCAGGTCGACCGTTCGATTGCGCGCGAGCGCGAGTTTTCGGTCAACGT
7   F19   BP3138-41                                          BP3138
                        TCGTCGAGGACGATCTCACCATCGCGGCCAACCTGTACGACTACCTGCAGG
7   F21   BP3139-736                                         BP3139
                        CTTACCGGTTTCGAACTGATGGCGGCCGATTGCCTGCAGGCCGTCACCCGG
7   F23   BP3140-496                                         BP3140
                        TTCCTGATGGACCGCATCGCATCGCCCGCCTTCTGCTCGGGCCTGACCGGC
7   H01   BP3141-296                                         BP3141
                        TGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGA
7   H03   BP3142-501                                         BP3142
                        GCATCATCTCGACCCGCACGATACGCTGATCATCGTGGCGTCCAAGTCGTTC
7   H05   BP3143-421                                         BP3143
                        TACCGGTTGGCGCTGGGTCATCGCAACAGCCGCATCGTGTTCCAGAACACC
7   H07   BP3144-481                                         BP3144
                        CATGGCTACGACGGCGCGCGCATGGTGGTGATCCCCAATGGCTATGACCTG
7   H09   BP3145-96                                          BP3145
                        GATCACGCTGATGCCCACCTACTCGTCCAAGGGCACTTGTTTTTATCCGCTG
7   H11   BP3146-1781                                        BP3146
                        TCGAGCCCGAGCCCATCCTGCGCAAATGGCGCGAACACCTGTCGGGGCACC
7   H13   BP3147-811                                         BP3147
                        TGCGCCGCCCTGTACGTGCTGACCTCGCGTTTCGAGGGATTGTCCAATACAT
7   H15   BP3148-1246                                        BP3148
                        GGCACCGCGGGGATCATGCTCGCCACCAGCCTGATGTATCTGCTGTCGTTC
7   H17   BP3149-956                                         BP3149
                        ACGAGCCGGCCTACGACATCCTGCGCGGGCTGGAAGCCGCCATGCCCTGG
7   H19   BP3150-1                                           BP3150
                        TTGCGCATTGATGATGTGAAACTGGCCGTTGTCGGCCTCGGATACGTGGGG
7   H21   BP3151-41                                          BP3151
                        GGGGACTCATCGTGGCGTCGGAGCGCTGGCATGGCGCGTTTACCGGCGATA
7   H23   BP3152-496                                         BP3152
                        ACCTTGCCGGTGCAGGACCAGCGCTCGCGCGACATCGTCCAGAAAATGAAG
7   J01   BP3153-216                                         BP3153
                        CGGCTGCAGCGTCAAGCTGCAGGCCGAACGCGCCGACGCCGATCCGAAGG
7   J03   BP3154-511                                         BP3154
                        GACCGCCGCATCCTGTTCCATGGCTGGAACTGGGCGCAGATCGAGGAAATG
7   J05   BP3155-96                                         BP3155
                        CGGCGACCTGGCGCACTTCAAGCGCACGACCCTCGGCCATCCCATCATCAT
7   J07   BP3156-286                                        BP3156
                        TCGCCGCCGCGGCTCAACGACAGTTGGCTGCTGTCCGATATCTATGCCGAC
7   J09   BP3157-46                                         BP3157
                        CCGTTTACCGCCAACCGGCAGTTCAAGTCCCAGCCGCGCCTGCTGGCCCGT
7   J11   BP3159-1226                                       BP3159
                        CCGCGCCGGCGCAAGGCGGCTGGAACATCCACAACACCAACTGGTACGCCA
7   J13   BP3160-46                                         BP3160
                        CTGATCATGGTGGCGGTCGTGGTCTTCGCGATCCTGCGCGCAAGCCCCGGC
7   J15   BP3161-771                                        BP3161
                        GTACTTCCGCATGCTGCCGGGCCTGATCCTGTTTCCCGGCCTGTTCCTGTCG
7   J17   BP3163-1301                                       BP3163
                        ACCCGCTGCAAAAGCGCTACGTGGCGTTGAAGTCACGCGTGCATTGGCGCG
7   J19   BP3166-361                                        BP3166
                        GCGACCTTCAGCCCCGAACTCTCGGACCTGACGCTTTACATCATCGACGTCG
7   J21   BP3168-1596                                       BP3168
                        CAACTGGCTGCCGGCGATCTCGGTCGACCCGCAGACCTACCAAGTCTATGC
7   J23   BP3169-96                                         BP3169
                        GCCGATCCAGGTGGGTTCGCACTATCACTTCGCCGAGGCGAACAACGCCCT
7   L01   BP3170-506                                        BP3170
                        TCGCGGGGTTTCGCCTCAAGCACTGGAACCTGTGGCTGTCGCGGGCGCTGG
7   L03   BP3171-86                                         BP3171
                        AGCTGAACTATCCGGAGACGGTGGCGCTGATCACGGCCGCGTTGATGGAAG
7   L05   BP3172-111                                        BP3172
                        GCAGCGGGCGCTGTATCCGGAAGGGCCGCAAGTCTGCCACGTCGCCATTCT
7   L07   BP3173-141                                        BP3173
                        GCATTTCATCCGCCGCACCCGCGACCTCGGCTGCTCGGTGGCCGAGAGCGG
7   L09   BP3175-136                                        BP3175
                        CCGGCGGATACGTTCGTGCTTCTGCAGGGAACGCCCAAAGAGTATTTGAAAA
7   L11   BP3176-256                                        BP3176
                        ACGGTGGACACGCACCGGGTGGCCTATTTCGAGCAGGATGCCTTCGCGCGC
7   L13   BP3177-691                                        BP3177
                        GCGGGCTACCGGCCCGACCTGCATTTCGATTTCCATTCCTCGCTGGGACGG
7   L15   BP3178-326                                        BP3178
                        GCAGCCACACCATGGGCCCCAATCTTTCCTCCAGGCTGCCCTGGGATCCGG
7   L17   BP3179-781                                        BP3179
                        CCCGGCGGACTCTTCCTCGGCGGACGTCTCTTCAAGTACCATGCATCCTGCT
7   L19   BP3180-846                                        BP3180
                        GGCGTTGACCCAACTGTCATTGTCGGGCCTGTGCTGCGTGCTCTCGCCACT
7   L21   BP3181-291                                        BP3181
                        GGCGTACGAGATCGTCATCAATTCCAGCCCATGTATTGCCTACCTGATGGAG
7   L23   BP3182-1146                                       BP3182
                        CCTGTGGGCCGAATACGAACAAGAGTCGGCGTCGCATTTCGTGATGCGGCG
7   N01   BP3188-391                                        BP3188
                        TATGGCCAGCAGGACGAGCGCGTCTGCATGGACACCATCGCCCAGTGCGAG
7   N03   BP3189-511                                        BP3189
                        ATCCCCGCCTCCTCCGGCGACACGCAGCGGCAGATCGAAACCATCTACCAG
7   N05   BP3190-571                                        BP3190
                        GCGATAGACGATATCGCGCATGCCCTGGCGGCCTACGCGCTGCGGGGCCTA
7   N07   BP3191-991                                        BP3191
                        GTGGTGGACAATACGGTACAGATCTGGGGCGGCCTGGGCTATTGCAAGCCC
7   N09   BP3192-826                                        BP3192
                        GAGAAATTCTTTTCGTTCGGCGGCTATGTCGACAAGATCGTGCTCGGCAGCG
7   N11   BP3193-611                                        BP3193
                        GCATGGTGGCGCCGCGCACGCCCATCCTCACCTCGATGGGCTTCGAGGAAG
7   N13   BP3194-536                                        BP3194
                        CCATGCTGGTCTCGCAGGTGCTGCAAACGCTGCAAACCCTGGCGCGTTCGG
7   N15   BP3195-446                                        BP3195
                        GCGTGCCGGCTGCCTGCCACGACCTGCATCCCAAGGAGATCTCCTATGGCA
7   N17   BP3196-586                                        BP3196
                        AAAGTGGCCGAAGAGAAATTCCCGTTCACGCAGGCCGACTTCCGGGTCGCC
7   N19   BP3198-41                                         BP3198
                        ACCGCGCCGACGGCATTCTCACCATTACCATCAACCGCCCGCAGGCCCGCA
7   N21   BP3199-221                                        BP3199
                        GCGACTACAACGTGTCGCTGGTCGAGCTGGAAGGCGGCGCCCGCATGATGA
7   N23   BP3201-516                                        BP3201
                        CCATGCGCGCACGTCGCCGCAGTCGGCGCTGATCTATCGCCTGTCGGCCGA
7   P01   BP3202-396                                        BP3202
                        CCCCATGCCGGTGCCCGCCCGCGAAACCGATGCGGTGCGCGATCACGCCAA
7   P03   BP3207-266                                        BP3207
                        CCGCGCACAATGCCAACCACCACCGTTACAAGCACGGTCCGCGGGATGTCG
7   P05   BP3211-196                                        BP3211
                        GCGCTGAAACGGCCGTGCCGCGTCACCATCCACACCGATTCCCAATATGTCA
7   P07   BP3212-66                                         BP3212
                        CGTCCTGGCCTGGGAGCAGGCCCAGTTCGACGAGGCGGTGGCTGACATCTT
7   P09   BP3213-456                                        BP3213
                        AACCCCGGCGCAAATGCTTGATTCATTGGAGAAATTATCTGCCTTACCGGCA
7   P11   BP3214-371                                        BP3214
                        CCACCGCCCTGTCGCGCTCGCAAGCCTCGGGCCTGTGGCAGTTCATTCCCA
7   P13   BP3215-101                                        BP3215
                        ACCTGGCGTTCACCTACGTGGGCGACCGCTTCAAGGAACGCATCACCGAATT
7   P15   BP3217-271                                        BP3217
                        AAACTGCATGGCGACCTGGACGACGCGCAGATCGACGAACTGCTCAAGGTG
7   P17   BP3218-541                                        BP3218
                        GAAATGTACCTGGCCAGCCTGCTGGTGGCCGACGAGCAGAGCTTCATGGAG
7   P19   BP3219-336                                        BP3219
                        GTTCCGCAACCTGGATTTCTCGCCCACGCGCGATTTCACGGCGGTGATCAAC
7   P21   BP3222-416                                        BP3222
                        GGCCCTTCGTATTCGATCCTGCCACGCGGCAATTGCTGCGCGATGACACGC
7   P23   BP3223-61                                         BP3223
                        CTGGGTTCGGTCCTGCTGGCGCAGGCCGCCACGCTGGCCACGGTGTCCTAT
8   A01
8   A03   BP3224-941                                        BP3224
                        TGGCCGGCACCGTGATCGGGGTGCCCGTGGTGCTGGTATTCAACATCCTGG
8   A05   BP3225-441                                        BP3225
                        CCTGTTTTCCTGGCTGCAGACGCCTGACGGCGCGGTCCTGATCGACGGCCG
8   A07   BP3226-326                                        BP3226
                        CCGTGCATTGGCTGGGCTTCGATTGGCAGGCCGATGGCAATGACAACCTGT
8   A09   BP3227-581                                        BP3227
                        GCCAGCGCGTCTATGCGCGCCATACCGACCTGATCGTGATCGGCATGGTCA
8   A11   BP3228-216                                        BP3228
                        GGCGCTCATCAAGGACAAGCAACTCGAGAACCTGTTCATCCTGCCCGCCTCG
8   A13   BP3229-106                                         BP3229
                        CCGGACTACCTGCCGCAACTGCAGCAGGAGCTGGTTGCCGTCATTTCGAAAT
8   A15   BP3231-41                                          BP3231
                        TGCTGGCCGTTTCCATGGCCGGCTGCTCGTCCTGGGACAGCATGAGCCGCC
8   A17   BP3234-476                                         BP3234
                        CGTATGCGCTCTACGGCGTGCTGTTGCGCAAGTGGCCGATGTCGGTCGGGC
8   A19   BP3235-316                                         BP3235
                        TCGCTCGTCGAAGGCGAGCGTTTCATCAAGCTGGACCAGGACGGCGACGAA
8   A21   BP3237-1426                                        BP3237
                        ATCGTCCGCGCGCTCGAAATCCATGCCCAGGAGTTCGGCCATATTCCGCTGC
8   A23   BP3238-51                                          BP3238
                        GGCCGTCACGTTGCACCGAGTGTTCCAGTCACTGCAACGCCAGACCTGTCG
8   C01   BP3239-421                                         BP3239
                        GACAGCTACCCCGAGATCGATTGCGAATTCGATCTCAACCTGAATGCCAGCG
8   C03   BP3239A-101                                        BP3239A
                        AACGCGTGCGTCGCAACACCCTGGAACGCCGTTGCCTGGGCAAGGCTTTCA
8   C05   BP3240-106                                         BP3240
                        TCGGGCAAAAGCTCGCTGGCCTTCGACACCCTGTATGCCGAAGGACAACGC
8   C07   BP3241-741                                         BP3241
                        GGGCTCGGTCAAGGTCGATGCCCTGTTCTCGCTGGAACGCTACCCCACCGT
8   C09   BP3242-306                                         BP3242
                        GCGCTACAAGACGACCTACCGCCCCTGGTACGCCCACACCATCGAATGGCT
8   C11   BP3244-71                                          BP3244
                        TGGCCGATGGTTATGACGTCGTGAACTTCAGCCGCGGCAAGCCGGCCGATG
8   C13   BP3245-426                                         BP3245
                        GTCTCCCTACCGCACACTGGCCGACGTGATCGAGGCGGCCCGCCAGCGCAA
8   C15   BP3246-1226                                        BP3246
                        GCTATTTCAGGACCGGCGATCTCGGCTACACCCTGGGTACGCGGCAGTTCG
8   C17   BP3247-221                                         BP3247
                        GCACCTTCGTCGAGGACACCCTGCCCGAAACCCCCACGCTGCTCATCCCCA
8   C19   BP3248-326                                         BP3248
                        TGACCCGTGTCGACGAATTCGTCGCGCCCGATAACGTGATGCAAGTGCTGG
8   C21   BP3249-331                                         BP3249
                        GTGGCGTCGTGTTGCATCGGTATCGGCTTCATGCTGCATCAGGTAGCGACG
8   C23   BP3250-411                                         BP3250
                        CTGCGCCACCGAGCACGGTCCGGTCAACGCGCTGGTGTTCATCATGAACCG
8   E01   BP3251-326                                         BP3251
                        GCGTGATCGAGAAAGTCAGCGCGGCCGAATCGGACGAATACTTCCACAGCC
8   E03   BP3252-346                                         BP3252
                        GGCGAAGGCTGCGCCGCCTGGTTCGAGTGCCGCAACCGCAGCCGCTACGA
8   E05   BP3253-131                                         BP3253
                        GTTCGCGCAATTCGGAAGTCATCCACGCCGGCATCTACTATCCGGCCGACAG
8   E07   BP3254-361                                         BP3254
                        GTGTCCAACCACAACGACTATGCCAGCCTGGCGGCGTCATACGGCATCCCG
8   E09   BP3255-571                                         BP3255
                        GAGGATTTCGTGTTCTTCGCGCAGGCCGCCTCGCCCAGCTATTACGAGACG
8   E11   BP3261-126                                         BP3261
                        CCAGGCCATCGAGGACAAGATCAGCCAGGGCAAGGCGGGCGTCATCGCGG
8   E13   BP3262-721                                         BP3262
                        GAACTCAAAGATGGGGTCGTACGCGAGTATGAGATCCATCCAGAGGATTACG
8   E15   BP3263-311                                         BP3263
                        CCATCGCCATCACGCATACGGGCACGGACATCTTCACCGGACTGCCCTCGC
8   E17   BP3264-781                                         BP3264
                        GCGCCGCTGTCGCTGTACCGCGCGCTGCGTTCGCTGAACCCCTCGCCCTAT
8   E19   BP3265-591                                         BP3265
                        CGAAGGAATGGACGTGCGTTCCCTGGATGTCGATGGTATAGTTGACACGCTT
8   E21   BP3266-136                                         BP3266
                        GACTGGATTCACTTCGACGTGATGGACAACCATTACGTGCCCAACCTGACCA
8   E23   BP3267-76                                          BP3267
                        TCCGATCCCAGTCAGCAGCAATACGTGTTTGCCTACACGGTGCGCATCACCA
8   G01   BP3268-221                                         BP3268
                        ACGACCTGTCGCGCTGGTGGCCGCTGTTCCTGCGCAATTGCAAAGGCCTGA
8   G03   BP3269-311                                         BP3269
                        GGATCGTCGAATCCGGCGAGATCGAACGGGTGCTGATGCAGGCGGTGCAGA
8   G05   BP3270-526                                         BP3270
                        TATTGCAAGCAACTGCACCGCACGCTGGAGGACATGGACAACATCACGGTCT
8   G07   BP3271-91                                          BP3271
                        GCCGTGGCCTTGCAGCCTTTCGATGTCATCGTGGCGATGCGCGAGCGCACG
8   G09   BP3273-616                                         BP3273
                        TATGCGCAATTCAAGCAATTTCCCATCATCCCCTGCAACCTGTGCGGCTCGC
8   G11   BP3274-61                                          BP3274
                        GAACACGAACGCCGCGCCACCCAGCCGCTGCATATCGACGCCGAGTTCGAC
8   G13   BP3275-641                                         BP3275
                        ACGGGCGGGCCTATGACCTCATCCTGGTGTTCTATGGCTGGGAGCCGCAGG
8   G15   BP3276-1141                                        BP3276
                        ACCCGCTATTACAAGCAGGACGAGAACTCCCCCAATGCGCTGGTCAGCTACT
8   G17   BP3277-211                                         BP3277
                        ATCACCGGCAGCGAGAAAGCCTTCGCCGCGGGCGCGGATATCGGCGCCATG
8   G19   BP3279-881                                         BP3279
                        GCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCT
8   G21   BP3281-141                                         BP3281
                        CCGGCCAAACCCATTTGCTTTTCTCTACGGTGAGTTGCTCAAGCTGCTCATG
8   G23   BP3282-51                                          BP3282
                        CCTGGTGCATTTGAACAATATTGGCGAAAAGCAAAGCGTCATCGCCCAGTTC
8   I01   BP3283-86                                          BP3283
                        TGGGCGGCAAGTACCTGGAAGCTTCGGCTCGTCAGCCCGAACTGATGAACG
8   I03   BP3284-51                                          BP3284
                        GGGCTGGTTCACGATGAAATTCGTGTGGCCGCCTCTGACGAAGGCGATCGA
8   I05   BP3285-306                                         BP3285
                        GAATCGTCACGAAGGCACGGCGCAGGCGGAAATCACCAGCGCATTCGAACT
8   I07   BP3286-421                                         BP3286
                        TCGGTGTCGCAACCGCTGCAGACCGGTATCAAGGCCATCGACTCGATGGTG
8   I09   BP3287-796                                         BP3287
                        GACAACGCGAAGAAGGTCATCGGTGACTTGCAACTGGTCTACAACAAGACCC
8   I11   BP3288-41                                          BP3288
                        TGGATATTCAGTTCCCCCGCGATAACATGCCCAAGATCTACGAAGCGCTCAC
8   I13   BP3289-116                                         BP3289
                        CCCCGCTGATTTCGCGCATACGCCCCGGGACGGTCAAGATCGTCCGTGCCG
8   I15   BP3290-781                                         BP3290
                        CTGATGCGTAAGCATGGCATCGATGCCCGGCCCTATCGCGAGGGCGTGGCC
8   I17   BP3291-106                                         BP3291
                        CCGGAATACAACGCCACACGGGCCCGTGCGGGCTCGTTCATGGGGCTCGCG
8   I19   BP3292-1861                                        BP3292
                        TACGATCCCGTGCCGCTGCGCGTTGTGCGCGTGGCCCACGTCGAGCGTGCC
8   I21   BP3293-116                                        BP3293
                        GCGTCATCACGCAGAAGATGGCCTATCTGTTGCGCGAGTGCGGCTACATGG
8   I23   BP3295-41                                         BP3295
                        GCATCCAGTCCTGGATTCAATGCGAATCCCCTTCGAACTCGCCAGCCGGCGT
8   K01   BP3296-266                                        BP3296
                        ACGAAATCTGGCCGGGCGTCGAAAGCTACAACAATGGCCGCGCCTTCACCG
8   K03   BP3298-606                                        BP3298
                        CGCCAACCTGGGCTTTCCCGCCTGGCGCATCATGCTGTTCCACTTGCTGCCC
8   K05   BP3299-721                                        BP3299
                        AACATCCTCATCCCGGTCGTTACCGTCATCGGCATGGAATTCGGCCACCTGA
8   K07   BP3300-501                                        BP3300
                        CTCGATGAGCAATGCCGACGAGCCGCTGCAGCTGACCGGCACCCAACCGCG
8   K09   BP3302-51                                         BP3302
                        GCGTGAACTGCTGCGCGGCGCTATGGAAGACCAATCGAACACCATCCGCCC
8   K11   BP3303-236                                        BP3303
                        CCATGCAGCCCGAACTGATGCTGCGCGATTTCCGCGGCCTGCTGGAAGCGG
8   K13   BP3304-661                                        BP3304
                        ACCGCCATTCGCTGGACCAAGTACGCCTTGAACAACTGGCTGCGCATGGCG
8   K15   BP3305-666                                        BP3305
                        GGCCGAACAGTTTCGCGAGCGCCTGCGCAGCCCCGAAGCCCAGCAGGCTTT
8   K17   BP3306-711                                        BP3306
                        CGCGTCCGACGTGCTGTACACGCCTTTTTTCACCGGCATTCCCGGCAACTAC
8   K19   BP3307-311                                        BP3307
                        TGGGGCATGCCCGCTATTTCGCGCGCCATCACGAGCAATTCGTGACCATGC
8   K21   BP3308-1026                                       BP3308
                        CTATATCTCCGAGTACGCGGTCGAGCGTTTCTACCGCGATGTCCGCCTGTTC
8   K23   BP3311-356                                        BP3311
                        AGCCGGCCGAGCCGGTGGTGCGCTACGAGCATCAGGTCCCCGGCGATCTG
8   M01   BP3312-836                                        BP3312
                        CCTTGCAGCCCTTCATTGACCGCTACAACTGGTATCGGCCACACTCCGCTCT
8   M03   BP3314-191                                        BP3314
                        CCAGCCGGACGGTCAATGTCGACATGACCGACGCCATGCGTTTCACGCCCG
8   M05   BP3315-1431                                       BP3315
                        CGAGATCGAGTTGCACCTGACGGGCAATATGGATCGCTACATGTGGTCGTTC
8   M07   BP3316-296                                        BP3316
                        GTCGCACGGGCCTGCAATGGGATGGCCAGTTCTGGGTCGGGCGCGACCTG
8   M09   BP3317-171                                        BP3317
                        TGGCAGGAACTTCAGCGCCGGATTCGACTTCACCGACTACGAGACGCAAAG
8   M11   BP3319-476                                        BP3319
                        TCGACCACTATGGCGCCGCCATCAAGCGGCACACCGAAGACACGCACGTGT
8   M13   BP3320-481                                        BP3320
                        CGCATACGGCGCAGCGTCTACGACCCGCAAACCGGGGCGAGCAAGGCGTTC
8   M15   BP3321-881                                        BP3321
                        AGCAACTGGTGCTCAAGACCGAAGCCTATGCGCGCCACCTGCGGGCGCTGA
8   M17   BP3322-886                                        BP3322
                        CAGTTCGAGACCGCCTACCAGGCACGCTACAACAGCCTGCCCGGCGCGTTC
8   M19   BP3325-186                                        BP3325
                        GATGTTCGCCGAGAAAATGGACCACCACCCGGAATGGCGCAATGTCTACAAC
8   M21   BP3326-171                                        BP3326
                        CGAGCAATCCGAACAACTGCACACCGAACTGAGCGCCGCCAACCTCGAGCG
8   M23   BP3327-271                                        BP3327
                        CAGGCCCTGCCCCTGCTGGGCGACGCCCCCTTCCTGGTCATCAATGGCGAT
8   O01   BP3328-46                                         BP3328
                        ACCATCGAGACGCGCTGCTTGAACAACGACCAAGACTCCCGCCTGGCCCTG
8   O03   BP3329-896                                        BP3329
                        GCTGGATGTACCGCACGTATCACCGGCAGCTCCTGGGCAATGGCTTCTATAC
8   O05   BP3330-521                                        BP3330
                        CCGTGGACGCCAATATCATTATTTCCGATGCTGAAGTGGATGCCTTCCTGAA
8   O07   BP3331-316                                        BP3331
                        TACAACATTTCCAGCCCGCTGCTGTTTCACCTGATGGGCGCCGCCGAACAGG
8   O09   BP3332-1076                                       BP3332
                        AAACACTGCTGGCCGAGCGGGCCCGCGACATCATGCAACTATGGGTCGCGG
8   O11   BP3333-311                                        BP3333
                        CGCGTTCACATTCCAAGGAGGCCGGCGACGCAACCATCGTGGGTATCGATT
8   O13   BP3334-1071                                       BP3334
                        GGTCATGCAGGGCAGCACCGAAACCACTTTCTACGTGCTGGCCGTGTACTTC
8   O15   BP3339-551                                        BP3339
                        GCCAGGAAACCCGCGACCATGGCTTGATCACCATCGCGGCGCTGCACGATA
8   O17   BP3340-546                                        BP3340
                        GATCCAGTTCACCGCCAGCGCCCAGGCGCTGCAGAATCTGGTGTTCTGGAC
8   O19   BP3341-151                                        BP3341
                        CAGAACCAGCGCGCGCGGCTGCAATTGGCCGATCAGTTGCAGGCCATGCAA
8   O21   BP3342-386                                        BP3342
                        CGGACAACCAGATCGAAACCATTAGTTTCGGCAAGGAAAAGCCGAAGGCGAC
8   O23   BP3343-991                                        BP3343
                        GCCCGCCGCCTGACGTTTAATGGTGGTTACAACATTTCACCCCGAATTTCCC
8   A02
8   A04   BP3344-791                                        BP3344
                        CACAATACCGGGTACAGTTGGGTTCTGATGGGAAGGTCAATGGTGTCACGCT
8   A06   BP3345-166                                        BP3345
                        GATGTGCCGGCCAAGCCGCTGGAAGTGCAGATTTCGGAAGACGGCAAGATT
8   A08   BP3346-366                                        BP3346
                        CGAAATGGACTCTCTCGAATCGCACCTGAACTTCCTCGCCTCGGCGGGCTCG
8   A10   BP3347-201                                        BP3347
                        CATGTCCTACCGCAAGCCCGCCCGGCTGGACGACCTGATTACCATACGCAG
8   A12   BP3348-1416                                       BP3348
                        CGCCATCGCCCCCTACGAGGTGGTGATCTGCCCGGTGGGCTGGGGCAAAAG
8   A14   BP3349-156                                        BP3349
                        CGAACTCCATGAAGAGGTGGGCTTGAAGCCCGAGCATGTCCGCATTTTGGG
8   A16   BP3350-496                                        BP3350
                        GGCTATCCGGTCGACAAGTCGCAGCTTTTCGGCAAAGTGTTCACGCACGAAA
8   A18   BP3352-306                                        BP3352
                        GTACGAATGGAGGGCGCTCGATAGCGGCCCGAAGCCAGCCAAGCAGTCCTA
8   A20   BP3353-56                                         BP3353
                        CCGGCGGCTACTACCAGGGCATCATCATTGAGCAGCTGGTGAAAGCCAGCC
8   A22   BP3354-121                                        BP3354
                        CGCGCCTATCAGCTCTCGGGCGAATTCCACCGGCCTGTCGGCGTCCTCGCC
8   A24   BP3355-171                                        BP3355
                        AGCGGTTCGAGAGGAGGGCAGGCGGCGCACTGCCGCTGTGGAGAAAGCTC
8   C02   BP3356-61                                         BP3356
                        GTTCTGGCGTCGGTCAGATTGATGGATTTTTTGGGCCGTTGGGAGGGGCAG
8   C04   BP3357-116                                        BP3357
                        CAGTTGCTGTTGTGGGCCTGTTAGTTAACTTGTGGTTTAAGTGGCAACATCTG
8   C06   BP3358-561                                         BP3358
                        CTCACTGGTTGGCATTCAAGAGTATGTGTTTCTGACTTACGCTTTGGATTCAG
8   C08   BP3359-56                                          BP3359
                        CCTTCGCCGTCACTCCGAGCGATACGCAAGACCTTCGTGAAGTGACGCGAG
8   C10   BP3361-46                                          BP3361
                        GACCAGATCGGACGCATTCACCAGGCCACAAAAGGTCAGGCCCACCGTACG
8   C12   BP3362-656                                         BP3362
                        GGCGCTATGAAATTGAAGAGATACGAATCGAAGAGACTCCGATAGGAAATTT
8   C14   BP3363-251                                         BP3363
                        CGCACGTCGGTATCTACCTCGATCTGGACGGGGGTGGAGTATTGCATGCCA
8   C16   BP3364-161                                         BP3364
                        TGGAAGCGGAGGCGCCACTGGACGGTGGGAAAGAGGTCCTGTTTCAGGCCG
8   C18   BP3365-176                                         BP3365
                        TTTATCAGCGGTTCTGCTCCATCGATCTCAACGGTTACGCGGGGTGGTTCCT
8   C20   BP3366-2026                                        BP3366
                        AACGCCTTTGCTGACGCATTCAAGGGGGCAGAGGACGCACTGGTTCAATTCG
8   C22   BP3367-101                                         BP3367
                        TGCCCAAGGTGGTATTCGAAGCGATGGGCTCACAGTGGCGCATTGGCTTTG
8   C24   BP3368-46                                          BP3368
                        GTACCGGTGGAAATACCCCGGCATGGTGAAGAGCCAGCCAATATCAAGGTCA
8   E02   BP3369-166                                         BP3369
                        CAGGTTACCAATGTGGCCAAGACAGGAGGTGAACAGCAGTTCTATCAATGGA
8   E04   BP3370-316                                         BP3370
                        CACCCCCAGGCTGACAATAAATCAGGCTACCTAGGGGTGTATTGGGAGCGAG
8   E06   BP3371-41                                          BP3371
                        TGAAAGACTGGGCAAAGGCACGTACGCCTGAGCTTGCCGTGGCCTGGCAGA
8   E08   BP3372-256                                         BP3372
                        GTGACTTACCTGTCGAACTCGCTGCCCTATGCCGTACCGCTGGAAAACGGTT
8   E10   BP3373-51                                          BP3373
                        GCTGGAGTTTGGCGGGCCGGTCTCCGTGCGCCAGTTCGTGACGGGCGAGT
8   E12   BP3374-41                                          BP3374
                        GCGAACCGGGATTGCAAGAGTGTTGCGGGGTGCAGCTTTACACGGCGGACG
8   E14   BP3375-56                                          BP3375
                        TGATCGTCGAAGACGGAACCGGCCTGCCGAACGCGGATAGCTACGTGAGCG
8   E16   BP3376-141                                         BP3376
                        CAAGGAAGTGCCCAAGGTCACCCTGAAGCCGGAATACCGGTCGAAGGGCAA
8   E18   BP3380-216                                         BP3380
                        GGACAGTGCTCGCCAGATCGAGAAGCTGACCAAGGACCTGGCCGAAAAGGA
8   E20   BP3381-41                                          BP3381
                        AAACGGAAAAGGACCGGATCCGGAAGCGGATCAAGGCCCTGCCGAAGCCGA
8   E22   BP3382-726                                         BP3382
                        CCGGCTGCATTGGCAGTGCCGCAGCACGTCGGTGCCGATCCTCAAGGGCAT
8   E24   BP3383-861                                         BP3383
                        GCAGGCCCTTAAGATCGGCTCATCGGAAGCGTGGGTATTCACCGACCCCCA
8   G02   BP3384-861                                         BP3384
                        GGAAATGGCTCGGATGCTGAAGGAACGGTTCAAGGACAAGGGGCACGGCGT
8   G04   BP3385-236                                         BP3385
                        AGGACGACATCCGGGTATGCGACGGGGTGATCATCACGACGCCCACCACTA
8   G06   BP3388-341                                         BP3388
                        CCCGCGGATGCCCAGGTGAGCAAAACAACATTTCCCTGTGGACCAGGCTTCG
8   G08   BP3389-211                                         BP3389
                        GGCGTCTTCCCGGTTGAGATAGCTATTCAGGTCCATGGCCCAAACTATAGCG
8   G10   BP3390-196                                         BP3390
                        GGCATCGAGAACTATCAGGAGACAGAAATTGGTCAGATTCTGCTCCGCCGGT
8   G12   BP3391-96                                          BP3391
                        GTTCGGCGTCAAGCGACGGCTGGATCGGATCATTCGTTTGCTTGAACAGCAG
8   G14   BP3393-446                                         BP3393
                        TCAGCGTCTGGAACGCGCTATGGGTCAGCCTGGCGTTCGGCGCCGGCTGGT
8   G16   BP3394-296                                         BP3394
                        TGCTGGTGCAGGCGCATGGCAAGGTGCTGTTCTATGGCCCGATGCTGCCGC
8   G18   BP3395-291                                         BP3395
                        CATTCTCACGCCCACGCGGGAACTGGCCGACCAGGTTTACGAAAGCGTCAA
8   G20   BP3396-196                                         BP3396
                        CTCGGGCCGGCGTTCGACTACAAGCTGGTGGCTGGCGTTCTTGCCATCATG
8   G22   BP3397-331                                         BP3397
                        CGCCATATGTCCTGGCCGCGGCGCCTGGGGCTGGGCTATTTCACCACCGAC
8   G24   BP3398-266                                         BP3398
                        GCGCCAACGGCCTGGCATCGTGTTACCTGCGCCCGCTGGCCTTCTATGGCT
8   I02   BP3399-96                                          BP3399
                        CCTGTGGAGCATGCATCCGCGCGTCTTCCTCGACGTCACCCATACCGGCCA
8   I04   BP3400-96                                          BP3400
                        GGAAATCGCCTGCATCCATCCAGGCGGCCTGCGTATCGTCGGGCACACGGC
8   I06   BP3401-676                                         BP3401
                        TTCATCGCACGGCGCATCTACACCGCGTACTTCCTGAAGACCATGCGGCGCA
8   I08   BP3402-746                                         BP3402
                        GCGGCGCATGGGCCAGTACTCACCCCTTGTCGATCGATCGGATGTCCGACG
8   I10   BP3403-696                                         BP3403
                        GCTGGAGGCAGCCATTTTCGACCATCTGCGTGCCACCACGGTCGGGGCGGG
8   I12   BP3404-481                                         BP3404
                        ATGAATTGGTCGGTCGTCATCAGCGGTTTCATGTACTGGAACCTCATTCTTGA
8   I14   BP3405-951                                         BP3405
                        GCTGGGCTATCGCCAGGATCTTTCCGCGCGCACCAGCCTTTATGCCTATGGC
8   I16   BP3409-76                                          BP3409
                        TCCCGCCTTACCTTCGTCTGCCCGCGCGATGCGCTGGGCGCCGTGCGCAAG
8   I18   BP3410-496                                         BP3410
                        GAAGAGTGCCTGGATTGCGAAGACCTTGAGCCGCTCAAGCTGCGGCCGCGC
8   I20   BP3411-1006                                        BP3411
                        GGATCGCTGGACGGGGTGCTGGAATCGGGCGCCTACAGCCGCTTCTACATG
8   I22   BP3412-181                                         BP3412
                        CCGGTCTGGTACGACAACCCGGCGTTCTTCCTGCTGTTCATTCCCATGATCG
8   I24   BP3413-296                                         BP3413
                        GCACGGTCATCGACCGCGAGGATTTCGACGTGCCGCAACTGGGCAATGTGG
8   K02   BP3414-561                                         BP3414
                        GTACGACACGATACGGGCCGTCAAGGCCGAACTGAAGATTCCCGTTATCGCC
8   K04   BP3415-71                                          BP3415
                        ATTCCGAGCCCCACGACATGTGGGACATGGTGATGCGCTGCGTGGAGCGCC
8   K06   BP3416-146                                         BP3416
                        AGGTCGCCCAGCACACCGGTTCGCCGGAAATCCTGGAAGGCCGCGTGAAGA
8   K08   BP3417-151                                         BP3417
                        AACCTGCGCGAAGTCGCGCGCGAGACCCGGCCCGACGTCGCCGCGCTGGA
8   K10   BP3418-166                                         BP3418
                        GATGCGCAGCTGCTGTACGGGTTCGGCAGCAGCGCCGAGCGCAGCACGTTC
8   K12   BP3419-661                                         BP3419
                        ACCCTGGGTGAAATCGTGCGTTTGTGCGCGCTCTGGAGCGGCCACCCGCGG
8   K14   BP3420-736                                        BP3420
                        GCCATCATCCAGCAGCAGGTGGCGGACATCCTGACCGTCAGCGATGCCGAA
8   K16   BP3421-61                                         BP3421
                        CAACCGGTGTCGCCCAACGAGGAGTCGATCGAACGCGCCCTGCGGCCCAAG
8   K18   BP3422-1136                                       BP3422
                        GCCTGCTGGCTTACTTCGGGCAGACCATCACGGCTTGCGGCAACTGCGACG
8   K20   BP3425-431                                        BP3425
                        CCACCGGCGATCGCGCCACCGACATCAAGCGGCTGGAACTGGCCGTGGTCG
8   K22   BP3426-1306                                       BP3426
                        TTGATGGGCAAGCCCTTCGACGATGGGCTGTTGTGCGGCCTGGGCGTGGCT
8   K24   BP3427-581                                        BP3427
                        CGTCGATGGATCTCTCCGACAAGGTCACCGTCATGGCCGGTCCGTACGCCA
8   M02   BP3428-451                                        BP3428
                        GCCTGGTACACCAACGTGGTCGATCCGGAATACGCCTTCCACGTCCTCATCA
8   M04   BP3429-61                                         BP3429
                        CTGATCGGCGTGGGCCTGAACGTGATCTTCGGCGTGCTGCGCGTGGTGAAC
8   M06   BP3430-591                                        BP3430
                        GATCTACCAGCTGTCGCACCACATCATCGTCATGAACGAAGGCGCGATCCTG
8   M08   BP3431-606                                        BP3431
                        CGACCAGAACGTGCGCCGCTGCGCCGAGATCTCCGACTACATGTACATCCTC
8   M10   BP3432-331                                        BP3432
                        GTGCAGATGCATTCGATCCAGACCAGCGGCAATTGCATCCGCAACACCACCA
8   M12   BP3433-291                                        BP3433
                        CTATACGGATGGGCGCGGCTATTCGCTGGCGCAGTTGCTGCGCCGCCGCTA
8   M14   BP3434-676                                        BP3434
                        GCGCGTGAAGACAACAAGAACGATCCGCGCATCGCGCGCTTTATCAAGGCG
8   M16   BP3435-326                                        BP3435
                        GCGAAGAAGCCGAGCAATGGGTGCACCTGTTCTGCGCCATGCCTCGCACCC
8   M18   BP3437-511                                        BP3437
                        ATGCTGGAATGGACCCTGGATACCCGCTACCGCGCGTTGCATCACCAGGTG
8   M20   BP3438-486                                        BP3438
                        CGGCAAACTGTTCCTGTCCACCTACGATACGCGGCTGGTGCGCGCCTATGC
8   M22   BP3439-2076                                       BP3439
                        GACCCAGGATCGTTCCTATCGGGTCGATGTGGGGAGCATCGTCTTTGATTCG
8   M24   BP3440-611                                        BP3440
                        ACCAGACCACCAATACCACGCAGCAGATCACCAGCGGCAAGGTGAAGGCCT
8   O02   BP3441-141                                        BP3441
                        AGTCGCCCAGCAGTCGCAGCAAGCGGCTGAGCTGAAGGATCCGCAAGACGT
8   O04   BP3442-501                                        BP3442
                        GGCCGGCGTCTATCCGCACGCCGACTACGTGACCGTGAACATTTCCTCCCC
8   O06   BP3443-621                                        BP3443
                        GCCCTGGCTGTACCTGGGCTACTGGATCGCCGACAGCCGCAAGATGGCCTA
8   O08   BP3445-471                                        BP3445
                        CTGGGACGATTTGTCGTTCCGCACCGTGGTCACCACGCTCAGGCGCTATCTG
8   O10   BP3446-781                                        BP3446
                        CGCCATTCGCTCATCACGATGATGGCCGTCTACCCCCACCGGCGTTTCCTGT
8   O12   BP3447-156                                        BP3447
                        CTATCCCGTGACGTACTTCGAGATCGTTGGCGGGGTGCTGCTGATCCTGGG
8   O14   BP3448-196                                        BP3448
                        GGCAACTGGTTTTTCCAGAACGGCCCGCAGCGTGTGTATGTGCGCCTGGAT
8   O16   BP3449-181                                        BP3449
                        CGCGAATACAAGGAAAAATACTGGGACGGCGCGTGCAAGGTCGAGCGCAAG
8   O18   BP3452-421                                        BP3452
                        GCGTCCTATGCGAAGGTCTCCATCGAGACCCAGCAATTGCTGATACAGGCAG
8   O20   BP3453-1086                                       BP3453
                        GTCCCGCCGCGACACCGACCTGGCGCAGGTCATGCATTGGCTCAACCAGCA
8   O22   BP3454-286                                        BP3454
                        GCCACCAATGCCTCGCTCTACACCAACCAGTCGTTCGACACCGTCAAGAGCT
8   O24   BP3455-641                                        BP3455
                        TGACCGAAGAAGAAAGCCGTCCGATCCTGGACTTCCTGAACCGCCATGCCAC
8   B02
8   B04   BP3456-41                                          BP3456
                        CCTATCCGCATCCCGGAAAAATCTCGGTCACGGCCACCAAGCCGCTGGTCAC
8   B06   BP3457-836                                         BP3457
                        CCATCGTGCCGTTCTCGTTCACCTGGCACCTGCCGCCGATCGCCGTATTCAT
8   B08   BP3458-286                                         BP3458
                        GTTCCCACGTTTTCGCTGATGCTGATGACGCTGCTCGTCTCGGTCGTGATCG
8   B10   BP3459-711                                         BP3459
                        GCAGATCAAGCCGCATCTTATCGCCTTCCCCGCGGTGTTCCTGTCCATCACG
8   B12   BP3460-726                                         BP3460
                        CAAGGGCGACGTGGTCGAGAACAACGACGTGCACGGCCTGTTCAATGCGCC
8   B14   BP3462-711                                         BP3462
                        CAATGTCTCGGTGTGCTCGGGGTTCGTGTTTTCGGACCTGCCCAAGTGCGG
8   B16   BP3463-601                                         BP3463
                        CGCTTCTTCATCGACCTGTGCTGCATGCATGAAAAGATCGAACTGAACATCG
8   B18   BP3464-676                                         BP3464
                        CTGCCTTCCGATTTGATGTACATGCACGAATCGCTCTGGGAGCTGAAAACCA
8   B20   BP3465-186                                         BP3465
                        CCGTTTCGTGATGCGCTCGCCCGAGGGCGAAGAACACACCCACGACTGCTG
8   B22   BP3466-191                                         BP3466
                        GGAAAAGCGGCCGCGTGCGCATCTACACCCTTGCGCCGCAACCGCTGGGCA
8   B24   BP3467-71                                          BP3467
                        CCATCTTTTTGCTGACATTCGATCCCAACGCCTACAAGTACAAGCTGGAAGAG
8   D02   BP3468-151                                         BP3468
                        GAGCTGCGCATGGGTTACCTGGTATTGAAGGCGCCGGGCATGCTGCGGCTG
8   D04   BP3469-381                                         BP3469
                        CAATTTCGGCATGGGTATTTTCGGCAGCATTGCGGCCCAGCCGGTGCTGGT
8   D06   BP3470-141                                         BP3470
                        ACCGCAATGCAAGGTGGTCTGCCCGGTGGAGTGCATCGAACTGCATCCCCA
8   D08   BP3471-326                                         BP3471
                        TGCCCGACGTCGAAACCATGTTCATGACGCCGTCCGACCAATACCAGTTCAT
8   D10   BP3472-511                                         BP3472
                        GAGCTGCTGCGCGAGGGCAAGGCCGGCGCCGTGCACTATCGCCTCTTCCAA
8   D12   BP3473-746                                         BP3473
                        TGATGGTGGATACGGCCGGCCGCCTGCCCACGCAGCTGCACCTGATGGAAG
8   D14   BP3476-581                                         BP3476
                        GGTACGGCTACTGGCCGCAGATCCGCCCCTCGTTCTGGTCCATCGTGCTGC
8   D16   BP3477-576                                         BP3477
                        GCAGGTGTTCGCGCGCTTCGTGGGCTTTGCCACCTACCAGTTCGACTCCAAC
8   D18   BP3478-466                                         BP3478
                        AACCGACGCGATACCGTTGAGGGGGCCGGCTGGGACTTCTTCTTCGTGGCC
8   D20   BP3481-851                                         BP3481
                        ACGAAATGAAAAAGGCGTTTGACGGGGCCGACCGCTTCTATCCGGTGACCTA
8   D22   BP3482-386                                        BP3482
                        CCATGATCCACATCACCGAGGCCAGCTACCCGGTGCATGTCAACATGCGCAA
8   D24   BP3483-651                                        BP3483
                        GTTCAAGTTCTTCCCGATCTCGGTCGGCGTGGCCAACATCCAGTCGCAGCTG
8   F02   BP3484-751                                        BP3484
                        CATCTGGCGCTGGTACACGGTAATATCGATCCCGAGCGCGAGACATTGGTG
8   F04   BP3485-256                                        BP3485
                        GGCGAAACCTATCACTTTGAAGTGGTCAGCAACGAGAGCGCCGCGGCCATC
8   F06   BP3486-276                                        BP3486
                        CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
8   F08   BP3487-126                                        BP3487
                        GCAAGTGGCCACCAGCACCGACCTGCTGATCGAAGGGCGGCACTTCTTTCC
8   F10   BP3488-226                                        BP3488
                        GGACAGGCCGGCCGGGAACTCGGCGTGTCCGACCACGTCGGAATGGTATG
8   F12   BP3489-161                                        BP3489
                        CGGTCACGTCGGTGGCCGGTTCCAGCGACTGGTTCGAGCGCGGCTTCGTCA
8   F14   BP3490-161                                        BP3490
                        ACGCGTGCAGCTTCAAGCCGCAGATCGCGTATTTCGCCGCGCACCGCGCCG
8   F16   BP3491-376                                        BP3491
                        AGCACTTCCAACTTCTTCAATACGCCGGGCGCGGCCGAACACGCCGTTACCC
8   F18   BP3492-51                                         BP3492
                        CCGCATTCTCAACGCGCTGCGCTACTCGCTGCAAGGGCTGAAGGCAGCCAT
8   F20   BP3493-536                                        BP3493
                        TATGGAGCACATCGGCCTTCGCGATGGCGGCCGACTGGCTGTCGAACCTCT
8   F22   BP3494-846                                        BP3494
                        GCAGGCGACGGGCGTCTATGCGTATATGCCTGGCAGCGAAATCACCCTGCA
8   F24   BP3495-1171                                       BP3495
                        GAAAAGAAGGCTCGCGTCGAAGACGCCCTGCACGCCACGCGTGCCGCGGTG
8   H02   BP3496-96                                         BP3496
                        CGAAAAGCCGGATCAAGGTGAAGTCGTGGCCGTCGGCCCCGGCAAGAAGAC
8   H04   BP3497-426                                        BP3497
                        GGCCGGCGTTCAGCAGCTTCGCGTGTATCGCGAGCCCGCCGATAACGGCCC
8   H06   BP3498-391                                        BP3498
                        GTTGCGGTGGTGACCCCGTACTCGGATGCCGTCAATGCCCAGCTGAAAGGC
8   H08   BP3499-101                                        BP3499
                        CGGTTCCCGGCTTCGATCGCTCGTCGCGGTATGTCGCGGTAAAAGGATGGC
8   H10   BP3500-326                                        BP3500
                        ACTTCCTGAATGAAAATACGGAGGTGAAGTTCGACCTGTCGAGTTGGCCGGA
8   H12   BP3501-461                                        BP3501
                        CCAGCATCACCTATCTGCAGACCGCGCTCATGCTGAAATCCGCCGGCTTGAA
8   H14   BP3503-686                                        BP3503
                        CGCACTCCGAGATCACTGCTCAACTGTTTCGGTCCCACAACATCACCATTCG
8   H16   BP3504-1196                                       BP3504
                        GCGACCGCCGGTTCGTATGGAAACGGGGCCTTGGCAACTTGATCAAGCCGT
8   H18   BP3506-151                                        BP3506
                        CTGGGATCGAAAGATGCGCACAGCCCTCACGCCATCTGGCGGGCGACGGCC
8   H20   BP3507-406                                        BP3507
                        GCCGCGACATGCCGCTACGTCGCGGATGTCACCATGACCGCGGTCGAGATG
8   H22   BP3508-141                                        BP3508
                        ATACGGGCTGGATGGCATGGCGATACGCCGCCTGGAACTGGGCGCGAGCC
8   H24   BP3511-41                                         BP3511
                        TCCAGCAGGTCACTGCCAAGGTCAGCGCACTGGAGACTACTGTCCAGTGCC
8   J02   BP3512-41                                         BP3512
                        ATTGCTGGGTCGGCCCGCCTGGCTGGACGATCTGCCGGGTCTGGCTGGACG
8   J04   BP3513-141                                        BP3513
                        GCTGCATGACGACGCGGTGGTGAACGCGGATAAGCCGATCGCCATCGTTGC
8   J06   BP3515-656                                        BP3515
                        GCGCCTTCAACCTGAACCTGTTGCGGCACGTCAACTCCGTACTCGGCAGCG
8   J08   BP3517-41                                         BP3517
                        CGGCGAGAAGCGCTGCGCACGCGTTGGTCGGCGACGGCTTTCGCGAAGAG
8   J10   BP3518-491                                        BP3518
                        AGTGGTTCGAGCGTCTCAAGCAGGGCGGAATCAAGGTGGCGGTGTTCAATC
8   J12   BP3521-341                                        BP3521
                        GCACGCAGGAAGATGTCTATGGCGACCGCTACGAGTGGATCAATCACTCCAT
8   J14   BP3522-41                                         BP3522
                        GCGCCCTGTCCCTTTTCTTACACCCCCTCCGGGATGTCATCATGAGTATCAA
8   J16   BP3523-381                                        BP3523
                        CATCATCACCACCTTGCTGACGGCCTGCGTCCTGTTTGGCGTGGCCATCGCG
8   J18   BP3524-331                                        BP3524
                        GCGCAATCGCACGCGCGCGGCTTTTACGAAGCGCACGGTTTCCAGGCCGAA
8   J20   BP3525-496                                        BP3525
                        GATGCCTTGCTGGCGCCCTTTCATGCGCTGGTGCAGGGGCAGGTGAGGGCG
8   J22   BP3526-1726                                       BP3526
                        GGCCACTTCGGGCTGGCGTATCCCGCCTATACCCATTTCACTTCGCCGATCC
8   J24   BP3527-626                                        BP3527
                        AGACCTGCGATCAGCTCGTGCGCATTCCCATGCTCGGTTCGGTCGAGAGCC
8   L02   BP3528-681                                        BP3528
                        CGGGTATGCCAATATCTACGAGTCGTATCGCAAGGGAGCGCCCACCGGTTG
8   L04   BP3529-476                                        BP3529
                        ACAAGGTCACGCCGGTGACGCGGGGCGCGCGCATCAGCGCCTTTTTCTGGC
8   L06   BP3530-41                                         BP3530
                        CCGATATCTCGAAAGCCGCCGCCGGCCGTTCGCTTGACGCCCTGATCGGTG
8   L08   BP3531-81                                         BP3531
                        TGCCCTGCATGCCGCAGTCATAGGCGCGGTGTTTCTGTCCAAGACGGAGCG
8   L10   BP3532-276                                        BP3532
                        GCAAAGCGACTTCGTGGGCAAGACGCTGTTCATCATCCTGATCGTCATGTCG
8   L12   BP3533-126                                        BP3533
                        GGCCCATTCGATCCGCATCAACATTCCGCAGGTCAGCGCCGAGCAGATCGA
8   L14   BP3534-506                                        BP3534
                        TGACCAAACGCCAGATCGTCAATTCCCTGTCTGCCTGGGATGCCGATTTCAG
8   L16   BP3535-126                                        BP3535
                        TCTGGCCGCGACCTGGGTGATCACGCACAAGATCGACATGTCGATCTGGATG
8   L18   BP3536-531                                        BP3536
                        CAAGCTGTTTGGTCCCATCATGGCGCTGTGGTTCGCGACGCTGGCGGTATTG
8   L20   BP3537-526                                        BP3537
                        ATGCGCCAGGCCGGTTTCGACTACAAGATGTCGGCCGAGAAAGCCTACTCG
8   L22   BP3538-286                                        BP3538
                        GAAGACACCGCGCGCGTGATTTCGCGCATGGTCGACATCGTCATGATCCGC
8   L24   BP3539-316                                        BP3539
                        CTGGCGCGCTACTACGGCTACAAGCAAGGCAATACGCACGCCCACATCATCA
8   N02   BP3540-131                                        BP3540
                        ACCACCTTACCTACTCGCCCTACGTGCTGCCGGTCGTCATCGACGGCGTGC
8   N04   BP3541-676                                        BP3541
                        AACGCCGAGAGCTATATCGCCTGTTGCCTGGCCGGGCTGGGACTGATCCAG
8   N06   BP3542-301                                        BP3542
                        CTGAAGAAGCCATTCTCCGAGATCAGCGAGGCCGAGTACGACGAGATGGCC
8   N08   BP3543-206                                        BP3543
                        CCGATCTCAAGGCGATCTGCAGCTGGGGCGTGGGTTACGAAACCATCGACG
8   N10   BP3544-846                                        BP3544
                        AAAAACCCTGCAGGGGCTGGGCTTCGAAGTGGTCGCCAATACGCCGGCCGA
8   N12   BP3545-71                                         BP3545
                        GCCTGCAGGAACAGGGCGCGCGGCCGTCGGGCAATACCCTCGAACCGTTCA
8   N14   BP3546-511                                        BP3546
                        GAGGATCCCGCGCGCGATCCTTATCTGGATGCACTGCTCAAGGAAGTCGAC
8   N16   BP3547-186                                        BP3547
                        GATCTTCGACCAGATCGCCTCGGGGCGCCTGAACGTGGGCGACAAATTGCC
8   N18   BP3550-586                                        BP3550
                        CTGAAGCTCAGCGCGCGCACGCTGTACCGGCGTTTTCTCGACGAAACGGGC
8   N20   BP3551-196                                        BP3551
                        AATGCCGCCCTGACCGCTTCGGCGCTGATGGGCATGAACAACACCTGGTATC
8   N22   BP3552-101                                        BP3552
                        TCACCGAAAGCTCCTTCCCCGGCAAGTGGAAAGTGATCTATTTCTACCCGAA
8   N24   BP3554-621                                        BP3554
                        GGATGTGCAGATTTCGCGTCTGCGCAAATTGATCGAACCCAACCCGTCCAAA
8   P02   BP3555-826                                        BP3555
                        CTCGAGGCGCAGGTCCAATCCTTTCCCTGGACGCGCGGCAATTTCGCCGAT
8   P04   BP3556-746                                        BP3556
                        TAGGCAATTTGCGCGGCCGCGTGCACAGCCTGCAAACCGACGAGGGGCGCT
8   P06   BP3557-66                                         BP3557
                        GTTCATCGCGGCGATCGCCTTGATCCTGGAGTTGAGCGGGCCCGACTGGAT
8   P08   BP3558-3336                                       BP3558
                        CGCCAATACCGAACGCTATGCCAATCTGGTCAGCAACATGAGCGAACAGACC
8   P10   BP3559-56                                         BP3559
                        TGCTGGGCTTTAACTGGTGGCAGGACCGCCGGGTGCGCCGCAGGATGCAAG
8   P12   BP3560-1951                                       BP3560
                        GGGAAGGTCAGCGGTTCGGTCTCCAAGAAGACGGCCTACCTGGTGACGGGC
8   P14   BP3561-646                                        BP3561
                        CAGGTCGACGATACCCGTCCGGTCGAATTCCCCGCCATGGACCAGGTGCGC
8   P16   BP3562-171                                        BP3562
                        GACGCCCGTTGCCCGCCATAGGCTGGTGTATCATCATTTGCAGGATTTGCTC
8   P18   BP3563-116                                        BP3563
                        TCTGGCTGCGCCTCACCGGCAAGGCCATCGAGGGCATGCACTGGATAAACC
8   P20   BP3564-51                                         BP3564
                        GGAAGAATACGCGGTCGCGCGGCAGAAAGGCACCGAGCGCGCCTTCAGCG
8   P22   BP3565-221                                        BP3565
                        GCCGGGTCGGTTTCGTATTCCAGAATCCAGAGAACCAGATTGTCTTTCCCAT
8   P24   BP3566-426                                        BP3566
                        CCTGGCGCTGGCCTTGCGCTTCATCCCCGAAATCTGGCGCAATTATCAGGAA
8   B01
8   B03   BP3567-46                                         BP3567
                        ATCGTGGTGTTGAGCCTGATGCCGCCGATTCCGCTGCCCGCGATTCCCGTG
8   B05   BP3568-181                                        BP3568
                        ATCGAATGGATCGTGCTCGACGACGCCACCGATACGACGCAAGCCGTGAAG
8   B07   BP3569-526                                        BP3569
                        CCGGCATTCGTCAGCGGGCAGGTCGATCTCGGGTTCTCGACCTGGTCGGCG
8   B09   BP3570-401                                        BP3570
                        ACGGCATCGCCGGCATCGAGCCCATCAGCCTGTTCGGCTGGTCGCTGGCCA
8   B11   BP3571-341                                        BP3571
                        TATTCAAGGTGCCCCTGCCCGGCGAACAAGGCTTCTCGGCCTGCTTCTCCAG
8   B13   BP3572-251                                        BP3572
                        ACGTCACGCCGGAAGTCTGGCCGGGACAGATCGAAGGCGCCTGGAAAAAAG
8   B15   BP3573-656                                        BP3573
                        AGACGCTGGTATTCGTCTCGGCCACGCTGTCGGACGCAACCTGGCAAATGT
8   B17   BP3574-336                                        BP3574
                        GCTCATCGAAGGCTTGTTTCGCAGTTTCTACGGCGTATCCGGCCAGCCGTAC
8   B19   BP3575-76                                         BP3575
                        GGCATCTCCGATGATGTCATCCGCATCGGCTTCATTACCGACATGTCCGGGG
8   B21   BP3576-196                                        BP3576
                        GGCACCGAATCGATCGAGCTGCCCACCTACAAGATCGCGCACCTGGGCGTG
8   B23   BP3577-516                                        BP3577
                        GGACGAACCCACCCAGGGCATGGGCCACGAGGACGTCGCCCGCGTGACGC
8   D01   BP3578-51                                         BP3578
                        TCCCAAACCCACCACCGAGCTCGAATACGAGACGCCGTTCCAGTTGCTGATC
8   D03   BP3579-296                                        BP3579
                        TCGATGCCATCGTCGGCGCCAACAAGCGCATGCATACGGTGCTGGCCGACT
8   D05   BP3580-56                                         BP3580
                        TCACCGACGCCAGTTCCCAGCTTTTCACCCATCCGTACAGCCCGCTGGCCTA
8   D07   BP3581-196                                        BP3581
                        GCGCCCGAGGAGCCATGGCTGGAGTTCTATTCCATCGTGGTCCCCGAAGGC
8   D09   BP3582-61                                         BP3582
                        TGCCCGGTGGACTGTTTTCGAGAGGGTCCGAACTTCCTCGTGATCGACCCCG
8   D11   BP3583-86                                         BP3583
                        GCATGATGCAGGTCGTGCTGCATCATTTTCCGGCTGCACAGGTCGAGTACCG
8   D13   BP3584-156                                        BP3584
                        CGAGGCCGGCACCGACAAGACCAAGATCCTCATGGCCCAGATCTTCGTGGC
8   D15   BP3585-221                                        BP3585
                        CCATGAAGGAATGCTTCGACCGTTGCTATTACGGCGTGCTCGACCGCATCCA
8   D17   BP3586-401                                        BP3586
                        GGCCGGTGATCCTCTCGTGGAGCGATGCGGCGGGCTCCGACGGCGCCTTC
8   D19   BP3587-781                                        BP3587
                        AAGCACATCTACAGCATCTGGAACAAGATGCGCCTGAAAGGGCTGGATTTCA
8   D21   BP3588-726                                        BP3588
                        GACCACCAACCAGATCCACGGCGGGATCGCGGTCAACACCATCCCCGAGCT
8   D23   BP3589-146                                        BP3589
                        TCAATTACGAGCTCAAGCATTTCGTCGGCCGGCCCAGCCCGGTCTACCACGC
8   F01   BP3590-286                                        BP3590
                        GACAGCGTCACGCCGGTAGTGCTGATGGGCTATGCCAATCCGATCGAACGC
8   F03   BP3591-76                                         BP3591
                        GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
8   F05   BP3594-1951                                       BP3594
                        GAACGGCTGGTGCAGTTTGCCGAGACCGTCAAGGGCTCGGGCGCGAAGAAG
8   F07   BP3595-581                                        BP3595
                        ACGGCTTCAGCTACAGCCTGTCCACCGGCTATGGCCAGAGCCATGGCTTCAA
8   F09   BP3596-541                                        BP3596
                        CGGGTATTCGTGCAGGCGGGCACCGATCCGCTGTTCACGCTCAACGACCAC
8   F11   BP3597-296                                        BP3597
                        ATGACCTGGTCAAGCTGGAGGTGCTGGGCGACCCGCAGAACCTGTTTCCCA
8   F13   BP3598-611                                        BP3598
                        ACCTGCTGCACGACGGCGACCGCATGATCGAACTGCCGGGCCATCGCATCG
8   F15   BP3599-121                                        BP3599
                        GAATTGTTCGTGCCGCCGGCGCTACGCGCCCTGGCCTTCTCCGACCTCGAA
8   F17   BP3602-76                                         BP3602
                        CCGCGTCCGCTGGTGTTCACCAATGGCGTGTTCGATATCCTGCACCGTGGC
8   F19   BP3603-761                                        BP3603
                        AATCCGGCAGCAGTCTGAACAGCTGCGCACACCTGTCCAAAGCCGGCCCCT
8   F21   BP3604-436                                        BP3604
                        CTGGGCAACATCTACCGCATGGTGCTGTCGGCCACGGGCAATGCCTTCCAG
8   F23   BP3605-476                                        BP3605
                        TGTATTTCGTGCCCGGTTCGCACACGGCGTCGTTCATGCCCGAACAGTACGA
8   H01   BP3606-526                                        BP3606
                        TTCTATTTCTCCATCGTGTCGATGTCCACCGTGGGCTATGGCGATATCACTCC
8   H03   BP3608-131                                        BP3608
                        AGCCGAACTCCGCGCTGCGTAAGGTTGCCAAGGTGCGTCTGACCAACGGTT
8   H05   BP3609-306                                        BP3609
                        TTGGCTCCGTGAAGCCGCCAAGAAGCGTGGCGAGAAATCGATGGATCTGCG
8   H07   BP3610-156                                        BP3610
                        GATGGAGCAAGAGCAAGAGCGTGGCATCACCATTACGTCGGCTGCTACGAC
8   H09   BP3612-51                                         BP3612
                        GATCGATCAGTCCGCAGCGGAGATTGTCGACACCGCCAAGCGTACCGGCGC
8   H11   BP3613-481                                        BP3613
                        TCCGGCCATATGGGTGATGTCACCCGCACCGTTCAAAACCTCGACGTGGTTC
8   H13   BP3614-251                                        BP3614
                        GTGGTCGCGCGTTCCCGAACTCGCCTGAAGAAAACTTCAGCCAGAAGGTCAA
8   H15   BP3615-56                                         BP3615
                        CCACCTTCGTTGCCGAGAAAAATCAGCAAGTCGCTTTCCGTGTCGTGGCTGA
8   H17   BP3616-701                                        BP3616
                        GTGGTGAAGGCCGTACCGGCGAAGCTCGCGAACCGGTGAGCCCGTGGGGT
8   H19   BP3617-51                                         BP3617
                        AAAGGTGGATGCGGCTGTCGCGGGCAAAGACAAGAAGCCGATCAAAACCTG
8   H21   BP3618-191                                        BP3618
                        CCGATATCGACGAGTTGAAGGTCACCACCATTTTTGTGGACAAGGCTCAATC
8   H23   BP3619-511                                        BP3619
                        GGCCGTGTACCGCTTCACACGCTGAAGGCGAACATCGACTACGGCACCTCG
8   J01   BP3620-156                                        BP3620
                        CGCCATCAACCGTCACATCAAGCGTGGCGGCCGTATCTGGATCCGTATTTTC
8   J03   BP3621-41                                         BP3621
                        TCGGCAAAGAGCTCGAGAGCCTGCTGAAGGCACAATTCGGTCTGCGTATGC
8   J05   BP3622-116                                        BP3622
                        ACCCCATCTTTGGCAAGATCATCATGCGTTCGGCCAAGTACAAGGCGCATGA
8   J07   BP3623-466                                        BP3623
                        ACCGTCGGTGAACTGGAAGCATGGCTGCGTTCGGCCTATCGGCCCTACGGG
8   J09   BP3624-1196                                       BP3624
                        GACGCGCCAACAGCCTGCCGTTCGGCCTGTCTTCGTATGTGTTCACCAACTC
8   J11   BP3626-86                                         BP3626
                        AGCGCCGTTATGCCGGTATCGGCGACATCATCAAGGTGAGCGTCAAAGATGC
8   J13   BP3627-141                                        BP3627
                        CAACCCGATGGCCAACAATCCTGGCGGCATCGTCGAAAAGACCATGCCCATC
8   J15   BP3628-346                                        BP3628
                        GGCATCTCGGGTCGTGCGTTCGACGGCCGTGGCAACTACAACATCGGGGTG
8   J17   BP3629-71                                         BP3629
                        GCGCCGAATTGAAGGCGATCATCGACGACCAGTCGAAGACCGACGAAGAAC
8   J19   BP3630-41                                         BP3630
                        TTCGCAATGCGCAGCAAGTTGACAAAACCACGGTGACCATGCCCGCCTCGAA
8   J21   BP3631-401                                        BP3631
                        AGGGCCCGAACAAGCAAGTCGTCGGTCAGGTGGCCGCTGAAATTCGCAAGT
8   J23   BP3632-56                                         BP3632
                        CGCAGCTGCGAGTGCATCGCCTGTCGGTTTTCCGCTCGAACCTGCACATCTA
8   L01   BP3633-46                                         BP3633
                        GACGACGGTCTGCGCGAGAAGATGATCGCGGTCAACCGCGTGAGCAAAGTG
8   L03   BP3634-41                                         BP3634
                        TGATCGGCACCAAGCAATCCCACCGCGACACCATTCGCGGCCTGGGCCTGC
8   L05   BP3635-111                                        BP3635
                        CCACAAGGGCCAGAAGTCGCGTTCGGGCGGCTTCCACAAGGTTGGCTTCGA
8   L07   BP3636-921                                        BP3636
                        TCGTCAACCGCTGTACATCACGCTGTATTCGGTCGCGATCATTTTCTTCTGCT
8   L09   BP3637-106                                        BP3637
                        ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
8   L11   BP3638-41                                         BP3638
                        GCAAAGTTATCAAACGTCACGGCGTGGTGCGTGTCATCTGCACCGACCCGCG
8   L13   BP3639-166                                        BP3639
                        ATCCGTGAACACATTGGCGTGTTCGCGGTTGAAGGCGACCTGCGTCGTGAA
8   L15   BP3640-201                                        BP3640
                        GCAGGTCGCCGCTGAGACGGCTGGTCGCGTTGCCATGGAATATGGCATCAA
8   L17   BP3641-196                                        BP3641
                        TACGGCGTTCTGGAAAAGCAGTTCCGCAAGTACTTCGTTGAAGCCGAGCGCC
8   L19   BP3642-191                                        BP3642
                        ACGAATATTCGACCATTGCCGGTGTTCGCGAAGATGTCGTCGACATCCTGCT
8   L21   BP3643-281                                        BP3643
                        ATACCCGCGTGCTGAAGATGGGCTTCCGTCAAGGCGACAACGCGCCCATGG
8   L23   BP3645-131                                        BP3645
                        CTGTGTACAGGTGGAAAGGCGAGGTAGAGGGCGCCGACGAGATTCCTCTGT
8   N01   BP3646-1621                                       BP3646
                        CTGGATTTCTATGCCGACTGGTGCGTGTCGTGCCGCGAGATGGAGCACTTC
8   N03   BP3647-641                                        BP3647
                        TGGCGTCGTCGTGGACGCTCGAGCCCTGGCCATGGCTGGTGGTGCTGTTTT
8   N05   BP3648-81                                         BP3648
                        GGTACGCGAGAACACGCTCACCGCCAACGATCTGATTTACCCGGTCTTCGTG
8   N07   BP3649-96                                         BP3649
                        CTCCAACGCCGGCAAATCCTCGGCCATCAACGTGCTGTGCAACCAGCGGCG
8   N09   BP3650-521                                        BP3650
                        GCGCGGGCATTCCGGGCCAGTATCCCCGCCTGTCGGGACAGTTTTCGTCGT
8   N11   BP3651-1896                                       BP3651
                        TCTGGGCTGCGTACTGCTTATCCTGGGCATTTTCGCCATGTTCTATATTCGCG
8   N13   BP3652-1016                                       BP3652
                        CATTGCCGTCGCTCGAAGTGCTCGACGACATCATGTATCGGGCCATCGCGAT
8   N15   BP3653-616                                        BP3653
                        GTTGGCGTCGATTGCCATATCGGCTCGCAGCTCACCGACATCAGCCCGTACT
8   N17   BP3654-41                                         BP3654
                        TCGACAGTATCGAAAGCCAGGCGGACGATTGGGCCGCAGGCCTGGATGTCG
8   N19   BP3655-41                                         BP3655
                        CCAAGAGCGGTTCAGCGATTTTGCGGTTCTTCCTGAAGGCCGGCATCTTCTT
8   N21   BP3656-251                                        BP3656
                        CGGTCATCTTCGAAATCGAAGGCGAAGCCGGGTTTCGCCGGCGGGAAGCTG
8   N23   BP3657-691                                        BP3657
                        CAGGATGAGCGCGAGTCCGGCCTGCGCGCCATTCTCAACCTGGGGCATACC
8   P01   BP3658-81                                         BP3658
                        GCACAGCGAGCCGCCGCCAGAGAACCGCACCGAGTTCCAGCGCGACCGGG
8   P03   BP3659-456                                        BP3659
                        CCTGTTCGGTCGTTTCTCGATTGCCGACGCGTTCTACGCCCCCGTGGTCTCG
8   P05   BP3660-1051                                       BP3660
                        GAGGAAGAGATCGCCTTCTTCTATGTCAATGAAAAGGGCCGCAGCACGGTCA
8   P07   BP3661-941                                        BP3661
                        TCTTCGTGGCCTTCAACATCCTCGAAGCCCTGCAGCCTTCGCTGGTGTCGCG
8   P09   BP3662-56                                         BP3662
                        TGCGTTACAGCCCGGATGGGGCGGCCATCTGCAACGTGTCGATCGCCACGA
8   P11   BP3663-946                                        BP3663
                        TTCCGCTATTACTCGACCGGCTTGAAGTACCAATTGGCGGACGAATGGACGC
8   P13   BP3664-331                                        BP3664
                        CACACCTTCGAGGTGATCGGCGAGGAAACCGTGGAGCTGTTCACCGTCAAC
8   P15   BP3666-756                                        BP3666
                        ACTGGGCTATCGGACCTTCGAAGAGGTATTGTTCGACGGTTGGAATGCCATC
8   P17   BP3667-126                                        BP3667
                        CGCGGTCGGCAAAGACCTCCCGATAGAACGGCTGATATCGGCGCACTATTC
8   P19   BP3668-446                                        BP3668
                        TCGTCATCTCCAGCGTCGCCAGCGTCAACTTCCCCATCTACCGCCAGGAGCT
8   P21   BP3669-546                                        BP3669
                        CGTTCCGTATCCGGACGGCGGCGATCATCTGTTCGAGGAGGCGGTTGCGTT
8   P23   BP3670-301                                        BP3670
                        GCGGTCAATCCGCACTTGTACAGGAAGCGGCCGTTCGATGTGCGCAAGGAC
9   A01
9   A03   BP3671-336                                         BP3671
                        GGTGGTGCGCACGCGCCATCTGAGCAATCGCGTCAACTCGATGCTGTCGTA
9   A05   BP3672-221                                         BP3672
                        TGCTGATCAAGATCGTCAATCGCGCGCGCATCAATGAGCCGGGGCGGCGCC
9   A07   BP3673-91                                          BP3673
                        GCGCAGGCGTTGAACATCACGCAATCTGCCGTATCGCAGACGGTTACCCAG
9   A09   BP3674-566                                         BP3674
                        CGGACGCCAAGGTGCTGGTCGATGACACCAGCTTCTCGCTCTACAAGGAGT
9   A11   BP3675-246                                         BP3675
                        CATACCGCTGGGGATTTTCCTGGGCACGTCGCAACGCGCGCGGGCGGCTTT
9   A13   BP3676-316                                         BP3676
                        CGCGAAACCGCGCAGCAGTTCATCGAGATGGTCGGCCTGAAGGGATTCGAG
9   A15   BP3677-496                                         BP3677
                        GAGCTGGACCGCGATGCCCTGCAGGCGCAGTTGGGCACGCGCTATTACCGG
9   A17   BP3678-16                                          BP3678
                        ATCATGAAAATGATCGCAATCGGTGCCGGCGTCATGTTGCTGGCGGGGCTG
9   A19   BP3679-41                                          BP3679
                        CTGGCATGAGCATCCCCAAGAGCGAACTCACCTTTGCGGCCATCGTGGACG
9   A21   BP3680-1241                                        BP3680
                        TCAAGCTGCCGCGCCACACCATCAAGATGGGCATCATGGACGAAGAGCGGC
9   A23   BP3682-481                                         BP3682
                        CTGCGCTACAACCTGACCTGGAGCACCGAGGGCCTGATCAACGAATACTGCA
9   C01   BP3683-101                                         BP3683
                        CCGACCTGGCCCAGGCCAAGAACGATGGCGTGGTGACCTTCGGCAACCTGG
9   C03   BP3684-466                                         BP3684
                        GTCACCTACTGGCCGCAGGTCGTGCTGGGCATCTGCTTCAACTGGGGCATG
9   C05   BP3685-911                                         BP3685
                        TGCAGGGCCGCTGCATGCTCGAAGCCATCGAGCGCGAATTCCCTGCATCGG
9   C07   BP3686-111                                         BP3686
                        CGCCAACTTCAGCGCCCTGGTGTACCAGGCGCTGCCGGACATCAATTGGGC
9   C09   BP3687-401                                         BP3687
                        TGGCCGAGCATCCGAACATCGCCGCCGTCAAGGATTGCGGCGGCTCGGTGG
9   C11   BP3689-46                                          BP3689
                        GCTGCACCCATAATCGTTTTCGCGATCAATGCTTTTTTCAACGCACAAGGAAG
9   C13   BP3690-71                                          BP3690
                        CCCTGGGCTACCAGGGCAAGCGCGTGGCGGTCGAGCGCAACGGCGAAATC
9   C15   BP3691-421                                         BP3691
                        GAAGTGCAGTGGTTCTACCAGGAAGGCGCGTCGTGGCTGTTTCCCGACCGC
9   C17   BP3692-421                                         BP3692
                        GTGGAAGTGGTGCGCGACATGATCGCGCCCGACTCGCTGGCCGGCGTGCA
9   C19   BP3693-386                                         BP3693
                        TCGAAGAGCAGAACAGCAGCGACATCGTCACCGCCGTGGCCGAGAACCGCG
9   C21   BP3695-251                                         BP3695
                        TCCGCGGGCTGGAACGCGCGCTGGAAGCCGGCACCGACGAGATGAACCTC
9   C23   BP3696-726                                         BP3696
                        CGAGCAGGGCGCCGAGGCGCGTTACATGGATCCGAAGCAACTGGGCGCCT
9   E01   BP3699-521                                         BP3699
                        CGCGCTTCTATGTCGACCGCAACGTTTTCCCGTCGCTGTGGGATACGCCGAT
9   E03   BP3700-311                                         BP3700
                        TGGTCAGCCGCATCGCCGGCCAGAAAACCTCGTACGACGCCGGCAAAGACC
9   E05   BP3701-791                                         BP3701
                        TGAAGGTCTCGCCGGCCGTCGCCAAGGCAACCTACGAGCGCCTGTGCTGCG
9   E07   BP3702-406                                         BP3702
                        CACAGCGGCAGCGTCATGCGATTGGACCGCATCATCAACGTCAACGACGAG
9   E09   BP3703-636                                         BP3703
                        GGGCGCGCAGAAAGGACTGGGTTTCATGATCTCGGACGCGGCGCAGCTGTT
9   E11   BP3704-786                                         BP3704
                        GATGAAGTACCTGTCGGTCTCGCGCGAAGTGGCCAAGCACATCTACGACCG
9   E13   BP3705-41                                          BP3705
                        GGCCAGGCGCCAGCCAGGACAACCAGGTCAAGATCTCGTTCCAGGGCGTCA
9   E15   BP3706-236                                         BP3706
                        CCCATCCCATGGGCGGCCTGGCACGCAATCTCAACGAGGTCGTGCTGGAAA
9   E17   BP3707-776                                         BP3707
                        CCGAGGTCGTGGACGCCATCAACCAGGCCATGCGCGAAGCCTCGGCGCGC
9   E19   BP3708-746                                         BP3708
                        CCAACATCGTGCTGGTGAAGAACATCAGCATCCTGGGCGTGTATTGGGGCTA
9   E21   BP3709-666                                         BP3709
                        GCCGGTATTCGACCGCTACGCGTCCATACGGCGGCCGTTCCAGACCCGCGA
9   E23   BP3710-41                                          BP3710
                        TCCTTACCCCCGAACTCGAAAATTGGGTGGGCATCGACTATGACGACATGCC
9   G01   BP3711-556                                         BP3711
                        TATTTCGGCAGCCAGTCCTGGCCTTTCCCCCATTCGCTGATGATTGCCTTCA
9   G03   BP3712-736                                         BP3712
                        CAGATCATGCTCGACGCCTTGCTGCAGGCGGGCGTCGAACCCCTCTACGAC
9   G05   BP3713-726                                        BP3713
                        CATCTGCCTCACGCACGAATGGCATGCCATCGAACCCGACGGCGCCCAGGC
9   G07   BP3714-221                                        BP3714
                        CCGATATCGAGATCGATGCCGGCCAGGCCTGGACCGTGGCCGACGGACTGG
9   G09   BP3715-776                                        BP3715
                        CGCGCGCATTCGAATCGCATGTGCGTCAACCCAATATCGTGGCGGCGTATTC
9   G11   BP3716-841                                        BP3716
                        CCGTCCGATGACGCGCAGAAGGCCGGGCTGCAATCGTTCGTGGCCGCCTAC
9   G13   BP3717-641                                        BP3717
                        ACTACCTGGCGCAATCGCCGGGCTTTTTCCTCAACCTCTGGATGGCCGCGTC
9   G15   BP3718-821                                        BP3718
                        TGCTGGAGATCGACCGGCTGTCGGTGCGCTATGGCGCGCTGCAGGCGCTG
9   G17   BP3719-636                                        BP3719
                        GGCCGGACTGTCGGGGGGCCTCTACACATTCTGGACGGGCTACATCAGTCC
9   G19   BP3720-286                                        BP3720
                        ATCACCATAGGCATCAGCGTGGTACTGCAGGGACTCGCCGTGGTGACCTGG
9   G21   BP3721-71                                         BP3721
                        AGGACGACGGTCCATGGACCGGCCTGGCGACGTATTTCCACATCAATTATTC
9   G23   BP3722-381                                        BP3722
                        GCGCTTCAATGTCTGCCACGGCGCGTATCCGCTGCATGAGTACCGGGGCAT
9   I01   BP3723-151                                        BP3723
                        ATTGCCGAACCCGGCGATCCCGGCGTCATTACGCCCGAAGACGATGTGCTC
9   I03   BP3724-196                                        BP3724
                        CGCGCCTGGGTGGAGACCCAGACGCATCACCCGCTGGGCTATGTCGAACAG
9   I05   BP3725-246                                        BP3725
                        GTTTCGCCTGGTCGACCCGGAAATCGAATTCCATGCCTTGCTGCCCGACGGC
9   I07   BP3727-691                                        BP3727
                        GACGGCGTGTACGTGTTCGCGGGTTTTCGCAAGGGCGTCGAAGACTTCTAC
9   I09   BP3728-526                                        BP3728
                        GACGACGAGCACACCATCGACACCATGCGACGCATCTATGCGCCGTTCCAG
9   I11   BP3729-856                                        BP3729
                        TGTACCTTCGCCGCGCAGATGGCCTCGTACGTGGCGCTGCCCTTCTATTTCC
9   I13   BP3730-796                                        BP3730
                        ACGCTGAGCTGTGGCCGCGACGTGTTCATCGACGTGGGGTGCGTGTTCGAG
9   I15   BP3731-461                                        BP3731
                        TTCCTCCCTCCATCAACGCGGCGGCCCAGTCGGCGTCGCAGGCCTGGTGGG
9   I17   BP3732-471                                        BP3732
                        GCTGGCTGGCCGTGAAGTCGAGCGCAATATCCGTGAGCAACAGACGGTGAC
9   I19   BP3733-1                                          BP3733
                        ATGGATACGCCGATCACCCTGCCCGAGCTGGAACAAGCCATCAACTACTGGC
9   I21   BP3734-341                                        BP3734
                        ACACGCCCGAAATACTCAAGCAGTACGTGACGACGTTCGATCCGCGCTTCCT
9   I23   BP3735-41                                         BP3735
                        AATACCTCGTCCTGACCAAGCCGCGTGTCACGCAGCTGGCGGTATTCTGCG
9   K01   BP3736-651                                        BP3736
                        GGATTTCCATGGCGGTTTTTCGCTGATTCGCGCGTTGGGCGAGCTGCCCTCG
9   K03   BP3737-281                                        BP3737
                        CCGAATCTTGCGCCCGCAAGCTGTTCATCACCCGCAACAGCCACGCCAGCC
9   K05   BP3738-606                                        BP3738
                        CGACTGGCCGCAGCCCTCGGTCGATTACAACCAGAACATCGGCTATGCCATG
9   K07   BP3739-46                                         BP3739
                        CTGGCATCCGCCCTGGTCTACCTGATGAAGGACAAAGGCAGTACCAACCGCA
9   K09   BP3740-221                                        BP3740
                        CCGAGAGCGGCTTGTACAGCAAGCGTATCGACGCGTCGTACCGCTGGGGGA
9   K11   BP3741-41                                         BP3741
                        GCTTTTTCCAGACCATGAAAGCCGTGCTGTGGGGCTTTTTCGGGGTGCGCAA
9   K13   BP3742-46                                         BP3742
                        CTGTTGGCGCTGGTCGCGGCGGTGTTCGTCTGGACTTTTATCCGCGGCGCC
9   K15   BP3743-46                                         BP3743
                        GGTCACGATGACCACCACCACGCCATGCCGAGCGGCTGGCGCCGCTGGCTT
9   K17   BP3744-801                                        BP3744
                        CAAGTGGGTCGCCGATCAGAAAAAGAAGATGGCGGCTTCGGCGGACGATCC
9   K19   BP3745-251                                        BP3745
                        CCCAGGTTGCGCAATCTTTACGCGATGCCCGTTGCCTGCGTGGGTGGCGCG
9   K21   BP3746-586                                        BP3746
                        GTCTTCAACGATTTCATTTTCCATTTCGTGGGCGGCGGGTTGGCCGGTTTCC
9   K23   BP3747-596                                        BP3747
                        TGCACCAGGAATTCGACTGCCGCCGCCACAACCTGCGCATGCTGGCCACGC
9   M01   BP3748-356                                        BP3748
                        CCGAGCGCGGGGTGCGGCTGGTGTCGTTCGCCGTGCACTGGATCAAGGCC
9   M03   BP3749-466                                        BP3749
                        AAGCGGCTGGTGCCCAACTGGCTGCCGTTCGTGGATGTCCAGTTTGGCAGC
9   M05   BP3750-46                                         BP3750
                        TGGCAACGCTACTATCGCCATGCCTCGAAGGAGATCGGCCTGCCCATGCGC
9   M07   BP3751-106                                        BP3751
                        GCCACCGGCATCTGTCACACCGATTATTACACTTTGTCAGGTGCTGATCCGG
9   M09   BP3752-556                                        BP3752
                        GAACAGACGCAACGCATCGAGCAGGCGGTATCGGGCCAATGGGCGCTGGG
9   M11   BP3753-2536                                       BP3753
                        GCGTCGCGCTCGAACAACTACCGCACCTACAAGGAATACGCGCAGATCATCA
9   M13   BP3754-1001                                       BP3754
                        GCGAGGACAAGCCCATGGTCTGGCCGTACTGGCCGCTCAAGCTGCGCACCT
9   M15   BP3755-126                                        BP3755
                        GGTCCGCCCCAAATCGAACAACGGCAGCGTCCTGAACGGGTCGGTGGACCT
9   M17   BP3756-316                                        BP3756
                        ACGCTCATGCCCGCCATCCCCTACGATGCGCAGAAAGACCTGGCCCCGGTC
9   M19   BP3757-726                                        BP3757
                        CTACGTCAAACAATTCCTGAACGGCGAGCCGGACGGGCCGGTGGCGTTCCA
9   M21   BP3758-601                                        BP3758
                        CTCAACGGCGTGATCAAGAGCCTCGTGTTCGGCGTGACCGTCACCCTGGTG
9   M23   BP3759-76                                         BP3759
                        CTGCGCGCGGGCAACCTCAGCACCTTCTCCTTCGCGCCCACCTATCAGCTG
9   O01   BP3760-316                                        BP3760
                        TTCAATACCACCATGGGGATCGGCGGCTGCTTCGACGTCGCGTCGACCACC
9   O03   BP3761-416                                        BP3761
                        TCGTGGTCCGTTCGCTGATCAGCCAGAGCAACAGCCAGCCGGTACAGGTCG
9   O05   BP3764-641                                        BP3764
                        AGGCGGTGTCGCACTGGAACCCCATTTTCTACACGATCGACGGCTTCCGTTA
9   O07   BP3765-181                                        BP3765
                        ATGAAGGCGGAGATCCATGCGCTGTCGATGCGCACGCTGACCCCCGCCGAG
9   O09   BP3766-1151                                       BP3766
                        AGGGCGAGACCCTGGTCGACCGCATCTACCATCTCGATCGCGGTTACGATC
9   O11   BP3767-266                                        BP3767
                        GGCGCCTGTACCAGCCCATCGACCTGAACATCGCCAAATGCCGCCTGTGCG
9   O13   BP3768-421                                        BP3768
                        TATCCGTCGTCGGTGCTGATGAACGCCATTCCGGCCAAGGTTGCCGGCGTG
9   O15   BP3769-981                                        BP3769
                        GGTTAGAAACTTCTCGAATGCTCACCCGCTGCTGGCCGACTGCCTGCGTATC
9   O17   BP3770-431                                        BP3770
                        TGGTCAATCACGCCCTGATGACCCTGCACATCGACAACCTGCGCGGCTTCAA
9   O19   BP3771-406                                        BP3771
                        CTGAAAGTCCCGCACATGGGCTGGAACCAAGTGCGGCAAACGCGCTCCCAT
9   O21   BP3772-426                                        BP3772
                        GAGCAAGCTGACGCGCCACGACGTGCTCGACCTGGCCAAGAAGTTCGAGGA
9   O23   BP3773-51                                         BP3773
                        CATCATCCCCTGCCTCGACGTGACCGCCGGCCGCGTCGTCAAGGGCGTGAA
9   A02
9   A04   BP3774-201                                         BP3774
                        GTCCGGCCATGCCCAGGACGTGCACGAACTGCGGCTGGACTGCGACGGCG
9   A06   BP3775-206                                         BP3775
                        TTAGTGAAACCGCTGATCTCTGGTTCCACTGTCTGGTAGCCTTGACCCATTAC
9   A08   BP3776-256                                         BP3776
                        TTTCGCCTGATGGCCAATTCCGGGGCCGAAGGCGGCCAGGAAGTACCGCAT
9   A10   BP3777-71                                          BP3777
                        AACTGCGCAACGTCGGCTCGGACCTGGGAAGCGCCGTCAAGGGCTTCAAGG
9   A12   BP3778-106                                         BP3778
                        CTGGGCCGGGCGCAGCGCTATGTCAATGACGTGAAGTCCGATATCCGGCGC
9   A14   BP3779-396                                         BP3779
                        GGCGTTCTGCTATTTCTTCGTGTTCCGCACGGTCTTTCACTTCATCGCCACG
9   A16   BP3782-806                                         BP3782
                        TCCTGCTCAACCGCCACATCAACGAGGCGCTGCAGTCCAAGGCGGTCGTCG
9   A18   BP3783-131                                         BP3783
                        ATGACTCCCGCCCGCCGGAGGACGTTTTCCAGAACGGATTCACGGCGTGGG
9   A20   BP3784-316                                         BP3784
                        GCATTCGACCTGAAAACGACGTTCTGCATCATGACCACGCGCAATACGGGTC
9   A22   BP3785-316                                         BP3785
                        ATGGAAGTCATGTTGCGCGCCGTCTTCATGCAACAACGGCCGCTGCGCATG
9   A24   BP3786-256                                         BP3786
                        TGGTTCGACACCATGCTTGGCTTTGCCATATCCGCGTATGCGCTCAAGAGCC
9   C02   BP3787-196                                         BP3787
                        AACGCCGAATTGCAGACGTATTTGCGCCAGATAACGCCCGGCTGGTCCATAT
9   C04   BP3788-146                                         BP3788
                        TCGTACTGCGCGGCGCGTCAGTGGCCACGGTGACCATCGCCATAATCTGGG
9   C06   BP3789-196                                         BP3789
                        ATCTGGCTTTACCTGCGCATGCGTTGGCTGAGCCGGGACCGCACGCATGCG
9   C08   BP3790-1801                                        BP3790
                        GGCGCCGGTGGCACGGGAATGCTGTGGTGGGTCTTCGACAATCCGAATGAT
9   C10   BP3791-346                                         BP3791
                        CGCCAGCTCCAGCCGCTGGTCTATTCCATGATGACGCTGCTGGTACTGTTGA
9   C12   BP3792-101                                         BP3792
                        TGCCGTATCCCGATGGCAAGCCCCTGATTCCCATCAACACCGCCGCCCCGG
9   C14   BP3793-166                                         BP3793
                        GCCATCGCGACGATGCTTCCGCTCAAGACCACCATTCCTTACCTGATCGAGG
9   C16   BP3794-596                                         BP3794
                        GGCTCACGTTCAGACCGGGTCAGCCGTTTCCGGCCGTATTCGCGGTAGCGC
9   C18   BP3795-741                                         BP3795
                        CTCGCAACGCATCTACGTCGCATGGAGCCGGCTTTTCATGCCGTCCGGGCT
9   C20   BP3796-66                                          BP3796
                        GCTGAGCCGGCAGGATATAGCGGAAATCTGCGTGAACCGTCCGGGGCAGCT
9   C22   BP3797-251                                         BP3797
                        CGCAATGGATTCCCAGCGGCCTGGTCTCGGTGGTGTTCTCCGCGGCCACGA
9   C24   BP3798-651                                         BP3798
                        CGCCCTGTCCACCTACCATTTCGCCCGCATGTTCCATGTTTCGTTCGGGGTT
9   E02   BP3799-101                                         BP3799
                        AAAAGGCGCTGTGGCTGTACTTCGCCGTGCAAAACCCCGCCACCCCCAAGTG
9   E04   BP3800-581                                         BP3800
                        TGCTGATCGTGCTCTCGACCGCCAGCTACCGCTTCGTGTGGGCCACCACCC
9   E06   BP3801-401                                         BP3801
                        ATCGCGACGAGCTTGCCATCCTGGCATCGTGCGCGCGGCCGCTGTTGCCGG
9   E08   BP3802-471                                         BP3802
                        CCTGTACATCATGAGCAAGTCGTGGTCGGAAAAGAACAAGACCACCGAGGCG
9   E10   BP3803-51                                          BP3803
                        GACCGTGGCATTGATCGCCTTTTCGATGTTCCGCTATGTGGGCGATCCGATC
9   E12   BP3804-41                                          BP3804
                        ACAGCGATCTCTGGCACAGCTTCAAGCGCTCGCCCGGGGCCATCATCTCGG
9   E14   BP3806-881                                         BP3806
                        GCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCT
9   E16   BP3807-866                                         BP3807
                        TCGAGGAAGCCGGCAATACCGAAGAGGCCCTCAAGGTGGCCTACGCGGTCG
9   E18   BP3808-506                                         BP3808
                        TCGCGGCCTCGGGCGACAACGTGCTGATCTACGCCACCTCGAACCGCCGCC
9   E20   BP3809-166                                         BP3809
                        CTGCATGAAGAGCTGGGCATCCGCGTGACCGAGGCGCACCCCTGGGTGACC
9   E22   BP3811-381                                         BP3811
                        CGAGCATCAGGCCCCCGGCGATCTGCTGCACATTGACATCAAGAAGCTGGG
9   E24   BP3812-196                                         BP3812
                        CAATGGTGGCAGGTGTATGGCGACCCGGTGCTCGACGGCCTGGTGCAGCAA
9   G02   BP3813-1946                                        BP3813
                        TGGCGCAGCAGGATATCCATATCGGCGGGCGCCAGAGTTCCGGCTCGTACG
9   G04   BP3814-2191                                        BP3814
                        CTGATTTCCACCGTCTTCACGCAGTCCAACCAGTACCGGGTGGTGCTGGAGG
9   G06   BP3815-926                                         BP3815
                        TTCCCAACCAGTTCGTCAACGTGCGCCTGTATGTCGAGACGCGCAGCGGCA
9   G08   BP3816-611                                         BP3816
                        GCGTCTGGGTCGATCCCAGCCTCGGCGTCTTTCCCGAGATCAGCGCCAACA
9   G10   BP3817-506                                         BP3817
                        CGGACGACGTCATCGTCAACGATGGCGCCACCTCGCCCGATACCTTGCGCG
9   G12   BP3818-691                                         BP3818
                        TATCTGTTCCTGTGGGTGATCTTTCATTTCTTCCGCCTGCTGACCGGGCGCG
9   G14   BP3819-616                                         BP3819
                        GCCAACAACGTGCTGCGCGTACGTTCGGTGGGCGGCCGTACCCCCAACCTG
9   G16   BP3820-136                                         BP3820
                        CAGGTGGCCGCCTATCTGGCGGCAGGCAAGGCAAACAAGGTCATTGCCATC
9   G18   BP3821-351                                         BP3821
                        GTTCCGCCCGGGTTTTTTCACGGGCGTGTGCACCGTGGTGATGAAGCTGCT
9   G20   BP3822-211                                         BP3822
                        CTGATCCGCAAGCAGAACTTCAACGTGCTCGACATCCCGATGGCCGATGTCA
9   G22   BP3823-111                                        BP3823
                        GGCGCAGAACACCGAGCTGCTCGAAGGCTTTCGCGCCGCCCGCGTGCCGC
9   G24   BP3824-1136                                       BP3824
                        GCGGTTTCTTCCGTTCGCTGCAATTCACGGCGGTAAATACGCTAACCTATGC
9   I02   BP3825-586                                        BP3825
                        CACGCCCAGGACTGGTCGGACGATATCCTGGCCCTCTTGAACATTCCGCGC
9   I04   BP3826-41                                         BP3826
                        CGTACCCAATGTTGTATTCCTGGATCAAGATCGTGCACGTGGCGGCGATGGC
9   I06   BP3827-386                                        BP3827
                        CCCCGGTCACCATCGTGGCGTCGGTGCCCAACGTGCTGGTCATGAACCTCG
9   I08   BP3828-156                                        BP3828
                        CCGGCTGGAGGAACACCAGCAAGGGCACATCATCGTCGACGGCACCGAGCT
9   I10   BP3829-221                                        BP3829
                        CGGAGGGGGCCTGCTGGGCCTTCATCGTCGAGAAGCATCGGCTGATCCTGT
9   I12   BP3830-206                                        BP3830
                        GTTTCGCGATAGGCGAAACGCCCATCGCCTATTCCCCTTCGGACACGTATGG
9   I14   BP3831-76                                         BP3831
                        TTCGACAACGTGAAGAAGAAGGGCTTTGTGCAATGCGGCGTATCGACCGGG
9   I16   BP3832-46                                         BP3832
                        AATATCCTGGCCGACATCAACTTTCGCATCAGCGCTGGAGAGTTCGTCTTCG
9   I18   BP3833-581                                        BP3833
                        TGTTCAATACCGTGCGCATGCAGGCCATGACCCAGCGCGAGGAAATCGCCG
9   I20   BP3834-216                                        BP3834
                        CCATTCGCCGGCCTCGGCCACCATGCGCTATGGCGCCTTCGCCATGGAAGT
9   I22   BP3836-46                                         BP3836
                        CGCCACGGCCGCCACGATCTGCCCTGGCAGAACACCCGCGACCCCTATCGC
9   I24   BP3837-181                                        BP3837
                        AGCGTCACCTGGTACACCTGGATCGAGCAGGGCCGCGAAGTCACCGTATCG
9   K02   BP3838-326                                        BP3838
                        ATGGCGAGTTCGACCTGGTAATGAGCCGCTATTCCACCCATCACTGGGAAGA
9   K04   BP3841-256                                        BP3841
                        GATCTGATCTTTTCGCACGCCGACGTCTTTGCACATAATCTCAGACCCGGATC
9   K06   BP3842-1036                                       BP3842
                        CTGATCCATGGCGGGGTACCGCTTGGCGCGTTTTCAGAAAACGGGATGCGT
9   K08   BP3843-111                                        BP3843
                        CACTTCGGTGGGGACCACCACGGACACGGTCGCGAGATTCGTCGCGGACGG
9   K10   BP3844-216                                        BP3844
                        GCAGGGGGTGATTGGCGACCTTGGGGCCCATTTGCGTCATCAGGACTTGAT
9   K12   BP3845-456                                        BP3845
                        GATTTTCTTCACCAACGACGAGATACTGGCCGAAGGCGCGCTGGTGGATACC
9   K14   BP3846-336                                        BP3846
                        CGACCGCCTCAGGATCGCCATCATCGGACACCTGTCCGCGCTGCTCATGCA
9   K16   BP3847-346                                        BP3847
                        GAAGCGTTCTCATGGTCCAACAATGGCTGTTCCGCCAAGGACCAGCAACAGC
9   K18   BP3848-661                                        BP3848
                        TGCGATGCCGGCCTGGAAATGGCCTGGCGCATCCATCGTCCGGCCTACGAA
9   K20   BP3849-401                                        BP3849
                        GTGTGCGGGAAATCAACGATCGCATCATCTATGCGTCGATCAAGGCCTTTGG
9   K22   BP3852-391                                        BP3852
                        AACACGCCCGTGTTCTTCATTCGCGATCCGCTCAAGTTCCCCGACTTCATCC
9   K24   BP3853-481                                        BP3853
                        GTATTGATTCATTCCGTGCTGTGGGCAATGGCTGTGAATATGTACTCGGGCT
9   M02   BP3854-176                                        BP3854
                        TGCTCAAGGCCGCGGCCGGTTTTCTGGCGCCAAGCGAGGGACAGTTCCTGC
9   M04   BP3855-881                                        BP3855
                        TCCTGATCCGCATCATCAGCAATCCCGAGGTGCAGTTCAAGGTGGCGCCACA
9   M06   BP3856-366                                        BP3856
                        CGCCGGCAAATACTGGCATTCGGATATCTCGTATAAGCCGCTGCCCAGCCTG
9   M08   BP3857-1056                                       BP3857
                        CGATGGCGATCATCGGCTGGAAACCTACCACGGCATGGGGCCGTGCCAGCT
9   M10   BP3858-366                                        BP3858
                        GAGGGACATCATCGGGGAGGCGCCCGTGGCCCATGGCATGGTGCTTTCCCG
9   M12   BP3859-796                                        BP3859
                        CTGATCGCGTCGATTCCCACGCCGGATACGCGCGGCAAGCCGCTGGACCAG
9   M14   BP3860-806                                        BP3860
                        CCGGCCATTACTGGATCTCGTTCTTTCCGGGTATCGCGCTGGCGATTGCCAT
9   M16   BP3861-176                                        BP3861
                        CCCTGTGGAAGCAGTACCTGATCTTCATGGGCCAGGCGGTGCGCGGCGACT
9   M18   BP3862-111                                        BP3862
                        GGAGCCCAGTTCGATGGATCCGCAGTACCACGCGCTGACTCCCAATACCCA
9   M20   BP3863-511                                        BP3863
                        ATGCTGGTGGAAGCCACCCTGGACTTTCCCGAAGAAGAAATCGACTTCCTCG
9   M22   BP3864-676                                        BP3864
                        CTGGGTCTGTTCGCCCAGATGGGCCTGGTCGCGCACCTGTACTCGCTGCTC
9   M24   BP3865-501                                        BP3865
                        CGAACCGTTGAACAAGCAACAGATCCTCGATCGCATCCAGTCCAGCGACAGC
9   O02   BP3866-416                                        BP3866
                        CGCGGCCGATGGATCCGCCGCTTTACAACGATAAAGGGGGACGTATAATCG
9   O04   BP3867-841                                        BP3867
                        GACGCGTTCGACAAGACGATGACTTCGCCCGAATACGCCAAGCTGCGTGAA
9   O06   BP3868-126                                        BP3868
                        CGAAGCGCCGTTTGCCTACGAACCTGTAGGGCCGCGCGCATTTCCGATGCT
9   O08   BP3869-691                                        BP3869
                        GCCGGACACAGTATCGAGGTCAAGCCGAGCGGCCGGAAACTGTTCAACCTT
9   O10   BP3870-1051                                       BP3870
                        TCGGCGTTCTACCAGAATCCCGCCGCGCCCGAATCCAACCACCATCTGGTGC
9   O12   BP3871-56                                         BP3871
                        TCACTCCGGACAGCGGCGGTACTGACGTATTCGCACATTTCTCTGCGATTCA
9   O14   BP0006-266                                        BP0006
                        GCATCGTCATTACCCATGGCACCGATACGCTGGAAGAGACCGCTTATTTCCT
9   O16   BP0019-861                                        BP0019
                        GCGCCAGAATATTTCCTATACCGTCGCCAGCCCCTGGCATAACGCCTTGGCC
9   O18   BP0021-566                                        BP0021
                        AGATCCCGGCGACCTCGCGCACCCTTGATACGCATTTGTCGAATATTCGCCA
9   O20   BP0024-221                                        BP0024
                        AGAAGCCTTCCGGCCTTGCGAGTCTCAGGAAAATGCTGGGCGCGGCGGATG
9   O22   BP0042-1                                          BP0042
                        TTGTCGCCGATTTCATTTACTCCCGCCGCGGACGGCGTCAGCCTGGCCAATT
9   O24   BP0046-831                                        BP0046
                        CCGACACCTACCTCGAACGCGTGGAAACCCTCATCGAGGCCATGCTCCACG
9   B02
9   B04   BP0051-656                                        BP0051
                        TCTGGAACCTCAACGCCTCGTACAAGTTCGAGACCGCCAAGGTGTTTGGGTA
9   B06   BP0054-16                                           BP0054
                        AATGTCAGCAAGTGGTATGGCGCGACGCAGGTGCTCAATGACTGCGTGACC
9   B08   BP0059-131                                          BP0059
                        AGATGCCGTTGCACCAGGAAAAACTCTACGAATCGACCTACCAGCTCGTCGC
9   B10   BP0063A-226                                         BP0063A
                        CCTCGCTCCGGTCGTCTATCAGACAATGTCTACTTGACAGGGGGGGCTTACG
9   B12   BP0068-121                                          BP0068
                        CGCAGAGCCATTTTCCAAGAGCAAGCAACTTGGGGGCCTGAGATTGCGATGT
9   B14   BP0070-156                                          BP0070
                        CGACCAGTGCGGAACCACCAAGTTGTTTGCAGTAGGTAGTTATACAGACAAA
9   B16   BP0073-431                                          BP0073
                        GGCACCTGTCGCGTAGCGGTAAAGCTTGCACTGCGGGCAGTGCCCTCGAGC
9   B18   BP0081-791                                          BP0081
                        GACAGGCTGCCTTGCAGCCCTTCATTGACCGCTACAACTGGCATCGACCCCA
9   B20   BP0083-331                                          BP0083
                        CTGGTCCGCCGCCGCGTGGATTTTGCGGAAGGCTTGTACCCCATAGTCCTC
9   B22   BP0101-91                                           BP0101
                        GATCGCGCCGCCCTCAAGCCTTATGTCATCGTCTCGGCTACCTCGGTCAGCG
9   B24   BP0111-331                                          BP0111
                        GCGCTGTACCGGCGCGGCATCATCATGAACCTCACCAATCCCAAGGTGCTG
9   D02   BP0125-651                                          BP0125
                        GGAACAGATCGGCCATGCCGAAACGCTGTACCGCGAGCCCGCCACCGAATT
9   D04   BP0127-656                                          BP0127
                        GCTGGCCACGCAGATCGACGTGCTGCCTTTGACGATCTATAACGAATTCACC
9   D06   BP0129-26                                           BP0129
                        CATCTATCATCGAGATCGCCCGCCACGGTATCGCGCGCCTTCAACCAGCCCG
9   D08   BP0136-606                                          BP0136
                        GGCAGCATGGCCTACATGGTCGTGGCGGTGTCGATGGGTGGTTACTACCTG
9   D10   BP0138-16                                           BP0138
                        GCCAATTCGTACATGATCGGCGCCACCGTTCCGCTGGGCCGCTCGTCGGTG
9   D12   BP0140-416                                          BP0140
                        CCGGCTGGCTGCGGCTCAGCTTCTGGCCTTGCGTGGCCTACATGGCCATCG
9   D14   BP0146-216                                          BP0146
                        CTACCGCGACTGGCAGTCGGGCCAGGTGCTGATGCGCAACCCGTTGATGCC
9   D16   BP0150-16                                           BP0150
                        GACCTGAATTGCGACATGGGCGAAAGCTACGGCGCCTGGCGCATGGGCAAC
9   D18   BP0165-6                                            BP0165
                        TTACCCTGAACTCTTCAAAACCATGGAAGCGGTGCGCTGGAATATGGCGTCC
9   D20   BP0167-1206                                         BP0167
                        GCACGGCCAACTGCTGGAAACGGCGGCCACCGAGACCCTGTTCACGCATCC
9   D22   BP0176-21                                           BP0176
                        CGCCCGGCCTTCAGTCGATTCGGAAGCACCACTCATGAACAGTACGCTCGAT
9   D24   BP0188-221                                          BP0188
                        TGGCGCGCGGGCACACAATGAAACAACGTCACAAGGCTGAAATCTGGGGTA
9   F02   BP0201-1                                            BP0201
                        GTGACCCGGCAGGAGAGCCGCATGTCCGCACCCGCCTGCGTGTCCGAGTTC
9   F04   BP0230-56                                           BP0230
                        TACAATCCTATTATATTTATAAGATCCCAAACGTCATCCAGCCTGGAGGAGAC
9   F06   BP0232-831                                          BP0232
                        ACAGGATTACAGCGCGATCTACCCGGTCATGCGCAGCCTGTCGGGATTGCC
9   F08   BP0236-791                                          BP0236
                        ACGCTGGGAGGTGCTGAACAACACGTACAAGCCGTATCCCTGCGGCGTGGT
9   F10   BP0255-181                                          BP0255
                        TCGATCTGGGAAGGCACCAGCAACATCGTGGCGCTGGACGTACTGCGCGCT
9   F12   BP0257-116                                          BP0257
                        TGTTTCTGTCCTACCGGCCGCCACAGGGCTGGTACGGTGAAACCGGGGTGA
9   F14   BP0265-301                                          BP0265
                        ACCAGCCTGGCGCAGCTGTTCCTGACCGACGTGATACCGGAGTTCCGCGGC
9   F16   BP0267-101                                          BP0267
                        TCGGTTATGAACAGGTCAAGTTCAAGGGCCAGTCGCAAAGCCGCATCGGCG
9   F18   BP0272-31                                           BP0272
                        GTGGTCAGTCATACTGCCGTGTCTCATCTGGTACAGGTAGGCGTGAGCCTGT
9   F20   BP0292-536                                          BP0292
                        GCAAGGGCACCAAGTATCTGCCCGAGTTCCACACCTCCACGCCCGATACGG
9   F22   BP0306-1991                                         BP0306
                        GCGCGGACATGATCGATTGCTCGTCGGGACAGGTCAGCCCCGACCAGCAGC
9   F24   BP0308-566                                          BP0308
                        GCTACACCGAAACCGACATCGTGCGTGGCGCGGTGGCCAACATCGTGGAGA
9   H02   BP0335-356                                          BP0335
                        CTGATGCAGGAAGTGCTCAAGACGCTCACGGGCGAGCCCTTGCGCATGTCG
9   H04   BP0336-36                                           BP0336
                        CGTTCCCAGTTACAACCCCACCGTGGTGTACGGCGCCTGGCCGTATCCGGC
9   H06   BP0366-526                                          BP0366
                        ACCCTGTTCCACGCCTATGACGTCCCGTTCGGCAAGGACGCGCCCGAAGAC
9   H08   BP0389-201                                          BP0389
                        CCTGCGCTGCCGCGCCGGCGAAATCGACCTCGCCATGCGCGACGGCGAAG
9   H10   BP0393-781                                          BP0393
                        TTTCTTACGGTTGTCGCGGCCGCCCTGCTGTTCAATGAGCAGGTCGAACCCA
9   H12   BP0400-11                                           BP0400
                        GTTACATTGTGCGAACAATGCGGCCGGCCGACGTGGAGGCAGTGCTGCGAG
9   H14   BP0401-906                                          BP0401
                        CAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTACATGGTG
9   H16   BP0407-1171                                         BP0407
                        TTCCCGACCAATCCGCCCTCGCTGGGGCAGTCGGCCCGTTCCAAGCCGGTG
9   H18   BP0409-6                                            BP0409
                        TCGCAGGACGAGCATCGAACGCTACCGCAACATCGGCATCAGCGCCCATATC
9   H20   BP0413-296                                          BP0413
                        AGAAAATGATCGAAAAGGCGGCCGAGGCCAACGAAGCCCTGCTCGAAAAATA
9   H22   BP0423-61                                           BP0423
                        CAGGCCCGGCGGCATGGCGAGAAGACCTTTCTTCATTTCCTGCCGCGCGAC
9   H24   BP0434-296                                          BP0434
                        ACCCGCTGCTCATGAAAAGCGGCTTCTCGCCGTCCGATCTCGAACCGGCCG
9   J02   BP0440-6                                            BP0440
                        CATTCCCAGCCTTAATTTCAATCTGGGCGAAGACCTGGATATGCTGCGCGAC
9   J04   BP0444-291                                          BP0444
                        CAGCCACACGGGCGAGCTGGTATTCGAAGACTGCGAGGTGCCGGAAGAAAA
9   J06   BP0445-861                                          BP0445
                        GCTGTTCAGCTTCACGCGGGCGTATTTCCTGGTGGACATGGAAACGCCGGC
9   J08   BP0458-26                                           BP0458
                        GCCATCGCATTGATTTCCGGAACCGCGTGAATTACATCGGCCGCTTCGCCCC
9   J10   BP0472-46                                           BP0472
                        CCGTCGCGTCACGTGGACGCGCAGGGCTACACGGTCGAGGACTTCGGCCTG
9   J12   BP0482-16                                           BP0482
                        ACCGGGCGCGATGCGCCCGGTCAGGAAGGCTGTGGGAACCTATTCATGATT
9   J14   BP0485-11                                          BP0485
                        CCCACATGGAAACCGTACACGTCATCGTCAAAGGCAAGGTGCAAGGCGTGG
9   J16   BP0497-6                                           BP0497
                        AACCCTCGTCATCCTGTCCTCGATCCTTGGCGATCGTTCGAATTCCAAGCAA
9   J18   BP0512-6                                           BP0512
                        AACCACTTACATCAGCGATGAGCAGGCGGTGCAGGTAATGGCCCAGCTCGG
9   J20   BP0524-546                                         BP0524
                        CCTACTCCATCATCGCTGCATCTGCATCCGCGAAAACGACGAGGACGCCAGC
9   J22   BP0536-396                                         BP0536
                        CAAGATCCCGGCCCGCAATGTCCAGGAGCTGATCGAACTGGACCGCAAGAA
9   J24   BP0560-386                                         BP0560
                        TGAAGACCTCGCCCGAACCCAGCAAATATGGACTGGCGCCCGAACTGCTGC
9   L02   BP0580-526                                         BP0580
                        CTGCGCGCCGAGTGGCTGCACACGTGCGAGGAGCGGGCGGTGATCGCCAG
9   L04   BP0602-551                                         BP0602
                        GCATCGACCTCACGCAGATCCCGTATCCGGGCTTTCCGCAGGTAATCACCGC
9   L06   BP0614-121                                         BP0614
                        GTGCTGGAGAAGGCCGACAAATTCGGCGGAACCACGGCGCGTTCCGGGGG
9   L08   BP0623-766                                         BP0623
                        GACTGGTCCATACTCAAGGTCACCTTCAAGCCCTATCCCGTCTGCGCGCTCA
9   L10   BP0626-596                                         BP0626
                        TCATCAACCCGCCGCAATCGGCCATTCTCGGCGTGGGCAGCATACGCGAGC
9   L12   BP0631-246                                         BP0631
                        CTGCCCGGAGATGGCGTTCAGCATGTATCCGGTCATCGTGCAGGCGGCGCT
9   L14   BP0632-576                                         BP0632
                        GATGAACATCTGCTTGCGCTCCGGGCTGGGGTTCAGCAAGTGGATCACCAC
9   L16   BP0648-911                                         BP0648
                        GTGGTCTTCTCGGGCCCGCAGCTTTCGTTGTACGAAATGCAGTCGCTCTCCG
9   L18   BP0684-451                                         BP0684
                        TTTCCGGCCGGCTACATGACGCCGGCGCTCGAACCCGATGAAATGCTGGTC
9   L20   BP0686-61                                          BP0686
                        CTGGGTCCGGACAAATACCAGGGTTCGGTGACGGTGCGCCTGGGGCCGATC
9   L22   BP0691-226                                         BP0691
                        AAGCCGCAGGATTATCTGTACCACCAGTTGCTGAATTTTCGCGATGCCCGGC
9   L24   BP0696-81                                          BP0696
                        GCTGCGGCATTTCGATCATGTTATCGATACCCAGGTCATGCTTTCGGTAGAG
9   N02   BP0703-1226                                        BP0703
                        ATGCGCGTCACCGCGTGCGTACGCAAGGCTACTACTTGCAGGATCAACTGCG
9   N04   BP0705-796                                         BP0705
                        CTGGAGAAGTTCGGCGACCCGCTGCATGATTTTCCCGCCTTCACCGCGTCG
9   N06   BP0713-31                                          BP0713
                        CAAGACCCAGAAATTACGACGACAACTCAAGAATCCCCCCATTCTCGGCGCG
9   N08   BP0715-51                                          BP0715
                        GACTGATTACCAGGGCGAGATCCTGCTTTCTGATCTGGATCCTCCCCATTCC
9   N10   BP0716-916                                         BP0716
                        CTGGACGAATACAACCTATTGACAGTTCACACCTACCGAGTACGAACTGGTG
9   N12   BP0738-136                                         BP0738
                        CGCGCATTTCTGTTCCGGGCCGCCCTGAATCTTTGCACGGACCTGTATCGCA
9   N14   BP0742-531                                         BP0742
                        GTGGCCTTCACCGACATCCACCCCGACGAGCGCTTCCCAGCGCCGTCCAGT
9   N16   BP0756-21                                          BP0756
                        GGCGGTCTTGGGCAGTCATCACTTCTGCAAGGGGAATACCAATATGCGATAC
9   N18   BP0766-226                                         BP0766
                        TGGTATTTCGTGTTGCCCGAGCTGTTGCCCAAGGCGTTGGGCGACTGGATC
9   N20   BP0787-26                                          BP0787
                        GGCGCTTTCTATACAGCCACTACTTCTTTGGCGGTATCCGACAGGCGATCGG
9   N22   BP0809-781                                         BP0809
                        ACTTCATTCTCTGGCACACCCAGGAGTTCGGCATGGTGCGGCTAAGCGATGC
9   N24   BP0833-436                                         BP0833
                        GAACGCCAGCCTCGGCCTGTACCCGCAATTGCTGGAAGACCGCGAGGCGTA
9   P02   BP0838-446                                         BP0838
                        CCCTGGAAGAAATGAACACCTTCACCTATCTGATGGGTCTGCTGCTGCTGTT
9   P04   BP0879-1376                                        BP0879
                        GCGGCCGCGAGTCCGGCTCGGACGCCTGGAAGCACTATATGCGGCGCGCC
9   P06   BP0880-1166                                        BP0880
                        TCGATTTCAGCCGGCCGCCGGATGCGCCGGCATGGCTGCGTGAGACCAGGG
9   P08   BP0890-681                                         BP0890
                        GGAAACCGACGAGGAAGCGCTGGAGATCGTCAAGAAGTGGCTGGCCTATTT
9   P10   BP0907-271                                         BP0907
                        ATCGGCACCATCGATGCGCACAGCTCCAACGTCTATATCGGCATGTGGGGCA
9   P12   BP0910A-1                                          BP0910A
                        ATGCATCCCGCCAGCAATTCCGCGGTCACCCGCGACAGCGCCGCGGTCATG
9   P14   BP0912-11                                          BP0912
                        GCGTTTCGCTGCGGCACTTGCGCTGCTTCCTGGCAGTGGTGGAAACCCGTT
9   P16   BP0916-21                                          BP0916
                        GGCCAGGAACGTGAGCATGCGGTTCGGCGACGTACTGGCGATCAAGGATGC
9   P18   BP0933-196                                         BP0933
                        TATATGGTGGATTATCTGAACCTGACGCTGCGGCACGTGGACGGCACCGAG
9   P20   BP0967-731                                         BP0967
                        TGCCCATGATTTCGGAGATCACCCCCTTGCTGATCATTTCCAAGCTGGAGCA
9   P22   BP0968-371                                         BP0968
                        TCGGGTCGCAAGGCTGGTTCGGCCCCTGGTTGCAGGACCATGACTGGAAGA
9   P24   BP0970-331                                         BP0970
                        GCCTTCTATGAAAGCGTGGCGTTGCGCAAGGCCTGCTGCGAAATCCGCAAG
9   B01
9   B03   BP0971-991                                         BP0971
                        TATCTGCTCAAGCATGGCACGCGGCTGACTTCGGCGAAGATCAGCGCGGTG
9   B05   BP0978-1                                           BP0978
                        GACCCTGTATGTACAAGGCAAGTGGGCGCAGTGGCTGACAGCAGTTTGTTAT
9   B07   BP0980-766                                         BP0980
                        GGCATCCAATGGCATGTGCTGGCCATGTATGCCCCCAGCTTCGTCACCGGC
9   B09   BP0984-101                                         BP0984
                        AGGAAGGCGGGCAACCGCAGGTCGGGGTGGTCACCCTGAAAACCCAGTCGG
9   B11   BP1007-1                                           BP1007
                        ATGAACACCCATAAGCATGCCCGATTGACCTTCCTACGTCGACTCGAAATGG
9   B13   BP1008-161                                         BP1008
                        ACCACTGGTGCAGCAAGGGCCATATCCTGTTCTGCCTGGAAGGCGAATTGCA
9   B15   BP1013-651                                         BP1013
                        GATCACTTTTCTCACGCGCGCGCTGCCGTTCATGCTGTCGACGCGCAGCTGC
9   B17   BP1026-6                                           BP1026
                        GGCAAGAATTCTGGTGGCGGACGATTCGGCGACGATGCGCATGATCGTGCA
9   B19   BP1031-666                                         BP1031
                        TCTTCTGCCGCAATGTCATGATTTACTTCGACAAGCCGACCCAGGCCAGGAT
9   B21   BP1037-1001                                        BP1037
                        CCACGGGACACCGCTACACCAACAGCGTGATCGGTTTCGACGCCAGCACGC
9   B23   BP1042-356                                         BP1042
                        GGCATGGGCCGCATGTTTGCCGGCAACCCCTTCAATTCGTTCCCGTCCAGCC
9   D01   BP1065-966                                         BP1065
                        ATGCCGTCGGAAGCCCGTACCCTTTTCCGCGTTCTCGGTGTATCGTCCGACC
9   D03   BP1081-151                                         BP1081
                        GAACTGCCATTCATCCTCGACCTCATGACCTTGTGCGCCGAAGCGGGCCTCG
9   D05   BP1096-116                                         BP1096
                        TGGCCAATGCCTATTGGCTGTATCTGGCCTGTCTGGTGGCGATCCATGTGGC
9   D07   BP1113-1771                                        BP1113
                        TACCGCCATATCGATACCCTGGTGGTGTCGCATGCCGACCTGGACCATACCG
9   D09   BP1135-326                                         BP1135
                        GGAGCCTCCCCTGGGCTCGGTGCTCTACGGACGCGACATCCCGACACCTTG
9   D11   BP1140-511                                         BP1140
                        ATCACCCACAAGAAGATATTCACCGATTTCTTCACTTTCCGGCCGCGCAAGG
9   D13   BP1172-851                                         BP1172
                        TGTTCGCGCCGGAGGAAAGCACCATGATCGAGCGGGTGCTGGCGATGGGCG
9   D15   BP1200-686                                         BP1200
                        CCGTCGAACCGGATCCGGACAAGGCGACGCAGGCGTATCGCAAAGACCTCG
9   D17   BP1226-296                                         BP1226
                        GGAAGATCGCGAAAATTATGCCGGCTACCAGGACAATCCTGTCCAGCTGGCA
9   D19   BP1261-1306                                        BP1261
                        GAGACCTGGATGATTTTCCGTTCTCGGAGCCGGGCGCGCAGGGGCAGTTCC
9   D21   BP1269-331                                         BP1269
                        ACGATGTTCTACATCGTGGCAGGCCAACTGGTGTGCAGCGCCGTGGCCGTG
9   D23   BP1271-466                                         BP1271
                        CGCCCGGAAATCTGGTCGTACGGCCATCGCAATCCGCAGGGCATGGCGCTC
9   F01   BP1272-51                                          BP1272
                        GCGCCAGGGCTACAGCTGCATCATTCCCGAGCCCGACGAAGTCGAGCGCTA
9   F03   BP1288-66                                          BP1288
                        CATCTTCTGTCTTACCCTGAGCGACGCCCAGGCCAAGTGGCTGGGCGAGCG
9   F05   BP1303-406                                         BP1303
                        CTGGCGCTTTATTCCCCCAACCAGTTGCAGGAGCAGATGACCTGGTTCTGGA
9   F07   BP1310-461                                         BP1310
                        TCACCAATGTGAACATCACGCGCGTCACCCACGTCTACGAACGCAGGGTGG
9   F09   BP1312-276                                         BP1312
                        CGTGGCGGTCAACGAGGCTTACGATCATCTGGGCGCGACCTATGCGCTGTT
9   F11   BP1316-386                                         BP1316
                        CCGGGAGTCTGGTTCGACCGCCACGGACTGTCCTACGCCTGTCTGCCCCCC
9   F13   BP1322-1346                                        BP1322
                        CGGACATCGCTTTTATCGAAGAAGCGGCCGAGCGTATGTGCGAAGCGATCG
9   F15   BP1324-981                                         BP1324
                        ACGCACGACTTGCCTACCCTGCGAGGCTGGTGGCAGGCGCGCGATCTGGAC
9   F17   BP1330-2006                                        BP1330
                        CTTCACCCAGTCGTATACCTATTTCACCTGGCGCAATACCCGCCATGAGCTG
9   F19   BP1338-826                                         BP1338
                        GCCAGCGAAAGCCTGGGCGCGGTGCTGATGTACCGCTTGCTGTATGCGTGG
9   F21   BP1341-116                                         BP1341
                        CGGATACCGACGATCCCGATATCGACCTGCCGCCGCCCGACGCGCCTGCGG
9   F23   BP1343-26                                          BP1343
                        AGCGGGTACGCCATCCGCTGAAAATGCGCCTGCTCGAAGTCAAGCGCGTGA
9   H01   BP1351-6                                           BP1351
                        CATGAAAAGAATCACGACCCTGTTGCGCGTGCTGGCGTTGGCCGGGGCGAT
9   H03   BP1357-1001                                        BP1357
                        CCTATGACTACATGGGCCTGCGGGCGTGCCGGTGCAGTGGGCGTTCATCGG
9   H05   BP1367-1546                                        BP1367
                        ATCGGACGCGAATCGCCCAAGCTGGTCGAGGACCTGGTGCCCAAGACGCTG
9   H07   BP1368-716                                         BP1368
                        TGGAACAATTGCAGATCTATGGACGCCTGATGGGCATTCCGGCCCATTCGGT
9   H09   BP1386-21                                          BP1386
                        ATATGACGTAGAGACCAAGCTGCGCGAGGACCAATACCTGATCTCGCGCACC
9   H11   BP1398-851                                         BP1398
                        GCCACCATACGGCCGAACTGCGCCTGGATCCGCCCGATCTGGGCCCCCTGC
9   H13   BP1407-636                                         BP1407
                        CCAGGCATTGCGCCAGACGCTGCAGACCAGCGGCCTGTTCTATGAATCCCA
9   H15   BP1416A-166                                        BP1416A
                        AACGTGGCGTTGATGATGATCGGCGCCATGATCGCCGGCAACGTGGTGCTC
9   H17   BP1454-536                                         BP1454
                        TGAAGACCGCCATGACGGCCCACAACCCTTATGCCATGCCGTTCCTGATGGA
9   H19   BP1460-56                                          BP1460
                        CGGTTGGAGTTTTCTTCTGTATCAAAGGATATTTGCTGCGCCGCCAGATGGC
9   H21   BP1473-6                                           BP1473
                        TCGAATGAAATTTGTCTGTGATGCAGAGCGCTGTATCGAATGCAATGCCTGC
9   H23   BP1478-231                                         BP1478
                        CATCTACCTGCTGCTTTCGCATTCCGGCCCGTTGGGCTTTCTCGGCTGGCTG
9   J01   BP1494-206                                         BP1494
                        TGGACGCCGAGGTGATGCAGGTAACCGAACTGGGGTGGTATTTCGTGCGGG
9   J03   BP1504-81                                          BP1504
                        GAAGAACCAGCCCTATGGCTTCAATACCCGTTTCGCGGACCAGCCGGGCAC
9   J05   BP1559-581                                         BP1559
                        AGGGCGACTTCGGCCGCCAGTTCACCCATCCGGCGCCGGCCAATGATCTGT
9   J07   BP1571-366                                         BP1571
                        GTATTTCGAGGCGGGCGTCCAGGAGGGCTATTGGTTCGAGATGGCCCGCGC
9   J09   BP1603-666                                         BP1603
                        CGGCCATATCGAGCAGTGGGACACCCCGTACAACCTGCACCAGCACCCGGC
9   J11   BP1608-271                                         BP1608
                        CCGAGCTACTCGACCCTGTTGCTGTCGCGCCTGATCACCAGCCTCAACCATG
9   J13   BP1610-6                                           BP1610
                        CAGGTCTGTTTCACCGTTGTTTTCCTTGCCTGTTTCCGGGCGCCGCCAACCG
9   J15   BP1632-991                                         BP1632
                        AGCCAGCCCATCTACGCCATGCCGGGACTTACCTGCCAGCACACGCTGGAC
9   J17   BP1634-86                                          BP1634
                        CCCTGTTGCTGGCGCTGTCCGGCACCGCGGCGCTGATATTCCAGATCCTGT
9   J19   BP1642-736                                         BP1642
                        CAAGGACGAGAAAGTGCAGGTTGGCACGACGCCGGTGGGCAGCTTCGCGC
9   J21   BP1648-51                                          BP1648
                        GACCCTGCTTCCGCAGGTGCTGACGGTGTTCGCCGACTACGAACCCCTCAT
9   J23   BP1663-66                                          BP1663
                        CCGGGTCATTTATTACTGGATCAGCCAGGATTGTCAGATCTACATGCTTGCG
9   L01   BP1676-1116                                        BP1676
                        TGGAAAATGCACGTCGTCTGGGAGGTGGAGCCCAATGTCGGGCCCAACCAC
9   L03   BP1677-321                                         BP1677
                        GCGCGCGCCTTCGTCCGGCGCCGCCGATATGTCCAGTGTGCGTGTCGACCG
9    L05   BP1679-81                                          BP1679
                         CGATTACTACTGCATCATGCGGGCCGGGCAGGGGGATGGCGAGCGCATCGA
9    L07   BP1681-166                                         BP1681
                         GACCTGCTCAGGCAAAAGGGCACGCCTTACGACGAGCTCGGTTTGTCGGAT
9    L09   BP1684-171                                         BP1684
                         CACGCCAGGCTTCGTCGACATCCATACGCACTACGACGGGCAGATCATCTGG
9    L11   BP1690-561                                         BP1690
                         CTATCGCGGTTCGGGGCCGGCGCTCAACGACACCATCGCCGGGCAGGTCAA
9    L13   BP1710-596                                         BP1710
                         CGCTGATCGACGATGCGGTATGGGCGCCGCTGATGAAGTTTCCCGAGTGGA
9    L15   BP1714-906                                         BP1714
                         GAGGTGATGATCGTTTCCGATTTTTACGACTTTTCCGATCGGTTGCGTTCGTA
9    L17   BP1734-21                                          BP1734
                         TGAAGTGAAAGGGCTGGGCAAGCGTGTGGCCGACGCCGGCGGTGAACTGTC
9    L19   BP1741-621                                         BP1741
                         CGAACGCATCGGGGCGGATCTGCGCACCACCACCTACGAACATTTGCAGCA
9    L21   BP1755-336                                         BP1755
                         GGTCAATATCCATCCTTCGCTGCTGCCGGCGTTTCCCGGCCTGCATACGCAT
9    L23   BP1765-16                                          BP1765
                         GATGCCTTGCATCCTTATCCTTTTGAAAAATTGCGGGCCTTGCTAGCGGACG
9    N01   BP1786-1041                                        BP1786
                         CGAATTGCTGCGCACCTGCGCCTATGTGAACCAGGTGTGTCCCACTTACTCG
9    N03   BP1787-61                                          BP1787
                         GCCATCGAGGCCGGCGGCGATGTCCAGGCCCTGTGGAATGCCATCGTGCAA
9    N05   BP1790-686                                         BP1790
                         TACCCGAGGTGCCTGCCATCGGTGAAAGTATCCTGGTTATTTCGTGACGTCG
9    N07   BP1793-361                                         BP1793
                         GATGCCAATCCCCAACCCGATGCAAAGCCCGGAGCTGAGATGAAACCCCGG
9    N09   BP1811-6                                           BP1811
                         TACCGAAGTTTCCCGCGTACCGTTCTACACAACCATGATGAAAGTGCCGGGC
9    N11   BP1821-431                                         BP1821
                         GCGAGCAATACGATCCCTCCAGCATCGTCAGCGCCAATGCCTATCTGGGAAG
9    N13   BP1828-521                                         BP1828
                         GCCGAACACTGGGCCCTCGACGTCGACATTCCGCTGGCGGGCAAGGCCGAA
9    N15   BP1832-1016                                        BP1832
                         CCATCAAGCGCTCGGCCATGCACGACCTGTACCTGGGCGAGGTCCGAGATC
9    N17   BP1853-506                                         BP1853
                         ACGATCTGATGCACGAAGGCCAGAAGATCATCAGCGTGTCGTATCGCTCGCT
9    N19   BP1856-446                                         BP1856
                         AACCTCGACGCGCATTTCGACCTGCGCACCGGCCGGCCGGGCAGTTCGGGC
9    N21   BP1858-1166                                        BP1858
                         ATTGTCCCGGCCAGGACAACTCGCTGGTGCGCGAGGAAATCTTCGGGCCGG
9    N23   BP1867-281                                         BP1867
                         CGCTTACGCTGGTCTACGGCGCGCGCGACACCGAGCACAACAACGCGGTGG
9    P01   BP1868-96                                          BP1868
                         TTCCGACTATATCGCGCCTGCGGCCGGGCAGGACCGCCTGCGCGGCCAGG
9    P03   BP1869-111                                         BP1869
                         TCGCAGCCGCGCCTTCGCCGCGCTGTGCCATGAGCTGGGCATCAAGCACCG
9    P05   BP1870-276                                         BP1870
                         GGTGGGCACGGTAGCGATCCCGCAGATCAAGAAGTACGGCTACAACGAGCC
9    P07   BP1871-21                                          BP1871
                         TGCAAGGTATCAAATGAAAATCGCATTCCAAGTCCAGGCCGATGGCGCCACC
9    P09   BP1880-116                                         BP1880
                         AGCAAGTGGGATTGTTCTTCGAATCTGGTGGCACGGTTGACTATACGTCGGG
9    P11   BP1885-1161                                        BP1885
                         TGCCGGCATGAGCGGACGCGAGCTGCCCTACATCGCCCGCGCCTCGCTGCC
9    P13   BP1888-796                                         BP1888
                         CTCAACCGCAGGTCGTTCATCGACAGCCTGATGGGCGCGACCCGGACTTCG
9    P15   BP1893-291                                         BP1893
                         CGAATCCATCGTCCATACCTGGTTCACGCCATTCATCCGCCGCCTGTCGCAA
9    P17   BP1897-701                                         BP1897
                         GGGCATCAAGCACCGCTTTACCCGACCTTACCGCCCACAGACCAATGGCAAG
9    P19   BP1927-881                                         BP1927
                         CCTATTACCAGCCGTACGTGGGCGAGGAGGGAGGCGATGGCCGGCCCGCC
9    P21   BP1932-421                                         BP1932
                         TACTGCCATTCGGCCGGGCGGGTCCTGCTGTCCGGCTTCACCCCGGAACAA
9    P23   BP1952-2056                                        BP1952
                         GCTGGCGCTCAACACCAATCTGCACAGCGCGCACCCCGACAACCTGATCCA
10   A01
10   A03   BP1960-1606                                       BP1960
                         AGTTGCACGGCAATGTGATCCAGTCGCTCAGCCGCGCCTTGAAGGAGCAGG
10   A05   BP1963-11                                         BP1963
                         CTGCCGCCTGTCTCCAGGATATGCTGATGTACCGGCTGTACCAGGCCTGGTC
10   A07   BP1966-141                                        BP1966
                         CGTCAACTCGGGCGTGTGCGGACCGTCGCGCATGAGCTACTACACCGGTCG
10   A09   BP1968-1081                                       BP1968
                         AAGACAGTCAGCCGCATGCTCAATATTTCCGTGGCGACCGCCAAGACCCATG
10   A11   BP1978-936                                        BP1978
                         CCGGCCGATTTCCTCGCTGCAAGGACTGGAGCCGGACGCGCCGGTGATCTA
10   A13   BP1981-46                                         BP1981
                         GTGGCTTCGGTCGCCTACCTGAATGAGATCGAGGGCGACCGGCCGGTGTTC
10   A15   BP1988-1                                          BP1988
                         ATGTACGCCAAGACCAAGACCCACCACCGCCCGACCCGTTTCGCGGTTCCC
10   A17   BP1998-706                                        BP1998
                         GCGCTGGCATTCTTCATTCCCGAAACCGAACGCGTCGTCACGGTGGAGGAC
10   A19   BP2000-606                                        BP2000
                         ATCCAGGATTTCCGCTCCGTCATGCCGGTGCTCGGCGGCGAGCTGAAGATC
10   A21   BP2002-306                                        BP2002
                         CTGGAGAGTTTCAGCCAGCCCATTCCCCAGTGGTTCGGCGAGCGCATCGAG
10   A23   BP2029A-1                                         BP2029A
                         ATGACCATGAATCCGTCATTTCCCTCGCGCCGCCTGGCGCCGCGCACCTTG
10   C01   BP2032-61                                         BP2032
                         CTGTTCGCAGCGCTTGCCTATTACTCGCCCGAGCACTTCAAGTGGCTGAGGC
10   C03   BP2036-101                                        BP2036
                         AAGCTCCCGATGCCGAATCGCTGATGCGCTCCCGCTACAGCGCATTCGTGC
10   C05   BP2053-371                                        BP2053
                         TCTCGGACGATTTCTATGCCCTGTGGCTGGATCCGCGCCGGGTCTATTCCTG
10   C07   BP2064-591                                        BP2064
                         CGACGTGCTGTTGCACATGCTGCCCATTTTCCACGTGCATGGCCTGTTCGTC
10   C09   BP2069-66                                         BP2069
                         GGTGCTAATTTCCTTCCGCCTGTTGCGCTTTCCCGACCTCACGTCGACGGCA
10   C11   BP2077-686                                        BP2077
                         TGGTCAAGACGCGCTTTGACGGCGGCGTGGCTTCCGAGCTCGACCTGAACC
10   C13   BP2083-16                                         BP2083
                         GAAACCGCTGTACTGGATAGCCCCGCCCTGCGCCGGCGCGATTGGCAAATC
10   C15   BP2088-51                                         BP2088
                         CGCCATCGCCCCGCTGTTCTTCCCCTCCGGCTATTACTTCCGCGTGGGCTCG
10   C17   BP2101-1881                                       BP2101
                         CACGCTGCAAGACAACGCCTTTGTCGACCCCAAACCCATCAATTTCTGGAAC
10   C19   BP2112-246                                        BP2112
                         GGCCGTACGGCGGGCAGTCGAGCATTTCGGCAGGATCGATACGCTGTTCAA
10   C21   BP2113-891                                        BP2113
                         CATCGCCGCGCCGCCCATCGACTACCAGGCCTTCGTGCGGGCGCATATCGG
10   C23   BP2117-21                                         BP2117
                         GGGCCACGAATATGATCTACATTACATTCCCGCGCCCCTGCGGCGGCGCCA
10   E01   BP2118-921                                        BP2118
                         CGAATACAACCTATTACCTAGCCGTGGGCCTGGACCGGCCAGGCCTTGCTCG
10   E03   BP2122-11                                         BP2122
                         CGACCCAACTGCTTGCCTTCGCCCTGATCTGCCTGGGCATGACGCTCACGC
10   E05   BP2123-6                                          BP2123
                         TGTTGCGCCGCCGGGGCGCACCGGAGAAATTGCTTTGACCCGTATCGATGA
10   E07   BP2136-246                                        BP2136
                         CGACCTGCCCTGGAACCAGCCCTTCTACGCGCGCCTGGGTTTCGCCACGCT
10   E09   BP2154-176                                        BP2154
                         TGCTGCTGACGCCCAAGGGCGGACGCCTGTTCCAGTGGGTGCATGGCATGC
10   E11   BP2159-351                                        BP2159
                         CCTGGAGCCGGCCGAGCCGGTGGTGTGCTACGAGCATCAGGCCCCCGGCG
10   E13   BP2160-11                                         BP2160
                         TCGTCAACCTCATCTACCTCTCGTCCACCCCGCTGTTCGGCCTGACCGCCAC
10   E15   BP2169-621                                        BP2169
                         GTGGTGGTACGGCCACAATGCCGTGGGCTTCTTCCTGACACCAGCTTCCTCG
10   E17   BP2182-31                                         BP2182
                         GAGGCCGATTACAAGTCGGCTCTGAAGGAAATTTCTCGGCTCATGGAGTCGG
10   E19   BP2205-491                                        BP2205
                         AGCTGGAGCACGATGTCTACGGCGCCAGCGTGGCGCTGGAAAGCAACACGG
10   E21   BP2208-1766                                       BP2208
                         CCAGCTCCTGGCTCAAATGCCATGAACCGGAGGCCTTCCTCGCGGCCCTGC
10   E23   BP2273-311                                        BP2273
                         CCGCGCGCCTGCAGGCCGAAGGGTACCGCGCCGAACTGTTGTCGGGCCGC
10   G01   BP2281-21                                         BP2281
                         GTTGGCGTCAGCCATGTTCGCCATCATGGGGTCGTTCGTGAAGCTGGCGAG
10   G03   BP2287-286                                        BP2287
                         CCGCGCGTGGACGCCAACTACACGCTCACCCGCGAACACCTGCCGAAGAAC
10   G05   BP2356-206                                        BP2356
                         TCGCGGCGTATGTCCGGTACGAGATCGAACGGGAATGGCGGACACGCCACT
10   G07   BP2366-676                                        BP2366
                         CTCAAAAGCGTGGGCGTGGGCATGGTGCTGTACCCGCTGTCGGCATTCCGC
10   G09   BP2375-376                                        BP2375
                         TGGCGCTCGGTCGATATGTTCATCGTGCTGGCGCCATTCGCCATTTTCGCGT
10   G11   BP2392-446                                        BP2392
                         GCGACGATGTGTTCATCGCCGAGACCCGCCCACTGTTTCCCGCCGCCCAAT
10   G13   BP2401-231                                        BP2401
                         GTACGTTGGCGAGAACAAGGAATTCGAACGCCGTTCCTGTCGGGCGAGCTC
10   G15   BP2410-136                                        BP2410
                         TCGGGCTACACCACCGTCATCCTGACGACGGTGTTCAGCACCTATTTCGTCA
10   G17   BP2412-26                                         BP2412
                         ACCGTTCGATACATGACCGCGATGGGTTCTGGCGCGAGGAGGCAGGGCGGA
10   G19   BP2427-251                                        BP2427
                         AAGTCTGGCTGAAATGCGAAAGCGGCAACCCGACGGGCAGCCACAAGGACC
10   G21   BP2450-6                                          BP2450
                         CTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGC
10   G23   BP2524A-166                                       BP2524A
                         CCCTGGCTGGGGCCGTTGCTGCCATGGTGCGACCGTCTGCTGTCATGGCGC
10   I01   BP2525A-816                                       BP2525A
                         GTCGCGCGTCAATGCGGTGATCGCGCCCATTGCCATCCGCGGCGTGAGCCT
10   I03   BP2528A-526                                       BP2528A
                         CGGGCAGGACTGGCTGCGGACCTGGGCCGATATGGCATCGGCCGATGGCG
10   I05   BP2584-156                                        BP2584
                         CTGGAACACCCGGGAAAACAACTATCGCGCCCGGGCGCTGTACGACCAATA
10   I07   BP2584A-6                                         BP2584A
                         CATAGACGGCGAACCCAAGAACGGCGATTTCGCGCGCTACATCGAAGAGCT
10   I09   BP2588-71                                         BP2588
                         TGGACCGGCAGGTATTGCTGGCCAAGGCCGACGACATCGACGCCACCGTCA
10   I11   BP2595-246                                        BP2595
                         GCTGTTCTATAACGGCCACATGGATGTGTTCCCGGTGGGCGATGGCCATGG
10   I13   BP2611-61                                         BP2611
                         ACCCACTGGTACTACCTGAAGGAACTGCTAGGCCGGCACCCTTCGATCCGCT
10   I15   BP2618-491                                        BP2618
                         CCTCCATCGTTGATCGCGCGCGATTGATGGAAGAGCTGCGGATCATACGCG
10   I17   BP2619-871                                        BP2619
                         TGCGCTATGAGGGCCTGTACTGGGCAATGGTGTTTCCGCTGGGTATGTACG
10   I19   BP2627-386                                        BP2627
                         GGGACAATGGCAGTTGGTTCCAGCCCTTGGGCCTAGGCACGGATGGCGCCA
10   I21   BP2629-31                                         BP2629
                         GCCATTACCCAGCTCCTGTACGACGGTATCGTCGATAGCGGGGATTGGTACG
10   I23   BP2631-126                                        BP2631
                         GGAAGACGGCGGCTCCATCGTGGAAGGCAGCACCCCCACCGAATACGCCAA
10   K01   BP2634-796                                        BP2634
                         CTGGATCTGCCGGTCTACCCCGTCAAGGGCTATTCGCTCACCATTCCCATGA
10   K03   BP2641-736                                        BP2641
                         ACCCAGAAGGCGGTGGGGCAGTTCGACCTGGGCCCGGCGGCGGCGTTTTC
10   K05   BP2642A-11                                        BP2642A
                         TTCTGGACGGAATTCAACTGCGCGCGGGGTCACAGGTACACCTGTACCCGC
10   K07   BP2646-306                                        BP2646
                         CTACTTCGGCACCACAGGCGTGCTCGAACAATTGCACCCGTTCCTGTGCCGT
10   K09   BP2650-301                                        BP2650
                         GGCGGACATGGCCCGCTGTGGGACCTGGCCGAAAGCGCGCATTCGACCGC
10   K11   BP2665-261                                        BP2665
                         CATGGTGCTGTGGGTCGGCCTGTGCCTGTACATCGCCGTGCTCGACCGCAC
10   K13   BP2680-546                                        BP2680
                         CGAAAGCCAGGACATTGAGCTGTTCAATGGTCGCCTGGACGGCGATAAAGTC
10   K15   BP2689A-196                                       BP2689A
                         CAGTTGCACGCCATCCTGGAGCCTACGGGTCTGTATCACGAGCAAGCGGCC
10   K17   BP2690-161                                        BP2690
                         CGTTCCAGACCAGCTTCATGACCATCCGCAAGGCGCCCTCGGCGGCGTTCT
10   K19   BP2695-11                                         BP2695
                         TCTCCAGGAATCCATCCATGCTTCCCATCGTCATCGTCTCGGGGCCGCCCGG
10   K21   BP2696-1676                                       BP2696
                         CGTCAACAACTTCCTGTGGGCCTACAACGTCGACAGCGGGGCACTCTCGCG
10   K23   BP2697-21                                         BP2697
                         CAAATGGCTATGGGCGGCGCGCTTCTACAAGACGCGCAGCCTGGCGGTGCA
10   M01   BP2731-56                                         BP2731
                         TTGCAGGGTGCAATGCGGTGCTGCTTTCGCCGTCGGGCGACATAGCGCTGC
10   M03   BP2737-906                                        BP2737
                         CTGGGGAGTAAACGGCCTGAAGCGTCTGCTGCGCGCCGATGACGCCCTCGA
10   M05   BP2775-316                                        BP2775
                         ATCAACTACGCGCTCTACCAGAGCATGCCTTATCGCAACAGCGATTTCGCCC
10   M07   BP2779-21                                         BP2779
                         CAAACGTCCCGAAGATCTGCGCAGCCACCGCTGGTACGGGGTCAAAGACCT
10   M09   BP2814-201                                        BP2814
                         GCGCTTTACCGTCTGCGAGACGGGCTTTGGCATGGGGCTGAATTTTCTCACC
10   M11   BP2822-106                                        BP2822
                         GAACCGGCGAATCTGTATTACGAGTACTTCCAGTCGGGAAGCGATCCGTGCC
10   M13   BP2828-726                                        BP2828
                         GACGCGGGATATCGGCGTCAAGTGGTACACCGAAACACTGTCGACCAAGAA
10   M15   BP2833-296                                        BP2833
                         AGCCGGTCAAGGTGCGATACCTGCTGGATCAACTCCTGCCGCCCAACGTGA
10   M17   BP2834-956                                        BP2834
                         CCTGGCCGATCGAGTTCCACGGCTCGAATACGCAGATGCACTGGGAGCCCC
10   M19   BP2842A-66                                        BP2842A
                         CCGCTGGTTCAACGTGCCGCGGCGCACGGTCTACTATTCGACAACGGGTTG
10   M21   BP2842-11                                         BP2842
                         ATGGAACACGAACGGAGCCGGGTGGCAGTGACGAAAGCAAGAGCGCGCTGG
10   M23   BP2843-916                                        BP2843
                         AAGGTGAGCAATGGACAGCCGGCAGGCAACGGAGATTTGACGTTGCCCGAC
10   O01   BP2846-591                                        BP2846
                         ACCTGGCATTTACGTGGCGAATTTTGGCAATGGCAATCACGCGTTGAAATTC
10   O03   BP2847-106                                        BP2847
                         CTGTTCGCTCCGGAGCAGGGTGTTTCGTGCCCGGTTTCTTACCCGTTGGAAG
10   O05   BP2866-6                                          BP2866
                         GCTTGTACCGAGTAACCTTGCGCGGGCCGCCTGCGCCATTGTGATGTCCAC
10   O07   BP2877-276                                        BP2877
                         GCTGATGATCACCTACTCGGAGCTGGCGACCTTGCCGGCGCTGAACAAGAA
10   O09   BP2898-51                                         BP2898
                         CATCTATGTCGGCTACCACGTGGTCTGGAATGTCACCCCTGCGCTGCATACG
10   O11   BP2899-431                                        BP2899
                         CCATCACTTTCTCCGGGTCGGTCATTGCGTTCGGCAAGCTGTCGGGCAAGTA
10   O13   BP2938-271                                        BP2938
                         GCCTTCGCCGGCGAACATGCCATCGACGCGACCTTGCTGGGCGGACCGTCG
10   O15   BP2945-51                                         BP2945
                         GCAGGCGTGCCGTCCCTTCGACGCCGACTACTGGTATCGCAAGGAACAGGA
10   O17   BP2950-416                                        BP2950
                         GGCTCGAGCCTACCGCGCGCATTCACGACAATCGCATTTTTGTGGAGGATGA
10   O19   BP2967-11                                         BP2967
                         CGGGCATGGCTGTCAGAACGCAGGAGGAAGTGCCCGTGAAATCCCCATCCT
10   O21   BP2982-6                                          BP2982
                         CGAAAGAACTGGAGCAGACGCCATGGACGGCACCTCCGCGGTCGACCCGCA
10   O23   BP2995-431                                        BP2995
                         TTCATATCGAACTCGATCCGGGCCTGGCGTTCGGCACCGGCAGCCATCCCA
10   A02
10   A04   BP3038-61                                         BP3038
                         ACCCATGTGGCTTACGGTCTGTACGCGCTGGGCTTTTTGACCGGCGGTTTTC
10   A06   BP3045-341                                        BP3045
                         GGCCCAATACCAACTCCAAGGGCAAGGTCATCAACTGGCGCGGCCAGGGCG
10   A08   BP3054-26                                         BP3054
                         TCGTCTTCGCCGTGCCGGTCTACAACTTCAATCTGCCGGCCCAGTTCAAGAG
10   A10   BP3101-1271                                       BP3101
                         GCTTCGACTCGGACGATCATTACCAGGCGCCGGGCAACGGCGACGACAGCG
10   A12   BP3104-61                                         BP3104
                         GGCCCCAATACGCTGCTGGCCCTCACGCACGGCGCGATGCATGGCCACCGC
10   A14   BP3112-251                                        BP3112
                         CCGTCTTTGGATTGCGCCGGGAGGAAGCGATCAGGTTCCAACCCAGTAATCG
10   A16   BP3113-656                                        BP3113
                         GCGCCCTGGAATACCCGTGGGACCAGTGGACGGTATTCCTCCATCCGGCAC
10   A18   BP3158-381                                        BP3158
                         CGCTGGGTGTGGTGGCGGGCATCACCCCGTTCAACTTTCCCATGATGGTGC
10   A20   BP3162-1376                                       BP3162
                         GCAGGTATGCGACACCATCGCGGTCATGCAGCATGGCAAGGTAGTGGAGAC
10   A22   BP3165-6                                          BP3165
                         AAATCTGGGATATCCCGCTCGGCTGGAGCTCTATGTCGCCGGCCAGTGGCG
10   A24   BP3167A-496                                       BP3167A
                         GCGGCTTACCACGCACACGAGGCACACCCCCATGCGCACTTCCATGCCGGC
10   C02   BP3167-101                                        BP3167
                         GATTGGTGCACGACGAGGCCAGCACCCTGGCGTGGATAGAAAGCCAGCTCG
10   C04   BP3174-101                                        BP3174
                         ATGGCATCGAGATTGAGCACGCATGCGACATGAGCTGCGCGTGCACGACCT
10   C06   BP3183-1446                                       BP3183
                         AATCCAGACGGCCTACCTGGAGTCGTATTCGGAATACGGACAGAACATTTTC
10   C08   BP3187-326                                        BP3187
                         AGTTCTTCGCGCCCGCCGCCGAGATCAGCCGCAAGGGCTGGGATGCCGTCA
10   C10   BP3197-646                                        BP3197
                         ATCCGGCAAGGCTGGGCAGCCCCGACGAGTACGCGCAACTGGCCCAGCACA
10   C12   BP3200-961                                        BP3200
                         AATGGCGGCGGCCTGTCGTGCAACCATCCGGGCATGTACGGGCTGTTCACC
10   C14   BP3204-3116                                       BP3204
                         GTAAGGAACTTACCGAAGTAGAGCGTTCGAACGACTACAAGTTCTGGATCGA
10   C16   BP3205-6                                          BP3205
                         GCAAGCATTCGCGGCCTTATCCGTCTGGCAGGTCATGGGGTATGGCCTGGT
10   C18   BP3208-6                                          BP3208
                         CGTTGCCTTTGATCGCGTCTATCTGCACAGCGCCGGTTATTTCATGCCCGGC
10   C20   BP3209-146                                        BP3209
                         GGCACTGGATCCACATCCCGGTCGGCTACCTGTATTGCATCGGCAACCCGC
10   C22   BP3221-6                                          BP3221
                         TCGCTCGGGAATTCCTACACTGGTGCGCGTGATGCTTGCCTGCGAACGCGA
10   C24   BP3232-176                                        BP3232
                         TGGGCGTCACGGTGGCGCCGCTGGACACGCAGATCCAGGCCCGTTTCCCCA
10   E02   BP3233-871                                        BP3233
                         AAGGCGCGTATCGCCCGCTTCGAGGAGCTGTCCTCGTACGAATACCAGAAG
10   E04   BP3236-51                                         BP3236
                         CACCGTCGCCCTGCTGGCTTTCGTGCTTTTCCAATACGTCGGCGATCCCGTC
10   E06   BP3256-386                                        BP3256
                        CCAAGTACGCGCTCAGCCATCTGTTCGTGCAGGCCGAATTCGGCCTGTGCTG
10   E08   BP3258-311                                        BP3258
                        TGTCGACCGGCCCCGTGGTGATCTCGACGCCCGATACCCATGGCCGCCTGT
10   E10   BP3260-911                                        BP3260
                        TCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTACACGACCGGGTC
10   E12   BP3280-231                                        BP3280
                        TGTCTATGCCTATCCGATGGTGCTGATGGAAATGACGCGGCGCGCCTCGAC
10   E14   BP3297-331                                        BP3297
                        GGCGAACAGATGGCCGAAGCCATTCTCACGCATGAGAACGTCCCGCGCGCC
10   E16   BP3301-661                                        BP3301
                        AATGACAATTACTGGGGACCGAAGCCGTACTGGAAGGACGTGAAAATGGTGC
10   E18   BP3309-676                                        BP3309
                        AATCTCAATTACATGACTTCCGGCAAGGCGCCGCGCCGGCAACGCACACCAG
10   E20   BP3310-661                                        BP3310
                        GAACAGGCCGGTTTCCGCATGGGCCCGTTCGAACTGCTGGACCTGACCGCG
10   E22   BP3318-986                                        BP3318
                        TCGAACACATGGATTGGGTGCAGGACCTCGAATTGCCCAACGGCGTGCGCA
10   E24   BP3324-176                                        BP3324
                        TGGGCATCGATGTGGTCGAGATGCCGGATGGCAGCCTGAAGGTCAACATTC
10   G02   BP3335-366                                        BP3335
                        CTTTTCTCCGTATGCGCATTCGGAGGTGGTGCGGCGCATTTCGGCTTATTCG
10   G04   BP3337-511                                        BP3337
                        GAACGGTTCATCTGCCCTGGGCAAGCCGATACGCTGCAGGATATCGCGGAC
10   G06   BP3338-601                                        BP3338
                        CGCAGTTTCCCGATGCCCCCACGATGGCGGAACTGGGCATCGCCGACCTGA
10   G08   BP3351-16                                         BP3351
                        GTGGTATTGCTGGTCATCGACAGCTGGAACGACTACCGCACCCTGGCGGCC
10   G10   BP3378-771                                        BP3378
                        GTCGGCCTTGCGTGAGTGGGCTTACGCTCACACCTACAACTCCCAACACCGA
10   G12   BP3379-221                                        BP3379
                        ATCGCTACGCTGCTAATGGCAGCGCCTCGCCCACCGATCTGACTCAGCTGAA
10   G14   BP3387-46                                         BP3387
                        TATTCGGACTCATCGCTTGCCGGTCTGCGCAACGTGCGGACCATGCTGAGC
10   G16   BP3407-31                                         BP3407
                        CGCCTAGGTCGAGCCCTTCTTGTTAACAGGGTGATGCAACAGAACTGGACGA
10   G18   BP3424-206                                        BP3424
                        AGATCGGGCGGGTCAAGGAGCAGTCCATCGGTCCCATAGCGCCAGGCGAAA
10   G20   BP3444-376                                        BP3444
                        GTCCAGCAAGCCTATCGCAGCTGGCATGCGGCGGGATTCGTGCACAGCATC
10   G22   BP3450-71                                         BP3450
                        GCAGCCTGGCTACCCAATTCGCCGTCATGGCCGCCACCTTCGCCGCCATGG
10   G24   BP3461-801                                        BP3461
                        CATCCTGACCCAGGACCCCAACATCAAGCTGGTCAAGCGCAGCCTCCCACCA
10   I02   BP3474-911                                        BP3474
                        AGGGCGCCCGTACGCATTTCAGCGCGTTCGGCATGGCGCGCGACCAGGATG
10   I04   BP3479-31                                         BP3479
                        GTGAAGGAATACCGGGCCGGCAAGCCGGTTCTCAACGGCATCGATCTCGAT
10   I06   BP3509-91                                         BP3509
                        TCATGGCGCTGCCCTGGCCGGGCAGTTCTGAACATGCAGACCGACGTCAAC
10   I08   BP3514-626                                        BP3514
                        ACGCCGGTGAAGGCTTTGCCTTCGACAACGAAACCCCGGCGCACGAGGTAC
10   I10   BP3549-941                                        BP3549
                        CGCTGCTGGGAACCATGGTGTTCATTTTCGGCGCGATCCCGTTCACCGACGC
10   I12   BP3553-346                                        BP3553
                        GACGACGACTACTGGCAACGGGTCGCGCAGCATATCCGCGTGCGTTTCGGA
10   I14   BP3592-106                                        BP3592
                        GGTATTGGCGACCACTATCAGCGCGTCACGCTGAACTACGAAACTCCCACGC
10   I16   BP3600-931                                        BP3600
                        GGCATCTCCTCCCAGGTAACAGAAAAAGTCCAACTGGAACAAAAGGCCCGCC
10   I18   BP3644-286                                        BP3644
                        GCCCACCTGATTCCGATGCACCATCCGCAGGACGTCACGTCCACTCAGTACA
10   I20   BP3665-246                                        BP3665
                        CGATGGCGGCGTGGATGCCGTGGTGGCGCCCATGATCAACAGCGCCAGAG
10   I22   BP3681-481                                        BP3681
                        GCCTCGCACAATGCGGTGCTGGTGCATACGCTGCAATCCCTGACGGATCTG
10   I24   BP3688-931                                        BP3688
                        CTATTGACAGTTCACAGCTACCGGGTGCGTGGCAATATCAGAAGGAATTCAA
10   K02   BP3694-6                                          BP3694
                        CATACCTGCCGCGCGGCGATTGCCCGCACACTGCTTCTCCATATCAAGTCAC
10   K04   BP3697-121                                        BP3697
                        AACCGGATCGCAGTTCGTTATGCGTATGAGTGGCACGACGATGCGGGGAAT
10   K06   BP3762-11                                         BP3762
                        CGCTCTTTTTTCCGGGCACTTCCCGCTTTATGTCAGCCGTCAGCCTCGAACA
10   K08   BP3780-31                                         BP3780
                        ATGCGATGGCGCGGAATTTCCAGCCAGAACCAATTGGCGCGCATTTCCGGC
10   K10   BP3805-16                                         BP3805
                        ATCGACAGCATACGCATCGAATTCCCGAGCCGGCGCGGCACGCTGGTGGCC
10   K12   BP3835-36                                         BP3835
                        GCTTGAGTCCGTACATCTGGACGACAAATACACCCTGACTGCCGGCCGCGC
10   K14   BP3840-301                                        BP3840
                        CATTTGTATGGCCACACCTTTGTTCCACCCCTGGACGATTGGGGCTACGCCA
10   K16   BP3850-246                                        BP3850
                        CGGCGCGCAGCATGCGAAGAAGGCGACCGCCAACGGCTACAACATCCTGCT
10   K18
10   K20
10   K22
10   K24
10   M02
10   M04
10   M06
10   M08
10   M10
10   M12
10   M14
10   M16
10   M18
10   M20
10   M22
10   M24
10   O02
10   O04
10   O06
10   O08
10   O10
10   O12
10   O14
10   O16
10   O18
10   O20
10   O22
10   O24
10   B02
10   B04
10   B06
10   B08
10   B10
10   B12
10   B14
10   B16
10   B18
10   B20
10   B22
10   B24
10   D02
10   D04
10   D06
10   D08
10   D10
10   D12
10   D14
10   D16
10   D18
10   D20
10   D22
10   D24
10   F02
10   F04
10   F06
10   F08
10   F10
10   F12
10   F14
10   F16
10   F18
10   F20
10   F22
10   F24
10   H02
10   H04
10   H06
10   H08
10   H10
10   H12
10   H14
10   H16
10   H18
10   H20
10   H22
10   H24
10   J02
10   J04
10   J06
10   J08
10   J10
10   J12
10   J14
10   J16
10   J18
10   J20
10   J22
10   J24
10   L02
10   L04
10   L06
10   L08
10   L10
10   L12
10   L14
10   L16
10   L18
10   L20
10   L22
10   L24
10   N02
10   N04
10   N06
10   N08
10   N10
10   N12
10   N14
10   N16
10   N18
10   N20
10   N22
10   N24
10   P02
10   P04
10   P06
10   P08
10   P10
10   P12
10   P14
10   P16
10   P18
10   P20
10   P22
10   P24
10   B01
10   B03
10   B05
10   B07
10   B09
10   B11
10   B13
10   B15
10   B17
10   B19
10   B21
10   B23
10   D01
10   D03
10   D05
10   D07
10   D09
10   D11
10   D13
10   D15
10   D17
10   D19
10   D21
10   D23
10   F01
10   F03
10   F05
10   F07
10   F09
10   F11
10   F13
10   F15
10   F17
10   F19
10   F21
10   F23
10   H01
10   H03
10   H05
10   H07
10   H09
10   H11
10   H13
10   H15
10   H17
10   H19
10   H21
10   H23
10   J01
10   J03
10   J05
10   J07
10   J09
10   J11
10   J13
10   J15
10   J17
10   J19
10   J21
10   J23
10   L01
10   L03
10   L05
10   L07
10   L09
10   L11
10   L13
10   L15
10   L17
10   L19
10   L21
10   L23
10   N01
10   N03
10   N05
10   N07
10   N09
10   N11
10   N13
10   N15
10   N17
10   N19
10   N21
10   N23
10   P01
10   P03
10   P05
10   P07
10   P09
10   P11
10   P13
10   P15
10   P17
10   P19
10          P21
10          P23
Control_1   A01
Control_1   A03   BP1019-151                                         BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   A05   BP1102-786                                         BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   A07   BP1254-156                                         BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   A09   BP1266-1006                                        BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   A11   BP1392-166                                         BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   A13   BP1419-51                                          BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   A15   BP2499-816                                         BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   A17   BP3029-86                                          BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   A19   BP3085-91                                          BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   A21   BP3486-276                                         BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   A23   BP3591-76                                          BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   C01   BP3637-106                                         BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   C03   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   C05   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   C07   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   C09   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   C11   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   C13   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   C15   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   C17   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   C19   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   C21   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   C23   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   E01   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   E03   Alien1
Control_1   E05   Alien2
Control_1   E07   Alien3
Control_1   E09   Alien4
Control_1   E11   Alien5
Control_1   E13   Alien6
Control_1   E15   Alien7
Control_1   E17   Alien8
Control_1   E19   Alien9
Control_1   E21   Alien10
Control_1   E23   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   G01   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   G03   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   G05   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   G07   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   G09   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   G11   BP2499-816                                        BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   G13   BP3029-86                                         BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   G15   BP3085-91                                         BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   G17   BP3486-276                                        BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   G19   BP3591-76                                         BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   G21   BP3637-106                                        BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   G23   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   I01   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   I03   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   I05   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   I07   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   I09   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   I11   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   I13   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   I15   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   I17   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   I19   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   I21   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   I23   Alien1
Control_1   K01   Alien2
Control_1   K03   Alien3
Control_1   K05   Alien4
Control_1   K07   Alien5
Control_1   K09   Alien6
Control_1   K11   Alien7
Control_1   K13   Alien8
Control_1   K15   Alien9
Control_1   K17   Alien10
Control_1   K19   BP1019-151                                         BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   K21   BP1102-786                                         BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   K23   BP1254-156                                         BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   M01   BP1266-1006                                        BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   M03   BP1392-166                                         BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   M05   BP1419-51                                          BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   M07   BP2499-816                                         BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   M09   BP3029-86                                          BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   M11   BP3085-91                                          BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   M13   BP3486-276                                         BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   M15   BP3591-76                                          BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   M17   BP3637-106                                         BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   M19   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   M21   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   M23   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   O01   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   O03   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   O05   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   O07   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   O09   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   O11   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   O13   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   O15   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   O17   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   O19   Alien1
Control_1   O21   Alien2
Control_1   O23   Alien3
Control_1   A02
Control_1   A04   Alien4
Control_1   A06   Alien5
Control_1   A08   Alien6
Control_1   A10   Alien7
Control_1   A12   Alien8
Control_1   A14   Alien9
Control_1   A16   Alien10
Control_1   A18   BP1019-151                                         BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   A20   BP1102-786                                         BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   A22   BP1254-156                                         BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   A24   BP1266-1006                                        BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   C02   BP1392-166                                         BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   C04   BP1419-51                                          BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   C06   BP2499-816                                         BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   C08   BP3029-86                                          BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   C10   BP3085-91                                          BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   C12   BP3486-276                                         BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   C14   BP3591-76                                          BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   C16   BP3637-106                                         BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   C18   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   C20   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   C22   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   C24   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   E02   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   E04   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   E06   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   E08   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   E10   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   E12   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   E14   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   E16   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   E18   Alien1
Control_1   E20   Alien2
Control_1   E22   Alien3
Control_1   E24   Alien4
Control_1   G02   Alien5
Control_1   G04   Alien6
Control_1   G06   Alien7
Control_1   G08   Alien8
Control_1   G10   Alien9
Control_1   G12   Alien10
Control_1   G14   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   G16   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   G18   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   G20   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   G22   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   G24   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   I02   BP2499-816                                        BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   I04   BP3029-86                                         BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   I06   BP3085-91                                         BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   I08   BP3486-276                                        BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   I10   BP3591-76                                         BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   I12   BP3637-106                                        BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   I14   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   I16   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   I18   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   I20   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   I22   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   I24   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   K02   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   K04   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   K06   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   K08   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   K10   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   K12   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   K14   Alien1
Control_1   K16   Alien2
Control_1   K18   Alien3
Control_1   K20   Alien4
Control_1   K22   Alien5
Control_1   K24   Alien6
Control_1   M02   Alien7
Control_1   M04   Alien8
Control_1   M06   Alien9
Control_1   M08   Alien10
Control_1   M10   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   M12   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   M14   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   M16   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   M18   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   M20   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   M22   BP2499-816                                        BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   M24   BP3029-86                                         BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   O02   BP3085-91                                         BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   O04   BP3486-276                                        BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   O06   BP3591-76                                         BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   O08   BP3637-106                                        BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   O10   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   O12   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   O14   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   O16   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   O18   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   O20   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   O22   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   O24   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   B02
Control_1   B04   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   B06   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   B08   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   B10   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   B12   Alien1
Control_1   B14   Alien2
Control_1   B16   Alien3
Control_1   B18   Alien4
Control_1   B20   Alien5
Control_1   B22   Alien6
Control_1   B24   Alien7
Control_1   D02   Alien8
Control_1   D04   Alien9
Control_1   D06   Alien10
Control_1   D08   BP1019-151                                         BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   D10   BP1102-786                                         BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   D12   BP1254-156                                         BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   D14   BP1266-1006                                        BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   D16   BP1392-166                                         BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   D18   BP1419-51                                          BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   D20   BP2499-816                                         BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   D22   BP3029-86                                          BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   D24   BP3085-91                                          BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   F02   BP3486-276                                         BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   F04   BP3591-76                                          BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   F06   BP3637-106                                         BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   F08   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   F10   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   F12   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   F14   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   F16   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   F18   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   F20   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   F22   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   F24   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   H02   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   H04   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   H06   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   H08   Alien1
Control_1   H10   Alien2
Control_1   H12   Alien3
Control_1   H14   Alien4
Control_1   H16   Alien5
Control_1   H18   Alien6
Control_1   H20   Alien7
Control_1   H22   Alien8
Control_1   H24   Alien9
Control_1   J02   Alien10
Control_1   J04   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   J06   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   J08   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   J10   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   J12   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   J14   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   J16   BP2499-816                                        BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   J18   BP3029-86                                         BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   J20   BP3085-91                                         BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   J22   BP3486-276                                        BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   J24   BP3591-76                                         BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   L02   BP3637-106                                        BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   L04   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   L06   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   L08   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   L10   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   L12   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   L14   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   L16   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   L18   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   L20   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   L22   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   L24   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   N02   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   N04   Alien1
Control_1   N06   Alien2
Control_1   N08   Alien3
Control_1   N10   Alien4
Control_1   N12   Alien5
Control_1   N14   Alien6
Control_1   N16   Alien7
Control_1   N18   Alien8
Control_1   N20   Alien9
Control_1   N22   Alien10
Control_1   N24   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   P02   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   P04   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   P06   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   P08   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   P10   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   P12   BP2499-816                                        BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   P14   BP3029-86                                         BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   P16   BP3085-91                                         BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   P18   BP3486-276                                        BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   P20   BP3591-76                                         BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   P22   BP3637-106                                        BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   P24   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   B01
Control_1   B03   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   B05   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   B07   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   B09   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   B11   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   B13   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   B15   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   B17   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   B19   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   B21   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   B23   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   D01   Alien1
Control_1   D03   Alien2
Control_1   D05   Alien3
Control_1   D07   Alien4
Control_1   D09   Alien5
Control_1   D11   Alien6
Control_1   D13   Alien7
Control_1   D15   Alien8
Control_1   D17   Alien9
Control_1   D19   Alien10
Control_1   D21   BP1019-151                                         BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   D23   BP1102-786                                         BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   F01   BP1254-156                                         BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   F03   BP1266-1006                                        BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   F05   BP1392-166                                         BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   F07   BP1419-51                                          BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   F09   BP2499-816                                         BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   F11   BP3029-86                                          BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   F13   BP3085-91                                          BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   F15   BP3486-276                                         BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   F17   BP3591-76                                          BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   F19   BP3637-106                                         BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   F21   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   F23   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   H01   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   H03   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   H05   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   H07   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   H09   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   H11   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   H13   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   H15   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   H17   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   H19   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   H21   Alien1
Control_1   H23   Alien2
Control_1   J01   Alien3
Control_1   J03   Alien4
Control_1   J05   Alien5
Control_1   J07   Alien6
Control_1   J09   Alien7
Control_1   J11   Alien8
Control_1   J13   Alien9
Control_1   J15   Alien10
Control_1   J17   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   J19   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   J21   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   J23   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   L01   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   L03   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
Control_1   L05   BP2499-816                                        BP2499
                                CGAGCTGTCGTCGAGCCAGCAGACCGAGATCAACCTGCCGTACATCACGGC
Control_1   L07   BP3029-86                                         BP3029
                                TCTTCATCGAACTGGGGCGTAGCCAGGCCGAGGCGCGCGATCTCGATACGA
Control_1   L09   BP3085-91                                         BP3085
                                CCCGAGGCCGACTACATGAACGATCGCCAATTGGCGTTCTTCAAGGAACGGC
Control_1   L11   BP3486-276                                        BP3486
                                CATTCTGCTGATAGGCAGCTTCGAGCTGATGCACCATGTCGAAGTGCCGTAC
Control_1   L13   BP3591-76                                         BP3591
                                GGGCTGTGGGTCAAATGTCCCTCGTGCGAATCGGTGCTGTACAGCGAAGAC
Control_1   L15   BP3637-106                                        BP3637
                                ATTTCCGGCAAGATGCGTATGCATTACATCCGGATTCTGCCCGGCGACAAGG
Control_1   L17   BPneg00001    CCACAGTCTACATTTGGCTTAGGAAGCTCGCCCTCTTGATTATGAAGGGTTG
Control_1   L19   BPneg00002    CGTGCTGTCCCATACGAGCGACACGTCCAAGTGCAATAGGTAGCTTAACACT
Control_1   L21   BPneg00003    ATTTTGGGACCTAACACAACTAGCTCATCTGTAGGGCTTGCGTCGAATAGAG
Control_1   L23   BPneg00004    GGATGGTTATAGTCGATTCCACTCCGTCGTAGTTCAGCGGTCCTAATCCACT
Control_1   N01   BPneg00005    ATATGGACTTGGTTTAGTCTGGTATAAGCGTAGACGGGGATAACCGGACTCC
Control_1   N03   BPneg00006    TGGCGCTCCTTGTCACTTAGCGTGAGAATCATATAGCGACGTAGTAACATTTT
Control_1   N05   BPneg00007    AGCCAGAGCCTAGTACCTACTAGACCTCCAGACAGGCACCGTTAATACCACG
Control_1   N07   BPneg00008    ACTATTCATCCATCGTTAAGGTAAGGAGAGAAAGGTTGTGGCCTCCTCTTAAC
Control_1   N09   BPneg00009    CAGTGGAATGCTCGCATTCGGTTGGATATAGTTGGTAAATGGCGGGAGGTGT
Control_1   N11   BPneg00010    AAGAGGGGATAGCCAATTCATTGGCCGAAAATAGAAGACTTGTCAGACACCC
Control_1   N13   BPneg00011    TCTTGGAGAACTCCCGAATGCCAAGACTCTCTAACATACGTCTAAAGCGGGG
Control_1   N15   BPneg00012    CGATTCGCTAGGCGTCCTTTACTTTTACCTTTCAATGTGAGTCCCTAGCCTTT
Control_1   N17   Alien1
Control_1   N19   Alien2
Control_1   N21   Alien3
Control_1   N23   Alien4
Control_1   P01   Alien5
Control_1   P03   Alien6
Control_1   P05   Alien7
Control_1   P07   Alien8
Control_1   P09   Alien9
Control_1   P11   Alien10
Control_1   P13   BP1019-151                                        BP1019
                                GACCGCGTGACGCTGGAAATGTCCCCCTACGACCTGACCAAGGGCCGTATC
Control_1   P15   BP1102-786                                        BP1102
                                GGGGGTGAGCCCGCGCCACAACCCCGAGTTCACCATGATGGAGTTCTACGC
Control_1   P17   BP1254-156                                        BP1254
                                GTATGCCGTATGCGTTTTCGATGCACGCGGAAAAACATTCCGGGACGATTTG
Control_1   P19   BP1266-1006                                       BP1266
                                CCCAAGACCTCGCGCGTCGATCGCGACGAATTCGTCAACACCTTGCTGGCG
Control_1   P21   BP1392-166                                        BP1392
                                GTGGTGCTCGAAATCGAAGGCACCTGGCTGGTGCTGGGCGTCACGCCCAAC
Control_1   P23   BP1419-51                                         BP1419
                                GACCCGTTACTGGAACCCCAAGATGGCCCCGTACATCTTCGGTCACCGTAAC
gene_symbol                      Tm

gidA                              83.53
gidB                              81.19
parA, soj                         82.94
                                  82.36
parB                              80.6
tufA, tuf                         83.53
secE, prlG                        80.6
nusG                              82.94
rplK, relC                        82.94
rplA                              81.77
rplJ                              82.94
rplL                              82.36
                                  78.84
rpoB, groN, nitB, rif, ron, stl, stv, ta
rpoC, tabB                        83.53
                                  80.6
                                  84.7
                                  78.26
                                  81.77
                                  81.19
                                  78.84
                                  80.6
                                  80.01
                                  81.77
                                  84.7
                                  84.11
                                  84.7
glyQ, glyS(a)                     81.19
glyS, glyS(b)                     81.77
                                  84.11
                                  84.11
                                  81.19
gloA                              80.01
                                  84.11
                                  81.19
                                  85.87
                                  83.53
metX                              84.7
                                  83.53
                                  84.7
ampG                              82.94
                                  84.11
gltK         83.53
gltJ         81.77
             82.36
             81.77
             83.53
             77.09
             78.84
             78.26
             75.33
             78.84
             76.5
             79.43
             82.94
htpG         81.19
             84.7
ampD         84.7
             84.7
             82.94
ffh          83.53
bplL, wlbL   82.36
bplI, wlbI   78.26
bplH, wlbH   80.01
bplG, wlbG   76.5
bplF, wlbF   82.94
bplE, wlbE   82.94
bplD, wlbD   82.36
bplC, wlbC   82.94
bplB, wlbB   81.19
bplA, wlbA   80.01
rfaC, waaC   78.84
kdtA, waaA   84.7
             84.7
baf          84.7
birA         83.53
             84.7
             80.6
             85.87
             84.7
             79.43
             80.01
             81.19
lipB         84.7
lipA, lip    84.11
rfbC, rmlC   82.36
rfbD, rmlD   84.11
rfbB, rmlB   84.7
             78.26
metC         84.7
dsbA         82.36
             84.7
argS         83.53
             84.11
                   84.7
                   80.01

                   81.77
                   80.01
                   83.53
                   84.11
                   84.11
                   84.11
                   82.94
                   81.19
leuA               84.11
                   82.36
rpoN, glnF, ntrA   82.36
                   85.87
                   84.11
ilvA               81.77
                   82.36
                   80.6
                   84.11
                   83.53
                   83.53
                   82.94
                   84.11
                   84.7
                   84.7
                   84.7
brg1               84.7
serA               84.7
                   84.7
                   83.53
                   84.11
phoR, nmpB         84.11
phoB               84.7
ubiE               82.36
                   84.7
                   84.7
ubiB, aarF         82.94
                   81.77
                   84.11
rhlE               82.36
                   83.53
prfC, tos, miaD    80.6
                   84.7
bfr                79.43
                   83.53
                   84.11
                   81.19
metG               84.11
                   84.7
                   81.19
                   82.94
                 83.53
dcd, dus, paxA   84.11
                 82.94
                 84.7
                 82.94
                 81.77
                 82.36
sodA             81.77
                 84.7
gcvT             84.11
gcvH             80.01
gcvP             84.7
                 84.11
                 82.36
                 82.36
                 84.11
                 80.01
thiC             82.94
                 84.11
                 84.11
                 81.19
                 81.77
                 84.7
                 82.36
ppc              83.53
sphB1            82.94
                 80.6
                 82.36
                 84.7
                 84.7
catI, pcaI       84.7
catJ, pcaJ       84.11
catC2, mmlJ      84.7
                 84.7
catD2            84.7
                 82.36
psiF             84.11
                 84.7
pcaC             80.01
                 82.36
                 80.01
                 82.94
                 81.77
folK             84.7
pcnB             84.11
                 80.01

                 84.11
purM, purG       84.7
miaA, trpX       84.11
mutL             84.11
dedA             83.53
amiC          84.11
              76.5
fumC          84.11
              80.01
              80.01
              84.7
ggt           81.19
              82.36
              84.7
              78.84
cydA, cyd-1   81.19
cydB, cyd-2   84.11
              81.19
              82.94
              84.11
apt           80.6
              84.7
              84.11
              82.94
sspB          84.11
sspA, ssp     78.84
petC          82.36
petB, cytB    78.84
petA          84.11
mscL          79.43
              81.19
degQ, hhoA    81.19
              84.11
              84.7
              83.53
              81.77
              84.11
leuA          84.11
              85.29
ilvD          81.19
              84.7
              82.94
              83.53
              78.84
              85.87
              84.11
              82.94
              83.53
              84.11
              80.6
              82.36
              84.11
              84.11
              84.7
              84.11
              79.43
              82.94
                    84.7
hemL, gsa, popC     84.11
thiE                84.7
thiD                84.11
rubA                84.7
                    81.77
                    84.11
pyrB                81.77
pyrC, pyrC', pyrX   83.53
                    84.11
apaH                84.7
                    81.77
mtgA                84.11
                    81.77
                    82.36
                    84.7
                    84.11
                    84.11
                    84.7
                    84.7
                    84.7
                    82.94
ogt                 83.53
alkB, aidD          85.87
                    82.94
                    85.87
bhuV                84.7
bhuU                84.11
bhuT                85.29
bhuS                84.7
bhuR                84.11
hurR                84.7
hurI                82.94
                    85.87
                    84.7
                    84.7
                    83.53
                    84.11

                    84.11
                    84.7
                    82.94
                    84.11
                    83.53
                    82.94
                    84.11
                    84.11
                    81.77
                    83.53
gdhA                81.19
                    83.53
pyrE                79.43
gatB               84.11
gatA               84.7
gatC               84.11
mreB, envB, rodY   81.19
mreC               84.7
mreD               84.7
mrdA, pbpA         80.6
mrdB, rodA         84.11
ldh                82.36
                   84.7
                   80.01
                   84.11
argB               82.36
                   80.01
                   82.94
                   84.7
                   83.53
                   85.29
ogt                81.19
                   84.11
                   84.11
                   80.6
                   82.36
                   80.6
                   84.7
gltS, gltC         83.53
                   84.7
atoE               83.53
                   81.19
dnaQ, mutD         80.01
                   81.19
                   84.11
                   83.53
                   85.87
                   82.36
                   84.7
                   84.11
                   84.11
                   84.11
                   81.77
                   84.7
                   84.11
                   83.53
cspA               81.19
                   81.19
                   84.11
                   82.36
                   81.19
                   84.11
                   83.53
                   83.53
                   84.11
                           82.94
                           83.53
                           81.77
                           81.19
                           84.7
                           82.94
accB                       82.36
accA, accC, FabG           81.77
                           84.7
argM, astC, cstC           82.94
                           84.11
                           81.77
                           82.36
                           82.36
hemC                       81.77
                           82.36
                           83.53
topB                       80.6
                           84.7
                           83.53
                           82.36
idnO                       84.7
                           84.7
                           84.11
                           84.11
                           80.01
                           82.36
                           83.53
ribB, htrP                 84.7
                           81.77

rne, ams, hmp1               79.43
rluC                         82.94
                             82.94
                             79.43
                             82.36
                             81.77
lldD, lctD                   82.94
                             79.43
                             84.7
                             84.11
                              himB,
gyrB, parA, nalC, acrB, pcbA,81.77 hisU
dnaN                         80.6
dnaA                         83.53
rpmH, ssaF, rimA             81.77
rnpA                         84.11
                             84.7
                             81.19
                             84.7
                             84.7
                             84.7
                             84.7
                             84.7
                             80.6
                             82.94
                             82.94
                             82.94
                             84.11
                             83.53
                             82.36
                             82.36
                             86.46
                             85.87
                             82.94
                             80.6
                             82.36
                             78.84
                             84.11
                             84.7
                             79.43
                             80.6
                             84.11
                             84.7
                             84.7
                             85.29
ecnA1                        83.53
                             80.01
                             84.7
                             84.7
                             82.94
                             84.7
                             82.36
                             82.94
                             84.7
                             84.7
                             84.11
                             84.11
                             84.7
                             81.19
                             80.6
                             84.11
                             80.6
                             82.36
                             84.7
                             84.7
fmt                          84.7
def, fms                     82.36
                             82.94
lrp, alsB, livR, ihb, oppI   84.7
smf                          84.7
hmgcL                        81.19
                             82.36
                             81.77
                             84.7
            83.53
            84.7
            84.11
            84.7
            78.84
            84.11
            82.36
            84.7
            80.01
            82.36
            82.94
            82.94
trkA        81.77
trkH        81.19
            84.7
            84.7
            85.29
            83.53
maiA        80.6
            84.11
            84.7
            84.11

            82.36
            84.11
            81.19
            81.77
            82.94
            83.53
            84.7
            82.36
            84.7
            84.7
            84.11
            84.7
            83.53
            80.01
            86.46
            85.87
gpsA        84.7
secB        81.77
grxC        82.36
            85.87
gpmA, gpm   79.43
            80.01
ctpA        84.7
thiF        84.7
            84.7
            83.53
            83.53
            83.53
            80.6
lpdA, lpd   84.7
            82.36
            83.53
            83.53
            82.94
            82.36
            82.94
            84.11
            83.53
pdhA        82.36
            80.6
            82.94
            82.36
            81.19
            81.77
            83.53
            84.11
            82.94
            83.53
            84.11
            81.77
            84.7
            83.53
            84.7
            84.7
            79.43
dld         77.09
            83.53
            83.53
            83.53
            84.7
            84.7
            84.11
            82.36
            81.19
            81.77
            82.36
            84.7
            82.36
            83.53
            84.7
glmS        82.36
            84.7
            81.19
            83.53
            81.77
            82.94
            84.7
            80.01
            80.01
            83.53
hemA        82.36
prfA, sueB, uar   84.11
hemK              84.11
                  81.77
                  81.77
                  82.36
                  82.94
                  84.11
                  83.53
                  83.53
                  84.7
                  84.7
                  82.36
rpoP, ptsN        80.6
                  82.94

                  82.36
                  84.11
                  82.94
                  84.11
purT              84.11
                  82.94
                  82.94
                  81.77
aspS, tls         78.26
                  82.36
                  81.77
                  84.11
                  84.7
                  84.11
                  82.36
                  84.7
                  83.53
                  83.53
                  84.11
                  82.36
                  84.11
                  81.77
nspC              83.53
                  82.36
                  80.6
                  84.7
bfrF              82.94
                  82.36
                  81.77
                  84.7
                  84.7
                  84.7
proB              84.7
                  83.53
rpmA              81.77
rplU              78.26
                  80.6
ispB, cel    81.19
             82.94
hyuA         81.19
hyuB         84.7
             84.11
gabD         82.36
cyaC, HlyC   83.53
cyaA, cya    79.43
cyaB         82.94
cyaD         84.11
cyaE         82.36
cyaX         82.36
             80.6
gltK         80.6
gltL         82.36
             84.11
             83.53
             82.94
             84.11
             80.6
             82.94
             84.11
             81.77
             82.94
             84.7
             84.7
             81.77
             83.53
             80.6
             83.53
ilvB         84.7
             81.19
ilvI         81.19
ilvH, brnP   81.19
ilvC         81.19
pssA         83.53
             83.53
rpsO, secC   79.43
pnp          81.77
             82.36
tdcB         82.94
             84.11
             84.7
tpiA, tpi    84.7
secG         84.7
betT         82.36
             83.53
             84.11
             84.11
             82.36
             82.36
             84.11
             80.6
metC         82.36
             80.6
             84.7
             83.53
             82.94

             81.19
hyuB         80.01
hyuA         84.7
             82.36
             83.53
             84.11
             83.53
             83.53
             84.11
             82.94
betT         81.77
             84.7
             84.11
             82.36
             84.11
             84.7
             82.36
nuoA         80.01
nuoB         82.94
nuoC         83.53
nuoD         79.43
nuoE         81.77
nuoF         84.11
nuoG         81.77
nuoH         82.36
nuoI         80.01
nuoJ         83.53
nuoK         81.19
nuoL         84.7
nuoM         82.36
nuoN         82.36
             81.77
bfrD         84.7
bfrE         81.19
             84.7
             84.7
             82.94
             84.7
             81.77
serB         81.77
mfd          83.53
ispD         84.11
ispF, mecS   84.7
fbp, fdp     82.94
pepN         84.11
             81.19
             83.53
tpm          84.11
vir-18       83.53
             85.29
             82.94
             84.7
             83.53
             81.77
             80.01
             84.7
             85.87
             82.36
             84.11
             80.01
accC, fabG   81.77
             84.7
             81.19
             81.19
pmi          84.7
             82.36
             85.87
             81.19
             83.53
             80.6
             82.94
             84.11
             84.11
             83.53
pphA, prpA   82.94
mrcA, ponA   84.7
             84.11
             84.11
dinP         84.7
             84.11
             82.94
             84.11
             83.53
             82.36
gabD         84.11
             84.11
citB         80.6
             84.7
             82.94
             80.6
             83.53
             84.11
             82.36
             82.36
             84.7

             84.7
                   84.11
                   82.94
                   80.01
                   82.36
                   84.11
                   78.26
                   81.19
                   82.36
                   83.53
ubiG, pufX         84.11
ompA               82.36
gyrA, parD, nalA   80.6
serC, pdxF         81.77
pheA               82.94
tyrA               82.36
aroA               79.43
cmk, mssA          81.19
rpsA, ssyF         82.36
ihfB, himD         83.53
                   80.01
                   84.11
rfaE               84.11
rfaD, htrM         84.7
                   82.36
cysM               83.53
mltB               80.01
                   81.77
etfB, etfS         82.94
etfA, etfL         84.11
                   81.77
                   81.77
sbp                82.94
cysA               84.7
cysD               82.94
                   84.11
                   83.53
                   80.01
rplS               82.94
                   82.36
                   81.77
                   84.7
                   82.94
                   82.94
acrB, acrE         84.7
cusC, ibeB         81.19
                   81.77
                   82.94
prlC, opdA         84.11
folD, ads          83.53
                   81.19
                   82.94
aceE               82.36
aceF               80.6
lpdA, lpd          82.36
flaA               81.19
                   84.7
tktA, tkt          83.53
gap, hexC          83.53
pgk                81.19
fabI, envM         82.36
ackA, ack          82.94
                   81.19
                   82.36
                   84.7
                   84.7
                   84.7
cbpA               83.53
                   85.87
pitA, pit          84.7
mog, mogA, chlG    84.11
                   84.7
                   82.36
                   83.53
infA               82.94
fliA, flaD         81.77
flhD, flbB, frlA   81.19
flhC, flaI, frlB   78.84
motA               80.6
motB               81.77
cheA               81.77
cheW               80.6
tsr, cheD          84.11
cheB               84.7
cheY               83.53
cheZ               84.11
                   84.7
corC               81.77
                   84.7
                   82.94
                   80.01
                   80.6
secF               81.77
secD               78.26
                   78.26

tgt                84.11
queA               84.7
                   84.7
upp, uraP          83.53
prn                84.7
cysG               84.7
                   83.53
                   84.11
                   82.94
                         84.11
ubiD                     82.94
                         84.11
                         82.36
                         84.7
maeB                     83.53
                         82.36
pstB, phoT               81.77
pstA, phoT               82.36
pstC, phoW               79.43
pstS, phoS               82.94
ppk                      81.77
ppx                      82.94
                         84.7
mrsA                     81.19
folP, dhpS               82.36
ftsH, hflB, mrsC, tolZ   84.11
rrmJ, ftsJ, mrsF         80.6
                         84.7
                         84.7
                         81.77
thrB                     81.77
                         83.53
                         80.6
                         79.43
                         82.94
                         80.6
                         83.53
                         84.7
livG                     82.94
livH                     84.7
livK                     81.19
livF                     82.94
                         82.94
                         82.36
                         84.7
lysS, herC, asuD         84.7
                         84.7
prfB, supK               80.01
recJ                     84.7
                         82.94
lolC, lolE               81.19
lolD                     82.94
                         84.11
sphB3                    82.94
                         83.53
bipA                     82.36
                         82.36
                         82.36
greB                     83.53
fim2                     81.77
maeB                     81.77
aceE         82.94
             81.19
             81.19
odhA, sucA   80.6
odhB, sucB   83.53
odhL         83.53
             80.6
fabG         82.94
             84.11
             84.7
             84.7
fecI         82.36
fecR         84.7
bfrH         80.6
             84.11
             84.7
trpS         82.94
tex          80.6
             84.11
comL         82.94
rluD, sfhB   84.7
             81.19
phbC         80.6
phbB         82.94
             80.6
             81.77
             81.77
             82.36
             84.11
             84.11
             84.7
             84.11
             84.7
             83.53

             82.94
             82.36
             83.53
             82.94
             85.29
ldcA         84.7
             84.11
             82.94
             84.7
             84.7
             83.53
             82.36
             84.11
astE, aruE   82.36
             84.7
             83.53
glnQ         84.7
                   84.7
                   84.7
                   82.94
aspC, aatA         84.7
                   84.7
                   84.11
                   84.7
                   82.94
                   84.7
                   84.11
                   84.7
                   84.7
                   82.36
                   84.7
                   84.11
btr                82.36
clpB, htpM         82.94
tcfA               84.11
                   80.01
                   83.53
                   82.36
                   84.7
                   84.11
                   81.77
                   82.36
                   84.11
apbE               84.7
                   84.11
                   84.7
                   82.94
nodI               84.7
nodJ               82.94
                   83.53
                   84.11
                   84.11
                   83.53
                   83.53
dadX, dadB, alnB   82.36
                   81.77
                   83.53
                   79.43
radA, sms          83.53
                   84.7
                   84.11
norM               84.7
                   83.53
                   84.11
                   83.53
                   81.19
radC               84.11
fkpB, slpA         84.7
lytB               83.53
                              84.11
                              84.7
                              81.19
                              82.94
                              82.94
                              81.19
                              82.36
                              83.53
nusA                          84.11
infB, ssyG                    82.94
rbfA, p15b                    80.6
truB, p35                     84.7
typA, bipA                    81.77
                              84.7
                              84.7
                              80.01
polA, resA                    78.26
                              80.6
                              83.53
                              82.94
sdaA                          78.26
                              77.09
glnE                          84.7
                              84.7
rho, nitA, psuA, rnsC, tsu, sbaA
trxA, tsnC, fipA              79.43
parE, nfxD                    82.94

                             82.94
parC                         82.36
                             78.26
                             84.7
livF                         83.53
livG                         80.6
livM                         82.94
livH                         84.11
livJ                         83.53
                             84.7
proC                         84.7
ugpB                         82.94
ugpA                         84.7
ugpE                         82.94
ugpC                         83.53
livJ                         82.94
                             84.11
                             84.11
                             84.11
                             84.7
                             82.36
lldD, lctD                   84.11
psd                          82.36
                             80.01
                             81.19
             82.94
             85.87
             84.7
             84.7
             82.36
             84.11
             84.11
             82.36
arsC, arsG   84.11
             82.36
             83.53
             83.53
             84.11
             82.36
             84.7
             84.11
             84.7
pdxK         84.7
             84.7
             82.94
glgX         84.7
glgB         84.7
             82.36
             83.53
             82.36
             84.7
             84.7
             82.94
             83.53
             82.94
             81.19
             82.36
             83.53
citE         84.7
             81.19
             82.36
             83.53
             84.7
             81.77
             84.11
leuD         82.94
             83.53
             84.7
             84.11
             82.94
             83.53
             81.77
             84.7
flhB         79.43
             85.29
flgM         84.7
flgA         84.7
flgB, flbA, fla FII             83.53
flgC, flaW, fla FIII            84.11
flgD, flaV, fla FIV             81.77
flgE, flaK, fla FV              82.36
flgF, flaX, fla FVI             84.11
flgG, flaL, fla FVII            81.19
flgH, flaY, fla FVIII           84.11
flgI, flaM, fla FIX             82.36
flgJ, flaZ, fla FX              84.7
flgK, flaS, flaW                82.36
flgL, flaT, flaU                81.77
tsr, cheD                       81.19
tar, cheM                       81.19
fliR, flaP                      84.7
fliQ, flaQ                      81.19
fliP, flaR                      84.11
fliO, flbD, flaP                82.94
fliN, motD                      84.11

fliM, fla AII, fla QII, CheC2   81.19
fliL, fla AI, fla QI, cheC1     84.11
fliJ, flaO, flaS                84.7
fliI, fla AIII, flaC            82.94
fliH, fla BIII, fla AII.3       83.53
fliG, fla BII, fla AII.2        84.7
fliF, fla BI, fla AII.1         84.7
fliE, flaN, fla AI              82.94
                                82.94
                                81.77
fliT                            84.11
fliS                            82.36
fliD, flbC, flaV                82.36
flaG                            84.11
folC, dedC                      84.11
                                82.36
cvpA, dedE                      82.94
purF                            81.77
dsbB, roxB                      84.7
glnD                            83.53
map                             82.94
rpsB                            78.84
tsf                             79.43
pyrH, smbA                      80.6
frr, rrf                        81.77
uppS, rth                       84.11
cdsA, cds                       83.53
dxr                             81.77
                                78.26
                                82.36
                                81.19
lpxD, firA                      81.19
fabZ, sefA                      79.43
lpxA                     83.53
lpxB, pgsB               83.53
rnhB                     84.7
                         84.11
                         82.36
ppsA, pps                81.19
                         84.7
                         84.7
                         81.77
                         84.7
smpB, smqB               81.77
                         81.19
                         86.46
                         80.6
                         82.36
mmsB                     84.11
                         81.19
                         82.36
talB                     84.11
carA, pyrA               82.36
carB, pyrA               82.94
gpmB                     84.11
                         84.7
                         80.6
                         78.26
aroC                     82.36
                         84.11
mobB                     83.53
moeA, chlE, bisB, narE   84.11
mobA, mob, chlB, narB    84.7
                         84.7
                         82.36
                         83.53
                         80.6
                         82.36
fdhA                     83.53
                         81.19
fdhC                     83.53
                         84.11
                         81.19
                         84.7
                         84.7
leuC                     84.7
leuD                     82.36
leuB                     84.11
asd                      79.43
                         84.7
truA, hisT, asuC         84.7
smoM                     84.7
                         82.94
                         76.5
trpF                     84.7
                 78.26
                 85.87
                 83.53
thrS             75.33
infC, fit        79.43
gshB, gsh-II     82.36
                 84.7
ptsH, phbH       81.77
ptsI             82.36
                 83.53

                 82.94
                 84.7
                 82.94
                 81.77
                 82.36
                 84.11
                 82.36
                 82.36
                 85.87
                 80.01
fmdA             82.94
                 84.7
                 84.7
fba, fda, cbbA   82.36
                 85.87
purC             84.11
                 82.94
                 83.53
                 84.11
                 82.94
purE             84.7
purK             84.11
                 82.94
                 84.7
                 83.53
                 84.11
                 82.36
                 84.7
                 84.7
                 81.77
                 84.11
gcdH             81.77
ilvG             84.7
                 84.7
xerD, xprb       84.7
                 84.7
                 81.19
                 84.11
pbpG             81.77
                 83.53
                 84.7
                    84.7
                    84.7
dnaX, dnaZ, dnazX   82.36
                    84.7
recR                84.7
                    81.77
                    82.94
                    83.53
                    84.7
                    84.7
                    84.7
                    84.11
                    84.11
                    81.19
                    84.11
mutS                84.11
                    84.7
fim3                84.11
                    84.11
dapA                80.01
glnH                79.43
glnP                83.53
glnQ                82.94
spoT                78.26
rpoZ                84.7
gmK, spoR           76.5
                    84.7
                    84.11
                    83.53
                    84.7
amn                 78.84
                    84.11
                    81.77
                    82.36
                    84.11
rph                 83.53
                    84.7
                    84.7
                    83.53
                    82.36
                    84.7
                    82.94
glnA                82.36
glnL, ntrB, glnR    84.11
glnG, ntrC, glnT    83.53
                    84.11
                    79.43
                    81.19
                    82.94
                    82.36
fpr                 81.19
                    84.11
                   81.19
                   84.7

recG               84.7
                   84.11
                   84.7
                   84.11
dps                79.43
                   84.7
tviD               78.84
                   84.11
                   75.91
kpsM               82.36
kpsT               78.84
kpsE               81.19
wbpT               82.94
vipC               84.7
wza                83.53
wbpO               81.19
wbpP, vipB, tviC   84.7
wcbA, kpsC, lipA   81.77
                   84.7
                   84.11
                   84.7
                   84.11
                   82.36
                   84.11
                   82.94
                   82.36
                   84.11
                   83.53
                   84.11
livG               81.77
livF               84.11
                   82.94
                   84.7
wcbQ               84.7
wcbP               84.7
                   84.7
                   84.11
                   82.36
sphB2              84.7
                   78.84
gst                82.94
tfdA               81.77
                   80.01
                   78.84
                   84.7
lldA               81.77
                   82.36
                   83.53
fabG               84.11
                   84.7
                   84.7
                   84.11
arsH               82.94
                   84.11
                   81.77
                   82.94
                   84.7
                   83.53
                   85.87
phaA               84.11
phaC               84.7
phaD               81.77
phaE               84.7
phaF, phaF1        82.36
phaG               83.53
                   84.7
                   83.53
cumB               84.11
ldcA               82.36
                   84.11
                   83.53
                   80.6
                   80.01
                   81.19
                   84.7
                   83.53
                   83.53
                   82.94
trxC               83.53
                   80.6
gcp                84.11
                   84.7
surE               84.7
pcm                84.11
                   78.84
                   80.6
                   84.7
                   82.36
                   83.53
                   82.94
                   85.87
                   80.01
                   84.11
                   81.19
ugpQ               81.77

ppiD               84.11
tesA, apeA, pldC   82.36
                   83.53
                   84.7
                   84.11
cphA                        84.7
cphA                        84.11
                            84.7
                            83.53
                            82.94
                            82.94
                            83.53
                            83.53
                            84.11
dfp                         83.53
lspA                        84.7
ileS, ilvS                  80.6
ribF                        81.19
                            84.7
                            84.7
                            84.11
uvrD, mutU, pdeB, rad, recL 81.19
                            83.53
                            84.7
                            84.11
dapE                        84.7
dapD                        84.11
                            84.11
phg                         82.36
                            84.7
                            84.11
cspA                        79.43
                            82.36
cspA                        77.67
                            83.53
tig                         84.11
clpP, lopP                  83.53
clpX, lopC                  78.26
lon, capR, deg, muc, lopA   81.77
                            82.36
                            82.36
                            84.7
                            82.36
                            81.77
                            82.94
                            84.11
fabG                        82.94
pcaI                        80.6
pcaJ                        81.19
lexA, exra, spr, tsl, umuA  84.7
tyrB, aspC                  82.36
uvrB                        81.19
ptpA                        81.77
                            84.11
iscS                        81.19
iscU, nifU                  83.53
iscA                        82.36
hscB         84.7
hscA, hsc    81.19
fdx          81.77
             84.7
             84.7
paaG         85.87
             84.7
pdxA         82.94
             84.7
             84.11
panD         84.11
ascD, rfbI   84.11
dadA, dadR   83.53
ugpB         81.19
             84.11
             84.11
             80.01
             82.36
             84.11
             83.53
             84.7
             82.94
             82.94
             85.87
             84.7
             82.94
             84.11
alaS, lovB   83.53
             84.7
             80.6
rpsP         80.01
rimM         82.94
trmD         81.77
             84.7
             83.53
             82.94
             81.77
tmk          84.7

holB         83.53
             82.94
             84.11
             84.11
             79.43
glnQ         84.11
gdhA, gdh    83.53
amaB         84.7
ilvG         82.36
citE         84.7
             82.94
             82.94
             83.53
             84.7
             83.53
             84.7
bvgR         82.94
bvgS         84.11
bvgA         82.36
fhaB         82.36
fimB, fhaD   81.77
fimC, fhaA   82.94
fimD, fhaE   82.36
fhaC         82.94
             84.11
             80.01
             84.7
             84.7
             80.6
             81.19
oplaH        83.53
             84.7
             82.36
             84.7
             83.53
             81.77
suhB, ssyA   84.7
             84.11
bacA         82.94
lpxH         84.11
ppiB         81.19
             84.7
cysS         84.7
             80.6
accA         82.36
             85.87
ask          80.01
             82.94
             82.94
             83.53
             84.11
             83.53
             81.19
bioH         81.19
             84.11
             84.7
             80.6
             84.7
             84.11
             79.43
             83.53
             84.7
             84.7
             84.7
             84.11
       84.7
       84.11
       83.53
       82.36
       84.7
nemA   84.7
       84.11
hmsR   78.26
hmsF   82.36
hmsH   82.94
       84.7
       84.11
       82.94
       84.7
       84.7
       82.94
       84.7
       79.43
maiA   84.7
       84.7
bfrI   82.94
       84.7
       84.11
pgm    84.7
pgi    82.94
srpH   84.11
       83.53
       84.7
       84.11
gabD   83.53

goaG   79.43
       84.7
       83.53
       85.87
       81.77
       84.11
       83.53
       84.7
       84.11
       81.19
       84.11
       84.7
       81.19
       85.87
       83.53
       84.7
       82.36
       81.19
       80.01
       84.11
       82.94
       84.7
       78.26
       85.87
       84.11
       82.94
       84.11
efp    78.26
       84.7
       81.19
       84.11
acnA   80.01
       81.77
brfB   83.53
       82.36
       84.11
       80.01
acnB   82.36
       83.53
       84.7
       82.94
       83.53
       82.36
       83.53
       81.19
       82.36
       81.77
       84.7
       84.7
       82.94
       82.94
       84.11
proA   84.7
holA   84.7
       81.77
leuS   83.53
       84.11
       84.11
bph2   84.11
       82.94
rpmG   76.5
rpmB   82.36
       84.11
       82.94
       80.01
       82.94
       84.7
       84.7
       82.36
       82.94
       83.53
       82.94
       82.36
       82.36
       81.77
       84.11
       84.11
       83.53
       81.19
       85.87
       82.36
       84.11
pdxJ   84.7
acpS   84.11
nagZ   84.11
uvrC   80.6
pgsA   81.77
       79.43
aceA   83.53
       83.53
       84.7
       82.94
       81.19
       84.11
       84.11

       84.7
       83.53
       83.53
       82.36
       84.7
       83.53
       84.7
       80.01
       82.94
       84.7
       84.11
       82.94
       83.53
       82.94
       84.11
       84.11
       79.43
       82.36
       84.11
gor    83.53
       82.94
       84.7
       84.7
       84.11
       82.36
       84.7
       84.11
       80.01
       83.53
                   82.36
                   83.53
                   83.53
                   81.19
                   84.7
                   82.94
                   84.7
                   81.19
                   84.11
                   84.11
                   84.7
                   82.36
                   84.7
                   84.11
                   84.11
                   84.11
                   84.7
                   84.7
                   84.11
                   82.36
acoD               79.43
                   84.11
                   84.7
                   84.11
                   82.94
                   84.11
bioA               82.36
                   82.94
                   84.7
                   84.11
                   83.53
                   84.7
                   81.77
                   84.7
                   83.53
                   81.19
                   84.7
                   84.7
                   80.6
                   83.53
                   80.6
rpoD               78.84
dnaG, dnaP, parB   81.19
rpsU               82.36
                   80.6
purA, adeK         84.7
                   82.94
hflC               80.01
hflK               82.36
hflX               84.11
hfq                80.01
his1, hisC         81.77
             84.7
             84.7
             84.11
hisS         81.77
ispG, gcpE   83.53
             84.7
             82.94
ndk          82.94
valS         80.6
             82.36
             84.11
             84.7
             82.94
fhp          83.53

             83.53
ectA         82.36
             84.7
             84.7
             84.7
             80.6
             82.36
             82.36
bapA         82.94
             81.19
             81.19
             83.53
alr, dadB    84.7
             82.36
             80.6
             81.19
             82.36
             80.01
brpL         81.77
bscC         81.19
bscW         84.7
bscU         83.53
bscT         83.53
bscS         81.77
bscR         81.77
bscQ         80.6
bscP         83.53
bscO         83.53
bscN         78.84
bscL         84.7
bscK         84.11
bscJ         82.36
bscI         82.36
bcr4         82.94
bcrH2        82.36
bopB         84.7
bopD         84.7
bcrH1      84.7
           84.7
bsp22      78.26
bopN       82.36
           84.7
           84.11
           81.19
bcrD       80.01
bscD       84.7
bscE       84.11
bscF       79.43
           80.6
greA       82.94
           82.94
           81.19
           84.11
           82.94
           83.53
           82.94
           84.11
           84.7
           84.7
           84.7
           83.53
qor, hcz   82.94
           78.84
           84.7
           83.53
           84.11
           82.94
           82.94
           84.11
           82.36
           81.19
           82.36
           83.53
           83.53
           84.7
           82.94
           84.11
           81.77
           84.11
           84.7
           83.53
           84.7
           81.77
           84.7
purD       82.36
hemF       80.6
nadD       84.7
           83.53
           84.7
                   84.7
vag8               81.77
                   81.77
                   84.7
                   82.36
                   82.94

                   84.11
waaF               84.7
                   82.94
                   84.7
                   83.53
                   80.6
                   79.43
                   84.11
                   84.11
                   81.77
                   84.7
dnaE, polC         82.94
                   81.19
                   81.19
argA               84.11
                   83.53
                   84.11
                   82.36
rpiA               82.36
                   84.7
                   84.7
                   80.01
                   84.7
                   84.11
                   80.6
                   80.01
                   84.11
                   80.6
                   82.94
                   84.7
                   83.53
                   84.11
                   82.94
                   83.53
gltA, gluT, icdB   81.77
                   81.77
sdhB               81.77
sdhA               82.36
sdhD               82.36
sdhC, cybA         80.01
                   81.77
mdH                80.6
prpC               84.7
acnA, acnM, acn    80.01
                   82.94
prpD   84.7
       81.19
       84.11
       84.7
       82.36
       80.6
       84.11
       81.77
       84.11
       84.11
       79.43
       82.36
       82.94
       84.7
eno    82.94
       81.19
kdsA   82.36
pyrG   80.01
       84.7
       81.19
       81.19
       84.7
       81.19
       84.11
       83.53
       84.7
       82.36
       78.84
       82.36
       84.7
       84.7
       83.53
ltaE   84.7
       82.94
       83.53
       84.7
       84.11
       78.84
       79.43
       82.36
       83.53
       84.7
       84.11
       84.7
pepA   82.94
       84.11
       86.46
       82.94
       82.94
       84.11

       82.36
                         84.11
                         83.53
rnc                      84.7
lep                      81.19
lepA                     80.6
mucD                     82.94
mucB, rseB               83.53
                         80.6
sigE, rpoE, algT, algU   79.43
                         84.11
fabF, fabJ               82.36
acpP                     81.77
fabG                     84.11
fabD                     83.53
fabH                     83.53
                         84.7
rpmF                     82.36
                         84.11
                         84.7
                         84.11
                         84.7
                         83.53
                         84.7
                         83.53
                         80.01
alcA                     81.77
alcB                     81.19
alcC                     78.26
alcD                     84.11
alcE                     83.53
alcR                     80.6
bcr                      80.6
fauA                     81.77
mar                      84.7
                         82.94
                         84.7
                         84.7
vrg-6                    84.7
                         79.43
                         82.36
                         81.77
                         83.53
ftsK                     81.77
trxB                     84.11
                         84.7
                         83.53
                         83.53
                         81.19
kdpA                     81.77
kdpB                     83.53
kdpC                     84.7
kdpD                     82.36
kdpE              83.53
                  82.94
                  83.53
icd, icdA, icdE   81.19
                  82.94
                  84.11
                  83.53
                  82.36
                  81.77
                  84.7
                  81.19
                  83.53
dnaJ              84.7
dnaK              84.11
                  82.36
                  82.94
                  84.7
hemH              84.11
                  81.77
ppnK              84.11
                  84.7
fur               77.09
omlA              82.94
dapB              84.11
murB              84.11
                  82.36
                  83.53
                  84.7
purU              82.36
soxG              82.94
soxA              84.7
soxD              83.53
soxB              77.67
                  80.6
                  81.77
                  82.36
folD              82.94
                  80.6
                  84.7
                  81.19
                  84.11
                  84.7

                  84.7
                  82.36
ecnB              82.36
                  80.6
ppa               79.43
                  84.7
                  82.94
                  84.7
HemC              84.7
            80.01
            80.6
sucD        80.6
sucC        81.19
            82.36
metE        78.26
metR        80.01
            82.94
recA        81.19
            84.11
            83.53
            82.36
            83.53
            82.94
            81.19
            77.67
fabG        84.7
            83.53
            84.11
            82.94
            84.7
            81.77
            83.53
            81.77
pyrB        84.7
            85.87
            84.11
ecnA2       82.94
            83.53
            84.11
            84.7
            79.43
            81.19
ihfA        84.11
pheT        80.6
pheS        83.53
rplT        83.53
rpmI        80.6
dut, dnaS   83.53
            81.19
            84.7
            82.94
            83.53
            81.77
            85.87
            82.94
            82.94
            84.11
            84.7
            82.94
            80.01
            82.94
       84.7
       82.94
       81.19
       83.53
       84.7
       83.53
       83.53
       80.6
       83.53
       83.53
       84.7
       84.11
       84.7
       78.26
       82.36
       81.77
       81.19
       84.11
       77.09
       80.6
       84.7
hipA   82.36
hipB   82.94
guaA   83.53
guaB   84.11
       83.53
       84.7
       84.11
lrp    78.84
       80.6
       83.53
       82.94
       84.11
       82.36

       84.11
glpR   82.94
       84.11
       84.7
       82.36
       82.36
       81.77
       84.7
       84.11
       84.11
       83.53
       84.7
       84.7
       84.7
       82.94
       84.7
       83.53
       84.11
       83.53
       82.94
       84.11
fhaS   84.11
purL   82.36
       82.94
       81.19
       82.36
       83.53
fimX   82.36
paaK   83.53
paaI   83.53
paaG   84.11
       84.7
paaD   82.36
paaC   83.53
paaB   83.53
paaA   78.84
paaX   81.77
       85.87
       81.19
       83.53
       81.77
       81.77
       81.19
       80.01
       82.94
       84.7
glnB   84.7
       81.77
       81.77
argH   83.53
       82.94
       82.36
moaA   84.7
moeA   84.7
moaB   84.7
moaE   83.53
moaD   85.29
moaC   84.7
       81.77
       81.19
       84.11
       83.53
       80.01
       84.7
       84.11
       85.87
       81.19
       84.7
       83.53
       84.7
       82.94
       84.11
       80.6
       83.53
       82.94
       80.6
       84.7
       84.7
       82.94
bapC   83.53
       83.53
       82.94
       83.53
       82.36
       81.19
       80.6
       82.36
putA   79.43
       84.11
       82.94
       81.77
clpA   82.94
pbp    82.94
       82.94
       84.11

       77.67
       83.53
       80.6
       83.53
sodB   80.6
xseA   82.94
       84.11
       82.94
       82.36
       85.87
       82.36
adK    82.36
       84.7
       82.94
       83.53
rpst   79.43
       80.6
       84.11
       84.11
thrC   84.7
       82.36
       82.36
       84.11
       81.77
       81.19
       82.94
       84.11
dnaB   83.53
       84.7
rplI   84.11
rpsR   82.94
priB   84.11
rpsF   84.7
       84.11
dxs    82.36
       83.53
xseB   84.7
       83.53
       84.7
       81.77
       83.53
       84.11
       79.43
       82.94
       84.7
       84.7
fadD   82.94
       84.11
       78.84
       84.11
       82.36
       81.77
       83.53
       82.94
       81.77
       81.77
       83.53
       84.11
       82.36
       81.77
       80.01
       80.6
       83.53
       84.7
       84.11
       81.77
       84.11
       84.7
       82.36
panB   82.36
       84.7
       84.7
       84.7
       84.11
       82.36
       84.7
tyrB   79.43
               84.7
               84.11
               82.36
               83.53
               80.01
               82.36
               84.11
               84.11
               84.11
               84.11
               84.7
               84.7
               81.19
ribE, ribC     81.77
               84.11
               83.53
               85.87
               85.87

               85.29
               84.11
               80.6
               84.11
               83.53
               82.94
               84.11
purB           80.6
               81.77
               83.53
trmU           84.11
               84.7
               84.7
               81.77
pntaA, nntA1   82.36
               83.53
bfeA           78.84
               84.7
glcF           84.7
glcE           82.36
glcD           78.84
               83.53
fhaL           82.36
aroG           81.77
               80.6
               78.26
bph3           81.19
               84.7
               84.11
               82.36
               81.19
               85.87
               80.01
       84.7
       85.87
       83.53
bfrG   84.11
       84.11
       80.6
       84.7
       84.7
       82.36
       82.94
       84.7
cyoD   84.7
cyoC   80.01
cyoB   79.43
cyoA   80.01
       79.43
       82.36
       84.11
       84.11
       84.7
       82.36
       84.7
       84.7
       84.7
       83.53
       84.11
       82.94
       84.11
       82.36
glyA   81.77
       81.77
tyrS   83.53
       84.11
       83.53
       82.94
       84.7
argC   82.94
rpsI   81.19
rplM   80.01
       80.6
       82.36
       79.43
       84.11
       84.11
       81.19
       84.7
       84.7
dbpA   84.7
       81.19
       84.7
       82.36
gltX   82.36
                       84.7
                       83.53
                       80.6
nrdA                   77.09
nrdB                   76.5
bpH1                   82.36
                       81.19
dltA                   80.01
dltB                   80.6
                       84.7

dltD                   80.6
                       81.77
pcp                    84.7
                       78.84
                       84.7
fabG                   84.11
fabE                   80.01
aroQ, aroD             75.33
                       79.43
mpl                    82.94
                       82.36
                       82.36
                       84.11
aroE                   85.29
                       82.36
                       83.53
grp                    82.36
                       82.94
                       84.11
                       82.94
                       82.94
                       82.94
secA, prlD, azi, pea   76.5
                       84.7
                       83.53
lpxC, envA, asmB       84.11
ftsZ, sfiB, sulB       81.19
ftsA, divA             84.11
ftsQ                   81.77
ddlB, ddl              84.7
murC                   84.11
murG                   85.29
ftsW                   82.94
murD                   82.36
murX, mraY             80.6
murE                   82.36
ftsI, pbpB             82.36
ftsL                   84.7
mraW                   78.26
mraZ                   84.11
                       84.11
pyrC                         82.36
                             81.19
                             80.01
lrp, alsB, livR, ihb, oppI   82.36
bllY                         81.77
                             82.94
cyt                          84.11
ilvD                         80.6
lgt, umpA                    83.53
                             81.77
                             84.11
                             82.36
                             80.6
                             80.6
                             82.94
ung                          84.7
                             82.94
                             84.7
cca                          82.36
                             80.6
                             84.11
                             79.43
                             82.36
                             81.77
                             83.53
                             81.19
acyH                         81.19
                             83.53
                             84.11
metK                         84.7
                             79.43
                             84.11
dapF                         82.94
                             82.36
                             84.11
                             80.01
                             84.7
                             84.7
                             83.53
                             84.11
                             85.29
                             84.7
                             83.53
dksA                         80.01
hslV, htpO                   81.77
hslU, htpI                   82.36
                             82.36
                             84.7
                             83.53
modD                         84.7
modC                         81.77
modB                         82.94
            82.94
            84.11

            85.29
            85.87
            85.87
            84.11
            83.53
            83.53
            82.36
            83.53
            82.94
            80.01
            77.67
            75.91
            83.53
            83.53
            82.94
            84.7
            84.7
pth         84.7
rplY        81.19
prsA, prs   83.53
ispE, ipk   81.77
            85.29
            84.7
mutM, fpg   84.7
            80.01
            83.53
            84.7
            84.7
hmgA        84.7
fahA, fah   84.11
            81.77
            84.11
            84.11
            84.11
            84.7
pgm         84.7
pgi         82.94
            83.53
            84.7
            80.01
            84.7
            81.19
            83.53
            84.7
wbpO        82.94
            84.7
            82.94
            84.11
            84.7
folA, tmrA                  84.7
                            82.36
                            84.7
                            84.7
                            84.7
                            84.11
                            83.53
ureG                        81.77
ureC                        82.36
ureB                        84.11
ureJ                        85.87
ureA                        84.7
ureD                        84.7
hmrR                        84.11
                            81.19
                            82.94
                            83.53
                            84.7
                            83.53
                            84.11
                            79.43
                            82.94
                            84.7
                            83.53
                            84.11
                            83.53
                            80.6
                            83.53
                            84.11
                            83.53
                            83.53
                            84.7
                            85.87
                            83.53
                            84.7
                            84.11
rnhA, rnh, dasF, herA, sdrA 80.6
                            83.53
gloB                        77.09
                            84.7
fabI, envM                  83.53
                            83.53
                            84.11
                            82.36
ompR, ompB, kmt             84.7
                            84.11

                           84.11
                           84.11
glnS                       80.6
minC                       84.11
minD                       82.94
minE               81.77
osmB               85.87
                   84.7
                   84.11
                   82.36
                   82.36
                   82.94
                   81.77
uvrA2              82.36
                   84.11
                   84.7
                   84.7
                   84.11
                   83.53
                   84.7
                   82.94
                   82.94
                   84.11
pdxH               84.7
                   84.7
                   83.53
                   82.36
                   82.94
trpC               82.94
trpD               78.26
trpG               84.11
trpE               82.94
gph                81.19
rpe, cbbeP, cfxE   80.01
                   81.77
                   84.11
                   82.94
                   79.43
                   84.7
                   79.43
folB               83.53
                   83.53
                   81.77
                   83.53
                   78.26
                   80.6
atpB, uncB, papD   76.5
atpE               81.19
atpF, uncF, papF   81.19
atpH, uncH, papE   81.19
atpA, uncA, papA   84.7
atpG, uncG, papC   80.01
atpD, uncD, papB   80.6
atpC, uncC, papG   83.53
                   85.29
hemE               84.7
                   84.7
rep          82.94
             83.53
             84.7
             84.11
             80.01
             84.7
             84.7
             85.87
             82.94
             84.11
             81.77
             81.77
             81.77
             84.11
             81.77
             83.53
copA         78.84
copB         84.11
             81.19
             83.53
             84.7
             84.11
             84.11
             81.77
             84.7
             84.7
             82.94
             81.77
             78.26
ksgA, rsmA   81.77
garK         84.11
pykA         82.36
             82.94
             82.94
             84.7
             82.36
             80.6
             81.19

             79.43
             82.94
             83.53
             82.94
proS, drpA   83.53
nudH         80.6
             81.77
             83.53
             83.53
             83.53
             82.94
             81.19
             77.67
       75.33
       82.94
       82.94
       75.33
       82.36
       83.53
       81.19
       80.6
       82.36
       79.43
       78.84
       80.6
       81.77
       82.36
       85.87
       84.11
       83.53
       83.53
       82.94
       81.77
       84.11
       82.36
       82.36
       84.11
       84.11
       78.26
       78.84
       82.36
       84.7
       83.53
       82.36
       84.11
       84.11
ilvE   83.53
       84.7
       84.7
       81.77
       84.11
       83.53
       79.43
ompQ   81.19
       84.7
       84.7
       84.7
       81.77
       84.7
       80.6
fis    84.11
purH   83.53
ruvC   84.7
ruvA   84.7
       84.7
             82.36
ruvB         84.7
             84.7
             84.7
             84.11
             83.53
             81.19
             84.7
             81.77
             82.94
cysI         82.94
             84.7
             81.19
             83.53
             82.36
             84.7
dnt          80.01
             82.36
             84.11
pyrD         82.94
             84.11
             84.11
             84.11
             82.36
             84.11
             81.19
             80.6
             84.7
             82.94
             81.77

maeB         84.11
             84.11
             83.53
             81.19
             82.94
             82.94
             78.26
             79.43
             82.36
             84.7
             79.43
             82.94
             83.53
fdx          82.36
coaD, kdtB   81.19
             82.94
ftsY         82.94
             84.11
             82.36
             84.7
             80.6
                           81.77
                           82.36
ribB                       83.53
ribH                       81.77
nusB, ssyB                 79.43
thiL                       84.7
                           83.53
                           84.7
pyrF                       84.7
ndh                        82.94
dgkA                       82.94
brkB                       82.94
brkA                       83.53
cpn60, groEL, mopA, groL   84.7
cpn10, groES               82.94
                           84.7
                           81.19
                           81.77
                           79.43
                           80.01
                           80.01
                           82.36
                           84.11
                           84.11
                           84.7
                           84.7
                           84.7
                           84.11
                           82.36
                           84.11
                           84.11
                           82.94
                           80.6
                           82.94
                           84.7
                           84.11
rnr, vacB                  83.53
                           83.53
                           82.36
                           84.7
hupB, hopd                 83.53
tonB                       84.11
exbB                       80.6
exbD                       82.36
basR                       80.6
                           80.6
kup, trkD                  81.77
argG                       81.77
argF                       82.94
argD                       81.77
                           84.7
                           83.53
                             82.36
                             84.11
                             82.94
                             84.7
                             83.53
                             82.36
                             84.7
ahpD                         81.77
ahpC                         78.26
risA                         78.84
                             84.7
                             84.7
                             83.53
                             79.43
                             84.11
ligA, lig, dnaL, pdeC, lop   84.7
                             83.53
                             79.43
                             81.19
msrB                         84.7
                             81.19
                             83.53

                             85.29
                             81.77
                             84.7
                             83.53
                             84.11
                             83.53
                             82.36
                             83.53
                             81.19
                             84.11
                             84.7
nth                          83.53
                             84.11
                             82.94
                             84.7
                             81.77
pncB                         81.19
                             81.19
                             83.53
                             84.11
relA                         78.26
                             83.53
trpB                         84.7
trpA                         83.53
accD, dedB, usg              82.36
metH                         83.53
                             84.11
                             84.7
thiG                         81.77
thiD                84.11
                    82.94
                    82.36
                    84.7
                    83.53
                    81.77
                    81.77
rpsL                80.01
rpsG                80.6
fusA, fus, far1     81.77
rpsJ, nusE          84.7
rplC                82.94
rplD                80.6
rplW                80.01
rplB                84.7
rpsS                81.77
rplV                78.26
rpsC                82.94
rplP                81.77
rpmC                81.77
rpsQ                78.26
                    82.36
                    81.77
rplN                83.53
rplX                81.77
rplE                81.19
rpsN                80.6
rpsH                80.6
rplF                81.77
rplR                81.77
rpsE                82.94
rpmD                84.7
rplO                84.11
secY, prlA          78.26
infA                80.6
rpmJ                81.77
rpsM                80.6
rpsK                82.36
rpsD, ramA          82.36
rpoA                80.01
                    81.77
cutA, cycY, cutA1   81.19
                    82.36
                    84.7
hemB                80.6
                    83.53
                    82.36
                    80.01
                    81.77
lysA                81.77
cyaY                82.94
                    82.36
aroK        82.36
aroB        84.11
            84.11
            84.11
uvrA        80.6
            84.11
ssb         82.94
bfrC        78.84
            82.36
            81.19
            82.94
            82.36
            84.11
            84.7

            83.53
            82.36
            81.19
            83.53
            83.53
            82.36
            83.53
            82.94
            84.7
glcB, glc   82.36
            82.36
            85.29
            83.53
            84.11
            81.19
            84.11
            75.91
            84.11
            82.94
            84.11
            84.7
            84.7
            84.11
            82.36
            84.11
            84.11
            81.19
            82.94
            82.36
            84.7
            84.7
            84.7
            81.19
            84.11
            81.19
nudC        82.36
            85.87
                       84.7
                       84.7
                       80.6
                       83.53
                       82.36
                       84.7
                       84.11
                       84.7
                       81.77
                       82.36
                       82.94
                       82.94
nadC                   84.7
                       80.6
rkpK                   84.11
                       82.94
glmU                   84.7
                       84.7
                       81.77
                       84.11
                       83.53
                       81.77
                       81.77
                       84.11
                       81.77
                       82.36
coIII                  82.36
                       82.36
                       84.7
ctaD, coxA             84.11
                       81.19
                       83.53
                       81.19
                       83.53
rpoH, htpR, hin, fam   82.94
                       81.77
                       82.94
adhI                   80.01
                       84.7
gltB, aspB             82.36
                       84.7
                       82.94
                       84.11
                       84.11
                       83.53
                       82.36
                       84.7
                       82.94
                       81.19
                       84.11
murA, murZ             81.77
hisG                   84.7
hisD   82.94
hisC   82.36
hisB   82.36
hisH   82.94
hisA   82.36
hisF   84.11

hisI   84.7
hisE   78.84
       81.19
tatE   83.53
tatB   82.94
tatC   81.19
       84.7
ptxA   81.77
ptxB   80.01
ptxD   81.19
ptxE   82.36
ptxC   79.43
ptlA   83.53
ptlB   82.36
       82.36
       81.77
       83.53
       81.77
       84.7
       82.94
       82.36
       84.11
       83.53
       83.53
       84.7
       84.11
       80.6
       82.36
       83.53
       78.84
argJ   84.7
       83.53
       84.7
       83.53
       82.36
       83.53
       83.53
       82.94
       82.36
coaE   84.7
       81.77
       84.7
       82.36
panC   84.7
       81.19
                   84.7
                   80.6
glpK               83.53
                   82.94
                   82.94
                   82.94
                   83.53
                   82.94
                   80.6
ftsE               82.36
                   84.7
                   83.53
mutY, micA         84.7
                   84.7
                   82.94
                   81.19
                   82.36
                   82.94
                   82.36
                   80.6
                   84.11
                   82.36
                   84.7
                   80.01
katA               81.19
                   78.26
                   84.7
                   81.77
                   82.36
                   82.36
                   84.7
                   84.11
                   81.19
                   83.53
                   81.19
trmE, thdF, mnmE   80.6
                   84.7
                   81.19
                   81.77
                   82.36
                   82.94
                   79.43
                   82.36
                   81.19
ansB               79.43
                   84.11
                   81.19
                   80.6
                   85.29
                   84.7

                   80.01
gltL                82.94
                    81.19
                    81.19
                    77.67
                    76.5
                    84.11
                    84.11
bplJ, bplK, wlbjK   82.94
                    84.7
                    81.19
                    84.7
                    78.84
                    83.53
                    82.94
                    84.7
                    84.7
                    82.94
                    83.53
                    79.43
                    84.7
                    80.01
                    80.01
                    86.46
                    75.91
                    82.94
                    82.36
                    84.7
                    84.11
                    82.36
                    81.77
                    81.77
                    82.94
                    83.53
                    84.7
                    83.53
                    82.36
                    84.11
                    85.29
                    80.01
                    84.11
                    81.19
                    83.53
fusA', fus', far'   84.11
fusA', fus', far'   81.19
                    82.94
                    84.7
                    81.19
                    82.36
aceK                81.77
                    84.7
                    83.53
                    81.19
                  83.53
acpD'             80.6
                  81.19
                  83.53
                  81.77
                  83.53
                  86.46
                  83.53
                  84.7
                  83.53
                  84.11
                  83.53
                  81.19
                  84.7
                  84.7
                  84.7
                  81.19
rpoN              81.19
                  81.77
                  82.94
                  78.84
                  79.43
                  80.6
                  84.11
                  85.29
                  79.43
gltJ              82.36
                  81.19
argH              81.77
                  84.7
                  79.43
                  84.7
                  84.11
                  80.6
                  80.01
                  85.29
                  84.7
                  83.53
                  82.36
cysU, cysT        81.19
cysW              84.11
cysH              83.53

cysN              84.11
                  80.6
                  83.53
acrA, mtcA, lir   84.11
                  78.84
                  81.19
                  84.7
cheY              84.7
cheR, cheX        81.77
lnt, cutE          82.94
                   82.94
                   83.53
                   84.11
livM               82.36
                   84.11
tauD, ssiD         82.94
                   81.77
                   84.7
bapB               83.53
                   81.77
                   84.11
                   84.11
                   84.7
                   84.11
                   84.11
                   80.6
                   81.77
                   84.7
                   86.46
                   81.77
malQ, malA         86.46
                   80.01
                   84.7
                   86.46
mxcB               84.7
                   84.7
leuC               84.11
flhA               83.53
flhF               81.19
                   81.77
fliK, flaE, flaR   85.87
                   83.53
marC               81.19
                   82.94
                   80.01
fdhB               78.26
                   81.77
hemN               82.94
osmC               82.36
                   84.7
                   83.53
                   84.7
                   83.53
                   82.36
wcbO, kpsS         84.11
                   82.94
                   82.94
                   83.53
                   77.09
                   81.77
                   86.46
       84.11
arsC   81.77
       82.36
       84.7
       81.19
       78.84
       82.94
       81.77
purN   82.36
dapC   80.01
       84.7
       82.94
       80.6
       84.11
kdgT   81.77
       81.77
       84.11
       84.7
       80.01
       86.46
aldH   84.7
       85.87
       86.46
       85.29
       83.53
       80.6
fimA   78.26
       84.7
       82.36
       82.94
       82.36
       84.7
       83.53
       83.53

       82.94
       82.94
       84.7
       80.6
       84.11
       84.11
       83.53
       82.94
       84.11
       84.11
       84.7
       81.19
       81.77
       82.94
       83.53
       84.7
       82.94
             83.53
             83.53
             79.43
             84.7
             84.11
             81.77
             84.7
             83.53
aroG         83.53
             85.87
             84.7
             85.87
             82.94
             80.6
             81.19
             84.11
             83.53
             85.29
             84.11
             84.11
             84.11
prpB         84.11
             82.94
             84.7
             82.36
             83.53
prpE         82.94
             82.94
             77.09
             86.46
             83.53
             86.46
             82.36
             84.7
             83.53
             84.11
             84.7
             81.77
             81.77
             84.7
             82.36
             83.53
dadA, dadR   83.53
             83.53
             84.11
             83.53
             84.7
             84.7
paaE'        80.6
             84.7
             83.53
             84.11
               84.7
               84.11
               81.19
amtB           84.7
               79.43
               84.7
               82.36
               79.43
               82.36
               81.77
               83.53
               83.53
               81.77
               81.77
               80.01
               82.36
               84.11
               83.53
pntAB, nntA2   82.94
pntB, nntB     80.6
               84.11
               83.53
               82.36
               84.7
               82.36
prmA           83.53

               81.77
               83.53
acpD'          80.01
               84.7
               84.7
               81.77
               84.11
mmsA           83.53
               84.7
               85.87
ureE           84.7
ureF           84.7
fdx            82.94
               77.09
               84.7
               84.11
               84.7
               77.09
               81.19
               81.19
               83.53
               83.53
               84.7
               81.19
               82.94
       83.53
       84.7
       78.26
       82.36
       84.11
       81.19
       82.36
paaH   84.7
       83.53
       80.6
       82.36
       82.36
       84.7
       81.77
       81.77
       81.77
       81.19
       81.77
       82.36
aat    83.53
       84.11
       82.36
       84.11
       83.53
       81.19
       82.36
       81.77
risS   83.53
       81.77
       81.19
       80.6
       84.11
glcC   82.36
       80.6
       81.19
       81.19
       78.84
       81.77
       84.7
       82.36
       81.19
       84.11
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6

                           81.19
                           79.43
                           80.01
                           78.84
                           78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC

                           77.67
TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                           77.67
AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                           77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                           77.09
GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                           79.43
                           78.26
                           80.6
                           81.19
                           79.43
                           80.01
                           78.84
                           78.26
                           78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                           77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                           78.26
GCACCGTTAATACCACGTGTATCGTAACACTATCG
                           77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                           77.67
TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                           77.67
AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                           77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                           77.09
GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                           79.43
                           78.26
                           80.6
                           81.19
                           79.43
                           80.01
                           78.84
                           78.26
                           78.26
                           78.26
         infA              82.94
         lysS, herC, asuD  84.7
         polA, resA        78.26
         parC              82.36
         fliO, flbD, flaP  82.94
         rpsB              78.84
         dnaK              84.11
         ftsL              84.7
         dksA              80.01
         nusB, ssyB        79.43
         accD, dedB, usg   82.36
         infA              80.6
                           77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG

                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                            78.26
 GCACCGTTAATACCACGTGTATCGTAACACTATCG
                            77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                            77.67
 TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                            77.67
 AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                            77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                            77.09
 GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                            79.43
                            78.26
                            80.6
                            81.19
                            79.43
                            80.01
                            78.84
                            78.26
                            78.26
                            78.26
         infA               82.94
         lysS, herC, asuD   84.7
         polA, resA         78.26
         parC               82.36
         fliO, flbD, flaP   82.94
         rpsB               78.84
         dnaK               84.11
         ftsL               84.7
         dksA               80.01
         nusB, ssyB         79.43
         accD, dedB, usg    82.36
         infA               80.6
                            77.09
TTGATTATGAAGGGTTGGGTAGTAACCATGAGAAG
                            78.26
AATAGGTAGCTTAACACTACTCCTGAAACCGCATTA
                            77.09
GCTTGCGTCGAATAGAGGGCGTTTATCTGGCACTT
                            77.67
AGCGGTCCTAATCCACTTGAATGGCCCAACGTTTT
                            77.67
GGGGATAACCGGACTCCCACATGACTGCTACGTAC
                            77.67
GCGACGTAGTAACATTTTCTGCGTAGGCTCACTGC
                           78.26
GCACCGTTAATACCACGTGTATCGTAACACTATCG
                           77.67
TTGTGGCCTCCTCTTAACCCTCGGAGGTCTACCAC
                           77.67
TAAATGGCGGGAGGTGTTATGTAGAGAATCGCCAC
                           77.67
AGACTTGTCAGACACCCGTGTACGTCCGTTGAAGC
                           77.67
ATACGTCTAAAGCGGGGAAGCAATAGGCCGGTTAT
                           77.09
GTGAGTCCCTAGCCTTTTCGGAAGTCCTAGACAC
                           79.43
                           78.26
                           80.6
                           81.19
                           79.43
                           80.01
                           78.84
                           78.26
                           78.26
                           78.26
         infA              82.94
         lysS, herC, asuD  84.7
         polA, resA        78.26
         parC              82.36
         fliO, flbD, flaP  82.94
         rpsB              78.84
description

glucose inhibited division protein A
glucose inhibited division protein B
ParA family protein
Putative acetyltransferase, GnaT family
probable chromosome partitioning protein ParB
elongation factor Tu
preprotein translocase SecE subunit
transcription antitermination protein NusG
50S ribosomal protein L11
50S ribosomal protein L1
50S ribosomal protein L10
50S ribosomal protein L7/L12
DNA-directed RNA polymerase beta chain
DNA-directed RNA polymerase beta' chain
putative lipoprotein
putative membrane protein
putative peptidoglycan binding protein
Two-component response regulator
transposase
conserved hypothetical protein
putative thiolase
MaoC family protein
putative transcriptional regulator
putative enoyl-CoA hydratase
conserved hypothetical protein
probable transporter
glycyl-tRNA synthetase alpha chain
glycyl-tRNA synthetase beta chain
putative haloacid dehalogenase-like hydrolase
probable acyltransferase
conserved hypothetical protein
lactoylglutathione lyase
peptide deformylase
putative exported protein
transcriptional regulator
putative membrane protein
homoserine O-acetyltransferase
conserved hypothetical protein
transposase
putative integral membrane signal transducer protein
putative aspartate/glutamate racemase
glutamate/aspartate transport system permease protein
glutamate/aspartate transport system permease protein
amino-acid ABC transporter binding protein precursor
conserved hypothetical protein
putative DNA-binding protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative ferredoxin
oxidoreductase
integral membrane protein
putative exported protein
transposase
heat shock protein
probable glutathione S-transferase
N-acetylmuramoyl-L-alanine amidase
putative exported protein
putative membrane protein
signal recognition particle protein
lipopolysaccharide biosynthesis protein
lipopolysaccharide biosynthesis protein
putative glycosyl transferase
probable sugar transferase
lipopolysaccharide biosynthesis protein
probable glycosyl transferase
UDP-N-acetylglucosamine 2-epimerase
lipopolysaccharide biosynthesis protein
probable acetyltransferase
probable oxidoreductase
probable heptosyltransferase
3-deoxy-D-manno-octulosonic-acid transferase
putative exported protein
Bvg accessory factor
putative biotin protein ligase
putative integral membrane protein
probable ATP-binding component of ABC transporter
putative exported protein
conserved hypothetical protein
putative penicillin-binding protein precursor
probable class IV aminotransferase
conserved hypothetical protein
lipoate-protein ligase B
lipoic acid synthetase
dTDP-4-dehydrorhamnose 3,5-epimerase
dTDP-4-dehydrorhamnose reductase
dTDP-glucose 4,6-dehydratase
transposase
cystathionine beta-lyase
thiol:disulfide interchange protein DsbA precursor
putative exported protein
arginyl-tRNA synthetase
conserved hypothetical protein
hypothetical protein
transposase for IS1663

inner membrane component of binding-protein-dependent transport system
inner membrane component of binding-protein-dependent transport system
probable extracellular solute-binding protein
sugar ABC transporter, ATP-binding protein
putative cAMP phosphodiesterase
ABC transporter, permease protein
probable periplasmic solute-binding protein
amidase
2-isopropylmalate synthase
putative membrane protein
RNA polymerase sigma-54 factor
putative bacterioferritin-associated ferredoxin
probable LysR-family transcriptional regulator
threonine dehydratase biosynthetic
probable iron-sulfur binding oxidase
GntR family transcriptional regulator
conserved hypothetical protein
putative lipase
putative enoyl-CoA hydratase/isomerase
putative exported protein
probable transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
probable dioxygenase
LysR family transcriptional regulator
D-3-phosphoglycerate dehydrogenase
putative exported protein
two-component sensor kinase
two-component response regulator
phosphate regulon sensor protein
phosphate regulon transcriptional regulatory protein
ubiquinone/menaquinone biosynthesis methyltransferase
putative membrane protein
conserved hypothetical protein
probable ubiquinone biosynthesis protein
putative membrane protein
putative exported protein
putative ATP-dependent RNA helicase
LysE family efflux protein
peptide chain release factor 3
putative exported protein
bacterioferritin
putative lipoprotein
putative lipoprotein
conserved hypothetical protein
methionyl-tRNA synthetase
putative exported protein
putative iron sulfur binding protein
putative exported protein
putative exported protein
deoxycytidine triphosphate deaminase
conseved hypothetical protein
putative lyase
hypothetical protein
probable orn/arg/lys decarboxylase
putative exported protein
superoxide dismutase [Mn]
probable metal transporter
glycine cleavage system T protein
glycine cleavage system H protein
glycine cleavage system P protein
putative GntR-family transcriptional regulator
conserved hypothetical protein
putative exported protein
putative restriction endonuclease
putative exported protein
thiamine biosynthesis protein
putative aldehyde dehydrogenase
putative oxidoreductase
putative GntR-family transcriptional regulator
putative hydrolase
putative acetyltransferase
Conserved hypothetical protein
phosphoenolpyruvate carboxylase
autotransporter subtilisin-like protease
3-hydroxybutyryl-CoA dehydrogenase
short-chain fatty acids transporter
probable short-chain dehydrogenase
probable transcriptional regulator
3-oxoadipate CoA-transferase subunit A
3-oxoadipate CoA-transferase subunit B
methylmuconolactone isomerase
conserved hypothetical protein
3-oxoadipate enol-lactone hydrolase
conserved hypothetical protein
phosphate starvation-inducible protein precursor
beta-D-hydroxybutyrate dehydrogenase
4-carboxymuconolactone decarboxylase
GntR family transcriptional regulator
putative solute-binding periplasmic protein
putative membrane protein
putative exported protein
2-amino-4-hydroxy-6-hydroxymethyldihydropteridi ne pyrophosphokinase
poly(A) polymerase
conserved hypothetical protein

conserved hypothetical protein
phosphoribosylformylglycinamidine cyclo-ligase
tRNA delta(2)-isopentenylpyrophosphate transferase
DNA mismatch repair protein
putative membrane protein
N-acetylmuramoyl-L-alanine amidase
conserved hypothetical protein
fumarate hydratase class II
putative membrane protein
putative exported protein
LysR family transcriptional regulator
gamma-glutamyltranspeptidase
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
cytochrome D ubiquinol oxidase subunit I
cytochrome D ubiquinol oxidase subunit II
putative exported protein
probable ATP-binding component of ABC transporter
probable ATP-binding component of ABC transporter
adenine phosphoribosyltransferase
putative exported protein
hypothetical protein
hypothetical protein
stringent starvation protein B
stringent starvation protein A
cytochrome C1 precursor
cytochrome B
ubiquinol-cytochrome C reductase iron-sulfur subunit
large-conductance mechanosensitive channel
conserved hypothetical protein
protease
putative regulatory protein
putative 2-hydroxyacid dehydrogenase
probable extracellular solute-binding protein, family 5
putative acetyl esterase
probable transcriptional regulator
2-isopropylmalate synthase
probable transcriptional regulator
dihydroxy-acid dehydratase
probable transporter
probable LysR-family transcriptional regulator
putative 5'(3')-deoxyribonucleotidase
hypothetical protein
conserved hypothetical protein
MarR-family transcriptional regulator
putative esterase
putative ABC transporter substrate binding protein
probable branched-chain amino acid transport system, permease component
probable branched-chain amino acid transport system, permease component
putative branched-chain amino acid transporter, ATP-binding protein
high-affinity branched-chain amino acid transporter, ATP-binding protein
putative enoyl-CoA hydratase/isomerase
putative acyl-CoA dehydrogenase
probable acid-coenzyme A ligase
probable 4-hydroxybenzoyl CoA thioesterase
conserved hypothetical protein
conserved hypothetical protein
glutamate-1-semialdehyde 2,1-aminomutase
thiamine-phosphate pyrophosphorylase
phosphomethylpyrimidine kinase
rubredoxin
putative transcriptional regulator
conserved hypothetical protein
aspartate carbamoyltransferase
dihydroorotase
acyltransferase
diadenosine-tetraphosphatase
putative membrane protein
monofunctional biosynthetic peptidoglycan transglycosylase
conserved hypothetical protein
putative coenzyme A ligase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
metallo-beta-lactamase family protein
putative exported protein
putative exported protein
putative membrane protein
methylated-DNA--protein-cysteinemethyltransferase
alkylated DNA repair protein
conserved hypothetical protein
conserved hypothetical protein
putative ATP-binding component of hemin transport system
putative hemin permease
putative hemin binding protein
putative hemin transport protein
outer membrane heme receptor
heme uptake transmembrane sensor
heme uptake regulator
hypothetical protein
putative ferredoxin
hypothetical protein
putative ferredoxin
probable ornithine cyclodeaminase

GntR-family transcription regulator
putative membrane protein
putative membrane protein
conserved hypothetical protein
probable aldehyde dehydrogenase
conserved hypothetical protein
CDP-6-deoxy-delta-3,4-glucoseen reductase
probable extracellular solute-binding protein
putative exported protein
putative membrane protein
NADP-specific glutamate dehydrogenase
putative endonuclease
orotate phosphoribosyltransferase
glutamyl-tRNA(GLN) amidotransferase subunit B
glutamyl-tRNA(GLN) amidotransferase subunit A
glutamyl-tRNA(GLN) amidotransferase subunit C
rod shape-determining protein
rod shape-determining protein
rod shape-determining protein
penicillin-binding protein 2
rod shape-determining protein
putative L-lactate dehydrogenase
putative Sodium:sulfate symportert
putative TetR-family transcriptional regulator
putative hydrolase
acetylglutamate kinase
putative exported protein
putative thioredoxin
putative exported protein
probable phosphosugar isomerase
putative tetrapyrrole methylase
methylated-DNA--protein-cysteinemethyltransferase
putative membrane protein
putative exported protein
putative membrane protein
conserved hypothetical protein
putative membrane protein
putative glycosyl transferase
putative sodium/glutamate symport carrier protein
putative exported protein
putative short-chain fatty acids transporter
putative membrane protein
DNA polymerase III, epsilon chain
putative universal stress protein
conserved hypothetical protein
putative GntR-family transcriptional regulator
putative Mg(2+) transporter
putative membrane protein
conserved hypothetical protein
probable enoyl-CoA hydratase
putative exported protein
LysR-family transcriptional regulator
probable acyl-CoA dehydrogenase
putative acyl-CoA dehydrogenase
probable thiolase
probable LysR-family transcriptional regulator
cold shock protein
putative exported protein
putative GntR-family transcriptional regulator
delta-1-pyrroline-5-carboxylate dehydrogenase precursor
short-chain fatty acids transporter
putative molybdopterin oxidoreductase
conserved hypothetical protein
probable LysR-family transcriptional regulator
putative dehydratase/racemase
conserved hypothetical protein
LysR-family transcriptional regulator
conserved hypothetical protein
MerR-family transcriptional regulator
metallo-beta-lactamase family protein
acetyl-CoA acetyltransferase
carboxyltransferase subunit of acetyl-CoA carboxylase
biotin carboxylase subunit of acetyl-CoA carboxylase
conserved hypothetical protein
succinylornithine transaminase
putative exported protein
low-specificity D-threonine aldolase
putative exported protein
putative membrane protein
putative heme receptor
conserved hypothetical protein
putative membrane protein
DNA topoisomerase iii
putative exported protein
ABC-transporter, ATP-binding component
ABC transporter, permease component
gluconate 5-dehydrogenase
probable aldehyde dehydrogenase
alcohol dehydrogenase
acetolactate synthase large subunit
AsnC-family transcriptional regulator
putative membrane protein
conserved hypothetical protein
3,4-dihydroxy-2-butanone 4-phosphate synthase
choloylglycine hydrolase

ribonuclease E
ribosomal large subunit pseudouridine synthase C
probable hydrolase
conserved hypothetical protein
putative membrane protein
AraC-family transcriptional regulator
L-lactate dehydrogenase
putative exported protein
probable amidase
transcriptional regulator
DNA gyrase subunit B
DNA polymerase iii, beta chain
chromosomal replication initiator protein
50S ribosomal protein L34
ribonuclease P protein component
conserved hypothetical protein
probable inner-membrane protein
transposase
LysR-family transcriptional regulator
hypothetical protein
hypothetical protein
C-terminal region of two component sensor kinase (partial)
integrase
phage-related conserved hypothetical protein
phage-related hypothetical protein
phage-related conserved hypothetical protein
phage-related hypothetical protein
hypothetical protein
phage-related exonuclease
phage-related DNA recombination protein
phage-related putative membrane protein
phage-related hypothetical protein
phage-related hypothetical protein
transposase
phage-related hypothetical protein
hypothetical protein
conserved hypothetical protein
probable glutathione S-transferase
putative exported protein
conserved hypothetical protein
putative metal-activated pyridoxal enzyme
probable haloacid dehalogenase
putative integrase (Remnant)
hypothetical protein
entericidin A anti-toxin precursor
autotransporter
conserved hypothetical protein
putative exported protein
putative substrate-CoA ligase
probable transcriptional regulator
probable enoyl-CoA hydratase/isomerase
probable carboxymuconolactone decarboxylase
arginase
ornithine aminotransferase
probable transcriptional regulator
putative exported protein
conserved hypothetical protein
putative 4-oxalocrotonate tautomerase
conserved hypothetical protein
bacterioferritin
putative lysine decarboxylase
hypothetical protein
probable haloacid dehalogenase-like hydrolase
conserved hypothetical protein
methionyl-tRNA formyltransferase
polypeptide deformylase
conserved hypothetical protein
leucine-responsive regulatory protein
conserved hypothetical protein
hydroxymethylglutaryl-CoA lyase
putative membrane protein
amino acid-binding periplasmic protein
probable aminotransferase
putative exported protein
putative exported protein
probable LysR-family transcriptional regulator
probable transporter
transposase
putative dioxygenase
conserved hypothetical protein
putative amino acid efflux protein
conserved hypothetical protein
putative exported protein
putative two-component sensor kinase
putative two-component response regulator
Trk system potassium uptake protein
Trk system potassium uptake protein
probable MarR-family transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
maleate cis-trans isomerase
conserved hypothetical protein
putative isochorismatase
probable ring hydroxylating beta subunit

probable Ring hydroxylating alpha subunit
putative ferredoxin reductase
ferredoxin
putative exported protein
oxidoreductase, large chain
oxidoreductase, medium chain
putative iron-sulfur binding protein
putative exported protein
probable ABC transporter, ATP-binding component
ABC transporter, permease component
putative membrane protein
putative membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
rRNA methylase
glycerol-3-phosphate dehydrogenase [NAD(P)+]
protein-export protein
glutaredoxin 3
conserved hypothetical protein
phosphoglycerate mutase 1
putative peptidase
putative carboxy-terminal processing protease precursor
adenylyltransferase
putative exported protein
probable transcriptional regulator
putative exported protein
conserved hypothetical protein
TetR-family transcriptional regulator
dihydrolipoamide dehydrogenase
branched-chain amino acid ABC transporter, ATP-binding protein
 branched-chain amino acid ABC transporter, permease protein
branched-chain amino acid ABC transporter, permease protein
putative leu/ile/val-binding protein precursor
putative substrate-CoA ligase
probable acyl-CoA dehydrogenase
probable enoyl-CoA hydratase/isomerase
putative pyruvate dehydrogenase E1 beta subunit
putative pyruvate dehydrogenase E1 component, alpha subunit
probable transcriptional regulator
putative exported protein
probable acyl-CoA dehydrogenase
probable enoyl-CoA hydratase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
probable acyl-CoA dehydrogenase
putative exported protein
conserved hypothetical protein
LysR-family transcriptional regulator
putative dihydrodipicolinate synthase
conserved hypothetical protein
putative exported protein
LysR-family transcriptional regulator
D-lactate dehydrogenase
probable acyl-CoA dehydrogenase
probable acyl-CoA dehydrogenase
putative exported protein
putative acetylornithine deacetylase
conserved hypothetical protein
putative endoribonuclease
conserved hypothetical protein
probable zinc-binding dehydrogenase
LysR-family transcriptional regulator
putative acetyl-CoA synthetase
probable enoyl-CoA hydratase
conserved hypothetical protein
putative exported protein
thymidine diphosphoglucose 4,6-dehydratase
glucosamine--fructose-6-phosphate aminotransferase [isomerizing]
AsnC-family transcriptional regulator
probable thiolase
probable enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase, bifunctional enzyme
probable acyl-CoA dehydrogenase
putative exported protein
acetyl-CoA synthetase
conserved hypothetical protein
probable transcriptional regulator
probable molybdopterin oxidoreductase
glutamyl-tRNA reductase
peptide chain release factor 1
heme biosynthesis protein
conserved hypothetical protein
probable flavoprotein
putative exported protein
4,5-dihydroxyphthalate decarboxylase
probable 2Fe-2S ferredoxin
probable dehydrogenase/oxidase
putative lipoprotein
conserved hypothetical protein
cytochrome C
Hpr serine kinase/phosphatase
nitrogen regulatory IIA protein
ABC transporter

putative exported protein
putative exported protein
probable hydrolase
conserved hypothetical protein
phosphoribosylglycinamide formyltransferase 2
putative membrane protein
conserved hypothetical protein
putative membrane protein
aspartyl-tRNA synthetase
putative endonuclease/exonuclease/phosphatase family protein
putative phospholipase
putative membrane protein
carboxyvinyl-carboxyphosphonatephosphorylmutase
conserved hypothetical protein
probable aminotransferase
probable amidase
probable ABC transporter, ATP-binding protein
probable ABC transporter, permease protein
probable ABC transporter, permease protein
probable ABC transporter, periplasmic binding protein
probable transcriptional regulator
probable transcriptional regulator
carboxynorspermidine decarboxylase
putative exported protein
hypothetical protein
putative exported protein
putative ferric siderophore receptor
putative inner membrane sensor for iron transport
putative DNA methylase
putative transcriptional regulator
putative transcriptional regulator
putative transcriptional regulator
glutamate 5-kinase
probable GTP-binding protein
50S ribosomal protein L27
50S ribosomal protein L21
conserved hypothetical protein
octaprenyl-diphosphate synthase
LysR-family transcriptional regulator
putative hydantoin utilization protein A
hydantoin utilization protein B
putative amino acid deaminase
succinate-semialdehyde dehydrogenase [NADP+]
cyclolysin-activating lysine-acyltransferase
bifunctional hemolysin-adenylate cyclase precursor
cyclolysin secretion ATP-binding protein
cyclolysin secretion protein
cyclolysin secretion protein
probable LysR-family transcriptional regulator
probable extracellular solute-binding protein
glutamate/aspartate transport system permease protein
glutamate/aspartate transport ATP-binding protein
probable aminotransferase
putative membrane protein
putative exported protein
putative acetoacetyl-CoA reductase
putative acetolactate synthase large subunit
probable GntR-family transcriptional regulator
hypothetical protein
probable GntR-family transcriptional regulator
probable Zinc-binding dehydrogenase
putative acetyl-CoA synthetase
conserved hypothetical protein
putative membrane protein
probable ABC transporter, ATP-binding component
putative exported protein
putative dioxygenase
putative acetolactate synthase large subunit
putative mechanosensitive channel protein
acetolactate synthase large subunit
acetolactate synthase small subunit
ketol-acid reductoisomerase
putative CDP-diacylglycerol--serine O-phosphatidyltransferase protein
putative lipoprotein
30S ribosomal protein S15
polyribonucleotide nucleotidyltransferase
putative lipoprotein
threonine dehydratase catabolic
conserved hypothetical protein
probable zinc-binding dehydrogenase
triosephosphate isomerase
protein-export membrane protein
high-affinity choline transport protein
probable transcriptional regulator
methylaspartate ammonia-lyase
putative exported protein
conserved hypothetical protein
putative exported protein
probable short-chain dehydrogenase
probable LysR-family transcriptional regulator
cystathionine beta-lyase
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
putative exported protein

conserved hypothetical protein
hydantoin utilization protein B
hydantoin utilization protein A
putative transcriptional regulator
azurin
conserved hypothetical protein
outer membrane component of multidrug efflux system
integral membrane component of multidrug efflux system
probable HlyD-family secretion protein
putative transcriptional regulator
high-affinity choline transport protein
LysR-family transcriptional regulator
probable DNA repair exonuclease
putative membrane protein
putative exported protein
conserved hypothetical protein
outer membrane porin protein precursor
probable NADH-ubiquinone oxidoreductase chain 3
NADH-ubiquinone oxidoreductase, 20 kDa subunit
respiratory-chain NADH dehydrogenase, 30 kDa subunit
respiratory-chain NADH dehydrogenase, 49 kDa subunit
respiratory-chain NADH dehydrogenase I, 24 kDa subunit
respiratory-chain NADH dehydrogenase, 51 kDa subunit
NADH-ubiquinone oxidoreductase, 75 kDa subunit
NADH-ubiquinone oxidoreductase, chain H
NADH-ubiquinone oxidoreductase, chain I
NADH-ubiquinone oxidoreductase, chain J
NADH-ubiquinone oxidoreductase, chain K
NADH-ubiquinone oxidoreductase, chain L
NADH-ubiquinone oxidoreductase, chain M
NADH-ubiquinone oxidoreductase, chain N
putative membrane protein
probable TonB-dependent receptor for iron transport
probable TonB-dependent receptor for iron transport
probable GnaT-family acetyltransferase
short-chain dehydrogenase
putative acetolactate synthase large subunit
putative exported protein
probable LysR-family transcriptional regulator
phosphoserine phosphatase
transcription-repair coupling factor
4-diphosphocytidyl-2c-methyl-D-erythritolsynthase
2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase
fructose-1,6-bisphosphatase
aminopeptidase N
putative exported protein
ABC transporter, ATP-binding protein
thiopurine S-methyltransferase
vir-repressed protein
putative exported protein
putative lipoprotein
conserved hypothetical protein
putative phospholipase
conserved hypothetical protein
biotin carboxyl carrier protein
probable carboxylase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
GntR-family transcriptional regulator
biotin carboxylase
transposase
hypothetical protein
hypothetical protein
putative mannose-6-phosphate isomerase
conserved hypothetical protein
hypothetical protein
transposase
putative ferredoxin
ABC transporter, ATP-binding protein
probable oxidoreductase
putative oxidoreductase
putative membrane protein
putative membrane protein
serine/threonine protein phosphatase 1
penicillin-binding protein 1A
putative peptidase
conserved hypothetical protein
DNA-damage-inducible protein p
putative decarboxylase
putative exported protein
probable inner membrane component of binding-protein-dependent transport system
probable inner membrane component of binding-protein-dependent transport system
conserved hypothetical protein
putative succinate-semialdehyde dehydrogenase [NADP+]
putative exported protein
citrate utilization protein B
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
putative fumarylacetoacetate-family hydrolase
conserved hypothetical protein
putative exported protein
LysR-type transcriptional regulator
putative membrane protein

putative CoA ligase
putative exported protein
conserved hypothetical protein
hypothetical protein
putative exported protein
LysR-family transcriptional regulator
phage-related protein
conserved hypothetical protein
putative sugar efflux transpoter
putative phosphoglycolate phosphatase
3-demethylubiquinone-9 3-methyltransferase
outer membrane protein A precursor
DNA gyrase subunit A
phosphoserine aminotransferase
p-protein [includes: chorismate mutase and prephenate dehydratase]
prephenate dehydrogenase
3-phosphoshikimate 1-carboxyvinyltransferase
cytidylate kinase
30S ribosomal protein S1
integration host factor beta-subunit
putative membrane protein
putative membrane protein
ADP-heptose synthase
ADP-L-glycero-D-manno-heptose-6-epimerase
conserved hypothetical protein
cysteine synthase B
membrane-bound lytic murein transglycosylase B precursor
histone deacetylase family protein
electron transfer flavoprotein beta-subunit
electron transfer flavoprotein alpha-subunit
probable acyl-CoA dehydrogenase
antioxidant protein
sulfate-binding protein precursor
sulfate transport ATP-binding protein
sulfate adenylyltransferase subunit 2
conserved hypothetical protein
putative membrane protein
putative membrane protein
50S ribosomal protein L19
conserved hypothetical protein
probable oxidoreductase
conserved hypothetical protein
putative RNA pseudouridylate synthase
LysR-family transcriptional regulator
acriflavine resistance protein B
probable outer membrane lipoprotein
putative membrane protein
putative exported protein
oligopeptidase A
FolD bifunctional protein [includes: methylenetetrahydrofolate dehydrogenase and methylenetetrahydrofolate cyclohydrolase]
two-component response regulator
tw-component sensor kinase
pyruvate dehydrogenase E1 component
dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
dihydrolipoamide dehydrogenase
flagellin
conserved hypothetical protein
transketolase 1
glyceraldehyde-3-phosphate dehydrogenase
phosphoglycerate kinase
enoyl-[acyl-carrier-protein] reductase [NADH]
acetate kinase
phosphate acetyl/butaryl transferase
conserved hypothetical protein
probable glutathione S-transferase
conserved hypothetical protein
putative acetyltransferase
curved DNA-binding protein
conserved hypothetical protein
probable phosphate transporter
molybdopterin biosynthesis protein
putative exported protein
putative peptidase
hypothetical protein
translation initiation factor IF-1
RNA polymerase sigma factor for flagellar operon
flagellar transcriptional activator FlbB
flagellar transcriptional activator FlhC
chemotaxis protein MotA
chemotaxis protein MotB
chemotaxis protein CheA
chemotaxis protein CheW
methyl-accepting chemotaxis protein I
protein-glutamate methylesterase
chemotaxis protein CheY
chemotaxis protein CheZ
putative aldo/keto reductase
magnesium and cobalt efflux protein
conserved hypothetical protein
PhoH-like protein
conserved hypothetical protein
transposase for IS1663
protein-export membrane protein
protein-export membrane protein
putative secreted protein

queuine tRNA-ribosyltransferase
S-adenosylmethionine:tRNAribosyltransferase-isomerase
probable D-alanyl-D-alanine carboxypeptidase
uracil phosphoribosyltransferase
pertactin precursor
siroheme synthase
putative membrane protein
putative membrane protein
putative membrane protein
hypothetical protein
3-octaprenyl-4-hydroxybenzoate carboxy-lyase
putative transglycosylase
probable aminotransferase
conserved hypothetical protein
NADP-dependent malic enzyme
conserved hypothetical protein
phosphate transport ATP-binding protein
phosphate transport system permease protein
phosphate transport system permease protein
phosphate-binding periplasmic protein precursor
polyphosphate kinase
exopolyphosphatase
conserved hypothetical protein
phosphoglucomutase/phosphomannomutase
dihydropteroate synthase
cell division protein
ribosomal RNA large subunit methyltransferase j
conserved hypothetical protein
transposase
putative membrane protein
homoserine kinase
conserved hypothetical protein
conserved hypothetical protein
putative membrane protein
putative membrane protein
conserved hypothetical protein
probable two-component response regulator
probable two-component histidine kinase
high-affinity branched-chain amino acid transport ATP-binding protein
high-affinity branched-chain amino acid transport system permease protein
putative amino acids binding protein
high-affinity branched-chain amino acid transport ATP-binding protein
putative long-chain fatty-acid--CoA ligase
probable TetR-family transcriptional regulator
putative membrane protein
lysyl-tRNA synthetase
probable short chain dehydrogenase
peptide chain release factor 2
single-stranded-DNA-specific exonuclease
putative exported protein
lipoprotein releasing system transmembrane protein
lipoprotein releasing system ATP-binding protein
putative deoxyribonuclease
serine protease
hypothetical protein
putative outer membrane ligand binding protein
probable hydrolase
conserved hypothetical protein
transcription elongation factor
serotype 2 fimbrial subunit precursor
NADP-dependent malic enzyme
pyruvate dehydrogenase E1 component
AsnC-family transcriptional regulator
putative membrane protein
2-oxoglutarate dehydrogenase E1 component
dihydrolipoamide succinyltransferase component of 2-oxoglutarate dehydrogenase complex
2-oxoglutarate dehydrogenase complex, E3 component
conserved hypothetical protein
3-oxoacyl-[acyl-carrier protein] reductase
LysR-family transcriptional regulator
putattive exported protein
probable short-chain dehydrogenase
ECF-family sigma factor
putative signal transduction protein
putative ferric siderophore receptor
putative iron uptake protein
putative iron uptake protein
tryptophanyl-tRNA synthetase
transcription accessory protein
probable ATP-dependent helicase
competence lipoprotein precursor
ribosomal large subunit pseudouridine synthase D
conserved hypothetical protein
poly-beta-hydroxybutyrate polymerase
acetoacetyl-CoA reductase
conserved hypothetical protein
putative exported protein
putative exported protein
putative membrane protein
putative regulatory protein
conserved hypotheticals protein
putative dioxygenase
putative 2-pyrone-4,6-dicarboxylic acid hydrolase
putative lipoprotein
putative racemase

probable LysR-family transcriptional regulator
probable short-chain dehydrogenase
putative membrane protein
sodium/solute symporter
putative membrane protein
putative muramoyltetrapeptide carboxypeptidase
putative adolase
LysR-family transcriptional regulator
putative oxidoreductase
putative exported protein
conserved hypothetical protein
hypothetical protein
putative exported protein
putative succinylglutamate desuccinylase
putative membrane protein
LysR-family transcriptional regulator
amino acids ABC transporter, ATP-binding protein
amino acids ABC transporter, permease protein
amino acids ABC transporter, permease protein
probable solute-binding protein
aspartate aminotransferase
putative aldolase
hypothetical protein
hypothetical protein
lipoprotein
conserved hypothetical protein
putative RNA polymerase sigma factor
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
ferredoxin
putative exported protein
transcriptional regulatory protein
ATP-dependent protease, ATPase subunit
tracheal colonization factor precursor
TetR-family transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
LysR-family transcriptional regulator
N-acyl-D-glutamate deacylase
putative exported protein
probable oxidoreductase
thiamine biosynthesis lipoprotein precursor
putative exported protein
putative exported protein
putative membrane protein
ABC, transporter, ATP-binding protein
ABC transporter, permease protein
putative membrane protein
putative membrane protein
putative exported protein
putative phytoene synthase
putative phytoene synthase
alanine racemase, catabolic
probable short-chain dehydrogenase
putative membrane protein
putative Ecf-type RNA polymerase sigma factor
DNA repair protein
putative membrane protein
putative exported protein
multidrug resistance protein
putative membrane protein
50S ribosomal protein L31
putative tryptophan oxygenase
conserved hypothetical protein
DNA repair protein
FkbP-type peptidyl-prolyl cis-trans isomerase
putative drug tolerance protein
putative glutathione-S-transferase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable LysR-family transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
N utilization substance protein A
translation initiation factor IF-2
ribosome-binding factor A
tRNA pseudouridine synthase B
GTP-binding elongation factor
putative toxin
putative exported protein
putative exported protein
DNA polymerase I
putative membrane protein
putative carboxymethylenebutenolidase
putative membrane protein
L-serine dehydratase 1
conserved hypothetical protein
glutamate-ammonia-ligase adenylyltransferase
transcription termination factor Rho
thioredoxin 1
topoisomerase IV subunit B

putative membrane protein
topoisomerase IV subunit A
putative membrane protein
putative glutathione S-transferase
high-affinity branched-chain amino acid transport, ATP-binding protein
high-affinity branched-chain amino acid transport, ATP-binding protein
high-affinity branched-chain amino acid transport system, permease protein
high-affinity branched-chain amino acid transport system, permease protein
leu/ile/val-binding protein precursor
putative membrane protein
pyrroline-5-carboxylate reductase
glycerol-3-phosphate-binding periplasmic protein precursor
sn-glycerol-3-phosphate transport system, permease protein
sn-glycerol-3-phosphate transport system permease protein
sn-glycerol-3-phosphate transport ATP-binding protein
leu/ile/val-binding protein precursor
conserved hypothetical protein
putative membrane protein
conserved hypothetical protein
conserved hypothetical protein
putative exported protein
putative L-lactate dehydrogenase
phosphatidylserine decarboxylase proenzyme
hypothetical protein
putative lipoprotein
putative lipoate-protein ligase A
conserved hypothetical protein
putative acetyltransferase
putative glutathione transferase
glutathione peroxidase
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
putative arsenate reductase
putative bacterioferritin comigratory protein
putative membrane protein
conserved hypothetical protein
putative exported protein
universal stress family protein
putative membrane protein
GntR-family transcriptional regulator
conserved hypothetical protein
pyridoxine kinase
probable alpha amylase
probable alpha amylase
probable glycosyl hydrolase
1,4-alpha-glucan branching enzyme
alpha-glucosidase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable phospholipase
conserved hypothetical protein
conserved hypothetical protein
autotransporter
conserved hypothetical protein
LysR-family transcriptional regulator
putative reductase
putative citrate lyase beta chain
putative GntR-family transcriptional regulator
putative acetyl-CoA synthetase
conserved hypothetical protein
conserved hypothetical protein
putative exported protein
probable LacI-family transcriptional regulator
3-isopropylmalate dehydratase small subunit
putative exported protein
putative mandelate racemase
putative ketopantoate reductase
putative amino-acid ABC transporter, ATP-binding protein
putative amino-acid ABC transporter, permease protein
putative amino-acid ABC transporter, periplasmic amino acid-binding protein
transposase for IS1663
flagellar biosynthetic protein FlhB
conserved hypothetical protein
negative regulator of flagellin synthesis
flagella basal body P-ring formation protein
flagellar basal-body rod protein FlgB
flagellar basal-body rod protein FlgC
basal-body rod modification protein FlgD
flagellar hook protein FlgE
flagellar basal-body rod protein FlgF
flagellar basal-body rod protein FlgG
flagellar L-ring protein precursor
flagellar P-ring protein precursor
peptidoglycan hydrolase
flagellar hook-associated protein 1
flagellar hook-associated protein 3
methyl-accepting chemotaxis protein I
methyl-accepting chemotaxis protein II
flagellar biosynthetic protein FliR
flagellar biosynthetic protein FliQ
flagellar biosynthetic protein FliP
flagellar protein FliO
flagellar motor switch protein FliN

flagellar motor switch protein FliM
flagellar protein FliL
flagellar protein FliJ
flagellum-specific ATP synthase FliI
flagellar assembly protein FliH
flagellar motor switch protein FliG
flagellar M-ring protein FliF
flagellar hook-basal body complex protein FliE
hypothetical protein
putative flagellar protein
flagellar protein FliT
flagellar protein FliS
flagellar hook-associated protein 2
putative flagellar protein
FolC bifunctional protein [includes: folylpolyglutamate synthase and dihydrofolate synthase]
conserved hypothetical protein
colicin V production protein
amidophosphoribosyltransferase
disulfide bond formation protein B
[protein-PII] uridylyltransferase
methionine aminopeptidase
30S ribosomal protein S2
elongation factor Ts
uridylate kinase
ribosome recycling factor
undecaprenyl pyrophosphate synthetase
phosphatidate cytidylyltransferase
1-deoxy-D-xylulose 5-phosphate reductoisomerase
putative membrane protein
probable surface antigen
putative outer membrane protein
UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase
(3R)-hydroxymyristol-[acyl carrier protein] dehydratase
acyl-[acyl-carrier-protein]--UDP-N-acetylglucos amine O-acyltransferase
lipid-A-disaccharide synthase
ribonuclease HII
putative RNA methyltransferase
conserved hypothetical protein
phosphoenolpyruvate synthase
probable class-I glutamine amidotransferase
putative membrane protein
putative membrane protein
probable membrane protein
SsrA-binding protein
conserved hypothetical protein
conserved hypothetical protein
probable acyl-CoA dehydrogenase
enoly-CoA hydratase
3-hydroxyisobutyrate dehydrogenase
conserved hypothetical protein
putative membrane protein
transaldolase B
carbamoyl-phosphate synthase small chain
carbamoyl-phosphate synthase large chain
probable phosphoglycerate mutase 2
LysR-family transcriptional regulator
probable ATP-binding component of ABC transporter
probable permease component of ABC transporter
chorismate synthase
putative lipoprotein
molybdopterin-guanine dinucleotide biosynthesis protein B
molybdopterin biosynthesis protein
molybdopterin-guanine dinucleotide biosynthesis protein A
putative iron sulfur binding protein
conserved hypothetical protein
conserved hypothetical protein
putative iron-sulfur binding protein
conserved hypothetical protein
formate dehydrogenase large subunit precursor
putative lipoprotein
formate dehydrogenase subunit C precursor
putative exported protein
conserved hypothetical protein
probable ATP-binding component of ABC transporter
putative exported protein
3-isopropylmalate dehydratase large subunit
3-isopropylmalate dehydratase small subunit
3-isopropylmalate dehydrogenase
aspartate-semialdehyde dehydrogenase
putative membrane protein
tRNA pseudouridine synthase A
putative periplasmic solute-binding protein
putative membrane protein
putative membrane protein
N-(5'-phosphoribosyl)anthranilate isomerase
hypothetical protein
conserved hypothetical protein
probable two-component response regulator
threonyl-tRNA synthetase
translation initiation factor IF-3
glutathione synthetase
putative IIa component of sugar transport PTS system
phosphocarrier protein HPr
phosphoenolpyruvate-protein phosphotransferase
conserved hypothetical protein

putative ornithine cyclodeaminase
putative exported protein
putative extracellular solute-binding protein
putative inner membrane component of binding-protein-dependent transport system
putative inner membrane component of binding-protein-dependent transport system
putative ATP-binding component of ABC transporter
conserved hypothetical protein
formate dehydrogenase
conserved hypothetical protein
putative transporter protein
formamidase
putative LuxR-family transcriptional regulator
conserved hypothetical protein
fructose-bisphosphate aldolase
conserved hypothetical protein
phosphoribosylaminoimidazole-succinocarboxamidesynthase
conserved hypothetical protein
putative DNA-binding protein
putative membrane protein
putative membrane protein
phosphoribosylaminoimidazole carboxylase catalytic subunit
phosphoribosylaminoimidazole carboxylase ATPase subunit
conserved hypothetical protein
putative extracellular solute-binding protein
putative transcriptional regulator
putative arginase
putative amino acid-binding periplasmic protein
putative inner membrane component of binding-protein-dependent transport system
putative ATP-binding component of ABC transporter
putative thiamine-pyrophosphate-requiring enzyme
conserved hypothetical protein
glutaryl-CoA dehydrogenase
putative acetolactate synthase large subunit
probable LysR-familyt ranscriptional regulator
integrase/recombinase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable D-alanyl-D-alanine carboxypeptidase
hypothetical protein
putative membrane protein
conserved hypothetical protein
putative nuclease/helicase
DNA polymerase III subunit Tau
conserved hypothetical protein
recombination protein RecR
hypothetical protein
hypothetical protein
putative membrane protein
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
putative exported protein
putative membrane protein
putative chromate reductase
conserved hypothetical protein
mismatch repair protein
conserved hypothetical protein
serotype 3 fimbrial subunit precursor
putative lipoprotein
dihydrodipicolinate synthase
glutamine-binding periplasmic protein precursor
glutamine transport system permease protein
glutamine transport ATP-binding protein
guanosine-3',5'-bis(diphosphate)3'-pyrophosphohydrolase
DNA-directed RNA polymerase omega chain
guanylate kinase
putative cytochrome C
probable cytochrome C
putative oxidoreductase
putative exported protein
putative nucleosidase
putative DNA-binding protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
ribonuclease PH
conserved hypothetical protein
probable transcriptional regulator
methyl-accepting chemotaxis protein
conserved hypothetical protein
conserved hypothetical protein
putative porphyrin oxidoreductase
glutamine synthetase
nitrogen regulation protein NR(II)
nitrogen regulation protein NR(I)
LysR-family transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
putative inner membrane component of binding-protein-dependent transport system
putative iron binding protein
ferredoxin--NADP reductase
probable LysR-family transcriptional regulator
probable aldehyde reductase
putative translational inhibitor

ATP-dependent DNA helicase
probable LysR-family transcriptional regulator
probable LysR family transcriptional regulator
probable probable aldehyde dehydrogenase
putative DNA-binding protein
C-terminal region of a putative polysaccharide biosynthesis protein (partial)
putative N-terminal region of capsular polysaccharide biosynthesis protein (partial)
hypothetical protein
putative glycosyl transferase
putative polysialic acid transport protein
polysialic acid transport ATP-binding protein
capsule polysaccharide export inner-membrane protein
capsular polysaccharide biosynthesis protein
capsular polysaccharide biosynthesis protein
putative capsular polysaccharide export protein
capsular polysaccharide biosynthesis protein
capsular polysaccharide biosynthesis protein
capsular polysaccharide export protein
putative arylsulfatase protein
putative nonspecific acid phosphatase precursor
putative exported protein
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
putative regulatory protein
putative exported protein
putative exported protein
probable short-chain dehydrogenase
putative membrane protein
high-affinity branched-chain amino acid transport, ATP-binding protein
high-affinity branched-chain amino acid transport, ATP-binding protein
putative TetR-family transcriptional regulator
putative oxidoreductase (Partial)
putative capsular polysaccharide biosynthesis protein
putative oxidoreductase
putative exported protein (Pseudogene)
probable two-component sensor histidine kinase
response regulatory protein
autotransporter
putative DNA-binding protein
glutathione S-transferase
alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase
probable LysR-family transcriptional regulator
putative exported protein
probable short-chain dehydrogenase
lactate dehydrogenase
putative hydrolase
probable short chain dehydrogenase
3-oxoacyl-[acyl-carrier protein] reductase
putative exported protein
probable LysR-family transcriptional regulator
putative exported protein
putative NADPH-dependent FMN reductase
putative membrane protein
putative transcriptional regulator
putative exported protein
probable short-chain dehydrogenase
LysR-family transcriptional regulator
putative membrane protein
putative pH adaptation potassium efflux protein
putative pH adaptation potassium efflux protein
putative pH adaptation potassium efflux protein
putative pH adaptation potassium efflux protein
pH adaptation potassium efflux system protein F
putative pH adaptation potassium efflux protein
putative exported protein
conserved hypothetical protein
putative zinc-binding hydrolase
muramoyltetrapeptide carboxypeptidase
probable enoyl-CoA hydratase/isomerase
putative membrane protein
putative membrane protein
putative exported protein
probable ATP-binding ABC transporter protein
putative ABC-transport protein, ATP-binding component
putative exported protein
putative permease of ABC transporter
conserved hypothetical protein
thioredoxin 2
permease
probable glycoprotease
putative membrane protein
stationary-phase survival protein
protein-L-isoaspartate O-methyltransferase
putative peptidase
conserved hypothetical protein
putative exported protein
putative exported protein
conserved hypothetical protein
MerR-family transcriptional regulator
putative exported protein
putative glutaredoxin
putative pyridine nucleotide-disulfide oxidoreductase
conserved hypothetical protein
glycerophosphoryl diester phosphodiesterase

peptidyl-prolyl cis-trans isomerase D
acyl-CoA thioesterase I precursor
putative exported protein
putative membrane protein
conserved hypothetical protein
cyanphycin synthetase
cyanophycin synthetase
hypothetical protein
conserved hypothetical protein
putative exported protein
putative peptidoglycan-binding protein
conserved hypothetical protein
putative AsnC-family transcriptional regulator
putative membrane protein
DNA/pantothenate metabolism flavoprotein
lipoprotein signal peptidase
isoleucyl-tRNA synthetase
riboflavin biosynthesis protein
conserved hypothetical protein
putative exported protein
probable fatty acid desaturase
DNA helicase II
putative exported protein
probable ABC transporter ATP-binding protein
putative adenine-specific methylase
succinyl-diaminopimelate desuccinylase
2,3,4,5-tetrahydropyridine-2-carboxylateN-succinyltransferase
putative exported protein
autotransporter
putative membrane protein
hypothetical protein
cold shock-like protein
conserved hypothetical protein
cold shock-like protein
putative membrane protein
trigger factor
ATP-dependent Clp protease proteolytic subunit
ATP-dependent Clp protease ATP-binding subunit
ATP-dependent protease La
probable LysR-family transcriptional regulator
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
probable enoyl-CoA hydratase/isomerase
conserved hypothetical protein
putative thiolase
3-oxoacyl-[acyl-carrier protein] reductase
3-oxoadipate CoA-transferase subunit A
3-oxoadipate CoA-transferase subunit B
LexA repressor
aromatic-amino-acid aminotransferase
excinuclease ABC subunit B
low molecular weight protein-tyrosine-phosphatase
putative DNA-binding protein
cysteine desulfurase
[Fe-S] cluster formation/repair protein
[Fe-S] cluster formation/repair protein
chaperone protein
chaperone protein
ferredoxin, 2Fe-2S
conserved hypothetical protein
hypothetical protein
probable enoyl-CoA hydratase
conserved hypothetical protein
putative pyridoxal phosphate biosynthetic protein
probable GntR-family transcriptional regulator
conserved hypothetical protein
aspartate 1-decarboxylase precursor
CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehy drase reductase
D-amino acid dehydrogenase small subunit
glycerol-3-phosphate-binding periplasmic protein precursor
probable LysR-family transcriptional regulator
hypothetical protein
probable extracellular solute-binding protein
probable inner membrane component of binding-protein-dependent transport system
probable probable inner membrane component of binding-protein-dependent transport system
probable ATP-binding component of ABC transporter
putative amidase
lipoprotein
hypothetical protein
hypothetical protein
putative general secretion pathway protein
putative fimbrial protein
putative exported protein
alanyl-tRNA synthetase
conserved hypothetical protein
putative exported protein
30S ribosomal protein S16
16S rRNA processing protein
tRNA (guanine-N1)-methyltransferase
probable class-V aminotransferase
conserved hypothetical protein
conserved hypothetical protein
putative exported protein
thymidylate kinase

DNA polymerase III, delta' subunit
conserved hypothetical protein
putative exported protein
probable transcriptional regulator
putative glutamine-binding periplasmic protein precursor
glutamine transport ATP-binding protein
glutamate dehydrogenase
N-carbamoyl-L-amino acid amidohydrolase
acetolactate synthase large subunit
citrate lyase beta chain
putative membrane protein
putative membrane protein
putative exported protein
GntR-family transcriptional regulator
putative amidase
conserved hypothetical protein
regulatory protein BvgR
virulence sensor protein
virulence factors transcription regulator
filamentous hemagglutinin/adhesin
chaperone protein
outer membrane usher protein precursor
fimbrial adhesin
hemolysin activator-like protein
putative membrane protein
putative exported protein
putative membrane protein
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
5-oxoprolinase
conserved hypothetical protein
putative membrane protein
putative transcriptional regulator
putative exported protein
probable methyltransferase
inositol-1-monophosphatase
putative membrane protein
bacitracin resistance protein
UDP-2,3-diacylglucosamine hydrolase
peptidyl-prolyl cis-trans isomerase B
putative exported protein
cysteinyl-tRNA synthetase
DNA-3-methyladenine glycosylase
acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha
conserved hypothetical protein
aspartokinase
conserved hypothetical protein
conserved hypothetical protein
putative 3-hydroxyacyl-CoA dehydrogenase
putative membrane protein
putative membrane protein
putative exported protein
putative hydrolase
putative exported protein
probable short chain dehydrogenase
probable TetR-family transcriptional regulator
LysR-family transcriptional regulator
putative extracellular solute-binding protein
putative ABC transporter, permease protein
putative ABC transporter, permease protein
probable ATP-binding component of ABC transporter
probable NADH-dependent flavin oxidoreductase
putative pimeloyl-CoA synthetase
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
putative ArsR-family transcriptional regulator
N-ethylmaleimide reductase
putative membrane protein
putative glycosyl transferase
putative hemin storage protein
putative hemin storage protein
putative membrane protein
MarR-family transcriptional regulator
branched-chain amino acid-binding protein
putative permease component of branched-chain amino acid transport system
putative ATP-binding component of branched-chain amino acid ABC transporter
putative ATP-binding component of ABC transporter
probable oxidoreductase
putative monooxygenase
maleate cis-trans isomerase
putative flavocytochrome
putative ferrisiderophore receptor
putative exported protein
putative LuxR-family transcriptional regulator
phosphoglucomutase
putative glucose-6-phosphate isomerase
serine acetyltransferase
putative membrane protein
putative Sir2-like regulatory protein
putative inositol monophosphatase
succinate-semialdehyde dehydrogenase [NADP+]

4-aminobutyrate aminotransferase
conserved hypothetical protein
probable ATP-dependent DNA helicase
putative nuclease
putative extracellular solute-binding protein
putative oligopeptide transport system permease protein
putative oligopeptide transport integral membrane protein
putative ABC transporter, ATP-binding protein
probable MarR-family transcriptional regulator
putative exported protein
putative membrane protein
putative membrane protein
putative membrane protein
putative exported protein
putative exported protein
putative membrane protein
putative type II secretion system protein
conserved hypothetical protein
putative membrane protein
putative lipoprotein
putative exported protein
putative response regulator
putative lipoprotein
conserved hypothetical protein
putative ECF-family RNA polymerase sigma factor
putative exported protein
putative cytochrome c
putative elongation factor P
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative aconitate hydratase
putative lipoprotein
putative ferric siderophore receptor
putative haloacid-type dehydrogenase
putative lipoprotein
hypothetical protein
putative aconitate hydratase
putative exonuclease
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative integral membrane protein
putative integral membrane protein
putative exported protein
putative LysR-family transcriptional activator
putative acyl-CoA transferase
putative LysR-family transcriptional regulator
conserved hypothetical protein
putative hydroxlacyl-CoA dehydrogenase
putative amidase
putative membrane protein
putative gamma-glutamyl phosphate reductase
putative DNA polymerase III, delta subunit
putative lipoprotein
leucyl-tRNA synthetase
putative transmembrane transport protein
putative MarR-family transcriptional regulator
DNA-binding protein Bph2
putative sulfate transporter
50S ribosomal protein L33
50S ribosomal protein L28
putative transmembrane transport protein
putative periplasmic substrate-binding protein
putative binding-protein-dependent transport protein
putative ABC-transporter ATP-binding protein
putative tautomerase
putative thiolase
conserved hypothetical protein
putative gntR-family transcriptional regulator
putative malonyl-CoA decarboxylase
conserved hypothetical protein
putative exported protein
putative superoxide dismutase
putative exported protein
putative ABC-transporter ATP-binding component
putative molybdenum-binding protein
putative lipoprotein
conserved hypothetical protein
putative DNA-binding protein
putative efflux system inner membrane protein
putative efflux system transmembrane protein
pyridoxal phosphate biosynthetic protein
putative holo-[acyl-carrier protein] synthase
putative beta-hexosaminidase
putative excinuclease ABC subunit C
putativeCDP-diacylglycerol--glycerol-3-phosphate3-phosphatidyltransferase
conserved hypothetical protein
putative isocitrate lyase
putative membrane protein
putative ABC-transporter permease component
putative ABC-transporter substrate-binding protein
putative dioxygenase hydroxylase component
putative dioxygenase component
enoyl-CoA hydratase/isomerase-like protein

putative 3-oxoacyl-CoA or -ACP reductase
putative ferredoxin
putative fatty-acyl-CoA racemase
putative esterase
putative acyl-CoA ligase
putative thiolase
conserved hypothetical protein
putative lysR-family transcriptional regulator
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
putative membrane protein
putative membrane protein
putative exodeoxyribonuclease III
conserved hypothetical protein
putative hydrolase
conserved hypothetical protein
putative exported protein
putative membrane protein
glutathione reductase
conserved hypothetical protein
putative lysR-family transcriptional regulator
putative exported protein
putative oxidoreductase subunit
putative exported oxidoreductase subunit
conserved hypothetical protein
putative araC-family transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative transmembrane efflux protein
conserved hypothetical protein
putative ABC-transporter membrane-spanning ATP-binding component
putative lipoprotein
putative membrane protein
putative exported protein
putative gntR-family transcriptional regulator
putative sulfate transporter
conserved hypothetical protein
putative ArsR-family transcriptional regulator
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
putative araC-family transcriptional regulator
conserved hypothetical protein
putative oxidoreductase
putative lysR-family transcriptional regulator
putative exported protein
conserved hypothetical protein
aldehyde dehydrogenase
putative sigma-54-dependent transcriptional regulator
putative integral membrane protein
putative biotin synthesis protein
hypothetical protein
putative 8-amino-7-oxononanoate synthase
adenosylmethionine-8-amino-7-oxononanoateaminotransferase
putative integral membrane protein
putative outer membrane protein
probable cytochrome C oxidase subunit
putative cytochrome C oxidase subunit (periplasmic protein)
putative cytochrome C oxidase subunit
putative ferredoxin
putative lipoprotein
putative inner membrane protein
putative inner membrane protein
conserved hypothetical protein
putative ABC transporter, ATP-binding subunit
putative ABC transporter inner membrane subunit
conserved hypothetical protein
conserved hypothetical protein
RNA polymerase sigma factor 70
DNA primase
30S ribosomal protein S21
putative transferase
adenylosuccinate synthetase
putative tRNA synthetase
putative inner membrane-anchored protein
putative membrane protein
putative GTP-binding protein
putative RNA-binding regulatory protein
histidinol-phosphate aminotransferase
putative GTP-binding protein
putative quinoprotein
putative membrane protein
histidyl-tRNA synthetase
1-hydroxy-2-methyl-2-(E)-butenyl4-diphosphatesynthase
putative membrane protein
conserved hypothetical protein
nucleoside diphosphate kinase
valyl-tRNA synthetase
putative outer membrane (scaffolding) protein
putative two component sensor kinase
putative amino acid dehydrogenase subunit
putative conserved DNA-binding protein
flavohemoprotein

conserved hypothetical protein
L-2,4-diaminobutyric acid acetyltransferase
putative transcriptional regulator (MarR family)
putative regulator (SIS family)
putative aminotransferase
putative cell surface protein
conserved inner membrane protein
hypothetical protein
putative autotransporter
putative phospholipase
putative anti-sigma factor antagonist
putative anti-sigma factor
alanine racemase, catabolic
putative inner membrane transport protein
putative regulator
putative exported protein
hypothetical protein
hypothetical protein
putative RNA polymerase sigma factor
putative type III secretion protein
hypothetical protein
putative type III secretion protein
putative type III secretion protein
putative type III secretion protein
putative type III secretion protein
putative type III secretion protein
hypothetical protein
putative type III secretion protein
putative ATP synthase in type III secretion system
putative type III secretion protein
conserved hypothetical protein
putative type III secretion protein
putative type III secretion protein
hypothetical protein
putative regulatory protein
putative outer protein B
putative outer protein D
putative regulatory protein
hypothetical protein
putative secreted protein
putative outer protein N
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative type III secretion pore protein
putative type III secretion protein
hypothetical protein
putative type III secretion protein
hypothetical protein
transcription elongation factor
methyl-accepting chemotaxis protein
putative xanthine/uracil family permease
putative regulatory lipoprotein
putative periplasmic protein
putative hydrolase
putative ABC transport permease
putative ABC transport ATP-binding subunit
putative transcriptional regulator
conserved hypothetical protein
putative sulfurtransferase
heat shock protease
quinone oxidoreductase
conserved hypothetical integral membrane protein
conserved hypothetical integral membrane protein
putative transcriptional regulator (MarR family)
putative multidrug resistance protein.
putative multidrug resistance protein
tartrate dehydrogenase
putative transcriptional regulator
putative solute-binding transport protein (periplasmic)
putative integral membrane transport protein
putative integral membrane transport protein
putative ABC transport ATP-binding subunit
aminobutyrate aminotransferase
conserved hypothetical protein
putative acetylpolyamine aminohydrolase
putative amidohydrolase
putative membrane protein
putative aldehyde dehydrogenase
putative 2-hydroxyacid dehydrogenase
putative aminotransferase
putative sodium:alanine symporter
conserved ATP-binding protein
conserved hypothetical protein
phosphoribosylamine--glycine ligase
coproporphyrinogen III oxidase
putative nicotinate-nucleotide adenylyltransferase
conserved hypothetical protein
conserved hypothetical protein
Maf-like protein
autotransporter
putative ribonuclease
putative dehydratase
putative transcriptional regulator
putative inner membrane efflux protein

putative ABC transporter
heptosyltransferase II
conserved hypothetical membrane protein
conserved hypothetical protein
putative transferase
putative polysaccharide deacetylase
putative outer membrane protein
putative transferase
putative transferase
conserved hypothetical protein
putative transferase
DNA polymerase III alpha subunit
putative dioxygenase
putative ATP-dependent helicase
amino-acid acetyltransferase
conserved hypothetical protein
putative phospholipase
putative transport protein
ribose 5-phosphate isomerase a
putative acyl-CoA dehydrogenase
conserved hypothetical lipoprotein
hypothetical protein
putative methypurine-DNA glycosylase
conserved hypothetical protein
putative inner membrane permease polyamine transport protein
putative inner membrane permease polyamine transport protein
putative polyamine transport ATP-binding protein
putative polyamine transport protein
conserved hypothetical protein
globin-like protein
putative inner membrane transport permease
putative periplasmic substrate-binding transport protein
putative inner membrane transport protein
putative inner membrane protein
citrate synthase
conserved hypothetical protein
succinate dehydrogenase iron-sulfur protein
succinate dehydrogenase flavoprotein subunit
succinate dehydrogenase hydrophobic membrane anchor protein
succinate dehydrogenase cytochrome B subunit
putative GntR-family transcriptional regulator
malate dehydrogenase
2-methylcitrate synthase
aconitate hydratase
conserved hypothetical protein
2-methylcitrate dehydratase
putative conserved inner membrane protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
putative AMP-binding protein
putative transferase
putative chaperonin
putative periplasmic protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
putative conserved inner membrane protein
enolase
conserved hypothetical protein
2-dehydro-3-deoxyphosphooctonate aldolase
CTP synthase
putative aminopeptidase
probable D-aminopeptidase
putative binding-protein-dependent transport permease
putative binding-protein-dependent transport permease
putative binding-protein-dependent transport periplasmic protein
putative ABC transporter ATP-binding subunit
putative L-asparaginase
putative transcriptional regulator
putative coenzyme A transferase subunit
conserved hypothetical protein
putative electron transfer flavoprotein-ubiquinone oxidoreductase
conserved hypothetical protein
putative cytochrome p450 oxidoreductase
conserved hypothetical protein
low-specificity L-threonine aldolase
putative integral membrane protein
acetyl-coenzyme A synthetase
conserved hypothetical protein
putative lipoprotein
conserved hypothetical protein
transposase
putative LysR-family transcriptional regulator
putative oxidoreductase
putative ABC transport protein, substrate-binding component
probable LysR-family transcriptional regulator
putative integral membrane protein
cytosol aminopeptidase
conserved hypothetical protein
hypothetical protein
putative integral membrane protein
putative exported protein
conserved hypothetical protein

LysR-family transcriptional regulator
hypothetical protein
GTP-binding protein
ribonuclease III
signal peptidase I
GTP-binding protein
serine protease
putative sigma factor regulatory protein
putative membrane protein
RNA polymerase sigma factor
putative integral membrane protein
3-oxoacyl-[acyl-carrier-protein] synthase II
acyl carrier protein
3-oxoacyl-[acyl-carrier protein] reductase
malonyl CoA-acyl carrier protein transacylase
3-oxoacyl-[acyl-carrier-protein] synthase III
putative fatty acid synthesis protein
50s ribosomal protein l32
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative exported hydrolase
putative membrane transport protein
conserved hypothetical protein
putative oxidoreductase
putative membrane efflux protein
alcaligin biosynthesis enzyme
alcaligin biosynthesis protein
alcaligin biosynthesis protein
hypothetical protein
putative iron-sulfur protein
Transcriptional regulator
putative drug resistance translocase
ferric alcaligin siderophore receptor
possible membrane efflux protein
hypothetical protein
hypothetical protein
hypothetical protein
Virulence protein
hypothetical protein
seryl-tRNA synthetase
conserved hypothetical protein
putative exported protein
putative cell division protein
thioredoxin reductase
hypothetical protein
putative mebrane transport protein
putative membrane transport protein
putative integral membrane protein
potassium-transporting ATPase A chain
potassium-transporting ATPase B chain
potassium-transporting ATPase C chain
Two component sensor protein
two component system transcriptional regulatory protein
putative exported protein
hypothetical protein
isocitrate dehydrogenase [NADP]
conserved hypothetical protein
putative cytochrome
putative cytochrome
putative ATP-binding protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
putative zinc protease
molecular chaperone
molecular chaperone
putative thioredoxin
putative GrpE chaperone
hypothetical protein
ferrochelatase
heat-inducible transcription repressor
probable inorganic polyphosphate/ATP-NAD kinase
DNA repair protein
ferric ion uptake regulator
outer membrane lipoprotein
dihydrodipicolinate reductase
UDP-N-acetylenolpyruvoylglucosamine reductase
putative hydrolase
conserved hypothetical protein
putative exported protein
putative formyltetrahydrofolate deformylase
sarcosine oxidase gamma subunit
sarcosine oxidase alpha subunit
sarcosine oxidase delta subunit
sarcosine oxidase beta subunit
putative dipeptidase
putative LysR-family regulatory protein
putative dehydrogenase
FolD bifunctional protein [includes: methylenetetrahydrofolate dehydrogenase and methylenetetrahydrofolate cyclohydrolase]
putative exported protein
putative membrane protein
putative secretory apparatus
putative secretory protein
putative exported protein

putative exported protein
integral membrane protein
entericidin B-like bacteriolytic toxin
conserved hypothetical protein
inorganic pyrophosphatase
putative exported protein
putative exported protein
putative uroporphyrinogen-III synthase
porphobilinogen deaminase
integral membrane protein
integral membrane protein
succinyl-CoA synthetase, alpha chain
Succinyl-CoA synthetase, beta chain
conserved hypothetical protein
5-methyltetrahydropteroyltriglutamate--homocyst eine methyltransferase
transcriptional regulatory protein
RecX-family regulatory protein
RecA protein
two-component response regulatory protein
two-component system histidine kinase
putative sugar transport protein
putative enoyl-CoA hydratase
ABC transport protein, ATP-binding component
ABC transport protein, solute-binding protein
putative exported protein
probable 3-oxoacyl-[acyl-carrier protein] reductase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
LysR-family transcriptional regulator
hypothetical protein
putative exported protein
conserved hypothetical protein
aspartate transcarbamoylase
putative integral membrane protein
putative lipoprotein
entericidin A anti-toxin precursor
putative exported endonulease
hypothetical protein
putative lipoprotein
putative exported protein
putative transcriptional regulatory protein
integration host factor alpha-subunit
phenylalanyl-tRNA synthetase beta chain
phenylalanyl-tRNA synthetase alpha chain
50s ribosomal protein
50s ribosomal protein l35
deoxyuridine 5'-triphosphate nucleotidohydrolase
putative GntR-family regulatory protein
hypothetical protein
hypothetical protein
DedA-family integral membrane protein
integral membrane protein
putative DNA-binding protein
putative LacI-family transcriptional regulator
ABC transport protein, ATP-binding component
ABC transport protein inner membrane component
ABC transport protein inner membrane component
ABC transport protein, solute binding component
conserved hypothetical protein
putative membrane transport protein
conserved hypothetical protein
putative GntR-family transcriptional regulator
putative membrane protein
probable alcohol dehydrogenase
hypothetical protein
hypothetical protein
putative LysR-family transcriptional regulatory protein
putative Arac-family transcriptional regulatory protein
putative exported protein
putative membrane protein
transposase
conserved hypothetical protein
putative solute transport protein
conserved hypothetical protein
conserved hypothetical protein
ABC transport protein, inner membrane component
ABC transport protein, ATP-binding component
ABC transport protein, periplasmic component
conserved hypothetical protein
probable membrane efflux protein
putative TetR-family transcriptional regulator
HipA-like protein
DNA-binding protein
GMP synthase [glutamine-hydrolyzing]
inosine-5'-monophosphate dehydrogenase
conserved hypothetical protein
putative GTP-binding protein
possible exonuclease
leucine-responsive regulatory protein
putative exported protein
putative lipoprotein
putative exported protein
putative integral membrane protein
putative ABC transport protein, inner membrane component

probable ATP-binding ABC transporter protein
glycerol-3-phosphate regulon repressor protein
putative glycerol-3-phosphate dehydrogenase
putative IclR-family regulatory protein
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative exported protein
putative exported protein
probable dihydrodipicolinate synthase
putative IclR-family regulatory protein
putative exported protein
putative membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative exported protein
putative aldolase
putative transcriptional regulatory protein
putative MarR-family transcriptional regulator
adhesin
phosphoribosylformylglycinamidine synthase
putative integral membrane protein
putative membrane permease
putative exported protein
transposase
fimbrial protein
phenylacetate-coenzyme A ligase
phenylacetic acid degradation protein
probable enoyl-CoA hydratase
putative oxidoreductase
phenylacetic acid degradation protein
phenylacetic acid degradation protein
phenylacetic acid degradation protein
phenylacetic acid degradation protein
phenylacetic acid degradation operon negative regulatory protein
hypothetical protein
oligoribonuclease
putative integral membrane zinc-metalloprotease
putative ATP/GTP-binding protein
ABC-transport protein, inner membrane component
ABC-transport protein, solute-binding component
putative gamma-glutamyltranspeptidase
LysR-family transcriptional regulator
endonuclease
nitrogen regulatory protein
putative NAD synthetase
putative membrane transport protein
argininosuccinate lyase
hypothetical protein
putative molybdenum-binding protein
molybdenum cofactor biosynthesis protein
molybdopterin cofactor biosynthesis protein
molybdenum cofactor biosynthesis protein
molybdopterin converting factor
molybdopterin converting factor
molybdenum cofactor biosynthesis protein
putative exported protein
putative hydrolase
putative lipoprotein
AhpC/TSA-family protein
putative membrane transport protein
putative exported protein
biotin synthase
putative exported protein
putative TetR-family transcriptional regulator
putative membrane transport ATPase
putative MerR-family transcriptional regulator
conserved hypothetical protein
putative oxidoreductase
exported SurF1-family protein
cytochrome ubiquinol oxidase subunit IV
cytochrome ubiquinol oxidase subunit III
cytochrome ubiquinol oxidase subunit I
putative membrane transport protein
putative chelatase (Pseudogene)
conserved hypothetical protein
nitrogen regulatory protein P-II
autotransporter (pseudogene)
putative TetR-family transcriptional regulator
putative membrane transport protein
putative ABC transport protein, ATP-binding component
putative ABC transport protein, ATP-binding component
putative ABC transport protein, ATP-binding component
putative ABC transport protein, inner membrane component
putative ABC transport solute-binding protein
bifunctional proline oxidoreductase/transcriptional repressor
lipoprotein
putative membrane protein
putative exported protein
ATP-dependent clp protease ATP-binding
penicillin-binding protein
putative exported protein
hypothetical protein

putative cold-shock protein
exported protein
putative thiolase
putative chloride-channel protein
superoxide dismutase
exodeoxyribonuclease large subunit
putative biopolymer transport protein
putative biopolymer transport protein
putative tetraacyldisaccharide 4'-kinase
conserved hypothetical protein
3-deoxy-manno-octulosonate cytidylyltransferase
adenylate kinase
probable short-chain dehydrogenase
conserved integral membrane protein
putative membrane protein
30s ribosomal protein s20
putative aldolase
putative malate dehydrogenase
lipoprotein
threonine synthase
homoserine dehydrogenase
putative aminotransferase
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
putative exported protein
DNA helicase
hypothetical protein
50s ribosomal protein l9
30s ribosomal protein s18
primosomal replication protein n
30s ribosomal protein s6
conserved hypothetical protein
1-deoxy-D-xylulose 5-phosphate synthase
probable geranyltranstransferase
exodeoxyribonuclease VII small subunit
putative transcriptional regulator
putative exported protein
putative integral membrane protein
putative iron-sulfur protein
putative cation transport protein
putative thioesterase
putative integral membrane protein
putative transcriptional regulator
putative hydrolase
long-chain-fatty-acid--CoA ligase
inositol monophosphatase-family protein
hypothetical protein
ABC transport protein, ATP-binding component
ABC transport protein, inner membrane component
putative exported protein
putative alcohol dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
putative GntR-family transcriptional regulatory protein
putative exported protein
hypothetical protein
putative ABC transport protein, inner mebrane component
ABC transport protein, inner membrane component
ABC transport protein, ATP-binding component
ABC transport protein, Solute-binding component
putative DNA-binding protein
putative MerR-family transcriptional regulator
putative hydrolase
exported protein, conserved
putative TetR-family transcriptional regulator
putative short-chain dehydrogenase
putative LysR-family transcriptional regulator
probable 3-methyl-2-oxobutanoate hydroxymethyltransferase
outer membrane porin protein precursor
probable short chain dehydrogenase
probable short chain dehydrogenase
membrane transport protein
conserved hypothetical protein
putative LysR-family transcriptional regulator
aromatic-amino-acid aminotransferase
conserved hypothetical protein
probable cation-transporting ATPase
conserved hypothetical protein
conserved hypothetical protein
putative alcohol dehydrogenase
conserved hypothetical protein
putative ABC transport proteins, ATP-binding component
putative ABC transport proteins, inner membrane component
conserved hypothetical protein
putative acid CoA ligase
hypothetical protein
putative AsnC-family transcriptional regulator
putative exported protein
riboflavin synthase alpha chain
amidase
putative LysR-family transcriptional regulator
putative membrane transport protein
conserved hypothetical protein

conserved hypothetical protein
putative lysR-family transcriptional regulator
putative exported protein
putative lipoprotein
hypothetical protein
putative integral membrane protein
putative c'cytochrome
adenylosuccinate lyase
conserved hypothetical protein
putative integral membrane protein
tRNA(5-methylaminomethyl-2-thiouridylate)-methyltransferase
putative LysR-family transcriptional regulator
putative exported protein
putative hydrolase
NAD(P) transhydrogenase, subunit alpha part 1
putative transcriptional regulator
ferric enterobactin receptor
putative exported protein
 glycolate oxidase iron-sulfur subunit
glycolate oxidase subunit
glycolate oxidase subunit
putative oxidoreductase
adhesin
phospho-2-dehydro-3-deoxyheptonate aldolase, Phe-sensitive
conserved hypothetical protein
putative hydrolase
putative DNA-binding protein (histone)
conserved hypothetical protein
putative RNA polymerase sigma factor
putative exported protein
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
putative lipoprotein
putative chromate transport protein
putative exported protein
putative TonB-dependent receptor
putative lipoprotein
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
putative integral membrane protein
putative membrane transport protein
putative regulatory protein
cytochrome 0 ubiquinol oxidase
cytochrome O ubiquinol oxidase
ubiquinol oxidase polypeptide I
putative ubiquinol oxidase polypeptide II
putative two component system response regulator
putative two component system, histidine kinase
putative exported protein
conserved hypothetical protein
putative LysR-family transcriptional regulator
putative integral membrane protein
putative racemase
putative LysR-family transcriptional regulator
putative exported protein
conserved hypothetical protein
putative arsR-family transcriptional regulator
riboflavin biosynthesis protein ribd [includes: diaminohydroxyphosphoribosylaminopyrimidine deaminase
hypothetical protein
conserved hypothetical protein
serine hydroxymethyltransferase
conserved hypothetical protein
tyrosyl-tRNA synthetase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative integral membrane protein
N-acetyl-gamma-glutamyl-phosphate reductase
30s ribosomal protein S9
50s ribosomal protein L13
putative exported solute binding protein
conserved hypothetical protein
conserved hypothetical protein
probable carboxylesterase
putative ABC transport proteins, ATP-binding component
putative ABC transport proteins, inner membrane component
putative hydrolase
conserved hypothetical protein
probable ATP-dependent RNA helicase
putative integral membrane protein
putative GntR-family transcriptional regulator
conserved hypothetical protein
glutamyl-tRNA synthetase
putative membrane transport protein
putative lipoprotein
putative AsnC-family transcriptional regulator
ribonucleoside-diphosphate reductase alpha chain
ribonucleoside-diphosphate reductase beta chain
histone protein
putative integral membrane protein
putative D-alanine-D-alanyl carrier protein ligase
putative protein involved in the transfer of D-alanine into teichoic acids
hypothetical protein

putative protein involved in the transfer of D-alanine into teichoic acids
acyl carrier protein
putative lipoprotein
putative carbohydrate kinase
possible membrane protein
biotin carboxylase
biotin carboxyl carrier protein of acetyl-CoA carboxylase
3-dehydroquinate dehydratase
thioredoxin
UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
conserved hypothetical protein
conserved hypothetical protein
putative membrane protein
shikimate 5-dehydrogenase
putative lipoprotein
conserved hypothetical protein
glutamate uptake regulatory protein
putative D-amino acid dehydrogenase small subunit
putative oxidoreductase
hypothetical protein
putative membrane protein
hypothetical protein
preprotein translocase secA subunit
putative peptidase family M23/M37 protein
conserved hypothetical protein
UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase
cell division protein FtsZ
cell division protein FtsA
putative cell division protein FtsQ
D-alanine--D-alanine ligase B
UDP-N-acetylmuramate--alanine ligase
UDP-N-acetylglucosamine--N-acetylmuramyl-
cell division protein FtsW
putative peptidoglycan synthesis protein
phospho-N-acetylmuramoyl-pentapeptide-transferase
Possible murein precusor biosynthesis bifunctional protein
peptidoglycan synthetase precursor
putative cell division protein
S-adenosyl-methyltransferase
conserved hypothetical protein
putative ABC transporter ATP-binding protein
dihydroorotase
putative hydrolase
conserved hypothetical protein
leucine-responsive regulatory protein
putative hemolysin
putative methionine sulfoxide reductase
cytochrome c-552 precursor
dihydroxy-acid dehydratase
prolipoprotein diacylglyceryl transferase
conserved hypothetical protein
hypothetical protein
putative membrane protein
putative membrane protein
putative gamma-glutamyltranspeptidase
putative oxidoreductase
uracil-DNA glycosylase
putative ATP-dependent RNA helicase
conserved hypothetical protein
tRNA nucleotidyltransferase
putative transglycosylase
5-formyltetrahydrofolate cyclo-ligase family protein
putative integral membrane transport protein
putative aminohydrolase
putative transcriptional regulator
putative methylenetetrahydrofolate reductase
putative membrane protein
adenosylhomocysteinase
putative glycosyl transferase
conserved hypothetical protein
S-adenosylmethionine synthetase
putative acyltransferase
putative acyltransferase
diaminopimelate epimerase
conserved hypothetical protein
putative integrase/recombinase
putative outer membrane protein
putative membrane protein
conserved hypothetical protein
putative periplasmic solute binding protein
putative ABC transporter permease protein
putative transport protein ATP-binding
putative regulatory protein
conserved hypothetical protein
putative dnaK suppressor protein
ATP-dependent protease heat shock protein
ATP-dependent Hsl protease ATP-binding subunit
putative exported protein
conserved hypothetical protein
putative phospholipase D protein
molybdenum transport ATP-binding protein
molybdenum transport system permease protein
molybdate-binding periplasmic protein precursor
putative hydrolase
conserved hypothetical protein

hypothetical protein
putative exported protein
putative membrane protein
putative regulatory protein
putative molybdate-binding periplasmic protein
putative exported protein
putative gamma-glutamyltranspeptidase
conserved hypothetical protein
conserved hypothetical protein
probable MerR-family transcriptional regulator
conserved hypothetical protein
putative modification methylase
putative restriction endonuclease
conserved hypothetical protein
putative integrase
conserved hypothetical protein
putative membrane protein
peptidyl-tRNA hydrolase
50S ribosomal protein L25
ribose-phosphate pyrophosphokinase
4-diphosphocytidyl-2-C-methyl-D-erythritolkinase
putative outer membrane lipoprotein
conserved hypothetical protein
formamidopyrimidine-DNA glycosylase
putative cyclase
putative oxygenase
conserved hypothetical protein
putative LysR-family transcriptional regulator
homogentisate 1,2-dioxygenase
fumarylacetoacetase
putative sulfatase
putative two-component system sensor protein
putative two-component system response regulator
putative oxidoreductase
hypothetical protein
phosphoglucomutase
glucose-6-phosphate isomerase
putative glycosyltransferase
putative glycosyltransferase
putative glycosyltransferase
putative asparagine synthase
putative glycosyltranferase
putative membrane protein
UDP-N-acetylglucosamine C4 epimerase
polysaccharide biosynthesis protein
probable glycosyltransferase
conserved hypothetical protein
conserved hypothetical protein
putative thymidylate synthase
dihydrofolate reductase
probable GntR-family transcriptional regulator
omega-amino acid--pyruvate aminotransferase
putative extracellular solute-binding protein
putative ABC transporter permease protein
putative peptide ABC transporter permease protein
conserved hypothetical protein
urease accessory protein
urease alpha subunit
urease beta subunit
urease accessory protein
urease gamma subunit
urease accessory protein
heavy metal dependent transcription regulator (partial)
conserved hypothetical protein
probable GntR-family transcriptional regulator
putative methylaspartate ammonia-lyase
putative exported protein
conserved hypothetical protein
putative membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative coenzyme A ligase
TetR-family transcriptional regulator
putative acyl-CoA dehyrdogenase
putative ABC transporter permease protein
putative ABC transpoter permease protein
putative ABC transporter ATP-binding protein
putative ABC transporter ATP-binding protein
putative amino acid binding precursor protein
enoyl-CoA hydratase/isomerase
conserved hypothetical protein
putative hydratase
conserved hypothetical protein
putative fatty acid desaturase
ribonuclease HI
conserved hypothetical protein
probable hydroxyacylglutathione hydrolase
putative membrane-bound lytic murein transglycosylase D precursor
enoyl-[acyl-carrier-protein] reductase [NADH]
conserved hypothetical protein
putative membrane protein
putative exported protein
two component response regulator
two-component sensor kinase

putative cytochrome oxidase
putative transmembrane cytochrome oxidase
putative glutaminyl-tRNA synthetase
putative cell division inhibitor
putative septum site-determining protein
putative cell division topological specificity factor
osmotically inducible lipoprotein B precursor
putative membrane protein
hypothetical protein
putative binding-protein-dependent transport protein (periplasmic)
putative glycosyl transferase
putative LysR-family transcriptional regulator
putative exported protein
putative excinuclease ABC subunit
putative chorismate-binding enzyme
conserved hypothetical protein
putative oxidoreductase
putative conserved membrane protein
putative fatty acid CoA ligase
putative transcriptional regulator
conserved hypothetical protein
putative inner membrane efflux protein
conserved hypothetical protein
pyridoxamine 5'-phosphate oxidase
putative monooxygenase component
putative conserved exported protein
putative formyltetrahydrofolate deformylase
putative LysR-family transcriptional regulator
indole-3-glycerol phosphate synthase
anthranilate phosphoribosyltransferase
anthranilate synthase component II
anthranilate synthase component I
putative phosphoglycolate phosphatase
ribulose-phosphate 3-epimerase
conserved hypothetical protein
putative membrane-bound transglycolase
putative monooxygenase
putative thiol:disulphide interchange protein (periplasmic)
putative 2-hydroxyacid dehydrogenase
conserved hypothetical protein
dihydroneopterin aldolase
putative oxidoreductase
conserved hypothetical protein
putative enoyl-CoA hydratase
transposase
putative inner membrane ATP synthase protein
ATP synthase A chain
ATP synthase c chain
ATP synthase B chain
ATP synthase delta chain
ATP synthase alpha chain
ATP synthase gamma chain
ATP synthase beta chain
ATP synthase epsilon chain
hypothetical protein
uroporphyrinogen decarboxylase
putative primosomal protein
ATP-dependent DNA helicase
putative peptidase
hypothetical protein
putative binding-protein-dependent transport permease
putative binding-protein-dependent transport permease
hypothetical protein
hypothetical protein
conserved hypothetical protein
putative enoyl-CoA hydratase
putative enoyl-CoA hydratase/isomerase
conserved hypothetical protein
putative TetR-family trasncriptional regulator
putative acyl-CoA dehydrogenase
transposase
transposase
putative blue copper protein
copper resitance protein
copper resistance protein
putative enoyl-CoA hydratase/isomerase
putative IclR-family transcriptional regulator
conserved hypothetical protein
putative amidase
putative binding-protein-dependent transport protein
putative pterin-4-alpha-carbinolamine dehydratase
putative inner membrane protein
putative nucleotidyl transferase
conserved hypothetical protein
putative outer membrane (permeability) protein
putative peptidyl-prolyl cis-trans isomerase
dimethyladenosine transferase
glycerate kinase
pyruvate kinase
conserved hypothetical protein
putative ABC transport ATP-binding subunit
putative ABC transport inner membrane permease protein
putative periplasmic protein
putative peptidoglycan-associated lipoprotein
putative TolB-like translocation protein

Proline-rich inner membrane protein
putative TolR-like translocation protein
putative TolQ-like translocation protein
conserved hypothetical protein
prolyl-tRNA synthetase
putative Nudix hydrolase
two component response regulator
phage-related conserved hypothetical protein
putative phage-related hypothetical protein (partial)
phage-related hypothetical protein
phage-related conserved hypothetical protein
putative phage lysozyme
phage-related conserved hypothetical protein
phage-related hypothetical protein
phage-related hypothetical protein
phage-related hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
putative phage tail protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
phage-related hypothetical protein
phage-related conserved hypothetical protein
phage-related hypothetical protein
phage-related conserved hypothetical protein
phage-related hypothetical protein
phage-related hypothetical protein
phage-related hypothetical protein
phage-related conserved hypothetical protein
phage-related conserved hypothetical protein
putative phage terminase
phage-related conserved hypothetical protein
phage-related putative membrane protein
phage-related hypothetical protein
putative phage repressor protein
conserved hypothetical protein
putative inner membrane protein
conserved hypothetical protein
putative ATP-dependent RNA helicase
putative conserved inner membrane protein
putative inner membrane protein
branched-chain amino acid aminotransferase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
putative exported protein
putative UTP--glucose-1-phosphate uridylyltransferase
putative inner membrane protein
outer membrane porin protein OmpQ
hypothetical protein
putative inner membrane protein
putative Xaa-Pro aminopeptidase
putative inner membrane protein
putative monooxygenase
conserved hypothetical protein
DNA-binding protein
bifunctional purine biosynthesis protein
crossover junction endodeoxyribonuclease
holliday junction DNA helicase
conserved hypothetical protein
putative serine/threonine dehydratase
holliday junction DNA helicase
ATP-dependent DNA helicase
putative carbonic anhydrase
putative amidase
putative branched-chain amino acid binding protein (partial)
putative branched-chain amino acid transport permease (partial)
putative branched-chain amino acid transport permease
putative branched-chain amino acid transport ATP-binding ABC transporter
putative branched-chain amino acid transport ATP-binding ABC transporter
putative sulfite reductase
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
conserved hypothetical protein
IclR family transcriptional regulator
dermonecrotic toxin
putative exported protein
conserved hypothetical protein
dihydroorotate dehydrogenase
conserved hypothetical protein
putative NUDIX hydrolase
LysR family transcriptional regulator
putative membrane protein
conserved hypothetical protein
putative membrane protein
GntR family transcriptional regulator
putative acetolactate synthase large subunit
putative lipoprotein
putative taurine dioxygenase

NADP-dependent malic enzyme
LysR family regulatory protein
binding-protein-dependent transport systems inner membrane component
binding-protein-dependent transport systems inner membrane component
ABC transporter ATP-binding protein
conserved hypothetical protein
LysR family regulatory protein
putative exported protein
conserved hypothetical protein
putative ArsR family transcriptional regulator
putative exported protein
hypothetical protein
putative transport protein
ferredoxin
phosphopantetheine adenylyltransferase
conserved hypothetical protein
cell division protein
binding-protein-dependent transport system permease protein
binding-protein-dependent transport systems inner membrane component
transposase
putative exported protein
putative transcriptional regulator
haloacid dehalogenase-like hydrolase
putative 3,4-dihydroxy-2-butanone 4-phosphate synthase
putative 6,7-dimethyl-8-ribityllumazine synthase
N utilization substance protein B
putative thiamine-monophosphate kinase
putative phosphatidylglycerophosphatase
conserved hypothetical protein
putative orotidine 5'-phosphate decarboxylase
putative NADH dehydrogenase
putative diacylglycerol kinase
serum resistance protein
serum resistance protein
60 kDa chaperonin
10 kDa chaperonin
hypothetical protein
conserved hypothetical protein
hypothetical protein
putative dehydrogenase
putative exported protein
LysR-family transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
putative membrane protein
putative phospholipase D family protein
putative membrane protein
putative membrane protein
putative membrane protein
putative acetyltransferase
conserved hypothetical protein
putative ribonuclease R
putative tRNA/rRNA methyltransferase
Cys/Met metabolism PLP-dependent enzyme
conserved hypothetical protein
DNA-binding protein Hu-beta
siderophore-mediated iron transport protein
MotA/TolQ/ExbB proton channel family protein
biopolymer transport protein ExbD/TolR
response regulator protein
sensor kinase protein
putative potassium uptake protein
argininosuccinate synthase
ornithine carbamoyltransferase
putative acetylornithine aminotransferase
conserved hypothetical protein
LysR family regulatory protein
putative short chain dehydrogenase
putative D-isomer specific 2-hydroxyacid dehydrogenase
putative lipoprotein
hypothetical protein
conserved hypothetical protein
GntR family regulatory protein
AraC-family regulatory protein
putative antioxidant protein
alkyl hydroperoxide reductase
tresponse regulator protein
putative acetyltransferase
bacteriophage-related DNA polymerase
putative membrane protein
putative chromosome partition protein
putative membrane protein
DNA ligase
putative peptidyl-prolyl cis-trans isomerase
BolA-like protein
putative intracellular septation protein
peptide methionine sulfoxide reductase
ABC transporter ATP-binding protein
putative cobalt transport protein

BioY family protein
putative exported protein
branched-chain amino acid transport system permease protein
putative branched-chain amino acid transport system protein
putative aminotransferase
putative solute-binding periplasmic protein
putative branched-chain amino acid transport permease
putative branched-chain amino acid transport permease
putative exported protein
ABC transporter ATP-binding protein
ABC transporter ATP-binding protein
endonuclease III
putative ferredoxin
intracellular PHB depolymerase
putative ferredoxin--NADP reductase
ferredoxin
pututative nicotinate phosphoribosyltransferase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative GTP pyrophosphokinase
putative peptidase
tryptophan synthase beta chain
tryptophan synthase alpha chain
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
5-methyltetrahydrofolate--homocysteinemethyltransferase
putative outer membrane protein
periplasmic binding protein
thiazole biosynthesis protein
putative phosphomethylpyrimidine kinase
putative protein-L-isoaspartate O-methyltransferase
putative cytidylyltransferase
transposase for IS1663
putative membrane protein
conserved hypothetical protein
putative potassium channel protein
30S ribosomal protein S12
30S ribosomal protein S7
elongation factor G
30S ribosomal protein S10
50S ribosomal protein L3
50S ribosomal protein L4
50S ribosomal protein L23
50S ribosomal protein L2
30S ribosomal protein S19
50S ribosomal protein L22
30S ribosomal protein S3
50S ribosomal protein L16
50S ribosomal protein L29
30S ribosomal protein S17
putative hydrolase
putative aldehyde dehydrogenase
50S ribosomal protein L14
50S ribosomal protein L24
50S ribosomal protein L5
30S ribosomal protein S14
30S ribosomal protein S8
50S ribosomal protein L6
50S ribosomal protein L18
30S ribosomal protein S5
50S ribosomal protein L30
50S ribosomal protein L15
preprotein translocase SecY subunit
translation initiation factor IF-1
50S ribosomal protein l36
30S ribosomal protein S13
30S ribosomal protein S11
30S ribosomal protein S4
DNA-directed RNA polymerase alpha chain
50S ribosomal protein L17
putative periplasmic divalent cation tolerance protein
thiol:disulfide interchange protein
putative membrane protein
putative delta-aminolevulinic acid dehydratase
putative GTP-binding protein
putative cytochrome C precursor
putative membrane protein
putative cytochrome c asssembly protein
diaminopimelate decarboxylase
conserved hypothetical protein
penicillin-binding protein 1A
shikimate kinase I
3-dehydroquinate synthase
putative phosphohydrolase
putative glutathione S-transferase
excinuclease ABC subunit A
putative transport protein
single-strand binding protein
ferric siderophore receptor
conserved hypothetical protein
putative exported protein
GntR family regulatory proteins
transcriptional regulator
putative chlorohydrolase
putative exported protein

putative glycosyl transferases
hypothetical protein
LysR-family transcriptional regulator
periplasmic solute-binding protein
ABC transport system permease protein
ABC transporter ATP-binding protein
conserved hypothetical protein
putative exported protein
TetR-family transcriptional regulator
malate synthase G
putative dehydrogenase
putative exported protein
UbiA prenyltransferase family protein
putative aminotransferase
conserved hypothetical protein
putative dihydrodipicolinate synthase
putative membrane protein
conserved hypothetical protein
prolyl iminopeptidase
putative methyltransferase
LysR family regulatoy protein
putative hydroxymethylglutaryl-CoA lyase
putative exported protein
GntR family transcriptional regulator
putative exported protein
putative exported protein
GntR-family transcriptional regulator
putative transport system permease protein
putative transport system periplasmic protein
ABC transporter ATP-binding protein
putative enoyl-CoA hydratase/isomerase family protein
putative exported protein
putative zinc-binding dehydrogenase
putative racemase
TetR-family transcriptional regulator
NADH pyrophosphatase
putative oxidoreductase
putative amidase
putative zinc-binding dehydrogenases
LysR-family transcriptional regulator
putative exported protein
conserved hypothetical protein
branched-chain amino acid transport ATP-binding protein
branched-chain amino acid transport system permease
branched-chain amino acid transport system permease
hypothetical protein
iron-sulphur protein
hypothetical protein
conserved hypothetical protein
putative nicotinate-nucleotide pyrophosphorylase
putative glycosyl transferases
putative UDP-glucose 6-dehydrogenase
putative membrane protein
UDP-N-acetylglucosamine synthesis bifunctional protein
conserved hypothetical protein
putative exported protein
conserved hypothetical protein
SCO1/SenC family protein
UbiA prenyltransferase family protein
putative cytochrome oxidase assembly protein
putative exported protein
putative membrane protein
putative membrane protein
putative cytochrome c oxidase, subunit III
putative membrane protein
putative membrane protein
cytochrome c oxidase polypeptide I
putative bifunctional protein
conserved hypothetical protein
putative sodium/hydrogen exchanger family
conserved hypothetical protein
RNA polymerase sigma-32 factor
putative membrane protein
putative esterase
alcohol dehydrogenase class III
conserved hypothetical protein
glutamate synthase [NADPH] large chain precursor
glutamate synthase [NADPH] small chain precursor
putative outer membrane protein
putative exported protein
putative ABC transporter, ATP-binding protein
putative membrane protein
mce related protein
putative lipoprotein
putative exported protein
putative ABC-2 type transporter protein
BolA-like protein
UDP-N-acetylglucosamine1-carboxyvinyltransferase
putative ATP phosphoribosyltransferase
putative histidinol dehydrogenase
putative histidinol-phosphate aminotransferase
imidazoleglycerol-phosphate dehydratase
amidotransferase
histidine biosynthesis protein
histidine biosynthesis protein

putative phosphoribosyl-AMP cyclohydrolase
phosphoribosyl-ATP pyrophosphohydrolase
MttA/Hcf106 family protein
Sec-independent protein translocase protein
Sec-independent protein translocase protein
putative Sec-independent protein translocase protein
putative exported protein
pertussis toxin subunit 1 precursor
pertussis toxin subunit 2 precursor
pertussis toxin subunit 4 precursor
pertussis toxin subunit 5 precursor
pertussis toxin subunit 3 precursor
pertussis toxin transport protein
pertussis toxin transport protein
putative bacterial secretion system protein
putative membrane protein
putative bacterial secretion system protein
putative bacterial secretion system protein
putative bacterial secretion system protein
putative bacterial secretion system protein
putative bacterial secretion system protein
putative membrane protein
AraC family regulatory protein
conserved hypothetical protein
putative membrane protein
conserved hypothetical protein
putative extracellular solute-binding protein
putative transport system permease protein
putative transport system permease protein
transposase
arginine biosynthesis bifunctional protein
conserved hypothetical protein
conserved hypothetical protein
transposase
putative outer membrane efflux protein
AcrB/AcrD/AcrF family protein
AcrB/AcrD/AcrF family protein
HlyD family secretion protein
conserved hypothetical protein
putative dephospho-CoA kinase
type 4 prepilin-like proteins leader peptide processing enzyme
hypothetical protein
putative regulatory protein
pantoate--beta-alanine ligase
conserved hypothetical protein
conserved hypothetical protein
putative membrane protein
glycerol kinase
putative membrane protein
putative exported protein
putative amino acid ABC transporter ATP-binding protein
putative amino acid ABC transporter permease protein
putative amino acid ABC transporter permease protein
putative ABC transporter periplasmic amino acid-binding protein
cell division ATP-binding protein
putative permease protein
conserved hypothetical protein
putative A/G-specific adenine glycosylase
conserved hypothetical protein
ubiE/COQ5 methyltransferase family protein
CAIB/BAIF family protein
hypothetical protein
putative lipoprotein
putative enoyl-CoA hydratase/isomerase
nitroreductase family protein
TetR family transcriptional regulator
putative hydroxymethylglutaryl-CoA lyase
putative enoyl-CoA hydratase/isomerase
conserved hypothetical protein
catalase
ABC transporter permease protein
ABC transporter ATP-binding protein
putative periplasmic protein
putative taurine catabolism dioxygenase
putative hydrolase
putative transport ATP-binding protein
putative transport system ATP-binding protein
putative transport system permease protein
putative transport system permease protein
putative extracellular solute-binding protein
putative tRNA modification GTPase
putative membrane protein
putative response regulator protein
putative sensor kinase protein
putative exported protein
putative membrane protein
putative membrane protein. Also similar to BP3051, 42.886% identity (43.776% ungapped) in 492 aa overlap.
probable aminotransferase
putative cold shock-like protein
L-asparaginase II precursor (pseudogene)
probable two-component sensor protein (Pseudogene)
probable two-component response regulator (Pseudogene)
putative racemase (Pseudogene)
putative lipase (Pseudogene)
probable malate/L-lactate dehydrogenase (Pseudogene)

outer membrane porin protein precursor (Pseudogene)
glutamate/aspartate transport ATP-binding protein (pseudogene)
regulatory protein (Pseudogene)
putative transposase (partial)
putative membrane protein (pseudogene)
putative hydroxylase beta subunit (Pseudogene)
transposase (pseudogene)
transposase for IS1002 (pseudogene)
putative integral membrane protein (Pseudogene)
putative exported protein (Pseudogene)
putative membrane protein (pseudogene)
probable ABC transporter, ATP-binding protein (Pseudogene)
probable Binding-protein-dependent transport system, permease protein (Pseudogene)
probable LacI-family transcriptional regulator (Pseudogene)
putative integral membrane protein (Pseudogene)
C-terminal region of an outer membrane porin (Pseudogene)
conserved hypothetical protein (pseudogene)
putative hydroxylase (Pseudogene)
conserved hypothetical protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
C-terminal region of a probable ABC transporter, ATP-binding protein (Pseudogene)
two-component response regulator (Pseudogene)
putative acetyltransferase (Pseudogene)
probable enoyl-CoA hydratase (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable oxidoreductase (Pseudogene)
conserved hypothetical protein (Pseudogene)
C-terminal region of a putative oxidoreductase (Pseudogene)
C-terminal region of TonB dependent receptor protein (Pseudogene)
probable LysR-family transcriptional regulator (Pseudogene)
N-terminal region of an outer membrane porin (Pseudogene)
integrase (remnant)
conserved hypothetical protein (Pseudogene)
probable bifunctional hydroxylase/oxidoreductase (Pseudogene)
probable short chain dehydrogenase (Pseudogene)
LysR-family transcriptional regulator (Pseudogene)
putative exported protein (pseudogene)
putative universal stress protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative membrane protein (Pseudogene)
putative acetyltransferase (pseudogene)
transposase (Pseudogene)
probable membrane protein (Pseudogene)
N-terminal region of elongation factor G (Pseudogene)
C-terminal region of elongation factor G (Pseudogene)
putative fatty acid CoA ligase (Pseudogene)
putative exported protein (Pseudogene)
N-terminal region of isovaleryl-CoA dehydrogenase (Pseudogene)
C-terminal region of isovaleryl-CoA dehydrogenase (Pseudogene)
isocitrate dehydrogenase kinase/phosphatase (Pseudogene)
probable aminoacyl-tRNA synthetase (Pseudogene)
conserved hypothetical protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable acylphosphatase (Pseudogene)
N-terminal region of acyl carrier protein phosphodiesterase (pseudogene)
phage-related hypothetical protein (pseudogene)
probable transcriptional regulator (Pseudogene)
putative exported protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable hydrolase (Pseudogene)
putative exported protein (Pseudogene)
putative exported protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable 2-oxo acid dehydrogenases acyltransferase (pseudogene)
C-terminal region of a putative enoyl-CoA hydratase/isomerase (Pseudogene)
C-terminus truncated putative pimeloyl-CoA synthetase (Pseudogene)
conserved hypothetical protein (Pseudogene)
molybdopterin dehydrogenase (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable cytochrome C (pseudogene)
probable sigma(54) modulation protein (Pseudogene)
N-terminal region of TonB dependent receptor protein (Pseudogene)
putative C-terminal region of dehydrogenase (Pseudogene)
putative membrane protein (Pseudogene)
putative membrane protein (Pseudogene)
transposase (Pseudogene)
ECF-family sigma factor Pseudogene)
transposase (Pseudogene)
putative exported protein (Pseudogene)
glutamate/aspartate transport system permease protein (Pseudogene)
N-terminal region of a putative membrane protein (Pseudogene)
putative argininosuccinate lyase (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable TetR-family transcriptional regulator (Pseudogene)
probable aldehyde dehydrogenase (Pseudogene)
putative exported protein (Pseudogene)
putative acyl-CoA carboxylase (Pseudogene)
putative lipoprotein (Pseudogene)
N-terminal region of a putative decarboxylase (pseudogene)
LysR-family transcriptional regulator (Pseudogene)
putative ATP-binding protein of a transporter (Pseudogene)
conserved hypothetical protein (Pseudogene)
sulfate transport system permease protein (Pseudogene)
sulfate transport system permease protein (Pseudogene)
phosphoadenosine phosphosulfate reductase (Pseudogene)

sulfate adenylyltransferase subunit 1 (Pseudogene)
transposase for IS1663
conserved hypothetical protein (Pseudogene)
acriflavine resistance protein a precursor (Pseudogene)
transposase (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative membrane protein (pseudogene)
chemotaxis protein CheY (Pseudogene)
chemotaxis protein methyltransferase (Pseudogene)
putative apolipoprotein N-acyltransferase (Pseudogene)
putative membrane protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
C-terminal region of a putative membrane protein (pseudogene)
high-affinity branched-chain amino acid transport system permease protein (Pseudogene)
putative competence protein (Pseudogene)
alpha-ketoglutarate-dependent taurine dioxygenase (Pseudogene)
putative iron uptake protein (Pseudogene)
putative membrane protein (Pseudogene)
autotransporter (pseudogene)
putative exported protein (pseudogene)
conserved hypothetical protein (Pseudogene)
C-terminal region of a putative membrane protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative aspartate racemase (Pseudogene)
putative membrane protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative membrane protein (Pseudogene)
putative metalloprotease (Pseudogene)
putative membrane protein (Pseudogene)
two-component sensor histidine kinase (Pseudogene)
putative 4-alpha-glucanotransferase (pseudogene)
putative alpha-amylase (pseudogene)
putative membrane protein (Pseudogene)
hypothetical protein (pseudogene)
iron utilization protein (Pseudogene)
putative exported protein (pseudogene)
3-isopropylmalate dehydratase large subunit (Pseudogene)
flagellar biosynthesis protein FlhA (Pseudogene)
flagellar biosynthesis protein FlhF (Pseudogene)
methyl-accepting chemotaxis protein (Pseudogene)
flagellar hook-length control protein (Pseudogene)
hypothetical protein (Pseudogene)
putative multiple antibiotic resistance protein (Pseudogene)
probable short chain dehydrogenase (Pseudogene)
putative membrane protein (Pseudogene)
formate dehydrogenase iron-sulfur subunit (Pseudogene)
putative permease component of ABC transporter (Pseudogene)
oxygen-independent coproporphyrinogen III oxidase (Pseudogene)
osmotically inducible protein C (Pseudogene)
putative exported protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable ATP-binding component of ABC transporter (Pseudogene)
putative membrane protein (Pseudogene)
putative autotransporter (Pseudogene)
capsular polysaccharide export protein (Pseudogene)
putative membrane protein (Pseudogene)
putative exported protein (Pseudogene)
putative branched chain amino acid transport permease (Pseudogene)
conserved hypothetical protein (partial)
probable sulfatase (Pseudogene)
hypothetical protein (Pseudogene)
Putative LysR-family transcriptional regulator (Pseudogene)
arsenate reductase (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative exported protein (Pseudogene)
putative substrate-binding protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable ATP-binding ABC transporter protein (Pseudogene)
putative ABC transporter (Pseudogene)
phosphoribosylglycinamide formyltransferase (Pseudogene)
N-succinyl-L,L-diaminopimelate aminotransferase (Pseudogene)
putative acyl-CoA dehydrogenase (Pseudogene)
putative acyl-CoA dehydrogenase (Pseudogene)
putative exported protein (Pseudogene)
autotransporter (Pseudogene)
2-keto-3-deoxygluconate permease (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative lipoprotein (Pseudogene)
putative general secretion pathway protein (Pseudogene)
glutamine transport system permease (Pseudogene)
probable arginase (Pseudogene)
probable aldehyde dehydrogenase (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative cytochrome (Pseudogene)
transposase (partial)
putative membrane protein (Pseudogene)
hypothetical protein (Pseudogene)
fimbrial protein (pseudogene)
conserved hypothetical protein (Pseudogene)
putative membrane protein (Pseudogene)
putative LysR-family transcriptional regulator (Pseudogene)
transposase (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable transcriptional regulator (pseudogene)
putative cytochrome (Pseudogene)

probable aldehyde dehydrogenase (Pseudogene)
putative transcriptional regulator (Pseudogene)
putative sulfatase (Pseudogene)
fusion between a transposase and a C-terminal portion of a regulatory protein (Pseudogene)
probable GntR-family transcriptional regulator (Pseudogene)
putative magnesium transporter (Pseudogene)
putative membrane protein (Pseudogene)
bacterial type II secretion system protein (pseudogene)
putative membrane protein (Pseudogene)
putative exported protein (pseudogene)
putative membrane protein (pseudogene)
putative transmembrane transport protein (pseudogene)
conserved hypothetical protein
putative cyclopropane-fatty-acyl-phospholipid synthase (pseudogene)
putative malonyl-CoA synthetase (pseudogene)
putative transmembrane component of ABC transporter (pseudogene)
putative efflux system outer membrane component (Pseudogene)
putative transmembrane transport protein (pseudogene)
putative ABC-transporter permease component (pseudogene)
hypothetical protein (pseudogene)
putative oxidoreductase
putative amidase (pseudogene)
putative transcriptional regulator (pseudogene)
transposase (Pseudogene)
putative membrane protein (pseudogene)
phospho-2-dehydro-3-deoxyheptonate aldolase, Phe-sensitive (pseudogene)
putative acetyltransferase (pseudogene)
putative LysR-family transcriptional regulator (pseudogene)
transposase (Pseudogene)
conserved hypothetical protein (pseudogene)
probable cytochrome C oxidase subunit (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative two-component response regulator (pseudogene)
putative DNA polymerase III alpha chain (pseudogene)
putative exported oxidoreductase (Pseudogene)
probable integral membrane protein (pseudogene)
putative outer membrane protein (pseudogene)
putative membrane protein (pseudogene)
probable methylisocitrate lyase (pseudogene)
conserved hypothetical protein (Pseudogene)
putative transport protein (pseudogene)
putative coenzyme A transferase subunit (Pseudogene)
putative integral membrane protein (pseudogene)
propionate--CoA ligase (pseudogene)
threonine synthase (pseudogene)
C-terminal region of a putative membrane protein (pseudogene)
N-terminal region of a putative membrane protein (pseudogene)
probable secretory protein (pseudogene)
putative exported protein (pseudogene)
putative acetyltransferase (Pseudogene)
putative membrane protein (pseudogene)
putative regulatory protein (pseudogene)
putative peptidase (Pseudogene)
probable transcriptional regulator (pseudogene)
putative transcriptional regulator
putative C4-dicarboxylate transporter (pseudogene)
autotransporter (pseudogene)
conserved hypothetical protein (pseudogene)
C-terminal region of a putative exported protein (pseudogene)
D-amino acid dehydrogenase small subunit (pseudogene)
putative ABC transport protein, inner membrane component (pseudogene)
probable ATP-binding ABC transporter protein (pseudogene)
putative oxidoreductase (pseudogene)
conserved hypothetical protein (pseudogene)
putative membrane protein (pseudogene)
probable phenylacetic acid degradation NADH oxidoreductase (pseudogene)
transposase fragment for IS1663 (pseudogene)
probable ABC-transport protein, inner membrane component (pseudogene)
conserved hypothetical protein (pseudogene)
putative phosphatase (pseudogene)
putative heat shock protein
putative ubiquinol oxidase subunit II (pseudogene)
probable ammonium transporter (Pseudogene)
putative exported protein (pseudogene)
putative dihydroxy-acid dehydratase (pseudogene)
conserved hypothetical protein (pseudogene)
conserved hypothetical protein
conserved hypothetical protein (pseudogene)
putative membrane protein (pseudogene)
transposase (Pseudogene)
transposase (pseudogene)
hypothetical protein (pseudogene)
putative exported protein (pseudogene)
putative exported protein (pseudogene)
putative exported protein
putative exported protein (pseudogene)
putative exported protein (pseudogene)
NAD(P) transhydrogenase, subunit alpha part 2 (pseudogene)
NAD(P) transhydrogenase subunit beta (pseudogene)
conserved hypothetical protein (pseudogene)
hypothetical protein (pseudogene)
putative AraC-family transcriptional regulator (pseudogene)
putative exported protein (pseudogene)
putative pyruvate ferredoxin/flavodoxin oxidoreductase (pseudogene)
ribosomal protein L11 methyltransferase (Pseudogene)

putative membrane protein
putative exported protein (Pseudogene)
C-terminal region of acyl carrier protein phosphodiesterase (Pseudogene)
putative TonB-dependent receptor (Pseudogene)
N-terminal region of a putative membrane protein (Pseudogene)
putative integrase (Pseudogene)
putative DNA helicase (Pseudogene)
putative methylmalonate-semialdehyde dehydrogenase [acylating] (Pseudogene)
putative ABC transpoter ATP-binding protein (pseudogene)
N-terminal region of a putative aldehyde dehydrogenase (Pseudogene)
urease accessory protein
urease accessory protein (Pseudogene)
[2Fe-2S] ferredoxin (Pseudogene)
conserved hypothetical protein (Pseudogene)
probable short chain dehydrogenase
probable short-chain dehydrogenase (Pseudogene)
putative thiolase (Pseudogene)
putative adhesin (pseudogene)
putative desaturase (pseudogene)
conserved hypothetical protein (Pseudogene)
putative N-terminal region of dehydrogenase (Pseudogene)
hypothetical protein (Pseudogene)
conserved hypothetical protein (Pseudogene)
putative ABC transport ATP-binding subunit (pseudogene)
putative binding-protein-dependent permease (pseudogene)
N-terminal region of a putative oxidoreductase (pseudogene)
putative exported protein (pseudogene)
transposase (Pseudogene)
putative exported protein (pseudogene)
oligopeptide transport ATP-binding protein (pseudogene)
putative binding-protein-dependent transport protein (pseudogene)
conserved hypothetical protein (pseudogene)
putative 3-hydroxyacyl-CoA dehydrogenase (pseudogene)
conserved hypothetical protein (Pseudogene)
putative outer membrane protein (pseudogene)
N-terminal region of putative oxidoreductase (pseudogene)
putative gamma-glutamyltranspeptidase (pseudogene)
conserved hypothetical protein (pseudogene)
N-terminal region of a two component sensor kinase (partial)
transposase (Pseudogene)
phage-related conserved hypothetical protein (pseudogene)
phage-related hypothetical protein (pseudogene)
transposase for IS1002 (pseudogene)
putative exported protein (pseudogene)
putative leucyl/phenylalanyl-tRNA--protein transferase (Pseudogene)
C-terminal region of a putative membrane protein (Pseudogene)
bacterial extracellular solute-binding protein (pseudogene)
conserved hypothetical protein (pseudogene)
putative transport system ATP-binding protein (pseudogene)
hypothetical protein (pseudogene)
conserved hypothetical protein (Pseudogene)
putative transport protein (pseudogene)
sensor kinase protein (pseudogene)
putative lipoprotein (pseudogene)
putative outer membrane protein (pseudogene)
histidine triad protein (pseudogene)
putative aldolase (Pseudogene)
GntR-family transcriptional regulator (pseudogene)
transposase (Pseudogene)
conserved hypothetical protein (pseudogene)
conserved hypothetical protein (Pseudogene)
probable ATP-binding ABC transporter protein (pseudogene)
transposase (Pseudogene)
N-terminal region of a probable ABC transporter, ATP-binding protein (Pseudogene)
putative pyruvate ferredoxin/flavodoxin oxidoreductase (pseudogene)
conserved hypothetical protein (pseudogene)
putative lipoprotein (pseudogene)
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo

Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control

Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control

Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
molecular chaperone
putative cell division protein
putative dnaK suppressor protein
N utilization substance protein B
acetyl-coenzyme A carboxylase carboxyl transferase subunit beta
translation initiation factor IF-1
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Randomized negative control
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
Stratagen Spotreport Alien Oligo
translation initiation factor IF-1
lysyl-tRNA synthetase
DNA polymerase I
topoisomerase IV subunit A
flagellar protein FliO
30S ribosomal protein S2
drofolate cyclohydrolase]
drofolate cyclohydrolase]

								
To top