Documents
Resources
Learning Center
Upload
Plans & pricing Sign in
Sign Out

Bacillus_anthracis_genelist

VIEWS: 4 PAGES: 2883

									The genelist of anthrax AROS V1.0 was generated based on the
following Genbank accessions and associated annotations. If an
oligo has 97% identity or greater to a transcript/feature sequence, the
oligo is considered to represent that transcript/feature.
organism/strain                                                           genbank_accesion
Bacillus anthracis str. A2012                                             NZ_AAAC02000001.1
Bacillus anthracis str. A2012                                             NC_003980.1
Bacillus anthracis str. A2012                                             NC_003981.1
Bacillus anthracis str. Ames                                              NC_003997.3
Bacillus anthracis str. Ames Ancestor                                     NC_007530.2
Bacillus anthracis str. Ames Ancestor                                     NC_007322.2
Bacillus anthracis str. Ames Ancestor                                     NC_007323.3
Bacillus anthracis str. Sterne                                            NC_005945.1
Bacillus cereus str. ATCC 14579                                           NC_004722.1
Bacillus cereus str. ATCC 14579                                           NC_004721.2
sequence_type      date
complete genome           16-May-05
plasmid pXO1               5-Nov-04
plasmid pXO2               5-Nov-04
complete genome            2-Dec-05
complete genome            3-Dec-05
plasmid pXO1               3-Dec-05
plasmid pXO2               3-Dec-05
complete genome           18-Jan-06
complete genome            2-Dec-05
plasmid pBClin15          21-Jan-05
plate     well   oligo_id     oligo_sequence
        1 A01    EMPTY        -
1         A03    AX00000001   TGATCGGCCACCAAAAGAAATTCCAACTTTAGAAGATCGTCTTCGTTCTCGCTTT
1         A05    AX00000002   ATTTGCAGTCTCCACTTCTGAAACAAGACCAATCTTGACAGGTGTAAACTGGAAG
1         A07    AX00000003   CTGTAAAATGGTTTTTACAAGAATATGAAGTGTACGTGAATCAAGAACTTGAAAA
1         A09    AX00000004   GTTCGCAAGGACAACAACGAACGACCGCACTGTCCCTAAAATTAGCTGAAATTG
1         A11    AX00000005   CGTAAGAGCGCGTTAGAAGTTTCAAGTTTACCTGGTAAATTAGCAGATTGCTCT
1         A13    AX00000006   AATGGAACGTTTTGGCTTAAGTGAAAAACAAGCGCAAGCTATTTTAGATATGCGT
1         A15    AX00000007   TATAAAGGACCTTTAGCAGATACAGTTCACCAATTAGTTGGTGGTTTACGTGCAG
1         A17    AX00000008   GCCAAAAGATACAAACGACCCTGGATTTTTAACTGGTAAGTCGTTGCAAGTGGA
1         A19    AX00000009   AACAATCGTTGAAGAAGTTATGGGTGCTGTGTCAATTCCGGTTATGGCAAAATG
1         A21    AX00000010   TATTTTACCAGGCGGTGAAAGTACAACTATGCGCCGTCTTATTGATAAGTATGAT
1         A23    AX00000011   CGTTTCCGTCGTGAGCCAAACGGCAAACCAGAACATGTTCATACATTAAATGGA
1         C01    AX00000012   AGAACAATAGAATTTTAAACAGTGGTGCAAATGTATCACGCATTATTAGCGATGA
1         C03    AX00000013   ATGCAACTCCACTTACTGAAAGAGATTGTTGATGAAAACCCCTTTTTAGGAAAGT
1         C05    AX00000014   AACATTAGAGCCTTGTCCGATGTGTGCGGGTGGAATTGTTTTATCACGAGTAAA
1         C07    AX00000015   TATGCGTGATGCGCTTAGTCTTATTGATCAGGCGATATCTTATAGTGATGAGAG
1         C09    AX00000016   AAAAAACAGTTGAAGGTACAGCTGGTGGCGGTATGATCACAGTTATTGCAAATG
1         C11    AX00000017   GGGAAGCTACAGCGATGTATATATCCCGCCTCTTAAAGCCGACAGGTATTAAAG
1         C13    AX00000018   GAAGGCTATAGAGATGATCCGAGTAGCATTGCAATACTATGAGGTGAAAGACAA
1         C15    AX00000019   ATATGGAAGATATCTCTTTCCATAAACGTGTGCGTGAAGGGTATTTACAAGTTGT
1         C17    AX00000020   ACCGTTACCTACGGAATCTTTAATTAGAAGATTGCAGGATGAAGGTATTACGGTA
1         C19    AX00000021   ATGAAACTTGTAGATGTAGAGTATACGTTCGATCGCAATAAGATTATTTTCTACT
1         C21    AX00000022   GCAGAGTTATTGGAAGAAAACCAACATATAAAAATGGAAAATGAAAATTTGCGAC
1         C23    AX00000023   CAAGAACAAAAGGGAATATTACTGGTGTGGAAATTCAAGAACGCTTATATGATAT
1         E01    AX00000024   TGAGTGGACGAAACAAAATGAAGTTCGTGGTGAGTTTTGTATTTTAGTAGCTGG
1         E03    AX00000025   CGCCGTACTTTAGGTATTGCAGAAAAGGATGCACTTGAAATCTATGTTGATGAC
1         E05    AX00000026   GCATTACGTTATTACTTACTTCGTGAAGTTCCATTCGGATCTGATGGCGTATTCA
1         E07    AX00000027   AACTTGCTTCTCATCCTAAGGTCGTTGCACTTGGAGAAATGGGCTTAGATTATCA
1         E09    AX00000028   GATGCAGGTTTAGTGGGCGGAGAAATGGCAAAGAGTCGCAGAGAAAGAATGGG
1         E11    AX00000029   TTATCCATTGCTATTCAGTATTATACAGAGGTAGAAACAGTTATGACTGTACCGC
1         E13    AX00000030   ATTTTCAAATGCCAGGACGTGTATTGCACATAGATGGAGACCCGTTATATTTGCG
1         E15    AX00000031   GAAATTTTATCCCATAATCGGTATGTCCCAGACGACCAAAGAAATCTGGCTTATC
1         E17    AX00000032   GGTCGGCACATTGCAAACGATACCAGGAGCAGCAGGAGGAGTGAAATATATAC
1         E19    AX00000033   GTACAAACAGAGCAAGTATTTCAAAATTTACAAGCAGTATTAGAAGAAGCAGGTG
1         E21    AX00000034   TGCCAAGTAAACGTACTCCAGATGGAGAATTCCGTGACATTGCACATCCAATTA
1         E23    AX00000035   AAAGCTTCACACTTAAGTTATATCGGGGATGCGCAAGTTGGAGAAGACGTGAAT
1         G01    AX00000036   GAAAAATGGCAGATCGCCTAAAAGCACCAATCGCTATTATTGATAAGCGTCGTC
1         G03    AX00000037   AGGCATAATATTGGATTTATGGCGATTGATGAACTTGCAAAGCGTTGGAATATTT
1         G05    AX00000038   CGACGTTTTATTTCAACTAACAGAGCAAGAAGTAGTAGAGATGATTCATTTTCAT
1         G07    AX00000039   AGAGACAGAGGATCAATTACGTTCTATTGAAGAGATTAAAAAGGATATGGAACG
1         G09    AX00000040   TTATATGATAGCTTAGGACATAATGTGCTTGTATGCGATCGAGATTCTATTATCG
1         G11    AX00000041   GGTTCTCTATAGATGATATTATTCGAACTTTATCTGAGAAAATGGTTCGTCGCCA
1   G13   AX00000042   GAATATCCATTAATGGTCAAGTGGCAAAAGCGAGTTCGGATGTGAAAGTAGCTG
1   G15   AX00000043   TATTACCGGTGTAAAGCAGGTAGAGAGTTTTGATAGTGAAGAGTTTTTACTTGAG
1   G17   AX00000044   CGTCAAGAACGTAAGCGTTGGCTTGTATTTATACATGATATACTATTTTGGATTG
1   G19   AX00000045   AATACAAACGGATGAGAACAGGAAGCGACTTTATCGCCGTTTAGCGGTTTTTCT
1   G21   AX00000046   AAACAGAAGGAGATCGTCCACGTGGTGAATACCAACGCGGTGGTGATCAACAA
1   G23   AX00000047   TAAGTGTTGGTAAATATGCTCTTGCGATTAGTGATGGTATGGGAAATGGGCAAA
1   I01   AX00000048   GAAGAAAACCCACAAGTGCATGAGAAATTCCAAAAATTTAGCATGCAGATGCAA
1   I03   AX00000049   CTGTATCTAGTTACGGTCACTCTACTGTTTCAACAGGCGAAGTGAAAATTTTGAA
1   I05   AX00000050   CTAAGAAAAGTCGTGTTATCTCTGAAAAAGAACGTAATATCGTTGCTTTCCATGA
1   I07   AX00000051   AACATTGGCGCATGGAAACAGATCGTCATAAGACAGAAGATGAATATGGAATGC
1   I09   AX00000052   GGTATGCGTGAGCCGTTTATTGGTCAATCTCCAATTGTTTCAGGAGAATTAGGA
1   I11   AX00000053   CAGACAGCGCAGATATATACTTAAAATTAGAATTTATGAATCCGGGGAGCAGCG
1   I13   AX00000054   GAACCTGTTCGCCGAGGGATTTATACAGGTTCAATCGGTTGGATTGGTTATTCT
1   I15   AX00000055   TCCCTAATCCATTTACTGCGACGCGCTATCATTCCCTTATTGTTAAGAAAGAGAC
1   I17   AX00000056   ATGTCCGTTTTAATGTATCGGCGGGTATAGATGAAATTGGATTGCAAACGGAAA
1   I19   AX00000057   CTTGAGGGAACGGGAGCTACCGTTTGTCTTGGTATTGAAAAGGGTTGTGAGTTT
1   I21   AX00000058   AAAGTGATGACTTAGAGCATTCTGTTAATTATGGAGAGCTTTTCGAGTTATGTAG
1   I23   AX00000059   AAATGACCTAGGAAGAAAAAGGGAAATTAGGTGGGGCCCTAGGACTATCGACC
1   K01   AX00000060   TGCAAAAGAATTAGGGGTATCTGTATCTGTTTTAGGTGAAGTTGAGAGAGGGAA
1   K03   AX00000061   TCGCAACGCCACAAGATGCAAAGCGTATGCTTGATGAAATTGGTGTAGATGGTG
1   K05   AX00000062   GTGGAGCTTCTGCTCGTCCTTTCATCACGCATCATAATGCGTTAGATATGGAAT
1   K07   AX00000063   AGAGGATTTGTAGTAGAAAGTAAACGTGGTGGAGGAGGTTACATTCGCATTATA
1   K09   AX00000064   AATCAACGAGAAGAAGGCGGAAGTTCATCTTTGTGAGCAATGTGCAGAACAAAG
1   K11   AX00000065   TTTTGACTGAGCTAATGGTTCTTACACAACCAGGCATTTTACAACAATATGCAGG
1   K13   AX00000066   GCAATTCGTATTGGGCATAACAATATTGGAACAGAACATATTTTACTTGGGCTTG
1   K15   AX00000067   CAAGACCAGTTTTAGTAGAAATACAAGCATTAATCTCTCCTACTAGTTTTGGAAA
1   K17   AX00000068   TAGCAAAGCAGACAGGCAGCCTTGTTGTGGCTATTTCACAAAGGCGTAACGTAA
1   K19   AX00000069   TTAATCCCAAAAGTTATTAACGTATTAGACATCGGTGCCGTTCCTTTGTTGGAAG
1   K21   AX00000070   CTTCCATTTGTGCGGTGCCAGTGAAAGATACTGTTAAGAAAGTAGAGCAGGGTG
1   K23   AX00000071   TAGATTGTACAATTATTGCTCAAAAGCCAAAAATGGCACCACATATTGAAAGTAT
1   M01   AX00000072   GATTTAACTGAAGCGCAAGTGAAAGAATTTGAAGCTGAGGGACGTATTCCAAGT
1   M03   AX00000073   TTTCGAAGTCATTTTGACTTACTCTGGATTACATGCAGTTTGGGCCCATCGAATT
1   M05   AX00000074   GCAAACATGCAACAGTTCACCCGCGTGTAACGGAAAATATGGATATCATTATTG
1   M07   AX00000075   AAAAATACGGATGTACAAACATACCGACATAGTACAGCCTTTGAAGCGCTGATTG
1   M09   AX00000076   TTTGGATTGCTGGTACAGATGCAAAAGGGAAAACGGATTACCGTAATTTAGATG
1   M11   AX00000077   GAGCAACTTGCAATTGAGCTTAGAAATATAAATACGCAAATATATGTTGCGACTT
1   M13   AX00000078   CGAAAAGGTAATACTGACGCTCTAGAATATTTGATTCACAAATATAAGAACTTTG
1   M15   AX00000079   AAGTTGGCCTAAAAAAGATGAATTACTCCGTTCAACAGCGACTGTTATCGCTACA
1   M17   AX00000080   ATTAGTAGAATTAATCATGACTGATGACTCTTGGTATGTTGTACGTAACACGCCG
1   M19   AX00000081   CAGTTGGTCCAGCATTAGGACAAGCAGGTGTTAACATCATGGGCTTCTGTAAAG
1   M21   AX00000082   GCTGGCGTTGAGTTCAAAGTTTACAAAAACTCTCTAACTCGTCGTGCTGCAGAA
1   M23   AX00000083   TCTTGGCTTAAAAGAAGCTAAAGAATTAGTTGACAACACTCCAAAAGTAATCAAA
1   O01   AX00000084   AGATGGTATGTATGCTGCTATTCTATCTAATCCTCCAATTCGTGCAGGTAAAGAT
1   O03   AX00000085   ATATGATCAAACTTGCGCACATGGTTGACGATAAACTTCATGCTCGTTCTACTGG
1   O05   AX00000086   CCGTAACTCTGGAAATGAGCCATCTTGGATGATCTTAGATGTTCTACCAGTAATC
1   O07   AX00000087   CGTGTTGGTGGTGCTAACTACCAAGTTCCAGTTGAGGTTCGTCCAGAACGCCG
1   O09   AX00000088   AATCATGACTGACCCTTATGTTGGTAAGTTAACATTCTTCCGTGTGTACTCTGGT
1   O11   AX00000089   AGTACGAAACTGAAACTCGTCACTATGCACACGTTGACTGCCCAGGTCACGCTG
1   O13   AX00000090   GAACATCATGAACTACAAGCCGAAAGCAAAACGCGTTGGTCGTCACGCTGGTTT
1   O15   AX00000091   TACGTCATCAAGGTGGCGGACATAAGCGTCAATACCGTATCATCGACTTCAAAC
1   O17   AX00000092   TTGTTGAGAAAGTTTTCGTTGACGAAGGTCCAACGTTAAAACGTTTCCGTCCAC
1   O19   AX00000093   TGGGAATCTCGTTGGTTCGCTGAGAAAGATTACGCTACATTATTACATGAAGAC
1   O21   AX00000094   ACGTATGGGTTCCGGTAAAGGGGCACCAGAAGGCTGGGTAGCAGTAGTAAAAC
1   O23   AX00000095   TTTGATGAAAACGCAGCGGTTATCATTAAAGACGATAAGAGCCCACGTGGTACT
1   A02   EMPTY        -
1   A04   AX00000096   TGTGGCTTTCCCAAAGCAAAACCGTGTTATCGTTGAGGGTGTCAATATCGTTAA
1   A06   AX00000097   GTAACTTTACGCGGCGAGCAAATGTATGAGTTCTTCGACAAATTAGTATCAGTTT
1   A08   AX00000098   CAAGAGTATACACGTTGCGAACGCTGCGGTCGTCCGCATTCTGTATACCGCAAA
1   A10   AX00000099   AACGTGAAGGTTTCATTCGTGATGTAGAATACATCGAGGATAACAAACAAGGTA
1   A12   AX00000100   AGTTGAGCGTCCATCTGAACAGAAGGAACACCGTGCATTACACGGTACAACTCG
1   A14   AX00000101   GCTAAACTTACTGGTACTGCAGAGCGTCCACGTTTAAACGTGTTCCGTTCTAAC
1   A16   AX00000102   ATTCTTTCGAAATCTCTTGGTTCTAACACACCAATCAACATGATTCGCGCTACTG
1   A18   AX00000103   ACAAGATCAACGTGCGACGGTAGAAGCTTTAGGTCTTAAAAAGTTGAATTCAAC
1   A20   AX00000104   ACGTTCTGGCGGCGGTGTTCGTCTTGGCTTCGAAGGTGGTCAAACTCCATTATT
1   A22   AX00000105   CAGATTGTTGCCAAGTATAACATCCCTCACATCTCAACAGGAGATATGTTCCGTG
1   A24   AX00000106   ATTAAAGCCGGGAATGGTCATCTGTGTTGAGCCGATGGTGAATCAAGGAAGACG
1   C02   AX00000107   GGTAACGCACTTTCTTGGTCTAGTGCTGGTGCACTTGGTTTCCGTGGATCTCGT
1   C04   AX00000108   TATCTTCACTCCCTGGTGCCGCTGTTACTGCTATCCAAATCGATGGCGTATTAC
1   C06   AX00000109   CAACGTCAATGCTAGACCCTCAAGGGAGACGTGAAGTAGTAGAAACGGTTAGAC
1   C08   AX00000110   GTAACGCATAATATGGAGGATGCTGCTAAATATGCCGAGCAGATTGTAGTCATG
1   C10   AX00000111   CGACGACACCCATTGAGATTACAGATGGTTTGGAGACGTTATTAAAGCCGTTGA
1   C12   AX00000112   TTACTACCGTCACACTAACCACCCAGGTGGACTTAAACAAAGAACAGCTCTTGA
1   C14   AX00000113   GCGAAGGACGCGTTATCATTAACGGTCGTGATTTTGAAAACTATATCCCATTTGC
1   C16   AX00000114   TTATAAAATCGTGGCGAGCTTGGAATTTACCCTTATCAGGGAAAGTAATTGTATT
1   C18   AX00000115   AGGTAATCTCAATGGGGTTCTTTGTAGAAGATAATGCACCGGTTATTTGGAGAG
1   C20   AX00000116   ATATCGTCAATATTTACAACAAGTACTAACAGAAACTGCTGAAAGCCCACTCTTC
1   C22   AX00000117   CCTTATTTACCGCATGGCTACTCTTTTTGAAAACATATTCACACGAGTCTGCTTT
1   C24   AX00000118   GTGCATTTATCATTAGATTTAGATGGTCTTGATCCTCATGATGCACCAGGAGTTG
1   E02   AX00000119   AGCCGTTATTATTATTTTCCAGCCAGAATTGCGAAGAGCACTTGAGCAGTTAGG
1   E04   AX00000120   ATCGATAGAGGGGGTCGAAGTAGATCTTAGTCAATTGACAGAGTCTACAACATT
1   E06   AX00000121   CACCTGAATTAGCGTTCAAAATTGGACGTTTCGGTGGTTATGTATTAACAAAGGA
1   E08   AX00000122   CCCAATCGAGAGGAAGGTGAAAGCCGTTACAAGCTTACAGGGCTAGCAATATG
1   E10   AX00000123   GAGCTAACCCATGTATCATCTCAATGAAAGGCTTAGAAATGGAGGGTGACAGCT
1   E12   AX00000124   TTATTAGTAGTAATTCACGGTGGTCCGGCTTGGGCATCCTTTCCGATATTTTCAA
1   E14   AX00000125   GAAATCATCAAGCTGGGTACAAACACCTTCAGATATTCGAGAACTCGGTGGTGC
1   E16   AX00000126   CTATTGCTCAAGCATCAGGTGACCACCCTGCCGTACAAAGTTGGTGGGCAGATT
1   E18   AX00000127   TTATTGCACTACCACTTGGTGTCACACTTGTTTTAACAAGACCTGGTGGGCAGC
1   E20   AX00000128   ATATTTTATCCGGTAATATTACTCAATTAAAACATGAGGCATACGGGAAACTTGT
1   E22   AX00000129   GATTCTATCTTCCGTGAAGGAAAAGATTCACCATATGTAAACTGGGTCGTTGTTC
1   E24   AX00000130   GGTGGTTATGCCGAATACACATGCGTGCATGAAAGTGGATTAATAACATTAAAA
1   G02   AX00000131   CGCAAAATATTTTTACGGTTGGTGGTTCATTAAGTGTAAATGTACATGGTCGTGA
1   G04   AX00000132   TCCTGATGCAGAAGCGAAACTGCACCTCGGTTATAAAATGAAATACGTGCCAAG
1   G06   AX00000133   ATACATTTCGGGCTCACCATTTGTGTTGCAGAACATATACGGAGCATCACCACA
1   G08   AX00000134   AAAGGTAACGACGAGCATGTTAGAAGATATTGATCATATACGAAAAGAAATTCGT
1   G10   AX00000135   TCCATTTTCATCAGATGCAAAAATCTTTCCTGAAGAAGTGATCCAAAACATGAGG
1   G12   AX00000136   TTAACGCCATTTACTGCGAGTGAACAGGTAAAAAAGGCAACAAACTTACCACCG
1   G14   AX00000137   ACATGAAGCAGAGAAACGTTTTGAACAGTACCCACATCAATTAAGTGGAGGTAT
1   G16   AX00000138   AGCTCATAGCTGGGATCGAGAGCCCAACGTCTGGTGAAATTGATTATAACGGTC
1   G18   AX00000139   TCGACAGATAGCACGTCAGGTTATGTAATTGGACATTTATTCTCAAGCTTATATA
1   G20   AX00000140   TAACAGGAGACGAAGCTATCACAAAATTAAGCCCACTTCTACAAGAATTGAAATT
1   G22   AX00000141   AACGGATTATATTCGAAAGAGAAGGTTAACTCATGCTGCGCAGGTTTTAGTGTC
1   G24   AX00000142   CCCGCAACATATGCAGCAAATGGCTATTATACAATAATATTTGGAGGAGTTAGTT
1   I02   AX00000143   CATTAAAAAATCAGCATGCGCGCCTTGCTATTAACGGCGCAATGAATAAAAAAGC
1   I04   AX00000144   TATTTAAAGACTCCGTTATCGCTCCTCTTTACCAGAAAGGCGAATCTTATTTAGA
1   I06   AX00000145   CAATCTATCAAAACGAAGAAGGCGTTGGACAAGCGATCCGTGAATCAGGTGTTT
1   I08   AX00000146   TGGAGTCGATGAAGCAACCGCAAAACACCTTGTCATTCAAATGATTTCTGGCTC
1   I10   AX00000147   CTACTGGTATGCAACTTGTTGCAACTTCTATCTTTGGAGTTATCGCTTTCCGTGA
1   I12   AX00000148   CGCTCGGTGAGTTTGGTGCTACACTCATGTTTGCTGGGAACATTCCTGGTAAAA
1   I14   AX00000149   CTGTATACGACTTGATTAAAAAAGGGGAACTTCCTTCTTATAGAGTTGGTAGACA
1   I16   AX00000150   GAAACAGTAAGTACATTACCTACCATTTTATCTTCTTACTATAAAAGCTATCCGAA
1   I18   AX00000151   TTATACGATGGGTGGTCAAACGTGTAGCGATTGGTCAACATTACGTTATTCTACG
1   I20   AX00000152   CATATGTTGTTGCGTGTACACATACAAGTTTTATGGATGTATTAATGTTAGCTAC
1   I22   AX00000153   ATTGGTTATTGTACGGGAAGAAAGCTAGGACCGAGTAGTCAAAAGCGTTTTGAT
1   I24   AX00000154   TTTTTGTTGCCACTACTAGACGTCTCCTGTTTTACGGGAAATTTCCTTACTATCC
1   K02   AX00000155   AATACGCGAAGCTATTACGAAAAACATGACACGCGGTGTTACTGTATTAGAAGG
1   K04   AX00000156   GCCCAGTTATCGATAAATATAATCCGTTTTATAAGACGAAAGAATACTATACGGT
1   K06   AX00000157   TAAGGAGAAGATTAGAAAAATTGTTTCGTATTATCCTCTTGAATATATGATGGTA
1   K08   AX00000158   AGATAAACCCGAACTAGTCGATCTTTTACGCTCTATGCAAGATGATGGTGCAAC
1   K10   AX00000159   TTGCCGAACATGAAAGCCGTTTAAATCCAAGAAGTGTTGGAGATAACGGAACTT
1   K12   AX00000160   AAAGTTGTTCCTAGATTTGTCGTTTCACCGTTATATGTAGGATATAAAATACCGC
1   K14   AX00000161   TTTGGATGCAGGGGCCATTCATATGAAGAAAGGTACACGTATTGGTCATGTGGC
1   K16   AX00000162   GGACAACCTATTCCAATACGTCCTGCACTATGTATTATTAACAATTATGATAGTC
1   K18   AX00000163   TGCTTAGTAAAAATGAAGCATATAAGAAGGCAATTGAGTTAATTCGTAAAGTCGG
1   K20   AX00000164   TATACAAAAGCATTGTTATCCGCTGTGCCAATACCAGATCCAACAGTGAAGCGA
1   K22   AX00000165   TATCTTATGTTCTTGTGCAAAAAAACATGCGTTTTGTTGTGTCTGGGGCTTTAAG
1   K24   AX00000166   TCCAAGATATTTACTATACATTTGCTGAAATGATTGAACGTGCTTCGGAAGATGT
1   M02   AX00000167   ATTCCAGATGAAGGAGAGACTAAGTTTCTTGTTGTAGAGGCAAATAGTCAAATTA
1   M04   AX00000168   CGAATTTGGCCCCTGAGCATTTAAGAGGGACTTATATGGGGGCTGCAAGTTTGC
1   M06   AX00000169   GCGACATTATGGGTGAAAGATGTAGCAAATCCACCTGAGAATCTTCCGGTTATT
1   M08   AX00000170   AATGCCGGACCCAATTCGTCGTATTGCTGAGCGTTTCATGACTGAGCCTCAACA
1   M10   AX00000171   GATTGAACATAAGCAACGATGTGTAATGCATGTTGGGGGCGGATATAAAGATAA
1   M12   AX00000172   GAAGGGAAGCCGCCTTACAGAGTTTGTAGCTGGAAGATTTGCAGCGAAAGAGG
1   M14   AX00000173   ACAATTGGAGCATTGACGAAAGACTCTTTAACGTGGTCGCATAACGGAGTAGAA
1   M16   AX00000174   AAATGGTAAAAGGGTACCGATTGTAGGGCGAGTAACGATGGATCAATTCATGAT
1   M18   AX00000175   TGCCAGGCAACACAACTGTTATTGCGTCAACATAAGACGAAGAAACGCTACCAA
1   M20   AX00000176   GTACGGTTTTGAGAGAGATTCTGTTATTTTACTTGAGCAGATTCGAACAATCGAT
1   M22   AX00000177   TTCTATCGGTAGACGTCTGCAAGATCCACTTGCTGAACTTGTAAAGATTGATCCT
1   M24   AX00000178   GTATCGCTTAGCAGAAAGTGAAGAAGATTTAGGCTTCGATGAGTATTTCTACGG
1   O02   AX00000179   CAGGTGTTCGTATAGGCGTAACAGCTGCAAAAACATTGGCTTGGTCACTTCAAA
1   O04   AX00000180   CCTTGGACTGCAGATGCCTTTCACCGTGAGTTAACGATGAATGAACATGCACAT
1   O06   AX00000181   AATCAGCAGTTATCAACACTGTGCATAACGCAAAACAACGCGGTATAGAGATTG
1   O08   AX00000182   CATCTTTAACAATTTGGGATGAAATGCTAACCGTCTTTACACACTTGCAGCAAAT
1   O10   AX00000183   AACACTCGACCAAGATGATATAACACGTGTAGCGCTTATTGGAGTAGGTAATTTA
1   O12   AX00000184   TCACTTTGATTTTACTCACTTATTGGTATACACTGCTATGGGGCTCGTATTCGCC
1   O14   AX00000185   GGTCGAGTGCTTGAAAATGGTGAGCGTGTTGCTTTAGAGGTAGCAGCAGGTGA
1   O16   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
1   O18   AX00000187   CTGACTGGGCACGTATCCCTTGGGACGTATTAGAGAAAATCTCTGTACGTATCG
1   O20   AX00000188   TTACAGCAGTTGTAACAGCAGGATTCTTCTTACTGGCACTATTCTTCTCGCCATT
1   O22   AX00000189   AAGAATTAAATCTCAGTTACGCCGTTATATGAAAATGAATGGTTTCGCTATACAA
1   O24   AX00000190   TTCCCTTCAAAGGCAGCGCTGGGAGATACAAATTGTAATTGCGAATCATAGTGA
1   B02   EMPTY        -
1   B04   AX00000191   TACATTTATAGAGCATAATGATTGGCTTAGAGATCACTACTTATGTTCTACATGTC
1   B06   AX00000192   AAAGGTTGTATCCGCTCATCGGACTCCGGATTATATGTTTGAATATGCAGAGAC
1   B08   AX00000193   TCATGGTAAACATTTTAGGCGAACATATAGAAGGGGTCCTAAGACAAGTGAATA
1   B10   AX00000194   CAGCTTATGAGAATGTTCCATTATGGCATGAGCGTGATATTTCTCACTCTTCAGC
1   B12   AX00000195   AACGTTGCATCGCCAGAGCAAGTAAGCGTATTACGAGATATGGCTCTACAAATC
1   B14   AX00000196   AGGAAAGCCAATTTTAGGTGTATGTAATGGATTCCAGATTCTTGTTGAATCAGGA
1   B16   AX00000197   GCACGTAATATCGTATGTTCTGGGGGAGAGCCTCTTGCAATTACAGATTGCTTA
1   B18   AX00000198   AATGGGGAAAAAATCGTCGGTCACAAGGGGTTAGGTTTAATATCGGAAGTGTTT
1   B20   AX00000199   CCAAGGAGCAGAGCCGCTTTTCTTCCTTGATTATATTGCTTGTGGTAAAGCTGA
1   B22   AX00000200   CGCTGTTGGGCGAGCGAATTATCATCATATTCCGTGTTTTGCTTTTTCAGCGAA
1   B24   AX00000201   GCAAGACTTACGTTATGGCGAGAACCCACATCAAAAAGCAACTTTCTATAAAGCG
1   D02   AX00000202   TTGCAAGATGTGATTGTTTTCCATGCAGGTACAGCAATGAAACGTGGTGACTTT
1   D04   AX00000203   ATTCAAAGCGAAACGGCAATCCGCCACGTCGCAACGAAATATCCTTATGACAAT
1   D06   AX00000204   AACTCGTACGCAAACCTTGGTGCACTTGGTCTAACATTTTGCTATGGATTGGTG
1   D08   AX00000205   GTACTACACATGCTAGTTAGCATTCGTAGATATGCAGTTCCTTGTGTGCTAGAG
1   D10   AX00000206   TGTCGGACCAGAAGCCGAAGATATTTGGATTTCTACGTTCCACTCTATGTGTGT
1   D12   AX00000207   GAAGAGGTAGCACTTCGTTGTATAAATCCAACTTGTCCTGCTCAAATTCGAGAAG
1   D14   AX00000208   CATTTGCGATTTATCGTCAGGCTCCAAAGTCTTCGCTCGTACCAGGTAACTTTG
1   D16   AX00000209   TGGATTTTATTCAAGCGGCAGCATCTGGAAAACTTTTGAATTTTGTTAGTAATAT
1   D18   AX00000210   ATGTAGGTATCCGTATTTATGAGCGCGCAGCGAAAGTAAACCCAGGCCAAATCT
1   D20   AX00000211   TTTTCCTACCCAATACAGAAGGTGTACATATTCATGAAAGCGTACGCCCACTTAG
1   D22   AX00000212   CTGGAAAGAGTACATTATTACGCCTAGTAAACATGTTAGAGAGACCAACGGCAG
1   D24   AX00000213   TTAGCAATGACATATGGTTATCAACGTTTTGATACATCAGTTATGTTCGTAACGG
1   F02   AX00000214   TTATTAATAACGGTGTTGCTGGTCAAGCTGGATTAGATCCAGCGAAGGATCCAA
1   F04   AX00000215   CAACAGATGTAAAACCAACAACTCATGTATTAACTATGAAAAATGTTATGCGTGA
1   F06   AX00000216   TAAATACGCTCTAGCAACGTATTACTTACTATCTTCTTCTGAAGCATCTGCTAAC
1   F08   AX00000217   CGAAAATTTTCTCTGCGAGTCCAACAGAATTCGGAGCGGAGCCAAATACACAAA
1   F10   AX00000218   AAAAACTGTGCCATTAGACCTTGGTAGAGCAAACGATACATATTTTATTAACATC
1   F12   AX00000219   AAAAATGGTGATTGCTATGCAATTGGGGTGCTATCTGGTACAGGAGATCGTCAA
1   F14   AX00000220   CCGCCAAAATATAGTACCAAAAGGAGTAAGTAACGGCATCCCAACGTTTGTACA
1   F16   AX00000221   ACACGTTCGTACAAGGCCTGTTTTTGATGATGAGGGAAATTTAAGAAGGGTGAT
1   F18   AX00000222   ATTCCTGCTTCTCATCCAAATAAGCGCATTTTAGTTATGAAGCAACCAGTTGGCG
1   F20   AX00000223   TTTCAGCGTGTTCGCCATCGTTGTAAAAAAGATTCATTTAAGTATTGCTTATGCA
1   F22   AX00000224   GCCCTGGAACAGATTTAACGATCGAACTTCCAGAAAAGCATGTATGGGCTGGTG
1   F24   AX00000225   CATGCAATCGATGATTATCACGGTCAAGGTATTAAAGACTTATTCGTATCACCCG
1   H02   AX00000226   CGCATTAATGATCGCTTTCATCGGTGTGATGGAAGTTGTAAACTACGTAATTAGC
1   H04   AX00000227   TCATCCTGTACTTGGCATGAAGAATCCGTGGGTATACCGTAATAAAGCACAAGT
1   H06   AX00000228   AAAGCAGGCGGACTACCTGTCAGCGTAAAAACAAGACTTGGCTTTAAAGAGTTA
1   H08   AX00000229   ATGCGATATGATGATGTTAGAGGCATTTTTCAATGGATTTATTACTTTAAAAAGAG
1   H10   AX00000230   TTGTTCATGAAATGTGTCATATGGTTCATTTAAATCACGATCGCTCTTTTTGGCG
1   H12   AX00000231   GAAAACGAACTCATCGCATTTCGTGCCCTACTCGTCCCTCCTATCGACGATGAA
1   H14   AX00000232   ATTCACGAAGGACATCGGAAACTTACATTACGACGTACCATTTATTCGCTTAAAC
1   H16   AX00000233   GAATTCCAAGTACGTACTTACAGCAAGACGAGACGACTGTCGCATCTTCCATTC
1   H18   AX00000234   TGCAACAAATCTTACTTGCTCTGAACAATATATTTCGATTGTTGTTCCTTCAAGAA
1   H20   AX00000235   ATGCTTGGATTAGGAGCAGACTTACAACCTGGATTACACCATCCGTATATGAAG
1   H22   AX00000236   AGATTTTGGGTGCGGAAAAGGACGATTAAACTTTTATATGCATCATAAGTGTGG
1   H24   AX00000237   ACTATGGGCATTGAGAACTTCATCAGCGTAAAACGCACTGAAGGTCCTAAGCTA
1   J02   AX00000238   ACTCGCACAATCACTACAAACTTCAACGTTTTAATGGAAGAAGAAGGTCTTGCTG
1   J04   AX00000239   AGATGTTTTGCAGTTAGAGGAAGAGTTAGCACCTGGACTTGTTCCGAAGGTGTA
1   J06   AX00000240   AAAAATCTATTCCGATGAAACGCGTCCTAGATTACAAGGTTCAACGTTAACAGCA
1   J08   AX00000241   GCAGGCCCGAATGTTCGCTGTGCACCGTATGAAACATTTGGTACGAAGCAATTA
1   J10   AX00000242   TTATCGGACTGATGGCTCCTCATATCGCGAAATCTTTAGTAGGTCCAAGACATC
1   J12   AX00000243   GCTATCTGGTGGAGCAAATGCTGCGCTTGCACTAACACTTGCTTTCAACCCTTC
1   J14   AX00000244   AAAGAAGGTTATTACGCATTATCTACTGAGGTATTACCTGAGTTTGCTGGTGACT
1   J16   AX00000245   GATGCTGGAAATGCTGTAAATAAAGCGAAACAATTTATTCAACCAGATGCAAGTG
1   J18   AX00000246   GCAGCAATACAAGAAAACAATTGTTACCATACAATTGGGGAATGGTACAAAAATC
1   J20   AX00000247   TTACGTTAGCTCGAACGTTTGAAGAACAACTTATTAAAATGTCTGGCAAAATCAT
1   J22   AX00000248   ATTTCTAGATGAAGCGATATGGAGTTATCCGATGTATATGAGTCATCATCGTCCC
1   J24   AX00000249   GCATTGGCAATGATGCGTGACGGTTTTTTATTGGGAGAAATTGAGGAGAAATTA
1   L02   AX00000250   AAGGCAGCGGAAGAAAAAGGGTTTGAAGTTGAAGTATATCATTGCGGATTTGAT
1   L04   AX00000251   TCGATCCGAAAGCAACGATATATCATTATTTACATATGGCTTCAAAAAATTATCG
1   L06   AX00000252   GGATCCGTCGGTATTACTCAAATATTAAATGCATATGTGACACAATACTTCCCAT
1   L08   AX00000253   AGAAGGAAAATTACATATTGTCGATACAACTTGTACACATCTCGGCTGCGAAGTT
1   L10   AX00000254   GAAAAAAGCATTTAAACCAGTTCCTACTCGTTTATTTGGCGGACTGGCTTATTTG
1   L12   AX00000255   TTCGCTGTCTTAACTTTTTAGAAATGTACGATGAAGGTGAAATTCACTTACAAGG
1   L14   AX00000256   TCTTCTGGCGCTGAGCAATCAGCGGCATCAATTCAAGCGATTGTTTCCGCTGTT
1   L16   AX00000257   GAATGGCGTTAAGATTGAAGATGCTGAGCTTTGGGTTGGAGAAGAGCAAGGTA
1   L18   AX00000258   AAGTTAATTGGAATGTCTGCTGGGGATATTAACGCAGTTCATACAATCGCTCGC
1   L20   AX00000259   TTTGTACGACACATATGAATTAGCAATAGAGAAGGATGAAGGAACAACTGTCCA
1   L22   AX00000260   ATTCTTAACGATGGGTCTTTCACAGGCGTTTATCGTATCGATGGGAGATATATTC
1   L24   AX00000261   TTCTCTCCTGGTCTTTACGATTTAACTGAATTGCAACGTGATGCCAATAAAAAGT
1   N02   AX00000262   TAATGTCGTAAGTATTGCAAAGCAGGCAGCAGATGAACTAAATACAGTTGCGGT
1   N04   AX00000263   GAAACTTAAATATGATTCAAGGATCAATTCAGCATCTAGTAACAAGTGCGCCATG
1   N06   AX00000264   TGAAGTTGTGCAACAATCGGGAGTTCGTTATGAAGTAGGGGCAATGGAAACAAC
1   N08   AX00000265   TCTCATTGCGATATGGGAAGGATCTGTGTCATTATTTAAAATCGAACCGTGGATT
1   N10   AX00000266   AGAAAGTCAAAAATGGTTAAGTACGAAGTATCAAGATGATGCAAAAGCGTGGGG
1   N12   AX00000267   TGTAAGTTATATGCCGCAACAGGATTTATTACTACCGTGGCGATCAGCTTTACAA
1   N14   AX00000268   ATTATTTCCGTTGGTGGCTGGACTTGGTCTAACCGCTTTTCTGACATGGCCGCT
1   N16   AX00000269   CGGGAAAAGGAAAACCACTACAATTAGAAGATCTTTCAATGGTACCTCCAGAAC
1   N18   AX00000270   ACTAGAGAATCGTATGTTATGTTTGAGACATTAATTGAAGCAGGCATACAGTCTG
1   N20   AX00000271   TGGATTACTAGTTTCATGAGATTTGGAACAGGTATTTGTTTAGCTTGCGTTAATA
1   N22   AX00000272   GATAAATGTAAGGTTTCTAGACAAACGATAAATGCAATTGAGAATAATAAATATG
1   N24   AX00000273   TTTCACATTCTTCTTTGGACTCGGCATTGTATTTACAAGTATGTTAGCAGTCGTC
1   P02   AX00000274   TGTGACGGCTCTGCCTATGTATATGTGAAGGACAAAAATGATACGGATACAATT
1   P04   AX00000275   TGCCAAAGCTATATAATCAGTGGTGTTCAGTAGTTCGTTGGGAGAAAACAACTA
1   P06   AX00000276   GTCGTCAAGATTTCGGGATGATTCGTAATGCATATATTCGTATTCAAAACCCGCA
1   P08   AX00000277   AATCCAGGTCTTTCAAAAGTTCTTGTAGGACTTGGTTGGGATACGAATCGTTATG
1   P10   AX00000278   TGTACGAAGGAAACTGATTTTATCTTCTATAACAATTTACAGTCTCCTTGTGGAT
1   P12   AX00000279   AGCTCATGGTATGAACCAAAACAGTATTCTCTTCAGAATGTTTGGTGTCTTCTGG
1   P14   AX00000280   GAAATTGAACAAGTACTTCACCACGATAATTCACTATTATACAAGCCGTGGCAAT
1   P16   AX00000281   ATGCACAAAATATCGCAACGCAAAGTGTGGAAGTAGCGAGATTATCAGGTTCTT
1   P18   AX00000282   GGTGTTCTTATGCAAGTTTGTATCATCTCCATCCCGCCCCTTGCAAATATATTCG
1   P20   AX00000283   TATTAAAGAAAAATTACGTATGGTTAATGCTGGAGCAATGAGAGCTGCTAGCTTT
1   P22   AX00000284   GGCTATATTGGTAGGCTGTCCGATTTTGTTCCAGACGGTGGCTGGACAGACGT
1   P24   AX00000285   TTTTAGTAAGAAAAAAGTTGAGCCAGCAGAGAAGCCAGAAACGATTGAAATTCAA
1   B01   EMPTY        -
1   B03   AX00000286   CAGCTCGCTTATTTCTTCTTGCTTGCGATTTTTCCTGGGCTTGTTTTCTTAATTAC
1   B05   AX00000287   ACTCGTTGTTACGCTTATGATGTTCGTCCCTCATTTCTTACTGGATTGGAGCTGG
1   B07   AX00000288   TCCATGTACATGTTCTTTATACCCGTATTTGGTGTATTATTATCGAGCATGATTTT
1   B09   AX00000289   GGATATGGTTACAAGATCCATCAGTAGAGTATAGTACGTGGGTTGCACTGGGTA
1   B11   AX00000290   GAAGAAATCACACGAGATATCCATTCTCAAATTCCTGAATTATTACAGAGCTGCT
1   B13   AX00000291   CTTTGGCCGGTGGGATTGTTGGATTACCGATACCAGACGAGTTTTTATTGACCT
1   B15   AX00000292   TGCAGGTGCTTCGTCATGGCTATTTTATTTTCTTGCCCTCAAAACAGGGAAAGTT
1   B17   AX00000293   GTTTTTCCACGAAGATTTTGTACTGTATGTTGCAACAGATCGACAATCCAAAAAG
1   B19   AX00000294   TCTATGTTCTTCGCGCAAAGGATGCCTTTAGTATTTACAATACCAGAACTTGTTT
1   B21   AX00000295   GGTACTGGACATGAGAGAGTGTATAATATTAGCCCGAGTCAACTCGGATATTTA
1   B23   AX00000296   AATGTTGAGTTTACAACGACGACGTTATGCAATATGCGCTGTGAGCATTGCGCT
1   D01   AX00000297   AGCTATCTATCATGCGCTTGAGCGGGCGACAAAAGATGGTAAACTTCGTCCAAA
1   D03   AX00000298   TATTTAGTGAAAGAACGTTAGCTCTTACGAAAGAAATGGGCTACTATAATGTATT
1   D05   AX00000299   GTGTACGTATACATAGACAATTTGGGATGATGCGTAAAGAAATGAAAGTCACTC
1   D07   AX00000300   GTAATTCGTACATCCTCCTCCATACTTCTCGTAGGAGAAACAGGAACTGGAAAA
1   D09   AX00000301   AACAGAAAGTAGAAATTAAGGTAGGAATAAGTGGGTATATTGAATCATTAGAAGT
1   D11   AX00000302   TTTTAGATATGTCTGCAACGGTAACGGATGGTGGTTGGTTTAGTGAATTTCATAT
1   D13   AX00000303   ACGTGCCTTATCTATGCGCCAACTCGGAATGCTGACAAGTATTGATCCTGCAAC
1   D15   AX00000304   ACTCGATGAAGCTCACCGATACATATTCAATTTAGAAGTACTTGAACTGTTAATG
1   D17   AX00000305   TATTTTCGGCTGCGTAAAAGGAGAAATGGGAATTGGTATTTTCGGACCAGCTTT
1   D19   AX00000306   ATAACTGTGCAACACGTCTACGCTTACAAGTGAAAGATGCTGGTCAAGTAAACG
1   D21   AX00000307   GATTACGGGTTTGGATGGTACGTAGACCCGGGAAGTTATTCGAATCACGGTGTA
1   D23   AX00000308   GATTATTTTTTAGATAATAAGTTATTGCCTGCTGTAGAACGACTTTTATTTTCACA
1   F01   AX00000309   TGAAAAACTGGGGTGGTGGAATTTAGCAGATCCAGCATTATTTCAAGCGATGGC
1   F03   AX00000310   ATATGGAGATGGAGAGCAAACACGTTGCTTTACGTATGTAAGTGATGCGGTAGA
1   F05   AX00000311   TTATCGCTGTACCGAATGCGTTTAGCCGTAAGTGTTTGAAACAAATTGGGTATAG
1   F07   AX00000312   TTTGCACCAGGTGCGAACCCAATGCATGGACGTGATACAAAAGGTGCGCTAGC
1   F09   AX00000313   ATAACAGTCGAAGAAGTAATGCAGGATGTGACATGTTACCTTCCTTTTATTGAAG
1   F11   AX00000314   ATTCCTGTGTATAACGTATTAACGGATTTTTGTGTGCACAAAATATGGATTCATC
1   F13   AX00000315   ATTTATTTTTAACGAAACAAACGATTGAAGCTGAAGAGCGTGGGGAATTAATTTC
1   F15   AX00000316   GATGCAAATGAAACATCTGAAGTTTCAACACCACATATCCGTTCTTTAGACGGAA
1   F17   AX00000317   TGAAACTTCTCACCCTAACCTTCAGTATGTGCAATGGACACCAGATTTACAAACC
1   F19   AX00000318   ACAATGAAGAGGTACAAAAAGCATATTTACAAGCAATCTCCTATTTATCCTATCA
1   F21   AX00000319   GACGTATGAATTAGTAGAAGAACCTGGTATATTATTTGAAATTACGTATTTCAATG
1   F23   AX00000320   GTGCGTGGGTTGAATTACTGTGGGAAGATTTTCAAACAACTTATGCGAAATCAG
1   H01   AX00000321   CCATTTAGCAGTCGTTACGGCTGATTATTACTACGTTGCGAGATGGCACCGTGG
1   H03   AX00000322   TCGGAAATTATGTTGCAGCAAACGAGGGTAGAAGCTGTAAAACCATATTACGCG
1   H05   AX00000323   ACGCGATATGACTGAACTAACAATGGTTTCAAAAAACGAATGGAAAGAAGATGA
1   H07   AX00000324   AAGCACAAATGCTAGTTATGGTACAGAGTTTGCGACTGAAACAAATGTACAAGC
1   H09   AX00000325   ATCGTACAGTAGTGACGGAATCAGATGGCCGAACATGGATTACTCGTGAACCAG
1   H11   AX00000326   TTGGACGGCGAGAACATTTTCGGCAGTAAATACGTTAACAGATTTAGGGCCGTT
1   H13   AX00000327   AATTCGTAAGCTCGTTTTATTCAGACAAATGTTAGCGACGACAAGCCGTGCTTTA
1   H15   AX00000328   TGACTCACCACTTGCCGCACTCGATACTGATAGACGAAATATCGCTGACTTCAT
1   H17   AX00000329   TATGAAATTTGCTGGTTGTTACCATGGTCATTCTGATTTAGTACTTGTAGCAGCT
1   H19   AX00000330   AGTTTGTTGCACCAGTTTCCTATCAGGCTTTATCAATGGTTATGCCAGATAGTCA
1   H21   AX00000331   ATGACTACGTATATCGCAATTGCGTGGATGGCACGTGCCTTTTATTTTAATAATA
1   H23   AX00000332   TTACGCTTGCAAGCCTTGGTTTTTGGTCGGATGCGAAAAGTTCAATTATGCCGC
1   J01   AX00000333   TTCAACTCGTTGAAATTTGTTTATATTTTAGCGCAGTTACTTTATTGTCTGTTGGA
1   J03   AX00000334   ACGGGTGTACGCATTACTCCACAGCGTCATGCTATTTTAGAGTACCTTGTGGAA
1   J05   AX00000335   ATTTATCGGCCTCTTCATTGCATACTTAGGAGTCTTTTTCCGTGAGAACATTATT
1   J07   AX00000336   CCAACTATCTATCAAGTGCGATTCATGAAATTAGATGAACCAATTCAATTTGAGT
1   J09   AX00000337   ACATGGGTGTAAACGGTTCTGTAGCTTACATGTTTGATGCGACAGCTGTTATCG
1   J11   AX00000338   ATGAAGTGTTATTAGCAAAGGTACACTGGCGAGCTGATACGTGGGAGTTGCCAG
1   J13   AX00000339   TCATTGGAAATGTAATGATCGAGCAAAGTGATATTAGTAAATTACATGTACCGGC
1   J15   AX00000340   TAAGGTAGTTGAATTTGGAGACTTCAAATGTCCTGCTTGTCGTACTTGGGATGT
1   J17   AX00000341   GTCGCGGGATTTTTTGTCGTGCTTCTTGGGGACAAGATTATCATCTTGTTTTAAG
1   J19   AX00000342   AGTACCAATGAATGGATATCCTAATATTCGTAAAGGATGGTGGCAAAGGGAGAA
1   J21   AX00000343   AAAGACGGTGAATTCTTCTATTTAACAAAGTATGGTGAGAAAGCTCATACAGCGT
1   J23   AX00000344   GTATCAGCTCATTTATTAGCAATAGAGGTTACAGAAGGAGCACTTATACATAAAG
1   L01   AX00000345   CAGAATCAGATCCACGTGCGTATCGATTTGATGGAGAATTAAATAAGGCAAACC
1   L03   AX00000346   GGATACAAGTGGATCGATGGGAATATGGGAGAAATATATGGCACGGAGCTTCTT
1   L05   AX00000347   AGCAAGAAGAAAGTAAGAAATCACTAGGAGCAACAGGTGGACAAGAGAATACAT
1   L07   AX00000348   TAGCCACATTTTTCGTTACTTCTGCCGACTCGGCAACATTTGTTGTTTCTATGCA
1   L09   AX00000349   ATGTAGTCTTCCACGGTATCGCAAAAGATGACGAAGAAAATAAAGCTCCAACGG
1   L11   AX00000350   GCGGATCTGTATCCATTGTTACTTTATTACTTAGTTTTTTCGCCATGTTATGTGG
1   L13   AX00000351   GGATAAGAACGGTTACTTAGATGCACTTGGTCAGCCGCAAATTGCGACGGTTAA
1   L15   AX00000352   GGAATTCAGCGTGTTGCAGACAGTTCTTCATTAGTATCCACAGCATCTATGTATA
1   L17   AX00000353   CTTGCGTTTGAAATCTGAAATGGATCAGTTAACAGCAGAGTTATCTCAGACGAAG
1   L19   AX00000354   ACCTATTTTGACAAAAGCTGCTGCTACTTATGGAATTAGTGCAGCTGAAATGGG
1   L21   AX00000355   GACGAAAGAAAAATTTGTTCGAGATTATGATTCGAAAGATTGGATTTCGTTAGAA
1   L23   AX00000356   GAAGTTGATTCAAGATGGAGCGAATATAAACGTAGAAGGTGACAACGGAGAAAC
1   N01   AX00000357   GCTGGAATTACCAGAGCGTGTATATGAATTACAGAAACATGGACATGATGTCTT
1   N03   AX00000358   TGGAGTGCGAAAGTCATCGGACAGTTACTCCTGAATAAAGGTGACAAAGTAAAA
1   N05   AX00000359   GCTATCACCAACTTTATTCTTTATCGTGACAGTAACGTTAATTAGTGCGTTCCAA
1   N07   AX00000360   TTCAAAACTTTGGCTGGATCAATAGTTTCGCTGGGATGACAGTGCCGTTTTTTG
1   N09   AX00000361   AACGAAGCCAGACGTACAAGCAAAGTGGCATACTGCAACAGGTTATTTCTCTAT
1   N11   AX00000362   AATCATGAAGATATGATGATCAAGGCGTTAACGACTGATGAGGAACGTTCATGG
1   N13   AX00000363   AAAACAATATGAGCTTCTAGAGTACCTTGTTCAAAATAGCGGAAAGATTTTAATG
1   N15   AX00000364   TTGCAACAAATGAGAAAACGGGCTGGAAAGTAGTTGGAGTCATGTTTGATGAAG
1   N17   AX00000365   TCGGTCTTGAGCCGCACAGGATAGCAAAAATTCTTGAAGAAAGAAATACGATGC
1   N19   AX00000366   ATTTGGCAGAAGATCGAGTCGTTGAATGGAAGAGTGTTTACAACAGATGAAATG
1   N21   AX00000367   ATTCTTCTTTATCATCGTACCAATTGTGAGTGGTGGTATCGGGGAAGGGATTTTA
1   N23   AX00000368   TCCCGTTATGTTTAGGGACGACGGATGTGGATGAAATCGTTACCCTTGTAAAAA
1   P01   AX00000369   CGCAACGTCATCCACTCAAGTTAATGCACCTTCCTTCTTTCACCTTAGCGTTTTA
1   P03   AX00000370   CCCTAGATATTCTATACAACTTATTATTTTCTCTATTCTCGGCATGCTCGGTGCG
1   P05   AX00000371   ATTTGTATGAATCTAGGGGTGTGCGTTGCTCAGCTAGTCAAATTGTATTAGGGG
1   P07   AX00000372   GCACAAGATGAAAACTATACGCTAGGTGCATTTAAAGATGGAAAATTAATCGGG
1   P09   AX00000373   AAGAATACTTGCAAATCATCGAGGATGAAACAGATAGTGTAACCGATCTCGTCC
1   P11   AX00000374   ATCTGTTCTTAAGCCCTCGCGGCTATTTTTGTATGAAAGCTACCTCTGGCCTTGA
1   P13   AX00000375   TGAAACATGAGGATCCTGTAGCTGCTATGGCAAAACGATTAAGCAATCCGGATA
1   P15   AX00000376   CCTGAAGAATGTTTTCACTTAATGAATACTTTACAACAATCTTCCACTACATTTCG
1   P17   AX00000377   ACGAATACAGAACGCCGTATTCAAAGATTATATGAAGTGTTGAAACCGCTTGGT
1   P19   AX00000378   TCAAATTCCTAACTTCATTACAGGAGAACTGTTTAAGACAACGATGGGACAAGTG
1   P21   AX00000379   GCGTTGTTCATTATGCAGTTGCAAACATGCCAGGTGCGGTTCCACGTACATCAA
1   P23   AX00000380   GCTAGGGGCATTTGACCTAACAATGCTAGGGATTGGTGCGATAATTGGTACAGG
2   A01   EMPTY        -
2   A03   AX00000381   TTCGTGTGTTAAAGCAAGCGAAACTGGTAAAGAATCGTAAAGAAGGAAAGGTCG
2   A05   AX00000382   GACATAGTCACGATCATGGTGAAGCAAATGTGAAAAAGATGGTAGGCCGATTAG
2   A07   AX00000383   AGACGAAGCCGGGTTTACAAACACAAAAATTATTGCTTCTAGCGATTTAGATGAA
2   A09   AX00000384   GAGGCTATCCCGTTGTATAAATCTGCGGGAAATAAAATAGAATTAAAGAAAGTAT
2   A11   AX00000385   GTAACTGATTCAACAGTATTACGTTTGCAACAAGTTTACGAAGGAGTACCTGTAT
2   A13   AX00000386   GGTAAATCAGAAGAGGATTTGAAGAATCGCTTGAAGACAGATAAAGTATCAGCA
2   A15   AX00000387   TTCTCGAAGCAATCATTCTATGCCCGTAAATTATTTACCACTTGGGCAAGATGCA
2   A17   AX00000388   GGTTCCTTCTTATTCCATTACTGATTATAGCACTTGGAGCAGGGGGATACTCCTT
2   A19   AX00000389   TAAATGGTCTTGGGAAATTAGAATCTTATAATGCTATCGCCTCTGCCATTGTCGG
2   A21   AX00000390   ATAGAGTAGCAAAGGAAATTATGGTGCCTCGTACGGAAGTTATAGGTTTATATG
2   A23   AX00000391   GAATTTGAAGCGTATAGCCGAGTGCTTGCGCGTGATATAAAAAGAATTAAACAG
2   C01   AX00000392   TTAGGATGGATTGGCGTATTCATTACAGGTTCAGTAGTATCAAGTGGTTCACTAT
2   C03   AX00000393   TCGCAGAGCGTAACGTATCTAAAGAACGTATTTCTGCAATGGATGGTGATGTAT
2   C05   AX00000394   CTTCTTGGCAAAATGTCATGGTACTTGCGCCGTGGGTTCTCATTTTAACGGTAA
2   C07   AX00000395   TCCGTATCAAACATGGCTGAAGCAATGGTCAGAAAAAGATGAGGAAATGGTACA
2   C09   AX00000396   AACGCCAGCTGATGCAGCGGCTTGCATGAGATCAATTGAAATCTTAATGGAAAG
2   C11   AX00000397   GTCCATCAACGCCGAAAGATAATACGCCACAAGATACAATTCAGCGTCCTACTA
2   C13   AX00000398   AATATTAATGGTACATAATGTAGAACAAAATGTTTGGTCATTGCCGGGTGGGGC
2   C15   AX00000399   AATCGCAAGAGCTTGACGTTGCATTCCAACTGTTAGTGGACTGTTCTGGTTCTA
2   C17   AX00000400   GCAGCAAGTATTCGTGGCATTATCGATGCATGTGATTTAGGTGTATATATTCCTG
2   C19   AX00000401   AAAAATTTGGAGGCGGGCCTGCAGCAGATAGAACGACTACCAAACTTTTAACAA
2   C21   AX00000402   TTATGTGCTAGGAGAGAAAGATGTTCTGGCTAGGCTGGGTGGCGACGAATTTG
2   C23   AX00000403   TTCTACACTTGCATGGAGTATTACAGGCCTTGGCGTATTTATGATTGCACTCGTA
2   E01   AX00000404   TAAATGGAACAGATTATGTTGTCGTTGTGAAAAACTTTACGCATTTTTATGATGG
2   E03   AX00000405   TTGGCCAATGATTGCTCTTTCTAACATTGCGCAAGGTAGTGCGGCACTTGCGAT
2   E05   AX00000406   TCTAATTGGCAAATTGAAATGCAAAAGGGTGGAGGATGGAATGCGTTATTCTGG
2   E07   AX00000407   TTTAGATGTCAGCTTTCGGGACCCAACAAACCCAACTGCTTTAGTAAAACTTATT
2   E09   AX00000408   GATTTCCGCTCTCATCGCTGGGCTTGCAATTCAGCTTATTATTTTACTTATGTGG
2   E11   AX00000409   TCGCTTAGTGAGTTTCTTGATTGCTTTTCTCTTACCAGCTATATATATCGCAACC
2   E13   AX00000410   ATCGAGGTGTTTTTTATACATTTTTTCGTAATAGATATGGCATATGGAGCGGTAT
2   E15   AX00000411   TAAAGGCTCTTCCAGTTGAAAGAGAAACGTTCGGCCTTATGCACGGTGACATTC
2   E17   AX00000412   ACAACAATTATGGCGTATTACTACATTGCAGAAACGAATATCGCGTACTTAAACC
2   E19   AX00000413   TGTACAAAATACGGAGGTACACAATGCAAAAACAGATATGAATGAATTACGCCG
2   E21   AX00000414   GTTGGGGTGAAGAATGATACGAACTTGTTTGGATTGAAAAATCCTTCAACAGGG
2   E23   AX00000415   ATTTAATGTATCAAGGAGATTTAATTTCAACGAAGACGTTTGTTACGTTCGATGT
2   G01   AX00000416   TCCAGAAGCAGGATTGAAATTAGAAATTATAACAGCTGTAATTGTTGCGTTAACA
2   G03   AX00000417   GGTAGCAATGCCAGTTTCAGGATCTTTCCAAAAGTATGCGACGAAGTTTATTGG
2   G05   AX00000418   GGGTATTCACCGTTACAATTACTCGTTTCTTCTATCGCAGGATGCAGTGCAATTG
2   G07   AX00000419   ACATTTTGAGGGTCGCGAAAAACAAGGCGATTGATAGTTATCGGAAAAATAAGC
2   G09   AX00000420   CTCTAACGTAGTACACAGTCCTACTCAGTTACATGTTTTACTGACAACAGAAGGC
2   G11   AX00000421   AATAATTTAATTGATGAATATGTTGTTACGATTACACCACATATATTAGGTTCTGG
2   G13   AX00000422   GTAAACGCCATGTATAAAGAAAGATACATTACAGTTTCTTTCTCTTGTCCTCCTA
2   G15   AX00000423   TAAAACTCGGAGCGGATGATTACGTAACGAAACCTTTCCATGAAGAAGAGCTTT
2   G17   AX00000424   GGATATGGGAAGCCTGCCGAAAGAATTACCGTTCTTTAGTATTCCAGACGTGCC
2   G19   AX00000425   TGTTGAAGTTGTGTACGTAGTTGATAATAGAACGGCAAAGTCAGATATTATACAA
2   G21   AX00000426   TTATCGCCGTTCTTGTGTACTGGCTAAACCCTCCTGGTAATCCAATGGTTGATAG
2   G23   AX00000427   CAGGACTTACACCACCGCAGTTTTATATTTTAAAGATTTTAGATCATTATGGAGC
2   I01   AX00000428   AGCGTGTAGCGGTGGAACTATTAGAAGAATACCCGCATATTGATGGAATTGTTG
2   I03   AX00000429   AAGGTTCTAACGGTGTACGTTTCCATAATGGTACGGAGATTGTACATGTTCCTAG
2   I05   AX00000430   TGGTGGGGCGCAGCATTGGTGAACGTTACCCAGAACGAAATAGTCAAATTGGC
2   I07   AX00000431   TCTTGGTGATCATTTAATGTTCCAAATGTTTGGCCGCGGTTATTTTCTCGGTATT
2   I09   AX00000432   GAAATTATCGCAGCATCTGTACGTCACAGTGTTCACGTAACTGACGCAGCGTTA
2   I11   AX00000433   TCGAAGCTTGGTCATTAATGAGTGGAGGTAGTTGGACAGGGAAAATTGCAGGAA
2   I13   AX00000434   TTGGTGCTTTCACACTCATGTTTTCACAAGGAATTGTCACTTACATGTTACCAGT
2   I15   AX00000435   ATCTCATAAAGTGGGAGACCGCGTCGTTGTAGAACCAATTTATTCTTGTGGTAA
2   I17   AX00000436   TACAGTTGAAGGATTACGTCCTCTTGACGCTTTATATTTTAGTGTGGTCACGTTG
2   I19   AX00000437   AAAGAAGGCGTAAATTCTCATTTATGGATTGTAAACCGTGCGATTGATATTATGT
2   I21   AX00000438   AGCAACTTGGGATGCAACGACAAACAGTATTGCAAAATATAATTTCCCTGATAGC
2   I23   AX00000439   GAAGATTCGTATAGCGAGTAAATCGTTACGTTCTGTTCCGGTTATGCAAAGGAT
2   K01   AX00000440   GAAAAAGGTTATGCGCAAGAAAATTTAGGGGATATTGATTCGCAATCCATTGCA
2   K03   AX00000441   AGTCGGATTCGTTCGTCGCTTTATCGCGATGCAAATTGATTGGATTTTCTTATCC
2   K05   AX00000442   TCGTTTTAGCACAGCACTTGCTAGGACTAAAAATAGAAGGGTTTAGCTTCGAAC
2   K07   AX00000443   CTGTCGTTGCCAATGAAGTAAGAAAACTAGCAGAAAGTACAGCGGAAAGCACAA
2   K09   AX00000444   CAGTCGCTGTTAAAGCAGAGTCAAACGACGAGAAACTTAACAACATGCAACAGC
2   K11   AX00000445   CAACCAGACTTGGCAGAAGTAGCGAATGCATCATTAGATAAGAAGCAAGTAATT
2   K13   AX00000446   CAAACCGAATATCTCTACACTGGTTGGGGAATTATACGAAGAGAATGATCCAAA
2   K15   AX00000447   AGGTTTCCTCGGTATGGTGACTTCTATTAAAGGAAAACAACAGATAAAATTGTAT
2   K17   AX00000448   TCACAAGCTATGCAAGGAGTAGAAAGCTCTGATTGGCTATCTGACAACTTCGGT
2   K19   AX00000449   GTTATTTTTTTCATTATGCGAGCGCTCGGAGAAATGGCAATTGAACAACCTGTTG
2   K21   AX00000450   CGTGTGAGCGGTGCATTATTTATTAGTATGATTGTGACAGGAGTTATCGCCTTTT
2   K23   AX00000451   AGTGTATGAGCATACAGGGGGAGTATCACGTAGCTATTTCATGAAACTATTATTA
2   M01   AX00000452   TCGCTTCTTTCTCAAAGGAAATGCATCCTGACTTACAAGCAGGTATGCATTATCG
2   M03   AX00000453   TTACTTGCTGTATTCGTCGGATTAAATTCCGAAAGCGGCCAAAGCATGTGGCTC
2   M05   AX00000454   GGTCACACGTTTTCGGATTTATTTTATCGCTTGCACTAACGTTTCTAGCTCTATA
2   M07   AX00000455   AATTATGCTGTTCGCAACACTTTTCGCCTCTTATCTAGTACTTGCTGGTCGTACG
2   M09   AX00000456   GCGGTTAACTCATTCTTCTCGATTTCGACAATGGCGATTTCGATTCCAACCGGT
2   M11   AX00000457   TTCAATTCAAACTGACTTCTGTCGGCCCAATGAATGCTTTCTGGGTACCAGAACT
2   M13   AX00000458   GCAACTTGCTAGTGAAATTCATCGAGTTCCATTTGAACAAGATGGTTTGCGTGG
2   M15   AX00000459   GGTCAGTTGGAGGAAGAGGCTTTGGTACTATTTTTGTTTTTCTTCTTATGGCAGG
2   M17   AX00000460   GTGGAGGCTTTTTAGAAAGGTTCGATGCAATTTTTTTTACGACTTGGATTATTAC
2   M19   AX00000461   AGTGAAAATTGATGGTGCTGAACCAAAAGTTGAAAACATTGCGTCTGGTAAATAT
2   M21   AX00000462   TTCAACGGTGGTTTCATTGGGTGCGGTTATTATTAGTGCGCCAATTGCTATAGC
2   M23   AX00000463   GTTTTTGGGATCCTAATTTCTTGTTTGGAGAACCAAGCAATACAAGAGCTGGTG
2   O01   AX00000464   GAATGGGCATTGATTGATTCTTATTTAGAACAAGGGCATAGTGTTATATTGGATA
2   O03   AX00000465   ACAATCGTTGCTATGCTCCCACTCCTATTTGGCCAATCACAAGCAGGAAGTATG
2   O05   AX00000466   GCAGTTTCATAAAGATGAAATTCCAACTTTAGTACGTATTCTTCGCTTATGCCAA
2   O07   AX00000467   AAGTAGTGGAAACTGTAGGAACTTGGTATAAAATTCGTTTTGGCACAGGATACG
2   O09   AX00000468   ATAAACAGTATGCAAAAAGACTTGGAATTTCTATAGAGGAGATAGAGTCTGCAAA
2   O11   AX00000469   CCTTGCCGCTAGAGTGCCAAGGTGTACAGAAGAAAGAAGCACAAATAAAGGCAA
2   O13   AX00000470   TGCGAGTTCATGGATGGAGAGAGCATTTTATCCATTATTAGTTGCTTCACAAACG
2   O15   AX00000471   CGGTAACAGGGGCATACATTAACCATGAAGTACCTGTTATGCGTCATGAAGGTC
2   O17   AX00000472   AATTGAGAGTGAGATTGATTATTTGCATATTCGTGAGCGTGAGAAAAGTACGAAG
2   O19   AX00000473   TTCATGGAGCACGAAGTTACTAGGTTATTTTCACCGCGAATGGGGTACATATCC
2   O21   AX00000474   AGTAGCCGAGCTACTTACACATTTAGAGTTAGATAACAGAATTGTTGTAGTAGAG
2   O23   AX00000475   CTGTGTCAGGAGCAAAAGATCCTATTAAGATGGCACAAGCAATGAAATTAAGTA
2   A02   EMPTY        -
2   A04   AX00000476   AATATTCTATTCCATGGATTTACGGAGCATGTGTAGGGAGTTACGGCCTTTCTTA
2   A06   AX00000477   GCTATTACGGCAATTACTGCTCAAAATACGCTTGGCGTTCAAGGGGTATATCCA
2   A08   AX00000478   CATTCGTTGCCATTAAGGAACTTGGAAATAACGGCGGTGGATTTTTCGGAGCTA
2   A10   AX00000479   CAGTAAAACCTGGTATGCGTGAACGTTTTGAACAGTTGCGTCAAATGGGGATTA
2   A12   AX00000480   TAGTGACAAATTCAGGTTCAGGGCTAGATCCTGATATTAGTCCGAAGGCAGCTT
2   A14   AX00000481   TTTGTGTACAATACAGTTCAACAGCAGAGAAATTAATAAGACGGGGATGGCGCA
2   A16   AX00000482   ATCGTTACATCTTTGTACGGTTTTAGCATGGGACTTTCTATGCCAACCCACACTA
2   A18   AX00000483   CAAAACGAGAAGTTTCTTTATGAGACGGGTGTAAGTAGTATGTCTTTATCTGAGT
2   A20   AX00000484   CGTCTAGTTCATTGCCTTTCATTGCACCAGTAGTAAATTATCGTGGTAAGCAACT
2   A22   AX00000485   GACGCATTTGATGAAGCATTCCCAGCATTCTTAGTAATCTTAAGCATGCCACTTA
2   A24   AX00000486   CAGCAATATCCGCAGCAAGGACTAGAGTATATTACAGCAGAACAGTTAGAAAAG
2   C02   AX00000487   GAAAACGGTATTGCCAAACGAAAGATATGCAGTGTACTCAAAACGAAAAGATGG
2   C04   AX00000488   CAATGTTTCTTTAGTAAACGGTTCAAATTTCGAAAAAAAGGCTGGTGGAGCACCT
2   C06   AX00000489   CAAGTGAAATCACATATCCTTCTGATGATTATATGTGGGCTCATTGCCTAACACT
2   C08   AX00000490   AAAGATATCGGTGTCAATTTCTTACTCCCTATTTGGTCAATGGCGAACGTTGCAC
2   C10   AX00000491   TATCGTATGTGCTACAGATAACATCGCTCTTGGCGCAATGAAAGTTATTCACTCC
2   C12   AX00000492   TGTATCCATTCGTTTTATGGCTCGGTATCGCTGTAGTAAAAAAAGACTATCGCAT
2   C14   AX00000493   CAATTATTTTCTAAGCGTATTGAGCATTTTTTACACGCTTATCAATACAGTAAAGA
2   C16   AX00000494   AAATTAAAAAGAATGGTGAAGTTGTTTGGGATTCCCACGCAACGACTTGCGTCA
2   C18   AX00000495   AGACGTTTTAGCTTACTATAAGCAAAATAATTCTTGGGAGAAAACAGCCGAGCAT
2   C20   AX00000496   AAGATTACGCTGCAACATGTGCATTTATGCAAAACTTCCAACTTCTTGCTTGGGA
2   C22   AX00000497   TGCGTACAAATGGTGGCTTCCCGTACTTAGTAGTAGAAGACGGAGACTACTTAA
2   C24   AX00000498   GCATTCCGGTCCAGAGACGGTCGGTGATGATCCGCTAGTGCAGTCGTATAAAA
2   E02   AX00000499   CAAGGAATGATTAAAGGCTCTATTAATATTCCGTTAGATGAATTACGTGATCGTT
2   E04   AX00000500   ATTGCCGAGAGGTTATTACACAGTTAACGGCATCTCGTTCTGCACTTGATCGTA
2   E06   AX00000501   GCCGATTGTGAAAACGAAGAAGGCGATAGAAGGATTAGCATCAGGGCAAGTGA
2   E08   AX00000502   CCACCAAAAGATGCGGAGGAAGTTGTTTTCTCATATGAACCGCTCGTTGAAGGA
2   E10   AX00000503   GTGTTAGAAGTACAGGTAACTGATAAAGGGTCAGTTAAGGATATTCCAGCGTGG
2   E12   AX00000504   ATTGATATTTCAACATCTCTTGCATTCTCAGAACCAAACTTTAATCCAGCGCTTG
2   E14   AX00000505   GCTGTTCGAAATGCCGCACACGATTTAGCACGCGGTGATAAATCTGATTTACGT
2   E16   AX00000506   ATGGAAGAGGAAGAGATGCTACTACGTCTAGGAGCGAAAAAAGTGATTCATCGC
2   E18   AX00000507   CAGGTATGAAGCCTCTTCGCTCTTTAGAATCATTCCAAGAATTAACGGTTAGCAT
2   E20   AX00000508   GGCGCTCGGCCCACTTATCGGACTTTGGCTTATGCAAACATATAACTTCACGAT
2   E22   AX00000509   GAACTAGGTGCGTACGGTATTCGTTTAGATGTTGGTTTCTCAGGATTAGAAGAA
2   E24   AX00000510   GTTTATTAGTTTGTGCGACTGGTCAAGGAAGCGCCCAGCTATTGAAATATAAAAT
2   G02   AX00000511   AGATTGCCGGACAGCGACATTTATTAGCAATTCGAAACGGGGTTATTTCTACATT
2   G04   AX00000512   TGACGTTATTATCGGAAATGCTTATGCGAGTGAAGAAGAGTTAGAGAAACTAGG
2   G06   AX00000513   AGTGCACCATCATCTTCTCGTGAGTTACGCGTTGTAGCAACAGCTTACACAGCA
2   G08   AX00000514   CCTGTCATTTCGGGAGTAACTGAGTATGACTCTGTAAGATTAACAATGACCTCTC
2   G10   AX00000515   GACCTCTTTTACGAATTAAATAAACAAGGCTCAACAATCATTATGATTACCCACG
2   G12   AX00000516   CAAAACGGCTTCCACGTTTACGTAACGAGTAAATCTGGCGAAGCAACTGGTACA
2   G14   AX00000517   GCAGTATGCTTTTCCGCATTTTCGTTTCATTGAATATTTTATCGCGCATATATTGC
2   G16   AX00000518   TAGCTGCTGCACTCCGTTACTTAAATCAGCGTTATACAATTCCTGATAAAGTCAT
2   G18   AX00000519   TAGACACCCACCCAGACGATACAGCAGCTATTAATCAATTTAATGACTTTTCCTA
2   G20   AX00000520   ACCCCTCCTAATTTATATTTAGGTTTTCAACCGCCAAATTTACCACAGTTCTCAC
2   G22   AX00000521   CAGTTGAAATGACGGGATATTTAAGAACAGAGCTTCATCATTTTCCTGCATTAAA
2   G24   AX00000522   CTGCGTTGCAAAAAGCTCACGAACCACGATCTATTCGTATTATATCTTTTATCCA
2   I02   AX00000523   GGCGGAACGACAGGACCGTTAACGTTATATGCACTCGGTTATTACGGTGGTCG
2   I04   AX00000524   TGTAGTCCGTGGTCTGCTACTGTAGTTGCAACAGCAATTGATAATGTTCTCTATA
2   I06   AX00000525   TCCAATTACAGTTGATTTTTTAGTAGGTGCTACAGTAGTTGATACAATTACTGTA
2   I08   AX00000526   AATCATCATTTGCAGTAGCGGCTGGTGGAATTATTTTTCCTTTCATCGGTGGTTA
2   I10   AX00000527   TTCTATTTTCTCGGAAGAAGCAGATGGTGAGTACGACCAGAAGCTGAAATATAC
2   I12   AX00000528   GTGTTGTTCGCTTTTGTAAATCGATTGGAATCGGAAGTTTTAAAGCATTTAAAAT
2   I14   AX00000529   AATGGTGCAAGGATTTATAGCAGGTGGATTGAAAGCGTTTACTAAAGCGGTGGA
2   I16   AX00000530   GAATTGGTGAGGTGGCAGATTATCACCTTGAAGATCTTGGGCAAGAGATGAAGT
2   I18   AX00000531   CAATTGATAATGAATTGTACGGTAGATATGCAGGAGAGATGCAAGTTGCTATAC
2   I20   AX00000532   GGTGTAGAAGCAATAATGGAAAATGTATTTAGCCGATTAGGATCAGAATGGGAT
2   I22   AX00000533   CTACATTTTAATAGTGGCGATTTATGGATGATTGCGGCTGTTTGTATTTGGGGAA
2   I24   AX00000534   AGAAGCGATGCCTGAAGTGTTAGAATGTCACTGTTTAACAGGGGAGTATGATTA
2   K02   AX00000535   TATATGTGGCTAAGTGAATTTTTAAGTGAGGCGAAAGAAGCCGGTGAAATTCGT
2   K04   AX00000536   GGTATGAACTCGACTTATACGAGTTTAGGAAATATAGCAGGACCAGCGATGGGC
2   K06   AX00000537   CGAAGGAACATTACGCTTTAGTGATTTACAAAAATCAATGGACGGGATTAGCCC
2   K08   AX00000538   AGGCATTGAAGGGTTAAAGTTTGCAGCGCAAAATTTTCGTAAAGTTGTGCCTGA
2   K10   AX00000539   AGAAAGAGTATATGTTCTCTACAACTTGGAATGCACCTGAAAATTCATTTGGAGA
2   K12   AX00000540   AAAAATGGAACCACACATTGCGCATACGTGGGAATTAAGTGAAGACTGGCTTAC
2   K14   AX00000541   AAACGGTGCACTTTTTCTTCGGGAATGGTTTTACGTTTGATTTAACAGGTATTCG
2   K16   AX00000542   CTGTTTTCGCTATTTGTCACGGACCTCAGCTACTCATCACTGCACAAACACTTGA
2   K18   AX00000543   AAATTTCCTGATTTTGTCCATGCAGTTAAACCAGAACCACATAATGATATTCCTC
2   K20   AX00000544   TTACTACTTGCTTTCCTGCTTCTATACACGAACAAACAGCCTACAAAACGAATAC
2   K22   AX00000545   CACTCGCCTATCTCATTCCATATCTCGTTTCACCAATCTTCCAGTTAAAACTAGT
2   K24   AX00000546   ATTCTTGGGTGTACGCATTATCCACTTTTAGAGTCCTATATTAAAAAGGAACTAG
2   M02   AX00000547   ATGCCATCTTTAGCAAGGCGTATTGCACGGAATAATTGTATCGATGCCAATATAA
2   M04   AX00000548   AACCATATCGTAAGCGGTGCATTCTCTTACTCTGGTCAACGTTGTACAGCTATTA
2   M06   AX00000549   ATAGTTGGATATGGCCTCACTTTCGTATGGCAACATCAATTGTTTGGCGGTGCA
2   M08   AX00000550   TAAACCATACGTTTCATCTTCAGCGGCATTAGTTATCGCAAAAGATAAAGATAAA
2   M10   AX00000551   TGGCAACGTTAACGGCGCTTGCACGTATTTCAGGTAGTCGTATTTTACAATGGA
2   M12   AX00000552   ATTGTCAATCTTCGTACGCAAACAGGTATGGTATTCCAGCACCATAATCTATTCC
2   M14   AX00000553   CAAAATTGCCAAAGTATACTCCAAGATTATGGGAAGGCTGTAGATTACATAGACG
2   M16   AX00000554   TTATCGTCCAACAAGGTATTTCCTTACTTCGCTTCGATGGGCAACCTGTTGATTT
2   M18   AX00000555   TAGAGCTTTCCACTATTATGGATCAAAAAGGGGCAATTTGGCTTATGTATGTCAA
2   M20   AX00000556   ATGTAAGTGTAGTGGATCGTGTGCAGCCAGAAGTTATTAAGTTTTTAGGGCAGG
2   M22   AX00000557   TTCAAGCTGATGCAGCTTCAAAGAACTTATTCGATGAGTTCCGCACAATGCAAC
2   M24   AX00000558   ACCGTTACATGTGACATCGGTTCCCATTCTATTTGGATGGCGAGATGTTTCCGT
2   O02   AX00000559   ATTTTGGACGCCAGATTATGCGCAAGGTATTGGTGTAGCTGGATTCCACTTACA
2   O04   AX00000560   GGACGGATCGCACAGAAGTCATGTTTGGTGCACCGGGACATGCTTACGTATATT
2   O06   AX00000561   TGTATCAAAATTACGCGGATTACAATTGCTTGGAGAGCATTTGAATATTTCGCTA
2   O08   AX00000562   TAGCAGAACTGAAAACAGGTGAGAGTGGAAAAGTGATGTCACCGAAATTACCGC
2   O10   AX00000563   AATTTTGGAGCGGAAAAAACTGCCCTGCATTTATGATTCAACGCGGACAATGGG
2   O12   AX00000564   TTCTGTTCTTCAGCAGTTAACTGGTATTGAGCAAAGCTGGGGTATTTTAACGGG
2   O14   AX00000565   GGTCATCCGAAAGGTGTATTACATCGCCATCGTGAAATGGCTGAGCATAGTATG
2   O16   AX00000566   ACGGTCATATCCTTACTCTTATCTCAGAGGATGATATGTGGAACGTGTACGCTG
2   O18   AX00000567   TATTAGGATCGATTGACTCGTTGTTAACATCGGTCGTAATGGATAATGTGACGG
2   O20   AX00000568   ATTCCCGATGGCGGCGGCCATTTCTTCCTTCAAAAGCGCGTTGGTGAAAATATG
2   O22   AX00000569   AGGACAAGCATACATACAAGCTTTAGCGAAAATTGGAACAGAAGAAATTCGTGA
2   O24   AX00000570   TATTTGTGCAAAAGACTCTAGCGGTCCGTATCATTATGCACTGCGTAAACATTTA
2   B02   EMPTY        -
2   B04   AX00000571   CTCTTGGAGGACGCTGGTACTTCGGGCACTATGTAGAAAGTGAACCAGTTTGGT
2   B06   AX00000572   GTATTGTCGGTAACAGCGGTACATACATATGAAGCTGTCGTTCCGAAAGTAACA
2   B08   AX00000573   TGTGATGCTATCCGACTTTCAAACGGGAGAACCGCTCGCACTTTTAGAAGGATC
2   B10   AX00000574   AACTTACAGCCTGTAGGATCAGGTCCGTTTAAGTTTAAAGAGTATAAGTCTGATG
2   B12   AX00000575   GAAACTTTGTCACGCCGAATATGAGTCCAATTGATGTTGAGCGTATTCGCAAAA
2   B14   AX00000576   ACGGTCGCATCGATTTTCGCATTCGTATCGCCTTACGATCCTAGTAAAATGTCAA
2   B16   AX00000577   GCCGATAGCGAAGACCTATACACAAAACCGGCACATCCATACACACAAGCACTA
2   B18   AX00000578   TATCGGAATGGAATCACTATTCTACTTCTACGTAGCTGGATGTATCGCCATCAGC
2   B20   AX00000579   TTGTCGTTCTCCTGTTAGCAGGAATATTTGTTTACATTCAGTCCGTTGATACGAA
2   B22   AX00000580   GGCATTTCGCAAACACAAGACATAAAAAACTTACCGACAGGTGTGGATCCGTTA
2   B24   AX00000581   CAAAAAGGTGGTCACGTACTGGCGATTAACTCAAGCTTACTCATAACGAACAAT
2   D02   AX00000582   TTACTCATGTACATTACACTGGCACGTAAAAATGAAGTGTACAAATACCATTGCC
2   D04   AX00000583   TTTGATCGGCGCTTTATGGATGTGATAGGGAAGTTAAAAAAGTATAAGGAAGAA
2   D06   AX00000584   TATGTTTCTTCAGAAGTGCGTAGATGAGGAGCTGAGTGTTCCGATGCTTTTAGC
2   D08   AX00000585   CGTTCTGTAGAGTCACGGCAAGATAAGCGTCCTCTTTTATCTGATTTAAGAGAG
2   D10   AX00000586   ACACCACTCGCTATTCACCTCTACCTGTTGAAATCTTTTTACAGAAGGCTCAATC
2   D12   AX00000587   AATTATTTCCAATCACTTTCATAGGTTCCATAATAGGGGCATGGACCGTTCATTT
2   D14   AX00000588   ACGATCACGATTAACCAAATTTGTGAACGCGCGATGGTACACCGAACAACCTTT
2   D16   AX00000589   AATTGGTACAGCTATCTTTATTTCGAAAATGTCTTCAGGAACAACTAGCTATATG
2   D18   AX00000590   CCTTCTACCTATTTTGAGAACATAAACGAGCTGGCTGAACAATTGGCAGTAACAA
2   D20   AX00000591   AATGAAAAAACACTTATAGGAATTCAAGAACGAATGGATCAAGTTACATCTAGCA
2   D22   AX00000592   CTTCTACAGAATTGTTAATGGCTCCATTTGGGGCGAGTTGTGTATTAGCGTTTG
2   D24   AX00000593   TCGCATCTTGGTAAGGTTGATTTTGTTCCATATGGCCATCATTTTCCTCTTAGCC
2   F02   AX00000594   AGTCGAGAGAGTATAAGGGGGGCTGTCCATTTATTACTCTTTATATTCAAAGTCC
2   F04   AX00000595   CTTGGTCCAAACGGTAGTAAGTATATGGAGCAGTTGTCTGAGTTAGATGATGTA
2   F06   AX00000596   TGTTTGATGGCATGGTTGCTCGGAAACTTGATTCTGTTTCGGAAATTGGCGGAG
2   F08   AX00000597   AGTTCGTAGGAATAAGCATTGGCCTTTTAGTTAGTATGTACTGCGCCTGGATTTT
2   F10   AX00000598   TTTCGCTAGTGTATAAGGTGACGCAGATTGCGACTGTATGGGATATAAGTAGAT
2   F12   AX00000599   TCTTTTACGGCGTCGGCATTCACGGAGAAAAAGGTTACCGTAAAGAAGCACTAT
2   F14   AX00000600   ACTATCTGTGAGCTGTGGATTCAGCCTTTCTGATGAGACAAAAAATACGATTGCC
2   F16   AX00000601   AATCGGATCATTCCTTGACGGTTGTTCCATGATTATTATGGAACATTGCGGCGG
2   F18   AX00000602   CAAAAGAACTCTGTATTACTCAAATGGAGTATATGCTAATAGTTTTACTGAAAATG
2   F20   AX00000603   CGTTTCTTCTATTACGCAAGTTGGAATGGATGATCACGAAAAAGTGAAGGCGAT
2   F22   AX00000604   TTAGAGCCAGCTCATGGATATTTAATTATGCAAAAGGTGGAGGAATTAAGTAATC
2   F24   AX00000605   ATAGTGGCTGGGAGCATATAGCCGGTAATTGGTGGTCAGGTACGCACTATTTTA
2   H02   AX00000606   TTGGGACAAGCATTATTAACGTTTTTCAAAACACGGGAGATCAGTTAAGAAATAA
2   H04   AX00000607   GGAATTGGTGAGGTTACAGAAGATAGAAAGTTGAAAAATGAAGGGAAGTGGGAC
2   H06   AX00000608   TCTTGGGTTGGTAGTGCATTATTTGGTCATTGGGGTCCTGAATGGGGAGGCATT
2   H08   AX00000609   ATGGTGAAATTGATGCATATACAGCATCAGATTTGAAAAATAAGATCATGCCTAT
2   H10   AX00000610   AATTGTCTTTGGGCTATATGAAAATCGATTAGAAATTATGGTTGCTGATAATGGG
2   H12   AX00000611   TATCGCTATTCAAAAGGCGGGCCAATGCATGAGGATATTATACAAGTAGGCATG
2   H14   AX00000612   TGCCCTATATTTAGCGGAGAAAATTAAGACGCTAGGTGGTACACCTACTACGAT
2   H16   AX00000613   CTTGTATCGCTGAATTCTGCACAAGAGCTTTTCGAATACATCCATTTTGGAAAAG
2   H18   AX00000614   TTTCTCGATCAATGTAACTGAGATGTTCCGTAACCCTATCTTTTTTAAGGCGCTA
2   H20   AX00000615   GAGAAGGCAGTACTTTCACCGTATATATTCCCAACCTTCCAAATGGATTACATGA
2   H22   AX00000616   AAAATCGGGTGAAAAAGTGAATAGCGAAACTGCACATAAAGCAGATATCTTTTCA
2   H24   AX00000617   GTCCAAAATAAAAATGGGGATCAGTATGTGAAGAAATGGTTTCGTAAACATGAAA
2   J02   AX00000618   GCTATTATGGGTGCAAATATTGTCCGCGATTTATTCGCTTCTGTTCGTGATGTTG
2   J04   AX00000619   TACGTCCAAACGGGCACTTTTTAACGATCGGCCTTCTATCAGGAATACAAGTGA
2   J06   AX00000620   GAAAGCAAATTGATGATCAGTTTTTACGATTGCAAGAACCATCGCTTACAGCAAA
2   J08   AX00000621   ACGAATCATTCGAGGCGGCAACTGAAAAAGAAGCGAAAGCAAAAGGTGAATCTA
2   J10   AX00000622   ATTTAGGGGGAAGCTGGGCAGCAATTGAGTTTCCGGAAAATGTTCATGTGTTTA
2   J12   AX00000623   AAATTGAACGATTACCAAAGACGGCAGCTGGCGAGGTAACCGTTTATTTTGAAG
2   J14   AX00000624   AGCGACGGCGGAGCAGTTGTATTTATCGCTGAGATTTGCATTAGCGAAAACATT
2   J16   AX00000625   AACGAATTTTTAGACTATCCAGCAGCGACGAAGAACCATCACGAGTTCGTATCT
2   J18   AX00000626   AAATGATGCAGAGCTTGCTTATTGGGAAGAACAGGTGATACAAAGAGGCTTCCA
2   J20   AX00000627   GAGAATCAGTAGCGTAGGGCTTCCTTCATCTGGTTATGTAGACCGTCACTTCTT
2   J22   AX00000628   TGAGTTAGGAAATTTTCATCTCGCTAAAGAACATTACGAAAAGGCTGAAAGTTTT
2   J24   AX00000629   TACTTATGCTGCACGGGTTTGGTGGTTCTTCTGATGGATTTAGTGATATTTATCC
2   L02   AX00000630   TTTCTTTTTGAGGATTATGGCAGACCATGCTAAATTTATTGGTCATCTTCTTGATC
2   L04   AX00000631   GTACCTGGTTATATCGCAGCACAAATGATTGGGGCAATTATCGGGGCAGTTATC
2   L06   AX00000632   GGAACTGGTTGCTTCATGTTAATGAACACGGGTGAAAAAGCAGTAGCTTCTGAG
2   L08   AX00000633   GTTCTAATCCCACTTGTATACGCAATGGATTACGAAATGACAGCAAAACCAGTCG
2   L10   AX00000634   TATCGTCTCTCATGATGCAGACATACTTACGATTGATGTACTTCTTTCTTCACCT
2   L12   AX00000635   TTTACAATACCGACTCCTCCCTCCGCTTCCATAGTCGAATTGAGAAGTTAACGG
2   L14   AX00000636   AAATTGTTACATCTAAAGCTGGTGACATTACAAAAGACGAATTCTACGAGCAAAT
2   L16   AX00000637   CATGACACATACACTGTGTGAACGAAAACAAATATCTGCGAGCCGCCAACCCGG
2   L18   AX00000638   AGGGCTTCTGTTGTTCGATGCGCTGTTAGATCAATTTGAAAAAGCGCTTCCACA
2   L20   AX00000639   AGGGGCTTCTATTTCTGAGATTGCTAAGTTTGGAGTTATGCACGTATCAACGGC
2   L22   AX00000640   CTGTTCTCTTCTCAACTCCTTCTTCTGGCAAAGACATGCGTGGCAAGTTAAAAGA
2   L24   AX00000641   CCACTTCCACCTTCATTTAATTCCACGCTACGGTGAAAACGATGGTTTCGGTGC
2   N02   AX00000642   AAGGAACTGTCACAATTAATGGGAAAACAATTCGTGATGATATGACTGCGTACC
2   N04   AX00000643   TCTTTTTACGTTTATGATTCAGTTATACATAATCGCCATCGTAGCAGCAGCGCTT
2   N06   AX00000644   AGTACCGAGACTATATTGATTTAGCAAAAATGCTTCAGCTCGTACCAATAATCGG
2   N08   AX00000645   CTTATGGCAGAGCACGGCATTGAGAAGATGAGCCTTTCCATGATTGCGAAAGAG
2   N10   AX00000646   ACAGCTACCAACTAAATGAAGAAGAACTTGAAATTCAGCATGGCCTTTTCGTCGT
2   N12   AX00000647   AATTACCGGAGCATTTAGAAGGAGATCGAAACGTCGCCATTATGTTTGCAAACC
2   N14   AX00000648   CCGCTCAATTATTTTGTATTTCCAAATTTACGTCAACGCTATTATAGTTACAGATT
2   N16   AX00000649   TTCCAAGCAATCCGCGTTCTACGCCCATTAAGTAACGATACATATGTCATCTTAA
2   N18   AX00000650   TTATACGGGTTGTCTCATCAAGAAGTACTCCGCGGAGGATATACGTTTGTCGTA
2   N20   AX00000651   GAGCTCCATTTACGTTAGCGAGCTATATGATTGAAGGCGGTCCATCTCGTAACT
2   N22   AX00000652   TAACAGAGCGTTACCGTGCAATTGGTGGTATTTCTCCTTTAGCTACTATTACATT
2   N24   AX00000653   AATTCCAACGCAAATTACGCCGTTTCTATTTTCTGGGCTGTTCTCCCCAATTGGG
2   P02   AX00000654   AAAACAAATAGTGAAACGGCTCGTATGGCTTACAATGCGAAGAATACTTTCGGG
2   P04   AX00000655   ACGGTGGATTTAAGCAAATAGGCGCAAATATTCAGCCGCGTCTTGATAAGTTAA
2   P06   AX00000656   GGAAGATCCAATGGACTGGAAGCCGAAAACAATCCGCACATTAATTAATCGGTT
2   P08   AX00000657   AAATTGGTTCAATCCGATTCTTTGGTACGCCTATTTTTGTATGCGAGAAGATCAA
2   P10   AX00000658   TCGGTTATAAAGCAACAACAATGGATCAAGTAGCGAAGTTAGCGAATGTAGGAA
2   P12   AX00000659   TACCGATGACATACTCTGTATCTGGATTGAAAGCAGTCGTATCTAGCGGAGACT
2   P14   AX00000660   CTTTTTTGATAAAGAGGATCGTTTAAAATCGATTCCAGGTCAAAAGAAGAAAAAA
2   P16   AX00000661   CGATTTTGGCAGGAGGCGATGAGGTAGCAGCTGGAATTATTTCAGAGGCGAAA
2   P18   AX00000662   CGTCGGGGTATTTGTTTGAACACGATGGTTTTCGTTTACTTGTAGACTGTGGTA
2   P20   AX00000663   TCTCAACGAAAGGTCGTATGTTCAGTCACGGTACGTTACTATTTGACTCTGAAAT
2   P22   AX00000664   ATGTTTCAAAATAAGAAGTGGAAAAGAAATGAAACATTCAGCACTGTTAATAAAA
2   P24   AX00000665   CGATTTTGATGTTACCGAAATTTAGCCCGAAAGAAGTATTCCGTATTTGCCGCAC
2   B01   EMPTY        -
2   B03   AX00000666   TTCCTGATCAAGGTAATGGAGAAAAAATAATTAGCAGACTACAAGAGCAGGGCT
2   B05   AX00000667   TAGATGATTCGAAGTGGACGTTACTGGAACGGTCAGCGCCCGAATTATGCGCA
2   B07   AX00000668   CGCTATCTTCTCTCCCTAACCGGAGATTCCCATTTTGCTGAAGATCTCATGCAAG
2   B09   AX00000669   TTTCTCATACGGATGAAAAAATTATTGATATCGCATTTGAGCATGGCTTTCAATC
2   B11   AX00000670   CAAAACTGGGTTATAGAAAGAGAATTAGAAGAAGGGGCTATTTGGACGTTAATA
2   B13   AX00000671   GAAATCACAAAAACTATAGCTAGAGAAGGTATAGTTATGGGATTTAAGAAATTAA
2   B15   AX00000672   AACCGTTATTACATGCGATGCGCTGGCTTAAAAATATTGCTGGTGGAAAGTACG
2   B17   AX00000673   TTTGCGAGAATCCGAACTACGTATTTTCAAAAGAAGAAATATACGAGAAAGTTTG
2   B19   AX00000674   TTGCAGATTTCTCAAATTATACGACGTTCTTTCCAGGGCTTATTATTTTTATAACA
2   B21   AX00000675   GTTTGCCATTGGCTGCAACCTGTAGTAGATACGATTGTGTTTCCAGAGTATTACT
2   B23   AX00000676   TCAACGCAAAGTACACAAAGCTGGATAAAAGATCACGTTATCGGTTTTTGGGAA
2   D01   AX00000677   GGCAGAAGACATGGCTCAAATTTCCCAAAGATCATCTGACCGAACTGATAGGGT
2   D03   AX00000678   TTCCAAATGGAACGATCAAAGCAACGGTGTTACTGGAAACGATTCACGCTTCGT
2   D05   AX00000679   ATTAAATTACGGTATGTTTGAACTAGCACGTGGCTATAAAGAGCGCGGCATGGC
2   D07   AX00000680   GCTCCTGGACCAAGAATTTGGGATATCGCTTATACACTGTATACTTGTGTGCCT
2   D09   AX00000681   GCAAGCATGGTTCTAGTTTTTTAGGTAGAAAAGAAGGAACGAAAGAGTTAACTC
2   D11   AX00000682   AGTCGTTTCTTTTCTTTTGTAAATAAGCATGAGAAAGTACGAAAGGCAATGGGAT
2   D13   AX00000683   GCAAGATGGCAATATGCTCGTTGTAAATAAGGTGAGTTATCATGTGGGGGACTT
2   D15   AX00000684   TTACAGATTATAATATCCCGCACTTCATCGATGAAAAACGCCCGATGTCACATCA
2   D17   AX00000685   TTACTGCAAGGATGGCGTGAATTCGCACGCCAACAGTCTCTTTCTGATTTAATTT
2   D19   AX00000686   CGCCCCTCCTCTTCTATAGGAAAAGTGGAATACAAATTCGATCAATTAAAAGTAG
2   D21   AX00000687   ATGTATTTGCGATTAGGCCTATTAGTTATTCACGCGCTTTCGCGGGGGCCGGCT
2   D23   AX00000688   TGGAAAAAACTATCGTGAGCATGCGATAGAAATGGGCGGAGTAGAGTCAATTCC
2   F01   AX00000689   TCACTGAAGTTCGCGGTAAAGGTTTATTCATCGGTATCGAATTAAACGAGCCAG
2   F03   AX00000690   ATGTGGTATGGTTTAAAAATGATAGCTGGTATTTTAGTTATCGGTGGAATGGAAA
2   F05   AX00000691   TTAGAAGTGCGCGTTCCATTTGCAGATCACCGACTTGTCGAATATGCGTGGAAT
2   F07   AX00000692   TGGTGCGATGCAAATCAATCAAAACCCATCTACAATTAACTACGAACCGAGCCG
2   F09   AX00000693   AAAGTAAAAACACAAGTACAAGATGATCAAGTACGTGTTACAGCAAAAAGCCGC
2   F11   AX00000694   AATGGAAGATGATGCTGCAGTGATTTATGCATATATGGAAGAACGAGGCGGAGC
2   F13   AX00000695   ACGCGATTGGAATGAATTTATTTTTAACGCCAGCGAAAGTGTACGCGAGTGGCT
2   F15   AX00000696   CGAGCAACAAGATCTCGTATATAGAGCAAAAAATGCTTTGCAATCCGCTTACGC
2   F17   AX00000697   CGTAAACTTTAATGGCGCTTACGTACATCACCCTCTTGATTCAAAGTGGGGTAC
2   F19   AX00000698   TTACAGTCTTTAATGACAGTTCGGGGGAATCAAAGAGTGACTAGCCAAAATCCA
2   F21   AX00000699   GAGCTACGTAATCGGCTCTATGACTGGCGGTACATACGATTTTAACCAAGCGTC
2   F23   AX00000700   ATTGAGAATGGTACAAGTTTATGGACACAACATGCGGGTAGATCTTATTTTTTAC
2   H01   AX00000701   TCTATCTTTCGAATTAGGAGCGGACGGAAGTGGCGGTAAGCATCTTTATCAAGA
2   H03   AX00000702   ACAGAAGAAAACGGACCTCGAATTGGTGTATGGATTGGTTCTGGTATTGGCGGT
2   H05   AX00000703   AAATGGATTGCACTCTTATCCGAAATTGCTTGGCTATGCGCTTGGATTTCATATT
2   H07   AX00000704   AATTACATACAACGAAAAACACAGCAGAAATTCGCTATTGGTTCACAGAGTGGG
2   H09   AX00000705   AAGTAGAGGAACCTATCGATAAGAAAGAACGTATTTATAAAACATATTCATTCAA
2   H11   AX00000706   GGTACCATCGTTCGTATTCGCCGCATTACTACAATATTTCGTAGGGGTAAAACTT
2   H13   AX00000707   ACAGATGATCTTGGCCGCGATTTATGGACAAGAACATGGGAAGGTACGCGCGT
2   H15   AX00000708   TTCCGAATCCTCCTGGACGCATTAAAAATGGTGAAATCGTATTTGAAGGTCGTG
2   H17   AX00000709   TTATCAGCGATTCCACTTCCAGATCCAGATTATGAGCGTAATCGTAAACGTATCG
2   H19   AX00000710   CATTATCAGACGATGCTGTATCTGGGGTTGGTGCAGCGAATCAATATCTCCATA
2   H21   AX00000711   TAAGATGATTCGTGACTATCCAGGGATTTTACGTCGTCCAATTATGATTGACGAG
2   H23   AX00000712   CATGAAGACAGACTTGCAACCTTTTTTCATAACAATCCAAGTTTCACTGCAGGCA
2   J01   AX00000713   AGCTCTTTTGGGAAATGATGGACGAAGCTCGTGATCATGACGATTTCTTTATTGA
2   J03   AX00000714   GATTACGAAGAACGGATTTTGCGCAATCATAAGCATCAAGAGCTGTTATTTCGTT
2   J05   AX00000715   GCACTCTGCATACTGGATGAAATTCTCCTCAATTATGGCTTTCTCCTTACAATCT
2   J07   AX00000716   ATTCATAAGAAAGTACAAGAGGGACATGCGGTTACGCCAGACATGTTAACGGAG
2   J09   AX00000717   AAGGCAGCGGAGTTGCAGGGTCGAAAAGCAGGTTCGAAGTTTTTGCGAAAACT
2   J11   AX00000718   CGGTCATCCTATGTTAAGAGCACGCCATCTCCCGTTTGAGATTACTCCAAAACG
2   J13   AX00000719   GAAACACCGAACTTCTCATTAAAGGAAGCTGGCTCTGCACTTCGTATTCGTCAT
2   J15   AX00000720   TAAAGGGGTTAAGTGCGCGTAATCACGTACTTGTAGACTCAGACAATTTATCATT
2   J17   AX00000721   AAATCGTGGAAGAGCGTGATTATGTCACGCAAAAGAAAGATAGTGGTTATCGTT
2   J19   AX00000722   GGACCATTTAACGATGGTTCATCAAGATGTGAAATCAATTCAGTATCGCGTGGC
2   J21   AX00000723   GAGAAGCTAGGGTATAACTGGAGTAGCGGTCTACCGGTTCACCCTGATCAACG
2   J23   AX00000724   AAATATAGAAGGCGATTTTATTGAAACTGGTGTATGGCGCGTAGGATCATGCAT
2   L01   AX00000725   GTTGGATCTCAGTTTGGTACAGCAATTTCTCAATTAGATGCTGATACTTTCGTAA
2   L03   AX00000726   CTAAAATTGATGCTGTTTCGATGCCTTATCATCTTGCAATGGATTCTAACGGGAA
2   L05   AX00000727   AAAGCATATAAAAAAGGAATGGAAAGAAGTTCTTGATATCGGTTGCTCGAGCGG
2   L07   AX00000728   GAGTTTCAAAAGGCAGGTTATTTAATTGGTATCCCTAATCAAGCAAATTTATGGT
2   L09   AX00000729   TGATTATTACAGGTAAAGAGCATATGGGGGATGTTGTTAGCTTTTTAGGGAGCG
2   L11   AX00000730   AGATTGGTTACATGTAACAGATCATTGTAGTGCGATTGACGTTGTTCTGCATAAG
2   L13   AX00000731   GTTGCTTCACAATTAGTTGGGGCGAAGTTAGTTTATATTAGTACGGATTATGTAT
2   L15   AX00000732   AGCTTCATTAGAAGCGAGCGTGAAATATTTAGCTAACGATTTAGGCCAACACGG
2   L17   AX00000733   ATCGCCCTCATTATATTCCGAAAGTAAGGTGCAGAATAAAAACAGCTACAATCTC
2   L19   AX00000734   GCTGTTATTGGTGTACAGGTGTATGGGTTAGTGCTTTTTTATTAGTTTTATATAA
2   L21   AX00000735   ACTACTATTACCTAGCGTAAGTCCAAACCCAAATATTACTGTTCCTGTAATAAATG
2   L23   AX00000736   TCGCACACATTCTGTAAGCCGTTCGTTACTTGATCAGCTTACCATTCATAAAATC
2   N01   AX00000737   ATGATCCACACTACGCATTAGTTCCGCCACATATTACATTGAAAACACCCTTTGA
2   N03   AX00000738   TCGTTTACTTACCGGTAAATTACACACCACTGCACAAACATACAGTTGTCATTGC
2   N05   AX00000739   CATTTCATTCGCAGCAGTTTTTGTAAAGATGTCCTCAGCACCATCTTCCATATTA
2   N07   AX00000740   ATACGAGACATAAAACAAATTTCAAATACGAAAAATCCAATAGCAGCTTATGCAT
2   N09   AX00000741   GCGTCTTGTTTGAACATACAACCTAATCCACCTAAAATTTCAATTGCTCCTTCTG
2   N11   AX00000742   AGCGTTTGCAAAGCGAATGTATTGGAGATCCATTCGCGTTATATCGAAAACTTCG
2   N13   AX00000743   ACAGCGATGGACGATGGAGAAATAATGGCAGTTCGTCACAATTATTATCCGCTC
2   N15   AX00000744   TTAGCACAACATCCGCATTTGTACTGGCAGGAGCTGGCGTAAAGGTTGCAAAAC
2   N17   AX00000745   GAGCAATTTACTGTCATCGCAGAAGTAAAGCGAGCATCACCATCAAAAGGAGAT
2   N19   AX00000746   TGAATATTCCGTCTATAAAGTCGCTCGGAGTAACTTCAGAGAGTGATATGAAAAA
2   N21   AX00000747   TCAAGAAGCGCACTCTATTTCAGCAGGACTTGATTACCCAGGTGTTGGTCCAGA
2   N23   AX00000748   TCGAGAACTGTATGGAAGCAGGTGTAGACGGCATCATCGTTCCAGACTTACCGT
2   P01   AX00000749   TGGAATCGTTTTACTCTCGCCAACGTTTCAATTAGGGATAAGTGAAACTGTGCAC
2   P03   AX00000750   TATAAAACGAGCAATAGAAGAAAAAGCAATTATTTATGCGTTTGGTGAAAGATGG
2   P05   AX00000751   GGCGTTATCATTGTAATTGGATTTCTATTAGGCTATTTAGAATCTCTCACACGAA
2   P07   AX00000752   GGGTTACCGTATGTCATTAGTGGTGCTATCGCTTCAACGGAAAAGTTAATCGCG
2   P09   AX00000753   TTCGGTAAGAAAGTAGAAGTATTGTTCTTCTTCCAAGACCATGTCGTGATCGGA
2   P11   AX00000754   GTATATATATTTAAAAATTGACGATTATCCAGACGGCATTTACCATTACGACGCC
2   P13   AX00000755   TTATAGCCTCGGTCATCGAGATGCTTGCGTATATGAAACATCAAATGGATGTGC
2   P15   AX00000756   ATCGTGAAGAATGCTGGGAGTCCGCATGGCATCGGCTACATGAAACGACTTTAC
2   P17   AX00000757   CAGTTGCAATCGATAACGAACGTATGGAAAACCGCCCAATGATGTACATCGCTT
2   P19   AX00000758   TGACGCCGAAAAGTTTATTACGTCACCCACTTACGCTTTCAACTGCTAATCAGTT
2   P21   AX00000759   CCAGACAAACCATCATTTCAATTGAAAAAGGAAAATACGATCCATCACTTCCGTT
2   P23   AX00000760   TAATGACGCATTCTGCACCGCCAGCTATAACGTATCCATTGCTTGGGATGATGA
3   A01   EMPTY        -
3   A03   AX00000761   ATTCTTATTTATTCGTAAAGACGTGCAAGGTGGGACGTTAACGAAAAGAGGCTT
3   A05   AX00000762   TATAATATGTAACAAACGAGAACAAGTGCCACCTATGTTAGTATGGGAGGGTCA
3   A07   AX00000763   CAGGTACAGGGATATTTAGCCGCCAGCTGCTTGACAGTGGTTTACATGTTATTG
3   A09   AX00000764   GATGTTACACATGATGAGTTTTTGCAAGAGTTTGTTGAGTGGGTCGATTCTAAAG
3   A11   AX00000765   TACGAGAGGTGTGCAAAAGTATCCTGAAATTTTACAAGCGATGAATACGAAAAG
3   A13   AX00000766   CTTCAAAAGCGAGCGGTGGTGATCCAACGGTGATGGGATATCAATTTAAGAGCG
3   A15   AX00000767   ACGATTTAGCTGCTTGGTTCTGGGATGAAAAAGGTATTTCAGCAGGTAAATCTG
3   A17   AX00000768   GGTGAAGACTTTGGTAAGCACGTTAAAGTGAAATTCCTTTGGAACTGGGATAAA
3   A19   AX00000769   CTTACATTAGTTCTATAGAACGAAATTTACAAAAGAACCCTTCCATTCAGTTTCTT
3   A21   AX00000770   ACAGTTGAAAGTAGTACACGATTCCAAATCGCTGATGCGGCGTTCTCATTCGAT
3   A23   AX00000771   TACCATGGGGAAGAAAGTTTTCGGACTTTTTCACATTATAAAAGCATTTTAGCCC
3   C01   AX00000772   TAACGATTTGCCACCATATAAGCGTCATATGAACCTAGTGTTCCAACATTATGCG
3   C03   AX00000773   CAAATATCGTTCCATTCTTTTATTATTGGCAACGATCCCGTTTTGGATTAACTTCC
3   C05   AX00000774   GATTTAGGAGCAACGCCGTGGCAAACGTTTCGTTATGTAACGTTCCCAGCAATT
3   C07   AX00000775   CTGCGTTTGATCCAGAGAATAAATATTCTTTAGTATACACTTGGGGTGTAACTGG
3   C09   AX00000776   CCAAAGCTACCGGGAGTATTAGGTGGTGATGGCTTTCAAACGGAAGGGGACTA
3   C11   AX00000777   GGTATACGATGGATGCGGAAGAAGAGGAACTTGTAAAGGTCATTCAAGTAGAGG
3   C13   AX00000778   AAACTTCCAACCAAACTGCTTCATTCCTGGTCAACAACCTACTGAAAATGTTGTA
3   C15   AX00000779   CGTATCAAGACTCTTGTCATTTACGCAATGTCATGCGAACATCTTCAGAACCTCG
3   C17   AX00000780   TGTAGATACATCCAATATGGGGCGTTTAACGTATAGTTATGATGCCACTCCAAAC
3   C19   AX00000781   ATATACAAGGCGTTATTATCGCAAGTACAGATATAGAAAGAATCGGTCAATTTCA
3   C21   AX00000782   AGGATATGTAGCCAGCTATGATAGTGATGAAGTGTGCGTTATGGATATGAAGAA
3   C23   AX00000783   CTCTTACAGTAAAAGAGTTTGATTTACTCTATTTTCTTTGCCAACATACGGGACA
3   E01   AX00000784   CACCACTTAGTTATATAAAAGGGTATAGCGAGGCTATTTTAGATGGTGTAGCGA
3   E03   AX00000785   CATTTTACTTGAACTCATGAATCATGTTTCAGAGATGATTGCTGAAACGATTGGT
3   E05   AX00000786   CGCCATCTGGTTCTTGTGCGACAATGTTTCATGAGTATCCGCATGTTTTTAAAGA
3   E07   AX00000787   TGGTGCGGTATTAACACCACTTTTAGGTGGATATGATGATTACAAAGAGCTTCC
3   E09   AX00000788   TTTACCTACTGTATACTTTGCTATTATTCCACGTGAAACACTTGTGCCTCGTATTA
3   E11   AX00000789   GTATAGTTGGGAGTGGCGTTATATTCATTTTGTTATACTGCATGCAAAAGATATA
3   E13   AX00000790   TCATAACTTAATTCCAGTTACAATCGGTAACATTATTGGTGGGTCAGTATTTGTC
3   E15   AX00000791   AAACTGCAGCATTCTTAATTGTAGGTTGGGTTGGTGTGAAACTAGCAGTTTATAC
3   E17   AX00000792   TTCCTCTATTGATGAGTGCTTTCGAAGTATTTTCAGCATTTGGGACCGTTGGTCT
3   E19   AX00000793   CTCGTTTCGAGTTTTATTTCTACCATCCTTGGAACGAAACTCCCAGGTAAAAATA
3   E21   AX00000794   CAATTCACTGCTCAGTTCAATAATCAATATACAGATTACGTGAAGCAATTAACTG
3   E23   AX00000795   CTTATTCAAATGCTAATGGATATCGGCTTCTCTTCTGTTGACCAAGGTAATGTGT
3   G01   AX00000796   AGCGCTCAATGAAACAATTAAAACAGAAGAATATTCTGCTTGGATGGGCAGCGT
3   G03   AX00000797   AAGAAGGTAGAATTATTAGCATTTCTTCTATTATTGGTCAAGCGGGTGGATTTGG
3   G05   AX00000798   ACTCGTTAAGGGTGAACTCGTTATTCGCGGACAAAAGGTAGACCTTGCAAATAT
3   G07   AX00000799   CGTTAGAAAATGATATGATATGTGATGTGCTTGTAGTCGGAAGTGGCGAAGCAG
3   G09   AX00000800   ACTTTATTTTCCAACTTGGCAAGAAGCTTATTTTCACGGTTTCTTTGCGGCTGTT
3   G11   AX00000801   TCCGCTTCACAATTGGAGTGATGAAGTAGATCCTGCCATTATGGCTGGCGATGA
3   G13   AX00000802   TGATAATATGGCAACTTATACGCATTCAGGCTCAAAACCAGCGAAATTAGCAGG
3   G15   AX00000803   GCTTGTTTCGCAGTCGATGGGCATTCCGTTTTATAAAACATTCTTTAGAGTAACA
3   G17   AX00000804   CAGAAGAAGCCCGTAAGCCAATGGGATTATTAAAAATTGATCATGTAAGGGCAC
3   G19   AX00000805   TATACGATCAGTGGGAAACGATGGAAAATCAAAATGGGAAATGGCGTTTTACGT
3   G21   AX00000806   TAGAAAATAAAGGCGTCAAACTAATAGAGACGAGAGGAACTTGGCCAAAGCAAA
3   G23   AX00000807   TGCGAATGCGAAGATAAAAGATCCGTCGTTCTTTGCGAACTTAAAGCAATTAAAT
3   I01   AX00000808   GAAGATTCGTTTGGTATGCGGACAGGTGGTTATATATTAACAATTGCAACACAAG
3   I03   AX00000809   AATTATTCAATCTGAGGCGAATCTACATAACATTGTATTCCATTTACATTTGCCAG
3   I05   AX00000810   AAGTAACGGGTTAAATCCAACTGAGTTTGCTGTATTAGAACTGCTATATCATAAA
3   I07   AX00000811   CACAAATTTGCGCACTGCAATTTTGGAAACGTGCAAGAGATAATAGACAAGAGG
3   I09   AX00000812   ATGTAAAACCACGCCGTGATAAATGGAGTATTATTCAAATTTTGCATCACTTGCA
3   I11   AX00000813   ACTTGCTATTATCTACAGTCTCATATACGGATTTAGTTGGATACCTTTCTTCCTTT
3   I13   AX00000814   CACGTCATATTGTAACGGGTGTATGTGAAACTGATTTTAGTGGTTATCCAGATTG
3   I15   AX00000815   AATAAAAGAGTAATGGTCAGCAAGGAATTTACATTTGATGCAGCGCACCATTTAC
3   I17   AX00000816   GGACAAAAGACGATGTTTATCCGTACAGCTGGCTGTGATTATAGCTGTGCTTGG
3   I19   AX00000817   GTTACATTGAGGTATGGGGGAAATTCACACCACGTGGAGGGATTTCAATTGATC
3   I21   AX00000818   GCAAAATTGATTGTAACGAGTGATCAAAGGTGTGCTGTACAGTCAGCAGCTGAA
3   I23   AX00000819   GGCAGTTGGAGTTATTGTCGCTTATCACGGTAGTGAAGCAACAATGCTTGATGC
3   K01   AX00000820   TAACTGTACAAGTTCAACATACGTATCAGTACATAGAAGGAATGATTGTATACTT
3   K03   AX00000821   AAAGGCGTATCTGCAAGCGGCAATCGTAACTGGGGAGACATGTTCGGTGCAAG
3   K05   AX00000822   AAATAACCAACATCCATTGAAGGACATTGGAACTGTGAAGATGTCCAACTTGTGT
3   K07   AX00000823   TTACTTATTCTATAGTGGATTCTTCTATCCACTTTACTTAGCTGGTCAAGGAAAAC
3   K09   AX00000824   AATACGATTCAGCGTACATTTCAAGAGCTAGAACGAGATGGAGTGGTTGTAACG
3   K11   AX00000825   TGTTGGAGATAACGGGAGCGGGAAAACGACGTTATTGAAAATGATTGCAGGCTT
3   K13   AX00000826   GGTCTTATTTCAATGACAGAGGGCGATATTACAATTTGTGGCCATAGTATCCGC
3   K15   AX00000827   CTTCTTACAAGGAGCAATTAATATGGTATTAATGATGTTTGCAAAAGGCGTAGCG
3   K17   AX00000828   TATTTAACAGTTTTTTTGACAAGCCAGGACGTTTAACGTGGGGATTAATTGTGTT
3   K19   AX00000829   CAACACGTATGCAACAGTTTATTCAGTCCTATCCATCTGCAAGTTTTTGTTACCG
3   K21   AX00000830   GAAGAACATTAGCGTACGGGAATGAATGTCCATACTGTATGGCAAAGGGAAGAC
3   K23   AX00000831   AAATGTAATGCAGTAGTGATTGTAGGATTAACGACAAATCACTGTGTGGAGACT
3   M01   AX00000832   GGCGACAGAAGGGATACTTCGTTTGCGTCATTTCCAAGGAGATGGTAGATGGA
3   M03   AX00000833   CACAACTGTAACTCGGGCGTTTTCCGGGAAATATGCACGCGGTATTCGTAATGA
3   M05   AX00000834   CGCTTGAAGGTATCGCCTACGATGATACGAAGTATAAAGTAAAAGCACTTGCTG
3   M07   AX00000835   TATTTGAAGAAGGTATTCTTGATTCTTTCGCTGTAGTATCTTTATTAGTTGAATTC
3   M09   AX00000836   CTGGGAATTCGTTTTATTCTTCCCTGCGATTTCAAGTGGACCTATCGATCGTTAT
3   M11   AX00000837   ATGGGCTGTAGAAGACTTCAACTTACAAACAGGGCAAGTATTCTTAAACCAAGC
3   M13   AX00000838   GGCGTGATGGACGGTGTTGATTATGTAATAGGTTTACATGTTATGTCAGGACTT
3   M15   AX00000839   TATTGATTTAACTGGAAAAAAAGCGGCAGTATTCGGATCATGTGATTCAGCTTAT
3   M17   AX00000840   TTGGTGAGTGGAGTACTGAGTCGTTTGTAATTAAAAAGTATGTTGTCGATGCGG
3   M19   AX00000841   GTTTCCCGCGAAAACAGGAATATGCAATGCGAATTCCGTTAGAAAAAGAACTGT
3   M21   AX00000842   ACAAGTATATGGATTCCAGTTAGTACGGGATTAACAGGAATTTTGATGGCTACG
3   M23   AX00000843   AGCGCTTTGGCCAGGCTTTTCTCGTTCTGGTTCTACAATAAGTGGTGGTTTATT
3   O01   AX00000844   ATGGCTGGCGTGTTATCGTATTAACAGCTGATTGGTGTGGCGATGCTCTTTTAT
3   O03   AX00000845   TTGAATCGTACGAATAAAGAAATGGTATCACGTGTAGCGAATGAGTTAAATGTGT
3   O05   AX00000846   GCTGGTCTTGGAGATCCGAAGCAACTTGGAAGAATCGGTTTAAAATCAATTTCA
3   O07   AX00000847   CCATTCGCAACGAAGGTACATATTAGTTGGGTAGATGCTTTCTTTACGGCAACG
3   O09   AX00000848   TTTGGTCTTGTTTCTGTACTACTGGGTATTTACGCTTATAATCGCGGAGCTACTG
3   O11   AX00000849   TATTGTTGTTGAGACGATCCGACAAAATAAATTATCTAATGGATACATTCGCCTA
3   O13   AX00000850   TGAAAGTATTTCAGTAGGTCATACGGAATCATCGGACATATCGCGGATGACGAT
3   O15   AX00000851   TATGTATGAAGGTGGACTTGAAAATATGAGATATTCAGTTTCAGATACAGCGCAG
3   O17   AX00000852   ATCCAAAGAATTTTAGGATTGGAATGTGAATTGGCGGATTATCGCATACAATCTA
3   O19   AX00000853   GAAAAGGGACCTTCCTTATATGAGCCTATTCACGGATCGGCACCGGATATTGCC
3   O21   AX00000854   TTGGAATATTACCGATCGCATTGCGAAGCAGCAACTAGATACGCTTCGGGAAAA
3   O23   AX00000855   ATTTAAAGAGAATTGAAAGAACTGGGTTTGGAAAGTTTTTATTTGATGAGTGGCG
3   A02   EMPTY        -
3   A04   AX00000856   CTTGGATTGGCAGATGCGATTGTTGATATTGTTGAAACAGGAAAAACATTACAAG
3   A06   AX00000857   CTGCTTTAGCATACGGGACGGAATCGATTCCAAAAGTAGATAAAATAGTTGGAC
3   A08   AX00000858   GTTGGAATTGATGCGAAAAATGGTTTCGTAGCAACGAGAGGTTGGCTTGATGTG
3   A10   AX00000859   GGCGAAATTTTGTTAACGAGTATGGATGCAGATGGAACGAAAAACGGATATGAC
3   A12   AX00000860   ATGATTTTACAAAGGCAATTGAAGAGGCGAAAGAACGATGGAGTAAAAGAGGTG
3   A14   AX00000861   GATGAAGAAAACAGCGTATATTGTAAATGCTTCACGTGGACCAATTATGCACGA
3   A16   AX00000862   CGTGTTGCTCGTTTATTACGTGTTGATTCACAAATGGGAAAAGAGCTTGACTCG
3   A18   AX00000863   TGGAATCGGGATGTAATGTATCCTGCACTTGGATATGATCGTTACTTTAATTTAA
3   A20   AX00000864   ATGCAGTAGTGTTATACTTTTTGCTTCACCGAGTGTGTCGGTAGCTCAATATGAG
3   A22   AX00000865   ATACGCTACACAGAGTCAGATACACCATTAACTCTTGAGACATACGTGCGAGCT
3   A24   AX00000866   ATTCAAAAAGTGCGGGAACGATTTCCTTCATTGAATATTATAGAAAAACAGCCAA
3   C02   AX00000867   TGAAGCAATGGCTTCGACAAAAACATGCCCGCACGGAAAAGAAGATCATGTTAT
3   C04   AX00000868   TGGGCATCATAGTTTTGTAATTTGGTTTACTGGTTTATCAGCTTCGGGTAAATCT
3   C06   AX00000869   GATATTCCGTGATTTTGGATATCGCGAAAAACGTCATTTAGCTCGTTTGAAATTT
3   C08   AX00000870   TAGCGAAAGGTGTAGAGACTTTAGCAGTATATATGGGGGTTAGCAATTTACCCT
3   C10   AX00000871   GGCATTGAACAGGAAAATAAGAATGAAGTGACGTTACTTCTCGTTGCAAGAGGG
3   C12   AX00000872   CGTTGGTATCAAAGAGAATATGAAAAAAGTGATATTAATGGTGCTTTTTTAGTTG
3   C14   AX00000873   AAAGTATTGGTGCCAAATAGCAAGTTATATCCTTGGATTGGTCGTATGGGAGTT
3   C16   AX00000874   TCATTCGTTGTATTATTAGCGACACTTGGTACAGTAGGTATTCCAGCTGAAGGC
3   C18   AX00000875   ACATTAGTGCAATATTATATCGATGTGGCGAAAGAATATGAAATAGACGACCGTG
3   C20   AX00000876   GTATTAGATCTTTTCTCATGCTGTGTGCAAGGATTAATTCCGTATGGTGCACAAA
3   C22   AX00000877   GTTGTGTACTGGAGCTATAAATCATTTGTGCGAGCACAATCATTTTTTGGAAAGT
3   C24   AX00000878   ATTAATGGCACGTGAAAATATGGCACATGCAAATCGTCGTATGAATACTGCGAT
3   E02   AX00000879   TTATTGTCGGACGTGTGCTCTTGCCAGGTCATGAGGAGACAGGGTTTAACCGTA
3   E04   AX00000880   GCGTATACAAGGGTTAAATACGTTTCTATTTGAAGTGGAGCGAGGGAATTTTCC
3   E06   AX00000881   TTATTCAAGAATGGCCAGAAGCAAAAATTGTAGTTGTAACGAGCTTTTTAGATGA
3   E08   AX00000882   AGGGGATTATGTGAACGCATTACAAGCGCTTTGTGAACAATATAATGTTGAAACA
3   E10   AX00000883   TCGCTTATGAAATGGGCGTAAGTTCTTTCTTACCAGAAACAATCCGTTCTAGCAG
3   E12   AX00000884   AAACAAGCAGAAGTTTTACTCTTTCAAAAAGGTAGTTTGTTGACAAATCAGTCTA
3   E14   AX00000885   TTCTGTAGAAGCATTATTGCAAGATTTATCCCCCCGAACAGGTCGATCCATTCTA
3   E16   AX00000886   TCGATAAAGCTGAGAAACAAGAAATAACAGGTAGCTTCGGTGAACCTGAATATG
3   E18   AX00000887   ACCGTTAGTTACGTATTATTATTAGATTTGTTGCCCAATCATATATTTATTGCCCT
3   E20   AX00000888   AATAATTTCTTAAATTATGGTAAAGCAGAGAATTATACAGAAGGGGACTGGAACC
3   E22   AX00000889   ACTGAAGCAGAGTTTTATTTCTGTGGTCCAGTACCATTTATGAAACATATAAATG
3   E24   AX00000890   ACAACCGTCTCTCCGAAAGAACGTCTTCATCGCTTACAAGAATGGTTCACACTAT
3   G02   AX00000891   AGGTGGAGTCGTGTTATCCGTTGAAGTAGACGGCCAAATTATTTATACGATGGC
3   G04   AX00000892   TGCTGTAGCAACTTCGATGTTTATCGTATTTCTATCAGCAATTGTAAGTTCTGCA
3   G06   AX00000893   GGAATCATTACGATGGCTCTTATGGCTAATAACTATCATACTTCGAGCGACATCC
3   G08   AX00000894   ACAAAGCGTTTATTACTCCTATTGAACGTGAGGACATCCTACAGCTTGCAATGAG
3   G10   AX00000895   TCAAATTGTAAATGGCCCGAGCACCGGTGCAAAGGATTCATGGTTTGTTGGATA
3   G12   AX00000896   TTTCTATCCACAATGAAAATAACGGTAATTATGAAGAAGAATTACCTTACGAACC
3   G14   AX00000897   TATCCAGAAATGAGAGATAAGACGTTACAGTTTCTAGAGCAGGAGAAATGGATT
3   G16   AX00000898   AGCTTATGAAAAGAAAACAGGTGCTTCTATTTCTGAGAGCACTCTTGTTCAAACA
3   G18   AX00000899   ACAATCTTCGAAACGTGATGGCTTATTATTCGTATTAGCTGTAAATTCTGGCTTA
3   G20   AX00000900   TGTTAACGAGTTAATCCAAAGCTACGGAGTTAAAAATTTAATTCGCGTTGGAACT
3   G22   AX00000901   CCAATCGATAGTGTACTTACAAAAAAAATAGGGGAGTATGAAGTTTCTCTTTTAT
3   G24   AX00000902   CTTCCTCCTACCGTACTGTGTTACAGGAGTTTTTAGCTGAGGCTGATCGATTTG
3   I02   AX00000903   GAAGAAGGGCATGATGCATGTTTTGTTTTGTTAAATAGCCAGCCATTTCGAAAG
3   I04   AX00000904   TCGTTTGGGTGCCACGATCTGGAAGGTTAGAAATTTTGCAGAGTACACTTCATC
3   I06   AX00000905   TAAAGCCTGGGCAAAAAGTGAAGCTAGAGGATTTAGTATACGGACTTATGCTTA
3   I08   AX00000906   TTATGCCGATAGTAAAAAGGTTGTTTCCAGAAATACCGAAGGATCATCCGTCAAT
3   I10   AX00000907   TCCGACGTATGAATCGTTCGTTGAAGGAGGAAAAGAAGGGATTCAAATTGCAAT
3   I12   AX00000908   TTTGGGGTACGTGGTGTAAACCTTGTGAGAAAGAAATGCCTTATATGAATGAAC
3   I14   AX00000909   GATATGCGCTATGAGGGGAGTGCTCGGAGATCTCTCACGCAAACAAAAACGATA
3   I16   AX00000910   ATATCACCGCTTATTCCATCTTTAAAAAGTAATTGGTTACATATTCACGTGACGA
3   I18   AX00000911   TTACGCCGTTCTGTACCAACAACATTCTTTACACAAGATACAACGACAAAAGATG
3   I20   AX00000912   TTGCGAACGTATCACATGAACTTCGTACACCGATGGTCATGCTTCAAGGGTATA
3   I22   AX00000913   AGAAGAAGCCCCGCCACTAGAACGCTTTATTTTGCCAGGTGGTAGCGAGGCGG
3   I24   AX00000914   CATCTAGAACTTCATCAAGGAAGATGGACGATGGCGAAAAAGAATGCGATGAAC
3   K02   AX00000915   GAAATCTATGTGCTATCAGTTTCCGGGGCTTATGCGAGAAGGAACCGTGCTTGT
3   K04   AX00000916   AGTCTTGGTTTGATGATGGTGGTATTAACGATAAGATGTTTCGAGGAATGTCCG
3   K06   AX00000917   TCATTCTGCTGCCGATTAGTATTTTGTGGTACACGGATAAATATATTCAGGTGAA
3   K08   AX00000918   GATATCAAATGATTGCCCCAAAGCGGAATCATGCGGGGCATCGATTATATACAG
3   K10   AX00000919   ACGAAAGAACATCAAGAAGCGGATACAGATGATGAGTTCCGTGACGAGTTTATT
3   K12   AX00000920   AATTTATGCATGATGCAGGTGCGAAAGTTATTGCAATCTCAGATGCTTACGGCG
3   K14   AX00000921   TAAGCGCGGCACATTATTACAATCAGTAAATAAATTTTTCGGTTTAGATACGAAA
3   K16   AX00000922   CTATAAATGAAGTTGCTTATCATGTTCGATATGGTGTGCCGACAGATAATGACTT
3   K18   AX00000923   TCGTAAGCCTGTTCGAAATCAAGCGCTTGCGTATTATCGTGAAGTAGTAAAGCG
3   K20   AX00000924   GTATTAAACGACGAAATTCATTGCGCTACAAACGTAACGAAAACACATACAAGCA
3   K22   AX00000925   CATCGCCTTGTTCGTGAAGAGATGGTACGCCGTCAACAAGAGTTAGCGGAAAAA
3   K24   AX00000926   GGTATTATCTGTTGATGCTGACACACAACGTATTTCTTTATCAATTAAAGCAGCT
3   M02   AX00000927   TTTCACTAAGTTCGCCGATTTTTATCAATGCGATGACTGGTGGTGGAGGAGAGA
3   M04   AX00000928   CGTTTGCAACGACATTTGCGTATATAGGATTTCGTTCATGGATTGCCGGAGTAA
3   M06   AX00000929   AAAGTGGACAATCCGGAAATGCGCAGTGACATTTATGATTTCTATGCATTAGGA
3   M08   AX00000930   CTTGTACAAGTGTTCATAGCCGAAATTGGCGCGCTGGAAATATGCTTGGAAAAG
3   M10   AX00000931   AATTGATTCATCAAGTGGCTCTTATGGCAGGACGTGAAGTGCCGAAAGAACAAG
3   M12   AX00000932   GTATTAATAGACGTTGAAACAAACCCGACAGTAAAGCTAATTGATGTTAGGATGG
3   M14   AX00000933   TATGGCAGTTTAGTCAGTATGAATTTATTGATCGAGCGAGCTTAGCTGGCATTG
3   M16   AX00000934   AAAAAGGACGCAACAAAAGCAGTAGACGCTGTTTTTGATTCTATCTTAGAAGCTT
3   M18   AX00000935   TAAAAGATATACCGTTTTATTCGATGTGTGAGCATCATTTAGTTCCATTCTATGG
3   M20   AX00000936   ACTTATTGTCTATGAATCGTGATATTGTTTTAATTCGTGCGCTTGCTGAAGGAAT
3   M22   AX00000937   TAAATACGATGTGATGAATTCTGTAATTAGTTTTCAAAGACATAAAGCGTGGCGC
3   M24   AX00000938   AACTTATTGAAGCTGGTGGGAAGCGAATTCGTCCTGTATTTGTGTTGCTTGCGG
3   O02   AX00000939   AGCTCGTAACATGATGGGTAAAACAAGACCACATGAAGCAGCTCCTGGAACAAT
3   O04   AX00000940   AATTGTTGTGCGCGGAGTGATGAAACCGATACCTACACTATATAAACCTCTTCAA
3   O06   AX00000941   CGGAAGCAGTTGTATATCATACGCCATTTTTACAGTCTCTTCCTGAAAAAGAGTG
3   O08   AX00000942   TTGAAGGAGCAGAAGTTCGTGAAGTATCACTTAAAGATGGCATTCACGATTTAG
3   O10   AX00000943   CGAAAGAAATGATGCCTGACGAACCTGTCATTACGTTTGGATTAGCAGAGTTAT
3   O12   AX00000944   GCAAAATATTGTCCGCGTGGCTTAGTAATGTCCGCGAATTGTGTAAAAGACACA
3   O14   AX00000945   TTGCTTATGTTACAAGTGATTTTTCATGGAAAGAAGATATGCAAGAATTACAGGG
3   O16   AX00000946   GATGTACAGTGAACTGGAATTCGGACAAATCACATCCGAATCAATTCTTTTGTCC
3   O18   AX00000947   TACCTGAGCATGTAAACCCGGCACATCACTTCTCTGCATTCGTTTATTGTTTTGG
3   O20   AX00000948   TTGTTTAACATGTCATGGTGACAATTTACAGGGCGGGGCAGCAGCACCGGCAC
3   O22   AX00000949   AGAAACTTCTCCTATATTTTGGCCGTTTGTACCAGATAGCCCTATGGCGAGTCTC
3   O24   AX00000950   TGGGTTTTTGATCCTGAGAAGGATCCGATTATATTAATGCTACCAGAAGAATTCT
3   B02   EMPTY        -
3   B04   AX00000951   CATTTCTCGGAGCAGTTTGTAATAAAGGGGAATGAAAAGAAGCAGGAAGTAACG
3   B06   AX00000952   ACGTAGTGCCTATAGCAAGTATTCACAAGTTTATTCAACATCGGGTATGACAGG
3   B08   AX00000953   CGTTTAGCGGGAGGGCGGGAAAACAATTAATGGGGTTTTTAGAACGTATTCACG
3   B10   AX00000954   GATGGAGCGCGGAGCAACCTTTTTAAAAGCTGTTGGATCATATACAAAAGTGGA
3   B12   AX00000955   GCATATATTGGTCAGTTTAAAGAAGGTTATTTCAGTCCACTTGCAATGATGGCTC
3   B14   AX00000956   AATTATCGCTCCAAACTTTGCAATTGGTGCAGTTCTGATGATGAAATTCTCACAA
3   B16   AX00000957   GTAATTTTCTTCCGCGATCCATTAACAGCACAACCGCATGAACCGGATGTGAAT
3   B18   AX00000958   GGAGGCATTAGAAGCGTATGAAAGTCAGTTTTCAACAGGGAGTGATGGTGTGAA
3   B20   AX00000959   ACCCTTCGCTAAATAATTTAATTCGTTTTGGTATTGAGCAATCTGATGTTGTGAC
3   B22   AX00000960   CATGAGGCTTACTTTGTCGGTGGAAGCGTAAGAGACCTTATTATCGATAGGCCG
3   B24   AX00000961   TAAAATTCTTTGGGAAAGTTACGCTGTAAGCATCGGGAAAGAAATTAACGCTCG
3   D02   AX00000962   ATCATGATCTTATCTCATATGGGGTAAATCGTGTTCCGAAATTTGTGAAGCAATA
3   D04   AX00000963   TTTATCCGAGTGTAGAAGAAATGTATCCAGCAGAACAAACGACAACGGTAGAAG
3   D06   AX00000964   ATAATAATGGTGCTCGCTTAGAGACATATGTTATTAAAGGCGAACGAGGTAGCG
3   D08   AX00000965   TCATATACAGTCGTGCAAGGTACCGATGAAAATGGAGAACAACTTATCGTTTGG
3   D10   AX00000966   GCAGCTTATTAAAGCGATGACGAACTTAGCGAGTCATAGTACGTCAAACCCTAC
3   D12   AX00000967   TATCACTAGAAGGTGGACAAAAATCAGAAGCGATGATGTGTGAAAGTTATTCTTT
3   D14   AX00000968   GTTACACTAAACTGGTCTGGACCAACAGAAGTTGATGCGTATGCAGCAAGCTAT
3   D16   AX00000969   AGATTACCCCGCTCGAAGTGCTGCAGTGGTAAAAGAGGCGTATTTTAAACAACC
3   D18   AX00000970   GAAATAGTGAAATTAGGTGGGCTTTTTTAGCGAGTATGGTCTCGAGAAATGCGG
3   D20   AX00000971   ATACGATTTTTATAAGGATATGAAACCGTTTGTAGATATGGTAGATGAGGAATTA
3   D22   AX00000972   ACTATATGCCACCACCATCTCCCTATGGCAATCAACAAGCGATGTTTTATCCACC
3   D24   AX00000973   AACAATGCGTAACACATTCTTTTTCAACAACGGTGGTGCCACACATTTTCCCGAC
3   F02   AX00000974   GAATATTACGAATTTATTCTCTCTCAAGCAGACCATGTTGATAGTATCACAAAAC
3   F04   AX00000975   TTGATATGATCATTAAAGATTATGAAGCTTTTCACAAGGAATTTGAGCAATTAAAG
3   F06   AX00000976   TTGAAGCAGATGAAAAGGCGATTTGTCGCACGAATTTATGGTTACGTACTGCGG
3   F08   AX00000977   TGGATCATATTTGGACGTACGATGCTCGTAAGCGTGAAGGGCAAATTCCGTTAT
3   F10   AX00000978   ATGCTTTCATCAGAAGTATTTGCCATGTCGACTTCAGATGAGATGGGGAACTAT
3   F12   AX00000979   TTTAGCCGAATTTTTACATGATGAGAGTAGAGGGGATCATACATTTTCTGTGAAG
3   F14   AX00000980   CAACGTCCGAGCAGAAAGGTTACAACGGATATCCTTATGCGGTATGTGCATCTG
3   F16   AX00000981   TTAGCAAACGGTCAGGCTGCTTTAGGTTTAATGAGCCTAGTAGAGCAAGCTGGA
3   F18   AX00000982   GTACTTGGCGGTGCGATGTTAGCGATGTTCGGTATGGTAATGGCATATGGTATT
3   F20   AX00000983   CTACACGTTACAAATCTTTATTAGCCGCTGGTGGCTGTCACGTTATCAATACGG
3   F22   AX00000984   TGAATCATCTATATAAAGCGCAGTTGTTACCGACAAGTCCAATTCCGACAAGCG
3   F24   AX00000985   ACATATGAATTTTCTTCATTCGTCTTATGCGGTGAAACACCAGACGGCAGACGA
3   H02   AX00000986   TAGAAACTGCTAAAGAACATGGTATGTCAAAACTTGAAGTTGGTACAGGTAATTC
3   H04   AX00000987   ATGTTTACAATTAGATGCGCAGCGTGAAGCAGCTATTGAAGCTGCCGTATCACT
3   H06   AX00000988   CCAAAATCTTTCGAAAGATAAGGAAACAATTGTATATTGCGGTTCTGGTGTTACA
3   H08   AX00000989   GGATTGGGATGATGAACTTGGGGTATGGCAGTGTGATGAGAGTAGCTCAAGTT
3   H10   AX00000990   TAATCAATCCATTGTCAGCATTTTTACTTCAGCCCAAATCAGTTCAGTGTCTTATT
3   H12   AX00000991   AGGAAATAAGGCGGTAAGCTATGTACTTGGAGGGCGATTACTTGGTTTAGCTAT
3   H14   AX00000992   CCGTGGCAAATCGTGCATGCGAAAGCTTTCATGGGAGATACGAGCGATAATTAT
3   H16   AX00000993   TTCGTTTATACTTGCGATGCTTTCGTATATATTTGTAGAAAAATTTGCATTCAGAG
3   H18   AX00000994   ATTCCTATCTCTGTAATTGTTAGTTTTTTTGTTGGGATAGGTTTAGCAGTATTTCG
3   H20   AX00000995   TTAACTATACATTGCCACTAAGTATGGTCGGTGTTTTTGCAGTGGCGTACCGGA
3   H22   AX00000996   TGGAAGTGGCAGATTTACATTATGGGAAGCTGCTTTTAAATATTATTTAACTAAT
3   H24   AX00000997   ACAGCCGGAAGATACGGCGTTATGGCTGAAATTATTACATGAAGGGCATGAAGC
3   J02   AX00000998   TAGCAATTCAGCAAGCTATAAATTATTGTGTAGCGAATCGAATTTCGACGGTTAG
3   J04   AX00000999   GAACGCTCTCCACTAGCGAATCCGAATATCGGTTTCCTAGTCGCTACTAATTTG
3   J06   AX00001000   TTTGGAACAAATAGAAAAGAGTTTTTAAAGAAAAGAATTATGCAAAGTGAACAGT
3   J08   AX00001001   AGCCGTGCAGAAAGCAATAGATGCCAATGCCCTTATTGTTTTCGTAAGAGATAT
3   J10   AX00001002   TTATTTGGGGAGCTACGTTTGTCGTCGTTCAAAATGCTATGTCTTTCGTTGGCC
3   J12   AX00001003   AAAAGAAGACAATACAGAATACTTATGGCAAGGTGATTCTACTTATTGGGGACG
3   J14   AX00001004   AAAAGCGAAGCAAATGAAATTAAAACTTGTATGTGAGCCAATCTCTAGAAAACAA
3   J16   AX00001005   CAATTTCAATGGATCCAGATACATTAGAACACGCTACTACTGCTGTAGAAGCAGC
3   J18   AX00001006   GGTATATACGGTAGTACACTTAGCTCATTGCTTACGAAGGTAACGAAACAAGAA
3   J20   AX00001007   GAAAAGAAATTACTGATAGAAATCCACTATATGAAGCGGTATTTCAGAATGCAGC
3   J22   AX00001008   GTCCTGTTACTAAGTTTGGAAGATGGCTAAAAAAACAGCACATATTACACCATTA
3   J24   AX00001009   CAAATGTTTGGAACCCTGTAGCTGGAAAAGCTATATTTGTTGGGGAAGCGATAT
3   L02   AX00001010   CACATCGTTATAAATTTATGTCACGTTACCGCGGGTATCATGGGAATACAATGGC
3   L04   AX00001011   GAAGTGACGGCGTACAAAAGAATAAATGAACCAGTTTGGGATGCTTATATTCCG
3   L06   AX00001012   CTATTATTTTAATCGGATGGAAAGGTGTTCCTGCGATTATGCGCTGGTTATCACC
3   L08   AX00001013   AAGCAAGTGAGGTAAATCGTTTAGATCCAAAGCAGGTAGCAATCCTTTGTACAG
3   L10   AX00001014   TTCGTTGCAAAAAAATATGAGGCAAATGGATGATAGCTTATTTTCTGGAGATATC
3   L12   AX00001015   GCAGGAGTAAACGTGGCTATTCCAGCGTTTTCAATTTTCTTCTCTATTTCATTAT
3   L14   AX00001016   TATCTTTTTATCTTATTTAGCTTTTCAGGCCATACCAGTCTCTGGTGCTTTGCAAG
3   L16   AX00001017   TGTATTAGGCTCGAAAGTAAACGGAACGAAACCATCGTACTCATTGCAATATCG
3   L18   AX00001018   GTTTAGGATTCAATCAATCTGACGGTGCTGGAATTGGAATGATGATCACATATG
3   L20   AX00001019   CCGAGAGAAGTGAGCGAATTGCTTCATTTACCGGATAAAGTATATCCTGTATTCG
3   L22   AX00001020   AGTACAGGTTTTGGCTTTTCTATTATGGCAACACCTTTCTTACTCATGTTATTTCT
3   L24   AX00001021   TCTATGCCGAAAAAATTTTCCACACGAACATTGGAATTTTATATACGGTTCAAGG
3   N02   AX00001022   GAAAACAAAAAGAAAGAGCTAATTCAACTTGTTGCTAGACATGGATTGGATCATG
3   N04   AX00001023   TGGCTTTCTAACGGACGTCAAGAAAGCGTTGCTGAACATACGTGGCGCATGTCT
3   N06   AX00001024   AAGATGTTGAAACGGAAGTGTATGAGTTAAGAAAAGGAGCGGCGTTATTAGATA
3   N08   AX00001025   ATATGTAGATAATAACGGTATTAGTCAAGTGAATGTATATCGAGAGGATACGGG
3   N10   AX00001026   TGTTATTTGTTCTGCAATGGGACAACAAGGTATGGTATTAGATGCAATTAAGGGT
3   N12   AX00001027   AGAACTGAGCGGTATTAAAGAAATCATGAACCAAATGATGGGGCATGCTGCAAC
3   N14   AX00001028   TTGCAAGGTGATTGGAATCTTCAGCTCGTTCAAAGTTACAAAGAAAATGAGAAAG
3   N16   AX00001029   CGCATATAAAAGAACTTCTTTTGTTAGATGGAACGTATGATTTCGCAGAAGTACA
3   N18   AX00001030   AAGTATGGAGTGCCGCTTGCGCTGCCGGTGAAGAACCATATACACTCTCTTTAA
3   N20   AX00001031   TTAAAAAAACACGGAGCCGAGTATGTCGCTTTTGATCATCCTTCCGACTCCATTT
3   N22   AX00001032   ATGTCAGGACAGGACTTGCATTTTCGGATAATTTGCATGCAGATCCAAAAAAAG
3   N24   AX00001033   GCAATTGCAGTACATTGATGGTTTAAAAAAGTTATCAAGTTCATTTGAAGAAATG
3   P02   AX00001034   GTTGCAGCAGAAGTAAGTCCATTCATTATTAAGGCGGCACAGCATATTCGAGAT
3   P04   AX00001035   GCGAATACACCCGGCTATAAAGCACAAGATGTAACATTTGCTGAGCAAATGAAT
3   P06   AX00001036   AATACAACGGCGGCTCCGGGGGCAGATTTATATGAGCGTCGTAGTGTAGTGCT
3   P08   AX00001037   TAACTAAAGGGGTAGGAGAAACGCATGACGTTTTAATTCAGCAGAAGAAGGCGG
3   P10   AX00001038   AAGAGATGATTCTAGAAGAATTAGATGGCTTAGGACCGCTTAAGATGACGGATG
3   P12   AX00001039   GTACATCCAGAAACATTTGAACGTATTCAAGAAGAGAAGGGAAATACGAAAGAA
3   P14   AX00001040   TAGCACGTGGTATTTTAGATGGACATATTGTATTAAAGCGTGAACTTGCAACGCT
3   P16   AX00001041   ATGGATAAAGATGATTTCCTGAAACTTTTCTTAGCAAGCTTTCAACATCAAGATC
3   P18   AX00001042   TACGAGAAAAGGGTCTTTCGGTGTATCGAAAGATAACTATGTTACAACTACAGG
3   P20   AX00001043   TGCTGAGCAAGTGTTAAAAATGGAACGAGAAGAGCATATATATTTACCGGATCA
3   P22   AX00001044   ATGCGAGCATATGAAAAATCAGCGATTACATGGCTGAAGTCTGAGCTAGAGTTA
3   P24   AX00001045   GTAGAATCTGATTTTAATCCGAAAACGGTGTCACATGCAGGTGCGAAGGGTCTT
3   B01   EMPTY        -
3   B03   AX00001046   ATATGAAAGTCGGCATCGGGGAAGCGATCGTAATGGACGAGAAGTTCGGTATT
3   B05   AX00001047   GTAAGCAAGTGTTCACTGTTATTAGTAATAACGGTGTTCAATCTGTGCAATTAAC
3   B07   AX00001048   ACACTGTTAATGTACCTCGGGATGATGATGGTACCGCCGATGATTTTAAGTTTAC
3   B09   AX00001049   CTGACGTTTTTACCGAAAATGGCGAGTATTGTACTCGTTATTATCATTTTAGGTC
3   B11   AX00001050   CTGACGACTAGTTTTTTAGATAGTCTACTCGCAACGTTATTATTTGCGATCACAT
3   B13   AX00001051   TTATATATACGAACGCTTGCCCGTGAACAAGAAATACCAATGGTGGAAAACCGT
3   B15   AX00001052   GTTCGGTCGATTACGCTGTAGTACCAGCCGCAACGCATGTGAACTTAGTACAAG
3   B17   AX00001053   TGCGTCATCACTCTTTACTGCATCTTATCGGAGCTGTCGTTTATGAAAAATATGG
3   B19   AX00001054   AAGTATTAATTGCGAACTTCTCAAATGATAGCACTTCGTGGGCTGTTACAACGTA
3   B21   AX00001055   ACTATCATTGGCGGGCTATTTGGTGAGTGGATACCAGATCCGCATACGTATGGG
3   B23   AX00001056   ACTCGTGCCACGTATTTTACCGCTACTCGTATTTAGTAAACTACAAATTCCAGAC
3   D01   AX00001057   TACACATATTGGACTTATCGGCTTTAGTGTTGGTGCTACCATCTCATGGCTATGT
3   D03   AX00001058   TGTTAGTTTTCAAGGCATGCCTGTTATGATTCAACACGTCGACGAAAGCAATGAA
3   D05   AX00001059   AAAATGGAAAAGCTACACCTTCGATGAAAACATTACAATATATTGCAGAAAAACT
3   D07   AX00001060   GTGGGTAAACTTTTTTGCTTGTGGGCTAACCGTTGCACTTCCGTACATTATTGTC
3   D09   AX00001061   TATGACACATATATTGAAACAGGTATGCAATCATTGAAAGATGAAAAATATAGTG
3   D11   AX00001062   TTATTCGAATTACGTTCGGGAAGGTATTTCTTAACAGAGGCTGGTGAGGCGTTG
3   D13   AX00001063   ACCGCTCAGTGCACTCGATGCAATTTTGCGAGAAGAAATGCGATTAGAGCTTAT
3   D15   AX00001064   GCAAAGGGTGAACCGGTTGATATTGTTTATCCAAAAAGCGGAACAGTTATTAGC
3   D17   AX00001065   AAGTCCTCTGAAAAATGGCTTGATATGTGCGGTATGTTACCGAATATGGTACCA
3   D19   AX00001066   GTTTGCTGCTAGTCCAATGACACCTAGTTTTGAAGTGAAGTTATTATTAAAGCCA
3   D21   AX00001067   GATTGGAGTTTTGCATACGAAGGCGGAGAATCCAATGATGTAGCACAAAGACGC
3   D23   AX00001068   AACAAATATTCAGTTAGACGGTTCCTCCTACAAAGAGTTACTTCAGGAGTTCCAG
3   F01   AX00001069   TACCTCTCCTTCATTATATAAAGCGACAGCTTCTGAACTATCGGAGTGGAAAAAC
3   F03   AX00001070   CTGGTTTAGACGCTCCTTGGGTAAAACGCGTTTCTGAACATGTAGGGACATCTC
3   F05   AX00001071   GGAAGATAGAGAAGAATTATTGAAGCTTATTAATCAATTAGAACCGTTAGATCAA
3   F07   AX00001072   AATGCAACAAAGCTTATCGTTACACCTCGTGTACACTTACGAGTTCATACACCTG
3   F09   AX00001073   GGACGGAACTGAAAAATATGAAATCATTATTATCTTCTTATACGTGGGCTTTTCC
3   F11   AX00001074   GCGAAAACATACGGGTATAAGCGAGTCGAAATGTTAGCGGCATTATGTAACGGT
3   F13   AX00001075   AAAACTTTGTTCCAGCAAGTCAATCTATTGATGAACATCACGCTATCATTCAAGC
3   F15   AX00001076   TGATTTCATTTCAATTACCCTTTCATTAGTAGGTACTTTCCTCTTACTAACAAACG
3   F17   AX00001077   TGATAGGTCTTCTATCTCAAGCAGGTTCCTCTATTACAATTCAAGGAGCCGGTG
3   F19   AX00001078   TCCAATGTGTGAATGTGTCATTATACCAATTGTAAGAAGGCTCATTCAAAAGGGG
3   F21   AX00001079   GAAGTGTAACAATTGATGGAAGTTTAGCAGGAAAAAGGGGTATGAATCAAAGTG
3   F23   AX00001080   TAAAAATCGACCGCCGCGTATTAGCGCGTAACTCAGAAGTAGGTGGAACATTAA
3   H01   AX00001081   GGAATGAACATTTTCCGCTTGTCGTGTGGCAAACAGGTAGTGGTACACAATCAA
3   H03   AX00001082   GAAAATGGTTCAGTTTTTCCATATGGGGCTGAATGATAAAGAGATTGTAAAAGAG
3   H05   AX00001083   GTGAACAAAAGGTTTTGTCCACATTATAATCAATTAAATAGAATGAACGCCTTCC
3   H07   AX00001084   GAAAATCGATGTGTTACAGCTTCATTTGCAAAAACAGCAATCAATTTACGAATCG
3   H09   AX00001085   TCGCTCGATTTTAGTCGGTATGACATATGCAGCGGGTTGGACTCCATGTGTTGG
3   H11   AX00001086   ATTCTGGCTCTTTGTATAGTGGGCTTGTTATGGATGAAAAATGAAAGGCTTGGA
3   H13   AX00001087   AGCAACAGCAATTATGACCATCCCGCCGAATACAGCTTCATCAGAAAATGTACTA
3   H15   AX00001088   TAACAGACGCAGACGGACTTGCGGTAGGAAGGCCATCTGGATTTGTTGGTAAA
3   H17   AX00001089   AGTTACAGCATTATTCCGTCATCCAATGGGAATTCCAATTCCGCATACAGCTTTG
3   H19   AX00001090   CGTTTTAGGAAGCGTTGGAATTGCTTTTTACTGTTTATTATCAACTGGATTGCTA
3   H21   AX00001091   GACAGATTCCTCTAAAGAGAGCGAACGATTTTATATCATTCTCCTATCAATCATC
3   H23   AX00001092   AACCTTCCAATGATAAATGATGATTCATTTACGAACGAAGTTATGACACAAATTAA
3   J01   AX00001093   AAAAATTACTCATCGCTCAAAAACTGAGAGAACTTCCCGAAAATTACCGTGACGT
3   J03   AX00001094   GATCCAGAGCGTATTCGTGATGCGATAAAAGGAGTATATAACGGTCAAACTGTT
3   J05   AX00001095   TTTAAGTTAGAAGAGAGAAATCGGTTGTCACAAGAAATTCATGATAAAATTGGCC
3   J07   AX00001096   TGTCGTTCCGCAAGATATTGCAATCTATGAAGAGTTAACTGCCTATGAAAATGTG
3   J09   AX00001097   TCTACCTCTTATAAAAGAAGCGGCGTATCCATACATACGTCAAGCTATTAATAAT
3   J11   AX00001098   CGTTATGACTTCCATCCCGTTTAATGCTGTAGCTGAACCATACATTCGCTTGCGT
3   J13   AX00001099   TTATTATTCGTTCTCATGTTAACATCCAAAGGTATGGCGGGAGTTCCAGGTGCA
3   J15   AX00001100   TCGGAAAATTAGCTGTTTATACGGCAGCAGTTGGAATCGATCCTAGCCGCGTAT
3   J17   AX00001101   TCCGCGTATGTCTTGACTGGGTCATGCAAGGTTCATTTCATATGACAGAATCATT
3   J19   AX00001102   TACTATCAGAACTCGGTATTGCGGGAGAGAACGGAAGTAAAGATTTACTTAGTA
3   J21   AX00001103   CGAAAGGCTTTGGTTCCGCGGTACCACCCAAATTAGCAACAGAGGTTGCTCACT
3   J23   AX00001104   AACTATTCCGCGTATCTGCACCATTATTCGTAACGAAAAAATCAGGATTAAACGA
3   L01   AX00001105   TGGTCGCGTAACCGGACTCGGTTCTCAGTGCGTAGAGATTGCTATGATGGTTAC
3   L03   AX00001106   AATGAAGGAACTGTTCATCTCTCCTTCTCCATCCATTCTAATGATTTAAGAGAAA
3   L05   AX00001107   CGATTACAATTGCTCAAATGGTTTGGATTCACGGTGTTGTTAATGGAATTGGAGT
3   L07   AX00001108   CTATTTTTGATCGCTCATGGTACGGCCGTGTGTTAGTGGAGCGTGTTGAAGGTT
3   L09   AX00001109   CATTGTCGCTACTACTACTGCTGATTACGTTTTCCCTAGTGTTGCTTGCCAAATA
3   L11   AX00001110   CCTTCAGTATATGATGCCTCGTTTAATTGGTCTTCGTGAGTCGTTAGGAAGACAG
3   L13   AX00001111   TATGTATTCGGATAAGAAGCCGTCACCATTTTTATTACCGCTCGGTATGTTTTCA
3   L15   AX00001112   TAAAACTAGAAATGTTTAATCCATCGCGCAGTGTGAAAGACCGTGCTGCCTATA
3   L17   AX00001113   GGCTAATCGAGTACCATCTAGTCAGTTTTTAAGTTTTGAAAAAGGCGAACTTATA
3   L19   AX00001114   GAAATGGAGCATACGAAGCTACGTTTGGTGAAATCATTTCCAATCCGTATTTAGC
3   L21   AX00001115   ACCGAGTAGAAACAAATGAAAAAGTGGTTGCTTTAACTTTTGATGATGGCCCTAC
3   L23   AX00001116   AAAACAAGAAACAAAACATTATAAATGGGGTACACGATCTGGAGGAAGAAAACA
3   N01   AX00001117   AACATAAGCCTGTATACTTACCAATTTCATTAATTAGTGATGGGAAAGTAGTGAA
3   N03   AX00001118   GGTCTGCAAGGAACGTTCCAAAGTTTAAATAAAAAGAGCATTTGTTCTTTATGTC
3   N05   AX00001119   ATCAATGTGATGTAAACGACTGGCATAATATTGTAGCGGTTGCAGCAAGGTGGC
3   N07   AX00001120   GCCACAAATCGATCCAACTGATGATGGCGGACAATTCTTTGACCGTGGTCCATC
3   N09   AX00001121   ATTAGAAGGCATTACGAGAAATAGTGTTATCGAGCTATGTGAGCGACTGAGTAT
3   N11   AX00001122   AGAAGCTTTTTACATCGCCGAAAGCGGGCGGCCAGGACCAGTATTAATTGATAT
3   N13   AX00001123   ATCTCCGCGAAGGACAAATGTTACTTTTCTCACATGGATTTAATATTCACTTCGG
3   N15   AX00001124   TCGGTATGCGCTATTCGCTTCCGAGTCGAGAAATTATTGCAGATTCAGTAGAAA
3   N17   AX00001125   GTGTTAGTCCTGCTACACAGGTCATTGGGGTAGAGCCAATGGGAGCTGCATCT
3   N19   AX00001126   AAAAAGCGACAAGAAAATAGAAGACCCGGAAATCACACTCACCTTCTCTGGTGA
3   N21   AX00001127   AGCTACTTTAATTTTTGCAATTGGCGCGATGGGGATACTTGGTGCACTCGACAG
3   N23   AX00001128   TGTTATGATGTAGTGAGAGGAAAGAAAGGATTGTTTGGTCCAATGGGCACGGCG
3   P01   AX00001129   GATTATTACCTTCCGTACAAACTCTACTAAAACAACATACACCAACTCATGTAAC
3   P03   AX00001130   TTCCAGTCCATCATAATATGACGAGAGGTTTAGATCATGGCTCATGGACACTCTT
3   P05   AX00001131   ACGGCTGGGTTCCGGTTCCTTTTTCAAAGGTCATGTATTTAGAGGCGAAAGATA
3   P07   AX00001132   TTACACGTGCAGGTGATGTGAAAGCAGTCCCATTTGCGCTTGTAAACCGAGTTA
3   P09   AX00001133   CATTCAAAAGCAACGTGGGATTATAGCGAAGAATTTATACTTGCTTGTAAGGAAG
3   P11   AX00001134   TGATATGTTATTACAACCATGGCTTGAGACGAGAATTTGGCCACTTGAAAGTCAA
3   P13   AX00001135   TCCAGGATCCTACTTTCAATCCTGACCACCCTCCAGCTGGCTACAATTTTGCGT
3   P15   AX00001136   CAAGGGTATTACGATGTACAAACGCTTAAAGCTGAAAAAGGAAATGTGGAAATC
3   P17   AX00001137   GGAGGCCGTATTATCATCCGTGATGGCATCATGACCGAAGATAAAAGGTTAATG
3   P19   AX00001138   AGTGTGGTGTTTGTGAGTTTCGATATGTTTGTGGGGGATCTCGTTCTAGAGCAT
3   P21   AX00001139   TTTTCTAATACTGACGTACTGCGCTATTATGGCCAAAAACCATTACAGGATATTG
3   P23   AX00001140   ATATATGAGAGCGTTTGGAAAGAAAGGGCCTATGAAAGCAATAATACAGTAATG
4   A01   EMPTY        -
4   A03   AX00001141   AGTAATGGCACCAGCTTCCGGGACGGTTGTATCAATTAATAATAATGAGCAAGA
4   A05   AX00001142   GACTATCTAGCTCTTCTGTCGGTACAATGTCAGGTGATATTATTATGCAAGGTTT
4   A07   AX00001143   AAACGAAGCGAAATATTTACGTGCATGTTCTCACGAATGTCGTGTAAGCCCACG
4   A09   AX00001144   AGTGGGCCAAATGTTAGGATTTACTATGATTGACCTGTTAAGAAACACCGATTCA
4   A11   AX00001145   GTTTCTTGTTCGTAGTAAACGGAAAAAACAATTGGAGGAAAGGGGACTTGTAAT
4   A13   AX00001146   AAATTGTAAATGCTGCCGATAGTCAAACGAGAGAAGCAGCTCTTCGCATTCAGC
4   A15   AX00001147   GATTCAGCACAAGGATACAGCTAGAGGAAATGCGAAGCAATGGTTAGATGTATT
4   A17   AX00001148   AATCAAAGTCATTTCTTCCAATTTCTTTTGTTAGGACTCACATTTACGACTTTGAC
4   A19   AX00001149   GGAACAGTGCGAGACGAAGCGCTATTATTCCGATTAGGTTATTTCGATAAGGAT
4   A21   AX00001150   AAAAGCATCTGGTGGTGTTCGTACACGTGAAGATGCAGAAAAAATGGTAGCTGC
4   A23   AX00001151   TGTCTATCGTTGGATCATACATGGTCTTATTAAAACCGCAATATGTTGTAACCGC
4   C01   AX00001152   TAAACAATCAAGGCGGAGATAGCTCAATTGTAGACAATCCAGAAAAAATGCCAC
4   C03   AX00001153   TATTACAGGAGAAACGGACGGACCAATTTCACCATGTGGTGCTTGTAGACAAGT
4   C05   AX00001154   TTAACAGTTGATGAAAAACAAGAACAACAAATGTTGCGTCAAAACTATACACAAA
4   C07   AX00001155   TTGATTTCACACTGAAGTCATCTGGCATTAAGCATCATGCGTTCAATACAATTTT
4   C09   AX00001156   CAAAAATTAAGTAACGGTGTTATTGTTCCGGTCTGGACATTTAATGGCTCATCTC
4   C11   AX00001157   TTTATCGGTCTACGTTTTCATCTGTACACTGCTTTAGAAGGAATGTTCTCTGGAT
4   C13   AX00001158   ATGGAGCGTACTGTACATGGGCAATTGGTCATTTGACGCAGTTATGTAATCCAG
4   C15   AX00001159   CTTTCTTCTTACGGGATTACACCTAATAGACTTGCTGTTTTAGGGGTAAACATAC
4   C17   AX00001160   CTCATTCCGTTTTTCAGCTCTGCCCAAATTGTATTTTTAAGTTTAGCAATCGTAG
4   C19   AX00001161   AACAAATGGCTCCTATGGAGATGGCAGTTAATTACGTAACAACTGTACTTGGATT
4   C21   AX00001162   TACGTAAGTGAAGCGCCTGGTGTTGAAAGTGAAGTAGCCATTCTTGAAGTGGAT
4   C23   AX00001163   TGTATTGGGATATGATTAAGCGTTTTTCACCGTGGGCAACATGTGCTGTCATTG
4   E01   AX00001164   ACTGTGAAGCCAGCAACTTCTGACATCGGCTCTTGGGAGACTTACACGATAAAA
4   E03   AX00001165   ACACCACCCGTTTTATTTGCAGGCGTTCGAACTTTAATTGGAGGATTCATTTTAC
4   E05   AX00001166   GACGCAGCCAGCTGTAAGTCATGCGATTTCAAGTATTGAGTCAGAGTTAGGAGT
4   E07   AX00001167   TGTCGTACTTGAAACAAGCTGGCTTTGTTTACGTAAATCGTGGACCGGGTGGCG
4   E09   AX00001168   TGCGTTTGCCACGTGTTTCTCCGCATCCATATACACATTTAGCTTTCGAAGGGTG
4   E11   AX00001169   TGGTCTCATCAAGGAAATGCGATGTTACAACATACTGTGTGGATGTTATTATCTG
4   E13   AX00001170   GGCTTCTTTTTTCTGTAGACCAACAAGACGAAAATAGAAAAGCAGTAGCAGAAAA
4   E15   AX00001171   GAAGTATCAAAGTATATAGAACAAGGTGTAGATGTCATCTATCAATCGATAGCAA
4   E17   AX00001172   ATACGGTCAAAAAGATGTGTATATCGGTGTACCTGCTGTTTTAAATCGCGGCGG
4   E19   AX00001173   CGAACCAGGCCAAGAGCTCGAGTTATTTCCGTATATTACATCACCATCTGGAAA
4   E21   AX00001174   AATGGCTTTCGAATTTACCAGATAGTATTTATCGTGTGAAAGGTTTTGTGAAATT
4   E23   AX00001175   ATTCAAAATATCATTAGCTCAAAACCAGATTATTTATTTATCGTTTGGGCAGGGG
4   G01   AX00001176   GATTACTATAGTTTTTTTCCGAGTTCGGCAAAATTTAAGCAACAAGTTGGAGAGG
4   G03   AX00001177   CGATATTTTCTTTCGTCTTTTTATTAGGAGCAGGGATGGCAGCGTTGGGAGGTT
4   G05   AX00001178   GTATCATTTGGTCATTGTATGTTCTTTGGAATAGGAGCATATGGCGTAGCGCTTT
4   G07   AX00001179   AAGTGTACCGTTGACTATTCAAAGGAACTCTTCTTCGTTAGCAATGACAAAAAGT
4   G09   AX00001180   GGAATGGTCATGAAGGAATGAACAAATTTATCTTTGAAGGGTATTACGATAATAT
4   G11   AX00001181   TTAAAACGTTTTGATTTAACGACTGCTCAATTTGATGTGCTGTTGCAAATACGTA
4   G13   AX00001182   TGGAATGGACAGTTTAGAGCACCGCTTGCACATGCATCGGTTATTCCAAGAGCT
4   G15   AX00001183   TTCAAAACCCACAATTATGGGTACAATTCCCGCATACAATTACAGCGGCAATTGC
4   G17   AX00001184   GGTCTACTCGTGAAGAGTGGCAAAAGAATATTGCTTATATTCCGCAGCAACCTT
4   G19   AX00001185   GAACCACAGGCGTTATTTTTCCGTTCGCGATTCCAAACGGGTGATATGTTAGGG
4   G21   AX00001186   AGGAACTTGAGGAGATTTATTTTTTCAGTGCCAAAATCAGTGTATGAAAAGAAGG
4   G23   AX00001187   ACCCGCATTCAATGAATTAACGCCACCTGATGTAGCAAAGGATCTTCATCAGCA
4   I01   AX00001188   ACATATGGCAAAGACGGAGAAAGATTTCGTTCAGCTTATGAATGCAAAAGCGAA
4   I03   AX00001189   GAAGTGATTTATCATGCTGTAAAACATACACCTTCAGCTTTTAACTCTCAAAGCG
4   I05   AX00001190   ACATCTTCAATCGCTGGATTCGCTAGATCTTTAAATGGTTCACCGTACAGAACTG
4   I07   AX00001191   CCGTTTCGGATTGCAATTACATTCATCAATTATTGCCCAATCATTACGACATCGG
4   I09   AX00001192   TTTTGAAGGGAATGAACGCACACTAGACGTTCATATAAATCGGTTACGTGAGAA
4   I11   AX00001193   AATGAGACCGAAGCGAGAGGCGATGATTTGGACTATTATTGAACCGATACAAAA
4   I13   AX00001194   TTTAACTCCAAGTACAGTAGCAACTGATATGGCTGTAGATTTAGGACTAACTGAT
4   I15   AX00001195   CCAGTGCGAGATATGTTAATTGTAATGCTAGAATGGCATATTGGTATGAAAACAG
4   I17   AX00001196   ATGATTGTACAGTGGAGTGTTGACACGGTTGATTGGAAAGGTGTAAGTGCTGAT
4   I19   AX00001197   GCAAAACGGATTCATCATGATGTTCATTGGAAGTGTTATTAGTATACTGTTTAGA
4   I21   AX00001198   TTCACAATGTCATCGATTCACTTCCATTCGCACCAGGTGAAGAAGTAGACGATG
4   I23   AX00001199   AGAAAGACCAGGCAATCGTCGTATAGACTCCATTTTGAATATTATTTCCAATCCA
4   K01   AX00001200   CAAGGGGATGAAGAAGTCGTTTCGAAATATTTCTTACGTATTTCATTACGAGATG
4   K03   AX00001201   TGCAATTGTAAAAGGGCATGTAATTGACGAGCCAGAAACAATTGCAACTGCGAT
4   K05   AX00001202   AGGAAGTAGTGCATCAGCAATTGTAGCTGGGATAGAGCTTGCGAATCAACTAGG
4   K07   AX00001203   CACTTCCGTTATGGGAAGGGAAGCAAATTCCGAGTAATGATGAGAATTGGAAGA
4   K09   AX00001204   ATATCGATGTACCAGTTACTTTCACTGAACAAGATAGTAAAGACCAAGCAGGTAT
4   K11   AX00001205   ATTTGTTCGTACTGTACGTCCAAAAGGTTGGGAAGATAAACCACATGGTGATAG
4   K13   AX00001206   ATATGATTTGGGGAACGAATTATGTAGGAGAGACGAAAGTAGTAGATGTAAATA
4   K15   AX00001207   AAAGCAAGGCATGGGGATTATTTCAGGTGAGACAGACAGATTAATTCATTTAGT
4   K17   AX00001208   ACAAAATGCAAGTTGATGCAGCTGCAGCACAAATTGCTCAAAATGTATTAACAAA
4   K19   AX00001209   ATTTTGCAAGAAGGTAAAGATCATAATGACGCTGTTATGAAGAAAATAGAGCAAG
4   K21   AX00001210   TCTGTAGCAAGTTGTTTAATTACGATGGTTTCAATTGAATCCGTACATGTATATTC
4   K23   AX00001211   ATGGAGAAATAGTTGGATTCATCGATGGAGGAGTAGAAAGAACTGGTACATACA
4   M01   AX00001212   AGCAAAATAGCGTTGTTCAGCTAAAGGATGGTTATCCGGTCAAATATTATTTCCG
4   M03   AX00001213   TTATTCAAAAAGCGATTATACCAGTTATACATCTTGTTGTAGAGCATGGGATCGC
4   M05   AX00001214   CTTTATTGCAATATAGTTCTGGAACTACAGGAGAACCGAAACTGATTCGTAGAGC
4   M07   AX00001215   TATATAGAAATGGATGTAAAGCTATGCGTTCCAGAGGATGAGGTAGACCCAAAA
4   M09   AX00001216   AAGGCGTAGCGACATAGATTTTCGCCCATTTTATTTTGGACTATGGGATGGAGA
4   M11   AX00001217   ATATTGTTCAATTTGCATATGAAAACGGTTTTGAAGGCATTGAATTATGGGGGAC
4   M13   AX00001218   GCGAGCCAACCAAATATTTGGAGGGCAGCCCCTGTAGTATTAACTGCCTCTATA
4   M15   AX00001219   CACTATAACGAGCCTATCTCCATGTTCAAAGGACTATTTAAAACAATGATGCAAG
4   M17   AX00001220   TTTAATAAAGAAGGAGAAGTATTACTGCAAAAAAGAGGCGACTTTAACGCTTGGG
4   M19   AX00001221   ACAGGATTCTTTACAAAATTCGGAGATGGTGGTGCAGACCTATTACCATTAACG
4   M21   AX00001222   ATTCCTAAAGAATTACGTGATGTATTGGGAATACAAATCAAATCACCGCTTGAAA
4   M23   AX00001223   CCCGCAAGATGTTCCAGAATTACATGAAGCAATTCAAAATGCGGTAAAGCAAGA
4   O01   AX00001224   ATGGGGCAAGGGATTACATTTTTTGATACAGCAGATTCATACGGTTTCGGTAGA
4   O03   AX00001225   GAGGAACTGCTAGAAAACTATAAATGTTTACGAGAAGCCCGCACAAAAAGCGAA
4   O05   AX00001226   ATCCATTGTGACTGCTATTTCCGGTCAGACTTTTTTACTACATCAAGCTCTTGGT
4   O07   AX00001227   ATTTTAGAATCGTTCGGCTGGGATTCTTTTTTTGAGGAACAAGCTGTAGAGAACT
4   O09   AX00001228   CGATTAATACGGCTTCTGCTCATACTCGTGAAAAAGCAGAAGATGGTGGAAAAC
4   O11   AX00001229   GATGTTACTCTCCTCACAAATCGGTGCATTTTCAGCGCAAGAATTTAACAAATAT
4   O13   AX00001230   GTTATATGTGAAACTACATAATTATCACTGGTATGTGACAGGACCACACTTCTTT
4   O15   AX00001231   AGAGCACCTGGCGGTATGCCAATTGCAACTCGCGCACTTCAAGAAGGAAAAATG
4   O17   AX00001232   GAGTTGCAACCAGCGATTGTCAAACCAGAGGGAAGAATATTCTTCGCTGGAGAC
4   O19   AX00001233   CGAAAGAAACAGGTGAATTTATTGCATCAGCTGGATTGCATCGTATTAATTGGG
4   O21   AX00001234   ATGCAAATCATCACAAAATGTGGAATCGCTCCCCCATCACCGAAATTTCCAGAG
4   O23   AX00001235   AATCAGTTGATTATGAATGTTGAAGAAGAAATTATGGAAATGACAAACGGTTGTT
4   A02   EMPTY        -
4   A04   AX00001236   TTGAAAGCAATGCGTTTTCTCTAGCAGAATCATTATATGAGGGAAACGGAACGT
4   A06   AX00001237   CAAAAGTAGCATCCGTTATTCAAAAAGAAACGGGTACAAAAGTTTTACGCTTAAA
4   A08   AX00001238   CTATTACTTGAATCAGATTACTACGATTCGGTTACTATTTTTGTAAGAGAACCAAT
4   A10   AX00001239   GCTTACATAAAACGACAACTTTTATACATGATAACGGTGCAAAAGCTGCCATTCA
4   A12   AX00001240   TGTAGGGAGACAATATCCGTATTACAAAAGGAAATGGGAGCTTGAGGAAAAGCG
4   A14   AX00001241   TTCTAATCCGAAGTATGATGAGTTAGTAGCGAAATCAAAAGGAGAGCTATTAAAA
4   A16   AX00001242   AGCGATTAGAAGAAAACGATGTTCATATTTTACAAGGAAGAGAACGGGATGTAA
4   A18   AX00001243   AACGTGATATACCGATAATCGCGGATGAGCATTTCTATGAAATTAACATGGGTAT
4   A20   AX00001244   CAAAACGATGTTACTGTAAAAAATGCGAATTCTTCCCTCACGGACACGGTGGCT
4   A22   AX00001245   ATTTGAAGTGATACCGTGGGATTATGATGCGACTTGGGGGCGTGATGTACAAGG
4   A24   AX00001246   TGAAAGGTTATTATTTGTGAAAGAAAAAAGTGATGGGAAATGGGCACTGCCAGG
4   C02   AX00001247   GCTTGGTGGAAATTGGCGACATATTAAAGAGTATGCATCTGATTACACACATTAC
4   C04   AX00001248   TTTAATAATCGTGGATATTCCAACAGTTAGACATGATGAAGAAGGAAATTCGATT
4   C06   AX00001249   TTTGGAAGTAGTATGCACATGGTATGGTATCGTTCGATTGTAGCGATTATCGTAG
4   C08   AX00001250   AGAACAATACTTCTTATTCCGTTTCGGTATTATACATTGTGTAGCGGATTCTGGT
4   C10   AX00001251   ATTAATGGTAGGTTGTAGTAAAGGTGAGGATAAGAATAAAGAAGAGGATACAAC
4   C12   AX00001252   GAAAGCCATAGAAGGAAGTGATATAGTAATTAGTGCACTTGGAACGGATCAAAA
4   C14   AX00001253   TTGGTGAACCGACTGTGGAACATTTACTACGACCGCTCTTTGAAAAGATTAATAT
4   C16   AX00001254   TTAGCGCTTACTTCGAATCATAAATCTATTTTAGGTTCCATCATTCTTTCATTCGT
4   C18   AX00001255   TGATGCCTTATTAGTTCGTAGAATTATGTTTACATTAGGAGAAGAGTTTAACGAT
4   C20   AX00001256   GCTTGTGCTGGCTTCTTTACAAACTTATTCCCAAAACTTTCGCATAAAACGATTG
4   C22   AX00001257   CGCGGTGAAGCACATACTGTCATACAAGCAATTGAAAGACAAATTTCTCATTATG
4   C24   AX00001258   ATGTACGCAGTTTTGTCGGCAAAGAGCTACCGGGTTTCGGTAAGTACGATACAG
4   E02   AX00001259   ATGGCCCACAATACAAGAGCTCAGGCACTATATAAAAAAGCTGGATTTGAGAAA
4   E04   AX00001260   AGTAGGCGTTTACCAGATGGGTATAAACCGCCAGATTTAGTTATTCCGAAAGTG
4   E06   AX00001261   TATTACGTAGTGAGGGAGCGACAGTAGTAGAAGATATTGATATTCCGTCTTTTCA
4   E08   AX00001262   TTTTACATGCTTTGGCTTGGAATTGGAGCTGTTGTCGGAGGTCTTATTGCTTTAT
4   E10   AX00001263   CGAAAGGGCCAGCAAATAAAGTCTTTATTCCATCTAATGCAATTGAAACACTTGG
4   E12   AX00001264   AAATATCCCGAGCCAAAGTTTCTTCATGATCGTTTTGAAAACGGGGAATCATTTA
4   E14   AX00001265   TGAAATGTGTGCACATCTTTCTCTTATTTGCCATGCTGATTTACTCATTTTAAATG
4   E16   AX00001266   GTCGTTAAAATCAAAAGTAGCCCATATTAAGCATGCGAAGAAAAATCGCGGTGT
4   E18   AX00001267   ATCTACTACACTATCAGGATTCGCCGTTCACCCTTCTTATCAAGGGCAAGGATAC
4   E20   AX00001268   AAGCTTACGCAGTTGCTCCTCGAGAGTTTGAGTTTATCGGACTAGAATATGTAC
4   E22   AX00001269   GGTATGAATAGTTCGAGTGAAGCACTATATTACGGTGTCCCGTTAGTTGTAATTC
4   E24   AX00001270   AGCAGGTTCATTAGAGCTTATTTTAGCGCCTAATGGATTAGTAGATGGCGGGGT
4   G02   AX00001271   ATAGAAAATAACGGTCAAGTTATAGGGACGGTCGGATTTTATTGGGAGTATAAA
4   G04   AX00001272   ACCTGTTAGACTGCAAAACGAAGCAGAATTAGGTGCGATTTATTTGTTACCAGAT
4   G06   AX00001273   CTGTTCAGACGGCTGACGGTGGTGTAGTGTTAACGGTTTCTAAAGTAGCGTTCG
4   G08   AX00001274   AGTTTGCAAGTAACATCCCTTCACCGCTTCATCAAGTGTTGCTTTTAAAGCATAA
4   G10   AX00001275   TACAGATGCACGAAATGGTGTATTCTTTATGACTGTAAAGCAAACATTTAAAACA
4   G12   AX00001276   GTACAAATACCGGTGCAATGATAGGCTATGTCGCTTTATTTCTTTCGCTTTTCTC
4   G14   AX00001277   AAAGTTGTAGATGGTATCGGTGTATATAAGCGCGGAGTAAATGAGAAGATGTTA
4   G16   AX00001278   TTTACTGGAGATATCCATGCGATCACAACTGCTAATAACGCGTTAGCCGCGTTT
4   G18   AX00001279   TAGTACGTGTAACACGTGCAGAGTCAAAAAGCTTAGTTGAGCATACGTATATCA
4   G20   AX00001280   AGTCGCAGCGGGGAATGGTGAAGTAGATTTCGATATATTCTTCAAGGTATTAGA
4   G22   AX00001281   AGCGGTGCTGAAACGAGCATTATACTACATAATAAAGAAGTGATTTCTAAAATGA
4   G24   AX00001282   GGATTTTTTCTACCTTGGTTAAAAAATAGAATAGAAAATGACGAGACGATCGCAC
4   I02   AX00001283   CTCTATACTCGGTTTTAGCTTTGGAACTACACGAAAAAAACGTCCTGAACTACTC
4   I04   AX00001284   CATTTTTTGATTGAAGATAAAACGGATGTAGATGATGTCGTTCAAGAAGTATACA
4   I06   AX00001285   TAAGTATGGGCCTTCAACCATACTTTGATAAATTAAATGGTCATAAATCAAGTAA
4   I08   AX00001286   AGACGCGCAAGTGAACTTTAACGTTTATCCAAGATTATTCTACTTTACACTCTTC
4   I10   AX00001287   GGCTGGGTAATCGATGTAAATGGTTTATTCTTAAGCTCCTACTTTAATTTAGCGG
4   I12   AX00001288   CCTCTGTATACATACATGACAGAACAAGCACCAGGTTTACTCGGTATGAAAGCA
4   I14   AX00001289   CAACCATCGCATACTTTGCGCCAAAATTTGGCCCTCAATGGCCAAACCCAATGG
4   I16   AX00001290   ACAATCCGAAAGAGCTCCAATTCGAGTTCAAGCCTGGACCAATCATGGGGAATT
4   I18   AX00001291   CCAGAAGGGAAGCTTGATTTACTCATTAACTTAGACTTCCGTATGGCTGGAACA
4   I20   AX00001292   ATGTATTTACCACGCATATGCGAACATTGTATGAATCCATCTTGCGTATCGTCTT
4   I22   AX00001293   CAAATGAGCAAGACAGCGAACCAATTATGAGTAAATACAAGGAGAATATACAAG
4   I24   AX00001294   TTCATTTTCCAACCGAAAGTTGAATATATGACGGAAGTACCTGTATGGTTTAAAA
4   K02   AX00001295   CACTTCGAATTTGTTCGGCATACGACATTATTGGAGAATTAACATTGTTCACGGA
4   K04   AX00001296   AGAAATACAGTTACGTTTCATTGAGTTTATGGATGTAGGCAGTACGAACGGATG
4   K06   AX00001297   TACGGTGTAACGTACACAATTCTTCCAGGAAAAACACCATGTTTTCGCTGCTTAA
4   K08   AX00001298   AGCCGCAATTCCGAGAGGGTGTAATGCGGTTGTTATGTTAGAACTAACGGAAGG
4   K10   AX00001299   TAGAGTATGTAGCTTATAAGACGATGGCGGAGAAACAGCTTGAGAGAATTGGTA
4   K12   AX00001300   CGTCCGATTGGTGGTTGGCTCGGTGATAAATTTAACCCATTTAAAATATTAATCT
4   K14   AX00001301   AATCGGAGGTATTATTCAATCATTTCTAAGACTGCCTGTATTTCATGCGCTCGTA
4   K16   AX00001302   ATTTTGAGCAGGTTTGTCAGCAATTTATTTCTGAGGGCCGGAAATACAAATTGTT
4   K18   AX00001303   GATATTAAAGATGCTCATCTTATTTATGCAGCTACAAATCAACATGCTGTAAATCT
4   K20   AX00001304   AGCAATATCCACATATAACATTTTCAGTTGTACCACCTTTTAGTACGCATCCGCA
4   K22   AX00001305   GCAGTCATTGAATGGGGTACAACTGGTAAACAGCGCGTTGTTACAGGGACACTA
4   K24   AX00001306   ATTCCGCCTTTCAAATGGTGATATTCGAGCTGTAGAAAATCGTTGTCCTCATAAA
4   M02   AX00001307   CGGCATTGTAGTCAATGACTATATGCTAACAAATGATGAGTCCATTTATGCAGTT
4   M04   AX00001308   AAATCCTATAGAATAGATTTTTGTTGTGGCGGTAATAAGCCACTTATTGATGCAA
4   M06   AX00001309   AAAATATGGAATTGAAATTGCAACTAGCAAAATGGAAGCTGCACCGTTTTTAAGA
4   M08   AX00001310   GTAGCCGGTACTGTTTATGACCTTTACGATAATAAATGGAAACCTGATGATGGTC
4   M10   AX00001311   GCGGATTTATCATATAGTTGGTGGGCAGGATGGCTTGCTTCTATATTAGGTCAA
4   M12   AX00001312   TTATGTGAAGTTTAGTAAGAAAAGCACAGTAGATTCTTCTATTGTTGGAAAACGT
4   M14   AX00001313   TTCAACAAGTTGTCGGTACACAGTTTTTACCTTTAAAAAAACCTGTACTAGATTTC
4   M16   AX00001314   AGCGTGTACATAAACTGGCGATTTCTTTATCCGAGCAAGAAGGAGGAAATCGTT
4   M18   AX00001315   ACACAGGTGCGGTATTACTTGTAACCCATGATCGTTATTTCTTAGATCGTGTGAC
4   M20   AX00001316   GCAAGGCGTCGCGTATGCACGAGTATGTGTTGCGGTGAATAGAGGATTTCGAA
4   M22   AX00001317   CGATGTTTGTTATGATTAAATCTCTGAAAGATTCAAGTAAATTAGTACGCTGGCG
4   M24   AX00001318   CATTCCATCTTATTGGTTTGCGGTGCCTTTTATAAAGCTATCTATCGTACTTGGA
4   O02   AX00001319   CCTCCATCTTCACCATCAATGGCATTATTAAAAGGAAAAGAAGTTGTTCACTTCA
4   O04   AX00001320   GAGAACACGACCCGTTTGTACAAGCCACGCAATTAGAGAGTGGAATGACAGTG
4   O06   AX00001321   ATACCTTTATGTGCGCGTTGTACAGGCATGCTTATCGGTATATTAATGTTTCCAA
4   O08   AX00001322   CAATTTATAGGACGTTTAATAGACAGAGGATTAACATATGATGATGCGCTAGCTC
4   O10   AX00001323   TCGTTACAATTAGACGCGGATCAGCCGATTGCTTGGAGTTTTCTCGCTTTATCG
4   O12   AX00001324   AACGGCATTACCGTATTACCGAATTGGTGAAACACTTATGGCATTAGGGCAATT
4   O14   AX00001325   TTAGCTGTATCAGCACTATATACTGGAAAAGTACCGTATAAACGAGTGCTATCAC
4   O16   AX00001326   AAAGATGCAATACAAAAATCAATGGCGTATGTTGGAGAAGCAAGTGAGCAAAAC
4   O18   AX00001327   GAAACGTATGCTTATTCACCAAAATCTTTACCAATCTCCCAAAACTCTGATCAATG
4   O20   AX00001328   TGTTTCACAAGGGGCAGAAGGAGGAGCGAATGTTTTTAAGCTTCCATACTTCCA
4   O22   AX00001329   GCGGGTCTTGCTATTTTTCCGGCCGTATTTTCATTAGGAATGGAGCCGACAGAA
4   O24   AX00001330   GAGTGGGAAGTATTTTCAAATCGCTCCAAGATCCATTTTGATAGATTAAAATTAG
4   B02   EMPTY        -
4   B04   AX00001331   GAATATGGATGCTGCTATCCCTTGGTCTGTAAAGAATCAAGCCCGTATGCATGT
4   B06   AX00001332   ATTGTCGATGAAGCAAAACTAGATTCTTCTATTGATTTAGAGAATATTATGCGAC
4   B08   AX00001333   CGTATAGTGGTGTTAGTGTGTATGTAGTAGTGTTTGCTGTATATCCGTTCGCAG
4   B10   AX00001334   GAGGCAAGAGAAGCGATGATGATAGCGTCCTTACAAGCTGGAATTGCATTTTCT
4   B12   AX00001335   ATATTCAAACAGTTGGTTTGCTTGGAACTAAATATACAATGGAGCAAGATTTCTA
4   B14   AX00001336   ATGCTATTGATGGCACCCCTATATTGGATATAAAGCCAATAATGAAAGAGTTTAT
4   B16   AX00001337   TGCAGAGCAATTAGCAAAGAAGCATAATTGCATTGGCACATGGCTAGTTAGTGG
4   B18   AX00001338   CAGCTGAAAGAATTTGTGAAAGATTTTTACTCATCTCACAAGGTACATTAGTCGC
4   B20   AX00001339   CGGTCGGTAACAGATTGGACAGTCGCATTATATATTATTATTCCAGCATTTATAT
4   B22   AX00001340   ATATTGCTTGATAATGCCAAAGCTGCGGACAAGCCTACAAGCACAGCTGGGCAA
4   B24   AX00001341   AGGTTACGGAATTGCAGTCATATCATCGAACTCAGAGGAGCATATTCGGGCGTT
4   D02   AX00001342   GACAGTTTTCTCTTCAGTTGTCTGGACATTACGAGCAGCACCGCATATGTTAGA
4   D04   AX00001343   ATACACCACACAATTCAATTCCAGATCAACCAGTTTTATCACTTCCTGAATCTCC
4   D06   AX00001344   GTAAAGGTTTTCCTTTATTAACGACAAAGAGAGTGCCGTTTCGCCTTGTAGCAAG
4   D08   AX00001345   TACCTTGGCGTTTACCGAGTGAATTGCAGTATGTAAAGAAAACAACGATGGGTC
4   D10   AX00001346   CTTGGAAAGTAGATTGGACTCCTGACTTTATCTTCCCAGGTATGACGAAAGATAG
4   D12   AX00001347   ACGAAGTTGTAACAATTGATTTATTCAACACTACAGTACCAGCAATCGATGCAGA
4   D14   AX00001348   CGAAAGACAAGCCGGTACTAGTTGTAAGTAATCACCAGAGTAATATGGATATCC
4   D16   AX00001349   ACACATGGTATCGGTGCCATTTTAAGCATCCCTGCCTTAATCATATTGATTATTC
4   D18   AX00001350   ACGAAGGATATTTATTTTTGGCTTGTCAAAGATTTACCAATGAAATTAACTGTTCT
4   D20   AX00001351   ATCCCTGTCCTACAGGCGCAGCATCCATTATCGTTTCTAATTCAGTCTCGTCTTC
4   D22   AX00001352   GCATCAATGACCGACACAAAAGTAACAGTTGTTGATTCGCAATTTATTACACATG
4   D24   AX00001353   ACTGTCACATGGATTGGGCATTCCACTTTTCTTATCCAAACGAATGGACTTAATA
4   F02   AX00001354   GGATGTAGTGGATCAGGTTCAAAGCTTCGTAAACCATTGAATTGGGATTTAGAA
4   F04   AX00001355   AAACATCCCATAACTATTATCGCCGAGAACGTTCTATTTCAGAAGCATCCAGATT
4   F06   AX00001356   TGGTGGTTATAACATTTACCGTGAGCCAAACTCACTGAAAATGTTCTCTTACATT
4   F08   AX00001357   AAAGAATGGACAGAAGATCCACTCTTTAAGCAACTGCAGGCTTCTAAAGATAATA
4   F10   AX00001358   AGCAGGGAAATTACTTACACGTTCTTTCGGGCCATATGCAACAGCTTTCTCGGA
4   F12   AX00001359   ACATTCGTATTTGTAGATCAAGTGTATGCAGATAAACATCAAGTAACTAGTACAA
4   F14   AX00001360   ATGGCACATATATTCGTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAG
4   F16   AX00001361   TATTCGTTTTATGCAAATTCGTGAATGGTCAGGAAAACTCCTTACCATACCACAT
4   F18   AX00001362   CAAAAGAAGAAGCCGATGTGTGAAGGAGACTGCTGGTGTGTAGAGCGTTTTGT
4   F20   AX00001363   ATTAAGCAGTTTTTCAGAGCAAGATTATGTTTTACCAGCACTAGAAGCTGGAGCA
4   F22   AX00001364   CAGATGGCCGTATTCTTGGTCATGAGGGTGTAGGTATTGTGACGAAAATCGCTG
4   F24   AX00001365   AGATACCATCCCAAAAGCTCCCCAGTTACTTTACAATGACAATAACGAATTACTT
4   H02   AX00001366   AATGGATAAACCGAATTGTGTTCATATTAGAAGCTGTCCCTGATATGATGATGAT
4   H04   AX00001367   GGTAGGTTCTGCTTCAATTGTAGGTTTAGGTGAAGCCACGCATGGGGCTCATGA
4   H06   AX00001368   ATATTAAGTATTGGCTTACACGCCTTTTAAAAGCTTCCTTACCATGGAAATCTGT
4   H08   AX00001369   TTAAATATTCACTTTTACTTATCAGGAATTCTTGAAACACCTCGCGTTTCTTATGC
4   H10   AX00001370   TGATGGGGTAGTATTATGTACACCAGAATATCATAATGCGATGAGTGGAGCGCT
4   H12   AX00001371   AATCGGCATAGCTGTAATCGGAATAATGGTTATATGGGGATTTGCTGGGCAACC
4   H14   AX00001372   TAATACGTATCATTTATATAGAACGAAAATAATTGCAAAGCGTTTAGGCATGAAG
4   H16   AX00001373   TTGGTATTGATCGGAATGATCATGCACTTATTATTTTAGGGGCCGTACCAGCCG
4   H18   AX00001374   GTTTTTACTTGTTTCTGAAATTTCCCACGTAGCAGGAAAAGATGGCGTGTTTCCG
4   H20   AX00001375   TCAGAAGAATTTCAAGCTGTAAAAACGATTATACAAACAATTGAGCGTAATGGAT
4   H22   AX00001376   TACTTTACAAGGTGTACCAGTACGAATTCATGCCCGAAAAGGGGCTACGCATTT
4   H24   AX00001377   ATTACGAGAAGACTAGATCGAATGGAAGAACAAATGCAAGATAAGGCAAATGAT
4   J02   AX00001378   GCAAAAGAAATAATGGTACCCCGAACTGAGATGCATATTATAAGGAAAGAAATG
4   J04   AX00001379   AAGAAGAGAAGAATTTGCAGAGATTATTGCAAAAGAGGCTGCAAAACCAATACG
4   J06   AX00001380   AACGTAATATGTATTTAACTACATTACGTGAGCGTGTAGAAATCGCTTTAACTAT
4   J08   AX00001381   GTACTCTTTAAACAAATAACAGATTTTTTAGAAGTTAGCCCTGGTACAGCTGATA
4   J10   AX00001382   GCAGGAAAAGAAGATAGTGCACTGCTTGTGGCACCGCCAATGACAACTACATAT
4   J12   AX00001383   ATATGACATTAATGTTTGGGGGATTTGGGGGGATCGGATCCCCTCCATCTTTAA
4   J14   AX00001384   TTGGTATACCATCGCTTGTACCAAATCATTTGCCTGACGATATAAACGTTATGTT
4   J16   AX00001385   ATGCGGTATTGCGCCGAATGAGACTATAGAGGCAGCAAAAGAAGAGTTTGAGAA
4   J18   AX00001386   ATTCTTTCACTAAATGTATTGTTAAAGGAAAGGGAGAGCATGTTTCCACATGGCT
4   J20   AX00001387   TGCAGAAGGGAATACATTAACAGCCAATTGTTTACCGCGTACATTTCGGAAAGA
4   J22   AX00001388   CTATGTATTGTCGTTACTGTACACGCCGCCGTTTTAGTGGACAAATTGGAATGG
4   J24   AX00001389   TACGAAAGCCATTGAAATCCAAGAGACACCATGCATTTCTTGTTCCTCATGTGGT
4   L02   AX00001390   TGTATGATGATTTAAGTTTTCCGAAGCAATCTGAAGATTACGATGAAATTAGTTC
4   L04   AX00001391   GAATGGTTAGAAGCGGATGAGTCAGATTTAACGTTACTTGCTAATGCTCAAACG
4   L06   AX00001392   ACAAACAAAAGAAGAGTTCATGCATGAAGATCAATGGGCAGACTCTCTTATTAAA
4   L08   AX00001393   AACGAGCTACAACTTATGAAGGTGAACAAGCTTTGATGCGAGAGGTTCACTTTC
4   L10   AX00001394   AGCTTTGTTGTATTATCTATTTCAGTTAGCCGAATATATCTTGGCGTTCACTATCC
4   L12   AX00001395   TAGCGATATTAATTGGTCTAAAAATCTCTCGGAAACCTCGTGATCCAGATCATCC
4   L14   AX00001396   TACATGGTACCCAGATTGCGTGCGTATGGACAACTTTATCGGAGATGTGATGGA
4   L16   AX00001397   GATTATAGAGCGCGTGTAGAAATTCGTGTGAATGGAAACGCAGCAATAGCTATA
4   L18   AX00001398   AACAATTATTTCATGCGTAGTACTGGCATTATCTGCATGTGGTTCCTCAGACAAC
4   L20   AX00001399   TGATGTAATTGTTTTTGGTCCATGTTTTTCAGATGAAAGTATGCTTGAAATTGTAC
4   L22   AX00001400   TCTACAGCGATTGGTACAAACGAAGTATCACCAACTGAAATAGCGGGTGCTTAT
4   L24   AX00001401   ACCAACTGAACTTGAGGAGAAGATCTTCGATCGTTCCCTTGTTTTATATAGTGAA
4   N02   AX00001402   TACAGTTTAGATTACCTTGACCCGAACAAGCGCTCAATCGCCAACGCTGTTCAA
4   N04   AX00001403   TAGGGGAAGTTGGGAAAGGGCATCACGTAGCTCTTAATATTCTTAACTTCGCTA
4   N06   AX00001404   ACCTATTAATTGGTTTTTATACAGCTGGTGTGAGTGAAGCTTTAACGTTAGCGAA
4   N08   AX00001405   GTAAACATGCACAAACGTTCCGTGATAACATCGATGCGGGTATGATCGGTGTAA
4   N10   AX00001406   TTTTAAATCCAAATCATAATACGTTTATCCAACTTCTCGTAATGGGCCTTACTTAC
4   N12   AX00001407   CAAAATGGGCAATGCCAGAAATGAATATCGGCTTCTTCCCAGACGTCGGTGCTG
4   N14   AX00001408   CGCAGTATTTTCATCATACAGATACGACAGAGGAAGTGAAGGATAAAGTACGAC
4   N16   AX00001409   TGGACATTTACATCAAGCGCATTTCGTACGTAATGAGACAATTCGATATTCAGGT
4   N18   AX00001410   GACTTACAAAAATCAGGCCGATTTATCGGTGTCATTTCACACGTTCAAGAGCTG
4   N20   AX00001411   CTACTGTTTCACAACATTTATCAAAAATGAAGGGTAAAGTGTTACGAGCAGAGAG
4   N22   AX00001412   ACAAGCTTCCTCATTAATATTGCTTTATGTACTAGCGGGAGTTGTTGTAGGATAT
4   N24   AX00001413   AACTTAGTTTCTCCTGGTTCTACTGAAACTGAAATGCAAAGGTTACTATGGGCTG
4   P02   AX00001414   AATCCGAATCCTATCGTTGTGGGGGCTTTGCCATTTGATCGTAGAAAAGAAGTC
4   P04   AX00001415   GAGAGCGTCTATATGGCAGTTCTTCCAGTAGCACATAATTACCCAATGAGTTCTC
4   P06   AX00001416   GAACAAGGAAGAGATCAACTCATTATTTGCGGTATTTATGCGCATATTGGCTGC
4   P08   AX00001417   TTCTCGGTTTGGGAAATTTGGGGACCTTTATTATATGGAGGGCGTTTAGTCGTA
4   P10   AX00001418   GTTGGGTATTTAGTTAGCTTAGCTGTCTTCCTTCCGATTTCTGGTTGGCTAGGA
4   P12   AX00001419   AATGAATCCGAATGTGGATGTTATGAAAATGGCAGAAGGCGTATTAACAGACAT
4   P14   AX00001420   GCATTACAATCTGGCGATAAAGTTCAATTAATCGGCTTTGGAACTTTTGAAGTGC
4   P16   AX00001421   CCATATACTTTTATGGATTGTCCAAGTTCATTACGTTTTGTCTTTTATACGATTGG
4   P18   AX00001422   CATATTGCATGGTAAAAGTATGAATGAAGCAATACAAGACCGAGAAAATTTACGA
4   P20   AX00001423   CAGGAGTCGCTGCTCTTTTAGCAAATCAAGGATATAGCAATACACAAATCCGCC
4   P22   AX00001424   TACTACAGGCGCATGGAAATCTGGTAAAACTGGCGTTGAAGCTACAACACTTGC
4   P24   AX00001425   AACCTAAAATTAATGAATTGACTACTAATTATAATGACATCATCGAAAAAGATTGG
4   B01   EMPTY        -
4   B03   AX00001426   GTGTAATGCCTATTATAAAGGTAAGTGGATGGGAGAACTTAGGGGAAAACGGGC
4   B05   AX00001427   AGGTGAGGCATGTGTATTTACTTTATGGGAAGATCGAGGTGCATATCAATCATT
4   B07   AX00001428   TCGCCATGAATTTAGTGGGGCGTTAAACGGATTATTAAGAGTACGTACTTTCTG
4   B09   AX00001429   ATAGTTTTACATACGCACAGCTACGCTTTCGAGTAAATAGTTTATCGAGAGTATT
4   B11   AX00001430   TCAGACCAATATGGTGCAGCAGCGGGGATTAATCAAATGGTAAATAGTTTGTAT
4   B13   AX00001431   TATGGGAAGTGCTATCGGTTCACTTGGCTATGTCACAATTCATGAAATGCTTTGG
4   B15   AX00001432   TAGGAGACTGTCTATATGCAGATATTTTTTCTTCTAAGTGGAACTATACGACGAA
4   B17   AX00001433   CAGGCAATGTACATGAACCTGAACATGATGGAACAGCCGAATGGAATTCGTTTT
4   B19   AX00001434   CAAGAACTTCCGTATTGCGGTGGAATACTAATTCTCCATACTCCAGGGCATACT
4   B21   AX00001435   ATTTACCGCTACTATGATTCAAATGATGATACGTATACGTGAGAATATGTCGCAA
4   B23   AX00001436   ACCTATTCAAAATGATAATACTGCAAATCTTAATATCGAAGAACAAGCAATGAAC
4   D01   AX00001437   TACAAGATTGTTTTGAATTTGTAGAGTTAGCAGTTCATCCACAACATCAAAATGA
4   D03   AX00001438   TCATTTGTTGGCAGCAATATAAGGAATATGAATATGAGCAATTGTAATGTAAGTC
4   D05   AX00001439   GACGTTTTACCTTATATGGTTTTCTTACCTAGCATGCGTGTAGATGCGATGGAAA
4   D07   AX00001440   TACAATATACTTCTGTAGCAAGTTCTACAGTTATCGTAACGTTACAACCTTTATTC
4   D09   AX00001441   AAAAGAAACAAATGATATTTGGCATGCACATTTCGGAGCAGCTGCAATTGCTAG
4   D11   AX00001442   GACAAATTGCGCCAGTGCTTTCAGGTGTATATTCTGGTAAATTGAACGAGCTTA
4   D13   AX00001443   TTCATTGGATGAGGTAACATGTTATTACGGCATGAATTCTTTTACGGAGTTTGGA
4   D15   AX00001444   GCTGCTGGAGCAGATTTAACTTTTGCTAACACAGACTTCACTGATGACACTGGT
4   D17   AX00001445   TAGACCAATGGTAGATCGTTTTTTACGTCAAAGCGGGAATATTCCAGCTAAAACA
4   D19   AX00001446   ACCCTAGTGAACAGCTGTATCCAATGCCATTATATGCAGAAGGGAAAATAGATA
4   D21   AX00001447   ACGAGCATGGATTATCTGTTACATTTTCAGCATGTGGTCAACCGGTAGGAAATA
4   D23   AX00001448   GAGATATTCGTGAAAAATTATTACAAAACGAATTAGATATTGGCATTACATTTCTA
4   F01   AX00001449   CACTATATTTTCAAGAAACAGGATATACGGGGTTTTATTTTCGCGTATTAAAAGA
4   F03   AX00001450   AAGCTGAAGTTCAATTGCGTATGAATCCAAATTCAAAATTCGATCAAGCCGGTCT
4   F05   AX00001451   GAATTATGTAATAAAAATGGGGCTTCTTATGATAGGAGCTGCAGCACTCGGCTT
4   F07   AX00001452   AAAACGATTTTAAAAGAAGTGAGTCTTAAAGCGCGGCCAGGGGAGACAATTGCT
4   F09   AX00001453   AACAACAATGGAAACAAGCGGTTTCTCCTATCCAATCAACTGCTGTAATTGGTCC
4   F11   AX00001454   ATGGTAAGACGGAACTTGGCCATCTTCATGGTGATAAATTAGTTGATTTACCATT
4   F13   AX00001455   AATTCCATCTACAAAAGCACATGGAATATGGAAAGGGGATATATTCACCATCCCA
4   F15   AX00001456   GCGGATCGAATTATACGTTTGTTCTTTGGGATTGCGCAACGATTGACAGAAGCG
4   F17   AX00001457   GTAACAACTGTAGAGCTTTCCTCAGAACGAGTTGGAGAGGCACTTGCCAATTTT
4   F19   AX00001458   ATGACGCAAAACGTTGTAACAGTTTCCGCTGCTATTCAGCTAGCATTAACGAATC
4   F21   AX00001459   AATCATTACCGTTTCTACAAGAATTTACACAACATCCACTCTTTTATCGCTGGATT
4   F23   AX00001460   ACGTAAAGTTTGGTATAAGTCCGTTCGGCGTATGGCGAAATATAGCTGACGATC
4   H01   AX00001461   AGACACCGATTTGACTCTGTAAAAAAATTTGCAGAAGAGGAGTCTATTCCGTGTG
4   H03   AX00001462   TGCGGCAAGTGTTTTGCTTACAGTAGTTGTTTCTTTCATTGATGGATCGTTTGCA
4   H05   AX00001463   TTCCACATTGCAAATTGGGGAACCTGCAGTAATAGCATACGAAACGAACACGAC
4   H07   AX00001464   TGGGGCGCGTATATGGAAAAGGGTATTTCGTTGCTACATTTTTAGGTGATGCGA
4   H09   AX00001465   TTATCTGCTCATTTACTTGGTATTAAGAGTAAAATTGTTATGCCGATTTCTGCACC
4   H11   AX00001466   GTACATGATGGTCAAATGATTTTGAATAATGAATGTCAAGTAGTGGAAACGCCAG
4   H13   AX00001467   ATCGCAAAATTAAGTGAATTAGAGTGGTTTCGAAATCTACATGAAGATCCGAAGT
4   H15   AX00001468   TATAATTGTGCTGAACTTCATGGTGATATACCTCAAGCGAAACGTGAAAGAGTTA
4   H17   AX00001469   CACTACTACTACCTAGTACAGGCCCAAATCCAAACATTACTGTCCCTGTAATCAA
4   H19   AX00001470   GTTGTATCCATCTATGTGATTACTGTAGTCCAAAAGAAAACACCAAATGAAAACT
4   H21   AX00001471   TTTACGATTTCAGCATTTGTTCGTGATGTTCAAATGAACCCATCAATCGTTAGTT
4   H23   AX00001472   TTTTCAATTTAGAGGTTCAAAATGAATTTGATTTTGTATACGATTCGGGCTGTTTG
4   J01   AX00001473   CCAAGGCCAAATTGAAGCGGGTTTTATTATAACAGGTTTTTATGAGGATGATTTT
4   J03   AX00001474   CTTGGTACACAGCTCGCTAATTTATCGCGGCGCAACATTTTAATTATTGGTGATG
4   J05   AX00001475   GATGTACAAAGACAACAAATGGGTGCTATTTTTTCAAAATTTGGTGAATCGTGTG
4   J07   AX00001476   TGGTGAGGAGCAAGTTCATATTTGGAGAAGAAGTATTGATGTAAGACCACCTGC
4   J09   AX00001477   TGGCGGTCTAAAAGGCGGACATTCTGGTATGGAAATTGATAAACAACGTGGTAA
4   J11   AX00001478   ATAAGCTTCATCATATTGACTTTTGGAATCATCATGTAGTTAATGACAATACGCTT
4   J13   AX00001479   ACCAAGTGGATTGACAGAAAGTAACCAACAAAAGCAAGCACACTTTATATATGCA
4   J15   AX00001480   TTCTCTATTCATTGCATATGCTCCTACCGAAGATCCACAGATTGCCGTTTCTGTC
4   J17   AX00001481   ACATTCGTGACACCAGTACAGCGAAAGCAATTGCTACGAATCTTAAAGCTTTTAC
4   J19   AX00001482   AAACCTGTATTATGAGGTATTTAAGAAATATGGCCTTGCTAATGAGTTACCTAAT
4   J21   AX00001483   ACATAGAATTATAGCTACATGTCAGCCAGAAAATACCCCATCATATCGAGTGATG
4   J23   AX00001484   AAAAGTCTTATACTTGCTGAATTCAACTACGAACATGAGCCTCAAGAAACGTTTC
4   L01   AX00001485   CCCAATCGTTTTACAATGTCGAACCGGATTACGTTCCGCTATAGCAGCTAGTATT
4   L03   AX00001486   AAAAATATGCAGAAACATTACAATATGCACATTTATATCCCGACACAGTTATATTA
4   L05   AX00001487   GTGGGGATAGATCCGCTTCTTAGAAAAACGATTTGGGAAAAATTTTATGATTTGA
4   L07   AX00001488   CCGCTCACATACGGCGCTGACGCAATGAGACAGGTGATGATTCGAAATCAAGG
4   L09   AX00001489   AAATGAACGTCAAATGCGTATATTAGAGGCGGCTGTTGATATGTTTGGAGAAAA
4   L11   AX00001490   GGAACTAATATGAATAGAGTTAATAACACTGACATTTCAACTCGAGTGAATGACA
4   L13   AX00001491   ATTTGCAGCCATTTGTTACATTTATACCTGTTTGTCCAGAAGTCGAGATTGGATT
4   L15   AX00001492   AAAACAAGAGCACAAAACTTCTTCGGTAATGGAGAAATGTATTTAGAGCGCTATA
4   L17   AX00001493   GGATGTCGTCATTTTGGAATCTATGAAAATGGAAATTCCAATCGTTTCAGAAGAA
4   L19   AX00001494   TATGTGTCTACTGTATTTGGATGTCCTTATGAAGGGGATATAAGTGCCATAGCAG
4   L21   AX00001495   AGAACAAGTTCGCCATGCTGTTAGTATGATTCGCACTACTATGGAAATGGTTGA
4   L23   AX00001496   GCGCCGCGGTGCAGGAAGAATCTTCTATAATCAAGTGAAATTATCAGGTAAAGT
4   N01   AX00001497   AAAATGGTACACCGTTTGCACAGTGGTATAATGGCGGAACATGTAACGTTGTAG
4   N03   AX00001498   ATGAAAGCAGTACTTCATATTGCATTTGATGAATTAAAACTACATAGAGTAACGC
4   N05   AX00001499   CATTAAACTCCAAGGTGTTGATGGCTTACAAACTAGTTTTTCAACTAATAGTAAT
4   N07   AX00001500   ACACCTCTTACCTCTATAGTTGGATACGTAAATTTAATCCACCATGATAATTATAG
4   N09   AX00001501   CGTGAAAATAATACTGTACCTATTCTTATGCTGAGTGCAAAAGCAGAAGATATGG
4   N11   AX00001502   GAAGATGGATTTAGTGTTATTTGTTGCTGATAAAATAGAATGGGATCAAAATGGG
4   N13   AX00001503   ACATTTTTATCTGGAGATCAACGTATCCGTAGTTCAGAAATGAGGTATTTACTCC
4   N15   AX00001504   ATGGGAAGTTTTATTACAATGAATGGGATGCAAACGACGGTGTTATTTTCCGTTC
4   N17   AX00001505   TAGCTGCTCATCCAACTAATAAAGATACGAGAAGTTTTGATTTCTATTCACAGGA
4   N19   AX00001506   ACAATTACGTCTCCTCGAAGACTCAATGAAAACGATGAGAGAGGATGTTGTTGA
4   N21   AX00001507   TCTACTCGAAATTATCGCACATAGTTATGTTAAAGAAGATGTATTAGTACCGCAA
4   N23   AX00001508   AGAAAAATAGAGGTTGAACAGTTGCGAAATAGGAAGAGTGAGCTATTTGATAAA
4   P01   AX00001509   GCATTATCAGTCTAACGTCATACATATTGATGGCTACGATAACTGGATAGCAACG
4   P03   AX00001510   TGAAGATTCTATAGTTATGGATATTGCTACAGCAGCGGTAAAGGAGGAATCTTTT
4   P05   AX00001511   TATACGTGCGCTTTATGAATTGGAAAAGCGTCATATTATATATTCTGTCCCTCAA
4   P07   AX00001512   AAAAGCTCCAATGTACGGAAAAGGAAAACAGTTGGATAAAGATTATTATGAGATA
4   P09   AX00001513   GCTCTTTGGTATTTCCGTCCAGTTGGAGCTTGTCCGCCCGAATGGTATAACCAG
4   P11   AX00001514   ATTTCATGTGGCACACCGCATGATCACGGCGGGAATATGGACTGTAAAGAGATA
4   P13   AX00001515   ATAGCGAATCCTATGTTGATGATAATACATTAAGTGTAAATACAACACGTGTGCG
4   P15   AX00001516   GGTTAGTTCCATCCTTTTTCGTGGCTAGCCTTAGTTATTCTAAGCGTACAGCTAT
4   P17   AX00001517   CATGCAGTGAGAATTACGACTAACATAGATGATCACATATTAAAACTAGGAATAT
4   P19   AX00001518   TAAACATTACAGATATATTGAGTAAAAGAACGTTTGAAATATCAGGGGGGCAAGC
4   P21   AX00001519   TCCATCTAATCTTGAGCATAATACTATCTCTTCTACTAAACTTGAAAGTAAGAAAG
4   P23   AX00001520   CATAAGTGGTACAGTGCTGGTAGAATCAACAGTTACAAACCTTAAAGATGGAAA
5   A01   EMPTY        -
5   A03   AX00001521   ACTTAGTGTAAGCAGAAACACTGTACTCGCTGCTTATGCAGATTTAGAGCAAGA
5   A05   AX00001522   CATTACACGGAAAATACGGAGAAGATGGGACAGTTCAAGGAACGCTTGAAAGTT
5   A07   AX00001523   GTGCTTCAAGATTCCTATTATTTGAGTCACTTTGCTAGAGTACAAACATTAGGAG
5   A09   AX00001524   GTTTTCCTTGAAACCACCGCTCCACAAACTGTATTTGAGGATTTTACAAACAATC
5   A11   AX00001525   AGAGAAGGATTTGCACGAACAAACCGTATTTCAGCATTTATTAATTTATTTATAG
5   A13   AX00001526   TTCGGAAGAGACTTATGGTTTTTTCCGACTGAAGTGAGAAGAAACGGAGTATCA
5   A15   AX00001527   AAGAAGACTTGGTTAGTGCTTTAATACTTGCAGAAAGTGAAGGACATAAACTTAG
5   A17   AX00001528   AACTTTGCTAGGGCTTTGCTTTATGGCAGCAGGACTAGGGATAGGATTAATTCA
5   A19   AX00001529   GCAAGTGGAGTTACCTTTATTATGAACGGAGCGAATCATCGGATGGATGGGTTT
5   A21   AX00001530   GCCCTCACTTTTGCTTAGGGGCACCACTTGCGCGTTTAGAAGCTGAGATTGCAT
5   A23   AX00001531   GTTTATTTAACTCATACAGGAAATCTTTATTTGGGAGAAGGAGAAACAGATAAAG
5   C01   AX00001532   ATCAGCTTTATACTGATAAAGGTGTGTACGTACCAGATTATGGAGTAGAGAGTG
5   C03   AX00001533   CAGGATCCCCCACAAAATTTTACGTACCCGCAGAAGCTTTTATGGGAAAAAAGT
5   C05   AX00001534   CGCTTCTTCATATTGGTGATGTAAGTGCTAAAGAAATGGTAGAACAGAATATTAA
5   C07   AX00001535   TATTTGCTGGGGCATTCGATATTATTGTGATGGGAGAACCGTTTGATAAAATTGT
5   C09   AX00001536   AACATGTAGGCACAATTTTGCAAGATCAAGATGCACAATTTATTGGTCTTACAGT
5   C11   AX00001537   CGGTATTCCAGATTATTTTGATGAAAGTATTATGGATAACTTCGAAGATCTTTGG
5   C13   AX00001538   GGAGAGATCCTGCAAAAACATTATCAAAGTCATGAAAAGATTATTTTTTCTAATAC
5   C15   AX00001539   GTGAAGAAGGTGTGCGTGAGCGCGTTTATAATGCTTTAAACGAAGGTAAAACTG
5   C17   AX00001540   GATGTCCAGCTTTTAGGAACGAAAGAAACTCATATATCCATGTCTGGCTTGCGC
5   C19   AX00001541   ATTAAGTCCACTCTCTATAGAAACTTTTTTGAAGGAGTTGGAGCAGGCCGTAGC
5   C21   AX00001542   GTGGTGCAACTGATGCCCTCGCGAATATGGGATACTTGGATACTAGAAAGCATA
5   C23   AX00001543   AGCAGGATGAAGAGGGATACTACGAATATTTTTACAAAGGAGTCAATTTATCGTT
5   E01   AX00001544   GAAGTTCCCTGTTATACATAACACCAGCCTCAATTGTAAAAGCAGAACCCACGC
5   E03   AX00001545   AAAATCTACAGTTTCAATCCATTGATGAAAGTACTTCAAATTATTTGAAACGAGG
5   E05   AX00001546   ATTTATAGTTTCGCCTTAGGATTGTATGTATTACAAATAACCGGATCGGCTTTAA
5   E07   AX00001547   ATTGGTGTAGTATTCGCTGATTTATGTAGTATAGATCGATTTAATTTCGAGTTTG
5   E09   AX00001548   TGGTGCTTCTGAAGCAACAAGTTCTCTATATTTAACGCCAATAACTGCATGTTTT
5   E11   AX00001549   TAGTCGAGTACCTTTAAGAATTGTAATGGACTATGCGATGTACGGCGAGAAGCG
5   E13   AX00001550   ATTGGGATCCACAACAAAGTCAATATCCATACTACTATATTCAAGACGATGCACG
5   E15   AX00001551   TGGACAATCTTGGGCGTATAGAGATATTAATGTAAGAATGATGACACGTCTTATT
5   E17   AX00001552   GGATCATTTATTGGAGCGATACTCGGGGGATTTCAACCAACTTTCATTATAATCG
5   E19   AX00001553   TCTGGACGAGGTATGACAGATAGAGATTGTTCATTATGGTGTTCATGGCTTATTC
5   E21   AX00001554   TTGAGAGTAAGTTTGGTGGTTATCCGTATTTACCTATAAATCAAGAGCATCCTAA
5   E23   AX00001555   TCAGATGACTCAAAAAGGCTCAAACACTACTTTAGTGAAAAAAAGACTCAAAGCA
5   G01   AX00001556   ACCTAATGAACTAACGAAGGCAATTAAAGATTTAGATCAGAAGCAGTTAGACACA
5   G03   AX00001557   ATACAGAAACTCGAATTAGTTCGCTAGGGTATCGGGTCGGAGAAAAATTTACTA
5   G05   AX00001558   TGTAATATGCTAATGTCTCCAAGTTTCCCTGATAATCCTTATGGCGTTCTTATTC
5   G07   AX00001559   TTACGCCAATCAATGGTTTTATCGACTTCCACTTGTTCCCTAGAGATAAAGGCGG
5   G09   AX00001560   AAATCATTGGTACAATCGAAGTTGGTCCAGCAAGTACATTGATTAATAGTTGTAC
5   G11   AX00001561   CAAGGATTAACCCCCTGTGATGTTCACGGGAAAAATGTGATGATGGAAAAAGGA
5   G13   AX00001562   AGAATGTCCATATATACAATTAGATTCTGTGTCTTCACTACCAGTAGAGGATGTA
5   G15   AX00001563   AGCATTAACAGTTGCACCTGGCTTAGAAAATGCTACCATGCTTGAAACGAGAGT
5   G17   AX00001564   CAAAAAGATTGGGCACGTAATTTATTTTCTGTAAAACAAGAAAAAACACGTGAAA
5   G19   AX00001565   GATACTATGGCAACTGTTCAATATGAGGTAAATGCGAAGCATATTATTATCCATA
5   G21   AX00001566   GATAAACGTATATTCGAACTAGCATTAAATAAGCTAAATGTACAGCCGGAAAATA
5   G23   AX00001567   GTATTATGGCGTATCGTTTGTTATCTATCGCTCGAGGCGAGACAGCGGAACTTC
5   I01   AX00001568   GCGGACGAAATACGGTGATCATAATAGTTACAAATCTCCAGATTCGATTAACCAG
5   I03   AX00001569   GAAATACGTAAATAATGGAAGCTTTAACTGGACGATGGGAGAACAAACTGGATC
5   I05   AX00001570   AAATAAACTTTATCCACTAGAGCAATCATTTATCGGAATTTCATTAGATAATCCTG
5   I07   AX00001571   TTCCAGTCATCTTTGCTTCCGCATTTTTAATGACGCCGCGTACAATTGCGCAGC
5   I09   AX00001572   GTGGCCTATTTTATATCTCATATTTATCGGATCAATTGGTGGGCACGGATTATAT
5   I11   AX00001573   GATGATATTTGTCAAAGTAAAAATCCCGTTTTATTGTATACGAATCCAACTTTCCA
5   I13   AX00001574   TAAGGCGCATCTATTTGGTATGTCATTAGGTGGTATGATTGCTCAAATTGCTGCT
5   I15   AX00001575   CGTCAAAGCCCAACTTCTAGCCATATTAATATTCGATATGATTTATCTGTTGCTC
5   I17   AX00001576   AATGTCAATTATACGAATAAGTCAAATAAGCCAAATGAAAAAGCAGCGGATCATC
5   I19   AX00001577   CATCTGAAGCTCGTTCAGATGTAGGGCAACTTCCTTTAACATTAATGCCTTTTAA
5   I21   AX00001578   ACGGATTTTATACGGGAAAAGTGGATGGTGTTTTCGGATGGGGTACATACTGGG
5   I23   AX00001579   CAAATATATATACCGGCTCATCAATTGTTCATGCGCAGCCGCCGTATGCGAAAT
5   K01   AX00001580   CATTGAGTTTCGTGACTCGCTCGGTCAAGCTTCAGGTTTTCAATCGTATCAATAT
5   K03   AX00001581   GGTCAAAAGAAGAGAGTGGCTCAGTAAATGTCGGAAAGTTAACGATGAGTATTC
5   K05   AX00001582   ATTAGAGGATGAAAAACGAGGCGGGCATATTTATTTAGAGCATGCAGAAGCAGC
5   K07   AX00001583   CTGGCGGAGAATACTGGAGCTTGCCAGCTGGAGCAATTGAACCTGGAGAAACT
5   K09   AX00001584   ATCTTGGTTTTGATGTTCATTATATGTATATGGATCCCGGACATTTATGCTTACG
5   K11   AX00001585   CGATACACCCCATATTATTTCACTAGGTAGTGAAATGAAGCAAGGATATTCAGCG
5   K13   AX00001586   TAATGGGGTATTCCATTTATAGTTGGAATGATACTTCGGAACTGAGTATGCTAAT
5   K15   AX00001587   ATGGAACTGAATTTGAAGAACGAGGAATTATAAAACCTATTTACTTGGAGTCGTT
5   K17   AX00001588   ATTGGTGTTCTAGATTTCTCCTGTCCAATTGAATTTTCGCATCCATATATGCTCG
5   K19   AX00001589   TGGTTCCAGGCTAATAGGACGATGGATGAAAGATAATAAGAATGGTACGACTGA
5   K21   AX00001590   TCGGAAATTAGAGTTCAGATCGATGGAGAAACTGAAAATATGGATAGAGAAGCT
5   K23   AX00001591   GATCTTGCGGAAAGTTTCGATATGTCTATCGATTCTATAAGAAGAGATTTGTCTA
5   M01   AX00001592   AGAGCGCTATTGAAAAGAATGCAATGCACTATGGGGAAATAGTTAAAAACGAAT
5   M03   AX00001593   CTATGGTACTGGTGGACCAAAAGATGTTGATATGCTGTATGATCCAATTGATATC
5   M05   AX00001594   TAGATATCATCCATGCAATTGAAGGTAAAACATCATTGTTTGAATGCTGTTTACA
5   M07   AX00001595   AGCTGGAACGACAGAATTTCTTCTGTAAGTACGGCTTCACCTTCTGCAAGTTATT
5   M09   AX00001596   TCAAGGAACTGTAATGATTCATACGGAAGTTACCGCTGATATTATGAGAGATTAT
5   M11   AX00001597   CTGTTGTATTAGCGCTTGGGGAGCATAAAGAAATGAACAGCGCTTATATAGATG
5   M13   AX00001598   GTTGATCATTTGCAAGATGATGAAGCATGGGGCGGTGTTCTTGGTGTTACGAAA
5   M15   AX00001599   GGTGAAGAAGCGGTAGCAGTTGGTGTATGTGCCCACTTAACGGATAGTGACAG
5   M17   AX00001600   GTAATAGTATAGCTGAAATTGTACAACATTTACTGTATTGGAACTCAACGTGGCA
5   M19   AX00001601   ATATGGGTAAAATACAAAAACATATTAATAGCGGCAGTGATAGATTTGGTAATCC
5   M21   AX00001602   ATACACCATATTGGCAGTACTGCTATTCCGCATTTAAGTGCAAAGCCCATTATTG
5   M23   AX00001603   GGCGCGTTAGTTTGGTCAAATGGTGATTGGGAATTTGCAGCTATTTTAGATGGA
5   O01   AX00001604   TACAATTACCACTCGCAACTGGAACGATTATGGCTGGTGTGAATCAAAGCATTA
5   O03   AX00001605   TTTTTAGGTATATTAACTGCGGATGATGCAAGTAAAGCCGTTCAAAAACAGTGGC
5   O05   AX00001606   GAACAAAAAGGCTACAAAGTTGAACTCATGTATTTAGAAAAAGCGGCAATTTGGA
5   O07   AX00001607   CAGGTTTTGCTATATTAGATACGATGAATTTAATTAAACCAGACGTGCAAACGCT
5   O09   AX00001608   AAAAATAAGAGACCAAATTACTTTTGAAGAACCACATGAAAAAATTGCAGATTTG
5   O11   AX00001609   GATGACAGAAAAAGGAATTGAAGATCATTTACGATTATCTTGTCAAATGCGTGTA
5   O13   AX00001610   TGAACTAGCATGGACCGCTTCTACGGATAATGTAGGGGTAAAAGGATATCAAAT
5   O15   AX00001611   AGACCGGATATGGGCGCGGGATGTGAAGAAAGATTTGATTTGCAATTTTTTAAA
5   O17   AX00001612   GCCCAAACGTACTTTTCAAAAATTCATATACAAGAGGACGCTAGAGATGAGAAAA
5   O19   AX00001613   AAGTTTGAAGTTTTTGGAGGGTTAATGTGGACAGCAATTTGGGCTACACTTTACT
5   O21   AX00001614   AAGCAAGAGCTAGTGACGAGTAGTTGGGATAAAACAGAGAGTAGGCCTCGTAAG
5   O23   AX00001615   GCAAATTATTTGATACAAACGAAGGATATCCGGCGATGACTTATTCGAATGAAGA
5   A02   EMPTY        -
5   A04   AX00001616   CGTGAAGTACGTAAAGAAATTGCACAAGGAGAAGGTGTACCTCCATTCGTTATT
5   A06   AX00001617   GATCTTGTTAAAGCCGCAAAAGCTGGTGACCAAAATGCAGCTGCCGCTATAGAG
5   A08   AX00001618   ATCACCGTATTGCTAACTTTGAAACAAGCGATCCTATTTACTACCGTTGTGAGCC
5   A10   AX00001619   AGAATCACCAGCGAGCCGTTCTTATTTATGTAAGCAAGGGGTAAATGTAAATTG
5   A12   AX00001620   ATTTAGTTACAAAGCCTAACGGAATTCATAGAGCCGAGATTTGTAAGTTAATGAC
5   A14   AX00001621   GTAGTTTTACAAACCAAATTCCTGAAATTGCTGAAACATATAATGCATTCACGCA
5   A16   AX00001622   CATCGCTTTTATGGAATCTTGGAGATTTAGGAATCGGTAGTATGGCATGGTTAAA
5   A18   AX00001623   TTTCCAAACGGTGTTGTAAACTTTGTTCCAGGGTTTGGTCCTGAAGCAGGAGCT
5   A20   AX00001624   TCGCAAAAAGAAAAGAACCATATAAAGTCGATTACCTTTCATGAAGATAACTTTA
5   A22   AX00001625   GGAGTATGACTGGATTCGCAAATTGTTAATGAATGAACCGCGTGGTCATGATGT
5   A24   AX00001626   ATTTAAGTGAAGAGTTAGAGCACTCATTTGAATATAGGGCGCCAGGAAGTATTC
5   C02   AX00001627   TCCAGCATTATGCATGAACTGCTTCATTACAATTGGCCAGGTAATATTCGCGAGC
5   C04   AX00001628   AATTAAAACTAAGAACACGTGCTGGCATGGGATTTTGCGGTGGCCGCACATGTA
5   C06   AX00001629   TGACTATGGTTTCTCTGCTGAAGTAGAGGTAAATGGTCGCCAGCAAATTTTAATT
5   C08   AX00001630   AACACAGCACCAAAAAGTAATAAAGGAAGCTTTATGAAAGGTTTATTACTAGGTG
5   C10   AX00001631   TGACCCAGCTGATCGAAGTGATGACTTAATCAATCCTGTTCATTTATATGGAGCT
5   C12   AX00001632   CCTCTGGTGTATTATGTTCAGCACATGATGGTCAATTATATGTGTATGAATACCT
5   C14   AX00001633   GGTCGCTGCAAACTATTACGTACCAAAAGGATTTTTAAAGGGTCCAGATAAAAAA
5   C16   AX00001634   TCAGCAGTTACTGCAGCACATTCAAATGAGTTGCATTGGAAATCCAAGTGCGAA
5   C18   AX00001635   GATGCGAATTGGGAAACTTGTATATCAAAAAGTGGTTATGTAATTTATGTAGCAA
5   C20   AX00001636   GGAGTAAAGGGCAGTTAGTACAAACGGAATTGCAACGCTTTGCGGTGCGTTGG
5   C22   AX00001637   CCAATCGATTAGTGTATACAATGCCTGTACTGCAAAAAGATACGCGTATAAGTGG
5   C24   AX00001638   TGAAAAACTACAGGAAGCGCATCAAGATTTAACAGATCGTAATGAACATTTAAAA
5   E02   AX00001639   CGTTCGCAAATACAAATCAACAAATTGAAGTATTTGATTGTCAAAAAGAAATGGT
5   E04   AX00001640   AGAGACACCAATTGGCCAAAAGTTATATTGGGATTATTTATGCTATGTAAAAGAA
5   E06   AX00001641   ATGTCGGGTCTTTCTTTTTGGAGCTGCTCCAGAAAGTAATAAAAAGGCATTAGAA
5   E08   AX00001642   GCACGTAATGCGATAGAAAGTGGTTGGGTAGATGCAGAACCGAGAGAGAATAA
5   E10   AX00001643   GTAACATTAGAGTCAGTTACATTATTGCAAAAAATGAGAGAAGGCGCTGTTTATA
5   E12   AX00001644   GTGTTGGACGATTAGTCCAAATAGATGAAGATACTTTAGAAATGGGCGGGATTT
5   E14   AX00001645   GTTATGGTTAATGCTTCTCAAAGCAAAGTAAGAGACTTAGGTGCTTACGATGTAA
5   E16   AX00001646   GAATACAAACGCTTTAGGAGATTCAAGAGCTATTCTATCAGAATCGGCAAGATCT
5   E18   AX00001647   CTTTTACTAGTCATGCTGGTAACCTCCAAACTTCAATTATTGAAGGAGATGATAT
5   E20   AX00001648   AGTAGCAGTGCACGAATTAGCGGATCAGGTAAAGTTGATGGCACAGTTCATGCG
5   E22   AX00001649   CATACGGACAGTTATATAGGTGGAAAAGAAAAAATTTAATACCGGAAGATTGGTT
5   E24   AX00001650   GATTGTTACTACAAGGTGTTGCAATCGGTAGTTTCGTTTTCGCTCAATCCGTTTT
5   G02   AX00001651   GAAAAAGGCACTCGTCATCTATTTGATTTAGATACAAATGTTGGATTCTTCGTAT
5   G04   AX00001652   TAAAATTCATGCTAAAGGACCGGATTTACAATATGTAGTTCAACAAGTTGAGTCT
5   G06   AX00001653   CTGGATGGATATGGATTGGTATGGATCAATTTGGTTTACATGCTCGAGAGGCTA
5   G08   AX00001654   TTCAAATTTCAGCAGCATTTTATTTCCCTGCATTACAATCTGTAATTCCACTCATC
5   G10   AX00001655   CCAATTAGCTTCCTCTCTGTGCCTGGTGCGAAAGATGTTGGCGTAGAAATCAAC
5   G12   AX00001656   CCCGGTGATAAACTTGATTTACATTATGAGTTAACTCGCAATCGCCGAGGTTTTG
5   G14   AX00001657   GACCAATATATTCGCGCTGGTGGAACCGGTGTTGGCGGTGGTACTATTATGGG
5   G16   AX00001658   ACCAACTACAGGTTTAGACGCAGCACATCGTGAGTTGTTTTATAGTTTACTACTA
5   G18   AX00001659   CATTTATCGGTGCAGCACCAGCTGTTATCGTAGGTCTGTTCGTATCTCCGATGC
5   G20   AX00001660   ATTTGTGATACTTGTCATGAACAAATGACAACAAATATTGATCGCCCCTTAATTC
5   G22   AX00001661   TTACAGATAGTAAAGTTGTGTTCCCGCCAGTTCAAACGCCATATCCTCCTATATA
5   G24   AX00001662   TAAAAACAGGAGAGTTATTCGGTCATTTAAGTATTAGTGTATTCAGGGCTGCGG
5   I02   AX00001663   AAATGGACAGAGTTTCAAAGTGGTCCTCCTTATTTTGAAGCAATTGCATCAAATC
5   I04   AX00001664   CACGTGAAAATGATCAAGTGAATTTATCAGCTTGTCCTGATCACTATGTACTAAG
5   I06   AX00001665   TGAAAGGATTTGGCATAAAAGATGTTGTGAATCATGCAGGTGTAGCAACGGGCT
5   I08   AX00001666   TTGAATGTTTTCGTACATATCCGAATGTAGTACGTAGTAACCATCCATTAGGAAG
5   I10   AX00001667   GTTATGAAGTATCAACAGGCGGGCTACCGTCAAGTAGCCAAGTTTTCCAATGTT
5   I12   AX00001668   TTACGGATACTTTGGATGATTTTATTGGTGCATCAAAAAGAGAAGAAGAATTGTT
5   I14   AX00001669   TAGAAAGAATGGAAGAATGGACAAAGTCTGATGATGAATGGATTGGACGAGCAG
5   I16   AX00001670   AGGCCACTACGTTGGGATGCACAGTATGACTCATAACTACAAGAAACTTTACAC
5   I18   AX00001671   TCATAAACAAGTTGTTGCGTTCCGTAACGGCAACTTCGTAAGCCCAACAGTTAC
5   I20   AX00001672   ACCCATTCGTTGGCTTCACACCTGAGCGTGAAGTAGGAAATGACTTATTAACTG
5   I22   AX00001673   ACCCAGCCGACTATGATGGTGTATCTTGTTTTAATAAATTTGAATTCGACAGATT
5   I24   AX00001674   TCGTACCACTGCATAATGAAGCACGAAATGGTCTATGGAACTTTATTTGCCAGC
5   K02   AX00001675   ACGGAAAATCAGCTCTAAAAGGTAATACAGTTAATAGTTACGGTGATCACCGCA
5   K04   AX00001676   AGACGCGAAAGAATACCGAGACTCTTTACCAGTACGAAAGAGAGGGGCAATTCC
5   K06   AX00001677   GCTGTTCGCCACGAGTTTTAGATGAGTTGCAAAAATCGTGGTTGGATCATGCTT
5   K08   AX00001678   ATTCCAAGCGAGTATTGAAAGATCTGATAGCTGTGCAGTACCAGCAGCAGGTGT
5   K10   AX00001679   GATGAAAGACCAAGGCTTAAAATTAATGCGCGGTGGTGCTTTCAAACCGAGAAC
5   K12   AX00001680   AGCGATTTATTAAGTACGCGGTAGAACATTTGGAAGTATTACATCCGCATACGAG
5   K14   AX00001681   CCATAATGACCCAGTAATGAAATATTTAGCAACTGGTTTACCACCAAGTACAAGA
5   K16   AX00001682   TCGAATTGGCAATACTGGTGCCATTATGTCGGATTTTTTACTAACATATTTAAGC
5   K18   AX00001683   CAACGCGCAGAGCATGTAGTGAAGGATATAAAATAACGTTAGTGAGTGATGCAC
5   K20   AX00001684   CGGACAAGGCACACTTTTAGTATCACAGGATGTTGTACGTAGAGATATGCTTAG
5   K22   AX00001685   ACAACTGCTACTGCAGAAACGATCGTAACAGCAGATGTACTCAACGTACGTGAA
5   K24   AX00001686   CGCGATGTATTCCACCTATATAACAACATGTGGGACCGGGACCTTCATATTGAT
5   M02   AX00001687   AAAGCTCTAACGAATGGAATAATGCAGGTACAGGGCATTCTGCGCTATGCGAAC
5   M04   AX00001688   TATCCGAACTGGGAAATTGTAACGACGCAGTACGGTGAAAATAATGCGCAAAAG
5   M06   AX00001689   GATGTAGAACCACTCGTCGTTACACTCGGCACGATGTTTTTATACGGAGGAATT
5   M08   AX00001690   GAAGATATGTGCGTTTATAATTTCAGGCATAAGTGCTGCACTCGCTGGTTGCAT
5   M10   AX00001691   CATGTTCTTTGCATAAAAGGCTAGACGAAGGACTAGTTTATGTGTCGGAGGATA
5   M12   AX00001692   GATACAAATGGCGGTTTATTAGAGCTCTCGCATCACAATCGTCTAATTGGCACG
5   M14   AX00001693   AAGTTCGTCCTCATGAATCTCACTATCTTATTAACCATTCTGACAAACCTTTTAAA
5   M16   AX00001694   TGTACTTAACTCCTGCATTCCTGAAAACTGCAGCACACCGATGGTTATGCGTGT
5   M18   AX00001695   TGGCTTAATTATCGGTCGTTCCACGCTTGAAGAGCCGGAGATTGCATACGAGTT
5   M20   AX00001696   TGTTCTTGTGAAAAAAGTAAGACGCGGCGACGAAGAAGTAGTCGTTATGATTCG
5   M22   AX00001697   CATACGATCCGCTATGCCGTCAGGTGTATTAGTAGGGGGAATATTGAGTGAAAT
5   M24   AX00001698   TGAGAGAGCACTTACAATTTGTCGAAGAACATAATACGTGGAAAGCATTGCTTC
5   O02   AX00001699   GAATCTTACAGCTGAACAAGCATGTTGGCAACCAGAAGGTGCTGCCAGTAATAC
5   O04   AX00001700   TTGTTTACACACCTTCCAAACATGAAAAAAAGGATTTCTTTTCTACTATTTCAAAC
5   O06   AX00001701   GAATGAAATCAAAAGTCGATGCTGCAAAGACAGCACTCTCTCTTGGTGTCAGTG
5   O08   AX00001702   GCGAGTCCTCCGCCAACTAACTTACTTCAACGGGACTTAAAGGAGGATTATTCT
5   O10   AX00001703   GAAACGAAGGATATGCTGTCAGTTATGGAGAAAAAACAGAAGGGACAGCTTCAG
5   O12   AX00001704   ACAACTGCTGGCATTACAATGCAGCGCTGGTTCCCTGATATTCCTGTTTGGGTT
5   O14   AX00001705   GGCAATCGTTCCTATTAGTACATGGTACGATATTCTTAATTGCAGGTTCAGTAGG
5   O16   AX00001706   CGCCCCTGGTATTATTGTTATTGGAATGATTATAATTTTTGCTTCAATGGTAATCG
5   O18   AX00001707   CAATGGCTAACCTTTCGATCTTGAAAAATGGTAAAGCAAAAGCAGTCCGTTTTTC
5   O20   AX00001708   CGGGCCAATTAATCGGAACGTGCGGTTTTCATTTAATTAACCATCATCATAAGCG
5   O22   AX00001709   ATAAAAGCAGAGCATGGTACATATATTGAATTTAATACGGGTACTACCATATTAG
5   O24   AX00001710   ATTGTTGAAGTTGCCTCAACAGATAGAAAGAAGTGCTATGAGTTAACGCCGTTTG
5   B02   EMPTY        -
5   B04   AX00001711   TTTTACGTGGGAGAGAATATTGCACACCAGAAGATATACAATTTTTAGTTCCTTC
5   B06   AX00001712   AATTATTGTGTATCCATCCCCTAAAGAAGTAGCAGGTTTGCAAGAACTTCAGCAA
5   B08   AX00001713   CAGCTATCGCTATTTACGTCGTTTGGAAAATAGTAAAGAAACGAAAACAATTTAG
5   B10   AX00001714   GTTACCATTTTGACGTTATTGTTAACAGATGAACAAATGCTCAGCTGGGGCTGG
5   B12   AX00001715   GCTGTCCCTCATGCTTTTAGTCGAAAATGCATTGATACAATTGGTTTTCATTCAC
5   B14   AX00001716   GTCCTACAATTGTAATTAGTCCTAGTGGATCAATTGTTATTACTTTACCATTAGTT
5   B16   AX00001717   ATGATATCTTGCAGAACCCTATTCTATCCCAAGTAACTCTTATTGAGAAAGGATG
5   B18   AX00001718   TCTAGTTTTCGATTTATCTTATCCAGGTTTATCAAGAGAAGAAGTTGAAGAGAAA
5   B20   AX00001719   TATAGCTAAAAGACTTGGTGCCACTATTATTAAATATAACGAACGACTTGGTCAT
5   B22   AX00001720   AATCGACTGATGTTCAAGTACAATTGCATGCCACGAATATGGATAGTATATGGAT
5   B24   AX00001721   GGTAAAGGAGCAGGAGGCGGGATACCGCTAGGTGGAATTATTGTAGGTGAAAA
5   D02   AX00001722   TATTATGTAATCACATTCCTGTCTTTTCTGTTCGCGATCCGATGCGTTTCCCTGA
5   D04   AX00001723   TGAACATAGTTTTTGGGAGGTGAGTAAAAGAGATCTGGAGGCTGCCCATTTGAT
5   D06   AX00001724   ATGGTGCGATTGCGACAGGTAGAATTGCTAATATCAATATTTTAGAAAGTAAAGA
5   D08   AX00001725   CCAGGAAAGAATCATGCTCGTGGATATGTGAAAATGGAAGAAACAGGCGAGTTG
5   D10   AX00001726   TATTAACACCATGGAGTCTCAGTTTAATGGTGTGGTATTGGTTGGTAATGTTAGT
5   D12   AX00001727   GTCATTCATCAGTTAAAACAGCCATTACCGACAGATACGATAAGAAAAACGCTAG
5   D14   AX00001728   TGAAGATTTTCGTTCCATCCACTGGAGTGCAACAGCGAAAACAGGGACGATAAC
5   D16   AX00001729   ATTACTGTACGCCAGATGATATTAAGACGCTTGCTGCATCCGTTTGTGCTCATCG
5   D18   AX00001730   AGTATGGAAAGATGAAGAGGCAGTTGCGAGTCATAATACGAGTGAACACTTCAC
5   D20   AX00001731   GGTCTTGTAGCAATGCAATTTATGCTAGCAGCTCGTGCTCACGGTTACGATACT
5   D22   AX00001732   GTTCGAAATTTGAAGGGTGTACGGGTATGAGCCAGTCTCGATTAGAGCTTATAC
5   D24   AX00001733   AACCAGTAAATGAGTTTGAATTAACTGTACCAGAGCATGCAATTAGTACCGCAAT
5   F02   AX00001734   GTTCTAGTACGGTTTGCTTTATGTTCTCAGGTTCAGGATATAATTACGATAAGCC
5   F04   AX00001735   AGAGGGTAGAACGTATTTGTTTAAGTGGGTGCCGGTAGAAGAGTTACATGCATA
5   F06   AX00001736   TCGTCTTCCATATTGGATTCAGCGTGTAGCAAAAGGAGGTAAGGTGTTAGTTCC
5   F08   AX00001737   ATAGGAAAAGGCGGAAACATTGGGGCTTTTAAATATTCATCTGCAGGAGCGCAT
5   F10   AX00001738   ACGACAATAGCAAGAATTGCAAAGACGTAAGAAGAATTTCTCAATACAATGAATG
5   F12   AX00001739   GCGAAACGTTAGGTTTCTTATGCGGATTCCTTTCGCAAACGCATAAAGAGGAAG
5   F14   AX00001740   AGAAGAATTTCTATGTGAGGACTGTTTGCAAAAAGGAATTGCGAGTGGAGAAAT
5   F16   AX00001741   GGTATGGAAGGTACTGAAACAAAAGATGAATGCTTACATCGTGAACTACTAGAG
5   F18   AX00001742   GAGTATGCATGGCTCGGAAATATAATTGGATTAGTCGCAGCAATTGCGTGGGGA
5   F20   AX00001743   CACATATGTGGGGCGTTTCTCCGACATTAACGCCGAACTGGAGGAATTTCGTAG
5   F22   AX00001744   GCGGAAGAGAGTTAGATTATATGACTGCTCTTAATGAAGCCAAATCAGGGAAAT
5   F24   AX00001745   TGGGAGAACTGATTAAATCAGTAAACTTGCTTATAGAAAGAACAACTTATCGAGA
5   H02   AX00001746   ATACATGATAAAACCTTTTGACCCTAGAGAGTTGTTGTTAAGGATTCAGAAAATG
5   H04   AX00001747   CAAGAGAAGCGCTTATTCGAAGCGGGAATAAACCACCATACATCTTAGTACCAC
5   H06   AX00001748   ATGGGCACACTCTACTGCACATGCAGCGGATGCGCTCGATGCGTTAGCTCGTA
5   H08   AX00001749   GTAGATACAGATTTTGAGATTGCGAGAAAACGTGGTGCTAAGCGGGAAACTGAA
5   H10   AX00001750   AAACCAGATGTCGTTTGCTACGGTGATGTTCACCAAGCATTCGTTCAAAATTTCA
5   H12   AX00001751   GAGAAAAGATGGCCGCCTTTTAGAATGGAAAATGTTATTTGTAAAGCAAGAAGA
5   H14   AX00001752   GTTGGGGACCGATTACGACACCTGTTCTTCTAGCAAGAGGAAATGAAGCGAGAA
5   H16   AX00001753   CATCACTTGGCTTTGCACTTGGATGGAACTATTGGTATAACTGGGCAATTACTAT
5   H18   AX00001754   ATTCGTATTAGAGGGACAATGACAAACTCTTGTAGTATTTTCGTTGATGTCGATT
5   H20   AX00001755   GGAATACTGCTGAATATGCCATTCGGCCTTTTCTTGAAACATACCATGAAGACAC
5   H22   AX00001756   CCGCCAACTATTTATGCGACTGAGGGTTATGCTCCAAACTTGCCAATTGCTCGG
5   H24   AX00001757   TCTTTTACTTTATGTAAAGTGGAAGGGAAATCAATGCAACCGACTTTATATGAAG
5   J02   AX00001758   AATGGATTGTATGCTGATGCGAATGTGGAAATGTACTTATCAAGAGGGTACTAT
5   J04   AX00001759   AGAGCAAGCGAGTAATTATCCAGGGCAACCGAGTATGTCACTTTCTACTATTCG
5   J06   AX00001760   GTTGCGGCAATGCGTATTACAAAATCGAAAATAACAACGCCTGTACAAGAAGGA
5   J08   AX00001761   GCAACTGGTGCCATTTTATTAATGAAAGGATTCTTCGATTCAGTAGGTATGCATG
5   J10   AX00001762   GAAGGCTATGTAAATTCGGTGAATGGTGAGAAAGTAGCAGTTCAGGCGCAGAC
5   J12   AX00001763   GCGGGACTCGAAATGACGATTATGGGACCGAAATTGTTAATAAAGAAAACGACG
5   J14   AX00001764   ATGTTAGGCTTTACACCAGGGTTCCCGTATTTAGGAGGACTATCAAAAGAACTA
5   J16   AX00001765   GATGGAACGGTTGTAGCAGGCATTAGTATTTCAGGATTAGCAATTGAGTACAGC
5   J18   AX00001766   TGATGCCGACTTTAGAAAATAACGAACGAGTTCTCGTCAATAAGATTGGTTATAG
5   J20   AX00001767   TAGAAAATCCAGTAGAAGCGATGAGAACGTTAAAGAAGTTTCATAAAGTGACTCA
5   J22   AX00001768   TTTAATGAATAATCAAGCACTACCTGCTAGTGAATTGGCTTATATGGCAAGAGTG
5   J24   AX00001769   TGAGGCTATGTCCTTTGGTGAAATGATTCGTCACGTATGGAGTTCAACTTTTTAC
5   L02   AX00001770   AGATTATTTTTACAGGTGGTACAAAGTTCGAGGCAGAACTTGAGGAAGCACGTA
5   L04   AX00001771   CGGGAAATTTGGGCGTATTTAATCTCTAAAATGGATAGTGTGCAAGATATGCAG
5   L06   AX00001772   GGACTACTCTCGTTGTAACATTCATCGTAACTGCTATCACCGTAAGAATCCCGC
5   L08   AX00001773   ATTGCGAAAGGAAATCCGTCTGAAGCGTATCCATGGCCTTGGTCTATTAATAAG
5   L10   AX00001774   GGAAGTTTCTAATTCATTATATATTCATAGATTTGCGGTAAAACGGAAGTATAAA
5   L12   AX00001775   TCTTCTTAATGATATCGGCGGTACTTTCATTAGTTGGACTAAAAGGAATCGGTTT
5   L14   AX00001776   TTGACGCCATTACAGTGAAAGATATTACAACGAAAGCAAACATTAATCGCGGTAC
5   L16   AX00001777   AGTGCGACGGCTGAAGATTTACCGTATGCCTCGTTTGCTGGTCAACAAGATACG
5   L18   AX00001778   TCTGTCGCTAAGGATCGATTTGGTACCAATAGCCGCCCAAAAGCAATTATTTTAA
5   L20   AX00001779   CCTAGAGTATTACTAATTTCTCTTTTCCTTACAGGAGCTGCCTATTTAATCGGAG
5   L22   AX00001780   TAATGGTGTAGCTTTACCGCCTGCTCCGCCAGAACGACCAGTTGCATCTATCGA
5   L24   AX00001781   GAATCATGCGAACTTGAAGATGAATCCCTACTCTTTTTATCGGATGTTTTGCCAA
5   N02   AX00001782   GGTGGATTACCTTTTGAAGGAAGGAACTTGCTTTCGAAAATTCAAGAGTTGACT
5   N04   AX00001783   AGCAGATCGACTTGGGATTGCGAAAAGCACCTATGCCGGGTATGAAAATGGTTA
5   N06   AX00001784   GAGCATAGAACTTCAAACTTTAATTATAATGAAAGAACACCGAAACAAATTCCCG
5   N08   AX00001785   CCGTTAAGGACATGGGTGTACTTTAGCATTTGGATTACTATTGGGGTAGTAATAT
5   N10   AX00001786   ATTAAGAGCACTGAGAATGAATTTGATAGAAAGTTAAAGGTTATTAGAGTAATGC
5   N12   AX00001787   GATTTTACTACCGTAAGGAGAAAGATGACAGAATTGAATAATGAACCAACATTAC
5   N14   AX00001788   ATTGGATTACCAGCTAAGAGTGGGGTATCCGGCGGAATTATGACACTTGTTCCC
5   N16   AX00001789   AAAAAGGATTTAGTACTTACCATTTCACTGATACTAGCAATTGTAAGCTGCTTAA
5   N18   AX00001790   GCAGGGGGAATCGAGTACTTAGGGGCTTATTTACGTGATCGTGAAAAACAAAAT
5   N20   AX00001791   CCGTTAAGTGGTCGATCTTGGGAATACCAAGTTCCCGCTCTTGTTGAGGCTGGA
5   N22   AX00001792   CGAATTACAACGCGATTGGCGCAACGATGTCGAAGGTTTTGGCAATTTACTTGC
5   N24   AX00001793   TGTATGCAGTTGATGATGCTTCAGGTGGGACTAGTTTGACAGCACATAACGCTG
5   P02   AX00001794   GTCCCAAGCAACAAATCTAGAGAGTATACTGTTATTTTTCGCTTTGATACGTATG
5   P04   AX00001795   AGGTGTGATTACTATAGGCGGTCTATTAGAGGATCTCACTTATTTAACACCTTAT
5   P06   AX00001796   CCGGGCTTCCTGTCACTTATTTTGGTAGTCAGCATGAGCAATTACAACGTGCAC
5   P08   AX00001797   TCTAACAAAAAAGATTGCGGATGATACAAACACAAATACGATTGGAGTAAAAGAA
5   P10   AX00001798   ATGGTATGTTGCAGGGCATTCAATGGGCGGAGCTATGATTTCTAAGTATGCCTT
5   P12   AX00001799   GGTTTTATGCATAATCGCACAAGAATGGCTGTAGCCTCTTTTCTTGTAAAGCATT
5   P14   AX00001800   AAAATATGTTGACTATACACAGCTGCGATTCTGTAATTGTACATCCTTTTGGAGA
5   P16   AX00001801   GAATGATACGATGGCGCTCGCAACAATCAATTGAGGAACAGGAACTTCTCATAG
5   P18   AX00001802   TGGAGATAGAGTTGTGGGGCCTTGGCATCTAGATACTTTAGCTTGGTTAATGGC
5   P20   AX00001803   AGGCAACATGCCAGGTATCATGCTTGAAACGCAAAATAATAATGTCGCAGCATG
5   P22   AX00001804   ATGGATGGGTTATATAAGCCCTTGGGCATTAGTGATGTTCCTAGGTTTGAGAAA
5   P24   AX00001805   TCCAGATTTGTTAATTGTACCTGGTGGTGGCTGGAATCATAAAGCAAAGCACGG
5   B01   EMPTY        -
5   B03   AX00001806   AATATTTCAGCACCGTAACTTAAAGAGTTGGAATCAAAGAGTGTATACGCTAAGA
5   B05   AX00001807   CTACTCCGCCGCATGTGAATCGTGTTCACTGGGGATTTGATGATCCAGCAGGCA
5   B07   AX00001808   TATTCCCTAGTGTAGTAGACGGACTGAATACATTACAAGTTGGAACGACGTCTA
5   B09   AX00001809   GAAAAAGAGGGTTTCTTTGCGCGTGATGAGATCGATACAACTTGTTGCTATGCA
5   B11   AX00001810   TGTATGAACTTTGTCAGCGGGGACAGACGTGTGTATGTGATTTAACAGAGATTT
5   B13   AX00001811   CAATGCAAAATTGCTAGATGATCCGGAAATACGAAATTTTGCTGCGAATTCATCT
5   B15   AX00001812   GAAAATGCGAGAATTTCTGTTTCAGAAATAGGACGAATTATATCCATGACGCAAC
5   B17   AX00001813   ATTCATCCGAGCGGAAAAACAGCGACAACGAGCCCTTCACTAGCAGTCGATCCA
5   B19   AX00001814   ACAATCCGACAACGTACGTATGGGGACCACCTGGAACAGGGAAGTCTTACAATT
5   B21   AX00001815   TTGAAGGCTACAACTCTTCCCTTCCGGCAGAAGGAAAAGTACATCACATTTGCT
5   B23   AX00001816   TATGGTCTTGGCTGGGATAGTGTGAAACTATACCCATTCAGTGAATATGGGATA
5   D01   AX00001817   ACAAGATGCTGAAAAATACGCTGAAATGCACAAGAACAGACTTGAAGCAGCTGG
5   D03   AX00001818   TATATCTGGGAAAATGGCAGATGAATTTAAGCGATTTGGTTTACCTTCGTTTTTT
5   D05   AX00001819   GTCAATGGAGAGAAAAGGGATTGTAAAGAAGGCTTTGAATGAGCAAGATCGGCG
5   D07   AX00001820   TATTGTAACTTCTTCTTATAATGGAAAGCCGCCAAGTAATGCAGGGCAGTTTGTG
5   D09   AX00001821   ATGATTTTAACACCAGCTTATGTACAAAACGTTCGCGGTATTTCACCGCTGAGCT
5   D11   AX00001822   CAGCCTGCTAATTGGACTCCATTCCCAGGGCATACAGGTTTTAATTTTCAAAAAC
5   D13   AX00001823   TGAAAACTACACAGAGAAACAAGTTCGTGAAATTTCTTTAGCCCATACAAATGGA
5   D15   AX00001824   CGAATGATTCGAAGCAAATACAAGATTTCAAAAACGAAGTCTCATCTATTGTAGA
5   D17   AX00001825   TGACCTAGTGGTGGATTGCAATATGCATAAAGTAACAAGAGGAGACCAAGTTAT
5   D19   AX00001826   AACTGTTCCGTGACGAAACCAACATAATAGGTAAAGTCTCCGATAATGGCATAG
5   D21   AX00001827   GGTTCCATTCACAAATAGCGGTCAAGGATTCCACGATGCTGGCTGGCGAAAAGA
5   D23   AX00001828   AATGGGATACGTTGCTTGTGCGCAAGAAATTATAGCGCAATCATTTGACCAAGG
5   F01   AX00001829   AAAAGACTATCCGCAAGTTGTTTTCTTCACGAGTCATACGCACTGGGATTTAAAC
5   F03   AX00001830   TGACGCCGCTTTCTAGAGCGCTTATTATGAATGGGGATATAACGCCAACTGGAC
5   F05   AX00001831   ATGGATTACACAAGTGCAATTATCACCAACACCTTTAGCACGTGCGGCATATTG
5   F07   AX00001832   GTACTTTACGAAAGAGTGGCTCGAAGCACGCGAAGTACGAATATTTTTAGAGGT
5   F09   AX00001833   CTCCTCAGCAAAGTACGGGAGATCGATTAGCTGAAATTAAGCAACATAAACAAG
5   F11   AX00001834   AGTACGTTATTATCAATCGCGGGTGCATTACTATCACCATCAAAAGGGGATATAT
5   F13   AX00001835   AGCAAATAGCTTAGTCGTGCAGGCGTTATTCTTATCAGTCGTTGCGATGGGAAT
5   F15   AX00001836   CAAGTGAAGACCCAGCTAAGTGGAATTACGTTTCATCTTGCTGGGAGTTTGATG
5   F17   AX00001837   TCATCATGCCCATCGTAGCCTTTATCGAACAATTCGCCTATCCTGCACAGTCAAA
5   F19   AX00001838   TTGAGGGCGAAAGTAAGCGAATGTCTAGTTTATGTAAACAGTTACTTACGCTCG
5   F21   AX00001839   TAATTACACTTCACGGGACGACAATTGATCGTAAAGGTGTTGAAGTAAAGTGTAA
5   F23   AX00001840   CTTCATTTAACAGAAGGATGGACGATTGCTTCGGATGAAATGCTCGTAAATGCC
5   H01   AX00001841   CGATGGAAGATCAGGGAGACGGTGCTACTAAATATGTCGTAGTGGAGTATCCAT
5   H03   AX00001842   AAGGGCGCTTAATTGGTGGTTGCATTGAAGTACTTGAATTTGCAAAAGGAACGG
5   H05   AX00001843   TTTAGCTGAACAATATTCACTGGAATTGGGTGAATACATAAGCTATGAGTTACTT
5   H07   AX00001844   AAAGGAATAGTGCTGCTAAATTTAGCATTCTTGAAGTATGGTTTGGGGTTGGGG
5   H09   AX00001845   AAAAGTACTATGGGGTGGCTGTATTCTGATCAAAGTATGTCTACGTTAGCTATTC
5   H11   AX00001846   TAATTGGTGAGGTAACACGAAACATTCAATGCGTAGCTGATAATGCTTCTGAAG
5   H13   AX00001847   CACAACGTCCTACCCTGGTTATGGAACGTGATGAAATTCAATTAAAGCAAAGCTA
5   H15   AX00001848   AAGTACTCGTACCTCTTGTATCATATCTTTCATCTGAGAATGCACGCGGTCGCG
5   H17   AX00001849   GATGTTGAATTAAGCATCGATCTCATTTACGGACCAATTTTTTATCGGTTGCTAG
5   H19   AX00001850   ACATACTTGATCGGAGATTTCATGCACAACCAAATGCTTGCTGGAAATGTGGAC
5   H21   AX00001851   ATGTTAGGTGTTAATCCAATGTATCTAGCTAATGAGGGCAATGTTTGTATGTTTG
5   H23   AX00001852   TATTATTACGGGTATGCAAACTCAAATTTGTGTCCAAACAACTGCAGCGGATGG
5   J01   AX00001853   AATGTCACCGGATTGCCGGTATGTATAGTTATCTAACAAAGGTAGTCACGGAAT
5   J03   AX00001854   GTACATTGCAATATCTTTTGTAACAATAGGGACCCACTCATATGGTGATAAGGAT
5   J05   AX00001855   TGTGTCAATAACATTGGACCAGTGGCTAATGAAGAAAGACTAATCAAAGTTAATA
5   J07   AX00001856   CTTGGTGCATCTACGTCTGAATCAGAAGAAAATTGTGCAGTCATGGCAGCGCGT
5   J09   AX00001857   GAACGCGGCCTTGTTACGTTAAAAGGACATCGATCAGTCGGTGGTATGCGCGC
5   J11   AX00001858   ATTTGTAGCGTTAGATTACAATGTAGTTGAGAAATGGTTTGGTTCTATGCCGGCG
5   J13   AX00001859   AATCCATCATATGAAGAAGTGAAGCAAAGTTTATTTGCGACGACAGTGTATAATC
5   J15   AX00001860   ATATGGCATGAGCATCCTAATACGGATAAGCTATTTATTGTGCTTGAAGGGGAG
5   J17   AX00001861   CAGGACAATCTCCTCGTCTTGTCGAATTACTTATGCGTCTTTGGGATGTGTATAA
5   J19   AX00001862   AAAGTATATGGCGTTTGATTTAGGCGGACATTGGCACGGACAGGCATTTCGATA
5   J21   AX00001863   TACATATATTTGTTAACTGGTACGAAAACGAAGCAATGTGGAATTTACGTATTAC
5   J23   AX00001864   GAAAAAAATATACATATCTAACGGTGCGCACGAGCCAGTTTTCGGCGTAGCTAC
5   L01   AX00001865   ATTCTGAAGAAATAAGTGCACTTGAGCTATGCGAACAATTAATACGATCTGGCAA
5   L03   AX00001866   CGTATGGAACAAGAAGGCTATGCACCGTCTCGCCGTATGGAAGAGCCAATCTTT
5   L05   AX00001867   CTTTTTCATTCTGGGTATGGTTTATCCTTAGATTTCTAGTTGGAGTCGGAGATCA
5   L07   AX00001868   ACACATAATCAACCTGAACCAGATCGCTATGAAAAGTATTTAGACGATATGTTAA
5   L09   AX00001869   TCTCCCACTGGGTTATTTAGTGCGCAATGGGCTGTAATTTTCCGCATCAATCAAA
5   L11   AX00001870   GTGGTTCTGCGACAGCTACGTACTTCTCATTCTTTGATAGTGGTATTGGATTTGG
5   L13   AX00001871   ATCACTTACAACGTCACCAGTCGATATTTTGATTATTGATTCTGTAGTGAATCGT
5   L15   AX00001872   GAAGTATATAAAACGTTAATCGCTCAAGGGAATAGTAAAAATTATCATGTGTTTA
5   L17   AX00001873   TGATATAGTCGGTGTTGAGTCTGTCATGGCAGAAGCTGAACTTATGAGTATGGC
5   L19   AX00001874   CATTATATAGGTATTATCGTTACTCTAGTTGCCTTCTTTCCTTATATAGACATCGT
5   L21   AX00001875   AAGGAAGCGGCCCTGGTAGTACAGACTTCTATAAACGTACAAATCAAGGTAGCG
5   L23   AX00001876   CATTGGAGGGAAATGGAAAGGGGTTATTTTGTATCATTTATTAGATGGTACAAAA
5   N01   AX00001877   CAGGAAACAGATTTTAACTTATTACAATCCGACCGTGCTGTATTTGATTGGGCAT
5   N03   AX00001878   GAAGTGCTCGGAGCGATGGATGTCGAAGGTGCAGAATATATTGCAGTTGCCTTT
5   N05   AX00001879   TTCAATCTATGGTAGATCATTCGATTCCAACAAGGGCTGAGGTAACTGATGTGT
5   N07   AX00001880   AAAAGAGACGACGGGAAAAACAAATGATCAAACGACTAGCGGAAAAACAACAGA
5   N09   AX00001881   CAGAGGAGCTGAAGCATCATTTAGTATGGAAGTTCCCGCAAGGTAAAGTAGGAG
5   N11   AX00001882   TTACTGTTTGGTTCTATCACGCATGCAATGTATGAGGGAATGATACATTTAGGGC
5   N13   AX00001883   AAGCGAAAAGGACGTTTGGTTATGTCCCAGATAGTCCAGATATGTTTTTACGATT
5   N15   AX00001884   TGTTTACTATGTTTTGTTTCTTCTCCTTTTTCACCTCATATAGAACGGTTCAACAC
5   N17   AX00001885   AGTAAGGACAACATTCGCGTCATTGCAAAGGATGTAAGTAGGCAGCGTCAAAGA
5   N19   AX00001886   GGAAAAACACGCATTACATAATGCGTTTGTACAGTTCGGTATGCCTACAGGGTA
5   N21   AX00001887   GTAAAATGGGGCAAGTTGTACCGTTCTGAAGAATTAGCAGGACTAACAGAGTGG
5   N23   AX00001888   ATGGAGTTTTCACCCGTTCATACACTGTTTCGTTAATTGCGTTAATACTCCAATT
5   P01   AX00001889   AGAATTAGCTTGGATATTAGCTTGCCTAACTCCGAAAGGGCTTATGAACCGTGC
5   P03   AX00001890   CATTCTTTAGTAGAGTTTATCGATGGATCAGTTATAGCACAGCTCGGTGCTCCTG
5   P05   AX00001891   CATTCGTTTCACTTTTAGAAAAGAAAGGTGTTTCAAGAATCGTATCGATAGCCTC
5   P07   AX00001892   GTGCTTCGTTAGGTGGTAAGTTATTTGGATCCTTTGGGCCATCATTTGGTGGGA
5   P09   AX00001893   GACTTGATCTTTCGAGCACACAAATTGAAACGGCACATGAAACGTTACAGTCGT
5   P11   AX00001894   TGTCGCTGGGTATTTTACGACCATTCGCGAAATGGGAGCAAAAGATGGTGCGG
5   P13   AX00001895   TTGCAGGAGGGTTCTTACTCTTACTCGATCCAATCTATGCCTTCTCTCTAACAGG
5   P15   AX00001896   TGAATGGTTCGAAAAGGGATACAAAGAATGCTGGAAAAGCCCCAATTGGATTGG
5   P17   AX00001897   GAATGGTGAATCCTACAAGCTTAACATTAAAGATATCGAACACGCTCATAGGACG
5   P19   AX00001898   ATTTATCAAATTGGATGAACATCGTTGCCTATGTCATTGGCTTTAGTGCGGGACT
5   P21   AX00001899   AGTGGTTTACTACTTATGTGGACGATTACTCCGTTTGGAAAACAAGTAACAGGG
5   P23   AX00001900   TCGTTGGTTTCTACCTGGAAGATTCAGTAGAAGAACACATGAAAGTAATCCAAAA
6   A01   EMPTY        -
6   A03   AX00001901   TAAAGAGAAAATCGAGGAGAAGAAGAAGCTGCTCGGTATCAATGAACACGTTTC
6   A05   AX00001902   CGGTATGTATGTTGTTAGCAAATATGTACTCGACTTTATCCCACCACTAACACTC
6   A07   AX00001903   TTTTAAAGGCAACACAGCCAATTCATAAAGAGCTGAAGACCGCAATTGAGGAGA
6   A09   AX00001904   TTATCTGTAAATCCAGGGAGTGGTCCGAGACATATTACTTTTCATCCAAATGGAA
6   A11   AX00001905   TGGGTTATTATTTCACCCGTATTTAGCAGGAGAAAGAGCTCCTTTATGGAATGCA
6   A13   AX00001906   CAGCTCCTTATGTTCCGCTTTCTACTACCTTGATGAAGATTGTCACATTAATCGG
6   A15   AX00001907   ATTTTCACGGTGAACCAAGCACTTTTAGCTGCTCGAGCAGGTGCAACGTATGTT
6   A17   AX00001908   GATCAAGAAGCTTGGGACATCGTTGAACCTATCTTCCGCGATACTGCTGTAGAA
6   A19   AX00001909   ATCCCGTGGATTGGAAAATACGTGAAGGTTTACTGCAAGACGTAATTTCTTATGA
6   A21   AX00001910   CAAATGAACGTCCTACACCGATACGTTTAGGTTACCGTACAGGGCGTAAGGCAC
6   A23   AX00001911   AGCTACTGGTGGCGTAGGACACGTAGCCATTCAATTAGCTAAATGGGCTGGTG
6   C01   AX00001912   AAAACGATGCAACTCTCACTTTCTCGCAGTTTAGCTGAGCTGACGACAGGAACG
6   C03   AX00001913   TAGGGAATCCTAAGCAGTGGTTTAATGCATTTAGTAATGGGGCTATGCTAGTAT
6   C05   AX00001914   AAATAGAGATGAATAGGGCGAAAGGTTATCCGGCAGTTACTTCTTTAGCGTATA
6   C07   AX00001915   GAAATTGTGGAGTTTGCTGTGAAATATACTCCATCCGCTTTCAATTCTCAAACTG
6   C09   AX00001916   TTCTTACATCACATCGCAATGCTCCAAATCGTTTATACGGGGTTTTAGGTGATTC
6   C11   AX00001917   GGGAAAGCTGGAGCTGTAGCAAGTGATGCTACCTTTGCTGAGAAAAGTAGGGT
6   C13   AX00001918   AGTTGTTTCTCTGCATGATCGTAGCTCGTATTATATGCAGATACAAAGTGAAATA
6   C15   AX00001919   TGTCAACAAGTAATGCGATTTCAGAAAGTGCAGGTGTTCACCCAGTACGTATTC
6   C17   AX00001920   CTTTCGCTAAATGAATTTTATAAATTAATAATTGAGCATCCGCTAATGTTGCGTCG
6   C19   AX00001921   TTCTCCGGCCAATGGTGGTGCTACGAATGGTTGGATTGAAAAATATATATTCCC
6   C21   AX00001922   GATATTACACGTATTCAATCATGAATGCTCCATTTCCAGTCACTAATTATCTATCT
6   C23   AX00001923   AGCGGATGGGATTACTATACATCGTCTGGGAGGACATTTTAGTGGCGGTTCTGT
6   E01   AX00001924   TTGATCCTTTACCAGTGTTAGGAGATCCTATATACGATTTAATTTATGCGTTCTG
6   E03   AX00001925   GACAGCTTACTTATCCATCATGATGATGCACAGCAGTTACAACAAGTCGCTAAAA
6   E05   AX00001926   GCCTTACGATTGAAACGAAGGCCGGGATTTTACCAATACAAATAGGTGTAAATG
6   E07   AX00001927   AAGTTCATGAAGAAGACGACGCCATTTACTTATTTACTTCGGGAACGACTGGAC
6   E09   AX00001928   CAAAGTACAATTAGTCAACATTTATCTAAACTAAAAGCTGCTAAAATGGTTACAG
6   E11   AX00001929   CAAAGTAGCACGATGCAAGTACGAGAGAATGCTATAAAAGCTGGAATTGGTACA
6   E13   AX00001930   GGAGCTGTTCCGGAAGAAAAAGTTACCGCTTAAACATATTGAACCGCGTGTTAG
6   E15   AX00001931   TACTTTTTAAGTACGGAGCTGTATCTGTAGGGATTTTTTGGTGTTATAGAAAAGA
6   E17   AX00001932   ATCCCTTTTAACTAACAGCAACTTAGTTGAATCAGAATTTGCTCTTAGTGCCATC
6   E19   AX00001933   ACTAATGGGATAACTCGCACATCCATTCAGGATATAATGACAGCTACTGAACTAC
6   E21   AX00001934   GCGGGTGTTATGACAGAAGCACAAATAGAAGAAGAATCTAGAGTGATTCAGTTT
6   E23   AX00001935   GCATAACTCTATCCTGCCCGTTGTTCGCTTTACTGATAACGAAGTGAAAGCTCTT
6   G01   AX00001936   CGTTTCATTACGATGCCTATTAAGCGCTCATCGATATTATGGGCTCACGTTTTAA
6   G03   AX00001937   GAAAACTTGATAATGATCGCCAAGTTACGTGGTGTTTCCAATCCCGCTCAAGTC
6   G05   AX00001938   ATTACTCGCCACCTGAATGATCTTGGGTTTACCGAAGTCGTGGAAGGAACGGTC
6   G07   AX00001939   TACAGGTGCCATATTAGCGACAACGAACTGTGTTATGCCAATTAAAGGATCATAC
6   G09   AX00001940   ATGATTTATATATAAAGGATGCGTATCCTCAATGTGATATATGGATTCGTAGTGT
6   G11   AX00001941   CACTAGCTTATTTCATCGGAGTAAAACAATACACTTGGCTCTTATCAGGATTCAA
6   G13   AX00001942   TGATTCTTTACAGCTTTTTACCCCAAGGTCTTACAGTAGCTTGCCAGGTATGGCG
6   G15   AX00001943   TGATGCTGTGATGCATTTATCAGAACATCATGGTGATGCCTCACCAGGTGGTGC
6   G17   AX00001944   GCTTGAAAATAGACTTGCGAGTTACATGTTAGCAGCAGGAGAACGGGCAGTACA
6   G19   AX00001945   TTTTTTTATACAGTGCTGGAGCGATTGGAGTATTCACTGTTCTTTTTAATAATATA
6   G21   AX00001946   TTACTCATCTTTATCGGACAATTATTTGCAGGAACTATCATTGATTTCTTCCTAAC
6   G23   AX00001947   TTATAAAAAATATTTCATATGGGTAGTTGATCATCACAATAACGAAGTGATGATTG
6   I01   AX00001948   TGTATACGCCAGGCCATTCTCCAGGCCATCAGTCGCTATTCATTGAGACGGAGC
6   I03   AX00001949   GGGAGCAGAGATGAAAGATCATCCGTTCAAAATGCCGTTTGCTCCTGTTACAAA
6   I05   AX00001950   AACGATTCTTCGTGAAAGTGTAGAAGGGCATAAGAGGCATGTTATGTTTGCTCA
6   I07   AX00001951   AGTAGATTGTGAAGCAGATATTGTAAAGGTTGAGGATGGAATTTTTGAAAACAAT
6   I09   AX00001952   ATTCGCTTATTAACAGATCAAGGAGTACCTGTAACGTATGCGTGTGGTACTTTAG
6   I11   AX00001953   CACGGCTGGGTATATGCTGAAGGTATTACGCACTGGGAAGTAGACGATAAAGAG
6   I13   AX00001954   TTTAGGCTTTATACTTCATTCGATTATTCATGTAGACGCTGCCGTTATCGCGATG
6   I15   AX00001955   AGTGCAGCAACTAAGGCACGAAAGACCAGTTGTTGAAGTGAGAAAAGGTGTTCA
6   I17   AX00001956   CAATTCATGGCATAGAGTGGAATAACAGAACGGGTTTATTAGCCATTGGTATAG
6   I19   AX00001957   GACCGATGGGACCAATTTTGTTCCAAGACTTAGGGTTACAACCTGCAAATGGTG
6   I21   AX00001958   TCGGTTTAGTTGCTCCGCATATCGCAAGGAAGTTAGTAGGTACTACATATCAAC
6   I23   AX00001959   TAGCGTTTTGGTACGCTGGTGGTGTTGCAGGGGTTAAGTGGGAACACTTGAAA
6   K01   AX00001960   AATTACTGTCTTCCACCTCATCGGCCTGTTACTAGAAATATATAAAGTACATTTC
6   K03   AX00001961   CTCAAAAAATGGCAATAGCCAAACAACTGGGTTATGCGGAAACCGCATTTATATC
6   K05   AX00001962   TGATTACCCGCTCGCAGTTTTACTAGCAGGACAATCAGAGAATGTAGAAACGCT
6   K07   AX00001963   TAAAAGAACAAGCAAAACGTATTAACGAAATTCCAGCAGAAGTATTTGAAAATAA
6   K09   AX00001964   TGTAGCCGATTGCTACCGATACTGGCTTGGATCATTCGCATTCAAGCAAAAACG
6   K11   AX00001965   CGAAAGAGAAGAAGTGGATTGATTCCAATTCTTATGTGGAATTAAAATTTAGCAC
6   K13   AX00001966   GGGACAGTGTATTTACGTTATAGCAATAGATGTCATGCAGCATGGGCTAAGTTT
6   K15   AX00001967   TCGATCTTGCATTTATTTTGGATGAATGTAAAACAGAAGATGCTTTACATGTGGA
6   K17   AX00001968   TATGGATACTTCAAAAACTTTAACTGGCGGAGACCTTTGGAACGTGCTTACTACC
6   K19   AX00001969   CGGCGGGAACGTTTTAGTTGTCGTTCATGGGCTTTTGATTACTACCTTAATAGA
6   K21   AX00001970   GAGTTTAGTGATAAAAAAGAACATGAACTTGTAAAACGTATTAGAGAATGTGACG
6   K23   AX00001971   AGGAGTTTTATCTTGCAGGATGTATTACAGTTGCGAGTACGCATTACGGTGAAA
6   M01   AX00001972   TACTGGAATCACAGGACCTACCGGTGCGACAGGTTTTACTGGAATTGGCATTAC
6   M03   AX00001973   AGAGAAGGTGATAGTGTACATGCTAATTCTGGTTTAGCAACATTAATCTCTGATG
6   M05   AX00001974   CACTCTTACTCACGAATGTGGGCACGGTATGCATACGCACTACTCACACGGATA
6   M07   AX00001975   TTACAATTTCCTGCAGGGACAGGATGGAAATATACAGACTATAATTATATGGTGC
6   M09   AX00001976   TGCCCTTATTTTACCGAAACGGAAAAGGTGTAACTTTAACTTCTAACGGTGAAAT
6   M11   AX00001977   GGAATAAGAATAAGTTTTTAAATATTGCACATCGCGGAGCAAGTGGACATGCAC
6   M13   AX00001978   AAACACGTCAAGCTATTTTGTTAGTTCTCATGGAAACGGAATGTCAAACAGGATT
6   M15   AX00001979   GAAATGCCCCTAATCCTTGGGAATGACTTTGCCGGTGTCATCATAAAGGTTGGA
6   M17   AX00001980   TACGGTCCTTGTGCATTTATGGACAATTACGACCAAGGAACCGTATTTAGCTCC
6   M19   AX00001981   GTGTTTATTTTAAGGTAGATACCGTTATAATGATTGGTTTAATATGGACAGCGCA
6   M21   AX00001982   CTGCTGCACTTCCAAGTGTATTAGCAGCAGTATGGCATAACATTGCAGGGCCAA
6   M23   AX00001983   TTAGAAGTCGTTCTTGCTGATGGAGAAGTAATACATACTGGGAATTTAGCTGCG
6   O01   AX00001984   CATACACATACACTTGTACTTGGTTTTTTCTTCTTTTTAATTGCTTTAGGGTTAGC
6   O03   AX00001985   CATTACGGTCAGAATTTTAGTGGAATGATGGTATATAGCTTTCATGCAACAAAGC
6   O05   AX00001986   GCCATTAATGACATTGCAACTTGGCTAGATATGATGAGGAAAGGGAAAGTAGTA
6   O07   AX00001987   TAACCGTCAATTGTACGGGTATGAAACGAATAACGGCGGTCTTTATATAGAAGG
6   O09   AX00001988   CAGGTACAATTATTATTCAAAAGCAGGCGGTGAAAGGATTAACGACAGCAGCTG
6   O11   AX00001989   TTAATATACATCATAGTTTAACTGAACATTTATTTAACGCTGGCGGTCATATCGG
6   O13   AX00001990   AACCGCGTACGACTGGTATATATCATGTAGCCTTTTTAGTTCCGACTCGTGAGA
6   O15   AX00001991   GGTGGCCGTATTGAAAATATTCGTTTGTCAGCAGCGAGCATAAATGGGGTTGTA
6   O17   AX00001992   CAGATCATATCTCTGTGAAGGCCCTGCTTGCTGATTTCGGGGATCAAATACATA
6   O19   AX00001993   ATTCTTCGTCTAGTAGTTGATTTAGAAAGTAAAACGATTAGGGCAACGAGTGTCG
6   O21   AX00001994   CTTTCGTTTGGAGTACATTTGAAAGTAGTGACACGTGGGAAAGTATAACGGAAA
6   O23   AX00001995   ATTAAAGTTAGTTTAGATGCTTTTGATCATGAAGTAGTATTGCAAGAAATGGAAG
6   A02   EMPTY        -
6   A04   AX00001996   GGTAACACTTGTAGCATCATCTCAAAAGTTAGGCTTAACAGATGGCGTTTCACTA
6   A06   AX00001997   ACGAATCTTACGACAAAAGAAATGATGGCGGTAAAAGTAACGGAAATAAAGCGA
6   A08   AX00001998   TGGTCACCCTTCTTCTAAAGGTGATATCGTAGTCGGCAATGATGTATGGATTGG
6   A10   AX00001999   CTGCCAGTAGTAGTGGAGGGTGATAGCAATACAGTTGTTATCCCGTTTATTCCT
6   A12   AX00002000   TTTACACAATGCGTAGCGACTGAAGAAGTGGAAAAAGAATATCCCGTAAAAATCG
6   A14   AX00002001   GTGCTCCAGGGGAAGCATTTACAGTATTTCAAATGATTCATAATACACCATTTGG
6   A16   AX00002002   GATGTGAATCGTTATTATGTGCCGAATACAGATGGTGGAGCGCAAGATAGATGG
6   A18   AX00002003   CGACAAGTAATGCGGCATATTTATTGCAACTGGCAGGACGGGAAGATATACCTA
6   A20   AX00002004   GAAGTGTTACCTCCTTGGTTAGCTGGAGTTTTCTTAGCTGCACCGATGGCGGCA
6   A22   AX00002005   TATGGGCTTGGTAGTAAAAATCCAAGTGAATATACATATGTATTCGGTTTTCCAG
6   A24   AX00002006   TATGCTCTGCTGGATCACGCCTATTTGTTCCGAAGAAAATGTATGATAATGTCAT
6   C02   AX00002007   AGATAAAGTGAAAGAAAAGATGGTCGGCGCGATTCCAGTTGGTAGAATTGGAAC
6   C04   AX00002008   CATTTAGTACACCATCCCAAACTGCATGGGCGTTAGATGCTCTCATTTCTTACTA
6   C06   AX00002009   ATTAGTCAAAACGGGTGAATTTGATTTTGCAAAGTTTTTCGCTTCAGGTGGGATG
6   C08   AX00002010   TTAATGTCATTAACAATAGCTTCAGTCTTGATTAGCGGAAACTGGTTTGTCTACA
6   C10   AX00002011   TCCGGTTATGTGGCGCGGACCGATGTTAAATAAATGGATTCAAAATTTCCTTGC
6   C12   AX00002012   GTAGCAATTACGCACCGAGTAGGACGGCTAGAAATAATGGATATTGCGGTAGTC
6   C14   AX00002013   TGTCTCAAATCCGAAGAGCAGGCGGAAGAGTAAAATATTTTGGGAAGTTTAGCG
6   C16   AX00002014   GTCGTATTGGCAGGAGGAGAATTAATTACCGGAAATATGATGTCAATGTCTATG
6   C18   AX00002015   TCTTTAGGTGTTAGAAAATTACGGATTACAGGCGGAGAACCGTTACTTCGAAGA
6   C20   AX00002016   AACATATAGAGGACAGCATTGTAACAGAGTTTCCAGTCACGATTAAAATGAACGG
6   C22   AX00002017   CGATTGCGACCCTTTATGGAAACTTAACACCTACTGAAAAATTCATTTCAAGTAC
6   C24   AX00002018   CATTTAGAGAGTAATAAAAAAGTAGGGGTATTCGATCTTATGAAAGTATTGAAAG
6   E02   AX00002019   TGAGCTGTGGTCAATGTGTAACGATTTGTCCTTGTAACGCTTTAATGGAGAAAAC
6   E04   AX00002020   GTTGTAGATCGCTCACCAGGCGTATTAATAGGACCTATGACCTTTTCATCCTTTT
6   E06   AX00002021   AATTATGGAAAAGCATCCTGGATATACTTTACTTGATGTGCTGACTCGTTATCTT
6   E08   AX00002022   AAAATCTAGTTTAACGCCGCATTTAGATAAGTATTGGCACTTACCAGCCTTCATG
6   E10   AX00002023   TTATTACTGTTACTAGTAGGAATAATCGTTTTAGGATGGATTGTCCGTCCGAGAT
6   E12   AX00002024   ATTTAGAAGACGGATTTGAAGTGTATACGTATGTGCAGGGGGATTTGGATTTTG
6   E14   AX00002025   TATGGATTGAGCCGGTGCAACAGCGCTCATCTTTTGATTCAGGATTCGGATACT
6   E16   AX00002026   ACAATTGTTAGCACAACTGCCTTTTAGATATGGAGCTAACGTCCTTGAGATAGGC
6   E18   AX00002027   TTCAATTAGCAGGTGATGATTTATACTTACCTAATGGCCCAAACGGCCAACGTG
6   E20   AX00002028   CAAGGAAACTATCAAACTGTTTTACAAATACTTTCAAACTATAATGTAACGGCAC
6   E22   AX00002029   ATGACATGATGCAAAAAATGATTGTACGAAAAATGAATACTGGCGGGTTATTTCA
6   E24   AX00002030   CCAGGTGCAGAGGTGGATGATTATTTCCACATAGTACTTCATTACGGAGTTAAA
6   G02   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
6   G04   AX00002032   GGGGAAACTAGGTACAAGTGAAGCTCGTTCTTCAATTGATGCCATTGTATCAGA
6   G06   AX00002033   AAAAGCAATGCAAGATGCTGGATACCGCATTATTCCAGTTAACCCAACAGTAGA
6   G08   AX00002034   TGTAGGTGTTATTAACATGCAACAAAGCATTGATCCATTTGCAATGCAACCGACA
6   G10   AX00002035   GCGGATGGCGTGGTAGGAGTAGCAGAAGAAAATGCTATGTCTTTAGCTGGAAT
6   G12   AX00002036   CGAACGGTTTTCATACCGGACATGGACATATGAGACAACCGCAAGACATTAAAA
6   G14   AX00002037   AATGGTTTTCGGATTAGATATTCACCCACTATGGTTCGGGTTAGCGGCTGTTCT
6   G16   AX00002038   GGTGGTTGCAGTACTGTGCAAAAAGGACTTTCTTTAGGTATTCGTAAAGATGAT
6   G18   AX00002039   ATTTAGTGTGGCTTGAATTAGGTCGCACGAAACTTATACAAGATTTAGGGTTTTC
6   G20   AX00002040   GCACCTGAAGATCGCGAAGCGTATAATCGTTTTTTACGAAATGTGAAAACACGC
6   G22   AX00002041   TGATAACTTTAATGAAGCAAAAGAAACAGCGGAGCTTTCTAATGAAAAAGACCGT
6   G24   AX00002042   GTGTTTCGGATGCACCGACGATTGAAGAAGTGTTACCTTTATTTTTAGCATTTTT
6   I02   AX00002043   GTGATTTTAAACTTTTGGGCAACGTGGTGTGGACCTTGCCAGCAAGAAATGCCG
6   I04   AX00002044   GCGGGTACGGCAGACGCGCTTGCCTTCAACATGGACTTAGAGTTTAAACGTAAT
6   I06   AX00002045   TATCAAACTGTTCTATGGTCGTGGCATCAAGATCCACGTGATTGGGCAAATCCA
6   I08   AX00002046   AACGATCCAAACTACGGTCATGATTTAAAAGAATTACGCCAAGAGGTTCAGGAA
6   I10   AX00002047   GGAAACAGATGTACCAAATGTAACTGAACAAAATGTAGTTATTAAAAAGATGGAG
6   I12   AX00002048   GTACTTCTCGATTATTACGGGTACCAAAATGGATTTGTAGTATTTTCAGCGCTAG
6   I14   AX00002049   ATTTTAACGGATTGTAATCGAGAAAGCGTGAAGTTTGATCGGTTATATGTAAAAG
6   I16   AX00002050   GACAGGGTTAGAAGTTAATATTCAGAAGCTACTCTATGTTTGTGATAAACCAGAT
6   I18   AX00002051   GACGCGGTAGCTTTTTGGCATGAAGAAAACGAACGAAAAAAAGACCCTACATAC
6   I20   AX00002052   ATTTCATTCAAGGCGGGGGCGGTAAGTGTTATATCGCCGGAGGAGTAGAGAGT
6   I22   AX00002053   TTGGTGGTATTTTCGTAGTTTATGTATTTGGTATTACTGTACAAGCTTTCTTAATG
6   I24   AX00002054   GGATAGTACGGAGATGGGAGAACTATGTTTACGAGCGCCATGGATCGCTGAAA
6   K02   AX00002055   GGAGAAGGTGAGTTTGTCGGTTATGCACAAATACGGAAAAAGGAGACGATGTTC
6   K04   AX00002056   CTACTTTGTCAGAATTTCAGCGTAAAGGCTGTCATACTGCATTAATTCAAAAGCG
6   K06   AX00002057   TGTCGGGAAAGTAACTGACAATAAAAAATTACAAGCTGAAGGAAAATGGGATAA
6   K08   AX00002058   AGAAGAAATGATTAAATTAGTAGGACCTTTTGCATACAATCAAGCAATTGGAGAT
6   K10   AX00002059   ATTTATGGTGTATGTGATGGTGCAACACCGCTCGTCCCGTTTCGTGATGAAAAG
6   K12   AX00002060   TCGGTATGCTTTTATCCCGCAAGCGAGACATTAAACTTGGCGGATTCCTTATTAT
6   K14   AX00002061   ATGAAGGACGCTGGCTTGAGGCAAATGACTACGCACTTTCTTGTTTCAATTTCC
6   K16   AX00002062   AGCAGGAAAATCCGTGTTTATCGCTGCTGGGACAAATGACCCGATTTGTTCATC
6   K18   AX00002063   GTGTCCCGTTTTGGATACCACGTAACTCCTGTACAAGACCGAAATTATTTTAACG
6   K20   AX00002064   ACGATTCCAGATTTTTTAGAGAATCGGTTTAAAGATCGTACGAAAATACTTCGTT
6   K22   AX00002065   TATAATGGCGCTTCAATGTAATTCTGGCCAATGTCCATCTGGTGTGGCCACGAC
6   K24   AX00002066   AAACACTTCTTCGTTTCTCTGCTTTTAAAGGTGATAATCCTACTTATATGTGGGA
6   M02   AX00002067   CAAAGTGAACACTGATAAAATAAAAACGGGTAAAATGCAAGAAGGTGCTGAGGT
6   M04   AX00002068   GTGGGTCGTAAGGCAGATTTAGTTTTATGGGATGCTTACAATTATGCTTACGTAC
6   M06   AX00002069   CGCCAGACTTGGTTACAGATCAAACATCTGCTCATGATCCATTAAACGGTTATAT
6   M08   AX00002070   TATCTCATCTTGCGCTCATATTATTAGGCGAAGGTGAAGTGTTCTATAAAGGGAA
6   M10   AX00002071   TGAAACAGACGTTTACAGAGAAACACATGCACTTTATCATGCAATAATGGAAGCT
6   M12   AX00002072   TCGTCAATTTCACGAACAAGAAAAATTAGTAGCTGCTATTTGTGCTGGACCGTAT
6   M14   AX00002073   CCGCGATAACGACTACATTTCTTTACCTACACATATAAGCGGCCTATCAACAGCA
6   M16   AX00002074   AACGAGGCATTTATGGGATGACGAACAAAAACAATTGTTAGAAGAGCTCGTCAG
6   M18   AX00002075   TTTATTCGTTTAAAAGCAGCTAAGAAACCTGCAACATTGAAAAAAATTATACTTCC
6   M20   AX00002076   CAGGTATGTCGGTTTCTGAGCTGAAAGAAGAAAATGCAATGCTTCGCAAAAGAA
6   M22   AX00002077   TATGTCAGGAGCAATTATTTATTTATGGAGCAGCGTTTGTTTTTGGATTAGTTAA
6   M24   AX00002078   AAAGTGCCCAAAGGGGAGAAGTGGGCTCACTTTCAATTGGTTTTGTAGGTGCGG
6   O02   AX00002079   CCTTCTGCAGTCGCTGTCATACGCTACAAAGATACACTATCACAATATGGAATCG
6   O04   AX00002080   TGGAATGGCTATTTTACTTAATGTCATTGTCGGTTCGTTTCTATCAGTTATTACTT
6   O06   AX00002081   GGATATACGTCAAAGTTTAATCAAAATAGATGGCTAAATCATGCAGATAAGCGTG
6   O08   AX00002082   AATAATGTTTGCGATTATGGTGCTATATCGCCGGAAAAGTGCAGCTTTTTATTTA
6   O10   AX00002083   GGTGATCTCGTTACATTTACGACGTATTTAGGTACTCTTGTTTGGCCAATGTTAG
6   O12   AX00002084   TTATACAGGAGCGGAATACGGCGAAATAATGGTGAAACCACACTATATTCGCAT
6   O14   AX00002085   CAGAGTCTGTACCATCATTCTTCGGTGGATCTGCTGACCTTGCTGGTTCTAACA
6   O16   AX00002086   TATTAGGTACATTTATTTCTGCCTTTTTATCTGTTCCATTTGCTTTTTGGGCGGCG
6   O18   AX00002087   GTGCCGCCAGATTGGAGTTATTTTCAAGTTATTACAACAGCGATGTTAGATACAA
6   O20   AX00002088   ACCTTGTAAAGCGATCAACAGTATTAAAGAACGTATTAGCTGGCCGTGTTGGGT
6   O22   AX00002089   TCAAACGAAAATAGTGAAATTTACGGAGAAAATTCCAAACGATACGATTTCGGTA
6   O24   AX00002090   CTGAAGAAGAACAACGTGAGCGTCAATCGCTACGTGAACAATATTTAAAAGGAT
6   B02   EMPTY        -
6   B04   AX00002091   TTGCATTTAGCAGAGCGCTATCAAATGAATGTTATTAAGGTGATTGAAGAGCAGG
6   B06   AX00002092   GTGAAATCGGTCAAGCAGTCGGCCTCGCTTCTAGTTCTACAGTGCACGGACATT
6   B08   AX00002093   TCTACATTGACTCTCCTTGTGCCTGAACGCTCTTACCAAGATGTAAAAGTAAATT
6   B10   AX00002094   CAACTTCAAATGTGACAAGAGCTGTCATGGCAGTGATTGGACTTAGTTTGTTTAA
6   B12   AX00002095   GAAGAGCATAATCTTGTTTCTCCAACCCGTACAAAGGGGAATCGTAGATTATTTT
6   B14   AX00002096   AGCGTTATTTGGTATTTTACGTCCAGGAGATGAGTTATTGTACATCACTGGCAAG
6   B16   AX00002097   AGTTGCAATATACAATGCCGCGTCTTATGGGACAAGGATTGTCTTTATCACGTC
6   B18   AX00002098   ATCCGATTGTCGCGTTTTGGCAACAAGACATGTTATTTCAAATCGCACTTTTATC
6   B20   AX00002099   ACAAAAGCATCCCTGAACCCGTTCGTCCAAAATACCATAGTAATGATCCATTATT
6   B22   AX00002100   GGAGTAGGAATTTCAATAAATGGAGCAGTCGCAACTGACAACTTCTCTTCAAATC
6   B24   AX00002101   GTACTTATTAAATGGTTTCCAGCTTCGTGGATTAATTAAAGGATTTGATAATTTTA
6   D02   AX00002102   GACGAATTCACGTCGTTATGCAAAACGTCAATTAACGTGGTTCCGTAATAAGATG
6   D04   AX00002103   AGGATTTATTGCGAGTTCTATTGCTGATCGTCCTGGTTTTATGCCTGGTGTTGTC
6   D06   AX00002104   GATTTGTAGGTAAATATGAACAGACAAAAGATATTGAAAAGGCATTTCAATATGG
6   D08   AX00002105   AGTAGGACGAAAGCTTTAATCGGTGCTATGGCACAGGAAAGTATGCAGAAGTAT
6   D10   AX00002106   TGCACTTGTATTTGGTTTTACAAATCAATTAACACGTCATCGTAAAATTGTACGTT
6   D12   AX00002107   GAGCAAGGTATGTTCTATTCCTTCTCATCCCCGTTCGATATGCAGCGCGAGCCG
6   D14   AX00002108   CAGCAGGACCAGGTTCTATCGTTTCATATGCATTAGCAGGACTTTTAGTCGTTTT
6   D16   AX00002109   CATACATTCACGTTCAACACTACAACGCTGGCAGTGGTATTGGAATGGACGGTA
6   D18   AX00002110   AAAATATATGGAGGAAGCTGGTTTCACTGTGTTAGTAAATGAAGTGCAGAAAATT
6   D20   AX00002111   GATATTCATGTTATTGGAACAATGCCAAAGGCTTGGGGATCATTTACTAGTTTTC
6   D22   AX00002112   GGTGATTTTGGCGGAGCACTTGAGAAAATGATAGCAGTACTTGTTATCGCTTGT
6   D24   AX00002113   AGCTAAACGGTGTTGAACAAGTGAAAGTTCAATTAGCAGAAGGAACTGTTGAAG
6   F02   AX00002114   TAGATTAAAGAGAATTGAAGGACAAGTCCGCGGTATTCAAAATATGATTGAAAAT
6   F04   AX00002115   GCTATGATTTTACGCCTAGCGTAATTTCAAAAGATGCGGCTTTAAAACCAGATGG
6   F06   AX00002116   TTACAAGGACAGGATTTACATACAATTCCAACGAAACAAATTGCGAAGCAGTTAG
6   F08   AX00002117   ACCATGATTTAGTTATTTTTGAGTTTCGTCTTCCGCGCATCATAATTGCTGGATT
6   F10   AX00002118   TAATTATTCCGCACATTACTCGCTTTATAATTGGAGTAGATTATAAGTGGATTTTG
6   F12   AX00002119   TATTCAGGGACGGCTATTTTTTCGAAAAAAGAACCGCTTTCTGTTACTTATGGTT
6   F14   AX00002120   TCATGCAGAGCAAGCATTAAGTGAAAACTTTCGCCCGTGCAAACGTTGTAAACC
6   F16   AX00002121   TGGACTATGTTTCATTGGATCACAAGACGAACAATTTGAGGAATTAAATATATGG
6   F18   AX00002122   GCCAACTATGTTTTAATGCGTTGTTTACGATTTCCTTCTGCTTTTCCAATTGACG
6   F20   AX00002123   AAATTGGCCGTGGCCCAGCACATTTTGATGTAGAAGCGTTTGGTGCATCATTCG
6   F22   AX00002124   TAAGTGGCAGAAGCATTGATGTTCTTTCTGGAGATAAAGAAGCAATTCAGCTAAA
6   F24   AX00002125   GAGAGTCATATGCGGATTGCCAGAGAAGAGTAGTGAAAGTGTTAAAAGAAATAT
6   H02   AX00002126   AGGAAATTAAGCCGGGGTTAGATGTTGCTAATTATGAGTTTATTGAAAGGTTGC
6   H04   AX00002127   ATTGCAATGATGGATGAGCGAGAAACATTAATAAAACTGCGTACACTAAAGAGTT
6   H06   AX00002128   AACAGTACTTAAGTTTTTCCGTATAACAAGTACGATCGGAAAAGGAGTGGGAAT
6   H08   AX00002129   AGTTGGTACGTGGATTCAAGGAGTATTCCATTTATCAATGCCAGGAAGTTTAATA
6   H10   AX00002130   GGTGTGTCACATAAACGAATACCGAACTGGGGTAGGTACGTTGAGGATGGATC
6   H12   AX00002131   AAGCTTGTCTTCTGGTGGTACAGCATGGAATAGTCCATATTACTATGCCTCTTAT
6   H14   AX00002132   GGGACGTCTGTACTAGGAATTGTATCCTCTGAGGACAATGAAGTTGGGAATATT
6   H16   AX00002133   GGACGCATTATTAGAAAGTACGAAGAAGGTTTAGTTATGCCTGACGGTCAAAAT
6   H18   AX00002134   AAATCGAGGAGCTGTATTTTTCACACACGGTAACAATGATTATACTGCGACGCC
6   H20   AX00002135   AAATTGGTTAAAGGTAGTCAATCCGTCTTATGCTGCATTTCCATCAGCAGCTGTA
6   H22   AX00002136   ATGCATGGAACATATATTTTCGCTCAAAATGATAAAGGCTTATATATGATTGACC
6   H24   AX00002137   CTTCATAAAATTCAAGACGGGGCAGCAGATAAAAGTTACGGAATTCACGTTGCG
6   J02   AX00002138   ATGTGAATCGAATAATGAGCCAACAAGTATTTTAGGGTGCTGGGTAATTAACCAC
6   J04   AX00002139   GAAGTTGATTTCTTTAAGAAAGCAGAGGCGCAAATTCATAAAAATGAAAACGTAA
6   J06   AX00002140   TATGTATGGCTGTGATAAGTTCTGTACATATTGTATCGTACCGTATACACGCGGA
6   J08   AX00002141   GTATCGGCTGTTCAGGTCGTATTTCAGGTTATATTAATTCATATGGTGTGCATAG
6   J10   AX00002142   GAGGGTATGAAAGTAAACCATGCTCATGTGCGTTTAATTCACCCGTTCCCAACA
6   J12   AX00002143   GACACGTGGGGCGGGTTTAACGACTTCTGGTAAACATGTTGTACAAGAACTGAA
6   J14   AX00002144   GTTATTCGCGAACGCGGAACAGCAGAAATTCAAGCCATTGGTGCAGGTGCATTG
6   J16   AX00002145   AGTTATTAACTTACAAGGACGTACATTCCTTCCTCCAATTGATTGTCCATTCCGT
6   J18   AX00002146   TAAACAGTATTGCATCTCACCATGGGGACACAGAACCAACTTCTATCATTGCAGT
6   J20   AX00002147   GATATGGCCTCTGAACTTGATATCGTTCAAAAGAGCGGTGCTTGGTACTCTTAT
6   J22   AX00002148   GGACATTACGCAAGAAAGTATAATCTTGTAACGAATTTAGGGAAGTTTCTTGATC
6   J24   AX00002149   ACGCAGATGCGGTTGGATTAAATGGAGAGGAACTACTTGTAGAATATCAGAGTA
6   L02   AX00002150   GAAATTATGAGGTTGCCTGCAACGAAAGTTGTGGAACATCCTGACGTATTTGTG
6   L04   AX00002151   GAAGTGATTCCTGTTCAAGCGAATTTAGCTTCTAGTGATGGAGCAGAGCAATTG
6   L06   AX00002152   TATGAAACGTTTTATCATCCAAGCAATATGTTAATGTTTGTTGTGGGTGCAATTG
6   L08   AX00002153   TTTCGTTTGAAAGCACCTTTAAATGAGGAGACGGTGACAGAGCGTGCCCTATTG
6   L10   AX00002154   TTGGGATTGCAGGGATTGATGGAAATGGTCAAAGTGAATTAATAGAGGCGATTA
6   L12   AX00002155   AAAAGGTGAAAATGTTTGGGTAATCGGTGTTGACCGTGACCAAAATCAAGAAGG
6   L14   AX00002156   CAGTGATGATTGAGCGTGTGCGTACAGCAGATGGGGAACCTGTTGTATATTGTA
6   L16   AX00002157   GGTAGCGGGAAGAGTGTATGTATTAACGGTATTATTGTTAGTATTTTAATGCGTG
6   L18   AX00002158   GAAGCTGGGCTAGCAATTTCTGAGATGGTCGCTTCACTTTCAAAACCGACAGTA
6   L20   AX00002159   TTTGTACCCGTACATGGTGAGTTTCGTATGCAAAAAGCACATGCATACTTAGCTG
6   L22   AX00002160   TACAGCGGTGATGACGGTTTAACGCTACCAGCTATGGCAGTTGGAGCGAAAGG
6   L24   AX00002161   ATTGCGATGCATGCAAAAGTGCCGCTTCGTGTACGTTCTACGTATTCTGATAGT
6   N02   AX00002162   AAAGAGCTTACTTGCAAATGCGGAAGGTATCGTTCTACAAGATAATCCAGAAGA
6   N04   AX00002163   GAAAGCGACGCTAAGAAATGGCAAGCCTGTCGTATTGGCTGTTTCGACGAATGA
6   N06   AX00002164   TGAGTGTTGCCAGAGCATTTCAATCATTAGGAGCCCATGTCAAGGTTGGAGCAA
6   N08   AX00002165   TTAGGCGGTAGTATGAGTAGCCGTTTATTCCAAGAAGTACGTGAGCAACGCGGG
6   N10   AX00002166   AATTGATTGGAAGCGACCTGAGCCAGATGTACTATTGCAGAGAGTAATGAGAAA
6   N12   AX00002167   AAGGTGACGAAATCCGTCCATTAGCATCAGAGGTTGGCATTTTATCTCGTACAC
6   N14   AX00002168   ACGGAGCAAATTAACACTCTAAACGAGCACTTACGTACTCACAAGAAAGATCATC
6   N16   AX00002169   CTACTGTAATGGCATTAGGATTTTTTGATGGCATTCATTTAGGACATCAATGTGT
6   N18   AX00002170   CACTAAAAGGTTTAGCGAAGGCAAAAGGCTTCATTCGTTCAGAAATTGGCCAAC
6   N20   AX00002171   ACGTACGGAAATTGCAATTGTTTCTGTATCCTCTAATCGTGTTATTTGTGAAAAA
6   N22   AX00002172   ATCGATGAGCAAGATGATGAAGAGAACTTAAAAGAGCGTCCAGCTGTAGTTACA
6   N24   AX00002173   AACGACGTACTACAACGTACCAATGAGAAAGGTCGAAAATCGACAACAATTAGG
6   P02   AX00002174   CAAAACGAGAGCTCGTTCGCATTGTTCGTTCCAAAGAGGGAGAAGTGTCTATTG
6   P04   AX00002175   ATGCGATTGAAGCAGCGTTAATCTCTGCTTATAAACGCAATTTTAACCAAGCACA
6   P06   AX00002176   TTCTTACGCGTATTCATCGATTCTGAAAAGGGAGTCGACATTGAAGAATGCGGT
6   P08   AX00002177   TGACATTCCGTTCGAAACGTTCCTTGGGTTTAAAGGAGATAAGGTACCCGATAT
6   P10   AX00002178   ATACTCTTTCCATGCTACGCAAGAGAGCTTAGATGAAGTGTACGATCGCTTATAC
6   P12   AX00002179   ATATGCGAGTACCAATTCAATACGCGCTTACATATCCTGATCGATTACCTCTTTC
6   P14   AX00002180   GTTTGTGGAATTATTGTGGCACTTGTTTACAACATGTTCTTCCCAGTTGAATCGA
6   P16   AX00002181   AATGACGAGTTCTTTACCTGACCCAGAGTTGTTAATCCGTACGAGCGGAGAGCT
6   P18   AX00002182   GCAACAGTTCGTGCTGGCCGTGCAAGCGCGTCTGTATTAGATAAAGTACAAGTT
6   P20   AX00002183   CTCGCGTACAAACTTCAATTGAGATGCGTCAAGTGGCAGAGCCTTACATTCGTC
6   P22   AX00002184   TTTGCTTACTTGACCAAGCATTCGTTAAAAACCCTGATATGAAAGTTCGTCAGTT
6   P24   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
6   B01   EMPTY        -
6   B03   AX00002186   GGAGCGTTTCATATGTCTAAACCGTCAGATTTAATTCCGGAATTACAAGGGAGA
6   B05   AX00002187   AGGTGACGATGGGAAATGCTGTTGTAATGAAACATACAGCTCGTAAAGTTCGTA
6   B07   AX00002188   TAGCCCGTAAATCTGTCGCAAGAAAAGTATCAAGCTTACGAAGTTTATATCGCTT
6   B09   AX00002189   ACCGGTAAGGCAAACGCCAGCTCATCACACAGATAAATTTGCAGAATTAGTATG
6   B11   AX00002190   GCTCGAATTTCCCAGATTGTCGTAATACAAAACCGATTGTGAAAGAAATCGGTG
6   B13   AX00002191   TAGATATGGTAAACGTAAAGAGATATATGGCTGGTAAACATACACGTTTACTTGG
6   B15   AX00002192   GGTTTAGCGATGGCTACGATGGATATCATTAAACATTACCATGGCGATCCAGCT
6   B17   AX00002193   CTAAAACAGGAGATCGTCCTGGTGTGACAACAGCTCAGCAATGGATTAAAGTTG
6   B19   AX00002194   CTTACGGTGTAGGTGTAGAGCGTACATTCCCAGTTCACACGCCAAGAATCGCGA
6   B21   AX00002195   ATGTGGGCATTATGAAGGATATGACGAAAGAATTCGTGAACACCTCGTAACGGA
6   B23   AX00002196   AACTAGCTGAAGGTGAATATTACTATCATGAAATTATTGGTTGCAATGTTGTAAC
6   D01   AX00002197   TTACAACGGAGAGATAAAGTATCGATTAACTGTACATCCTGAGGATGTTGGAAA
6   D03   AX00002198   TCGTGTAGTTGTTGCAGATTCTCGTTCTCCTCGTGACGGACGTTTCATTGAGGA
6   D05   AX00002199   TTAGAGCGAGAACAACCGGAAATAATCAATGCTAGTCGCAAAAAACGCATTGCC
6   D07   AX00002200   GAAATTGCGGAAGAATTTGATGTAAGTCGCCAAGCCGTGTATGATAACATTAAA
6   D09   AX00002201   TGGCTCATAAGTTTAAATCAGAAGGTAAGTCTGTCTTATTAGCGGCAGGAGATA
6   D11   AX00002202   TTTCTACTACGTTTGAAGGGATTCGAATGGAGTTTCAATCGGTGTTCTCTGAATT
6   D13   AX00002203   TTGCAAACGAGTTGTCATTTGGTAGCCTTGTTTTATTAGGCAAAGGTGAGGAAA
6   D15   AX00002204   AACAGAAGTAGTACCAGCTGCGAGCTTCAAGGAAGATTTAGGAGCAGACTCCCT
6   D17   AX00002205   ATTGATTTAGCGAAACAAGGGGCAAATGTGGTAGTAAATTATGCTGGTAATGAG
6   D19   AX00002206   TAACTTTTGAGGATGCAGTATATGCTGTAAGGAAACGTGGGGAATATATGGAAG
6   D21   AX00002207   ATTATTCGGAGTATGGAGGAGCGGCATTATTTGGATTGAAAGCTCCTGTCATTA
6   D23   AX00002208   AAGTCTACCATTCGATACATTCGTCCTGTAAAATTAGGAGAGCGTGTTGTTGCAA
6   F01   AX00002209   TGGTAAATGGGATCAGCATCGTCAAACGATTGCGGTATCAGAACTTCATTTTGG
6   F03   AX00002210   GTCGGCGTAAGTTTAGCCAAAGGATTATTAATGGGAGCTCGTGGTAACTCTGGA
6   F05   AX00002211   CATTAATTCGTATTTTTGGTGCTACCGGCGGAAGGCTTGATCACGGTTTAGCGA
6   F07   AX00002212   TATGACAGTAAACCCTGGATTTGGTGGACAGAAATTTATCCATTCTGTATTACCG
6   F09   AX00002213   AGGTAGAAGATCTTACATATTGCTTTCCAGAGTTGAAAGAAGCGAGCCAATACT
6   F11   AX00002214   CTCGACTATTCAAATAACGAAGAGTTTATTAAACGTTTCCATCGAGAAGCGCAGT
6   F13   AX00002215   CGAGCTCGATGACCATTCAATTATTCCATGATTATTGGAAGCAAACGCATAATAT
6   F15   AX00002216   GCATCATTAACCATGAAAAAGGACTTCATATTGGCGCGAGACATATGACAGTTTC
6   F17   AX00002217   AGATTGCAAAGCGTCGCGGACATAAAGGCATTGCTGGTATGGTAAACGGTGTAT
6   F19   AX00002218   ATCACATTCGCGGATTGAATCCATGGCCAGTTGCTTATACAACTTTAGCAGGAC
6   F21   AX00002219   CTAGAAAAACGTGGTGAACAAGTAGGTCCCGAGGGCTGTTTAAGCTTCCCGGG
6   F23   AX00002220   TTACAAAACTATTTCCAGAGGCACGAGTCATTCGAATGGATGTAGATACGACGA
6   H01   AX00002221   GATTACAACTACTTTGTTAGCTACTACAGCCCCAGTGTGGATTGCACCTGCTATG
6   H03   AX00002222   ACAGTGGCTGCAAAACGTGCGCGCGAAATGCAACTTGCTAATAACTGTGTTGTA
6   H05   AX00002223   AAAGAGCTGTTTAGTCATGAGGATACACGTTTTCAGTACTCCATTTCAGTAACGA
6   H07   AX00002224   AGTCCGGAGTCAGCTCCTATTAAACGAACAGTACAGGAAGCACGTGAACATAAT
6   H09   AX00002225   CTATTAGTATAGCGGGTGAAGGGCTTGTTGAAAGAAAATTAAGTGTGAATTGGT
6   H11   AX00002226   GCAAAAGAGTCTAGTTCTGTACCTGTTGATTTCACAAAAATACGCCATGTGAAAA
6   H13   AX00002227   GTGCACTTTACGACGGATATTGTTCCGATATAACACGTACTGTAGCAATTGGGG
6   H15   AX00002228   ACCAGTTATATTATGTATAGGAGTATTGATTTTTGCTCCTATGTATCGTTGGGAT
6   H17   AX00002229   TATTTTAATAGAAGGTCAGAAACAAATGGAGAAAATGTCTATTTTTCAAGAATGG
6   H19   AX00002230   CCCCTACACTCGCCTACTGGATTATCGGCCTTTTAATGATGACAATTTCTTTCTT
6   H21   AX00002231   AAACGTATTACGTAATGCCGATTGTAACGTTTGCTAGTTTTTTAATAATAGGTGT
6   H23   AX00002232   AGCAACTGCTGGTATTGCGCACGCTGCATGGGTAAGCGATCGTATGGATTTACC
6   J01   AX00002233   TGGTAAATGTTCATGCTGGTGGGGGAAGCAGTATGATGAAAGCTGCGATTGAG
6   J03   AX00002234   TTAAGTGTACTAGGATCAATCATGATTAAAGCGACGACAGAACAACCACGCTATG
6   J05   AX00002235   ATTAAGGTAGCAGAGGGCATTGCGCCCCTTCTGCGCCGCCCAATTAGTATTTGT
6   J07   AX00002236   CGTTGTAGCACCAAGCCAAACGCTAAGCGATCGTGAATACCAAATGTTGCGTAA
6   J09   AX00002237   TTCCTTTATTCGGAATTTGCCTAGGACATCAATTGTTCGCTCTAGCATCTGGTGC
6   J11   AX00002238   ATATCCCATCAGCTGATCCTAATTTTAAAATGAACCCACCGCTTCGTGGAAAAGA
6   J13   AX00002239   ACTTTATACGATACGATAAGAACACTAGAATCAATCGGAACAAAAGCAGTGGTCA
6   J15   AX00002240   CATACAGCAGTTAACATGGCGATGAATGGTGCGGATGGCAAATATAGCTTTACA
6   J17   AX00002241   GAATTAGTCATGAAATCGTGGAACGAAATAAAGGTGTCGATAATTGTGTTCTTGT
6   J19   AX00002242   AGTAGTGGATTTCATTCACGTGTATATTTTCTCGTACAACTATCCAGTATTCAATA
6   J21   AX00002243   ATTCCGTAAAGAAACAGACATCATGGATGTATGGTTCGACTCAGGTTCTTCTCAC
6   J23   AX00002244   AAAGTATTCCGCACTCGTTTCCGTATGTTATTAGAAACACAGCTTGAAATGTTAA
6   L01   AX00002245   TTGGAAATTGACTATCCTTCCAAGTTTTATACGCTAGAGCATAGGCAAATATTAG
6   L03   AX00002246   TTACAACGAATGTCTACTGATCAAGCTGTACGTATCGTTGACTTTTTAAGTGGTA
6   L05   AX00002247   TAAGAAGGTGAAATGTTTTATTCAAGTGAAAACATCATCTGAAGAATCCAAGCAA
6   L07   AX00002248   TGGGGTAAGTACGGGCTCCTTTCATGCGATGAATTTAGGATTACATGTGAATGA
6   L09   AX00002249   GTGATGAAAAACAAAAGGACGAGCAGTGGGTTGAAGAGCTAGCACTAAAAGAAG
6   L11   AX00002250   CTATGATGACACATCCGATTATGAAACTACTGTACTCGTTACTTATCGTGTATAC
6   L13   AX00002251   TGATAGCATTGCAACTCAACCACCAAAACCAATTATCCGTCCGAATGTGAATCAC
6   L15   AX00002252   AACCAGGTACAGCTACTTCCTTGTCACGGAGTAGTCGCTGTTTCAAATGAAGAT
6   L17   AX00002253   GTGACGTATGATACAAGTTATTTCCGGGTGACAGCACATAAAGCAGAAGAAAAC
6   L19   AX00002254   AACCTTCTTGTATCTGATCTAGGTATAGAAGGTGTCGTTATTCGTTTAGGAGAAG
6   L21   AX00002255   TCCGGAAGCAAGGTTTTTATATATTGGTACGGAAAATGGATTAGAGAGTACAATC
6   L23   AX00002256   CATCAGCACCGTATCGGATGAAACGTATTACATCATATTTAGATCCGTGGTCAG
6   N01   AX00002257   CCGTTAGCAGAAAATGTACTCGCTGCAGAATTACAAGCAAAAGGAATGGACGTT
6   N03   AX00002258   GAGTATTCGTGATGAGGGACCAAAGTCACATCAAAAAAAATCAGGAACACCGAC
6   N05   AX00002259   TTGCGGAAAGACCAATTGATGTTGACGTTCCAGTTGTACTTGTGAAAAACACTTT
6   N07   AX00002260   CTTCGGGATGCACTTCCTGTTATGGGAGTGAAACCGAGAAAAGAACAGGTTGAG
6   N09   AX00002261   TGATGAAGGAGTAGAGCGCTCTTCAAACGTAGCATTTGCAATTTTAGGGGATCA
6   N11   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
6   N13   AX00002263   TTTAAACGAAATAGTACAACGCCGCAATTGCCGCCAGGATTACCAATTATTCCTG
6   N15   AX00002264   AAAAGCGCTTGGAGATGAAAATACATATGTTGTTATAGCTGGACAACAAGCTGG
6   N17   AX00002265   ATGAAAAGGAACGGCGGGGAACCATTCGAAATTACAGGTACTTACCTAGAACTC
6   N19   AX00002266   AGAGTTGATTTTGGCTCCGGTAAGTTTACGTTCCATCTACATATAACTGGAAGCA
6   N21   AX00002267   AAGAGTCTGGTGATTTTATGCTTGTTACGGTTTCGATGGGACCAGCAAATGTAG
6   N23   AX00002268   TTATGCAACATGAGCTTGTGATGAATCGGCAAATTGCATCGGATTTAATGATGCG
6   P01   AX00002269   TTTCTCTTGTACTCCACCCCCAAGCTGCTTTACAAGCTTCCATTCGAGGGTTAAA
6   P03   AX00002270   AAGAGCGCTTAGATTTAATTCGAGAAGCCACAAAGGATATCCCTAATGTAAAAGT
6   P05   AX00002271   TTTAATATGATAGGTCCTTATTTTGATGGCGGTATCGCTCTTGATTTATTTGGCG
6   P07   AX00002272   AATTGAGCATATGATGCAAAAGTTGAACAAACTTCCTTTTGTGAAAAAGATAGAA
6   P09   AX00002273   CGCCTGCTTATTCTTCGGTAAAAGAAAATAAAAAAGAAAAAGATAATCGAACCGA
6   P11   AX00002274   TTGTCGGTGTTCGTTATATGGATGACGAAACGTTATTACGCCAAAGACCGTATC
6   P13   AX00002275   AGTATCGTAAGCTAAATCCTTGGGTGCCAGTTGAACCTTGGAAGGCTGGAGATT
6   P15   AX00002276   AACAAAGTCAAATTGCTCATCCTATTTGTCTCGCTATATTGTTCTTTACAGCAATC
6   P17   AX00002277   GTAATTTTTCAATTGTACTATTTTATGCATATGAGTCATAAAGGACATGAAGCCG
6   P19   AX00002278   TGGCACATATTTAGCGTTAAAGAATTCTACAAATGGTGGACCAACTTCTCAAGAG
6   P21   AX00002279   CGTGCGCCAGGAATGACGTATATGCGTATGCCGATGTTTACATGGACGACATTT
6   P23   AX00002280   AAAGCTGTATTGGTTGTCACGCAGTTGGATCTAATGATAGTAGACCACCTTCCG
7   A01   EMPTY        -
7   A03   AX00002281   TGGTTCTGGATTAGTTATGGCAGGGGTATGTTGTTTAAACAACTACATTGATCGA
7   A05   AX00002282   GCTTTAGTACGTCACGAACGAGCTAGCCTAGCTTGTCCAGACTTCCCTTTATGT
7   A07   AX00002283   CAAGTGCGAACACGCTATACTATGCGTTAGGCGGAAACGAAAGACAGCCAGATG
7   A09   AX00002284   GAATTGCAAGTTTAATTGGAATACAAACTTTTGTTAATGTCGGTGGTATGTCTGG
7   A11   AX00002285   GTGTTAGACACACAAATGTTTGGACTATCCCGCGAAGTCGATTTTGCAGTTCGC
7   A13   AX00002286   GAGAAAACACTTCAGAACTAGAAGCTTATTTAAAAAACACTTCAGAACATTGGGA
7   A15   AX00002287   GTATGGGGGATACGACCACGAAATGTGCAGCAAATTATGGGGTTAGAATTGTTG
7   A17   AX00002288   AACAAGTTCCTAACGTAAGTGCTATTTCTTGGGTGTATGCAGTGAGTAAAACTAG
7   A19   AX00002289   GTGGATCGTATCTGGACGTGGGGAACTACATTTATCTATCTTAATCGAAAACATG
7   A21   AX00002290   ATTAACTGCAATTATCGGTGTTATTTTCTTAATTGGTATCGGCATTATGATTGCTG
7   A23   AX00002291   AGATCATACGGCTGTGCAGCATTAGAGATGGTATACGTTGCAACCGGAAGAATC
7   C01   AX00002292   TACGTTTGGAGCTAGATTATGAATTAGCAACTTTATATGATGCGATGATGGAAAA
7   C03   AX00002293   ATCCAAACAAACTGATGAGAACTTTTTTTATCATGTAGCAAAACACGCACGTCGC
7   C05   AX00002294   GAATTATAAGAGAAGAGTTAATGGGATTATATCGTCGTTTTAAAGAGATTGTTCC
7   C07   AX00002295   TGAGCGTTTGCGGTCCTGGTGACAAAATACTAGTGCCACGAAACGTGCATAAAT
7   C09   AX00002296   ATTGGAAAAGAACGTCTCTTGGAGGATTCGAGCTCCTTCCAAACATACCCCCTT
7   C11   AX00002297   TGACACATGATACTCGTTATGATTTTGGTGTTATTTATACAAATATGTTCTTTGGA
7   C13   AX00002298   AAGCAATTAGTGGCCATGCATCAGCTATCGATTACATCGGAATTCCTGCAGTAT
7   C15   AX00002299   CGCAGCTGATACAGACAAAGGTCTATTAGTACCAGTTGTTAAAGATACAGATCG
7   C17   AX00002300   TTGGTGGACTTGCAGTTGGACTTGCACTTGAAGGATTCCGTCCAGTTCCAGAAA
7   C19   AX00002301   TGAAGGTCCTACTTTAATCGAGACTTTAACATTCCGTTACGGTCCACATACAATG
7   C21   AX00002302   ATAGCCAAGATCCTGAAATGGCTGAAAAATATAGTTTACGCCCTGGAATCGGAT
7   C23   AX00002303   GAGAGCATCAGTGGAATATCATGATTATGTGAAGGAAGGCTTTGGTAGCTTAAA
7   E01   AX00002304   GCTACGTCTGAGAAGGATGTTCGTACAAAATTAAATAAGTTCGCATATAATATCG
7   E03   AX00002305   TCTGTTTCCTTCTTCCGTACAACTCACAGTATCCCAGATTCATACGGAGTTGTTG
7   E05   AX00002306   AGCGTGATATGGGAAAAAGGATTGCTAATAATATTGCATCAAGTAATGTGTTAGA
7   E07   AX00002307   ATTACATGTACTGAGGCAATGACAGGTGAAGATTTTGGTTATATGCTTCAAGAGA
7   E09   AX00002308   AAGGTTCTATGATCGACATGAACGCGGTACTTGGTGGACGTGCAACTGTTGGTA
7   E11   AX00002309   TGGTTGTGTTAGCACAGGAATCAAATATGAGAAAAGCGGCGGAACGTTTATTTG
7   E13   AX00002310   GAAGTAGCACAACGCTATTTTGAAGTGAACGGTGAACGCAAATGTAGCGTGAAA
7   E15   AX00002311   ATATGAAGAATTTGACGTAAAAAAAGACGCCGCTGCACGCAATCGTCTTTTATAT
7   E17   AX00002312   ATTTACAGATGAAAATAGTAGAAGTGATAAACAAAGTGGTGAATATTTACTTCCA
7   E19   AX00002313   TACTGTAATTGGATATGAAGTAGTAGGGCGTATTCAAACAGAAGAGGGCATACA
7   E21   AX00002314   AATCCGAGTTAACGCGATCGCGCCAGGACCAATTGAACGTACGGGCGGTGCTG
7   E23   AX00002315   ACAAGCTGGAGTAAAGGTGGAACTCATCGTTCGAGGAACATGTTGCCTACGACC
7   G01   AX00002316   TTTCAATTTCAAGAAAGTACACGATTCCATCAGTTGCACCATGTACTTTGTGTTG
7   G03   AX00002317   TCCTACCACATCTCGGTCATCTTGAATCCTCCTATCGAAATCCGAAAACAACCTT
7   G05   AX00002318   GTTTGAAGATGCAAAAAAACTTGAAACTTTAGAGAAAGAGGGACAAGAGTTATAT
7   G07   AX00002319   AGTTACAGAATGGATTGCGCTTCAGGATGTAATTACAAAACTGGATTCACGATCA
7   G09   AX00002320   ACAGGGCTATTCGGTGCTGTTTTCGGGACATCTAGTGTATTCGGTCCTTTATTA
7   G11   AX00002321   AATATTTTGGTGAGCGCCTTGCTGGCTTCTCATTCACTAAAAACGGTTGGGTAC
7   G13   AX00002322   CTGGACGGATGAAGATTTTGAAAGAGGTTATGCGAAGGCAGATGGAACTGTTAT
7   G15   AX00002323   CGTGATGAATGGCCAATGGCGATGTGTAAAGAAGGCGGAAAAGGAGCACATAT
7   G17   AX00002324   CATATAGTTCGCAAATATAGTCAACTGTTAGAGGAACATGGTTATATGATTTCCA
7   G19   AX00002325   TCATTTGCAGCGATGCAAGGTGTATATTTGCAAGTTGAGATTTCTGAAAGCCTTT
7   G21   AX00002326   TAACAATTGGACAATCCGATTTTCCTACACCTTCTCTCGTAAAAGAAGCGGCAAA
7   G23   AX00002327   AAGATGGTGCAGGGGCGCCAAATTGGTGGCATTATTCTTTTATATTCAAGAGAG
7   I01   AX00002328   GTATGGATGGAGCAGGACATTTCCGTATTTTTTGGCAAATCATTATGCCGCTTG
7   I03   AX00002329   GAAGCGGCTACAGTAGATGGAGCTACAGCTTGGCAACAGTTTCGTAAAATTACA
7   I05   AX00002330   ATCTTTCTTTCATCGGCTCTCCTTGTATTTATTATGGAGACGAAATTGGTATGGA
7   I07   AX00002331   TAGTCTGTATTGGAATAACCATGATCAGCCTCGCGTTGTATCTCGTTTTGGTAAT
7   I09   AX00002332   ATTGTTTTAGGTATTCGTCCTGAGGATATTCATGATGAGCTACTATTTTTAGAAG
7   I11   AX00002333   CAAAGAGATTGGCAACGCGTTATCAGTATTACTTTGAATGCATTCAGTCGCATTG
7   I13   AX00002334   CTAATTGACATGTTTTTAATCTCGGTTATGTATGGTGCAGTAGTAGCTGTTATGA
7   I15   AX00002335   CTCATACGTACTTCTGGAAATGCCTTTGAACTTTTCCCCACGCAAGATGCTGTG
7   I17   AX00002336   GGTGGGCGTGAGCTAAAAAAAGTAGGGCAAAAAGTGAAAGAAACTGGATGGGG
7   I19   AX00002337   TAACGGCTCTTATATTAGGTAGTATGGCGCCTGACTTTGAATATTTCTTGCACTT
7   I21   AX00002338   ATATCCTTATTGCTTACCCGCTATCCGAACATTACAATCACTAGCTTTCCACCCA
7   I23   AX00002339   ATATGAAATTACAAGAGAGGAACAAGATGAAGTTGCGCTTCGCAGTCATACATTG
7   K01   AX00002340   AGAAGTATTGCTTCAATATCGTTCAGATACATATGATTGGGGTGTACCTGGTGG
7   K03   AX00002341   GAGTGGAAGATGTATATGTAGAGGTGGGAGAACCTTTATACGAACATCCATTAA
7   K05   AX00002342   ATTTACAAGACGTGTTCACGGAAAACTTACTCACGCAGATCCTCATTCCCCAACT
7   K07   AX00002343   CCTAATTTTCTACTTCGCAAAATGACTTTCGTAACAAGTTTTACAAAAACATGGTT
7   K09   AX00002344   TTTCTGAAGGTGAAATATACGGTTATGAAATGAGTGAGAAGCTAGCAAAGTATG
7   K11   AX00002345   ACTGCCATATGCGAAAGTAGTTGGTGAGAGCTGGCCATTGTCTATAAAAAGAGC
7   K13   AX00002346   TATCGTCTTACCAGAACTATGGACAACAGGTTATGATTTAACGAGACTTTCTGAA
7   K15   AX00002347   GGTGATACGATTCTCGTTCCCGATCCAGGCTATCCAGATTATTTATCAGGAGTT
7   K17   AX00002348   AGCTTTTCCGTTCCGTCTGCTGGTATTCACCCTGGCTTCGTTCCCTTTATTATAC
7   K19   AX00002349   TGGAATGGATTTCTTCGTCTATCCACTCTTACAAGGACTCATTCCAAAAGAGCAA
7   K21   AX00002350   ATACAGGGAGATTCGGGGGCAGTATTAATCCGTAACCATGGTATTACCGTATGG
7   K23   AX00002351   ACGTTGAACTTGAGCCAGGCGATCTCATATCTGTTCCTGAAAATGCAAGACATT
7   M01   AX00002352   TGCTATTCCTATTTCAATTCTGTGTGCATTTTATATAATACGCCATGCTCGTACAA
7   M03   AX00002353   GCAGAGCTTATGAAATCTAAAGTGGAGCAGCAACATGTGTTTGCAAGGTGGGG
7   M05   AX00002354   ATGCATCTTTAGCAGCTATGCAACTTATGCTTGCAGCTAAAGCAACTGGCTGGG
7   M07   AX00002355   GAGAGAGGTTAAACCACAACAACCAGCTGTATGTAACGTACTTGCTAGCATTTC
7   M09   AX00002356   TGAACCCATTCTTAGGCTACCGTGCAATTCGCTTATGTCTTGATGAGCAAGATG
7   M11   AX00002357   ACGGAAAGAACGTTAACTTAAAATCAATCATGGGCGTTATGTCTTTAGGCATTCA
7   M13   AX00002358   ACTAGCAGTTATTTACTACTTCGGATTCCGCTTTGCAATCCGTAAATGGAATCTA
7   M15   AX00002359   TGCTGAAGGTGTTGTAGATCTTTTAAATTCTCGTTTGCAAATTACATTGCCAGAG
7   M17   AX00002360   GTTATTCTTTGCTTCGCCTCTGGACGACTTGATAATGAAATTGCAGACTTAATGA
7   M19   AX00002361   TTGCGATAAGTTCGAAGTGAGTCGTATGACAATCAGACAGGCGATTAATAATTTA
7   M21   AX00002362   AACTTATGTACCAAACGGGATGGCAAGTGATTTAGAGGAAGAGTGCAAACGTTA
7   M23   AX00002363   AACGCATTTATACAATCAAATGCGTGGATTACATCACCGTGAACCAGGAGTTGT
7   O01   AX00002364   ATAAGGCGTTACAAACGTTAGTATCACACTTACTTATAAAAGAAATGGGAAGAGC
7   O03   AX00002365   TAACGGTGATGACTTTATAGATGATCCTCGTCAAGAATTGATGGAGAGGTTAATT
7   O05   AX00002366   ATTTGAGTGTGAACCCATCTCACCGTCATATGGGTATTGGGACGAAGATGGTTC
7   O07   AX00002367   CTGATGGAAATCCTCATAGACACCTTGTAGGATCACTTTCTATGGCTCATGCTG
7   O09   AX00002368   CTAGAAGGGATTGTTCCAAAAGCACAAATTGGTACGAGAGCAATTTCCTCTTCTA
7   O11   AX00002369   CAAATTGAAGCAAATGAGGTTGCATGCATTGGAGATTCTTTCAATGATATTTCCA
7   O13   AX00002370   TGGCAGAAGTAGGACTTGAATTTTTAAGGATGGCAGCCATTCATACTCCAACGC
7   O15   AX00002371   ATGCAAAAAGGGAATTTACAACGAATTTTTGTCGTTGCCACTGGTGCTTTATTAA
7   O17   AX00002372   TTGTACTATTATCGGCGATTTTAACAGGTTGTGGTGTATATGATAAAATCGGTCA
7   O19   AX00002373   TTACATTTCAAACGTCGCAATATTGGCTTGTTATATTAGGAATATTTTGTGGCAC
7   O21   AX00002374   AGGTATGGTCTTATTTTTTAATCATGTATTTCAAAAGCGAATTAATGAAGAACCG
7   O23   AX00002375   GTTGTTATGTTCCTTATTATCGTAGTTCGTGCAGTGACAATGGAAGGTGCGATG
7   A02   EMPTY        -
7   A04   AX00002376   ATGGATCAGTGAAAGTAAGTAGGTCTTTAAAGGAAACAGGAAACAAAATTCGAAA
7   A06   AX00002377   ATGAAGCGAGACAACCCCTTTTTACAACTAAACCTGAATTAGAGCGTTCCGGAA
7   A08   AX00002378   TAGGTGGAGAAATGGTTGTTTGTGCAATTTCACCTCCTGTTAAACGTTTATTTGA
7   A10   AX00002379   GGAAAATTAAAACTGACCGATAAAGTTAGAGCGAGTGAGCATGCAGCTTCAATG
7   A12   AX00002380   TTGTATCCCAATCGATTACCCCAACATTAGACGAAAGGAAAATCGGGATGGTTG
7   A14   AX00002381   ACCAAACAAACGAATTCGTAGTTATTCAAAAGGAATGAAAGCACTGCTTGCCATC
7   A16   AX00002382   TTCTGTATTACGCGCGTTATTTTTAAACAGTCCACAGATGGCTTCGCAAATTGCG
7   A18   AX00002383   AGTACATACAATTTAAATATTAATCCTGTTCCACTCTCATTCGTTGAAGAATCTGC
7   A20   AX00002384   ATTCGCTAATTACGGCGATGTGTTTGGAGCTATGTCATTTGGCAAACTCTCTTCC
7   A22   AX00002385   CGGTATTCTCGACTATTTTCATGCCATTAACATTTATTGCGGGAGTATACGGAAT
7   A24   AX00002386   AGCGCAAGGCGGCGATGCATCTGTTGTTGATGATCCTTCTAAATTACCACAAGC
7   C02   AX00002387   GCAGCTGGTGGTGTAAATACATCATTCGAACCAGGCGATCTTATGTTAATTTCAG
7   C04   AX00002388   AAAGAAGATGATCTATTATTAATTACAGCAGACCACGGTAATGACCCAGTTCACC
7   C06   AX00002389   GGAAAAGGTGTTTATGCTGTAGAGAAAACGTTTGAAACGGATGGAGTATACCAT
7   C08   AX00002390   GAACGGAAATTACCGAAAGTATTGTCAGTTGATGAAGTAGAGGCGTTACTTCAG
7   C10   AX00002391   TTTCGCTATACTATGGATAAATGAAGAATATGAAAGCTATCATCGTTATGAAAAG
7   C12   AX00002392   TATCTGAGTTAAAAGTTGTCGATAAGATTAACTTCGGAGACGGTGTTTCACGCTA
7   C14   AX00002393   CTATTACCATTATTGATCCGTTATACATGCTTCTTTCTTGTAATTGGAGCGGTGT
7   C16   AX00002394   CCAAAGTTTTCACTTCACTTCTGGCTACATAGCGCTTATACAAAACAAGGCTATA
7   C18   AX00002395   TTCTTTCTATACATCTCCAGGATTTGCAGATGAAATTTTATATGTATATAAAGCGA
7   C20   AX00002396   ATTAGCGTCATTGCCCGCGGACCGCTTGCAAAAGGAATTCTAACTGACAACAAT
7   C22   AX00002397   GGGAAGTATGTTGATACGTACCGAGCATTAGAAAAACTGTATGAAGAAGGTAAA
7   C24   AX00002398   AACGTTCGTATCACTTACACGTGTTTGAAAAAGGAGATCCTGAGATAGTAAGGC
7   E02   AX00002399   GAATTATCTCCATCTAAAACGTATAGCGTAGTTGCGAATGCTTTCTTAGCTTCTG
7   E04   AX00002400   ATGGAGAAGAACCGCGTCACTTACAACTCCAAGAAGCGACAGCCCTTCAATATG
7   E06   AX00002401   GGCACATTCGGAGGTGCAATCCAAAACGGATCTTCCTTTTCGTTCATACGAAAA
7   E08   AX00002402   TTTCTTATGCTTGTGATTGGACTTCTCGTTACGATGGGGATTGGTTCATCCTTTT
7   E10   AX00002403   ATACGTTCATGAGGACACAGTAAAACAAGTAAAGGAAGCAATTGAGGAGTTACG
7   E12   AX00002404   GTTCATGTGTGAGAACTGGGGGAGCTCATTGATGGTTTCACGTGGAAAGGGGC
7   E14   AX00002405   GAAGATGGCGCTGATTTCTATATTGCAGATTGTCCTTTCTCTGATTTTTACGGAC
7   E16   AX00002406   ATCATCCATATAGTTTGTTACATTGGTCCATTGCTGGTGTAGGACAAGAGTCGAA
7   E18   AX00002407   TCTTTTCGCGTTACAGGGGACGTGGAATTAGTTGATTCACAAGGGAATGTATTC
7   E20   AX00002408   TTCACCAATACCGCCATACACATGATGCGATTCTCGTTGGAGTGAATACAGTTAT
7   E22   AX00002409   AATGGCTGCAAATGGACGATTCGGTGGACATTTCGTTTCAGGACATATTGATGG
7   E24   AX00002410   TCATACTGCATTTACAGTGAGCATTGACCATGTTTCTACAACAACAGGCATTAGC
7   G02   AX00002411   CTTTAGATGGGTTAAAGCGTCACGGTGTAGAAGAAAACGATATTGATGTTGCTT
7   G04   AX00002412   GAATTGAACAACATTTTCGAACGAAAGCTGAACATTTTGGATTGAAAACAGAAGG
7   G06   AX00002413   GTTGGCAATGATGCGTTTTGTAAACCCAACAAAAGAAATTCGTATTTCAGGAGG
7   G08   AX00002414   TCATATTGTCAAAGTCCCTCACTCTTTCGTGCGATGCTTCGCATATATGAAAGAG
7   G10   AX00002415   GTTGGAATACTTTGCATGTAGAACGGCTGAAAAGAAATTTGGCGAGAAGGAAAG
7   G12   AX00002416   TCGTCCGCCCACTGTACCGGTCCATAGTTCTCGAATTCGCTTTGCAGTTACATC
7   G14   AX00002417   ATTTGTCCTTATTCTATTGAAGAACCGCTTGCTCCGAGACTTGCCATGAAAAGAG
7   G16   AX00002418   AGTATGTAAACGCTCAAGAGAGCTGGGTATGATTTTGCGCCCGCTCGGTAACAC
7   G18   AX00002419   AGCAAATACAGCAGTCAGAAGTGAAGAAAGCGAAAGAAGCTGAAGAGAAGAAG
7   G20   AX00002420   TATTATCTCGCGGTGGCCTGCAAAGTATGATGATGTCAATCGCTCTTATTTTCCT
7   G22   AX00002421   GTTACAACTCGATGACTCCATCGCAAGTTATGCAGATATGTTTTTAGATGGCTGG
7   G24   AX00002422   AATGGCACATTAGCAGTTTCCGAAATCGGCAAGCGGCTAGCGATTTCACGGCCT
7   I02   AX00002423   GCTCGTATATGTAATATTTTATCCAATCGTCAGGTTAGTAAAGGGATCTTTTCCT
7   I04   AX00002424   CATTGTTGTTAGCGAGTGCGAAAGTCGGAATGCATATGACTGTTGCAACGCCTG
7   I06   AX00002425   CGTAAGCATACTGGAAAATCTCTCGTCGTAACGTGTGAGCAGTCTTTTCACGGT
7   I08   AX00002426   GCGGTAGGTTGTTCAGGGTGTGACGGCAAATTACTTCAAGTTCAACCTGTCAGC
7   I10   AX00002427   GGTTCAAGTCTTGTGAAAACAGCAATACATGGTGAAGACCCAAATTGGGGGCGA
7   I12   AX00002428   ATGCTAAAAGCAAGTGAAAAACACCCTTCTATTTTGCGAAAGGAAATTACTTCTC
7   I14   AX00002429   TAACTGGCGGAGATGCTGTAAAAGTTCAGGCGTATATGAAGAGCGGAAAAGGC
7   I16   AX00002430   ATCGCTTCGGTGCTATTGCAGCAGTAGCCTCAATCCTTGCGAAACAAGAGATTA
7   I18   AX00002431   TATTTGATTGTGGTGAGGCGACGCAACATCAAATATTACATACATCAGTACGTCC
7   I20   AX00002432   GGTAAGTTCTTTCGTGTCTGATCACCCAGCACAATTAGAATGGACGACTTTGAA
7   I22   AX00002433   ATGGATGATAGGGAAGTTGATCCGAGTCAAATGGGTCAACATAAAAGTGTTGGT
7   I24   AX00002434   TCTTCACCAAAGTGGTGGCGGAAGTGATGCAAACGTAATTGCTGGACACGGAAT
7   K02   AX00002435   CAATACTACGACAGAAATCGTGAATTTTTAAAAGCTTGGGAAGAGTATAGACCAG
7   K04   AX00002436   GTATGTATGGCATTACTCAATCTTACTTTTGTTATTGGAGCATTCCAGCAGAAAC
7   K06   AX00002437   GAGGAACGGATGGAAGTAAATATGGAATACATGGAACGAACCAACCGAGTTCAA
7   K08   AX00002438   GAGAATGCATTTATGCGAGAAGATGACTATTACTATCGCTATTTCAATATGCGCA
7   K10   AX00002439   TTTACGTTGTATGAATGTGTTAGAAGCACCGACAAATGGTCACATTTGGATTGGA
7   K12   AX00002440   GTACTTGCATTTAGCTTAAATTCAGGTGCATATATGTCAGAAGTAATCCGTGCTG
7   K14   AX00002441   TTGTGCAGGTGGTATTGCTCGTCCTGCTGCTGCACATTCTGTACATTATGATAA
7   K16   AX00002442   ATCGGTATGATCGTTGGATTAATGCCTGTAAAAGGTATTGCATTACCTTTCTTAT
7   K18   AX00002443   ACCATCTTCTTTCACTGGTATTGTGAAAGAGTTGATCGCTGGTGAAGGTGATAC
7   K20   AX00002444   CACATACGGATTATGTGTTCATTTTGCTCTTCAAGCAGCTGAAAAGTTAGCACAA
7   K22   AX00002445   TCGACGAACGTATGTGGTTATTAAACCGTGCTGGTAAAATTCCATTCGTAATTTC
7   K24   AX00002446   TGATGTGTTTGAAGGTATTGGCCGTATTCTTGGCCCATCTATTTTCTCTCCGATG
7   M02   AX00002447   TTTAGCCCAGAGCGTGCTGGTACAGTACCAGTAGGACAACTAGTTGAAATGTGT
7   M04   AX00002448   TTCACCATCATTCGGTTCTTCTGGTAACCCATCTCCAGTAACTGCATACGGTGTT
7   M06   AX00002449   ACTTTCTGTTAAAGCTGTAAGAAATGGCGAAGCAGATGTGCTTATGAAGGGGAA
7   M08   AX00002450   ACGAGACCTATATTGATGTACAACATTTACCGCCATTACATAACGAAGAGCAGG
7   M10   AX00002451   TCCATACAGAGGTTTAGAGGAAGAAGTTATAACGCTTGTACGGAAATTTAATCTA
7   M12   AX00002452   TCGTGGGAATATTGATTCTATTTCGTCCTTATTCGGTTATACAGTATCCATGTCA
7   M14   AX00002453   CCGATTCAAGTCGAAGATGGACAAATTATGCGTTCGACAGTTACATCAATTGAAA
7   M16   AX00002454   ATTAAAGAATTGCACTTAGTGAAAGTGCCATTACATGATGGTCGCTATAAATATA
7   M18   AX00002455   AACGAACAAACTTCCGTTACGTAACACCAGCAGACTTAGAACGTGGTTTACCAC
7   M20   AX00002456   ACATTAAGGCAATATCAAGGTCTATGTGGTTTCCCAAAACGTTGCGAGAGTGAG
7   M22   AX00002457   TGCAGCTTGTGCTCTTGAAATGATACATACATACTCGTTAGTTCATGATGATTTA
7   M24   AX00002458   TATTTTAAAGAGGGTATGGAATTATCTAAGCTTTGTGATGAGAAGTTGAAGAACG
7   O02   AX00002459   GGTGTGATTACGTCACCAACAGGAGCAGCGATTCGTGATATTATAACAACGATT
7   O04   AX00002460   CAGGAAAACTTTGTGGTGATGTTGACTTTGACAACGTGTTAGATGTTGCAAGTTA
7   O06   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
7   O08   AX00002462   TTGAAGTAATCGCAGGTATTGCAGCTGCTGAGGTAGAAGGTGTAGCGGCAATG
7   O10   AX00002463   CACTCAGTGAGTTTGTCGTTGAAGGCGTACATACAACAATCCCGTTCCATTTGC
7   O12   AX00002464   TTCTTCTTCTTCTCCTGATACACCTCCATATGTAAGTGTAGGAGATAGAGTATCG
7   O14   AX00002465   GCATCGCCGGCAACAGGTGAAAAGATTGGACAAGAAAAACAAGGTACTGATAAA
7   O16   AX00002466   ATGAGAAGGGAAAAAAGGTAACACCTAAGTTCTTACTTGTCCTACTCATACTTGG
7   O18   AX00002467   AGAAACAGTATGGTATGTCAGTCTCTGAAATACAAATAGTCGCAGCGGAAAGCA
7   O20   AX00002468   AAGTACGATGAGTGATCAATATAAAGTAACGAAATTGTCCAAGCTTTTGCAAAAC
7   O22   AX00002469   TTTAGCTTTCATTCATACCGTACTAAAAGAATTAAAGCGTGAGGATATTGCAAAT
7   O24   AX00002470   GGTGAAACGCTCGGACAACATGATCGTGAATCGCAACAAAAACATATTCGCTTA
7   B02   EMPTY        -
7   B04   AX00002471   AAGATAGTGAAGCAATTATGGAGGCAGTACATGCAGGGGTTCAGCTTTTTATAA
7   B06   AX00002472   CGCTTTGCTCATGCTTTATGTGAATGATGCGAAGAAAGCATTGTTTATAAATGGT
7   B08   AX00002473   ACACTTAAACATATTAATTATGAGAAGAAACAATCTCACATTGGTAGTTGGCTCG
7   B10   AX00002474   GAAAGTAGAAAAAGCACACATCGAAAACCGTCGTATGCAATACTTATACGCAAG
7   B12   AX00002475   ACATTCTACTGGTCATGGAATCGGTCTTGAAATCCATGAAGCACCAGGTTTAGC
7   B14   AX00002476   TTATTGAAGTACATATTTCTAACATTCATCAGCGTGAGTCGTTCCGTCACGAATC
7   B16   AX00002477   CTGAATTAACGAGACCGATTTTCCCATCTCATACAGGGCAAATCATTGTCGAAAG
7   B18   AX00002478   ATTCGCAAAGCTCATATAAGCGCGCTGCAAAACAATCGAGCCGCAAACATGGGA
7   B20   AX00002479   AGAAGCGAAAGAAATGGGATTAAAAATCGCATTAGCTTCCAGTTCCTCTAGAGA
7   B22   AX00002480   TGATGAAAAGGGTTATGCCCGCGTATCTGATATTGCTGAAGCGCTTAGTGTACA
7   B24   AX00002481   GATGTATGGGACATTGTCATTATTGTTACTTGCAAACGACACTTGGGAGTAAGC
7   D02   AX00002482   AGGGCTTAACGCCGAAATGTAACGAAGAATTATTTTTGAGCGGAAACGTGGATT
7   D04   AX00002483   TATTGTGTCTGAAGATCATCCGAATATGCCAAAAACAGTTACAGAAGCGTATCGT
7   D06   AX00002484   AATATACTGCAGGGCATATTTTAGGCGCACGTAACATTCCGTTATCACAAATTCG
7   D08   AX00002485   ATTTCAAAGGCGTTAGAAATTTCAACAATTGAACATCCCGGTCTCGCAATGGGC
7   D10   AX00002486   ACCATCGATTTACGCACACTTTAAAGGAAAAGAAGAGCTATATTTTATATGCTTA
7   D12   AX00002487   GAGGCTCCACTTGAATGGGCTGGTGTTGCATTATTAATTACAATTAGTTTCGTCT
7   D14   AX00002488   GATGGGAACTGCTTACGCGATTTGGACTGGAATCGGAACTGCCGGAAGTGCAC
7   D16   AX00002489   CTAACATGACACTTGAAATGATATCAATCGTTCGGTCCATTATTGCCTCCATTGC
7   D18   AX00002490   GTCGGTTGTTTTACGATGGGAATGAAGAATGGGGTTAACCTATTTGAATTTATTG
7   D20   AX00002491   ACGTTCATCAATGATGGAGAAATTATATTTACTGGTGAAAAAGACGACTTAATGG
7   D22   AX00002492   GACTTATGTTTCACGTAAAAATAATGAACTATTAAAAGAACAGCGGCTTCGCCTA
7   D24   AX00002493   GCAAACTTAAATGCAGTATTAAGCCAAGCGCGCCCAGGAGATATGGGATTTGAC
7   F02   AX00002494   ACGCAGTTTGGTGGACCGCACTGTGGTTACTTTGCAACAACGAAAGCATTTATG
7   F04   AX00002495   TGCGCCTCGCAAATTAGTCGGCATCGAAGTAATTGAACGTGGAATTCCTCGTAC
7   F06   AX00002496   TTCTTCCGTCCCATTCCGCGGCGGATTTAAACGCGGGAAGAAAGATTGGATGAA
7   F08   AX00002497   GCACTATCTTGAGAAAACAGGAGGCGTACCGAATCCGATGCGCCTTACTCTTAT
7   F10   AX00002498   TGGAGAAGGTGGCCGTTCTGTATTAGAAAATTTAATGGTGAAGGCATCTATCAG
7   F12   AX00002499   CTCATTTGGAAATTTGCAAAACCTTATATCGATCCTTATTACGCGATGTTACTTTC
7   F14   AX00002500   GAAGATCGAAAACAAAAGAAAGAACAACGCCGTGCTGAAAAAGAGCCATTTATG
7   F16   AX00002501   GTCCACTATTTCAGAAGAAAGATATAGATGCATTTGTAACGAAATTCGAATCGCG
7   F18   AX00002502   ATCATGAATGTTCCTGCGTCGCATGGAGAAGGATTACACATTTTAAATTATGAAG
7   F20   AX00002503   TCCAAATCCGATGACATATAATCCGAGTGGAAATATTAATAGAGGTGGCACGAT
7   F22   AX00002504   ACACATGGACAAGCAAACGGTAATTTGGCGATTGAATTAGGTGACTATAGCGAT
7   F24   AX00002505   CTGCACAGCGACTTGTCGAATTAAAGTGTCCGTTTTGCAAAAGAAAGTGCTCAA
7   H02   AX00002506   ATATGGGTCGTACAGCTCTTAACGTAAGTGGTTCTATGACAGCAGGTCTTATTTC
7   H04   AX00002507   ATGGAGCGCATCGGAACCGAATTGGAATTGTAAAGAAAAACGAGACGAAATTAG
7   H06   AX00002508   AGCGGCTATGCAGAAATAACATATAGTAGTCAATTTGAAAAATTCAACGTACAAA
7   H08   AX00002509   GGTTTTCATGTGTTAGATTGGATCGTTCTTCTTGAAACAGAATTTGGCATTGATA
7   H10   AX00002510   AGCGAATGAACTGAAACATGCAGGATGGCACCATACATATGATTGGACCAAAAA
7   H12   AX00002511   GAGCTAAGTCTCTATGAAAATACTGCACTTATTATATGCTTTGTGTTGTACGTTG
7   H14   AX00002512   TAATTGGAGGATGGCTAAATAGAGTACCAGTTTTATTACATGAGTCTGATATGAC
7   H16   AX00002513   TGTATTACGAGATGTTCCCGCCCTTCATCTCGCACCATTTCTGAATAGACAAATG
7   H18   AX00002514   GATCCAGCACGCGTTGGTGATTTTCCAGGTGCCACTTCTGTATATGATTTATCC
7   H20   AX00002515   GTCCTTTCCCTATTCCGCTCTGGAGACGAACTTATTGTATCCGAAGATTTATACG
7   H22   AX00002516   CTACTGCATTCCTCCTTCTTTCACAAGGTGATCACGTACTCATTTCAGAAGACGT
7   H24   AX00002517   AAAGGATTAATTGAACGTGGTCCAAGCAACGTTTCTACAATGTACACTGGCTTAA
7   J02   AX00002518   GTTGCTCCGAATATTTGTGAGATTGGTGGGGGAACAGGAAGGTTTGCCTATGAT
7   J04   AX00002519   GTATTTTCTGGAGATGTATTGTTCCAAATGAGCATCGGAAGAACAGATTTACCTG
7   J06   AX00002520   TAGAACCAATTCAACGTTATTTCGAGCAATACGCTTTCTCACGTGCTGTAAAGAG
7   J08   AX00002521   CGAATTGCAGATTTACAATTAATGCAAGATGAATTGCGTGAATTAAATCAATCAC
7   J10   AX00002522   TTGGATATGGCGGTGGCTATTATGATCGTTATCTCGTGCATTATAAAGGGAAAA
7   J12   AX00002523   TTGAGCTAATAGCATTGCAGGGAAAAACATTTCTCAGCATAGTAGAGCAATCACC
7   J14   AX00002524   GCTTATGCTTATTACGAAGCAGCAACCTGTAGCAAGTGATTTAAGAAGGATTTTC
7   J16   AX00002525   TAGAGAGCGCAATATATTTGATAAATCATACCCAGTTGAAGAATTACGAACACAT
7   J18   AX00002526   TGGGGCACTTGCATTTGCAAATTATGTTCCGTTTAGTATGTTTGATAGATTTACA
7   J20   AX00002527   GTATACCGACAATTGTATATGGTTTTTTTGCATTAACAGTTGTTACACCGCTTTTG
7   J22   AX00002528   ATGCTTATTATATGGCCAATCGAGATAAGGTGAGAGCAATAAAAGTGAATGGTG
7   J24   AX00002529   GGATCAACTGCAGAGGCTCGCTTAGAAACAGCGAAAAAGCTAGCAGATTTGATT
7   L02   AX00002530   GCTCGTATGTTAAAGAAAGAGTGGCGAAAAAAAGCAATTTTACTTGGAGGCATT
7   L04   AX00002531   AATTCGCAAAAGCTGGCGCAACTCGCTTCGGTTCTGGTTGGGCTTGGTTAGTAG
7   L06   AX00002532   GCACGTGCTTTTGATTACCCATTACATTTAGGTATCACAGAATCTGGAACATTAT
7   L08   AX00002533   AAAGACGTTTTAGAGCATATGAAGGATGATTATCCAGGTCTTAGCTTTGATACGA
7   L10   AX00002534   TTTCATTATATTGGTTGCTCTTGTCATTGCAGTATCAATGCGTGTAGTAGGGGTT
7   L12   AX00002535   GATATGGGAGCTGTTACCGAGAAAGTAACACATGTTGCATGCTTAAATCAACAT
7   L14   AX00002536   AAATGCGATTTTACATCGTCTTGGTCGTGGAACTACAAAGCTTGTAGCGAAAGG
7   L16   AX00002537   TAACGCCAGATCAGACTGTTAACATTGCGTTAGAAACGATGGCAGGAAAAGGAA
7   L18   AX00002538   CATACTTACTTCCTACATTGAACAGAATTAACCCAGGTCGTGAAGAAGTACAACT
7   L20   AX00002539   GGAGATAAGATTGGCCTGCAGATTGGAGCGCTTAATAAACCCGTGCAGCACGT
7   L22   AX00002540   TTACAAGATAAAGTAGATGTGCGTAAAGGGAATGGACTAGCTGTTATCACGCCA
7   L24   AX00002541   GGCTAAATAAATCTAAAGAGTTAGCTGATGCAAAAAATGGTGGGAAGCCAGCAC
7   N02   AX00002542   ATGGATCTTGCTCCAGAAAAAGTGCGCGAAATCTTAAAAATTGCTCAGGAGCCA
7   N04   AX00002543   CGTTCAACTTAGAAAACAGGGACGTAACTATTTCGGCCTTTGTCCGTTTCATGG
7   N06   AX00002544   TTTGGTTGTTCGAGCAGCAATGGGCCAATTCCCATTTGCTCCTGATATTAGACG
7   N08   AX00002545   TAACCTCACTTCCGGTTAATATTATCATGACAAGGATGCCAAACATTGCGATGTG
7   N10   AX00002546   AAACGAAAATGCTTCCGGTATTAGGGATGCGCCCGTACTTTGACACATGTGCGA
7   N12   AX00002547   ATTGATACACCAGGAATACATAAACCTAAACATAAACTAGGCGACTTCATGGTGA
7   N14   AX00002548   GACAAGTTATGGTAGAATTATGTAAACAGGATACGAAAGTATACCTATCAAATTT
7   N16   AX00002549   ATTTAGCCGCAGTCATTGTTTTATGCTGCGGCTTTTATTTCCATATTACGAAAGT
7   N18   AX00002550   GAATTGCGTATGTTGTCCCAGTTGCGATGGGAACAATACTTGTAAAACTAATGAT
7   N20   AX00002551   GTTTTAGTTCTAAAATGGTTATTACGGGGGATCCTTCACAAGTAGACTTACCAAA
7   N22   AX00002552   CAGCTTCTCGTATCAGGGATATATGGTAATGAGGAAAGTCCGACGATTGTTTCG
7   N24   AX00002553   CTGGTCGTGAAGACCTTGTTAATAAACTGCAAAGTGAAATTCAGATTTTAAGCGC
7   P02   AX00002554   AACACCTGCAGCACGCATGGAAGACCAAGTTCCTGAAGATGTAAAGAACGATCG
7   P04   AX00002555   TTCCAGAAGTACATGCTCCGGCATCATTTAAACAATTGCTTTCAATGAGTGGTGA
7   P06   AX00002556   AATATCCGGCGGAAGGTGTATTAATAAAAGCATACTTCCCGCAAACGGATTCTT
7   P08   AX00002557   ATGCCATTAACGTTTGCGCAAATGGCACTTGGTGCTGAAGTAGAAGTTCCTACT
7   P10   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
7   P12   AX00002559   GTCGCACATTACGTCTACAAGCTGATTTTGAAAATTATAAGCGCCGTGTCCAAAT
7   P14   AX00002560   GCAATCGGCTCAAATTTTATCAGAGCTTACGAATTATACGGCCATTGTTCTTGGA
7   P16   AX00002561   GTAGGCATAATCTCACATACTGGAATAATGAAGAGTATTATGGGTTTGGAGCTG
7   P18   AX00002562   CCTCATCGTTTTAGTGAATTACAACGGTTATTTCCAAGCATTTCTCATAAAGTTTT
7   P20   AX00002563   CGCTAGGATTTGGTTTCCGTTGTGGATTCTTAGGACTTCTTCATATGGAAATCCT
7   P22   AX00002564   CTTGGACCGATAGTGGTAGAAAATGTATTGGTAACGAGACATTTGTTTCAATTGC
7   P24   AX00002565   ATAACGCTTCTATCAAGTCTGACATGCGTTCTGCTGTTAAAACTGTAGAAGCTTT
7   B01   EMPTY        -
7   B03   AX00002566   TTAACGTTATACGTCGGTATGGGCGGAGAGATTACGCCGAAACTTGTTGCAGAG
7   B05   AX00002567   GCTGGTGGATATAATGGTTCAATTAAAGGTGGCGTACATTGTATAGATGATGGA
7   B07   AX00002568   TGCCTTACAATCATTAATCGAACGCCAGCCAAAGCATATCATATAAAGGAAAAAT
7   B09   AX00002569   CACAGTGAATGGGGAAGAAATATCTCTTATTTGGAATTGCTTCCCTGGTGAAGA
7   B11   AX00002570   GCACGCTGGGTGTTAGTTGACCTTGGAGATGTAGTTGCTCATGTATTCTATAAA
7   B13   AX00002571   AGATTTGCCGAAAGATTTACTTTGTTATAACAAAGAGTTATGGCATGCACCTGTT
7   B15   AX00002572   CTATACGTATGACACTATGCTACAATTGACGAAGAAGTATCCGGATGTGCAGTT
7   B17   AX00002573   AACAAATTGCAGATACTTTAGAAGCTCGTGAGTTATTTAAAGTAAGTGTGCTACA
7   B19   AX00002574   ATATTATCATTCAGACGACAACGATAGGTATGCATCCACGCGTCGAACATACGC
7   B21   AX00002575   AGTGGCGGTCGTCGTGCATTTACTTGTCACTTCTCAAATCGCTTAACAATCCATC
7   B23   AX00002576   AGAGCAAGGCATTCAAGTAACGGTCGTTTCAAATAATAATGAGCAACGAGTGAA
7   D01   AX00002577   GTCATTATCATCGTATTCATAGTCCGCTTTCTGGTTCTGTGACTGAAAGATTTGT
7   D03   AX00002578   TATGTGAAGAACAATGCGTTTCCGCAGCCATTATCATCAGACGATGAGAGAAAG
7   D05   AX00002579   CTAAAGGCTCTTAATTTACAGCAGGAACCAGAAATTCATAATATGTTTTTAGAAA
7   D07   AX00002580   TATAGGCTTGTTGTAGATGATCAAGAAGGTGTGGATGACCCATATCATCTATTAT
7   D09   AX00002581   ATACGTGTCCAATGATCGGTTTTGATGAAAAAGCAGTACAAAGTGAATTAAATAT
7   D11   AX00002582   CTAAATTTGAAATTATGAACCGGGAAGCCCAATTTTTAGAGGATTACAACCCGTT
7   D13   AX00002583   TGCCTAGTGCCGAAGACTTAAAAACGCAAAAAGAAGCAGCTTTTCAAAAGGGAA
7   D15   AX00002584   CAGGAGAAGATGTAAACGTATATGCATTTGGCCCTGGTAAATACTTGTTCTCTG
7   D17   AX00002585   GAAATGATAGTAGCGTTTCATGGAAAGAAGGAGAAACGTATCATCAATTCTTAAA
7   D19   AX00002586   AAACAGCGGTCTTTTTCGGCCTTGTAATGAACTTTTCCTATATGTTTAGTGGGTC
7   D21   AX00002587   AAAGTGGATTTCATTTTTAGCAGTACCGACAGCTTCATGGTCAGCTGATAGCAAT
7   D23   AX00002588   ATGCACCTCTTGCTGCGCAAAGTAACATTCAGCATGCTCCAGATTTACAAAATAG
7   F01   AX00002589   CCACGCTGTATGGCGTTACATTATGAGACAAAATCATAGTTTCTTAAAAGACGTT
7   F03   AX00002590   TAATCACCACCCATTTATCCTTATCCAGTATAAAGCAGTCATTATTACTTTGTCAT
7   F05   AX00002591   TTGCAATTGTAGAAGAAGGGGATTCTTTCTCCTGGAATGCATGTGTTCCTCATAT
7   F07   AX00002592   TACATTACATAGCAAGAGAATTAGTAAGTGAGTTTATTAGACCAGTTTTTGCAGG
7   F09   AX00002593   TGGTCGCGAACATAGTAAATTTAGTTGTGAAATGTGAATATAGAGGGAAGGGAT
7   F11   AX00002594   ACGCTTCACTATGGGGAAATGAGAAGGTAATGCGTTATATTGGAAATGGGACGT
7   F13   AX00002595   AGCTATTTTAGTAGCACAACCAGAAGCATTACGTGCATCTGGTCCACATGGTAT
7   F15   AX00002596   ACGATGAAAAGTGCCGATGTAGCGAAGCAATTAGCGATGTTACCACAAATGCAT
7   F17   AX00002597   TTGGTGCAGCAACATCAGCATTAATGTTATTGCATAGTGACAAAGTACAGTCCG
7   F19   AX00002598   TAGTGTATGGAGCACCAGGTACATATTTAGCCGCATTACCAACCTCTTTATCAGG
7   F21   AX00002599   AAGAAAACGTACATGTAAATATCCGGAATTAGGAAGTAAGGCGCAGTTTGTTGC
7   F23   AX00002600   GTTGTTCTCAAAAGGTGACCACGTTATTTTAACAGATGATGTGTATGGTGGAACG
7   H01   AX00002601   AACCGACTGCTGGAAATACTGGTATTGGACTGGCACTTGCAGCGTTACAACATG
7   H03   AX00002602   AAGCAGCAGCTGTTGCACAAGTATGCCACCAATATGAAGTTCCGTTTGTTATCA
7   H05   AX00002603   TGGTAATTTAACAAATAAATTATTACTTGCTGGCCGCACAGTTTACGGTATAGAA
7   H07   AX00002604   GCTTCTTTAGAACGAAAAATTAGTGAACAAATCGATAATAATAAAGCACTTATGC
7   H09   AX00002605   AAAAGCTAAAGGCTGAAGAAGAACAGAAAAAAGCTGAAGAAGAAGCGAAAGCTA
7   H11   AX00002606   CAATTGCAAATATGATGGCGACGATTGCTAGAGGTGGAGAAAAGATGGAAGTGA
7   H13   AX00002607   CACGTAGCTTCGGAGATCTTTCTGAGAACTCTGAGTATGATGCAGCGAAAGATG
7   H15   AX00002608   ACAGATGCGGACCTTCGTATCCTGCGCCGCATGCAGCGTGATATTAAAGAACGC
7   H17   AX00002609   CAATGTGTATCGCATATTCAGGAAGATGTACGTTAAGTAACCATATGACAGCGC
7   H19   AX00002610   CTTGTATGTTCCAATCGAAGCGTTCATTAGTAGGAAACTACTTTGAGTATCAAGG
7   H21   AX00002611   TTGACGCAGCAAAAGGACAATATCGTCGCTTTTTTGACTTATATGAACCGTTATT
7   H23   AX00002612   TATTGAAGAAGAGGCAACAGGCTTTACAGATCGTCAAAAGATCTCTAGTGTCTTT
7   J01   AX00002613   TTTTCACTTTTGACGCTGAAAAATTTGGCAAAAAATCATACGTAGTCTTCTCTCC
7   J03   AX00002614   TGAAGCATGCCAACAATTTGCAGAAAACCTACGAGAGCTGTTACAATTAGACGT
7   J05   AX00002615   TTTATTAAGTGGAGACCCAGCATACATACCTCGCCATAAAGATGCACGAAGCAT
7   J07   AX00002616   GATTTTCTATGACCGCGGAGAAGCTTACGGTAATGACTTTAGTGACCCAGAATT
7   J09   AX00002617   GCGTATTTATTGCATCCTTTAATTGAAAAAATTCATAAGGAAGGGATGCCGCGTA
7   J11   AX00002618   TTTTATTGCTGGAATTGTTATATCGAATTATCGGTTTCAAAGGGGAAAATCCATA
7   J13   AX00002619   CCAACAGTAAAGCTTACTGAAATTTATCGTCAAGCGGAAGGTTCATCAGTGATTC
7   J15   AX00002620   CCAGTGCGGACTTTGTTTTGCACGATTAGAACATATTCAAGAGGCGAAACCTTA
7   J17   AX00002621   TTAGCGACAGCGGCGAAGAAAGATAGTACTGGTATTTGCTTCATTGGTGAGCGT
7   J19   AX00002622   TATACGCTGGTACAAATGTGAAATTTGAACCGTTATTAATAGGCGGAGAGCAGG
7   J21   AX00002623   TATCAGATCAGCCGGCTAACATTACAGCTGGGGATGTAATCCGTGTGTTAGAGG
7   J23   AX00002624   AGCCGTACTCACAAAAAAACAACAAGCAATCGAAGAAGATTACGCAATGCTTGT
7   L01   AX00002625   TCTCAAGTATGGGTGCAGCAAATAAAATGGATCCAACTCGTTTTCGTATTGCGG
7   L03   AX00002626   ACAGTCTCCACAGCTATTTAAACAGCTTCTTATGGTCGGTGGATTTGAGCGTTAC
7   L05   AX00002627   GGCATGGGCTTAAAAAATATTAAAGTTGTATTAAACAGCTTAGGTGATGCGGCG
7   L07   AX00002628   GTAGAAGGACAAGTTCTATCCATCTCGCAATTCACATTATACGGAGATTGCCGC
7   L09   AX00002629   CAAGCTGTTACAGAGACGAAAACGTACATTTCAGCAGTTTCTGGTAGAAGTGAC
7   L11   AX00002630   GTAGGATTTGCGCCAGTTCGTAAATTAGGAAAATTACCACGTGAAGTAATTACAG
7   L13   AX00002631   ATGCAGAGTTAGAAAGTATTCGTGCAATCGGATCAGACGGTTCTCATTTAAAAAT
7   L15   AX00002632   ATATTAGCGATTATAAAGGCGGTAATTGGTTATATTGGGAACAGTAAAGCGCTAT
7   L17   AX00002633   GTAATTGCACTGCTTATCTTCGGTAGTGAGTCACTACGTAACTTCTCGTTTGCGT
7   L19   AX00002634   CGGTTACGACCGAGTGACAGATGATGACATTTGGAAGTTTCTTAAAGTGAAAAA
7   L21   AX00002635   CAACCCAGCAATACGGTATATTAAACGGGTATGCATTCCCGCTCCTTTCACTGC
7   L23   AX00002636   TCATTTTGTCTGTCATTTCTTTAAAGTTTCAACGATTTCGGCATTTAATAGAAGGT
7   N01   AX00002637   GGTGATGCTATCGTAACAATCGGTGGTTTACACGGTACAATCGAATCAGTAGAT
7   N03   AX00002638   AATTCGTGGTATTGATATGTTTGACTGCGTACTGCCAACTCGTATCGCTCGAAAT
7   N05   AX00002639   GCGAAACAGGGGATATTGAGCATAAACATTTTACGGACATTCTTTCTTACTTACA
7   N07   AX00002640   GTTCATTGGAAGGCTTCCAGGCGATATTTTTGTGAAAAAAGGAAACGTTACCTTT
7   N09   AX00002641   TCGGTGTACTTTCAAGATTAGAGTATTACACAGTAGATCAGCTTTCTGCGATTGT
7   N11   AX00002642   AAGCGATTGAACATGAAGACGAGAAGTTTTTAGTGAAGTTCCCGGGCGTCGGAA
7   N13   AX00002643   TGTATACGGTAGCTTCGGGTACGGTGACATCATCTTTAACGACTTAAAACTTCCA
7   N15   AX00002644   AAGTGATAATGCGATTCATTCCTTCTTTCAAATTGATATGAAAAAGCTTGAGAGT
7   N17   AX00002645   GAAATCTCCATTGTGGCTATTATTTATGCTTACGAGTATTTTACTTGCTTATTTAC
7   N19   AX00002646   TGTAAATTACAACGGTCAAATTGCTAATCCGCATCCAACACGTAATATTACAATG
7   N21   AX00002647   AACAACAACATCCATATCAAATGCCATATCAGCAAGGAGCACCGTTTGGACCGC
7   N23   AX00002648   AGCGTCTCGTCTTTTTACCGGATCAACATTTAGGGAGAAATACAGCGTACGACT
7   P01   AX00002649   ATAGCGACGATGACGCGTAAAGCGGTTCTCGCTTTAGATAGCAGCCATACACGC
7   P03   AX00002650   CAAAGGAAACGAATCGTAATAATAATACACATTTAGCGCAAGGTGGAATTGCCG
7   P05   AX00002651   AAAGCAGCATCGCAATACTTCGGAAACGAACAAAGTTTACACGATATTGGAGGA
7   P07   AX00002652   AGTTGAGCATCCTGTATACGGTGACTTAACAGCATCCATCATGGTAAGTAATCG
7   P09   AX00002653   TGTAGCAACTGGCTTTACTGGCTATCTATGCCGCGTTCTTCAAGAAGGTACTGT
7   P11   AX00002654   GTCGTTTTTTTCCGGAAGCAGAGCATGTACCGTATCGAACGATTCCAGATTGTA
7   P13   AX00002655   TATGGAAGATTTCCCGCTGGCAATTATGTATGCTATTTTTTGCGCCAATTATAGT
7   P15   AX00002656   CAGGTCATGTGCTTGTAAATGGAGAAGAAATTAATCAAATGCGTGCTGCAAAAT
7   P17   AX00002657   GGATTGTTGTTATTCCCGTCTCAGCACGTTGTTGAGTGGCAAGGACAACAAACA
7   P19   AX00002658   TCCAAACCTTGGTGTTGTTGAAACTGGTGATAACCGCAGCTTCGTTATGGCTGA
7   P21   AX00002659   ATCGATCGTTTTGTCCAAGAAGCGAGACAAGAATCCAATCTGATGGGGCTATCT
7   P23   AX00002660   ATCCAGGTGTTAACGTTGGTCGTGGTGGCGATGACACTTTATACGCGAAAGTTG
8   A01   EMPTY        -
8   A03   AX00002661   TGGAACTACAGCGGTTGTGTTTGGTTCTATAAATGCAGTGGAAGAACTTTGTAA
8   A05   AX00002662   GCGAAAGTTGAAAAACAAGGTCGCGCTAAGAAAATTATCGTTTTCAAATACAAAG
8   A07   AX00002663   TTATCGTATACATGAAGGGCAAGCGGTACTCGTACAAGTTGTAAAAGAGGCAAT
8   A09   AX00002664   TGGCAGTTACTTTGGAATAGTAATAATATTATGATGTGGGTACTGCTCATATTTT
8   A11   AX00002665   AAAGATTATGCAATTCCTGCTTCCGGAAAGGTGATGCAAGGGTTTCAAAAAAATG
8   A13   AX00002666   GTCGTTGAAGGGCGTTGCCGTTTACCTCAGGCTCTTATTAAAGATAAACGTTTTG
8   A15   AX00002667   TAATCGCTGCATCTGTTATGAATCCGATGCAACTTCGAATTAGTGATGTGGCAAT
8   A17   AX00002668   GATTTTTAACTTTGTTAGGACGTACTCATATGTCGGCGTATGTCTTTTTCACAGA
8   A19   AX00002669   TATGGCTGTAGTAACTTCACAAGGTTTAGTTGGACGAGTGAAAAGTGTATCTCA
8   A21   AX00002670   CTCACGTAAACCATACGTAATGGTATGTGTACCATCTGGTATTACAGCTGTAGAA
8   A23   AX00002671   AGAAAATAACAGTGATCATATTGTGTTAGGTGCAGATACAATTGTTACATATGAA
8   C01   AX00002672   TGATTTCACTTGTCCTTTCGCCTCTTTTGAAGATGTGCGGATCGCAATGAAAGG
8   C03   AX00002673   AAATTACACCAGCACATGACCCGAATGACTTTGAAGTAGGTAACCGTCACGACT
8   C05   AX00002674   CCTTTTACGAAAGAAGAGCAACTACTCATGTTTGCGTATATGACGTATCCATCGC
8   C07   AX00002675   TAAGAGATCTATCGCCAGCGAAGTCAATAGATTATGTAGAAACAAGAGAAGATG
8   C09   AX00002676   CAGTTAACGCCAGAATCATATGTAGAATTCGAGCGTAAAGCTGAAATGTTAGAAG
8   C11   AX00002677   ACCAGTTATGTCGTACGCTGTGAAATATTCATCAGCATTTTATGGACCATTCCGT
8   C13   AX00002678   GCAGCATTGAAGTTAGGGAAAGTAGACATTATTACATTTACGAGCCCTTCAACTG
8   C15   AX00002679   TGCTCGCTGCAAGACCAGATTTACAAGTGAAGTGGATTCGCGGAAATATCGATA
8   C17   AX00002680   CAAAGTAACCGAAAGGCGAACCGATTTGCTTTTTGGTTACTTTCGATTGTATGGG
8   C19   AX00002681   TTAAAACGTGGTTAAGTACACTTGGTGTCGTTCCGTTAATATCAGCTCTTCGTGA
8   C21   AX00002682   AGAAATGGGCATTACGTATCCACAGTACATTACTTTACTCGTACTATGGGAGCAA
8   C23   AX00002683   GCAGGCGGAGAGGCAACAAATCCAGAACAACTATTTGCTGCTGGTTATGCTGCT
8   E01   AX00002684   AGCAGGTCGTTCAAATGTCGGGAAGTCTTCCTTTATTAATAAAATTTTAAATCGT
8   E03   AX00002685   ACGTACGTTGGAGCAATGCCAGGACGCATTATTCAAGGTATGAAAAAGGCAAAA
8   E05   AX00002686   ATCTCCATTTCGCACAAATGCAACATTTATTGAACTGGATGCGACGACAGCTCG
8   E07   AX00002687   TTGAAGGCTTAATGCTTGAGGTAATGTTCGAGCTACCATCTCGCAAAGATATCG
8   E09   AX00002688   ATCAACGTACCAGGTTTCCGTAAAGGAAAAATGCCTCGTCCGTTATTCGAACAA
8   E11   AX00002689   GGCATTTACAGGTCATAATGAGGAGCAATCCGATAACATTATACATACATTATCA
8   E13   AX00002690   AAGAAATTTCATACGACAACGACATTACATTGCAGTATGCACATAAAAGTTTAGA
8   E15   AX00002691   AAGTAGATATCATGATTCATTGCGGTGATTCAGAGCTAACGCCTGCTCATGAAG
8   E17   AX00002692   AGATGCTTTAAACGGAAAACCAGGTGTGTATTCAGCTCGTTTTGCTGGAGAGCC
8   E19   AX00002693   TAACAGGACGTACAATGGAAATCCAGCGCTTAATTGGACGAGCATTACGTGCGG
8   E21   AX00002694   AGGGTGTGGCTTTATAAATCAAGAGAAAGCAACGGAACAAATTGATCCGCCAAA
8   E23   AX00002695   TAATAACCGTGTTATGGTAGAAAGTTTAGCGTGTCCGCCTTTCGTTGAACTTGTA
8   G01   AX00002696   ATTAGTCAATCGAAAGTAAGTTGGGTTGTAGTAGGTTACTCCTTAGTTGTCGGTA
8   G03   AX00002697   AATGGCGGAGAGCATCGATTGGGAATGGTATCAAAAGAAAGAATTTATGAATCG
8   G05   AX00002698   ATCAAGATGAAAGTATGTCTTTTGCAGAACGTTTCCAAAAGACGTTTATTCACTC
8   G07   AX00002699   TTTCGGATTATGATGCGGTTTTATTTGGTGGTGGACACGGGGCGATTGTAGATT
8   G09   AX00002700   TTGCAGGTGAACTTTTTATCAGTGAAAAGACAGTTCGCAACCACATCTCAAACGC
8   G11   AX00002701   CGGCGTTATGTTTTTACCGTCTGGAGCGCTCCAGTCCTTGCCGTCTGTTATGCA
8   G13   AX00002702   GTGGTGGTTTAGGAGAATATTTTGATATTAGCTCTACTCTTATTCGCATACTTTG
8   G15   AX00002703   TAGATGTAGGACAAGCATGGCATCTAGAAACGATGTTCCGTTATACGAAAGAAA
8   G17   AX00002704   GAACAATTTCTGGATGTCACATTAACCCAGCAGTATCAGTAGCTATGTTCATCAA
8   G19   AX00002705   ATCCAGTTGTGATTCGTCGCATTACAGGAATGTTGAAGAGAGCAGGACTTGTTG
8   G21   AX00002706   ACAGAAGAGAATGAGAAGGGGTTACAAGCTATACATGTATCGTATGAAAAACAA
8   G23   AX00002707   AACTGTTTTAGATAATAGTCCTCATCAAGCAATGAGCGTAAAAACAGGCAAAGGC
8   I01   AX00002708   GTGCGTTTATTGCGACGATTTTTGGTATTTTTTCAGGTTATGTATTATGGCATCC
8   I03   AX00002709   TTATCGTTCATACAAACGCCAAAAATCATTACATGATACATACGTTAGACGTCAA
8   I05   AX00002710   GTGAAGTAGATATGTTTGGACATGTAAATAATGTCGTTGCCTTTACCTATTTTGA
8   I07   AX00002711   AAGACATTCCCGGTTGTTCGTGACTTACAAGTTGACCGTAGTCGCATGTTTAATG
8   I09   AX00002712   GCAGGTGAGTGTGATTATTCTATGCACGGTGGTAACCGTCTTGGTGCGAACTCA
8   I11   AX00002713   CAGAGGCTTTTAACAAAGCTGCAGGCTTTATGGAGCTCCTTCCATTCCGGTATG
8   I13   AX00002714   TTGAAAAAGCTGGCTGGGGCACTTTAAGCATTATTGAACATAAGCGTCGTGAAA
8   I15   AX00002715   TACATTTCATCGTCAATTACACGGGAAATCTGTCATTCAATCAGCACTGGATGAT
8   I17   AX00002716   GTAGACGTGGATGAAAACCAAGAAACTGCTCGTCAATTCGAAGTAATGAGCATT
8   I19   AX00002717   TCCGTACGTAACGACAATTACAAAACTTGAAATTGACGGTACAAACGTGAAGATT
8   I21   AX00002718   GCCACATGCGCTTTGCAACTGAAAGCGCAAAACTTGGTTTACCTGAATTAACAC
8   I23   AX00002719   AACGCACTTCTTGCTGTTGTCGCAAAATGATCCTCTTGCTATCGTTACGCAATTA
8   K01   AX00002720   ATCATCTCCAGTTACACATAGTAATTTTTTATGGGAAAAGCGAGTACCAGGTAGC
8   K03   AX00002721   GCATTTGCAAATAATACGTCAGGGACAGCGATATCGGTACTTCTTGGTGGAACA
8   K05   AX00002722   ACAAACAACTGTGGAATCATTACAAAGTGTACAAGATTCAAACTTCATTTACATTG
8   K07   AX00002723   TGTTAGGAAGAGTCGCTTGGCATATCGTGACGGCAATTCCTGTTATACTATCTG
8   K09   AX00002724   ATTATTGGAGTTATTAGTGTATCTCTTTATTTCACCTATTATGGTACCCCTTGGG
8   K11   AX00002725   TGGCATTAATGATCTTTGTGAGCATCATCGCTCAAGTAGAAGGTGATGCAGAAA
8   K13   AX00002726   ATATTGGCGTACGGTATAAAGGTGTCCCGGCATCATTGAAGCTTATGGCCAAAA
8   K15   AX00002727   TAATTCCTTTATTTTTTGGAATGAGAAAGAAATCGACACCGACAACGATTACTTC
8   K17   AX00002728   ATTGTGAATATATGGGCTATTACGATAAAAATGAAATTGACCATGCTTTACATTTA
8   K19   AX00002729   AGGGTATTGAACAATTTTATATCAAATGCGATTACATATGGAGACGATGGAAAGA
8   K21   AX00002730   GAAGAGTATTACGGTGACGATAACGTTATTAATGTTCATATGAGAAGATTGCGTG
8   K23   AX00002731   AGATCAACGCACCGGCAAATTAACACGTGGAATTGTAAAAGATATTTTAACGAAC
8   M01   AX00002732   ATTTATGAGAAGAAGCGTTTTGATACGAAAGGGAAATACATTGAAGGCGATGAT
8   M03   AX00002733   AAATACAGTTGATTATGATGAAGTAACAATTAGTACACGCTGGAATGCAAAAGAA
8   M05   AX00002734   CGAAAGACAATGATTACTATTTATTTCGTAATTATAAAGGTGAAGATATGAGAGC
8   M07   AX00002735   TTAAGCAAACGACGACTTCTAATATAACGATGAAGACGTGGGGCGATGTAGAAA
8   M09   AX00002736   ATACAGAGTACTTAAAGAAAGCTGATCCAGATATTATTTTACGAGCAGCTCATGG
8   M11   AX00002737   ATTACAACCACTTGCAGTTCAAGCAGCTACCAAGTTGGCTGACGGTGAATATTC
8   M13   AX00002738   TGCTTTTACTGTATGGAAAGGCGATAAAGATGAATCGTCTAGAATGAATAGGTAT
8   M15   AX00002739   CAAACCGGCAGCTGTAAAAATTCATGTTGTTGTACCAAATGCAAACTATGACCAC
8   M17   AX00002740   TGGAATGGGCGCAAACGGAGGAATTATTTTAACAAATGTCGTGAATCATTTATTT
8   M19   AX00002741   GATATAAGTTTATGGCGATTACGGATCACTCACAATACTTGAAAGTAGCGAACG
8   M21   AX00002742   CAGAGGGTTTATTCTGCAACTTGTAAAGTTAACAAGCTTTATTATCGCATACCTT
8   M23   AX00002743   TAAAATGCGCGAACTCAATGCCAAGAATCCTTCGCTTGACACGAGTAGACTAGC
8   O01   AX00002744   ACAACAATATAAACATTCGCTTAGCCCGAAAACTCCGCAAGGCGGGATCTTCAT
8   O03   AX00002745   TATTAAACTTTCGGATTCGAAGATTTATCGGGAAACACGATGCCCGCTTGTTAAT
8   O05   AX00002746   TTAGAAAATACGGCGGTACAAAACACGCTGGATTCGGTCTAGGTTTCGAGCGCT
8   O07   AX00002747   AGTAAACGTTCTAATTGAGTCTGCATACTTTGCAGGTCAAACTGTGCGCCGTAC
8   O09   AX00002748   CGTCTTCGTCCAAGTTTCTTCCCATTCACAGAGCCATCTGTAGAGATGGATATTT
8   O11   AX00002749   GTTGTGCTTGGAGAAGGTTGTGTTGATGCATATAATAGTAAAGTACTCCGCTCT
8   O13   AX00002750   TGTTGATGCAATTCAAAGCGGCGAAGAAAAAATGCTTCCAGGTCTTGGTGTTTT
8   O15   AX00002751   TCGCTTACCATGCGTTTCACTTAGCTAAAAAGCATCACGCCTCAGTCGATGCTG
8   O17   AX00002752   TGTTCCAAGACGCAACGAAGCAGCAATCTTCCGCACTAAACTTAGATGTCTTTAA
8   O19   AX00002753   TCGTTGTTCCTATCATTTGTATAGGTTCTGGAATAGATTTAGAGGGGATGGTTCC
8   O21   AX00002754   TACACTAGCTCAGCCAGTGTCTAACACGAAATTAGATATATTCGGTGTGGTTAGT
8   O23   AX00002755   TACAACGTTAACAGGAAAAGTAGAGCAAGTAGGCTTAACAACAGCGAACACATT
8   A02   EMPTY        -
8   A04   AX00002756   TAACATTAAGCCTCTCTATTTCACAACCTAACGATGAAAAACTAATGGTTCCGCG
8   A06   AX00002757   GTAACGAGCGTGAACCACGTGAAGTAATGAAGAAATATATTGAGCCGTTTGCGG
8   A08   AX00002758   AGTGTGCACAGACGAATAAAACACAAGTAGAAATTTTCTTAGACACATATGCGAA
8   A10   AX00002759   TCTTACAGCCGCTTAATGCACGGTCTTAAAAATGCTGGCATCGAAGTTAACCGC
8   A12   AX00002760   TGGATCAGGTAAACTGAAACGTTCTCACGCTTACACAAGCCATTTATTCGCTAAC
8   A14   AX00002761   GACAAGGTTAAAGCGTCAATTCGCTTTAAAGGACGTGCCATTACTCATAAAGAAA
8   A16   AX00002762   GTACTAGGAAGCAGAGAGCTTTATGAAACTTCTGGTCACTGGAATCACTACCGT
8   A18   AX00002763   ACTGGCTTTGTGATCCGCTTTCATTCTCGTTTTCATCATATGTTCGTTTTCGTCT
8   A20   AX00002764   GGTGTAGGGAAAACGTATTTATTAGGAGCAATTGCGAATGAGCTTGCTCGAAAG
8   A22   AX00002765   AAGATCGTGTATTTGGAAAAGAGAATACGCATCATTCCCTTATGGTGACTATGCA
8   A24   AX00002766   TGAAAAGTGATATGATTGGTGAAATTGTTATGGAAGAACTACGTGATATCGATGA
8   C02   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
8   C04   AX00002768   CCTCTCTTATTTGAAAGTAAATTAACAAGTCTCGTTGACCGCGTTTTAGTTGTAG
8   C06   AX00002769   TGCGTCTTTATTAGGGTATGCACCTGCTATGATGGCGATATTAGTTGCAGTGAT
8   C08   AX00002770   GCACGTCCGTTTCTTGTTTACAGATGGAACTGAATTACATTATAAAGATGTGAGA
8   C10   AX00002771   TTTTAAAGAGTGGCTTGCAGATGGAGAAATGAGAAAGTATACATTTGATGCGAA
8   C12   AX00002772   GGGAACCGTTGATATGAAGGGGCTTCTTGAAGATATTCATATGGTGCTTGATAA
8   C14   AX00002773   CAGATGAAGAGAGCATCACAATTGCTGAACTTAAAATTTTGCCGGAATTTTATGA
8   C16   AX00002774   GGGTTAACGAATGATGCCAATCCATTATATATTCAGCATGATTACGCATCCCAAA
8   C18   AX00002775   AGAAGCGAGCCCAGTACAAGGTTTTGATGCTAACATTATTGGAACATCTGATTAC
8   C20   AX00002776   CAAAAACTGGGGTTACGAAGTAGCGGAACAAGAATTCGGCGACAAAGTATTTAC
8   C22   AX00002777   GTATACCATTGTTTAGGAATTGACCATGACTTATTTACACCTATTTTTGCAATTAG
8   C24   AX00002778   ACGTATTTTTCACTGGCGACACTGCTTTCGCCATCGGTCTTCTCATTTTATACAT
8   E02   AX00002779   TGGCGAAAAGACAAGGGTTTAAAGTGCTTGGAGAGATTCAATCTAAGTTGAATA
8   E04   AX00002780   AACAGTTGGTATCTTACTTGATACAAAAGGTCCAGAAATCCGTACTCATGACTTC
8   E06   AX00002781   GAGTATGACATGGAAGATGTTATCGCTCGTCTGAAGCGCGGTAGTGAACGTGG
8   E08   AX00002782   GACCGTGTTCAAATTGCTCGTCATGCAGAACGACCGACAACGCTCGATTATATT
8   E10   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
8   E12   AX00002784   GACGTGGTGAAGGGACGTTTATTCGAAACTTTTACGATAACGGTCTTGTACAAT
8   E14   AX00002785   TATTAAACTTTTATATCGCTATGGCGTACGCGACATTATTATGTGTGACCGTAAA
8   E16   AX00002786   ATTCCATCTCTCGCTCAGGCGATGCGACATAAGAAAAAAGTACAAAGAGCTATT
8   E18   AX00002787   CTTATCGGAAAACCAACTCTAACTTACATTAATCAATTCGCCCAAAATTTAAGAAT
8   E20   AX00002788   TGCTGTTGGAGGTGTATTGAGCTGGTTTATTTTTTTGTACATATACGGTGTTTTT
8   E22   AX00002789   TTCACAGGGTGGTCTTAGTACCATTCTACAAGAATCGTTTCCAGAGAAAAATATT
8   E24   AX00002790   TTTCGTACAAACCGCCCAATGGAGAAAGGTTGGCTCTCAGGAAAATCCGCAATG
8   G02   AX00002791   AAAAGCTGACATATGCAGAAGTCGTTAACATTGTTGATGGTCAAGTACTTGGAG
8   G04   AX00002792   ATTTGAACTAGCGACATTTTTAAGTTGGCAAGGTGTAAATACACATCCGATGCAT
8   G06   AX00002793   TTGCTCTGACATTACACGTACAGTGGCATTTGGCGAGATTTCTGAAGAACAAAC
8   G08   AX00002794   TTTTCTAGCGAGAGCAAAAGTTGGACGGGACAATATAAAGGCCATATTAAGGAT
8   G10   AX00002795   TACGAGTTTCTATATGGGAACATAAAATCTTTCTTACGCAGCTTATTTTTCAGACT
8   G12   AX00002796   GCGATATCTTATGGATTAGGGCACGTGTATTCGCATCCTATACTAACTTTTTTAA
8   G14   AX00002797   TTGAGACAATTTTCCGGGAAATAAGAGATGGAGAAGAGTACTTATATTGGTATTC
8   G16   AX00002798   AAAAACGACGACGTTTGCTTATGCGGTATGTGATCAAGTGATAGATGGTGAGGT
8   G18   AX00002799   TAGTCATTGCTTACGAATCGCTGTATTTACTGGTGAATATGATTGGCACTATCAT
8   G20   AX00002800   CGGATTCCAAGGGGCAGATAGTGCACCGGGATGGATTTATCGTTCAGCTTTTGC
8   G22   AX00002801   CTTATAGCCGTGCAATTGCTGAACGTGCAAATCTATTTGCAGAAGACTTATTAGA
8   G24   AX00002802   TTTCATGCATTTTCTTCCTTATATGAAAGAAAAGCGAGGAGAAGAGGAAGATCCG
8   I02   AX00002803   TACGGTATGAATGTACAGTTTAAAGATGAACCAAACGAATCATATACATATAGAG
8   I04   AX00002804   TGGCTATACGCACTTACAGCGTGCCCAGCCAATTTCATTTGCTCATCATATTCTC
8   I06   AX00002805   TTGGACGTATCGATCACGTAGAAAATCGTCTTGTTGGTATTAAATCACGTGAAGT
8   I08   AX00002806   CGCTATATCACATTCACTTCCAAAACCACTTAACAGAAGGTGGCTTTGTAGGTAT
8   I10   AX00002807   AAGCAGATGGATGGCTCTTTCATTTGCATGCATTGATTCAAAGTTCACAATCACA
8   I12   AX00002808   GCTGGCCTGCTTGGGCGTTATATCAATTCGAATTATCACCCTTTTTTGGCGTTAT
8   I14   AX00002809   CGACCTCTTGGCGGTTCAATTGAACTTGGTGAAAAATCAGCACATACTGTTATTC
8   I16   AX00002810   AGCCGTATCCACAAATACATCGGTTCTTACACTGCTCGTATGAAAGGTGTAGAC
8   I18   AX00002811   CGGTGCAAGTGAATATAAGTTAAAAGCAGATGAAGGAATGTCGTATGCCCACCA
8   I20   AX00002812   CATACAAAGGCGAAGTAAAATTAATTAGTGTTGTACCTTCAATCGACACAGGTGT
8   I22   AX00002813   CGGATTTGCTGCTGGTGGAAGTGAATTTGGTAAAGTAGAACATTCAGGCCGCCA
8   I24   AX00002814   ACCGGATATGCATGGGGGACAAAAGGAATGGCTGCTGGAGTTGTAGGACAATA
8   K02   AX00002815   TCGTACACTTGGTTCACCGTTCATTTTAAATCACGAACGTACATTAACTTTAAAAC
8   K04   AX00002816   TGCGATTCATACTATCGGTGACTTATCGCTTGAATATGTCATTGATGTACTTGAA
8   K06   AX00002817   CATTCCCAGGTCAAGGGCATGCAATTGGTTCTCAAGTAACAATCGCAATTCAAA
8   K08   AX00002818   GTTACATAGCGCTGTATCCGCAGGTGAGCCGTTAAATAGAGAAGTCATTGAAAC
8   K10   AX00002819   CATATGATATTTCAATTCGTCCGTACGAAGATTGCTGTACAGTATTCACACCAGC
8   K12   AX00002820   TCTTCAAAAGCAAATGAAGTGAGCAGAGTGTTAGTGTCAATGGGAGTACCGCAT
8   K14   AX00002821   GGTAGAGTGTCAAGCGACGTTACCAGTTCAGCTGGAAGATTTATTACACGGACA
8   K16   AX00002822   TATGCGGCGTTACTTGCTGGGTCATTTATACAAACGGTGGTGCTAGTTTTCAAT
8   K18   AX00002823   AACGAAAACAACGCAGCTTGTAGCAGACGTTCACCAATTCCCAGGACACATCGC
8   K20   AX00002824   GTTCACCTTATTTACAAAGACCGCTTGAACTTGGCTGTGACGCCGTTGTTCATAG
8   K22   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
8   K24   AX00002826   ATGAGTTGGTATCAGGGAAGTAATTTAATAGATAATCCTGATGAATGGAAATATA
8   M02   AX00002827   GCGGCGCAATTTGGTTAGACCCAGAGAAAACAACTCCTTACGAGTTCTACCAAT
8   M04   AX00002828   GTTATTTTAGGCGGACGCTTTAGTCCAGAAGCGTGGTATGAAGCACTGCAAGAT
8   M06   AX00002829   AAATTGCCAGAAGCTCGTCTCATTATTGCTAGACATGACCAAACGATTGTTGGAT
8   M08   AX00002830   TATCGTGAGCGTTCTCGTCTACCCAGCAAAAGATGAGAATGATAAAGTACTCGT
8   M10   AX00002831   TATTCCCTGGAACTGGCGCTGTAAACGAACGCGGACAAGGTAATGGCTATAGTT
8   M12   AX00002832   TTAGCCCGAGTGAGCTAGTAGCAAGAGTAAAAGCCCATATTTCTCGTTATGAAA
8   M14   AX00002833   TTCTCAAAGCTCGATTTGAATCGAGTTCCCTTTCAGTTTGAAACGGTTGAATTAA
8   M16   AX00002834   ATCGATGTAAACCATGTAAATAACCTCGGATGGACAGCTTTAATGGAAGCCATC
8   M18   AX00002835   ACAAAGTGGTTCCCCCTCATGGGAAACGACGTTAAAACAACGCGGTTTTGAAGA
8   M20   AX00002836   TGCATTCGGTAAAATCGTTAGTTCTTTAGTAAAAGATATTATTACACCATTACTTG
8   M22   AX00002837   CACGTATGTAACTTCTATTTTTATTGAAAGTGTATCAGTGGATATGAGCACAAGT
8   M24   AX00002838   GATAATACACGCCTTGCATTAATGGTTCGTCCGCAACTTTCAACAGTTGTACAAC
8   O02   AX00002839   AATGGTACGTATATTGCTAGTGCTACTGTTCAAAAGAATGATACGAACATTGGAA
8   O04   AX00002840   AATCGTGTTGCAGAACAGTACAGCATTAAACATGAATCTCCGCAAGTGTTATACA
8   O06   AX00002841   TTGGAACGACAATCCATTCTTTAAATACGAAACTTCGTAATGTATCAGAGTCTGT
8   O08   AX00002842   ACTCTGCACCCGTTCGTGATTCTGTTAACGGTACAGTTTCTTACAACACGCCATC
8   O10   AX00002843   AAAGCTGTTTGAAGTCATGAAAATGGATAAGTGGGAAATGCAGTCAGCTCCTTT
8   O12   AX00002844   TGTAAATGTCCCGCTCGTTTGGGAAGTATTTATTAAAAAGCATAAAGTAGAAAAT
8   O14   AX00002845   GGATGGTAGGCATTCATCCGGTAAGCTGGGGGAAGAAAGCGGCGAGCCTTGG
8   O16   AX00002846   AAAAACATCCAGAGCGTGAAATTGTCGCTGTATTCCAGCCGCACACATTCTCAC
8   O18   AX00002847   AGATACGTCTCGCACGATGATTGATCAATACTTCATTCGCCACCCAGAAGTACT
8   O20   AX00002848   GAGAAATTACTTGGCCGTGGTGATATGTTATTCTTAGGGAACGGTACATCTAAG
8   O22   AX00002849   GATGTTGCTCGCGTATACGATCGTGAAAGCAACGAAACAGCAGGATTCAACATC
8   O24   AX00002850   TACCTGTTATTCGCTCTACTTCTTTCCCGAAACAAGCAGAAGAAGGAAATCCGTT
8   B02   EMPTY        -
8   B04   AX00002851   CGTGATGAGTTTATTGATCTATGCGTAAAATTAGACGTATTTGGCATTCCGAGCT
8   B06   AX00002852   AATTGGTATTGGACTAGAAGGCGGTGTAATGAAAACGGAGCACGGTTTATTTAT
8   B08   AX00002853   TTTCTATGCGCTTGATGCAAGTCCAGCAAACGATGCATCTGGTGACAAAACACA
8   B10   AX00002854   AGGTGAAATTACTGGCTCTTGGGTACATATGGTTCCAGAGACATTTGAAAAATAT
8   B12   AX00002855   TTATTTACGAACAGATCCGTTACTTTTGCAAACGAAAGACGGTAATATGCTCATT
8   B14   AX00002856   CAAAAGGTGAGATTGATCGCGTTTATTTAAACTTCTCAGATCCATGGCCAAAGAA
8   B16   AX00002857   TCTGAATGCGAGCAATTAGAGCGTCTCATTCAATCGTTACTCGCAAACGATAATA
8   B18   AX00002858   TTGCTGACCCAGCTTTAGACCTCGGTATGTTATTATATTGGTACATTCCGCGCCA
8   B20   AX00002859   TGCAGGAGGAATTACCATTTCGTTCGTGGGTACATAAAGAAGACTATCATATTAC
8   B22   AX00002860   TGTAGATGAGTTCGGGATCACACCGCGAACGATACAACGTGATCTAAATGTGTT
8   B24   AX00002861   TATCACAATGGATTCTGTCCTTCATGATTTCGCCTGATAGCCGAATTGGTGCTCT
8   D02   AX00002862   GAAATGTCTTCTAAATTCACGAACGGCTTATATTTCTGCGGGGAAGTTCTTGATA
8   D04   AX00002863   ATTTGGCTTAGGAATGGGACTTGTGACACCGATTTATATGGTAACAATTCAAGCA
8   D06   AX00002864   AATAACGGATCATTTTCCGATGAGTCGTACCGCGGTTGTAAAGCACCTTCATATT
8   D08   AX00002865   TTGAAAGACTTAGGGGATAATAAAACAGAATTTACGTTAATTCACGGCGGCTGG
8   D10   AX00002866   ATCGTTATCACCTTGGTATGTGTAAAGATGCCCAAAATCATGAGACAGGGGATC
8   D12   AX00002867   GTTGTTCGGGATTTACTTCGCCGCAATAAAGAGAGAGCTTTAAATGCGAGCGAA
8   D14   AX00002868   TGAAAGAGTTTGGTACGCTTGACGTTATGATTAATAATGCAGGGATAGAAAATGC
8   D16   AX00002869   TTTGGGCAGCTGGAAATATGTTTTTATTCATTTCACAGCCGCGTGTTGGAGTGG
8   D18   AX00002870   TACGAAAGGGCGTCGTACATTATACTTAGAATATGTCGCTTATAAAACGATGGCA
8   D20   AX00002871   TCGTAAGTAGTGTAGAAGGTGCTGGATTACTTTCGCTTTCTTCACTAAGAGAGG
8   D22   AX00002872   ATTATGGCTGCGAAACGCACTTCTGATATTATCCCAATGTGTCATCCTTTATTAT
8   D24   AX00002873   TATAATATTCCGTGGATATATGGTGGTTGTGTCGGAAGCTACGGAGTAACGTAT
8   F02   AX00002874   CGTATAACTGTAAATGGCAGTCCGCTTGCGGGAACGATAAACTCCCCGACAGTG
8   F04   AX00002875   GGGACGGAGACAAAACTTTGTTTACAGCCTGGAGATTCGGTGACGACAACATAT
8   F06   AX00002876   ATGTCGGCGATTGTTATGATATCTCACCTTTAGCTGTAGCAAAAGTATATGCAGG
8   F08   AX00002877   GAGAATGAATATATCTTTATTTGTCGCTCGGGAATGCGCAGTGAAAATGTATGC
8   F10   AX00002878   AAATATGGAGAAGAGCAGCCAATGAAGGGGCTTCAGTTAGCAAATAGAATGATG
8   F12   AX00002879   CTACTCTTTTAGAACGACCTAACGCATCACTAGAAGAGCTGAAGGAACATATTCC
8   F14   AX00002880   CGCTCAACTGTCAATCTACAGTATGACCGGTTTTGAGATTTACCTCATGGTGTAT
8   F16   AX00002881   ATAATATGGAGACCGGACCTTTACCAGCGGATAATCTACATATAGGAGCATTTC
8   F18   AX00002882   TCGGACATCCTGTGACAAATACTCCAACAAAATTAACAGAAGAACGTGCAAAAAT
8   F20   AX00002883   TCATCATCACCAAGGTCACCACGGTCATCATGGGCATCATCAACAACAAGTACA
8   F22   AX00002884   GCTTACCACCAAACAGTCAAGAAAGTAACAGAAGACTATGCAGAGCTTCGCTTC
8   F24   AX00002885   CACTTCTTATCGTATGTGTAGCATATGCTTTATGCTGGGTTACATACGTACAGTG
8   H02   AX00002886   TGATTTCTTTGGAGCCATATTCTTTTTCAGCTTCGGTTTAAGTATAGATCCGTTTT
8   H04   AX00002887   ATTAGATACGATTGAAATGGCTTTTGAAGGATTATCAATTGAATGGTTTAAGGTG
8   H06   AX00002888   TAAAAGAGCACTCGCAGCGAGATTATCTTTTATTTGTTATTGGAATTAACACAGG
8   H08   AX00002889   CTGGTAAAGGCTATAAAGCATTTTACCTGCCATCTATGACTGTTACGTGCATCTT
8   H10   AX00002890   TTAGGGGACGAGCCAACAGGAGCGCTTGATTCTAAAAACGCGACGAGTTTACTT
8   H12   AX00002891   AAGAACTATTACCACTCGGCTTAATTTTATTAGGGCTTGCTGCAGGGCAATATCG
8   H14   AX00002892   GGAGTATTCGGATGCGCAGTTACAATTAGAACAAGCGTATAACGATTTACAAAC
8   H16   AX00002893   GACTCGCCCAGATTGTTTACCGGACGATGTCGTTGCATATTTAGCGGACTTAAA
8   H18   AX00002894   TGCAAAGGGAAAAGTAACAGGCGCAATCTTCAACTTAGGTTACCTTCCAGGCGG
8   H20   AX00002895   AGAACTACAAAAACAATCCGGTTTTATACACGTTGCACACAATTCAAATCAAAAC
8   H22   AX00002896   TTGCGATGTACTTCATGAGCTTACTTTTTGTATATGCGTATAAACCGACTCCTAT
8   H24   AX00002897   AATATACGGAGCAAAGCATGACATGGACTTTCCTCATATGATGATCTATTCGTGC
8   J02   AX00002898   ATTACATAGTTCTCTTTTAGTTGGTGGCACTGTCATTAACTATACTGTAGAACTTG
8   J04   AX00002899   AGAAGAAGCAGAGAAGAGCATTGGTGATTTGCCTCACGCGAAGTTTCATCGTCT
8   J06   AX00002900   ATCATATCGGCTACCATGTCGTGATGGGGGACCTTCCGTCACATGGAACGACTT
8   J08   AX00002901   GTGATGTGTCACCAACAATTATTGGAGACCGCGTAAATGTACAAGATCAATGTA
8   J10   AX00002902   TCCCGTCTGGTCATACAACAGCCGTTTTCTCTGTCTTTATTCCATTTATTTGCTA
8   J12   AX00002903   AAATCGCCTATTCTGTTTTCGCCCCTCAGCATACAGCTGAAGATAATTTCGTAGC
8   J14   AX00002904   AATATATAGAAGCAGATTGGTATGCTATTATGCCTTGCGATGCGCCAAATGTTTC
8   J16   AX00002905   TTGGTGAGTTGTTCCGCATGATTAGTTATTTAGAAGATATCGGAAGCAGCGCAA
8   J18   AX00002906   AAAATGCTAGACTTACGTCGCCCAATTTACAAACAAACAGCAGCTTACGGTCACT
8   J20   AX00002907   CATACCCTATGCATGCGATCGACAATATCATACTGCCAAGTGTTGCTGGACACC
8   J22   AX00002908   ATCGTAAGTATGTATTGCGTTTGGCTTTTAGGGAGACGAATTGAGAAGCTTGGA
8   J24   AX00002909   AGAAGTCGGTTTATATGGAGCGAAAGGATATACCTAGATTAATTATCGTTAGCGT
8   L02   AX00002910   ATATAAAGTTATTTTACGATAATGAAGGTTGCGGTTGTGTAATGAGCGGCATTAT
8   L04   AX00002911   AAGGCCCAGAACAAGAGCCAGTTGGCCTTATTTGTGAAATAGATGAAACATCAA
8   L06   AX00002912   AAAATCCACTTGCTTCATTAAAAGGGTTTACGCAATTACAACGAGAGAAGCATGG
8   L08   AX00002913   TATGGACGAATATGCTGGCCATTACGTTTTTTCTGTACATGCTCATGATCTTAGC
8   L10   AX00002914   ACAAACTCAAAACATTCGCATCGGCGAAGTTACCCACTCTCTCTTCTATGCCCCG
8   L12   AX00002915   TTTCTTTGCACTATGGGAAATAGCTAGCAAAAAAGAATGGATTGATCCTTTACTC
8   L14   AX00002916   ATTTTTGAAGGGGAGCAAATTCGTAGTGCATTGGATAAAAAGTTTAATGATTATC
8   L16   AX00002917   GGGTGTCAATTGGAAATTAGGTGTTGCATATGCTCATTCTAAACAGGCGATTAC
8   L18   AX00002918   AAAGCATGTTTGGGTTGTATGCCGGTACGGGGATCAATGGTTATTAACGCATCA
8   L20   AX00002919   TTCACCAATGGGCTGCCAAACAGGATACTACCTTGTAGTAAGCGGAACACCGAC
8   L22   AX00002920   GAGGCGTTTCAAAAGCATGGCGCATTCAAAGGCTTTTGGCTTACTTGTAAGCGT
8   L24   AX00002921   ATTATGCGTAGTATTTTAGTCGCTGTATATGAACTTGGCGCTGATGAAGTATGTG
8   N02   AX00002922   AATTTCACCAAAGTTCCGTGCCTTCTGTATGTGGATGGTTGCACTTGGAACAAA
8   N04   AX00002923   TGTTCTTCACTGCTATATTCGTCGTATCCGGTGCCCTTTGGGTTATGATTAAAAC
8   N06   AX00002924   CTATACCAATTCAACAGACCAAGACGTAATCAAGATTTCATCATCGTTCTTGGTA
8   N08   AX00002925   GGCGGGGCATTAGATGGAATCGATATGCTAGCTGTATTACTTTCTCGCAAGTTA
8   N10   AX00002926   ATTCGGTTCACGAAAATCATCGTACGGTGATTATCGCGGATATAATGACAGACA
8   N12   AX00002927   GCTCCTGGCGATATGGTTGAAGTTTCATTAGTCATGTACGAATTAACTGGAAAAA
8   N14   AX00002928   GCAAGGGTACATTTTATCTCAATCGATTACGAAAGCAAATGACTTATGGCAAGCG
8   N16   AX00002929   TATTAATCAGGCGATGTCTGGATTTGATTCAAACTCAGCGAAAGCTGGTTTAAGC
8   N18   AX00002930   ACGACACGAAGCCACTTGATAAATTACCAGCTGTAACAACAGAACAAGGTGTAT
8   N20   AX00002931   TCTTTCTGAAGGAAGCGAACTTCGTATGAAGCAGAAAGCGATGTTCAAAGGTCC
8   N22   AX00002932   TATTATTGCATACCGCTGGGGCTTTAAATCAGCTTTCTTAGGTGGTTTAGTTTGG
8   N24   AX00002933   GTCGCAAATCAAGGCCGGATTGAACAAGTCATCGTGAACTTCATTACGAATGCG
8   P02   AX00002934   TAGCAAGAGCGAAACGGTTGTTAGAGAGTAGAAAAGTGACAAAGCAACTTTTAG
8   P04   AX00002935   TGGATTACCCATGCGGATGATCGTACTGTTATTATAAAAAAAGAAGAACCGATAC
8   P06   AX00002936   GTGGAGCGATAGTTGTAGGTTTGAAGAAGAGACCCCTAACGAAGAGCAAAAGA
8   P08   AX00002937   TTTAATTCGTCACATTAAAAACGATGTAACAATCGACTTTATTTCTGCATCTAGCT
8   P10   AX00002938   TACATACAAATTTAACGAAAATCGTACCACCTCTTGCCGCGGCTTTTCCTGACTT
8   P12   AX00002939   AGTAAGTGAAAATGAATTCTTCCAATCAGTAGCCGCTGCAATAGAGAAGAAAGA
8   P14   AX00002940   GAACGTATGAGTCAAGATTCCTCTTTCCGACAAGCCTATGACGCAAGGGAGAAA
8   P16   AX00002941   TTCCTATACGACAGGATTTGTTTGGACACTCATTTATTTCGTGCTCGGTTCTTTA
8   P18   AX00002942   GATGTAATTGATTTTAATAAAGCGAAATGCATTGTAGAGTTAGGGCCTGGTACAG
8   P20   AX00002943   TGAAAGAGCGGATCAAGTTCTGAACACACACTATAATGTTACGAAGCAGTACCA
8   P22   AX00002944   GGTAATAAATTTGCAGCGTTAAAAGGGATTAACCTACAAGTAAAAGAAGGTGAG
8   P24   AX00002945   TCAAACATTAAAGTCCCTTTCAAACATGGAACCTACTGGAATCATTAGTGCTTCT
8   B01   EMPTY        -
8   B03   AX00002946   AAAGGTCAATTACGCCGTATTTACGGTGATTATGCGCCAAATATTTCTGAACGTA
8   B05   AX00002947   GAATGTACCATAGATTAAGTGAGCAACCAGAAAAAATGGAAGATGCGTTTATTGA
8   B07   AX00002948   AATCCATAACGACAATGCAGCAATTCAAGCAGAGCACCCTCCTTTCCATGCAAG
8   B09   AX00002949   TTTACGAAATTAAATAAAGAAGAAGATGCAACGATTTTAATGGTTACCCACGATC
8   B11   AX00002950   TTACTTATCGCGTTACCAACAGCCATTATCGCAGGACCGATATTTGCAAAGTGG
8   B13   AX00002951   GCGGTAAAGGAACGAAAGTCATCCGCAATACTTCTGCGACAAAACTGTCAAAGG
8   B15   AX00002952   GTCGTTTTTGATTGTAACTATCGTCCATCTCTTTGGGGAGAAGACGGATATGAAC
8   B17   AX00002953   ATTCATTGAAGTACTTCCCAATGAAAGGGCTAGCTCACGAAGAAGAATATCGCG
8   B19   AX00002954   ATACGGTGCTCCTGTTGAAACGATGATTTACTTAGGCGGAGGAAAACTTGTAGA
8   B21   AX00002955   CAGGTACTTACGTATCGAGTGGTTGGATTGATTTGCACGTTCATGCTTTTCCAG
8   B23   AX00002956   TTATCACTGGACGTTGGTTCAACGCAAAAGAAAATGGAGAAAGCGCCTGAAGGA
8   D01   AX00002957   TACCGTATCTTTTTGATATGTTTTATACAGGTGATAAATCGAGAACTGAGAACCG
8   D03   AX00002958   ATTTATTAGCGAGTCATCCGAAGAAAGTGTACAATGTGGAAAATATTTTTCAGCA
8   D05   AX00002959   TATCCGCGGATTACATGTTAACGAAAGTAGGATCAGCCGGCAAACCACTATTTC
8   D07   AX00002960   GGATATGTAGGTGACGACCAAATCCCACGTCTAAACGTATTAGACCTACAACGT
8   D09   AX00002961   TACAAGAAGCAGTGCGAAAAGAACGACTTGCTAACAATTCAAACGGACTTGCAA
8   D11   AX00002962   TCTCTTGTAGGGCGCCTTTCACATATGGAAAAGGGGCTTATTATTTGTGGAGAT
8   D13   AX00002963   AGCACTCCGCATTGGGCAACCGGATTGTTACGTATTTTCTTTTGATTATAAAGGG
8   D15   AX00002964   GCTATCGTTCGCGATGGCATTCAGCCAAAAACAGTGCTTAACTTAGCATTTGGA
8   D17   AX00002965   TCTGGCGAAGAAATTCCATTTGAAAGATTAGAAGCAATGCCGACTGCTACAACA
8   D19   AX00002966   CTGGTAAACGTCTCGTTACAGGTGAAAGCATGTTTATGACTGTATTCACAAATAC
8   D21   AX00002967   GGTTATGAGACGAGTACTGTAAATACACTTAGACTTTGGAATGCGGAACCAGTT
8   D23   AX00002968   GTATATACGATTCATAACTTGCAGTTCCAAGGTGTATTTCCTCCTGAAGTGATGT
8   F01   AX00002969   TTACCTCCTTATGCGGAGTCTTCAGGTGTGAAGTGGTACACAGGTACGGCAAGT
8   F03   AX00002970   CATAGCATTGTATAAGCGCTCTAAACCACTTTGGCAGCTTGATCATTCGCGTGA
8   F05   AX00002971   CTACTTAGATGTAGATCCACGTAACGTTCATGCTTACATCGTTGGTGAACACGG
8   F07   AX00002972   AAAGCAGCTTATAACTTACCACATACCGATCATATGAATATGGATCCCCTTCGAC
8   F09   AX00002973   TTGGAACGCCGTATATTCTTTCGCACGTATATCAAGACGAACTAGATGATCATGT
8   F11   AX00002974   GACTTCTCTATTAACGTTATTTCCAAATCAGGTACAACGACAGAGCCTGCACTAG
8   F13   AX00002975   TAATCGGGTTCTTCCAGTTTGACTTAGTAGCAGCCATTTTCGGTGGACAAAACTC
8   F15   AX00002976   TGAGTTTATCGTTAAAAGCGGCGAAAAGAAAACAAGGACGGATTCTTATACCGA
8   F17   AX00002977   AATTAATGCTCAAAATTCACCAATATTCCATGATGTGTGCACCGACGATGTCTCA
8   F19   AX00002978   GGTGAAAGAACATACAGGTTTAACGGCAATGATCGATGTGAAAGTTACACCAAA
8   F21   AX00002979   AGACAATCCGCTCTTATCATTACAAAACGTTGTGACTTTACCACACATCGGATCT
8   F23   AX00002980   AACGCCCTACTTTTGTGCTCGTTCACGGCTTTTTATCTTCCTCATTCAGTTACCG
8   H01   AX00002981   GCGAGCGATGTTGTGAACGTCGCAAGTGTGTTTGATGATCCGAAATACATCGCA
8   H03   AX00002982   TCAAGCCTTTACATCCATCCAATATAGACAAGGCTTCCACGGATTAAATATATTC
8   H05   AX00002983   TTTTAATCCAGATGATAAAAAGCATGGACTACTTAATCCGAAGGGTGCAGAAAAC
8   H07   AX00002984   GTACCATTTTTCCACGAAAGACGTGCTTTAGCTTTCCGTGAACAGACGAACATTC
8   H09   AX00002985   CGTATGGAAAAGTAGGGACGGGTAAGCATCATTGTGCGCTAGATGATGCGATG
8   H11   AX00002986   TCGTTGATTTACACAACGCCTTTACGAAACATATTGAATGGGGGACGATTACACT
8   H13   AX00002987   CATCTACGCTATCTTAGACAGATATGGAACGAACTCTATATTATTTACGATTATTC
8   H15   AX00002988   TGGATCGCATCAGATAACATATGGTTACAACGCGCCGCTATTTTATTCCAGCTG
8   H17   AX00002989   ACCACCTTTGCTCAGCCTATATTTGAATTACTATCAATATACAGGCGGAGCACAC
8   H19   AX00002990   GGAGTAGCAGGTGCACCAATCTTCGCTAACTTCAAAGCTGGATTTGGAGCACTT
8   H21   AX00002991   AAATTCAACGTGTATTCGCTTACGATTTCGAAGGAAAGCGCTACGACGTAGGTG
8   H23   AX00002992   GTTCGTCATTTACATACAGTGAGTGGAATCGTTCTTACGGCAAGCCATAATCCG
8   J01   AX00002993   CATATGTTAGCAAATGTACAAACACTGGCAGCTACATACTATATTCAAGCGTATT
8   J03   AX00002994   CCGATTTTTGATCGTGATAAAGAGCGCGTGAGAAACAGTAAGTTTGCTGATTTA
8   J05   AX00002995   TTACATATTCAGGTGTTAAGGCGAAAAGGGATTTATATTCCACAATCGCAGCGG
8   J07   AX00002996   ATTGTCGCTCATGTGAAGGGGATCATTGGTGTTCGATCGGGCGTAATTCACAAT
8   J09   AX00002997   AGTAAACAACAACAGCTATCACTACCAAGCGACTTGGTTACATGAGAGCGCAGC
8   J11   AX00002998   TATCATCGATGTTGATGACGTAATCGTAAACTACGGCTTCGTTTCTTCCCTTGGC
8   J13   AX00002999   TCCTGAAACTATGACAACTTTAATAATACCTGCCGCTACGTATGCGGTATTTACA
8   J15   AX00003000   TCTTAGTGTTCCAAGGCTTATTTTTATGATTATCGGCGGCGCTGTAGCTGATAAA
8   J17   AX00003001   AGCTTGATGAGACGTATTGTCGTCACGATATACCGAAGCCTTTTATATACGCACT
8   J19   AX00003002   TGAAAGAACGTAGTCCCTCTTGTGGTAGTTCTACCATTTACACGGGAGAATTTAA
8   J21   AX00003003   TAGTTGGCTGTGATTTAAATCGTATGGGTAAAGATGAGTACTACGTTCAAATTAC
8   J23   AX00003004   AGATGCTGAAGATGGAGAGAAGTACGTGCGCCTTGCTGTACACGGCGGCGGAT
8   L01   AX00003005   TGCGCATGTTTAATAATGATGGATCAGAAGGAAAGAGCTGTGGTAACGGTCTAC
8   L03   AX00003006   TTTAGATGTAATGGAGTATGGTTGTTTAGGCTATTGTGGTATTTGTTTTGAAGGA
8   L05   AX00003007   CATTAGTTGCGGGTACTATTTCAGAAACGCATATTCGTATACCGTTCCCTGAACA
8   L07   AX00003008   CGTAGTCATGCTTGGGCAAACACCACCTATTTTTGATGGAACCATTAAAGACAAT
8   L09   AX00003009   AACAAATCGCGCTCGCAACATTCCGTATGACGATTCAGCTCGTACTCGTTGCCT
8   L11   AX00003010   GGAACTTCTTCAGTTGTGAAGATCGGTACGAAAGTAAAGAGTATCCGTCTAGTT
8   L13   AX00003011   ATCCAGCGCAAAGGAATACGTGGAATTGGGTAGCCTTTTTCTTCCCAACTTTTTG
8   L15   AX00003012   ATGGGAAATGCCTGAGAATCTCGTACTCTTATCTGGGGACGGACATACATGGAT
8   L17   AX00003013   CATGAAACTATCGACATTCCTAATTACCTTTCTACTATTTTCGACTGGTTTCAAAC
8   L19   AX00003014   AGATAGTCAAGGCGGAAGCGGGACAATTACGTTTCATCCGAATTACACGATTGT
8   L21   AX00003015   TACGTGTATTGTGCAGATGGTAAAGCGAATGTAGGTCATTGGGATATTAATGCG
8   L23   AX00003016   CGGCGATTGGTCGTAAATATGAAGGACAAGAAAATAAATTTAATTTCGAGTATAT
8   N01   AX00003017   TATCGTAAAATTACGCCTTATGGGTGCATGCGGAAGCTGCCCAAGTTCTACAAT
8   N03   AX00003018   TACCGACATGGAATGCGAGCTACCAATTTTTATTTAAAGAAATCCAGCAAGAATT
8   N05   AX00003019   ATGATACGCCGCAACTAACTGATGCAGCAACAATTTGCCAAGAACGATTCACAC
8   N07   AX00003020   GTGAGCCGTTACAAGATATCGTAAAACGTGATGAAGGCTTATACGGAATTGATG
8   N09   AX00003021   TACACAGCAGGCGGTATGTTTGACGCAATGAAGAAAACCGCGGATGTTGGTATT
8   N11   AX00003022   AATGAAGCCTTAATAGTTGGGGATAACTACGATACAGACATTTTAGCAGGAATAA
8   N13   AX00003023   TGGCGATTCGAAGACATTTAAGTAATCTTGAGAAAGATGGTTTCATCTATTCTAA
8   N15   AX00003024   ATTGATTCTGTATTAGATGTAGGGAATGCGATGATTGATGGATTTATTATGCGCG
8   N17   AX00003025   CAATCTTCTCAGCAACTGGTGTATCTGCTGGTGAGTTATTAGACGGCGTAAAAT
8   N19   AX00003026   AAAATGAGCGTCATGATTTAGCGCTATTATACTCCGATCGTCATTACGGTAAAAC
8   N21   AX00003027   TTACTGATCACGTTGAAACAGTCGATATGACGCAACAGGATCAAACGGAAACAA
8   N23   AX00003028   CTGGGGATATGAGCAACTTAGATTGCGCGGTTTCTTTGATGATAGTAACCAACG
8   P01   AX00003029   AATGATTACAAGCATGACAGTCAAACTTCCTGACGTTACAAACGCTGCTACGCTC
8   P03   AX00003030   AACTTCAGTCACTATTCATTAGATGCTTTTAAGGGGCTCGGTCAAATGTACGTCG
8   P05   AX00003031   GAGCTAAGCCGTCTACAGGACATGTTAATTCAGCAACCTGCCTACTTATACTTCC
8   P07   AX00003032   TAGAATCTACTTTTACAAATATAGATATTGCCTTTTCAGGCGGGGAGTCAACGAA
8   P09   AX00003033   TGCGAGACAAAACTGGTTGCACGCCGGGATGTGTCGCTCCTTTCGGGTATTCA
8   P11   AX00003034   CAGTATGTACACGTGCTTGTCGTTTCTGTGCGGTTAAAACAGGCTTACCAACAG
8   P13   AX00003035   ATTATTACGCTCACTTAGGCGGGTTCTCAAAAGAAATACAGCTTGGACAAATTGT
8   P15   AX00003036   TAGGTCTTTTAAATGAGAAGTTAGGAGATCGTGGTATTATTGCTGGCCGCGCGG
8   P17   AX00003037   TAACTCTGAAAATATGGGACAATTCGAGCGTACGCTTATCATCGTAGACGAAGG
8   P19   AX00003038   GAAGTTTGAAGGAGAAGGATGTTCTATCTCAATGTCTTCAGCTTCAATGATGACA
8   P21   AX00003039   TTAGCGCAATACGCTTTAGAAAGACTATCAGAAGTAGATGGCGTTACAATTTATG
8   P23   AX00003040   AAGTACTTAATGAAAGACGGCGTGAAGGTAGACGAGCATCGTCTAACTGCACTT
9   A01   EMPTY        -
9   A03   AX00003041   AACGAAATGCGTGGCGAAGAATTCGGTTGCCTAATGATTACGCATTACCAACGT
9   A05   AX00003042   CAAAGGATGCAATTGCGATTGAAGGATCAGACTCTCCATACGCAAATATTATTGC
9   A07   AX00003043   TATTGAGCCTGGTTTATTACCACAAGTGTATAACAATAAAGAAGGCGACGCTGTT
9   A09   AX00003044   GTTGGTGCTGGTGGTCTTGGAACACTTGCTTATTTAGAAGGATTCCAACGAGGA
9   A11   AX00003045   AAAAGTAATTCGCTTGCAGTTTATCGGTGAGGCTGTAGAAAGACCAGTGCTTCA
9   A13   AX00003046   TTGGGATGTTAGATTTAAATTATGCCCCGCATTTCGCGAAAGAGTATGGGATTG
9   A15   AX00003047   ACAATTGGTTTGTCGACAATGGATGAGCTCGTTGATCAGTTTTTTGATAAGGAAG
9   A17   AX00003048   GACCAACCAGAACTTGTTAACGAATCTCCATACGAGGGTGCATGGATGGTTAAA
9   A19   AX00003049   GTTACCGTGAACTTGGTCTGAAAGATAAGTTAAAAGATGCAAGTGAAGACGAAA
9   A21   AX00003050   ATGCCATGTATACGCAAGGGTTTGCAAATATCGGAAGTGGTGAAGGACAACAAT
9   A23   AX00003051   CCCTAGCATTCATGTTCTTACTACATTTGTCATTATGCTAGCTGCCTTTAAACGT
9   C01   AX00003052   TCAAGCTCTTTGTACTCCGAAAGTACAGCTGCCAAATATCACTAAAAATCCAATG
9   C03   AX00003053   TAGATACTTTAGGAGCGAGCGCGAAGATTATGGAAAGTGTTGTTGGCGGCGTAA
9   C05   AX00003054   TTAACAAGTTATGCAAATTATATTGCTCAGTCTGATAATGAACAGTTACACCAAAC
9   C07   AX00003055   ACACGCAACAATTATTAACAAGTTGGAGCAGTATGCACAAACGTGTACAGATCC
9   C09   AX00003056   TAACGTTAGCTTCATTAGCGCAAAGGTTAGGGATACGTTCTCCCTCACTATATAA
9   C11   AX00003057   GCGCATGATGATCACATCGGTGCATTAGACGCATTAAAGGAAGTACTTCCTCAT
9   C13   AX00003058   GAAAACGGCGACATGTTACGCATGATGTTATCATCATTACGTAAATTAACTCGCC
9   C15   AX00003059   GAGCAGAGACGACGCTAGATATTTTAGGTAAATTACGTCCAGCATTTAACGTTC
9   C17   AX00003060   GCATTTATCTGGTTACATTTCAGAGTACGACCTTCACATTGCGAAGAAACTTGCA
9   C19   AX00003061   GAATATATGAATTCAACGCGTACAACTCTACATACTTCAGAACGCTCTCCAAACA
9   C21   AX00003062   GAAGCAATCCGTGCAATTGGAAGAGAAGGTCTTGATTCGCAACTTTCTTTAAAG
9   C23   AX00003063   AACTATTACTTGGAGAGAGCAATGAAGAGAGAAAAGAACAGGTACAGAAGTGGG
9   E01   AX00003064   GAGAAAAATGCAGATCGCGTGAAGTATCAATTAACACCAATGAATACAGTTATTG
9   E03   AX00003065   AGGTACATAACATCGGTCACGAGCAAGGAGAAATTACAGCGGTAATGCATACAA
9   E05   AX00003066   TCACAACCTTTCGTGAAGTTCTTTACAGAATTCTTTTATCACGACGTTGCACTTG
9   E07   AX00003067   ATTTTCATGGGGATTAGTGGATCACTTGTACTTGGAGTACCGCTTGGCCTTGTA
9   E09   AX00003068   TAGTAGGAACGATTATTGGGTCTGGTGTGTTTATGAAACCAGGGAGCGTATTAG
9   E11   AX00003069   AAATGTTTGCGGGATTAGATGAACAGGCGAAAGAAAAAGCGAAGTCGATTTTAG
9   E13   AX00003070   ATCAGGCGGTTGGAATCCACTTGCTGGTTGCTGGCCACTATTAATACAAATGCC
9   E15   AX00003071   GTTTTCTTCCTTGCTAACGTTTCTCGCTTTGTGCGTCAGCAAGCATCGAGCGGT
9   E17   AX00003072   GCGGTGGATTCGCTGGCGTAGGGATGATTATCGGTTATTTAATGCACTACAATA
9   E19   AX00003073   ACCACTTCAATTAAGCTCAGCTTTCTTCCACGGTCTATGGACTTGGTTCATTGCA
9   E21   AX00003074   GGCGTTGCAACACTAGTACCACCTTCTATAGAGACACCGAATCTTTCGAAAAAA
9   E23   AX00003075   TGTATTTACGTATAGGTGATATAGTTACGCAGGCATGGTTTGTATATGCAGTTAT
9   G01   AX00003076   ACGATTAGTTTAATTGAGCGCGGGGATTATGCACCATCTATTGTATTGTCGTTAA
9   G03   AX00003077   ATTCTTCTTAATCGGTGGTTACTGGTTAGGTGGCAATTTACATGATATTTTTGGA
9   G05   AX00003078   ATCAAGAAAGCATGATTGGCAAAAGCTACATCATTCCAACGAAAGCTTTTCACTA
9   G07   AX00003079   TAAAAATCGTCCTTATTACACAGGCAAAATTAAAGGCGGCGATCCACGTAATCCA
9   G09   AX00003080   TATTAAGAAGGGCAGCAACGAAGGAAGCCGAGGCTGCAACTATACTACAATTCC
9   G11   AX00003081   CCAAATGGTTACGCACTAGAAGTTTTAAATACAGGTTCACAAATAGATGAAGATA
9   G13   AX00003082   CTTTTTAACAGACGGTGCTTTGCAAGCTGGCCTATGGAAATATGCTTTCTTCCTC
9   G15   AX00003083   TGAGCGATGTTTTCGTAACCTTGGTTTTACGTATGATTGCTATACACGTACAGAT
9   G17   AX00003084   TTCTTACAGAAGCGCAGAAAGAATCGTTACCGAAAACAACCATCCGTCGCTGGA
9   G19   AX00003085   CAACTGCTGAAGAAATGGCTGCAAGTGCTGAAGAAATGAACGCTTCACTGAATA
9   G21   AX00003086   GATGACTTCTATCGGCTGTCCAATGGCTGGGCAAATTGTATCAGACGTAAAAAA
9   G23   AX00003087   GGAACAGCTGATAATGGCGGCGTTCATATTAACAGTAGTATTAACAATAAAGCTG
9   I01   AX00003088   ACCAAACTATGGTGAGTTTAAATTTGATTGGAGTAAGCGTGAAAACGAATGGTTC
9   I03   AX00003089   GCTCAAGTTGGAGGGCATGATCGTTTAACGCAGCAAGAGCTTGGAAATAAGCTA
9   I05   AX00003090   AGCATAGTGACAGAATTGAACATCTCGTTGTTCCATTTAGAGACTTTTTCGGAGC
9   I07   AX00003091   AGTGGAGAAGGAAGCTCCAGCAATCGGAAAAACAATCGGCGATCTTGAAATAAG
9   I09   AX00003092   ATGGGTAGCTCTCCTAACGCAGCAGCAACCTCAGATGTATCTCACCCTGTAAAA
9   I11   AX00003093   TCACAAAACTACACAACTTCCATTGGTACGTAAAAGGACCTCAATTCTTCACATT
9   I13   AX00003094   GCTAATATTTTCAATATACGTATCGAGGTTAAAGACTATGCTTTCCTCATTGTCTT
9   I15   AX00003095   TAATTGAAGTAGAAACGATGCATGAACGTAAAGCGAAAATGGCAGAGCTTGCGG
9   I17   AX00003096   AAGCTGGTCACAGTATAATGCCTTTATTCGGTTAAATTTCTTAACAGAGGAAGTC
9   I19   AX00003097   GGCGATGGCTGCTTACTGTACAGCCGAAAGCTACGATGGATTCGCTAACTTTTT
9   I21   AX00003098   CTTCTTGGATATGCAGAAGCTGGAATCGTTTTCGTATTTGGTGGCCTTGTTAATA
9   I23   AX00003099   GCTTTTGATGGGGCATTCAAAACAGATAGTAGATTAGTAGGTCTTGTAATGGCT
9   K01   AX00003100   ACGTATTCGCTCTTACATCTAATGACTTACAAGCATTCGATGTAGTTGTAAATGC
9   K03   AX00003101   GGAGAAAAGTTCCGCATTTTAGTTCCGAAACAAACACCAGCTGGTGGATTTAGC
9   K05   AX00003102   GTGCTGACGAAAGCAACGAAGTTATCGGCCTATTCGGTCTGTTAAAATTACTAA
9   K07   AX00003103   AAGCACAAGTTACAGTGATTAACCAATACCCAACACACCAAATCATCACTGAACT
9   K09   AX00003104   GATTTCGCTATACTGCGGAGTTGATCCGACTGGTGATAGTATGCATATCGGACA
9   K11   AX00003105   GTCAAAACAACCTCTAGAATATCCTTCATGTGGTAGCGTATTTAAACGCCCACCA
9   K13   AX00003106   TAATCATACGGCAATCCTTTTAGGATACGGCATGTTATTCAATCATTCATATACA
9   K15   AX00003107   GAGGAATCGAATCGTTCTGCGGGAAGAATTCAAGGGATTTTGAAGGAGTTTAGT
9   K17   AX00003108   GTGAAGAAATATGTAGAAGGTGAAAACTTCGTCACGATTATTGATGGCTTTATCG
9   K19   AX00003109   ATCATTCTGAGTGGGGCATAGCCTTCTTATATGTATCATGCAGCATACTTGGTGG
9   K21   AX00003110   TAACGATACATGCTTCAAACAGTAAAGTAGGAGCGAATGGATTTCTTGAAGAACC
9   K23   AX00003111   AGTTAGTGGAAATCGATTATATTCACCGTAGAACGGAATTCCAAATTATTATTGA
9   M01   AX00003112   AATAAATACGAGTTTTTCAATAGCGAAACAGGTCAAAGCCGCGGTGACTATGGT
9   M03   AX00003113   CAAATGATGGAGCACTTGAGACGTGCGGCTAATGAATTTGGAAGAACAATTTTG
9   M05   AX00003114   GCCATAGCTTGTCGACAGTTGCTTTCCAATCCATTACGAATAATAAGATTATTAC
9   M07   AX00003115   TTAATGCTGACTGGAGCTGCAATGGCGATGGCAGGGCTCGTCATGCAACTCAT
9   M09   AX00003116   TGGTTTTGCTGCGCCGCACTCTGGTCGTGTTTGGGGACCAATGTATGAAATTTT
9   M11   AX00003117   TGCAGACAAATACGACTTGTTAAAATGACACCGATCATTATTGTGACCGACAATA
9   M13   AX00003118   CCTTCAAGGAACGGAAATTAAGTCGATTCGCGCTGGACGCGTGAACTTGAAAGA
9   M15   AX00003119   GTATTAGCACGCCTTAGTTCCCAATCGAGTGGTTCGCGTCAAGAAGGTTCTATT
9   M17   AX00003120   CTCAGCTGATGTACGTATGTTAGGGCGTTTCTTAGAAAAGAAAGGCTACACTTG
9   M19   AX00003121   TTTCAGGCGGTGCAGAGCAATTATTTGGTAAGCAAAAAGCACGTGGAATTGAAG
9   M21   AX00003122   CCTTCCATGACACAATGCCAATACTCGCTTTACTTGATAACTCTATGTTTACGTA
9   M23   AX00003123   AAATATGACCTTGCAGGTGAAGGCCGTACTGGCTTAACTTCTGCAGAAATGGTT
9   O01   AX00003124   ACTTTAGTGAAACAGTGGATGGTTACGTGGCATTCAAGCCAATGAACCTTGATA
9   O03   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
9   O05   AX00003126   CTTCAATACATTAGGCTCATGCAGCCGATTGGAAGAAGAAACTTATCAGCAAGT
9   O07   AX00003127   GAGCTAAGTGTGCATGAATCTACAATTAGTCGTGCAACGCGAAATAAATATGTG
9   O09   AX00003128   TGATACGGATAACCAACAAGCGAAGCAACTTTTCCAAACAGCTGCGCAGCAAAC
9   O11   AX00003129   AAAACCTCTTCGTAAGAAGCTTCAAAAACAGCTAAGTGATGAGCATCCTACTTTC
9   O13   AX00003130   GGATTTGGTATATACGATCGGTTTGGTCAGTTTGCCGGAGCAGGAACAGCTGTA
9   O15   AX00003131   CTCCTTATCTCGGACTATTCGGCGCTTGTTCTACTTCTATGGAAGGTTTAGCACT
9   O17   AX00003132   CAACTTATGTTTGATGTTGGAAAGCTAACACCAGCTCATACAATGGCAACACTCG
9   O19   AX00003133   CTTTCTCGGTCAAGTGGATTCATATGGACAACTTACTATCGACATTTATAATGAC
9   O21   AX00003134   CAGGTATGGCAATTTACGATACAATGCAGTTTATTAAACCGCAAGTATCAACAAT
9   O23   AX00003135   CCGGCTGCGTTGTTTGTACAAGAGGCCAATCGCTTTCATGCAGATATCTTCATC
9   A02   EMPTY        -
9   A04   AX00003136   ACTTTTGAGATTTGAAGACATTCGAATCGTACGTGATATGCGTAATTCTGTAAAT
9   A06   AX00003137   CAGGTGACATTCGTAACGTACTTGTTGCGTTATCAGATGTAGAGCCACTGGTGG
9   A08   AX00003138   GATTTAGGATATTTCTGTGTAGATAATTTGCCACCGATGTTATTGCCGAAGTTTA
9   A10   AX00003139   AAAGGGGGTCTTCACCTTTGTTATCCAAGAAGGTGATAAAGTTGTTTCTGAATGG
9   A12   AX00003140   TCTTTAGTCGTGAATGGAAAAAACATTTAGGATTTTTAATTCCACTTGCAGCTGG
9   A14   AX00003141   AGAAAGAAGTCAAAACTGACGGCGTATTCGTATACATCGGTATGTTACCACTATC
9   A16   AX00003142   AAACGTCAAGGATACGAAGGAGACGTTAGTTTTTATTATTGGTTTGCATATTCCG
9   A18   AX00003143   TTGTACCGCACATTTTTGCGGATGAAAGTAGGAAAGAAAACATCGTTTGCGCTT
9   A20   AX00003144   TCAAAGCTTGATGAGTTTTTTGATGTTGTCGTGACAATTGATGATGTAGAGCATG
9   A22   AX00003145   TTTTCGTAGAAGGGTTACGTACAGATAGTTTAATGCTAGGACCGCTTCGTATTGC
9   A24   AX00003146   CTATCAAGTCGTTTAACAAATTATTTAGAAGGTAAGTTAGCGCCAACAACTGCCG
9   C02   AX00003147   TAAAAGGGATTGCACCTGACGCGTTTTACGTAGCAAATATACAAACTGCAATTAT
9   C04   AX00003148   GAAGCGGAGAACGCGTTTCATAATGAAGTGAAAAAGGATTGCTACATCTTCTAT
9   C06   AX00003149   GTTTTTCAATTGGAGAATTAGAGCCGCGTATGTTCTCATTCAATAGTCCGTTCGG
9   C08   AX00003150   CGTCACTCAGCAACGTCCGCATTATTTGAACGGGATGATGTAATTATTGTTGCG
9   C10   AX00003151   CTATCGGTTTCTTTTTACTCCGTTACGGATTTCGTTTGAAAAAGGCGAGTTTTAT
9   C12   AX00003152   TTTATTCGGTAGATGTGGAAGGAGAACTCGATTGGAAAGTTATGTTTGAACTGA
9   C14   AX00003153   ACATGCTTATCGCAATGGCGATGGCGGGACTTGGTTTAAATGTAGAGTTTAAAA
9   C16   AX00003154   GGACACTCCAAGATCAAGTATGGGTATTAAGAGAAAGTGGTTCTGGTACACGCG
9   C18   AX00003155   AGAAAAGGGATTACTCCCTTCTAAGCGCCTCGCAAACGGCTACCGTGATTTTGA
9   C20   AX00003156   AAAAATGTATGTTGTCATCGTTGGCGGAGATAACCCAAAGCTAAAAGCATTACCG
9   C22   AX00003157   TTTCATTAGCCATGACCGTGCCTTCATTCGTTCTGTTGCAGACCATATTCTACAA
9   C24   AX00003158   TAGTTATATGCTTATGCGTCTCGTAACGCTCTTTGTCTTAATATGCGGTACATGG
9   E02   AX00003159   TAACGCAGTTTATTTCATGGTGGCCTGTCGTTTCAATCGGTTCTGATACATATTC
9   E04   AX00003160   ACAAGGCATGTTGTCTACGCTGAAGGACCCTTATTCCACGTATATGGATAAAGA
9   E06   AX00003161   GCGGAACAATTTTCGAACTTCTACCATATAGTCCGTTCGTATTCCAATTAGCTGG
9   E08   AX00003162   AAGAAGAGCCTGATGCAATTCGTGAGCGTGTAACAGAAGTTTTAGGTCTTGTAG
9   E10   AX00003163   TAAAGGCGTACGTCATAACATCTTAAATGCGAAAAACCATGCGCGTGAAGCGGA
9   E12   AX00003164   ACATTCCCAGAGATTAAAGTTAATTTAAAAGTATACTCTGACAAGCAACGTGTCG
9   E14   AX00003165   CAGCTTGTTTGCCTGTCGAAATTTCTTATCTATCATTAAGAAGAAGGGAAACAGA
9   E16   AX00003166   ACAACAATACTTAGGTTTACCATATGTTTGGGGAAGTGCATCTCCATCAAACGGT
9   E18   AX00003167   CGATCGTATGTTATCAGAGCGTTTAAAGGAATTGGAAAGCGAAGGCATTGTAGT
9   E20   AX00003168   AGCGCGCAAGCTTTCATCGGTAGTCTGTTACAAGTAAAGCCGGTTTTATATTTTA
9   E22   AX00003169   CGTGCATATGGAAAATGTACAAGCGAAGGCATTAATCATGTCGGTGTTGTCGAG
9   E24   AX00003170   TTCCTATTTCAGATGGCCTTGCTCTTTACAATAAACTCTCTGGATTTGATCCTTC
9   G02   AX00003171   AAAAACCTATTTCAGCACCAGATAAATCGCATTTACATCACCGTTTACTTGCAAT
9   G04   AX00003172   ACTGGAAAAGCTATGACAATCCTTCTGCCATACTAGAAAGAGTACGTAATCAGAG
9   G06   AX00003173   CAGCTACTACTCGGGCAGTTATTTGGGATTAAAAAAGGAGCTTATACAGGGGCA
9   G08   AX00003174   AAAAAGAAAATGGATGGATGAACGGAGCTATGGAGATTTAGTAGCACTAAGTCA
9   G10   AX00003175   ATTATGGTTCATCCAGCTTATATTGATCCAGAGCTTGTGAAGCGTTCTTCTTACG
9   G12   AX00003176   AGACTTTATTCGTGGCCTTCGTGCAATTCCATGTCCATATCACCGTTACTACTAC
9   G14   AX00003177   GCGATGGAGGCACTTCAATTTGCCAAACAGGGGAAAATGGCAGAGGCTGATGA
9   G16   AX00003178   ATTACTTGTAGCAAAAAGTGCACAATTACGCGGTGTATCTCGCTTATCAATTGGT
9   G18   AX00003179   GATTAACTGTGAAAAGTTATCATACAATCGTTCCTTCTTTCGGAACTGACTGGGG
9   G20   AX00003180   GTTGTTCAATGGAAGCAATTGATTGCGCGAAGCGTGGGGAGTTTACAGAAGCAG
9   G22   AX00003181   ACCACTTAGTGTACTTGGTGCTAGTCTTTGGGGCGCAATAATAGCAGTTATTCTC
9   G24   AX00003182   ATCTTTCATTATGTACTACGCTCCAATTGGACTTGCTGCTTACTTCGCAGCATTA
9   I02   AX00003183   ATGGTGCTTATTTAGCTCACTTTTTCTTCTTGCAACTATGTACAAAGTTTCTTTCT
9   I04   AX00003184   AAGAAGCAGGAACAAGCATCGTCCTTCACGATAAAGCGTTAATTGCAAAGATGC
9   I06   AX00003185   TTTACAATCAGGGGTTAGTGAATTAAGTGCTGGTACAAATGAATGGGTGAACGG
9   I08   AX00003186   TTTGGGAGCCACTTATTACAGAAGAAATTTTCTTAGTCGTCCCTTCAGGCCATCG
9   I10   AX00003187   AATTGTATGACCATATGTCCACATTCCGAAATGACAACGTATTTAGTAGATATTA
9   I12   AX00003188   GGAACAATTGTCGGTGTGCAAATCTCACTTCTTTGGCCTGGTTTTGCCAAAATTG
9   I14   AX00003189   GGAGGTAACAAATACGTTTCTCGTCTTTGTCGTTGTCGCATTTCTTGGCTTCTTT
9   I16   AX00003190   TCGTTCTTCTCATCTGGAGATGGTACTACTTACGAACAAATCCTGTCGACATTTT
9   I18   AX00003191   ATTCCGTTGGCGCGATCAATTTAATTTATCTTTAGATCCTGAACGCGCGATGGAG
9   I20   AX00003192   ATGGCAGCGACCGGATATGGTTTCTTATACGGATTATGGCCAATTGCTTGGATT
9   I22   AX00003193   TCGGTCATTTATGCAAGTTTATTATTGTTTTACGTTTTGCAGAAACCGGATGTTC
9   I24   AX00003194   ATTAATCGATGAATACAATTCTGGTGATGGCGTATTTGACCGTTACATGGTAACT
9   K02   AX00003195   TTAATTTTTCTTACGAGGGAATTAAGTTCGTTGCTGGGGATTTAGTCAACGCAAA
9   K04   AX00003196   AATGAAGCCGGTGCTGACATTGTAATGAACCGCCTAAAGCCAAAAATGGAGCAA
9   K06   AX00003197   CTATGTTATTTAGTGCTGGTATGGGTATCGGCTTAGTCTTCTGGGGCGTTGCGG
9   K08   AX00003198   AAAAATCACTTTAGATGGTAAAGACGCATTCGTAAGTGCAGAGTTCACAAAAAGC
9   K10   AX00003199   GAAAGTATTAAAATTGGAGACCAAAGCACGTATTACTTAAAATTCCCGAAAGAAA
9   K12   AX00003200   CCTGTTAACGTCGTTCGTATCTTTGTAGATAAAGTGGAATCCATCGTTCGGGAC
9   K14   AX00003201   TGGCACCGACATCTGTTCTTGGAAATTGGCAAAAAGAATTTGAACGGTTCGCAC
9   K16   AX00003202   AGGCGGATTTATTGAGTTTTTCCTTCGTAAAGGTGCTCATTTTATGGTATTCTTT
9   K18   AX00003203   TGCACAAGTCGTAAATCAAGTAATGGATACGATCCTTGCCTCATCTGTATTTTCA
9   K20   AX00003204   GTATTAGATGAGAAGGAGAAGTATATTATTTTTGAACGTTTTTTTGTAGGAAAGA
9   K22   AX00003205   ATCGTTTCCACATTCGCAAAATGGCCACCACTCGTTTCATGGGAAGTTGTCGTT
9   K24   AX00003206   CGTCCAACAGAAGGCGAATATATGCTGAATGATGTGAATATCTTAACAGCAGAC
9   M02   AX00003207   AATATACATATAAAGCAAGCCTTGATAGTCAAGATGGTTTATCTCCAGGTTATCA
9   M04   AX00003208   TCTTTCCCTATGTAGGTTCAGAAGAAATCTCTATTTCTTTATTTGATGTTGTGCTT
9   M06   AX00003209   CCACCTTGTAGTATTGTTATGACGAAATGGTTCTCGAAGAAAGAGCGCGGTACG
9   M08   AX00003210   GAGCAAACAGGGTTATCTGTTAATGCGATTTCGAAACTAAAACGTGCACCGAAT
9   M10   AX00003211   GAGCGTGAAGACATTCTTACTATTTCTGTGTATCCATCGTATTTTGTTGTGCAAT
9   M12   AX00003212   GTTACGGTTTGTATATTTGTCAGGAGATTATGGATAAGCAGGGCGGAAGTATGC
9   M14   AX00003213   TTTATGTCAGTTGTTTGTTTCTAATCCGCAGCGTGTATTTATGAGAGATGAGTTA
9   M16   AX00003214   CGATGACAAATCCAACGAATACGTATGGAGAAACGAAGTTAGCAATCGAGAAGA
9   M18   AX00003215   GCGTGGTTTAGAAGGTTTGGATAAAGTAATGAAAGAAGCAAAGCCGGATATCGT
9   M20   AX00003216   GGAGGTACAACGGATATCGCTGTACTATCTATGGGTGATATTGTTACCTCTTCC
9   M22   AX00003217   GGTAAGTATATCGTGGAGACAAGAAAGACAGTGCGTGTCATTGCAAAGGAATTT
9   M24   AX00003218   TTGCTTGTGCAGCGGTAATCTTAATGGTTGCGCTATGGTTCCAAGGAGCTAATC
9   O02   AX00003219   AACGACGATTTTCTTAACGACGCACAACATGGACGAAGCAGAAACGCTTTGTAA
9   O04   AX00003220   AATCATTACCTATGGAGGAGTATGTGACCGGTGTAGTAGCTTCTGAGATGAATG
9   O06   AX00003221   AATTGGTTCACGTCCAATTGACCAACATTTAAAAGGCTTCGAAGCAATGGGAGC
9   O08   AX00003222   AAGAGCATTTGTGTCAGTCTCCGCATACAATAAAAAGTGGGATGACGCTCTTTC
9   O10   AX00003223   CTCGGGGCTGCCATCCTTCTTTCCATATGTGATTTGTTTTTTAAGCTGAACCATA
9   O12   AX00003224   GGGAAGTGGGGGAAATTGTCGAGTGAAAAGGCTGCTTATAGTTATTTAATATAT
9   O14   AX00003225   GGAAGTGTCATTCATGCCGTGCATACGCAAAACATTAATAAAATGGGCGGCTTA
9   O16   AX00003226   ATGTTAACGAAACATAACGCGGAAAATGAATCACGTCTTACTCTTCGAAAATGGA
9   O18   AX00003227   TTTGTGATTTATGTACAGAAGTTTGTCCGACAGAGGCAATCGTTATGACAAATAA
9   O20   AX00003228   AGCAGAATCGGAACTTGTTTCTGGATATCATACGGAATACTCAGGGTTTCGCTG
9   O22   AX00003229   GGATGGACTATTTATCGGCTATGACGAATAATTACGTCATTTGCCATGCTGTAGA
9   O24   AX00003230   ATGAAGTAATGGAGTTACTGCGATTCCATGAGGGACTTGCATTTGATTATATGTC
9   B02   EMPTY        -
9   B04   AX00003231   TACATTGGAACAGTTGAAAGGATGGGCGCGAAGTAATTCTTTATGGCCGATGAC
9   B06   AX00003232   GATGCTGCGCCCAAATAAACCAAGTGCAGCGAAAGCGACGACGTATGAGAGCG
9   B08   AX00003233   GAAATTGAAAATCAACATTTACAAATCTCACCGAGCATCGGGATTGCCATATATC
9   B10   AX00003234   AGTCGTCGTATGATGGATGGGCATAAGATGGAGTATTTCATTTTATGTTTAAGCT
9   B12   AX00003235   AGAGAGTGGGGAAATGGGGATTTTACCAGGTCACATTCCAACTGTTGCACCATT
9   B14   AX00003236   CTTACATTAAGGGTGGTAAGATCGGTCTATTCGGTGGTGCCGGTGTAGGTAAAA
9   B16   AX00003237   AATTAATCATCCAATGCTAAATGCGCGCCCTGTAAAGCGTACAGGATACATCGT
9   B18   AX00003238   CACTTCGTCTTGACCTTGCATCTTACCGTGAGTTAGAAGCGTTCGCTCAGTTCG
9   B20   AX00003239   GAACATTTCAAAAGAGCAGAAGAAGACGTTTCTTGCAAACGTATTCGGATCTGT
9   B22   AX00003240   TCTTACTTCTATTAGTAATGCTACGCAAATTTGCGTGGGGTCCTTTAATGGGAAT
9   B24   AX00003241   TACAATCGAAGGTGTTGCTCGTCAACCAGAATTAAAAGGCGCACTTCAAACAAT
9   D02   AX00003242   GAACTCGCAGCTTAGCTCTTCGCCCAACAGGAATGCAAAACTTCATGGAATGGG
9   D04   AX00003243   TGCTAGGATGGGGATTCACCTCTTACAAGGATGTATTTCTTGGACTGATTATCG
9   D06   AX00003244   AGCTTATGCTTTAATGTCAGGTATTCTTGCTCAGTTAGTCGGTTCTATTCTTGTT
9   D08   AX00003245   AACTTCCAACGGATGTAGAAGAGCGTGACTTTATCGTACTAGATCCGATGCTAG
9   D10   AX00003246   TCTCATGGTGGTCACTTAACACACGGAAGCCCTGTTAACTTCAGTGGAGTACAA
9   D12   AX00003247   ACAGTTACGCCTGTTAGATCAGCAGGTGGTGCATTAGCAACATATGCTTATCAC
9   D14   AX00003248   TAGCAATGGGCGAGCGTGTAATTGGTGCTGGTCTAGCACGTGACATCGCAAAA
9   D16   AX00003249   ACCAGATCCAGTATTCGCTGGTCGTATGATGGGTGACGGTGTTGCAATCGATCC
9   D18   AX00003250   GGTGCTCAAAAATTATTTGGTTGGTTCGGCGGTTATGGTTTAAAAGGAACAGGC
9   D20   AX00003251   ATGGAGCACCATATAGTTATTTCAATATTGTCGCTGCTAATCCGCCACTTATCTC
9   D22   AX00003252   TGCTCGGTGTACAAATGTTTGCTGAGTTTTTAGATATTGAGTCATTGAAGTTTGT
9   D24   AX00003253   TTTCAGTAGGGCTTAGTCTTGGTATTTACGGGGCACAGACAATTATTACGATATT
9   F02   AX00003254   TTGTCCACATCGGGACAAAATCGCAGTTAGATGGGATTGTGAAGGAAATTCCAC
9   F04   AX00003255   AAAAAAGATGATAAAATAAATGAGTTGTACGCGCAATTTATGATTTTGGAAGAGG
9   F06   AX00003256   TACAATTGGGGAAGGAGAAGGGGCAAACTGGTGGTGTGTATTATTTCCACCGAT
9   F08   AX00003257   TGTTGGTGGTGAAGACGGATTAGATTTCTATCGCCGCTTTATGGAAGAATTGCC
9   F10   AX00003258   ACGGGTGATCGTTCAGAGCGTATTCGTACGTATAACTTCCCGCAAAACCGTGTT
9   F12   AX00003259   ACATGTAACAAAACTACAAGCTGTATGTTCTGCATGTGGATCTCCGGCAAGTCG
9   F14   AX00003260   AAACACAGGCTTCAAATTCTTAAGCGGATCTACTAAAGGATCTAACGAAACTGTT
9   F16   AX00003261   GGAAATATGGAACTTCACTTAGATCGTTCATTAGCTGAGCGTCGTATCTTCCCG
9   F18   AX00003262   TGAGGCAGACGGTGCAGCAACATCAGCTATGCGTGATGTATTTGATACAATTCC
9   F20   AX00003263   AAAAAAGCTGTTATTGGGCTTCCAGGTGGATGTCACTTAGGACCGAGGCCAATT
9   F22   AX00003264   AAGGCGTAATTTACGCTGACCCAGCTGAGTGTAAGCACCTTGTTGAAGCAACAG
9   F24   AX00003265   TAATGACTGCTTATGGTGAGCTTGATATGATCCAAGAAGCAAAAGATTTAGGTGC
9   H02   AX00003266   ATATACAGATGTACATATTGATACAAAGCTATTAAAAGGTCTTATTCCAGACGAT
9   H04   AX00003267   GCGCAGAAACTGACTTAGACCTTGGTCACTATGAGCGTTTCATCGACATTAACT
9   H06   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
9   H08   AX00003269   GGAAGAAGTATTAATCATGTATCAAGAGGTACGCTTTTTACCGAAAGAATCACTC
9   H10   AX00003270   TTGGTTTAACTGGTATTCCGTGGCCTGAAGAATACGGCGGAATTGGAAGCGATT
9   H12   AX00003271   TGTTCCTAGTATGGAACAAGGGGTGTTCCCAACAGAGATTTTGCAGAAGATGGG
9   H14   AX00003272   TCCAGAACACGCAATTTTAGCGACGAATACGTCATCCCTGCCAATTACAGAAATT
9   H16   AX00003273   TACAGCAATTGCAGTGGAGTCTAAAGATTTCCCGAGGACGCCAGGTTATGCAAT
9   H18   AX00003274   AATATGTGTCCGGCAACAGGAACAGGGAAAATGTTATCGCCGATGGATTTAATT
9   H20   AX00003275   TTTGCGAGGAACCGTTAGAAGAGTTGCTTCCTGCAATTTTTGAAACTTGGTCAC
9   H22   AX00003276   AGCGAATGAGCAAATTAAAGACTTAGTAAAACGTGAAGAACGGCAGCGGATTGC
9   H24   AX00003277   TCATGTGGAGTTAACGGTAGGGCAGTGGATTGGTGCTGGATTATGGTTATTGTT
9   J02   AX00003278   GCAGGAAATCCAGACTTGTTATTTTTAGATGAGCCGACAGTTGGAATGGATATT
9   J04   AX00003279   GCTTACATGAAGCACCAAACCATATTTTAAGTTACTTTGACCCAATGGATAATGC
9   J06   AX00003280   GAAACTACGGACAAACTTTCAATCCCCGCCTAACGAAAAAGCAATCTATCCCTG
9   J08   AX00003281   GTTTATGACTCAAATCATAATCTTATTGGACGTTATTCTGATGGTTACGGCCGCA
9   J10   AX00003282   CAAGGGGAGACAGGTTACGAGGCGAAATTCTCATCATGGGATATTGCCGGTAA
9   J12   AX00003283   TTTTCATCGCGGCACCAACTTTCTTACGTGGAGAATTATAAAAAGTGGATTACTA
9   J14   AX00003284   GACGGTTCTTACACATACTTAACGCCAGATATCGCATATCACCGTGATAAATTAG
9   J16   AX00003285   CTTATTATGCGTTCAGGTGCTGTTTCGATGCGTCAGACGCATGTGAAAGGTGAA
9   J18   AX00003286   ATGCTTAACTTCTAATAAGCCTATTGAAGTCCTGCCATCTGAAACATGGAGCGAT
9   J20   AX00003287   GAATGATGAACCGTGAATTGCATACGGGTGCTTTTATAAAAATTTATGCAAAAGG
9   J22   AX00003288   TTCCAGCTCGTTAATAACGCACCAGGAACAGCATCACCAATCCCAGGACTTCTT
9   J24   AX00003289   AATATGTATCAAAACTTTTAGATGCCGGTAAGTTTCCACTAGGTCTCGGCGGTG
9   L02   AX00003290   CAATTACTCGTTTATACACAGCGAACATTCCAACTTACCCAAGTGGTCTTTGGAC
9   L04   AX00003291   TAGGCGGGATATTAGGTGGACATTCTTGGCGGTATCCATTTTTCGCAACGAGTA
9   L06   AX00003292   TTAAAAGAAAGAATGGAACAGAGAAGAAATAGCGAGAATCCTCGTGATCGTGAA
9   L08   AX00003293   TCTTGCTCTCGGCACATCTCCTGTAAAACCAATTGAAATGGTTAACGCTTATAGC
9   L10   AX00003294   TATAAGTCACTTCCAGAGCACGTAAACAAAATGGATAAATCATTGAAGCGTCACA
9   L12   AX00003295   CCAACAAATATTCGTGCGAAAATGACACAGTATGAAAAATACGGGGCGATTGCG
9   L14   AX00003296   AAGCTCTTGCTGAGAAAGTAACAGCAGCAGTAAGCGAAACAACTGGTGCTCCTG
9   L16   AX00003297   ATTTCAACGCTTGCGCCGTATTAAGCAGCTTGGAACGACATTTTTTACATTTCAC
9   L18   AX00003298   AGACGTAAAACCAGTTGGTTCTGCTTGGGGCGATAAAATTAACATCGAAGCAGT
9   L20   AX00003299   TGTTATGGTTATCCATGACTTAAACCATGCTTCTCGTTTCTCAGATCATATGATTG
9   L22   AX00003300   CTTCGCGTTAGTTGGAGCGATATTAGCAGCGGTTATTATTTATTTACTAGCATGG
9   L24   AX00003301   GTTGATTCCAAAGTTAAAAAAAGTAGATTCATGTGCAACGATTGAAGTTGGATGT
9   N02   AX00003302   TACATCGGCTGCCTGTGGTTTCCGTTGGAATGCTGTTGTTCGCTATAGCTATGA
9   N04   AX00003303   GACCAACATTCCATGCACTTCAATCATTCGCAATGGATGATACATTATGCACAAG
9   N06   AX00003304   AAGGTAAAGCAACAGAAGAAGACGCTCGCAAAATCCTTAAAGACGAAAATTACT
9   N08   AX00003305   GCTTCTACCCAATGGACAAGCGTCGCCAAGGTGATGACAACTGGTACATGCTTC
9   N10   AX00003306   AAAAGGAAAACATCCTGAGGGTACTGATCCAAATGCAGAAAACTCTATGTCAGC
9   N12   AX00003307   TGCTGAAGCCGAAGGAGAAGGGCAACAAGGCATGTTAATGGTCGGAAATGTTG
9   N14   AX00003308   ACAAGCAGCTCAAGCTGCGCAAGCCCAATATGCAATTTCTCAAGGCATGTTACC
9   N16   AX00003309   ACTTTTAACTACTGCTGGTTGGCTTATGGTAGCTGGGATTATTATGTTCTCAGGT
9   N18   AX00003310   TTCAAGAAGGTCCTGCAGGCCTTTGGTGGGGAATTTTCTCCCTTTATGCAAGTT
9   N20   AX00003311   AAGGAACGAGCTTAAACCAATTAATCCAAAAGCTTGGCATTAAGCGTGAAGAAG
9   N22   AX00003312   AATTACAGGCATGGCTCACGGCATTCTATTTATTCTATTCATCTTCGCAGTAATT
9   N24   AX00003313   GGACAAGACCCATATCATGGGCCGAATCAAGCGCATGGTTTAAGCTTTTCTGTA
9   P02   AX00003314   CTGCTTCTTGTAGGTGTGTTTGCATACATATTATCAGGGCTTGTATTTGGATACT
9   P04   AX00003315   TTCAGGGAAGCGATGCGTCAAATTGGGAGTATCGTTGAAAACCCAGAACTGTAT
9   P06   AX00003316   ATAATCCTTTTGAAGATGTAGAAGATTTAAAGGGGTCTTCAAACATTGTTGTAGA
9   P08   AX00003317   TTGATGGGGTTATTATATGTTCCCGGACAAATAGTAAGGAAAAGCTTGAAGAATA
9   P10   AX00003318   ATATGATGACGACCATTACTTCCTTTGGACTTAGCCCTTATGATTCCTTCTTTATT
9   P12   AX00003319   ACCCTTGGTTTCTCTACAAATGTAGAGCTTGGAGATGTCAAGGTAAAAGGGATT
9   P14   AX00003320   GCAACATGTGAAATTGTTACAAGGGTTTGATGAATTGTTTTTCGCCCCGCATTCT
9   P16   AX00003321   GTGAAAATGCTCTCGCAGTTGCTAAATGGCTTGCTGATCATGAACGTATTGAAT
9   P18   AX00003322   GAAGAAGGGCTCATTATTGGGGATTCGTTAAGCGCTGATATGAGAGGTGGATAT
9   P20   AX00003323   TGTTAAATATGTAGCAAGCATGATGGGCTTCTTCGGCGCAACAAACATGGAAAC
9   P22   AX00003324   TATTGACTAGCTTTTCTGATCAGGCGCATGTGTTACCAGCATTAAGGGCTGGAG
9   P24   AX00003325   GTAACGATGGATCCACATAACGGTTGGGCACATAACGTATTCCCAATCCCAGCT
9   B01   EMPTY        -
9   B03   AX00003326   GCAACGATAGATGCATTGACAGGTTTAGGAAACGTAAGGCAGTTTGATTTAGAA
9   B05   AX00003327   ATTAATGCCGTATGGCTCTTAGTAGCTGCGGTATGTGTGTATGCAGTTGCTTAT
9   B07   AX00003328   AGATGTATGGGCTGGAGAGGTAAAACGTGCACCAAAATGGATTCAAGCGATCCA
9   B09   AX00003329   GTGTTTTTACAGCTATCGGTGCAAATGCGGCAATGTCACATCATGTTGACGCCT
9   B11   AX00003330   ACAGGTACATCATTAGCTACAACATCGGAAGAAAAAGCAAATAAAGGTAAAGAAC
9   B13   AX00003331   GCTGCAAGGCATAGTCGTAAACATTGCGTAACAGCATCTATCGATTCTGTTGAT
9   B15   AX00003332   TGAAGTTACAGAGAAAATGGGAACTGCTACACCAGAAGAATTGGAGGAACTTCT
9   B17   AX00003333   CTAAGGGTGTAAATGCGACATCAGTGCAGGAAATTGTGACAGCTTGTGGCATAT
9   B19   AX00003334   TAGTAAAAGGCATGATTGGCGAGATGTTCTTACCATTCGCCTTAACTATCGTCTT
9   B21   AX00003335   TTATACCGTAAGGGCTCAGGGCGAGATGCATTTATTAAGCAACATTGGCCAAAG
9   B23   AX00003336   GAAGTATGTAGGACAAGGCGTTGACATTTTGTATAAATCGATTACGAATGTTGG
9   D01   AX00003337   AGATACAGCAGTAATGAATTCAATGTTACCACAAGCAGCAACAACAGCAATTGCG
9   D03   AX00003338   ATTTACCAATTCCAATGCCCTCATCGGTAATCGGGTTAGTCATTTTATTTAGTCT
9   D05   AX00003339   ATGAAAAATCCACCTGCAATTGTATTTGCGACTGCCTATGATCAATACGCGTTGC
9   D07   AX00003340   TGAAGGCTGTCCTTTGCAAGCGGCGATTGTTATTCCGCTAACTTCACATGGAAA
9   D09   AX00003341   CTCATTTACTTCTTCTTATTCACAGATTCAACATTATTGTTATGGGGCAGCGCAT
9   D11   AX00003342   GTAGTGACAACAGGAGATTCAATGGCGTATTCGATTTCAATGGCAGTAACTGGA
9   D13   AX00003343   ATCATGATCGTTATAATTTACTGCCCGCCGTTGCGGAGATGATGGATCTAGATA
9   D15   AX00003344   ATTATTGTCATAGTCTTTTTTGGGAAGTAATGAGCCCACGGGGTGGCGGTGAGC
9   D17   AX00003345   TTGTGGGTGCACTGCAAATTATTATTCCGTTCTATTTGATCATGATTTCTGACCA
9   D19   AX00003346   AGGCATTCTTTATACAATTGGTGGATTTATTTACGGAACAAAGCCAAAGTGGTTA
9   D21   AX00003347   AACGTCGAAAGCTTTAAACAAGACATAAATAACCGTGTTTCAGAAGTAAGTGAGA
9   D23   AX00003348   CGGTATACCACTTTGTGAAATGGTAGAGTGGGAAGAGAATAAACCACAAGCGTT
9   F01   AX00003349   AAAGTTTGTATTACTAAAATTAAAACAGGATTTGGAACTGGCGGTTGGCAACTAG
9   F03   AX00003350   AGTATTAGGACTCGATCAAATGCTGTTCTGCGACTTACATGCACCTTTAGATCCC
9   F05   AX00003351   TTTGATGGACACCCAGGTTCGCAAGATAAAGAGGGCTATGTAAGAAGTATACTT
9   F07   AX00003352   TCACTTGGACTAAGTTCAGAAGTAATGAAGCGTTCAAATGAATCTCTTTCTTTTT
9   F09   AX00003353   GATGAGTGTGAAGTCGCGCCAGTTATTAACAATGTGGATAACTCAGAAAAAGAG
9   F11   AX00003354   AAGCAAGTGGAAGTAATATGGCCGAAGCTCAAGGAATTAAACAGATTAGCTTTG
9   F13   AX00003355   TTACCGCATCTACTTCTAATAACCAAGTACTTGCTTCAACGTGGAATTTAAAAAC
9   F15   AX00003356   GATGGGTTAGCTGAATTGAGACAAGTATGGGGATCAGAAGAAGTAATGGAATAT
9   F17   AX00003357   CGAATGCATTAAAGTATTCACCAGAAGGTGGAACAGTAACATATCGTTTACGTG
9   F19   AX00003358   CTTACACACCGTGAATTTGAGCTGCTGCATTATTTAGCAAAACATTTAGGACAAG
9   F21   AX00003359   GAAGAGTACTTCGAGTACGGACAGCAAATCGCACAATATGTATGTGATACGTCT
9   F23   AX00003360   AGAAGGTGGCCGTCTATTTGGTTCAATCACAAGTAAACAAATCGTAGATGCAAT
9   H01   AX00003361   GGAATTAGCGGCAGGTCTTTAGGTGAAGTGAATGTGCAGCTAATTATGGAAAAT
9   H03   AX00003362   CAAAGGTTTTACGAAAGGGGTTCCTATTATTAGTTTTATTGCCTGCATGTTTATT
9   H05   AX00003363   ACGTTTCGTTTCTGAGCGTGGTAAAATTTTACCTCGTCGTGTAACAGGAACAAG
9   H07   AX00003364   TGCGGAAAGCGTACAATTTTTAGAGCCGCGTAATGGCGGTGGGGAGCAACGTG
9   H09   AX00003365   ACACGAAAGAGTGGGGTAAGCGTCGTTTAGCTTACGAAATCAACGACTTACGTG
9   H11   AX00003366   AATTACACAAGCAGGAGCAGAATCTGCGAACTATCCATTCTGTACAATTGATCCA
9   H13   AX00003367   GAATCGTTGGAAGATTATTCGTATGGGAATGGATATCCGCATTAAGTGCGAGGG
9   H15   AX00003368   CGTATGGGAAGTCGTTCGCCAATTCAAATTTCAGAACGTCGTACAGTTACAGTA
9   H17   AX00003369   GTTTTATGGAGTTTTTCGTTCTACAAAACACAAGATTAAGTTTAGTCATGAAAATG
9   H19   AX00003370   CCTTCTTTTGTTCAAGATATGATTGCAAATGGTCAACTTTCAATGGCTCATGGGA
9   H21   AX00003371   AATCTAGCAATTCAAGGTGTATTGCTAACAATGTTGGATGCCCGTACAAATTTAG
9   H23   AX00003372   ACGTGAGGAACTAACAGCAATCGAGGAAGCTGTGGCGTATCAAAAGCTAATTGA
9   J01   AX00003373   TCAATTTGTGATGTTGGCGCAGGAGCTGGATTCCCAAGTATTCCTTTAAAAATTT
9   J03   AX00003374   TAGACAGAAATTGAAAGATGTTCGTCCGCTTTCAATGGGGCAAGCTTCACGTAT
9   J05   AX00003375   CTGATATTGCAGGAACAACTCGTGATGTTATTGAAGAGTACGTTAATGTGCGTG
9   J07   AX00003376   GGTTTATTTGGGAACCGACCTGCAGTAGTAGAAGTTGTATTGAAGAAAGATCCA
9   J09   AX00003377   TCCATTAGCAGGATGTTTACCAATCTTTGTTCAGATGCCTATTTTATTCGCGTTT
9   J11   AX00003378   TGGAAAAGATTTTGTTATAATAGCAAGGAAGCCTTGTGCAGAGATGACATATGAA
9   J13   AX00003379   GATCAACAAGAAGATGCGTTGCAACGTGTGTCGTATAGCTATGCGGATGTTTTA
9   J15   AX00003380   TATGATGTTGTTCAGAAAGAAGGATGGGGCGGAATTCGTGCGAAAGATGCTGG
9   J17   AX00003381   GCCTTTTGGCGTGGGGCTATTATATTAACAATCGCAAGTTTTGTTACAAAGGTAT
9   J19   AX00003382   GTAGTCGTTGGTCATAAACGTACATTGGAAGCAATCAAAAATGGTATAGTTAAAG
9   J21   AX00003383   TTCCTCGAGACAAACGCGTTGTTATTTCTTTAACTTACGTATTCGGCATTGGTCG
9   J23   AX00003384   ATGTTACGTGACTTAGCTACTGATTTAATTATCAACGAGCGCATCCAAACGACAG
9   L01   AX00003385   GTGGACAATACTATTTGCAGTTATGGCAACGATTGATTTTAATTTGGCACTTCGC
9   L03   AX00003386   AAGCGTATTAGATCCACAAGGAACAGCAGTAAAAGGAGCACTTCATAGCCTTTC
9    L05   AX00003387   TGATCCTGAATTACATGCAGTCATCGAAAAATGGGCGAATGATGAGTTTCGTAG
9    L07   AX00003388   GAATTTACCAAAGTCGTATATTGAAGAGCTAATTCAGCAAAAGAAAATTCGTGCA
9    L09   AX00003389   TTATAGTGATTGTGAGATTGAACTTGCGCAAAACGGTAATCGTGCAGGAATGAT
9    L11   AX00003390   AACGTTTAAATATGTTCATTGAAGTAATTGATACAATTGAACCTGAAGAAGTAGA
9    L13   AX00003391   TAACCATACGTGGACTCGTCCGAAACATGCAAAAGCGCAAGTTAACGGACAGAC
9    L15   AX00003392   ATCGACGGTCAACCGAAAGCGAAATCACGCTTCGCTTCGAAGCGACCTAACGG
9    L17   AX00003393   GAATTGAGCGCTCTACATTCCTGATTAATAAAGACGGTGAGCTTGTAAAAGAGT
9    L19   AX00003394   AGTTTAAGTATATTAGGGGGTGCCTCTCCTTCTGAAACATCAAAAGGAAAGACA
9    L21   AX00003395   GAAGAGGCGTGCGTATTAGCTGCTAGGCAAGGAAATCGTATGTGGTCTTTAGAA
9    L23   AX00003396   TTTATCTTCTTCAAGTAGAATCGACGTTACATATGAAGGCGTACCGGTATGGATT
9    N01   AX00003397   AGACAAAGCTGGAGAGCAACAATCACCAAAAAAACATCCACCAGGATTGTACTT
9    N03   AX00003398   TGTATGTCATGAACAATTTAAAGAGCATACAAAGAAAGCGAAAGCTATTATTCGT
9    N05   AX00003399   ATCATATTACAACTTTTGAAAGTGCGTGGTGTTTTCAAGAGGGAGAACAGATTTT
9    N07   AX00003400   GATTAGTTTAATTGAGAAGGGCAAATACAATCCGTCTTTAGATTTATGTTTGAAA
9    N09   AX00003401   ACTTTCACTCCTTCTCGGAACTGCTAGCATACTCGGACTTTTCGCCGCACCTGC
9    N11   AX00003402   CACTTTCCGAATTTAAGACTGGAGAGTTTGTACAAATTGAGAAGATACAATTAGA
9    N13   AX00003403   TGGGTTTATAGGATCGTTTATATCAGGAATGGTTGGAATTGGCGGTGCGATTAT
9    N15   AX00003404   GCAGGCATGTCAACGAGTATGGTTGTAAGAAAAATGCAAGAAGAGGCAAAGAAA
9    N17   AX00003405   TTTATGTGCAACATGTTTATCTGCAAAATATAGATTTACGAGCATGGCATTAATAC
9    N19   AX00003406   AGAGTTGTATTTCATGTTCGCCGATTTGTTCCATTCCTATTTGACTTTTTTACTTC
9    N21   AX00003407   CAATAGGAAATTGGGCATCGTTTACAGCTTGCATCGGCATATTTTTCATTTTACA
9    N23   AX00003408   GTTCCTGTTTGGTGAGTCGAAAAGTAAAGCGCGTATCATTAGTGTGGCTCTTAT
9    P01   AX00003409   ACATTGCACTCATTTGGTTTTTAGCATCATTACTTTGTTTACAAGTTTCTTATGCC
9    P03   AX00003410   AAGCAAGAAGAAATTGATAAAGCACTTTCGGCAGCTGGAATGCTTTTTAAGGGA
9    P05   AX00003411   GATTTCGTTCAATTTTCTTATCGACACGATCATGCTACAAAATTAGTTGGTTCCA
9    P07   AX00003412   TATCCGTACTTATGAAGGTAAAAAACTAGAATCGTATCGTACGCATGTGTTATCT
9    P09   AX00003413   GGTATCCTGACCGGAGCTGGCGTTGTCATCGGTAGAAGATACGTCGGTCCATG
9    P11   AX00003414   CTTTTCAAGCGGATGGAAATTGGATGAAGTTAATCGGTTTCATTTGGCTACTTTG
9    P13   AX00003415   TAAGGTGTACAAACGTATGGGATTTGTAGAAGAAGGCAGACAAAGAAAGCAAAT
9    P15   AX00003416   AGTTTTTCAGAAATTTACCGACGAAAACTTGTGCGCACTGCGGGAAAGAAATTG
9    P17   AX00003417   CTTTCAAATTGGAAATGTGGATTATGTTTTTAATAACTCTCGTATTATGCAAATCC
9    P19   AX00003418   CGCGAGTTCAAAGTCGGACAGATTAAAATGAACGGTGTATCATCGTCCGCACTC
9    P21   AX00003419   CTCATACAGTCGGTAATGTAGAATATATAAACAATGAATGGATATTCTTTGATGA
9    P23   AX00003420   CTGGACAAAAAGCGCCGAATGATGGCATTTACGTGGAAATTGGTGAAACGGGA
10   A01   EMPTY        -
10   A03   AX00003421   TTTTTACAAATCGTAATGAAGCATTTACCAGAAGCAAAGGCCATTTTAGATGATA
10   A05   AX00003422   ATCAAGAACAATTACAGCAACAAGGATTTGTGAAGAAAAAGGGATGTAATTGTGG
10   A07   AX00003423   ACAAAATGCGGCAATCAACAATAATAAAACTCCGAAAGAAAGCTTACCAGATGCA
10   A09   AX00003424   AACTCTGTTATTGTGGATATAACAATTATGGAGAATTTTAGAGAACTAGATATGG
10   A11   AX00003425   TCCCTCGAATTGGTGAAAAAGTTGAGATTTTAAAAACAGTCCGCACTGTTACAGA
10   A13   AX00003426   CACCTTCTGCGGAGGGGATTAAAAGATAAAAATAAAGATATTGATCAGCATATGG
10   A15   AX00003427   GCAATCATTCGACGAAGAATTCGCCCCTGAAATTTCACCTGGATATCGGCAAGA
10   A17   AX00003428   ACGAGACAAGAGGTAGTAGAGATGCTTCAACTATTTGATCTAATGGATACGAAA
10   A19   AX00003429   CATTATTTAAAGCGTTTGGTAGAGCGCTTAGAGAAGCAGTCGAAAGAAATGCCC
10   A21   AX00003430   AAACGAAATGGACGGTATTTGCTTGTTATATCGGATTAATGGCTATACTTGGTTA
10   A23   AX00003431   AAAATAAAGAATAAATTTTTGAAAGGGATTACAGCATTGGTAGCGTACACCCTTA
10   C01   AX00003432   TTAAATATTCGTCTGACTTGTATAAAATTGTTGATAGCTTGAATCGTACGTTAAAA
10   C03   AX00003433   TGGCGGATATGTACCCAGAAGCACATTGTGAATTAATTCATGATAATCCATTTGA
10   C05   AX00003434   GTTCTCTCGATTTGCTGGAAATGAATATAGGGATTAGAACGAATCATGCATTAAA
10   C07   AX00003435   TGCGAGACATTGGTATCTCGAAGGAAAAATATGCATTTCAGATTACCGAACAGT
10   C09   AX00003436   TGGATAGCCAAGGTGCGATTGTAGATGAAATACAAAAAGCGCAAGAAGAATATT
10   C11   AX00003437   TTTCATTCTTACATACGAAAGGATTTAAACTATCAGAGGAAGCGCAAGGGTTTAT
10   C13   AX00003438   GGAAGCACTGCAGTACATAAAAAGTTTCGATCTCTTTTTTATTAAGTGGATTCCA
10   C15   AX00003439   ACATTAGTCATTATGGTGATCCGGAACATCGGGAATGGAAACAATATTTCATAGG
10   C17   AX00003440   AGTGAGGTTGAGCAGCGGACTGTTATGGCGGCGAGTAGTTTGCCGGATTTAAT
10   C19   AX00003441   GACTAAATTCAAAATCTTGAACGAAGCTGGTATCAGCATGCTTTCTCAAGCAAAC
10   C21   AX00003442   TTCTTTCCACAATTATCGTTTTATTTTTCGTTGGGGTTTCACGTTATATTCATAAA
10   C23   AX00003443   GGCATTTAATTGATGTGTTAATTGGAGCAGGTGTATTTAAAATTCGTGACCGACA
10   E01   AX00003444   ATCGTAGCGAAAGATCGGGAATTGTTTGCACTTGGGCGTAATGAGAAATTTAGT
10   E03   AX00003445   ATTAATAAAATCGTGGTCGATTGAAACAAGTTCAAAGTGGACAATTGAGAATCCA
10   E05   AX00003446   ATGGAGAAAAATATTTAGCTGCTTATGCGGAGACGAAGCAGGAGGCGATTGAAA
10   E07   AX00003447   CTACTGTAGTTGGTTTTTTAAGTAGTACAGTAGCAAAAGCCATTCTCCAAATCAT
10   E09   AX00003448   ACTTTGGATTTAAGAATTGGAACTGTAACACATGCAGAGGAATTTAAAGAAGCGA
10   E11   AX00003449   CTACGACTGGGTTGATATTGCAAAATGCCCTGAATTAGCCGGGAAACAAGGTGA
10   E13   AX00003450   GCATAGGGATGAAGAAAATTATCCAGTGTTTCAAGAAATTACAGCGAAACATTGC
10   E15   AX00003451   CTATTGTTTGGGCTACTGTATTATTATCTTAAGAGAAACAAAAGAAAGAGAAAAG
10   E17   AX00003452   ATTGCAGATTTAGATGGACTAGCATCAGTTTTTAATAACTATCGTATGTTTTATAG
10   E19   AX00003453   TACGTGGTCCGATGGAAATGAATCATTATTCGGAAGGGTACTATACGATTGATT
10   E21   AX00003454   AATTGCCGGAAATCGGAAAGGCCTTAGGGGAAACGTTAAAAGAATTCAAAAAAT
10   E23   AX00003455   GTAACTACCGAAGGGCCTGGTATACCAAAAACAGTTGATATATCATTAGGTAAAG
10   G01   AX00003456   GTGAAGTAAGGAAAGTATTAGTGCAAGAATCTTTTTTTAATCATCATCCTGAACT
10   G03   AX00003457   CAAGTAGCGATTATAAACGACGTTCATCTGGTTATGGGCATCATCATTATAAAAG
10   G05   AX00003458   GCCCTCAGTTGTAGGGAATTTAGTTGTACAAAATAGTAACGGTTCATTTAACTTA
10   G07   AX00003459   ATACTGAATCAGTCTTAGTTGAAATTACAGATGTAAGCGGTGGTACTTTTGAATT
10   G09   AX00003460   TACACATATAAAGTATTAAAAAATGAGGAGGGCCAGTATTCTCTCTGGCCTGCCT
10   G11   AX00003461   GATGTGCCTTGGGATGGTTATCGTAATGACGTTTTACAATTTACTAATGAATGGA
10   G13   AX00003462   GTGAACATCCTACAGATTTTAATGGATTATTAGCCTTATACGAATCTTTAGGATG
10   G15   AX00003463   TTATAGCTGGTATGGCGGTAATCGGAGTAGGTGTAACATATGGCATGCTGTATT
10   G17   AX00003464   TAGAAGAACCGAAAAGAGAGCAGTTATTTCCTTTATTTGAAGAAGTGTTTGGGAT
10   G19   AX00003465   AAATTAATGATTACTATACCGATTATTACACGTATTTATGAAGAAGACGGGGAAA
10   G21   AX00003466   AAAACTTATCTGGACCGATGGCAAGACTTTCTGAACAGAGACATTTACAAGCAAT
10   G23   AX00003467   GCTTAATGCATATGTATTGGGATAAAGAAGAATTAACTGAGGAACAAGTACGGA
10   I01   AX00003468   GCAAATCCCACTAGAACAATCTTTATATATTGGAGGCCTCTTATTTTTTACTAGTT
10   I03   AX00003469   AGTTAGCATTGAAAATGTAATGATTAATCCTACTAATATATCTTCTGTAGTTGAAA
10   I05   AX00003470   GCCACCAACTTTTGGATACTCACATGTAGTGGAAGCTAGTAACGCTAAACGAAC
10   I07   AX00003471   CTATGCAAGGAGTTCCCACAAATAAAATTAACATACATCAATTACCTAAATGGAT
10   I09   AX00003472   AATGAACCAGTTTCAGAAGATACATACACCAGCTACAGTAAGAAATTGGAGGAC
10   I11   AX00003473   AAATATTCCAGCACAAAATTTATATGAAAAAGTTGGTTTCCAAGATAAAGGGCTT
10   I13   AX00003474   AAAGCGACAGAAGATTCACCAGATGGTTGGAATGCAACGTGTATGAGGCTTAAT
10   I15   AX00003475   ATAAGAATAGGCTATGTCTCTGTACCAGGGATAATTGGTTTTTCATGCTTTGTTA
10   I17   AX00003476   CACCAAGAGCTGAAAGATCAGTAGAGATTATACCGTTAAATACACCTGGATATAT
10   I19   AX00003477   CATTAAAACCGTCTGAACGATTAGTACTATTATTATTAGAGAAGCATAGAATGTT
10   I21   AX00003478   CGCGAAATAAAACTTCTCAATCATTCCAACAGCTTCGAACGAAAGTATTACAGCA
10   I23   AX00003479   ACGATGAGGCGGTAGAATTTTATAAAAGAATTGGTTTTCAGGTTAGAACTTTAGG
10   K01   AX00003480   TTGGTATTTCTTCAGGCACTATAAAGATTCATTTCACAAACTTTCACGACTCCGT
10   K03   AX00003481   CTTCAAAAAATCTGATGAGCTGAATGAATTAGCTTCAAAAATTGTACAAGCTGTA
10   K05   AX00003482   TGAGAAGAAGGGGATTGCTATTCTTTCGTTAATACTGTCCTCATCATTTTTTATA
10   K07   AX00003483   GAGGAAACGCAGAAAAACCTTTCAAAATTTGAAAATAGGTATTGGAAGGCAGAG
10   K09   AX00003484   ATGACATAGATTCAACCATCAAAGATAATATTAGCGGGAAAAAATTGAGGGACAT
10   K11   AX00003485   ATCTAAAGTATCGACATGGTTGCTAATTCCATATTTTTTATGGTCTACATTTGCTA
10   K13   AX00003486   TTGAGTCAGAGATAAGTAAAGCAATTACGCACTGGGAAAAGGACTACCTAGGAC
10   K15   AX00003487   CGTTGTAAAAGGCACGATTTCTACACTTTTAATCGTTACAGGTGCTAAATATTTT
10   K17   AX00003488   TCTTATTATATTGGTGAGGCAAATGTACAAAATGAATGGATGAAGGATGTTTTTG
10   K19   AX00003489   TTGGATTATCGTTTTTGGAATATGGGCAGCTATTATTTGGCTACGAGATGTTGAT
10   K21   AX00003490   GTACATTTTGTGCACCATGTACAGAAGAAAGACACAACGTTTGTCCAAACTGCG
10   K23   AX00003491   TGCAGCACGATTTATTCATTATGTTTATTACTACTCACTTAGTATAGGTACTTTAA
10   M01   AX00003492   CAAATCCTTTATCTAATAGACCTTGCATTATTAACAGGAGACGAAGAATGGTTTA
10   M03   AX00003493   AACGGATTACGGTTCGTCTTTAGGAGCTATACTCGATTCCCTCTGTTCCTGGGG
10   M05   AX00003494   CTACTATTATCTTAGGTTCTAATGCGTCTAATAATGAAAAAATTCTCGGCTTAGG
10   M07   AX00003495   TGACGAACTAGTGGCAAACGCTAAAACGTATGTCTCCAAATATCGTGAAGATTTG
10   M09   AX00003496   TTGAAGAAATGTTACATGAAGATTTCCAAGAAAGTATAACGGAGATTATCGCACC
10   M11   AX00003497   ACTTATAAGTGGGTGATGTTAATTGTTGCGACGATTGCTCAAACAACAGCGACA
10   M13   AX00003498   CAAACGCTATGATAAAACGAATTGAGGAACATACAAAAATGTTCCCTTCTACTTT
10   M15   AX00003499   GAAGAAACAGTGGAGAACGCCAGAAAGTACGTTGTTTTTATCAGCGGCAGCTGG
10   M17   AX00003500   ATGGCATTAACAGCATGTTCTACATCAGGTGGAGATAAGAAGACAAGCACAAAT
10   M19   AX00003501   AACAATTATTAAGCGATCGTGATGCAATCGATCGTATTGAAGAGCGTATTGAAAA
10   M21   AX00003502   TTTTTGGAAGATAAATTTGTATATGATTGCGCAGGGTATATTTTTGCTCATTCATC
10   M23   AX00003503   GACAAAAGACCTCATTTTAGCTACTGCTACAAAAGAACAAAATTGTTCACAAGAA
10   O01   AX00003504   ATTGATCGGCAAGATAATGTTATTACAGTTCGAGTAAATGATTGTTTTCATACGG
10   O03   AX00003505   GATGAACCAACTGTAGTCTTTCCTCTTAATTTAAGTGGAAGTCGCCAACAAATTA
10   O05   AX00003506   TGGGAATGGATCAAGGCAATTTTGATAGCTGTTGTATTAGCAGGTGTTATTAGAC
10   O07   AX00003507   CTATCGAGATATACTCGTGGGCACTTATTATTTACATTCTCCTATCATGGTTCCC
10   O09   AX00003508   ATTGTAATTCCTTGGAAGGGAATTGTGAAAATTGGGGAAGATGTCATACTTGTTA
10   O11   AX00003509   TGAGGAAGAATATAGAACATTGCTTGATTATATCGATCAAAAAAGAAGTGTAATG
10   O13   AX00003510   TAGAGTGCCCAAGCTGTGGTGAAGCGAAATTAGCTCACCGTGTATGTAAAGCAT
10   O15   AX00003511   ATGCAACAATAGAAGAGCATGGGAAAGGTATTCAGAAGATTAGGATAACTCATT
10   O17   AX00003512   AAGTTCCAACAGGAAATCCATTTTTTGATGCTGGTGGCTGTGGTGGCGGTTGTG
10   O19   AX00003513   CGACATGGACAAACTGATTGGAATTTTCAAGAGATTATTCAGGGACGTGAAGAT
10   O21   AX00003514   ACATATATGTGCATGGAATGTTCGGAACGAATTGCAGAACGTACGATGGAACGT
10   O23   AX00003515   ACAATTAAAACAGTTGCCGAAGCACGTCCGGATGATAGTGCTGCAAAAGAAACG
10   A02   EMPTY        -
10   A04   AX00003516   AAGCAAATGAATTTTGCCGTTTTCTAGCGAAGAAATTAGAAGGAGAGTTACAATT
10   A06   AX00003517   TTTGTCTTATATGCATATGTTATTATTGCGGCGGTTTATTTTGGGATAAGTTTTTA
10   A08   AX00003518   GTTTCAGAGAGACATTTAAATTTTGATATGGTCTTTACCCGTATTTGTAATTTCAT
10   A10   AX00003519   TCTCGGCTTGCTACTCGAAGGAGATAAACATCCATATGAAGTGCAGCACATCAT
10   A12   AX00003520   TGCTGATTATGCGATGTTTTTAGCGAGCGAAAAAGCGAAAGGTATAACTGGACA
10   A14   AX00003521   AATCAGAAAAACATACTGTACGATCCATCGTACCGCTACTCTTAGCTCTTCCTGT
10   A16   AX00003522   AAAGCGTCAAGAACAAAAAGAACGTGAAAAGAATAAATCATTTGAAGAACTGTTA
10   A18   AX00003523   TGCATAAACAAGAAAAGAAAGTGCAATCTAAGGAGAAGCGAGAGGCTGAAAAAC
10   A20   AX00003524   TCGCCCTTTAATTTTAGTTGGTGCTGTTGTACTCGTTATAAATGAACATGGATAT
10   A22   AX00003525   ATTTCATTAGCTGTGTTTGGTATTAAATTAATGAGAGATACTGTATTCGGGATTC
10   A24   AX00003526   AGTGACGGCAATTGATAAGCAAGGAACGATCATTTCAATAGCATGTGAGGACAT
10   C02   AX00003527   AGAAAAACAAACGTAACAACGCTGAGCGTATCGAGCTTAAAAAGTATTGCAAGC
10   C04   AX00003528   TATATTCGCCTAAAGATATGGCGCTATTCCGTTTTCAAAAAATCGGAAAAACCAT
10   C06   AX00003529   ATTCGTGCTTGTTCTTGGTTATATATTTTATTACGATATAAAAATCGGCACTTTAC
10   C08   AX00003530   ATTTGCTTTTGAAAGAAATGGAAAAAGACGTAAACGATGAGATGGATCAACATGA
10   C10   AX00003531   CGTTACATGGCTTTTTACATTTACTTGGTTATGACCACATGACAGAAGAGGATGA
10   C12   AX00003532   GCACTTCGCCGTTTTAAAAGATCGGTTTCTAAAACTGGTACACTTGCTGAAGCAA
10   C14   AX00003533   GAAATATCGTGAGGAACATGGTCCGTTTCAGAAAATAGAAGATTTGTTAGAGATT
10   C16   AX00003534   AAAAAATAAACGAAACAATCCAGAGCGCATCGAACTAAAAAAATATTGTCCACGA
10   C18   AX00003535   CGCTCCTTTCACCTCTTATGATAAAAAATGGTAGCCAACTTCCTGGAAATCGTAA
10   C20   AX00003536   GGGTAACATTCTTTATGCACGGTTTAACAAAATTCCAATCGGGAATTGACAATAT
10   C22   AX00003537   ATACTCGGTTCGGACAAATTCTTCTCGCTGTAAGTACATTGTTAATGGTTGGCTT
10   C24   AX00003538   GCAAAACAATACTTCAATGGAGCTTGCTTCTGAGTTTGGCATTTCTCTTCAAGAT
10   E02   AX00003539   CGAACTCCCAGTTACTTTATCAATTAGCATTAATGGGTGCGAGTACACTCGGTG
10   E04   AX00003540   AATGCGGTCGAATTATCGGAATTGAAGTGCTTGACCATATTATAATAGGTGACCA
10   E06   AX00003541   TACTTATTATAGGACTTATTGCGAAAAACCAATCGCTTACTGTAGCTATTGGTGT
10   E08   AX00003542   TGTCATCAACAGTACTCTTTTTTGGTAGTATCGCACTATTTTACTTTCTTATAATG
10   E10   AX00003543   TGCTGTATTGTTAGCTTTCGTAGACGGGAAAAAAGTTGCAATGGAATTGAATGA
10   E12   AX00003544   GTCACGAAAAAGACTTAGAAGACGCTGTAAATGTTTTTTTGAAAAAGATTGATGA
10   E14   AX00003545   ATATATATGAAGACGGAAAGTTTTATCGCATCATAGATACGCACCGTGGCAATAA
10   E16   AX00003546   GGTTATGCAGCATACACGTTAGTTAACTTTGTAAAGAAAAGTAAAAAAGGAAAAT
10   E18   AX00003547   AGAACGATACGTATATTGTCCAAAATGTGATGCGAAAATTAGAAAAGGGAATTCT
10   E20   AX00003548   AGATGACAGAAGATAAGGTAGTTGCTACGATGCCTGTTGATGAACGTACACATC
10   E22   AX00003549   CGCGGTTTCGAAGGGGACCTATTTCCTTTCGGCACATACTGCTTATGTCGTTTA
10   E24   AX00003550   ATGGACGTATACAATATTCGGGAACGTATCGAACGATGTTATTAATTGAATCGAT
10   G02   AX00003551   AAGAATTAAGAAAGCAACATCATATAACGCAAGTTGAAATGGCAAAGGCGATGC
10   G04   AX00003552   TAATGCAGAAAAGGGATTTGGGTTTATTGAGCGTGAAGATGGTGATGATGTGTT
10   G06   AX00003553   GCAGCGGGAATGTCTTCCAGCTTGATTGTTACAAAAATGGAGAAAGCAGCAGAG
10   G08   AX00003554   CGAAAATAAACTTAATATCCCTTCCGGTTGTTTTGTTTCTGCTCTTTTCGTATGG
10   G10   AX00003555   CTCTCGCAGCTAGAATTAGCTAAAAGAGTTAAAGTGGCGAGACAGACAATAAAC
10   G12   AX00003556   GCTATTTTTAGAAAAGAGGTACAAGATTTTAAGACAAATTCACAAGTGTTGCTAA
10   G14   AX00003557   CAAGCACTGATTGCCATTGTTTCGCATTTATTGTTTATTACCATCACGTGGTGGG
10   G16   AX00003558   CATTTGGCGGATCGCTTTCTATTTATAAAGAAACGTTAGAAGAGATGGAAAAACT
10   G18   AX00003559   AATAAAATGGCGAATGAAATTGCAAAGGCAAAAAGTAGTGAAGGACAAAAATCAA
10   G20   AX00003560   ATAAACGTAAGCGCAGCAAAGTACATGGTTTCCGCAGCCGTATGAGCACAGCAA
10   G22   AX00003561   AAACATATAAAGGTTTATTTGACGCTATGGTCATGACTCCTTACTTCCCTCATCC
10   G24   AX00003562   GGAATTATACATTGTATGTACCCCAGGACTGTATCGCCTCTAATCATGATCAAGA
10   I02   AX00003563   AAGTGAAGAATGAATGGTTACGTCAAAAGAGAATGGTTGAACAAAGCGTTGAAC
10   I04   AX00003564   CATATAGAGAAAAGGATTGGGACCCATAATAGCGGAAGAGGAGCTAAGTATACG
10   I06   AX00003565   TTTCCTAGCAGCGATTGCAATCTTACCAGTTATCTTTACGAAGCTGGGAAATCTT
10   I08   AX00003566   TTACCATGTGCACACGCATAGCGAAGATGCTCATCGGTTGCTAGCTAATCTGAC
10   I10   AX00003567   GTTGCGAGCGAATTGAGAATGCGCATTATTGCAGGTGTGATTGAAAGCGGTACC
10   I12   AX00003568   TGCGGATACTGCCATGTTGATATCCTTACTAGTTGCGATCTATACAATGGGATTG
10   I14   AX00003569   ATATGCTTGAAAACATCTCTGCAAAAGTGAATAACGAGCCTTGCTGTTCTTATAT
10   I16   AX00003570   TTAAATATCGTATGGCTATATATGGTCTCACCTATTAGAGATGAAAGCGGAGGTC
10   I18   AX00003571   CAAAATACTTTCTATAAAGTATATACGTTGCTAGATGACCTAACAGAGAATAACA
10   I20   AX00003572   AAGCTTGATAACAAAGATACTCAAGACGTTTCACTATCTCCTATAAGCTCTACAT
10   I22   AX00003573   ATACCGCTACTAGCTCCAGCGATTATTCTAAACTTATTTCCTACATGGAAAAAGA
10   I24   AX00003574   GAACATGTAACGATGACATATGGTGTAGGGGTAAAAGCTGAGGGAACAGAGATG
10   K02   AX00003575   CCGGAATGTTGGAAATAGCTTTTCGCAGTTTGGCTGGGCTTATGGTTTATTTGC
10   K04   AX00003576   TATTGGCAGCCTTTCAATTTATATTTAATGTATATGGTTGGTATCATTGGATTGCA
10   K06   AX00003577   TTTTATTACGGCCATTTCTAAGCCAGGGGGAGTTTTCCTTCCATATTTCCAAGAG
10   K08   AX00003578   GAACAGATTTTTAATTGGCCAGGGATTGGGAGTATTCAATTAGAAGCATTAAACT
10   K10   AX00003579   TAGGCGATTTTTTCCTCTTTCCTATGGCAGCTTATCATGAATATATCGCTAATGG
10   K12   AX00003580   ATAAGGCGATGTTTAATAGTAGATTGCGCACAACTGGTGGGCGTTATCTATTGA
10   K14   AX00003581   CGGGTGAACCAGATTTTCCATTTTGCCTTTCTTGGGCAAATGAACCGTGGACAA
10   K16   AX00003582   ATTCTTCGTCCAGGTGGCATCTTCATAGCCACAACACAAGCACGCTATTTTCTCG
10   K18   AX00003583   ATACAGGAAGCTATGCAGAACTTAGCATTACAGATGAAGCCTTTCCCCGATTTC
10   K20   AX00003584   GCAAGTATCCATCCAGAGGATCATATCTTTCAATTCCTGGTCACGAATCCAGTTT
10   K22   AX00003585   GAAAAGTTTAAAATAGCCAGTGATTGGTTTTTCTATGTTTCTATCCTTAAAGAGG
10   K24   AX00003586   CGCTATCCCAAAGATATACAGCACATTTTACATTAGTGGAGCCTACTCCAGATAT
10   M02   AX00003587   CGTATTTAAGTGTCGATGATATCCCTATGTTTGCGGTAGGATTCATCACTTCTTT
10   M04   AX00003588   GCTACTCTAGATATTGCAAATAACGAATTACAACCCACATATCCACCAGAGTATT
10   M06   AX00003589   TCATTTCTAGTCACATATTAGCAGAGGTAGAACAGTTAGTTGATCGTATCGGAAT
10   M08   AX00003590   TTATGCCAGAGTCTACTTGTCCTATCATTGCAGATCACCTAAGCCTTATGCGGAT
10   M10   AX00003591   CGAAGCCTTTCAGCATTCACGAAGTAGTTGCACGAGTCAAAGCTCTTATACGGC
10   M12   AX00003592   TTAGAAGAGTTACCTGCCCCAATCCAGCAATCTGCTAAGCAAATGCTAAATATTT
10   M14   AX00003593   AGTACGACGACAGGCGTTGTAAATCGCCTTGTAAAAAAGGGTTATATTGAACGC
10   M16   AX00003594   AGTTGAACTTCCTTTAACGCAAGGAGTTATTACATGGGATCCGTATGAATATAAC
10   M18   AX00003595   GCGGAACGATGGTACGGAGCTAACAAGGGGAGTAGCCAAATTAGTATTTCATAA
10   M20   AX00003596   TCACAAAATATAGTTTCGGAGACTAATCATACATCCCAATCTTCACAAGCTCAGT
10   M22   AX00003597   TATTTAGGAGTTGGCCCAATTTTTCCGACGAGTACGAAAAAGGATACGAAAGCG
10   M24   AX00003598   AAGTTCTATGGTTGAGTTAAGAGCTGGCGCTCAGTTACAAGAAACTTCAGTACC
10   O02   AX00003599   AGTCGTATATTGCAAGCTGAGAAACTAAGGATAGGTTATAGTGATCCGTTATGC
10   O04   AX00003600   TGCAGGGCGATATGCAGTATTTACTGGACCGACAATTTTATTATTTCATAATGGA
10   O06   AX00003601   TACGTACTTGTTGTATTCATTTTTGGTCTGTTTTTCGCATCGGTAGGCTTTAATA
10   O08   AX00003602   GATAGTGGTTCTGATGGCAATGGTTCCGATGGTAGCGGTTCTGGTGACAATGG
10   O10   AX00003603   GAAGCGTCACGGATTTACAAATACGAAATATGAAGCAGGTAAAGCTGAACAATG
10   O12   AX00003604   TAAAAACCCATTTCAACATGTGGAAATACCTCGACCACGAAAAGTGGTCAATTCT
10   O14   AX00003605   GATATAGATACGTTGGTTATCATCGCCTCCTTCTTCAATGTTTCGGTAGACGCGC
10   O16   AX00003606   AAATCCATCAACAAAGAGATTTGAATACCTTGGAGTTTGTACATCCAAGCGAAAA
10   O18   AX00003607   AAACAACCGAATTGAACCTAGTATGACTGTATTGAACTCTATTGCAGATTTGTTT
10   O20   AX00003608   GTTCGTAAAATTGAAAGTGGATATATACCGAGACCGGATATAATGGTTAAATATC
10   O22   AX00003609   TGGGGGCAGCTCAACTTTGAGCCTACCCAGTACCAGCATTATCAAAATAAACAA
10   O24   AX00003610   AAGATGCACGACAAACAGCAATAGAAAAACTAGATACTATCCCGGTTACTTACGA
10   B02   EMPTY        -
10   B04   AX00003611   CACCCTCTTACGATAAAAAGGAAGAGCCTCCTACATTTAAACGTAAGACAAATAC
10   B06   AX00003612   TAGTAGAAGAGTTCTTTACATGAGGATGTACAGATACGGTTGGGAATTGCAAGA
10   B08   AX00003613   AAGCGACTTTACGTACTTGGAATAACAAGACTGATTTTGGAGGACGTGTTTCAAA
10   B10   AX00003614   AAAATTGAGGTTAAACAAAACTGTGAAAAATGCTGTCATTGCGACGGAAAAGGT
10   B12   AX00003615   CATTTTTGGGTGGGTAACGTTTACCATAATAGCTCATTAGAGTCTGACACAATGG
10   B14   AX00003616   ATGCTTCTCAATTTATGAGTTGGGCAAATACGGTACTGGCACTCGTGGACGATG
10   B16   AX00003617   AAGTGCTGTCCGAACTTTGGAACAAGAATATGGTTATGAAGGCGAAGCTTGGGA
10   B18   AX00003618   AATCGCGCTTTTGCAATGATGATTATTGAGACATATACAGCAAGTCAACATAGAA
10   B20   AX00003619   GCATAACACTGGATGGGGATATCATTATCAAGCTTATCGGACCGAAAAGGAATA
10   B22   AX00003620   CATACTTCAAATTCAGGCATGGGTTATGTGAAAGATGTACAGACCCAGGAAAGA
10   B24   AX00003621   ATACGGATCCGACATTTTTACCGATTATTTATGAGTTAGACAGTCGTAAGGAATG
10   D02   AX00003622   AGAGAAGATGACAACGGAAACCGGACACTTATAGGTTATGCGGTAAAGTGGGA
10   D04   AX00003623   ACGTGCAAATGCTGTGACTAAAACAAGTGACATCGGTTCTGTTATCCCGCAAAC
10   D06   AX00003624   AGGCGATATGTACGAGTCAAATGATTCGGAACGTATTGCCTTTTTAATTGAAAAA
10   D08   AX00003625   AGAAGCAGCCCGACACGACTTAATGTTGTCGGGTGTTTCTTCCGTTAAAGCGAA
10   D10   AX00003626   TTCAAGCTGGTCAAAATGGTTTCAAACCAAAATGTGTATTAATCGTTTATTCGTTG
10   D12   AX00003627   CGAAGGGATGGCGTAAGAAGAAAGAAGGAAATGGTTTTATTGTCCATAACGCAT
10   D14   AX00003628   TAAGCCGCCTTTTATTTGTTATCTGGTGACTGGTTCACCAAACATGATTGCTGAT
10   D16   AX00003629   GCGACTCGTCATTTATTATACAACGTGTCTGTGTCACGCCCTGGTTTTGGTTCC
10   D18   AX00003630   TTAGACGTGATATGTTCGCGGATATCCTTAGTTTAGGGGTACTTTCTTCATACAT
10   D20   AX00003631   TTCTATGAAGGATGCGGTTCGTGATGCTGTAGACGATACTGAAAAAATGTCTGA
10   D22   AX00003632   GACTACACCGTTTCTATTCCTGGTCGTCCTGGTGCTTATTATTTCGGGTCAGATA
10   D24   AX00003633   AATTATTAAACCCTGGGACCTCTGAACACGCGAATGCTGGAGTTGAAATTCCTG
10   F02   AX00003634   CCAAGATAATTGCGACCCAGATCATCCAGCCATCATAAGGTTTCAAATACCTAAC
10   F04   AX00003635   GGTGATTTTATTATTCAACGTATTGATGTTAAACGTATCATTCCATTAAATATGAT
10   F06   AX00003636   AGAAGTTGCCATTGAAGCCCAACAATCAGCAAAAAGCGCTCATTTGCGTGTGGA
10   F08   AX00003637   AAGTCACTATCTTGGTTTACAGAATCGGCAACCCAGGAATCTGTACAAGCGCCT
10   F10   AX00003638   TTCCGACGATAGGTATCTCCCTTTTGTTTTTGGTCTTATATGGATTAATTAAGGA
10   F12   AX00003639   AGCGGTTCTATCCGTTGCGAATTCAGGATTATACGCAACTTCTCGTATGCTATG
10   F14   AX00003640   AATCGTTTCAGGTGTGCTTTTATCTGTGACAGATGGAGCAGTAAGCGTTCGTAC
10   F16   AX00003641   ATTACAAGCTCATCTAGAAAAGTATCAGCAAATTGAAATGAGCGAAAAGGATACG
10   F18   AX00003642   TATATTTTCTCGTTCCAAGGGATGAGAGAGATAGAACTATGTTTGAATACGAATA
10   F20   AX00003643   GTGAGCTTGAAAAGGTTGCAGTCGGCATCAGTGGAAATATAAGATTAGTAAATG
10   F22   AX00003644   GAGATAAAGCGAGAAGTGCGTCAGAGGGAGCGGGATTAGGCCTTTCAATCGCG
10   F24   AX00003645   CATTGCGTTGTACTTATTGGATATGATCAGGAATCTGTATATATTCGGGATCCAC
10   H02   AX00003646   ACATACAGCTCTTCGGTGTAACAAACGGAACCATTATTTCGATCGCAGGTGAGG
10   H04   AX00003647   TATTTTCATTTCCGAATCCGCCGAAGCGCCCGAGCTTCCCAGAAGCGGCTGGA
10   H06   AX00003648   GTTAAGAGCGTTAGCGCATCCGTTGCGTCTACGTCTAGTAATGGAATTAATGCA
10   H08   AX00003649   CTACCAAGGGCATTAATTGCAGCGAGTGTTGGTGCTAGTTTAGCCATTGCAGGT
10   H10   AX00003650   TAGAAAATAAAAATGGGATCGTCCATTTTTTAAACCTCAAAGACTACACATACCC
10   H12   AX00003651   CATTTTTTGGTGGAGGTTTCTTTCCAGGGTTTGTAGCAGGAGCATTACTCAGTC
10   H14   AX00003652   TCATAACGGCGGACATCACCACCATGGTGGACACAATCATCATGATCACCATCA
10   H16   AX00003653   ACAGTTTGTCAAAATGGTGGAATATTTAACGAGCTAACACATTATCATATGCATG
10   H18   AX00003654   AATCTATATGCATCCATCCATAAAGTTGCTTAAATCTGAAGGGAATGCATGGAAC
10   H20   AX00003655   TATATCACGGACTTCGTGTTCCAGCTAACTCTCCAATTCCACCATCTATGCCAAA
10   H22   AX00003656   ACAAGAAGATATCGTTCGAGTCGATCTGTTCGCCATTTATGATCCTCCTTCTGCT
10   H24   AX00003657   TTATACCCGATCTTCCCTACAAGTGGTAGCGTTGATCCACAAGTGGCAGCCGGA
10   J02   AX00003658   GATATTCGTCCAGAAAACCGCGAACAACAGCGTAAATTGCGTCGTGAAGTAAGC
10   J04   AX00003659   CGAATGTCCCTGTTATTACAGTAGACCGCGTTGCGAATTCAGGTAAAGTTGTTT
10   J06   AX00003660   CATTCAGGTGTCCACACTGTAAGGTGAAATTAAAAGAAATGAGGATCACACCAT
10   J08   AX00003661   GTCGTACTACATTTATGTCACTATGGTACGTGTTGCCTTGTGCGGTTGGTTTTTT
10   J10   AX00003662   ACATCAGTAGGTAGTGTGAAAGAGGCTGCTGGAAACTATGGACAAGCGCCTATG
10   J12   AX00003663   TTGTCACCGTTTCCGCAGTTTTTGAATACGGAAAGGCCAGATAATATTGTGGCC
10   J14   AX00003664   ATTACCTCTCTTAGGATTAACTAAACAAGGCGTACAAATGGAAGGAGCGGCATT
10   J16   AX00003665   GAGTTAATGGCCCAGCATCAAATTAGACGATTACCAGTCGTTGAGAGTGATCAA
10   J18   AX00003666   TGTATATAAGGGTCTTAGACACACTGGATATACCATGATGCTTATTTTTGGTGGT
10   J20   AX00003667   AGCCAGTGCGATTATCGTTCAGCCAGATGCCGATGAATCAGGTCAAACTGAAAA
10   J22   AX00003668   AACGATTTCCTTCTATCAAACCTCTTGCGTTCATTGTCAAAAGGTCTCTCCTATT
10   J24   AX00003669   TCAATCCACTCATGCAGGTACAATTGAAACAATCTCTTCCCTTCTAAACGCCAAA
10   L02   AX00003670   ATTTTAACAGACGGTTCACCATATGCATTAGCTGGACCAGCGACATTACTCGATT
10   L04   AX00003671   GGATTACGTCAGCTCACGGTATTAACAATCATCTCTCAAAAAAGTAATACTCCCC
10   L06   AX00003672   CAAACGCATCCTTCCTAATGGGGCAACTGGTATAGAGCTAGCTGAGTATTTAGG
10   L08   AX00003673   CGGGAAGATTGTTTGAATATGCTGGAGATGCACGTGAGTTTACACCATACGCGG
10   L10   AX00003674   CCAATTTGAAGGTGATTCACGTGAATTTACACCACATGCGGTAAATACGATGCG
10   L12   AX00003675   TTCGTACAGTAGGTGAATATAGAGGAAATCATATGAAAGGATTTCAAAATATCCC
10   L14   AX00003676   GAATGCGAGTGAAAAGATGACACTTGCTAGTGAAGAAATTTCAGCAGCTCATCG
10   L16   AX00003677   TTAGTTTTGTCATGAATCGCATGTTAGGTGGGCGGGAAAAAGGTGTTACAGATT
10   L18   AX00003678   CAATACGCTTGCACCAAAGCAAGATGCATTTGTTATCGTAGGTGATTTCACAGAT
10   L20   AX00003679   TATACTTACGCATACATGACAGTCGGAGAAGTCGTCGCCTTCATCGTTGGATGG
10   L22   AX00003680   CGTGAAGTGAGCTTACAAACGTTACGCGTCATCGGGCTTATTGTTCTAATTAGT
10   L24   AX00003681   TCAAACAGTGCACAACCTAAGGAAGAAAACGATGTACAATCTATTAAAGATGTTA
10   N02   AX00003682   AACCCTAAAACGATCGCGAAAGAACTTACTGTTTCCTATGCAATAACCAATGCTG
10   N04   AX00003683   TACTTATAACAAAGTTTTAGTAACAACAGATAACGACTATTATTCTTTCCGACTCG
10   N06   AX00003684   CGAAGAAAACGACCTTGAAATCTCGGGTGAATATCTTCTCCACTTATCAACAAAA
10   N08   AX00003685   GTACTTCTTCTAAAAAGCTTAGACTTTGCAAATAATCTTACTCATTCTTGGGTGC
10   N10   AX00003686   GGAAACAGTATTTATACACAAAATCAACTTGGATCAATAAAGTAGATGATAAGTT
10   N12   AX00003687   AAAATAAAACTGTAAAACCAACGCTTTACTTCCACCCTAGCTGGGGTGCAGTAG
10   N14   AX00003688   CAACAGTCGCTACGATATGTTGCCCTTCATTTCCTAGATCAGAACTGGGTCAATC
10   N16   AX00003689   GCTTGGTGGACAAGATACGAGACTCCCATTAATTGTCACTTCGTTTGCGTTATTA
10   N18   AX00003690   ATTTCAATTTTGTCGGAATGTTCGCTTCTAATCGGTATGAGACTTCATGCGCTCA
10   N20   AX00003691   AAGGTGCTGCAGTAGCTTCAATCTCTAACTGGACAGTTGCAGAACAAAATAAAG
10   N22   AX00003692   TCTTTGAAGGTGGAGAAGCTACTTCTACTACAGGTAAACTAGCTGTTGGCATTA
10   N24   AX00003693   CTTAGTCCTAAAAGACTCATTCGCAAACGCGATCGTGCCACACTTAGCACAAAG
10   P02   AX00003694   ATTACATATATATCCCGCTCGGCGGAAACCGCGTTTCAAAACTAGCGAATTATCG
10   P04   AX00003695   TTGTTCATCGATTGTGGAATAAAGCAGGAGGTCGCATGCCGGACTGGGCAGGA
10   P06   AX00003696   AGGCGCAAAGCTTACTATATCCAATTAAATCGTATGTGAGTATGGATGGGATTAC
10   P08   AX00003697   AACTATTTAGCGTAAAACATATGCTACTAGCTAGCACACTCGTCCTATCGCTCGG
10   P10   AX00003698   GTATTACTGATGTTCAACATAAGCCACAAATGGTTGAAGTGACAGAGCAAAGAG
10   P12   AX00003699   CACGTAATTGTCCTCGTCCTTTTGGGGGCAGACGTGTTTGTTCTTTTGCCTGCG
10   P14   AX00003700   TACGAGTGAGACACCGGAAATGGATAGTAGCATAACTTTAACGATTTTGTTTCTT
10   P16   AX00003701   ATCTGGTTGCGGCAATACATCCGACAAAACTTCTTCAGAATCTAAAGAAACTAAT
10   P18   AX00003702   AATCAAAGTGATTTGCCTCATTTTTGGGGAGAAGTTGGTACAACAATGGTTAGTG
10   P20   AX00003703   GGAGTTGACTCTTATTTGTTAGATACAGAAAGGGACGAATCAATTTGCGGGCTT
10   P22   AX00003704   TAAAAATCTAGGTTCGTCTAAAATATCGCCGTATATTGTATTGGACGGTGATTCG
10   P24   AX00003705   TATTCCGGTTCGACCTGATTGGAGTGATAGCTCTGATTTACTCGGTTATGTGAA
10   B01   EMPTY        -
10   B03   AX00003706   CGACGAATATATATATTTCGAACTAGAATCATGGAAAAAACTAGACCACCTCATC
10   B05   AX00003707   CTAACGGAAAAACACCCACAACAAAAATTCTCCCCAAAGACGAATACATAAAAGA
10   B07   AX00003708   GTTTGGAGAACCGGATAATAAAGCGGAGTCCCAAGCTGGGGATATTAAAATGAT
10   B09   AX00003709   GTTTAGGTTGGGCGGCAGTCGCTTTATCGATTTTAGGTATCGTTGGATCAGTTA
10   B11   AX00003710   CGTTTGGACAACTGCGAAATTGCCAATTCTCGTGTATGAATATTCTTCATTTGGA
10   B13   AX00003711   ATGGAACATGTTTCGCAACCTTCTCCCTGCGATGCTCTCCATCATGCTTTTCGTT
10   B15   AX00003712   AAGTGCGAGGAAGAACTTCCCGTCAATCCAATCGATAGTGCCATTTTATATCGT
10   B17   AX00003713   GTAGCAATCCTATGTTAAACACTAGTAATATGACCCAAGTTGGCGATCATACATT
10   B19   AX00003714   TCTTGCGGCAATACAATTGGAGAAAGGCTGTCTTCAAGAAGAAGTTCGTAACAA
10   B21   AX00003715   ATGATCAGAAATTACTCTTTAACCTTTGCGGCAGTTACATTAAGAATTTGGCTAC
10   B23   AX00003716   CAAGGTAATGGACAAGAGTTGACTCGTGAAGAACAAAAAGTAACGGAACGTATG
10   D01   AX00003717   TATCTAAAGTGGGCATTGTGAATTCTGTCCCAGGTGTAAAGGGAGGATATAGGT
10   D03   AX00003718   AAGAATTAGGGTGGCGGGGTTTTGCATTAATGGAGCTCCAGAAAAAATACTCGC
10   D05   AX00003719   ACGGTAAACTTGGAGGTGCTGAACTGAGTGTTGTAGCTAAAGATGGTTATTACC
10   D07   AX00003720   AGCAGATGCATTCGATGCCATGACTTCTTCAAGAGCATATCGTTCAGCTCTATCT
10   D09   AX00003721   GGCACGCCTAAAACAATTACACTAGATCAAAAAAAGCGAAAATCTGCACATTCTA
10   D11   AX00003722   TATTAGACAGTTTCATACCTATAGGAATGCTCATTGGCTGTATAATCGGTTTGAT
10   D13   AX00003723   TTTGCTCATGTTGCGGCGTGAAATACGAGCATTCCGTTCAACCAGAAGGACAGT
10   D15   AX00003724   TGGGAGAAAGGTTATGACGCTACATATATATCAGATCTTATTGAAACGATGGGTA
10   D17   AX00003725   ATCTATCGGAATAACTGAATGGTTCGGCTGGAGAATGGTATTTCTTTTTTCACTA
10   D19   AX00003726   GAGGTCGCGGAGGATGTAACGCAAGATATATTTGTGAAATGCTATAAATCTCTT
10   D21   AX00003727   ATCGTCTAGAGCAGAATCGCTTTATCCAATCTAGCTGGGACCACGAAGGAGCTA
10   D23   AX00003728   GTTGGTGGAGTGACTCTTTTTATAATCCATTGTATTTGTAACGTTGGCATGATCC
10   F01   AX00003729   ATCTCAATTGTCAGCCCTTGACACACCTTATCATCTAACAGGGCCAAGGCTACG
10   F03   AX00003730   CATTTAGGTTTACCTCAATGGTTTAGAATTGCGACAGGTTGGATCGCTTTAGCAG
10   F05   AX00003731   TTATTTTCGCTCTAGGTTCCTTGCTTGGCTTACTTGCTACTGAGTATTGGGTTAT
10   F07   AX00003732   TAAATTTGGTCCAAGAGCGCTTATTATTCCTGGGACGCTGTTATTAGCAAGTGTG
10   F09   AX00003733   ATGAAGTTTCGTTAAGACAAGCGCAGGAAAATTTCATTGTGTTTGGTGCCTGTG
10   F11   AX00003734   GTCGCCAAAAAGGTACTAGTACATAATCAAATAACAAGACAGTATTTTGAGCAAC
10   F13   AX00003735   TTCTCTTATGATTGTAGATATGCTAGGAAGATCAGCGGCTAGATTTAACATTTTG
10   F15   AX00003736   TATGATACGAGACAATCAGTTAGTCATGGTGTACCGAGGACTCGCGAAATATAC
10   F17   AX00003737   TATGTTTAGTTGTAGGTATTAAAGCGAAGGGGTCGTTATTTTATGGGGATTGGC
10   F19   AX00003738   GTCGCTTCTATTTCCATTTGCAGCTACCTCCATCCCTTACGTCCTGCTAAATACA
10   F21   AX00003739   ACGCCCTTTCACCTATCTTGTTTCATAAAGAAAAATATATAAATATGAAAGATGCA
10   F23   AX00003740   TTACTGGCTATATGATTACGTATAATGTTCCGTATCCAGGCATGCTACTTACTAC
10   H01   AX00003741   GATAAAGAAGCAGTGCACGGTAAACCAGATGGTACATTTGCTCCGGCTGAAAGT
10   H03   AX00003742   CGTTAACGAACCCTAAAGGACGTAAGACTGTTTATACGTATAACGATGCTGGGA
10   H05   AX00003743   GAGAGGTTTGTTGTTGGAGACATAGAGATAGAACAAAAGTTAGAAAGTATTATG
10   H07   AX00003744   CATTTAGCGTGGTTTATTCCAGTCGCTGTACACGAGGCGAGAATCGCTGCTCCG
10   H09   AX00003745   GAAAAGCAGCCTGAGCTATTGTGGATTGTAAATTGTAGGGACTTTAGTATATTAG
10   H11   AX00003746   AATTATTGTCGGTAGCAAGCAAGGCGCATTCGGTTCTTATAAAGATGGTCATGA
10   H13   AX00003747   GTGGCGGCGTAGTTGCTGAAAAAAAGAGTGAAGAAAGCGTTAATTATATGTGTG
10   H15   AX00003748   TCGCTTGAGAAACTGATGTCATCTGGCATGGTATGGGCACTTCTTGCAGCACTA
10   H17   AX00003749   GCGCATTACAGTCTAATAAAGTAGCGGTAGGAACGGGAGATGGCAAGTTCGAG
10   H19   AX00003750   ATTTTAGTATTAACAAAGCATGGTATTTTTGAAGGCGATGAAAAAGGAAATTTTA
10   H21   AX00003751   ATTTAGTGCTGAAGGGGCTACAGCAAAAGCTGAATTAGCTGCAAAGCCACAACA
10   H23   AX00003752   TACACAATACGATTGAAGAGATAAAAGCGTATGCGAAAATGTATGAACATGATAA
10   J01   AX00003753   AAATTTCATTTTGGGCTGCCGTTTTCCTTACAGCTATCGGGTTTGGTCGCGAAA
10   J03   AX00003754   TAGTATCGTATTAGCGCCGCATTATTCTACCTTTAGCATTAAGGCATATAACGAG
10   J05   AX00003755   TGAATTATCCGCCATCGCGTTTGAAACTAGCTCTTACATATTTATTGACATCACC
10   J07   AX00003756   GAAAATATTATGGACTCGCAACACTCTAAAGAAGACTTAATAGATGCGCTGATTG
10   J09   AX00003757   AGGCGGAGACCTCGGATACTTCCATTCAGGTGCAATGACACCTGAATTTGAAAC
10   J11   AX00003758   ATTAACACGTGACCTAGCAGAGCGTTTCAACAAACGCTTCCGTGAAGTATTCAC
10   J13   AX00003759   GACTTCGTTTATTCTTGGCGAAGAGCTGTAGATTCAAACACGGGTGCCAAGTTT
10   J15   AX00003760   TTAATGTTGTAAAAGATACAGGAGCAGCTGTTAATTTGTATAATACGAGTGCGAT
10   J17   AX00003761   TTCATCTTAGGAATATCTAGTGCTACCCCGGCCCTTATAGGAAATAGCGGTGCT
10   J19   AX00003762   TGCTGTAATGAGCCGCATCATTGATAATCGAAAAACAAAGAGGCAGCAAAAAAA
10   J21   AX00003763   GGTGATGCGATCTATATCACGGAACCTTTAAGTTCTTTCCGCCTTCATACGGGA
10   J23   AX00003764   TAGATGTAGGCTGTGGTATCGGCCGGATGGCGGTTCCATTAATGAACTATTTAA
10   L01   AX00003765   TTGAATTTAGAAAAGCTGGCTATACAGTTGGGGTTCCTGTACAGCGTGATGCTT
10   L03   AX00003766   GGGTTACGCATTCATTTGTACAGGATAATGTCTCGTATTCAGCGGAAGCGGGAA
10   L05   AX00003767   TTGGTGCTGGGCGTTTTCGCACCATTGATGGAATTGGAAAAATGGAACGCATTT
10   L07   AX00003768   AGGAAACTCGTCCGAATGAAACGGTAGAGAAAGCGAAGCGATTTGCGAGTGGG
10   L09   AX00003769   CATTCACTCCACATATAACGATTGGGGCAAATGGATTTTTTGAATTCGAAGATTT
10   L11   AX00003770   GGTTCACATCAGACTGTCGTGATAGATGTGAGAGGACCAGATGAAACGGGAGA
10   L13   AX00003771   CGATTTGGTGGAACGCTTGAGGGAGCAGTGGTGGAAGCAAAGAATAGTGTAGG
10   L15   AX00003772   ATTACTTGTAGTTGCTATTACGTCTCCTTATGAATTACCTAAAAAAGTTGGCTTTA
10   L17   AX00003773   TCGGAAGGCAATATTTATCAAAGAAAACCGTAAACGCTATGCCAGAACTTTTAAG
10   L19   AX00003774   AAGTTATTATGCTGCGATGATCGTGTATCCAATGGGCATTTTAACAACACATCTT
10   L21   AX00003775   TCTATGCCTCTATCCATATTTACCGAATCAGATGGCTGTACATTGGAACGAAAAT
10   L23   AX00003776   TGCCTTTTCTTCCTTCCACAAAGGAAGATGCGATAGCGGCTCATAAGAAAGGAC
10   N01   AX00003777   ATGATAAACCTCAACATCTGGAGAATATGAGATCTAAGATTACTAAACGATTTCA
10   N03   AX00003778   GCAGGCGATATCTGCGTTCGGGAAAATGACCGAAAGTACATTATTTCGATTAAC
10   N05   AX00003779   CGTCAGAATGTATCGTACCTAGCTCTTCCCGTACAATTACAGGTCAATTAGTTGG
10   N07   AX00003780   AAACGAGGAGATACGTGAAGTGACGGATGAAAGTTTTCTCTATCAAACTGTAGC
10   N09   AX00003781   TACGCTAGATTGGTTCGTCATTCATATTGCCGATGATTGGATAGAGAGCGTACA
10   N11   AX00003782   ACATAGTAACGGACAAGGACAGCATAAAGAGAAGAAGCAAAGTCATCCGTTTGG
10   N13   AX00003783   ATGAAGTTGTTACCCTTAATTCAGAACAGGATGCACAAGGTTGCGATTGTTGTG
10   N15   AX00003784   AAAGATATTCGCACTCTTTACTATCGTGTCAACCAGATTTCGTTGCTCTTGCGAA
10   N17   AX00003785   GATATGACAATTCCTTTAGCGAGAGTGGTGGGAACGCAGAGGTGTGATACGCC
10   N19   AX00003786   TTAGTTCGTGTGTTACAAGAAATTGGGCGTTCAAGAAAACCACTTCTAGGCATTT
10   N21   AX00003787   GAAGAAAAGGCATTTAAGATGGCGGAGATTGAGCTTGAAAAACATTTTTTACCG
10   N23   AX00003788   ATGGTCAACCACCTACTCGTAATTTCTCAACTAACGTTATCGGTAGTGCTGTATC
10   P01   AX00003789   AAGTGAACATAGATGTAAACTCGTCTATATTTGTGAAAGCGAATCGTAGTCGTAT
10   P03   AX00003790   CAAAAGCCAGTTTCCTAGACAAAGATCCGGTTCCAGTTTGGTCTAAGGATGATA
10   P05   AX00003791   TACGGGATATTGTAGCGATATGCTGTTTACTAAAAGAGAACGAGCTCCGTACGC
10   P07   AX00003792   CTGGTGGTGCCCCTCTATTTACTTGTGAATCGACAGAGGAATTAGAATTTGTTG
10   P09   AX00003793   TTTAAATTCCCTCAATGTATTTGCCTCAGTTAACGACTTGGCACAACCTATTGCG
10   P11   AX00003794   AGTGATGTACATAGTCCGGGCGGGATGCAAAGCAACTGGTTTAGTCGTTGTTTT
10   P13   AX00003795   TTGCTACTTTATTTCGAAACAGAAAGAAACAAGAAGCTGAAGGTCCGATGATTCT
10   P15   AX00003796   TCAAAACTTATGGGATCGTTGGCAAGCATGGCTAGCTGAAGATTCTTTTTGGCC
10   P17   AX00003797   GAACTATGAGGAGATTTTGCCATCTCTTCATTCAGATATTATATATATTCAGCAC
10   P19   AX00003798   AACATGTGCGTGATGGATTACAATGTGAGAAGATTACTGTGTCTCGAGTAGAAT
10   P21   AX00003799   GTTTTATACTGTGTATCACGAGTTGAAAAAAACAGGAAAACAAGTATTCACAGTT
10   P23   AX00003800   AGTGCAGGGAAATGCGATGGAGTGATCTTAGCAGTCAAAAAGCGAAAAGATTCC
11   A01   EMPTY        -
11   A03   AX00003801   ACTAGTAACGCTACCAATAATGTTGTTCTTTTGTATTATGATTGCTTTCGAAACG
11   A05   AX00003802   TCAAAGGTACTCAATACACCGGCATTTGGTGATGTTACGTGGGCGTGGGTATTT
11   A07   AX00003803   TGGATAGCGGGTATTTGTGCAGGAACATCTTTACTACATGCAGCAGGGGTGCTG
11   A09   AX00003804   TTGCTGGAATACTTCTCACCACGCACTCAGCAACCTTTGTTATTTACTGCAACTC
11   A11   AX00003805   ACAAAGCAAAATCTGCTCATTTCTATATTGAAGAAAGCGGCACAGAGGGAACGA
11   A13   AX00003806   AATGAAAGCTGGCTCGGCCTTTGGGAAGGCACAGAATACAAAGTGAATTATCAT
11   A15   AX00003807   TATGTGCGTCAAATGGTGAATTACGGATCGGCTGGAGCAAGTCAGGGCTATTCA
11   A17   AX00003808   GCTGGGGAAAATGGAGCTGTACAAGGAAGTAGTATTGCATTTTCGATTAGTAAC
11   A19   AX00003809   GAGTTTCGTAATTTAGAAGAACTGCTACATGCTTTTAAACTACAAGAAGGAGATG
11   A21   AX00003810   TTTACCTCCGCAAAAAGAAAAAGGGCTAGAAGTACAATCAAAAAGTGAAGATTCT
11   A23   AX00003811   ACTGGTACCGATTCAATAGGGAAATCTAATAGTGGCGCTGAGAAAGTTTCATTG
11   C01   AX00003812   TAACTTTGTTGAGGCTAGAAATTTTGCTGCTTCAAAGGTGAGTGGAACATGGAT
11   C03   AX00003813   TCGTGTAATACTCTTGAAGTCGAATATAATTACAGCATCTTATGTTGAAAATGAG
11   C05   AX00003814   ATTGGAAAGCCGACAACTAGGATTAGAGGAATGTGTAACGTTTTCAGATTATACA
11   C07   AX00003815   ATCAATTAGAAAGTCCACGTACGGCGAAGAAATATGATACGCAAGTATCACTGG
11   C09   AX00003816   GCGATGGATGGTGCCGGGAAGTTCATTAAAGGGGACGTTATTTTCGGCATTGTC
11   C11   AX00003817   AGAACAAATTGTGAAGGCGAACGGAATTCAATCGGTACTGCACAATTTAGAAAA
11   C13   AX00003818   AATGGCGTGGCAGTTTCACGGTAAGAAAAAAACGGTTGGTTTTATTACGACAGA
11   C15   AX00003819   TGCATTAATTGATGGATTGGCATTGCAAGCCTTATTCAATCCATCTTTTTCTAGC
11   C17   AX00003820   AGAATACACTTCAAATAGATTTTTTCTACAATTGACGTTTCTTGAATTAGCAACAG
11   C19   AX00003821   AATTGAAAATTGGAAACAGAACGTCTTACATAAAGAAGCGAAAAAAAGAGGTCG
11   C21   AX00003822   CCAACATTGCGGTTTCAATGGGGGTATAGTGGGCACGTATTAGGATCGGTTTGG
11   C23   AX00003823   AAAGGACATATGCGAGAACCACATTGGCATCCGAATGCGTGGGAATTGGATGTT
11   E01   AX00003824   GATACTGATGGTGGAGCGCATCCTGACTGGTTAGAAGATGCTAGAGCGAGAGA
11   E03   AX00003825   ACTTGAAATACATTCCTATGTTAAAAGCAATTTGTAATCAAGATATGGGAATAAAA
11   E05   AX00003826   GCTTTATTGCTGCCCTTCCTCTCGTAAGTTTACTGAGCCTATTTTGGATTTCTTT
11   E07   AX00003827   TGGGGGATTAGCTACAAAATGTTTTGCTGTAGATACTTGGACAGGAGATGGGCA
11   E09   AX00003828   CCACAAGTAGGATTTAAAGCACCAGACATAACATTAAAAGGATTAGATGGGAAG
11   E11   AX00003829   CTATGGATTACTATGCGGTTGTAATGACGACGATGATTGCACTATATGCTGCGA
11   E13   AX00003830   AAAAACTCAGCATCGGCAAATACGATGCAAAATCTGGTCATTGTACCAACATGTT
11   E15   AX00003831   CCAGTAGCGACGAAAAGCGGTGGGGCTCTTCTTGGGATTCAGTTAAAACTTGCG
11   E17   AX00003832   GAATGTTTTTCCCTGAGCGGGGGAAGAAAGTGCCATTTACAATACATAATACCG
11   E19   AX00003833   TTCAGCGGAAAAACGAAGTATTGTTAATACAGCGCCCTGATCATCTTGGCTTCC
11   E21   AX00003834   CACGTGAAGAGAACGGAAATCCAGGAAGTAACAAAAATGAATCTCTTGCGAATC
11   E23   AX00003835   GGCACTCGAAGCGATTAATGATTTAACGTCAAAAGGGGTTATTGCAGGTTACGA
11   G01   AX00003836   ACTCAAATGAGTAATCAAGGCATACGACTAATTGGACCGGCTCTTGGAGGCTTG
11   G03   AX00003837   AAAAATTTCACAGTCTATATCGCTACCTATAGAGAAAATAGGCTAGCTTATAACC
11   G05   AX00003838   TTTCCATTAGACCCTAATAGCCATAATTTCAAAGTCATCATTACTTGGGAAGAAA
11   G07   AX00003839   TACATCTGGTGATACCGCATTCCGTGCGGCACGTTCTATCATTGCGGACTATTT
11   G09   AX00003840   GAGATTAGATGAGGCAGAGATAGAGAGAAATACTTTAAGTCATATTGCTAAGGG
11   G11   AX00003841   TTTATGGTCAATGCCGCCAGAGGATGACGATCGTAAGGGACCTATTCATCGTAT
11   G13   AX00003842   CGATATGCAATCCCAATTGTATTTGTCGGCATCGCAATTCCACTCTACACGTTAG
11   G15   AX00003843   ACTTATCAAGTGAAGCTGGATCAAATCAACAGACAAATCAGTGTATTGGACGTTG
11   G17   AX00003844   TGCAAGCCCCCTGGTGATCATTTGTGTTCTGGACTATAATGTCGTCCATGAAGT
11   G19   AX00003845   ACAAAATCTTTTAGTTTTGGACAGACGTTAGTAATTTCAATTGCAATCGGAATCA
11   G21   AX00003846   AGTATGACGAAAGGCGCTATTAATACAATGACTTTCACACTAGCAAAACAGCTCG
11   G23   AX00003847   GGTCATAGTATGGGATCTTTCCTATCAAGACGAGCTGTGCAACTTAGAGGCGAA
11   I01   AX00003848   TTTTTGGAACAGTTTTACCTAATGCATTAGATCCAAATGAATCATTAGCAGGGAA
11   I03   AX00003849   AATAGCAGCTATGGCAATTGCTTTATGGGCGTATCGTGAGTCAGGGTGGTTAAG
11   I05   AX00003850   GGCATTGTAGGTACACTTGCTCCTTGCCAATTAACAGGAAACATTAGTGCTATTA
11   I07   AX00003851   CATTCCTTTTCCGTACATCCGGATCAATCTAGTGTAGTGGCGGTAAGTACTAAAG
11   I09   AX00003852   TCAGCGAAGACGAATGTAAGCATGAGTCGTAGTAAAACTGTAATCGCTAATGTA
11   I11   AX00003853   GGGTTTTCATTAGGTGCTCAAGTGTTAATTACGATGCTTAGCATGAAACCCAACT
11   I13   AX00003854   TCTCCCTATGATGACAGTGCATATAGAATGTCTATTCATAGTGATGATCCTGTAT
11   I15   AX00003855   GTTGGGGAGTTACTAATAAGAGGACCGAATGTAATGAAAGAGTATTGGAACCGG
11   I17   AX00003856   GAGTGGGGATTTTAACCCAATCCATATTGATCATGAGTATGCGAAACAAACTAG
11   I19   AX00003857   ATGTTCGTATCCCAGCTGGTGGATCAAAGCAGGTTGCGAGCTATGATACAGTTG
11   I21   AX00003858   ACACATTTAATTTCAAGGAAAGGAATAGGGTATGTACCAGAAAATCAAGGTATCT
11   I23   AX00003859   CAGGGAAGAACGATAAAACAGAAAAGTGATCTGTATCAATCGATATCCTCGAAG
11   K01   AX00003860   ATGTACAGTGTCGGTATTAATCAGTCTTGGTAATACAGAACAATTACCATTTCAT
11   K03   AX00003861   TTGCAATTCCTGACTATACGTACAACTGGTAAGTTAAGAGAACGTGCACGTATTG
11   K05   AX00003862   TGGCATTTTAGGAAGACATACTGAATCATTTGAGCATCTTAATTTAAATTGGTCA
11   K07   AX00003863   AACAATCCTACCGGTTCTTTACATGATGGGCTCAACAGAGCTGAAACGGGTAGT
11   K09   AX00003864   AACTTTATCTCACCATTTCAAAGTATTACGTGAATCTGGTGTTATGTATACACGC
11   K11   AX00003865   CATATTTCAACTGAGTTGTCAGGATGGATGGTGAGTTCATATGCTTTAGGATATG
11   K13   AX00003866   TAGAAATATGGGAAGACGCACTGTATTTAGGGGAATCGGGGAGAACGATTCGC
11   K15   AX00003867   ATTAGACGAAGAGGAAGAAGGGATTCAATTCGTTTTAGAACGTATGCCTAGTCG
11   K17   AX00003868   GAAGATCGCCTCATATGCGGAATGAAACTAGGTCCTTACTTAGATCGTATATTAA
11   K19   AX00003869   TTACCACAGTCTTCGCAAATTCAGTTTTCAGATGGGTTTGTTTGGGATGATATAC
11   K21   AX00003870   AGCTATGCAACAAGCTTAATAGTTTGCATCTATCTAAAAAAGAGCGTGAACAAAT
11   K23   AX00003871   TCAACGGGTGCTAAAGGGGCAATCGGTAACACTGAGCCTTATTGGCATACCGG
11   M01   AX00003872   AATTGGAATATCTATGGCAATATTCGGTGCATTAGATCATAACCACAAAATGTTT
11   M03   AX00003873   CTTTGTGGAGAACCTTGTGGTTGTGAGTGCAATGAATATGAATTAATTTGTAGTT
11   M05   AX00003874   AATCATGGGGGAGCACCAACTTATACCCATGGTGAGGGCTGGTCTCCGAGTTA
11   M07   AX00003875   TGGAAGTATTCCTGACCTTGTAAAGAAAGGTATTGTAGATCGAGAAGGAAATGG
11   M09   AX00003876   ATATGCGGGAAGTTCTTTAGACGAAGTCAGTTCTTATACTGGTCCATTCGGATC
11   M11   AX00003877   AGGGGAGCATATCTACACCGCCCATTCCTAGAATGGATTGCTTCATTAGCCATT
11   M13   AX00003878   AATGAGCTCGATGAATATTTTAAGGGGAATAGAAAAGAGTTCACAGTCCCGTTG
11   M15   AX00003879   CCAATAACATTGGTTGTCGCATGGATACACGCAAGTGCAAAAGATGCGTTATCA
11   M17   AX00003880   AATAATTGGACTTGTTCAGATGGTTGTACTTATCCCAGTTTCCGTTGCGACTGCT
11   M19   AX00003881   TACTCGTTGCATCAACGGAACCATAGACGCATTGTTACGATAGATGGAAAAGTA
11   M21   AX00003882   TATGACAAGTAGCGGGTTGATTGCCTTATTTCTATGTGTTCTAATGGGGCCATG
11   M23   AX00003883   AACGGAATAGCCGCGGATAATGGACGTGTAATGCAAGCGCTTAGCGAGACGTT
11   O01   AX00003884   AAACTCGTTTTACAATATGCACCACCACATTCTCATATTTCAGATCTTTGCTGTG
11   O03   AX00003885   GTTGCATATGTCACTCCATCTCACCAATTCCCACTCGGAATCATTATGCCGTTAT
11   O05   AX00003886   AATGAGAAACATGTTTTTGTGTATGACCTTGTAACCGCGGAAGCTCATAGATCAA
11   O07   AX00003887   GACAAGCTGTGTTTTGGGAAAAGGGTGAATTTCATGAAACGAGTACAGAAAAGG
11   O09   AX00003888   TCGCGAGTTTTATGGTGCCAGCAGACAATAAAACAAGATTAATAAATGTACTCGT
11   O11   AX00003889   GGTGGTTTTTCCCATTTAATTTATGGCAGAAACTATTTTTCAGTATTGGTATGATT
11   O13   AX00003890   GCTGGAATATGTTTTGTCATTATTACATATTACTTTAGCAGTAAAGGCGGATTTT
11   O15   AX00003891   TTATTATAGAGAACTCGCAGACCTTGGTGTAGAACTGTATCTACCATCAACGTCC
11   O17   AX00003892   ACTGAGTCCCCTCTATTCGAATCAGTCGTCACATTTACTGCCTCTATTGTCAGGG
11   O19   AX00003893   TAGTAAATGGCAACATTTGCGGTTTAGAAATTCAGAACGACACAACTACTATATT
11   O21   AX00003894   CAGAACCGGCATCATATGAAAACTATGTACCAAAAGATTGGAGTGGTACATATG
11   O23   AX00003895   AATGGAATCAAAGCGCCACATGGTAGAAGTCAAACTTGCAGAAGTCTGTCAAAT
11   A02   EMPTY        -
11   A04   AX00003896   AGGTGACAATCGGTTAATTAATGAGCAAACTAAATCTCTTTTTTTAAATTTGCACC
11   A06   AX00003897   TTTATGTTTCTTCACAAATACAGTTAAATGATGGCGGTCTTGTAGGGTTTCTTAT
11   A08   AX00003898   TTGGAAATAGGAGTAAACATCCATACAAATAAGCTATTTTATAAAATTCCTATTAG
11   A10   AX00003899   CAAACACAACCTGCTTCAGGAAATACTAGTAGTGCATATTACAAAAATTGTGCCG
11   A12   AX00003900   GGGAGACTCTTTTTCTCTAAGGGTGGTAAATTTGAAGCAGCTAAACTGAACATC
11   A14   AX00003901   ACTAGATGATGCTTTAACGTATCCATCGGGAGAAGTTATTACTTCAGCTATTGAA
11   A16   AX00003902   AAATGTAACGGTTCAAGATATTACTACTGCATGTGGGATAGCGAAGGGCACTTT
11   A18   AX00003903   AGATGGTGCGACGATTTACGCAACGCGTGACTTAACGGCAGCTCTATATCGTCA
11   A20   AX00003904   GATTTATTGGGTGGTGTGAAAACAATAGACGAGGTAGCAAGACTGCGCCCACTA
11   A22   AX00003905   AAGAAGTGAGTGCATTTCGATTGCCAGAAAAAACACCATGGTTACTTCGCGATG
11   A24   AX00003906   GATGTGTGGGATGGACAATATGTAATGCTATATAAAAAAGGATCGATTATCCCTT
11   C02   AX00003907   AAAAAGCAGTGGGATTGGATGAGGTGGCTTCCTCACGTATGGGATGAACAGAG
11   C04   AX00003908   GCGATATTAATAGTTTAGAAGGACAATGGGCTGGGGCAACACAAGCGAAGTTCC
11   C06   AX00003909   CAAAATTATTTAAGCAGGCATGGAGTAGTAACTCTTTCGCAGAATGCCCGAGCT
11   C08   AX00003910   ATTAGGAATTGTGTATTACGAAGCGGGCCAATTTTATGAAACGCGAGATGGCGC
11   C10   AX00003911   AGTAACGTATAAACCTGATGAAGTATCGGTGGAAAAGAAAGATCCACAAATCAAA
11   C12   AX00003912   GTGGATCCGAAGCCACCAGAACCAACACACCCAACAATTACAGTATCACCAAAA
11   C14   AX00003913   ACTTATCATTCTATGGAACTAGGATATCCGGAAGCAGATGCAAAAGAATGGATG
11   C16   AX00003914   TTTTATGAGATATTACAGAAATCAAATTTGTACGTTGTTGCTTCGGTAGAGGGAG
11   C18   AX00003915   AGGGTGTAAACTTTGTAGCCTCCACAGCAAAAGGATTTGCCGACAAAATCGGAA
11   C20   AX00003916   AGATTGCAATTGGACATGATAAAGTTTTTATTGGGCTTATTGAAGGTATAACAAG
11   C22   AX00003917   TGAGCTACGACACTTTTGTAAGCATTGGTCACTTACTCAATTGGCAGAAAGACTG
11   C24   AX00003918   GTTTTTCTCAGAGTTAGATGGAAAAACAGCATTAGCGTTTTGGCAGCAATATCCG
11   E02   AX00003919   TAAGACGATTTCCAAATGCCAACAAATTAGCACGATTTGCGGGGATTGCGCCTG
11   E04   AX00003920   GATTAAGTGAAGCAGCCAATAAATCTAAGGGGTCTAAATCTTATTCTGATTGGAC
11   E06   AX00003921   AACGTAGACAAGAGAGTTGAGAGTATTTTATCGATATGGAAAGAGCAAGTAGGA
11   E08   AX00003922   ATACCTTTAGATGATAAGCATGTGTTAGTTGAATTAGATTCTCCAGCTGTTGAGT
11   E10   AX00003923   AAACGGGGGATTTTACTCAAAAACCACTATTCGTTCAATTAATGAATCAGACTAA
11   E12   AX00003924   TTATTATCAATTTGGACTGGTAAAAGAGTACCTGCGGATTACAACACTATTATTA
11   E14   AX00003925   TTGGTTTAATCAATTATGCGGTGAGCATGGAGTAGCTAGAGTGTTTGGTCCGCA
11   E16   AX00003926   CTCACACTACGAGAGCAGTAATTTTTATTCCACCACTACTATACTTTGCAAGTAG
11   E18   AX00003927   CTGCTCGTGATTCAGTTGTTGACAAGGTTAGTGGTTTAGATCAAGGAGCAAGTG
11   E20   AX00003928   GTAGTGCTGATTGGAGTTTGGAGACTAACGAATCAGATTTAGTCCGATTATGTC
11   E22   AX00003929   CATACAATAACAGGAGAAATTATATCAACTACATCAGTAAATAACACTATTCAGCA
11   E24   AX00003930   ATTGATGTAGAACGTATGGACGATAAGGGTGTATATGAAATAGAGGTAGAAACA
11   G02   AX00003931   ATTGCATCAATCGGCGTTTTATATGGCTATGGTAGTGAAACAGAATTGACTGAAG
11   G04   AX00003932   TTTGATACCTCTGGGTTACCAAAAGAACTTCAATCATTAAAAATACACGGACGAA
11   G06   AX00003933   GTTCAAGGGGAGACTGCGGTTTTATCTCAGTTAATTATTCACTTTGATTATCAAA
11   G08   AX00003934   AATTTCAAGAAGATGGGAATGTATATTTGCAAATATCAAGAGGCGCCCAAGCAC
11   G10   AX00003935   TGATAGAGGAAGAGGTTGAAGATGTGAATCGGTGTATTCGTATCGTCTTGATGA
11   G12   AX00003936   TGAACAAGGACAAATACTACTACAACAAAGGCAGAATGGTATTTGGGGTGTCCC
11   G14   AX00003937   TGGTTTGGATTCCGATTTCGCCATCGTATCAAGAACCACATGATTTACTTGGTTA
11   G16   AX00003938   GCTGACGATTTTAGGGCAAATGTCAGCTAGTTTTGTACACGAATTTCGTAATCCG
11   G18   AX00003939   AGAATTACCGTATCGACTACGTAAGCAAGTTCCATTCGCGCAAGAATTTGAGTTT
11   G20   AX00003940   CTGATATTCGTTTCCACGATCTACGGCATACCCATGCAACATTAATGTTAAAACA
11   G22   AX00003941   AAGCATCAGATAGGTTCTTTTTTAATAGATTTATGGACCCATTTTCGGTTTCTGA
11   G24   AX00003942   AGACGTGGGAAAACATGGGGAATGCCGCCCTGCACCCTATTGATACCCTTAGTA
11   I02   AX00003943   TGATATATGCCTACTTGAAACCAGCAGATGAACATAATGCACCAAATCCTTTCAC
11   I04   AX00003944   TCACGCAAAATTAATTATGACTGATCACATCGCCTATATTGGTTCACAGAATTTT
11   I06   AX00003945   TTATTGATGGTGATGCAGTTGGAGGATATTTCGTTACACTGAGTAATTTCAATAA
11   I08   AX00003946   GGTATTACAGACCAAACACTTAGCTTAATAGCAAGAGGAAAAAGTGAACCAACA
11   I10   AX00003947   TATAAAGGCTATTACCGTTTATCGAACGATATTATGGATGATTTATATGAAGATG
11   I12   AX00003948   AAAATGCTGGAAGAGTGCCAATACATGCTAAGTCACATCGCACGTGTTGGAGGG
11   I14   AX00003949   GGAAAGAATACGTGTATTATCTCAATAAAGAAGGGCACGCGATGTTTGGTGATG
11   I16   AX00003950   TTGATCCAGGTAAATCACATTGGTTATCCGATAATTTAATCGTCCGCTCATCACC
11   I18   AX00003951   GTTATTTGTATCATCAGGACAGATTGGGATAAATCAGAATGGCCAATTCCCAAAG
11   I20   AX00003952   TTATGTGGTCACAAGTTCCAGTAATGCTTGCGATGTATTTTCTTCAAGGTGCGG
11   I22   AX00003953   ATTATAGGAAACTTATTGCAAGCTATAGGGAATTCCTTGCAGGCAATTGGAGGA
11   I24   AX00003954   AAACTAGCGTATTACAAGAGAACGTACAATGAAGATCTAGAACATAAATGGAATC
11   K02   AX00003955   AATGCAAATGCAGCAACAAGGTATCCAGCCGTATTATTCATCTATGGAGTATTTT
11   K04   AX00003956   GGTCCTTATAACGAGGTAATTACAAATGTTTCTATAATTAATCAACTTTCCACACC
11   K06   AX00003957   GAAGATGGGTACATACTTACAAGCTATATGACAGTTGTACATATAAACCCGCTAA
11   K08   AX00003958   ACCATTTCAAGCAATAATTAACTTCATATTAACATTAATATTTTGGGTTCCGGGGG
11   K10   AX00003959   GCATTGCAAGCCGCGATGCTTTCAATTGTTGACCCGAGTAAAAGAGGAGTTGCT
11   K12   AX00003960   ATAAAGCATGGTGAATCTATACGGTTTAATGTAAGATACGGAGGAGATAGCTCC
11   K14   AX00003961   CAGTACATCCCGAAAGAAGCGAAGAACTTCTTTGATAAAAACGGAACATTTCTTT
11   K16   AX00003962   GATACATACACTCCGCGGAATTATGTTGGGAAATATGGTGGAACATCAAGACTC
11   K18   AX00003963   AAGCGATTCCGTTTGCATTTATGGTGGGGCACGGATTCCAGCATTTCCTTACGA
11   K20   AX00003964   AAGGGGATTCAAGAGAAGAAGGTGACTCTGGTTGGTCAATATTAAGTGGTTATG
11   K22   AX00003965   AAGAGTACGAAGGGGATCTGATTGTTGTGTACAACGTACCTGGTGCTGAGTTGT
11   K24   AX00003966   GAAACGATTGTGGAAATGGTTAGACTACAAGAATATCCTAATTATCCGTCAAGAT
11   M02   AX00003967   ATATACTGAAATAGAAGATTTCAGTCATACGGATGGGGTTGTATTAGAGATGTCT
11   M04   AX00003968   GAAGCGCTTATGAAAAAAGAGTTTCCGAATAATGCGGGGAATCCTTTGTTAGTA
11   M06   AX00003969   CTAGTGTTCATGGTCTTTTAACGAAAGAAAATATTCCGCCTAATATATTTCCGAT
11   M08   AX00003970   TTGAAAGAGGACATGCGAATCCCTCGTTAAGTGTATTGGAATTAATAGCGAAAG
11   M10   AX00003971   GCTTGAATCGTGGCAAGTTAAAGATTGGTACCCTTTCGATGAAACTGGTGATGT
11   M12   AX00003972   CAGCATTTTAATCATCGCTACTCTTTCTCTTTCATATGGAATGTATCATGCAGCA
11   M14   AX00003973   GGAATTGTGGGTTCTTTAGTTGCTTTTTTAATACAAGGTGCAACAGAAGAAATTG
11   M16   AX00003974   TTCTCTAACCATTCATTCTAATGATTGTTCATACGTAGAAGTTTTTCCAATTGATA
11   M18   AX00003975   CTGATGAATGCAGGGGAGTCATTACAGATGATGGCACATTGTGTCAAATTATGC
11   M20   AX00003976   ATTCGGACCGTCAAAAAAATAACTGTTTTGTTGAGACTCATACAATTGGTGGTTC
11   M22   AX00003977   AGACAACGTAATTAAAATAACATGTGTTTGTGTGGGGATAGCAATTATCTACGCT
11   M24   AX00003978   TCTAAAGATAAGCATCATTGTGATGACGATTGGTGGAAATCTAAAGATAAGCACA
11   O02   AX00003979   AACTTCAATTTGTTTCTTTTCACTTGCAATTTTTAATTTGTTCGCATATTGGTTTC
11   O04   AX00003980   AAAAGTTTCTTTTTGGGGAGCTTCGCAATCCTAACATGCTTTATTTTATTATTAAC
11   O06   AX00003981   ATCGGAAAGAACACATTATGGATCGCCAAGTTAAGGATGCAGTTGTTGCTAAAT
11   O08   AX00003982   TTTGGAGTAGCTTTCGGGTTTTTCATCCTCACTTCCTTATGTAGCTTCTTTAATAT
11   O10   AX00003983   AAAAGGTTTCCCAATTAACAGGTGTGAGTAAAACGATGATTGGACAAATTGAACG
11   O12   AX00003984   GTTAATACGACAACTGCACTACTTGCTGGTACAAGGCTGCTATTAAACTCTTCGA
11   O14   AX00003985   CCATTGACACCTGTTCAAATTCAGATGCAAATATTTATCGCACCTGCTGCAAGTA
11   O16   AX00003986   AACGATTGGTGGCACAGGCGCGATTTGTCTAGGGAGAAAAGGAGAAGTATACG
11   O18   AX00003987   AAAGGGGCTCGTATTAACAAATGGGGAATTTGGTAATAGATTAGTCGGGCATGC
11   O20   AX00003988   ATGAAGTGTAAGGAACATATACTTACCCCTACAAAATTCCCATTCGAAATTCACG
11   O22   AX00003989   AACGATATGAAAACATCTTTTGCAAACAAAGAATTGGCCGATTTGGTGAAAGGAA
11   O24   AX00003990   TGAACTATTACTATCTTCAGCGCAAGTCATATTTGATGAGGGGTTATTCCAATGG
11   B02   EMPTY        -
11   B04   AX00003991   TTTTTCAGCAGAGCAACCTTCTTAGAAACTTGAACCTATTTGATAATATCATCTTG
11   B06   AX00003992   ACACCTAATATTTCAGAAATATGGGGAGCGAAATTTAGCGATATCGGCAAGACG
11   B08   AX00003993   AAAGAAGTACCCAATACAGATTTCTCTCTTTTGAAGGGTGCATTGATTCAAAATT
11   B10   AX00003994   AATACAATTGGTACGCTCCCACCTGCCTCTGCTGAATCGCAACCTACACAAAAA
11   B12   AX00003995   TGCGTTTACTTATCCCATCAAAGAATAATTCCTCATTTCCTAGTAAACATACAGTC
11   B14   AX00003996   TCACGACTCATGTTGTGACAACTGATGATATGAGGGGAGGCTACCTAGCTGGAA
11   B16   AX00003997   TTATTCTTTCCTAGTTTGGGTATCTTACAGTACGCCTCAGCAAATGCTTTCAAGA
11   B18   AX00003998   CCAAGTATAGAATATGTTCGCTCTTCAGGCGGATTGTTTATGGACATGATGATTC
11   B20   AX00003999   TAATTAAACATGGCGGGGATGGTTCAATCGCTTATACGAGAGACGGTCAGTCTC
11   B22   AX00004000   AGCAGCAAATGAAGCGTTCAAATCTTGGTCTAAAACTGCTGTACCAAGACGCGC
11   B24   AX00004001   GGAACAGAGTTTCGCTACCGAAACCAGGAAACACGTAAATTAGACGGAGCAATT
11   D02   AX00004002   AATGATGTAGTCCATATCCCACTCGTTTTACATGGCGGCTCTGGCATTAGTCCA
11   D04   AX00004003   ATTTCTTATCCAGGGCGATGGTCCAGTTATCCACCTCATCACCATGATCAACCG
11   D06   AX00004004   CAAGAACAAATGCTAGAAACATCATCTCAAGTGGAACATAATCCAAACAATAACA
11   D08   AX00004005   TATTATTACGAGTACGATCCAATTTAGGCTGGTTATATAATATTCAAGATTTATAT
11   D10   AX00004006   AAACAACGTGAAAAGAAAAGGACAAGAGCATACGGATCGCTTCTCGGCAAAGCC
11   D12   AX00004007   TTACTTTTGGATTAACACCGGCATTTGCAGATTCTAATAAGGCGTCTGTAAGCAC
11   D14   AX00004008   GCAGATACTCACAGATTCCCAGATGTTCCTGCATGGGCTGACAAATCCGTTACT
11   D16   AX00004009   TTAGGGAATTATGAGTATAGTGGAAAAATCCTTGCTTCGGTAGAATTCAATTACT
11   D18   AX00004010   CAGAGGCTTTAATACGTTGGCAACATCCAGAGCTTGGGCTAATTTCACCTTTTG
11   D20   AX00004011   GATATTCATGGTTGTGAGACAACAGCTGCAGATTCTTCCGTTGTTTACCACACC
11   D22   AX00004012   TTACCTACATATTCAGCCGGTTTATATGAAAAACAAAATACGTCTATGGTAGTAA
11   D24   AX00004013   TTTATCGTACCGACTACTAGTGAAGGGTTAACGATTTCAAGCCCTTACGATAAGA
11   F02   AX00004014   AACAGATCAGTGCGTATTACAACAGGAAGTAATAATTATGCAGGAACTGTTTCTT
11   F04   AX00004015   TAACTGTCCTACTGATATTTGTAAATGGATTGATGATGGAGCCAATTATGATGAA
11   F06   AX00004016   ACATATGATCGAGCGGGAGTAGGGAAAAGTGGCAAGAGTTCCAAGCGACGTAT
11   F08   AX00004017   ATATACATATGGTGAGGTCTTAAGGCACGTAATTGTACATGAAATTCACCATATC
11   F10   AX00004018   CCAGGTCTTTATCCTAGTTTAGGACGCAAAAAAGAAATTTCTTATCCAGATGTAT
11   F12   AX00004019   CCATTTGTTATAGAGGGAAATGGTATTGGAAGTATAAAAGAGAGTTTAGTTGATA
11   F14   AX00004020   AATATAAAAACAATGCGCTGCGGTACATTAGCGGTTCATCCGAATTATCGTGGT
11   F16   AX00004021   ATATAGTAGAAAAATCAGGGGTAGGGAACGCACGTAGGGATTGTTTGAAGTATG
11   F18   AX00004022   AAAGAATACATTCATGTATTAACCGACCATACACCAAAAGATATAGCTGGTTGGC
11   F20   AX00004023   ATTCTAACTAAGTTGAAAATTCAAGAGTGGGTTAATACTTATCAAGAAGTAACAG
11   F22   AX00004024   GAAAAGGACAAATTCAACACATTTATGTTACGTGGCATATTCATCGCAGTTATTA
11   F24   AX00004025   TGGTTTGGCATTCCAAGAAAAAGTGTAGTGTCCTATGATAATACCGGGGCACCG
11   H02   AX00004026   TTGCTTTCGGTGTTGCAATGACTTGCAATATTGCATGGAATACAATTGTAGCCAC
11   H04   AX00004027   CTATCATGTATATTGCCTATTCAAAGATGCTACCTAAACTATCTTCTGAAACGAAT
11   H06   AX00004028   AAAGATGCCTTATTATCTATTCTTTCGTGTGATGCTGCTAAAGGCATATTGAAAC
11   H08   AX00004029   AGTTATGGACTTGATGGATCACTTTGAAGGACAAAACAACTTGCAAGTACTTGAC
11   H10   AX00004030   TAAGATTTTGGATCTTTATGAGTTTGCCTATTATTGTATTATCGGTCGTTCCTGC
11   H12   AX00004031   TATTAAAATAGAAGGAAACGAGATTCCTGTTACATACGATAGTGACACTTGGATA
11   H14   AX00004032   ACATGCTGAGAAACATGGACATAAGCGTTTTGGCAGAACTTATAGTGGTTTTGC
11   H16   AX00004033   GCGAAAAAACGTGCACACCGGCTTGAAGTTACAAAGTCGATCACAAGCGCTCGT
11   H18   AX00004034   CTGTACCTTTCGGAGCCAAAATAGCCAAAACAATTGAGATAGGTATCAAAATTAA
11   H20   AX00004035   ACGTGAGCATAATTACGAAGAATCAGCTCCAGCTGCAACATATGAAATGAAAGA
11   H22   AX00004036   AACAAACTAATATTGTTCATTTTGCATTTCCTAATATTATTGTTCAAGTGGCATCC
11   H24   AX00004037   TGTATATTACCTGCTGTCGCTTTATTGTATATACTTGATGTTACCTTTGAACTACT
11   J02   AX00004038   ATGAGTGGGATAGTCTATCGAAAAGTACGGAATTTTTAAGAGTTTGGACCGACA
11   J04   AX00004039   TTCTGAAATGTTGCGCGAGTTTCCCGAAAAACTCGCGACAAACAATATAGAATTT
11   J06   AX00004040   TGGGAGAGAGTGTATGTGAATGATGGATTATTCCGATCCGTTCTTGGAAATGTT
11   J08   AX00004041   ATAACAAGGGAGATATTACTCTTGTGTACACAAGTCGTTACTTCCAACCTAATAG
11   J10   AX00004042   TAAGAGGATTTGGAAAGAAGAATACACGTACGTGGTTTTATACAAATAAAGCGAA
11   J12   AX00004043   TGTTAACAATAGTAGTGTATGGCACAATGTTTATCATTACAGCATTCGCATCCGC
11   J14   AX00004044   TCTGGATATGTATTAATTTTTGATTGGTTTGATGGTGAATGTCTTCATTCGCATTG
11   J16   AX00004045   TTCGGGGAAGATTGTATTGCTATTGAACATATAGGGAGCACATCTGTAAAAGGG
11   J18   AX00004046   CGTCATATCTTACTTGGGAAGAGTCTGGCGTTTTGGCTTTATCGGCACTGACTG
11   J20   AX00004047   TTGTATACTTGGCAATTAAACAACCAAAGTTAAAGGGAGACGAGTATGGAGCTC
11   J22   AX00004048   CAACTCATTACGTAGTTTAATAGGATCTGGGGCTTCTGTAATTGGTCCAGCGAT
11   J24   AX00004049   CGAAAGAACGTAAACTAAATCGATTGGAAGCATGGACTAGGGACAATTTATGGG
11   L02   AX00004050   TTGTACTGTTTATCGGGATAATTGGCCCTGATGCACTATTTATTTATTCAATTGG
11   L04   AX00004051   AGTTTGGAGAAGCGTTAGCTAGTCTATTTGGTACATCAGAGGAAGGGCAATATG
11   L06   AX00004052   CGAAAGCTATTAATCAATCAAATCATATAAAAAACATTGCACATAGAGGGGCTTC
11   L08   AX00004053   ATAGCCCCGTTCTTTGCGGGACAATTCCTATAAGAATGGATACGCTTCAATCTG
11   L10   AX00004054   TGCTGTTGTAAAAGAAACAACTGATATGTATTGGATAAACGGATTTATTATCGAT
11   L12   AX00004055   AGCGTTTCACTGGATAGATTATAATCGAGACGCTTTACATACTTATAAAATCATG
11   L14   AX00004056   GCGAAGCTTTTTTCGAAGAGAGAGGACACCATGCAATATTCTTTAATTTTTTAGG
11   L16   AX00004057   TTCAAACCGTCATTAACATAGATAGACAAAGAATGTTACAAGGGGTAGATCGATC
11   L18   AX00004058   TAAGTGACTATAATTACGGCGTAGGAGAGATGATACCTAAATTTTTAGTTGAAGT
11   L20   AX00004059   TTGTAGGGATGGAAACTGGTGTGAAATTAGTAGCAAAGAAACCACAATTTGGAC
11   L22   AX00004060   GGTGGCGCAGCGGCGAGTAAGGAATATGCATCTCATAAAGATAGTATATACTGT
11   L24   AX00004061   CAAATAGGAGGGAGGTACTATCCAACGTGTATGATTATAACAGCTTGTGAAGGA
11   N02   AX00004062   GGTCCTATACGTATGAGGATCATATTAGTTCTATCGTTAAAGAGGCAGAAAAGAA
11   N04   AX00004063   GTTTATGTAGTCGGTAGTTTTCCTGGTTGGGATCTGTCTGTAAATCAATTACAAC
11   N06   AX00004064   ACAGAAGATGATTGTATAAGTGCTGATTTAAATTACTATTGGATGCATACAGCAG
11   N08   AX00004065   TAAATTTTGGATCAGTCCAATGTTTATTCATCCAATCTATCAAGGGATAGGAATT
11   N10   AX00004066   ATTTATTAGCCCTTTTGCGACGTTACCAATTTTTTTGGCTATTTGCTACTCTAATC
11   N12   AX00004067   TACATCTGAAGAAGGCGTTTCTAGTAGTGGTTATGATGAACGAGGATTGCTTGG
11   N14   AX00004068   ATCGTAATACAGCTATTGGAAAAGCCGCTTTTCTTTTAGCAATCATTATTGGAAT
11   N16   AX00004069   AGAAATCTATTTTCAATAAGGGCCCAATTGCAGTCAAATTGACGGACTCTGGCC
11   N18   AX00004070   ATTTATCCGATCTGGGATACCCCTGTTAGCAACCAAGCTAAAAAGAGCCAAATG
11   N20   AX00004071   TTCATCGTGTTGATTCTTTGACATTAGATCCGCATAAATGGCTTTTTCAGCCTTA
11   N22   AX00004072   AATTATACGTGGCAGATGCACGTATATCTGTTCATTATAGAGTTGAAAAAGCCGA
11   N24   AX00004073   AGCGCAAGAGGTGTTTTTGCAACTGTATCATTCAGATTGGAAAGCAATAGAAAA
11   P02   AX00004074   AAGCACAGGTTCATCACATGAAAAATAATCAACGTACTTCCGGACAAGAGGAAT
11   P04   AX00004075   ATAATAATTAGCTACCTTATCAATCATATTACATGGGGAGATCCCCACGGTGTAT
11   P06   AX00004076   TTCGGGATGTACAGAGGAGCTATTTGTTAAAACGGCAAATATTATGGAGGAATG
11   P08   AX00004077   CAGCGTGTGAACAGAAGAAAGAAGTAAAAAAGCAAACAGCGACTTCTTCTACTG
11   P10   AX00004078   AAATGAATTATAACTCAGGCTCTTCGCATTTACTTAGTTACATTATCCAAAAAGCT
11   P12   AX00004079   CAGAAAGAGTTTTATTAGCGACGGGTATGCAGGAAGAATTCCCATCTATCCCTA
11   P14   AX00004080   TTTAAACTTCTCAGAAACAGTAGAAGAATGGGAAGAGATGTTGCGAGAGAGTGA
11   P16   AX00004081   CGCTAAAATGGCTTATGTCATGTTCACTTATTTAGGGATATCATGGACTTTAAGA
11   P18   AX00004082   TGATGTCCAAGAGCTAGCTGTTGTAAATGAGCATATTTTCGAGTGGAACAACGA
11   P20   AX00004083   AATTCAAGCTGTCCCGACATCAAAGGAAACGGAAGCATTGGCACAGCAGCTAAA
11   P22   AX00004084   AGAGTATTCGATTTATGCTATTGCTGTACGAGTATTTTGAGTGAGTTATATAGTG
11   P24   AX00004085   AGTTTGCTTTCGCGTTACCTGAGTTATTAAATGATTATTTAGGTGATGCTTTATG
11   B01   EMPTY        -
11   B03   AX00004086   ATAGGGTCGTTAAATTTTACAGACGGAATGCGAGCTAGGAAGAAATGGCTTAAA
11   B05   AX00004087   TTCGAGCGTACCTAGAAGATGTTGTTGTGCATGAAAGTGTAAGAAATAAAGGCA
11   B07   AX00004088   AAGAGTATTAGAACCAAGTTTCCGTCCAGGTCTTCCTAAGCCTAAAGGAGAGTT
11   B09   AX00004089   AATCCAAACTCCCTTCCACTGCAAAAGAGGGTGATGTTCTTATAATAGAGGATG
11   B11   AX00004090   ACAATGGATGACATGATAGCCGGTACACAAGCTTTTATTGATGAATTACGCCGA
11   B13   AX00004091   TCATCTGCATATAGATTTTTTATGGGTTGATGAATCAGTTCGTCATGATGGTTAT
11   B15   AX00004092   ATAGAAGAGAGATTTATCCACTGTTCATTTTTAGAACAAGCTTTAAACGTTGCTC
11   B17   AX00004093   TTGATTGGCGGGCACCTGTCGCAAGTATGTTTTATTCATTTACCGGCGGTGATG
11   B19   AX00004094   ATGAGATTAGTAATTTATGTGCAGAGGCTCGTTTCAGTATAGTTGGGATTTTCCC
11   B21   AX00004095   CACAAGATTGCATAGGTGAACCATTGACATATGTGAACGCAAACAATGGATATAT
11   B23   AX00004096   ACGGACCGATGGAGGCAAAGGATGTATATATTAGCCCATTCGGAAAAGCATGTC
11   D01   AX00004097   GAAAGCGACACATTACGAAAATATAGCGGCCTCATTTTAGATGTATATGATGCTA
11   D03   AX00004098   CATCATCCCAAGGCTATAATCATATTGGCTGGAAATTGTTTGTTGGACAAGCGTA
11   D05   AX00004099   ATGCAGGAAAGATATCTGCGCGAAGAGGTGGCTGAACTTTATTCCCTCAGTCTT
11   D07   AX00004100   AGTTATGGAATCTTATTTAGTTGGTGCGACGGGATGGGTTTCAGTAGCAGGAAA
11   D09   AX00004101   AAATGTCATTCCTACGTTTCACTACGTTAACAGCACTCGCAATCATCCCTTGGTC
11   D11   AX00004102   ATTACAGCGAGTACCTGATGATATATGGTTTCAGGCATTAAGAGAAGGTTCATG
11   D13   AX00004103   GTTCATCTGAATTTTTACGAATGGATGCATATCATCCATCTAATTACTTCAAGGTG
11   D15   AX00004104   AACTAATATCACATTGGGAACAGTATGATTTCGGGGTATGGTTGTTAGTTAATAG
11   D17   AX00004105   TAAGAAAAAACTAAGGCGATTTATATTCATGTTTATATTTATTGCGGCGGCTACT
11   D19   AX00004106   ATTGTAGCAGTCGCTCACCCACACCCTCATGAAGATATAGAAAAATGTTGGGTT
11   D21   AX00004107   TTCATTCTTGCTGCCCCCATTGTTTTCTTCGCCACTTTGCACATAATTGGCGAAA
11   D23   AX00004108   AATAAGATTGGCCGATTAAGGAGATTTTATATTGCGAAGGACTATCGTCGTATAG
11   F01   AX00004109   GCAATTGGACATGTTGCCTACATAAATGAAGTACCGTTTCTCGTAATACGATGTA
11   F03   AX00004110   AAAAGGGATGGGTGCACCGCGATCTATGGGTAGATAATCTCTTATTCCATAACG
11   F05   AX00004111   TAAAAAGTGAAGTGCAGCAAGTCATACAGCAAAGTGAAGTGGAAATTACCGATA
11   F07   AX00004112   ACAGTGTTCTATCGTAAAGGAAGATGAAGCACGAAACCTCATTGGAACAGGCCC
11   F09   AX00004113   AACCACGTTAAAAACTTGTTTGAACTAGCGAAAGAAGGAAAAGTACCTAATGTTC
11   F11   AX00004114   AAGAGTGGTTTCGGTTATCTGGTGGGCAGTATTTTGGATACAACCGACTCGGTT
11   F13   AX00004115   TATTATCGCTGGTATTATTGGTTCTTGGATTGGTGGGAAATTACTTGGTAGTTTC
11   F15   AX00004116   CAGCAAGACCGATGACAGCTGAAGAACCTTTATTCTTTCCTGAAATTCATGGGG
11   F17   AX00004117   GGTATTCAGCCAATAAATAAAACGGATGCAACGACTTTTACAATTCCCAACTCCC
11   F19   AX00004118   TATATACGGTTCTTGGGAAGTCGTTGACAACAAAAACGGTCTTTGTCCTATATCG
11   F21   AX00004119   AATAGCTTACATACCAGTTACACTACCAATTCTAATATCTTCCTTTCTATTTGCTA
11   F23   AX00004120   CTTATTCAACTTGATATTTTCCCTACGGTCGTCTCGTTCGGTGTCACTAGGTTGC
11   H01   AX00004121   AGGGGATTGCTGTTATATGGAAAGAACTTTCTAATGAAGATTATTACTCTCTTGA
11   H03   AX00004122   AATGACTGCACATCGTGCGAGTTTAACAATCCCAAAAGGAAGTTACACCATTGC
11   H05   AX00004123   ATTCATCAGGAGCTAGATGGATTCCTATCGAAAGCATTACAGAACGCAATTCATC
11   H07   AX00004124   TATTATATGCTCTTCCGATTGTACCAGCTGCTCCGAAAGAAGTTGTCCTTGGATC
11   H09   AX00004125   GAACAGGCGATTGCAAACGGTCTTGAAGGTGAGTCGCTTTGCGGCGCATATAT
11   H11   AX00004126   GATTGCAAATTCACCACATTCTTTATATTCGCGCGGAGCAATGCACTACGTAATT
11   H13   AX00004127   AGCACAAGAAGATCCAACGATGGTACATTACTCAAATAATAGTATTAGCGAAGGT
11   H15   AX00004128   GACTATACGATTGACACATGGGACGGTCCGTATACTGGTAAACTATTAATTGGT
11   H17   AX00004129   GAACTGGTGGTAGTGGTGGTGGAGGGTATTACGGCGGAACTAACAGTAACAAT
11   H19   AX00004130   GCAGTTGTCGATTTGCATTGGGTATACCGCTTAAAAGGAGAACCCGTTCCACTG
11   H21   AX00004131   AAGAGGCGATTCGTCAAGAAAATCCGATTAAGCGAGTGGAAAGTAATTTAACAG
11   H23   AX00004132   ATTGGGAATCGCGATTGGTAATAAAGAATACTGGGGTAAAGGGGATGGAATAGC
11   J01   AX00004133   TGGTTGTAACCCAGCTCCAAAAGATGAAAAGGAGCCAGATCCAACGGAGGAAC
11   J03   AX00004134   GAATTGATAACGTTCTCGCTGTTGCTGGAGCTGCGCATGGCAATTTTTCTTTAG
11   J05   AX00004135   AAAAACCGACTTTCCAGTCAACGCAAATATTCGTGAACAGTTTAGCCATACATAC
11   J07   AX00004136   AAAAAGGTGCTTAATAGAGTTTGATGATGTGCCAATTGGTTATATTCAAATGTAT
11   J09   AX00004137   ACTGCATGGACACCAAACTTTAGACCTGGCGGAGAATTCTTTAATAGAGTATTAA
11   J11   AX00004138   TCAATAATGGATAAAATTGTAGGGACACCAGAAAAAGCAAGACAAGATACGGGA
11   J13   AX00004139   TTTTTGGTTACATGGACTAGTTGTCAAGCAAGTACAGGATTGGCGTCGTAAATC
11   J15   AX00004140   AAATGATGAGTTAAAGGCTTCATACATAGTTCAAACTTCAACTTGGACATTGTTA
11   J17   AX00004141   GGAAACCTTGTGTACGGAAAAGGTAAATGGATTCATGCTTATCGGATCTGTCGC
11   J19   AX00004142   AAACTCAACAAAATGGAAGGCGCCTAAAAGAAATGGTATCCTAGATATAGGTGA
11   J21   AX00004143   ATTCACAGAGCGCTCAAACAAACAAGCTTACCTCAAGAAAGTGTACAGCTTATAG
11   J23   AX00004144   TATACGCATCAGTAATTAACGAAATTAAAGAAGAGATCAAAAGCGATGTTATTGT
11   L01   AX00004145   AAAGGGAATCCAGACTGGAATTTTTCTGGTCCGCATGGGCCAGGACGTATCATG
11   L03   AX00004146   CATTATTGTCTAAGCGTGCGAACATAGGCTTCACAACAGGAGGGCATACAGGTG
11   L05   AX00004147   GATAGTAAAATGACAGCTGCATTGTCAGAAGAAAAGATGAAAGATCTTACACCTA
11   L07   AX00004148   ATTTAAATGGAACTAGCACAGATTTTCAAATGTTTTCGGTTATGCAGCCTATACT
11   L09   AX00004149   AATTATCTCGCATACAAATTCCAGAAGTAAGAAGTGTATTAAGAGCAAAAGTCGG
11   L11   AX00004150   AATAAGCATATTATTCCGTCCGATGACTTTATCGTTGAAAATAGTAATGCCACTG
11   L13   AX00004151   TTTTTAAGCCCGATGGAATCAAGAGTGCCAATGTGGGCGAAAGTTATGACCGGT
11   L15   AX00004152   GAGAAAACTACATCCGAAAACTCAATCCCTATGCAATTAGACCTTAGCGTTCTCA
11   L17   AX00004153   CGATTAGTGCAATAACGTTATCACGAGGTGTTGTGCATGTGCAAAGCATAGTAA
11   L19   AX00004154   ACTAATTTATATCATCCTTGACATGAATTCGTGGATACCGAACTTCAAGGAAGGA
11   L21   AX00004155   AGACAGCATGGAATTTCAACTTTCCATAGAAAGTTACATACTAGGCTTCTTGGCA
11   L23   AX00004156   TCTAATAAACCCGGATAGTGGAAACGTCTCCTTATTTGGCATGAACTATTCGACT
11   N01   AX00004157   TTACAACGAAAAGAGCATATGAAGAACTGGAAAAAGACGGTTTTATTAATTCAAT
11   N03   AX00004158   TACGTTCGCGTTAAACGGTATAAATTTAACGATATATAAGGGCGAAATTATAGCG
11   N05   AX00004159   ATTATTGTAGCAATAACTGGCTTAGGAATGTCAATAGCTTACTTTTCATGGAGGT
11   N07   AX00004160   GGATATCGGCCACGTAATAATGAATGGTCTCCTTAATAAAAATTGGTCTCCACCT
11   N09   AX00004161   GATGCTAAAACGTCAGATTGTATAAACGTTAGCGTTGCATCCAAAGGACCGGTG
11   N11   AX00004162   CATCTGTCCTTGGGAACATGGGGAAAGGATCTGATGGAGTATTAATTTGTCAAT
11   N13   AX00004163   AATCATTTGCGGTTGGACAAGTTCACGGTTATTGCGGAGGCGAACCGTCACTTC
11   N15   AX00004164   GTAGGGCATGTAGAAAATGTAAAACAAAATAAGGATGTATTACCTTGGGGCGCG
11   N17   AX00004165   GGAGCATACCAATATTTCCGAATGGAGATTACTACTTTTTTATTCAGAAGGACTT
11   N19   AX00004166   CAAAGAGTAAAACGAAACAATTGGTAGCTGAGATTGAAGGGTATGATTTGTTAAC
11   N21   AX00004167   TAGTAGAAGATACCTCTATTAATGGAAATCCTGTTTCTCCTGATTGGGGACCTGG
11   N23   AX00004168   TTACTTTATGACGACTGTATATTCGTTAAAGAAAACATTTCTTCCTATTCTGCTAT
11   P01   AX00004169   TAGTTGGGAGTCGTTTATTCCTCTCATTCCAGGTGCTACTAAACCTGATGATGCC
11   P03   AX00004170   AAATCGCTCTTGGAATGATGAGATGTTCAAATGGTTTTGCGAAGAAGTGCGTAG
11   P05   AX00004171   AGCATTTTCATCAGTTTGTACAGATCTATACAAATTTAACTGGTCAGCAGCCAAA
11   P07   AX00004172   ACGCTCAATGTGAAAGCAGCACGAAGTCTTTCAAGGATACTAAAGAGTAGGCCT
11   P09   AX00004173   TTGTTTATGGTTGCTGATCTTCGTCGTAGAAATGCATTTTGGTTGAAAAGATGGT
11   P11   AX00004174   CAAAACAATCTACAAGAGTTAGTACAATTTTATCCTTATGCTCCTGGATTTCAAG
11   P13   AX00004175   CTTAATACGCCAACGTCTAGCCGCTTATGACAAAGCTCCTATTCACCCCTCCCT
11   P15   AX00004176   GTTTTTCACGCTTGGATTCTTGGCATAGGAGCCTTACTTGCAGATGTTATCTACA
11   P17   AX00004177   TTGCTCAATTATCTATGGTTGATGCATCTCAGCAAGTTGAGTATAAAACATCTAA
11   P19   AX00004178   GACACTTGGGGTTGAATGGGGCAAACTCTTCCCTGTGCCGAACTATGATATTAA
11   P21   AX00004179   TACATCCGGTGTTTGGTATTGTATTTGCGATCGTTCTCTATCTAGCGATTGGTCC
11   P23   AX00004180   GAATCAATACTTAGCGCTAGGAGCAAATACGTTATTAGCAGTTCTCATGGTCGG
12   A01   EMPTY        -
12   A03   AX00004181   AGAGCTTCATGTCAACTATGTCATTCCAAATCCGTTTGATCCTAGGGTGGTGCC
12   A05   AX00004182   AAAATAAACTCAGTGCACCATTAGTTATGTATTGGAATGGTAGCCCTTATGCAAT
12   A07   AX00004183   CATTTCATTTCATCCAGGATTAATTCCCACTAAGCTCGCTATTTCTATTCTCGGA
12   A09   AX00004184   TTAGACGATGGTTCAAGTATCATCAAATCTGGTTGGCAAGCTGCCGATTCAGCC
12   A11   AX00004185   ACGTAATCCAAGTAATCCATCGGAAGAGGACAAAGAAAATTACGTTGAAGGACA
12   A13   AX00004186   CTAACAATTATGGTCAAGCAGGTCACACGTATCGTAGTTTTGAGGAGTGGGAAA
12   A15   AX00004187   ACGGGCTTACAGCAGGTGGTCACCATTAATAGAACGTGCGGTTTATGACTTAAT
12   A17   AX00004188   TGTAGCAGAACTTCAAAAGTTACATGATGAGACAGTAAACAGAATTCATCAAATC
12   A19   AX00004189   GACAGTCGCATCCCTTCAAACTGTTGGAATTATTCTAGTTGTTGCCATGCTTATC
12   A21   AX00004190   AGGCCGAAGAAAGGGGAGCGGGATTGGGCATTTGAATGTCTAAAGAAAGTCGG
12   A23   AX00004191   TATTCCGCAAGATTTATAAATAGCAAGCGAACAATCAATCCAGCTTTTGGGGCG
12   C01   AX00004192   AACACTCCTTCTAGATCAAGAGGCCAAAAACTATATACATTCAAAAATGAAGGTT
12   C03   AX00004193   TGTACAATCAATTAACCCCTCTTTCAGAAGCACAGCGAAAGCTATTACTTCCAAG
12   C05   AX00004194   ATTCAGCATAATCTTGGGCAATTTCACGATGCTATCAAAGATTGTGAACATCTTC
12   C07   AX00004195   GAGATGGTAAGTCAGAGTCTGGGTACTTCTTCCCTATTATAGAGAGAAATACAC
12   C09   AX00004196   TGATTGTATTTTCTACATGGTTATCTCCAATCGTTGTGTTCGGAATTATACTACTT
12   C11   AX00004197   TGGTTTCGTACAACGAACCAGTAAATACCAAACAAAAGATTTAGTCGCTTTATGT
12   C13   AX00004198   AAAAATCCTGGATATCCTTGCAGGATAAGTTTGAAGGATGCAGAGGTAGGAGAA
12   C15   AX00004199   TATTTTAGGATCAGGTGTCCTATTTTTATCAGGGGTAACGGCCTCAATAGCGGG
12   C17   AX00004200   GCATGGATTATGCGAAACACTACTTTAAAAGCTGGGGACAACATGTGCTTGCTT
12   C19   AX00004201   ATAGAGGCGAAAGCTACGTTGTATCAAATTTGGGTAATTCCTAATAAGGATAAAA
12   C21   AX00004202   CTTTTTCTTTTCACACCTCTTTTAGACAGCGTTGGGATAGAATATGTCGTGCCTT
12   C23   AX00004203   AGTTGATGATCTCATCTTGCCAGTCACTCTTAATAACGCAGAGTTCGAAAATTCA
12   E01   AX00004204   GGTGCTTCCTTCTAGCATTCTACATAAACACACGATTGCTTTTTTCTTACGTGCA
12   E03   AX00004205   AAATTGCATACTCCAAGGGCAGTTGGAAACAAATCTGTTTTCCAGCAACAGTAG
12   E05   AX00004206   GAACAAAATGGAATCAAGTTTGTTCATTGTCCTCTTGAAGACAGGGAGCGTGTG
12   E07   AX00004207   CAATCTGGGGAAGTGTTAGCTCACTCTACGTACAAAACGGAATTCACGGCAGGC
12   E09   AX00004208   TAGACGTACCAGAAGGCTGGACATTAAAAAAAGCTGGGGTAAAAACACGATACT
12   E11   AX00004209   ATAGACCAGAGATACTAGGGGTGTTAACAGCATTCATAACGGGCATTGGTATTG
12   E13   AX00004210   TTCAAGAAAAGCTATCTGAGATGATAAAAGTAGATCGTACAACTGCAGCCCGGG
12   E15   AX00004211   TTTGAAACCTGTGAGAATGTTCTTGTAATGCTTCAGGGACCGCACTCTTATATCT
12   E17   AX00004212   AGGGGCAGTATTAACAGCACCTGTAGCGGTTCTGTTGCTATCTTTCACTAGTTG
12   E19   AX00004213   GAACGTCGCTCGGGAGTTACTCCTCCCAGGTGGAAAAACAATCCACTTAGCCAC
12   E21   AX00004214   TTACTACGACATTGCCAAAGGTTCATATTGCGATTATGGGGATGGAACGCCTTG
12   E23   AX00004215   TTATGAATCAATGTGGAGTGGAACTAGATTTCCCTGAAGGACAGACTTGTTGCG
12   G01   AX00004216   ATGACTGGCATCGGTGCCTCTATCTTGCCGAAAAGTGCTATATCTCATATCCCG
12   G03   AX00004217   ACAATAGCGAAAAATACTAATTTAGTCGCTTCAATGGGGTTTAATTATCGCTACT
12   G05   AX00004218   CTCATTTTGTGGCGAGTGGATTAGGTACAGAAATAACGTACTTTGATAGTAATGG
12   G07   AX00004219   AGCATTATTTAGCATATGGGCCCATAATACTTTGTAATGAGTATGAGGAAAATGC
12   G09   AX00004220   CAAGCTGCAAATTTACAATATGTTTCTGCTGAGCCATCGGGAAATGTGGTAGCA
12   G11   AX00004221   AGCAAAACACATACCTTAAGCCGTCCCACTAACTTAACCATGGACATTTATCAAG
12   G13   AX00004222   TGAAGATGGTTATTTACTCACCAACTATATGACCGTTATCGATATATATCCATTAC
12   G15   AX00004223   CCGCTTACCTTTAGAATTGGAATATTGGGTACTTTCATGTATGTGTGCTGCTTCA
12   G17   AX00004224   AGTGTTTTGTGGGCTTTTTGGCATCTTCCGCATTTCTTAACGGCTGCACAAAGG
12   G19   AX00004225   TCGGATGCGACTGCTGCATATGTGGTTGTAAATCAGGTTGCAAGTTATGTTCAG
12   G21   AX00004226   CAACAGTTTCCCAACACTTATCTAAAATGAGAGGGAAGGTTCTAAGAGGAAATC
12   G23   AX00004227   TCTCCAACCGGTTTAACCGGAGGTGATGCAGTTAAAATTAAAAACTATCGAGAAA
12   I01   AX00004228   CGGTGGTGGATTGATCGAAGTCAAACATGTTGAAATTGACGGATTTAGCTTAGA
12   I03   AX00004229   TGTTTGAAATACCCCCAACTTCAAGGAGAAGTACGAGGGAGAGGCTTTATGCAG
12   I05   AX00004230   GAAATCCATTTTCTTTCTTACACGTTGATAAAGCAGAAATTGATTTAGACCCAGC
12   I07   AX00004231   TTCAGTCGTAGGCATGATTACAAAAAGAAAAAGTCGAAAATATGCATTGTGGGC
12   I09   AX00004232   AGGGGATGTATGTTGCTCCGATTGGTTTTCCAGCAGATATGATTTCAAGTCTAAG
12   I11   AX00004233   TTATTTTCCCTTTCTCGTAGCCATCATGCAGCGGAGGACTTGATGCAGGAGACT
12   I13   AX00004234   GTACGTAGTGGTGCAGGACTGGAACATCAAACTGTGCGTAAAGCTTCAAATGGA
12   I15   AX00004235   AGAGATAAACAAATCTCATACTGACCAGCTTAGTATTGCACAAGGGGAACGTGG
12   I17   AX00004236   AGAATATGGGGTGCCTGATGTTTGGAAGAAAGCACCTTGTACAGAATGTGATGC
12   I19   AX00004237   AGATTATGGTTAGAAGAGCGTGGAATAGAGGTAGTAGGGAGTCAGGGGAAAGG
12   I21   AX00004238   AGAGACGGATTGGACTTTAAGCACTGGATACCAACAATCATACGATATAAATAAT
12   I23   AX00004239   GAAACTGCACCGCCTGGTTCTGTCTTTTCTTACAATAACGGATCAACAGAAACAC
12   K01   AX00004240   TAATCGTCGGTTTGAATCCAATAATGGATCGGCTTAATCCAGCCGGTATGAGTA
12   K03   AX00004241   TCCTAATTTTTTTCATTGGATGACAGCGAGAGAAACGCTTACGTTTATGGGCCAA
12   K05   AX00004242   GCCAGTTATTGCAGTGGGGGCACTTTTAGTTTTAATTGCATTCATTGATTTATAT
12   K07   AX00004243   ACCAGTTATCACTTATGACACAATATCAAAGTTACCTTAAGAAATTAGAGGAACA
12   K09   AX00004244   AAGATCCTATTTTAGTAGCATGGAATTGGTCTTTTTTGCCTCTAGATTTGTTAATC
12   K11   AX00004245   ATTAAAAGGGATGGAAATGTCCGTTGCATATGCGGTTTGGTCAGGTATGGGAAT
12   K13   AX00004246   AAAAATTCAAATTCCGTTTTTTATTGAAGTCTATTTGGGGGCACTGAATCGCATA
12   K15   AX00004247   TTTCAAACGAAACAACTTTCCCGCTCTTTACTTTTTTAAGTGCGGGCATCGTTAA
12   K17   AX00004248   AAGTGGATGAGGTAGTAAGAGGAAGTAAAGAATATGAAACGTATTTTCTTCCTAA
12   K19   AX00004249   ACGTCGCACTACTATATCGATCAGCCGATTGGATTATAATGAAGAGAGGTGTTT
12   K21   AX00004250   CTGGAAATGCAGGAGACTATGAAGTGATTATTGATCTTGAAGATTTTACAGAAAG
12   K23   AX00004251   AGATAAGCCAATATCATTGTTAGATATTCAAGAACATATCGTTTCGCATCATGAA
12   M01   AX00004252   AATGTTTAGAAGCAGCACTACAGACTGTTGAAAAAGATTTTAATCGTGCTCGTAT
12   M03   AX00004253   TACGTTTTATGTCAAAACGATGATACGTGAGAAAAATAATCCGAAGTATCGCTTT
12   M05   AX00004254   CGAGAGGCAACGTGGGAAACAGTCATTTCGTATTATATCGCAAGTTTTTATTTCG
12   M07   AX00004255   TCCGCTTGCAACGCGCGTTATTTGTATGAATAACGGTCGAATCGTGTATGATGG
12   M09   AX00004256   TCGTTATTCACGCATAGAGGCCGAACGACATTATTTTGGGTAGGTGATAGCCGT
12   M11   AX00004257   CCAGATCCAGTACCGCCAGTGCCAGATCCAGTAATACCAAAACCAAAACAAGTT
12   M13   AX00004258   TATTGTCATATCAACTTCCGAATGGTGAATTTAAATGGTTACCAGGCGATCAAAA
12   M15   AX00004259   TAGTTGTTGACGGGGGAGCCTCTACGAATTGTGCGTTACTTGGTGATAATTTGG
12   M17   AX00004260   TTTCGTAACCAGCAATTACTTTTTATATGCATTGTCGCCGCACTCTTTTCTATTCT
12   M19   AX00004261   GTTGATAATTGGAACCGAGAGCATGTTTGGGCAAAATCACACGGTGATTTTGGA
12   M21   AX00004262   AAATAAAGTTAGGGTGAAAATCCTTAACCGTACTGCGGGCCCGCTTACTGGAGT
12   M23   AX00004263   TTGATAAGCGCGGAGTAGGAAAGAGTGACGGAGAATTTCTGAAGACTGGAATG
12   O01   AX00004264   AGACGGGGCAGAGTTATCCGGATATTACATTTTTACCACTGCTAGCATCGTACT
12   O03   AX00004265   ATTTGCTTGTTTACTTCCACTAATACTTAGTTCTACGATTAACCCTATTGTATGTG
12   O05   AX00004266   ATTGGGCGAAAGGGTGATGCAAATTATAGTAAAGCGACAAAGGGGAATATTAGA
12   O07   AX00004267   TTAGTGTACGTCGTGAAACAATTAGCCATCTCGAAAAAGGTAAATACAATCCTTC
12   O09   AX00004268   GTACCGGCACATTATAACGCATATGGGACTGTAGATCGTTGGGGATCAAAGTGG
12   O11   AX00004269   AGCTGTGACATATAAAGTAGGTACATTTTACGTGATGCCAATGGTAACATTTCTT
12   O13   AX00004270   AGAAAATAGCTTATATCATAATCCGAAAAAGCAGTTTGAATCTTATTTCATAACTT
12   O15   AX00004271   ATGGAGACGTCGTACGAGGGAGTACGTTTTTCTCAGGAGAGATATCTTTCGTTC
12   O17   AX00004272   TATTGGCAATGACATTGGCTCGAATGTGCAGTAGTTATTTTCTAGATCGATTCGG
12   O19   AX00004273   GTGTGATTTTAGACGTTTGTGAAGTTCGAATCGGTGATCATTGTATGTTTGCACC
12   O21   AX00004274   TATAATAGATCGTACACCTTTATTTTTTGATTTCAAACTTATCTTAAGGGTAATAG
12   O23   AX00004275   AGTTAGCGTTATGTTGGCTGTTTCTCTAATTGTTACGATGATTGTATTTTCGAGT
12   A02   EMPTY        -
12   A04   AX00004276   AATTTAATCAAAGTATGATTCTTGTTACTCATGATCCCCACATTGCTACGTACGC
12   A06   AX00004277   AGCTATCCCTCGACTTTATGATACTATAGCCGATATTCAATCATGTGATGAAATT
12   A08   AX00004278   AGACAATGTCTCTGTTCGCATCGTTGCAATGCCAAGCTGGGAGTTATTCGATCG
12   A10   AX00004279   GGAGCCAGGAGTAAATCCCTCTTCTAATATAGACACATTTATTGCTGCTCGCTTG
12   A12   AX00004280   CAAAAGGATTGAACCGTCTTATTATAGAGAAGCCTTTTGGTCATCATGTAACGTC
12   A14   AX00004281   TTGGTAACGGAATTGCGGCTGTCGCAACAAGCTTCACTGTATTACTTATTGCGC
12   A16   AX00004282   ATGGAGAGCCAATTATCTTCCAAGAAGAAGACGGCTTGAAATCTGGATTTGGTA
12   A18   AX00004283   TTTCCTAATGAGAGTGGAACAGGTGGCCTACTTAACGGATGGACGCACTTTTGA
12   A20   AX00004284   ATGGTGTGATTACACGTAAAATCTATAACGAAATTCCACCTCGAGTAGAATACTC
12   A22   AX00004285   TGAGTATAATGGGCTTTGTTCTTTCTGAAAAACAAGTGGTGTGGGTATATTTAAT
12   A24   AX00004286   GTTTAGTAGTTATAACTCAAGTGTGAGAGTGTTACTTGATGCCGGTTTTTCTTTG
12   C02   AX00004287   ATAATAAATGTGTCCTCTCGGTTAGGTTCATTGCATAAAATGGCCAACAAAGAGT
12   C04   AX00004288   CATCATCAACAAAAGAATGGTTCACGGAATGGATTAGAGGTTTTGATGAAGCAG
12   C06   AX00004289   ATTCTTGCTTTATGCGCTGTATATGAAGATTGGGGACAGTTTATCTTTTTTGTTA
12   C08   AX00004290   TACAAAAGGAGTGCATTAAGTCTTGCTTGCGACCGCAATAAACCAGAGATGGCA
12   C10   AX00004291   CGTCTTTACTACGAACAAAAGTAGAACTTAATACGACGCAACGTCTGATCCAGG
12   C12   AX00004292   AAGGAAGAGTTTAAACCAAATACCGAAGCGAAGGATAATAAAAATTTGGTGAATT
12   C14   AX00004293   AACAGGATGGTGGCAGTTATTAAATTTGGTGCCATTTGGAGGAGCGGTTCTGCT
12   C16   AX00004294   AAATAGATTCAGACACTTCTCATGGTTCCTCTCCCGTCAGAATTAAATACGGCTT
12   C18   AX00004295   GAAGCAGTTCCTTCGAACGGTTTAATCCTTAATACTTCTAAAGGATTAGTACTTG
12   C20   AX00004296   GTATACAATGGCGGAATTAGGTGAATTAGCGGAAGTTATATTAAAGCGTGATAA
12   C22   AX00004297   ATGCACGTTTAAAGAGGATGGAAGATAGATTACAGCTGATTACGAAAGAAATGG
12   C24   AX00004298   TTATTTGATATCGTTGGCTGGCTTGTTTTCAATGCGCCAATTCAAAACAAAGTAA
12   E02   AX00004299   TTGTTAAGTCACCAATCTGGAATCATTGATCCTCCTAATAGCTTTGAACATTATC
12   E04   AX00004300   ATTCGCTTTCATCATTCTATTGTTTGGCGGTATGTTAATATCTAAGTTACTTGCCT
12   E06   AX00004301   TCATTTTCGTTTTCGGCGGTTCTCACCCCGGCAATTGGCAAGCTCCTCTAGAAA
12   E08   AX00004302   GTGATATGTAATCTATGGGGGATTTGGGTTTCCATTTATAAGCCTCGGCAGCCT
12   E10   AX00004303   ATAGGTACATTATCACAAAACGGTTTAGCGACGGTCTTAATTTTAGTCTTTTCTT
12   E12   AX00004304   GCAAGGAGATGCATTTGGTTTTTCTATGGTACTTCATCCGGAAGTTCTCGGTGC
12   E14   AX00004305   TGGTATTCATAGTTCATTTACATACCAAGCGGGTCATGCTGATCTTCCTGCACCA
12   E16   AX00004306   CGCATTTACCGTTGTTGCTAAATAGGGAAACACTCACGTTACATGGTCACTTCG
12   E18   AX00004307   GGCGTTCGGCAGAAAGGACGCTTTCGTTCCGTGGGACGGAGAAAGTACAGATT
12   E20   AX00004308   ATATTGACCTTCATACTACAGTATATCCAGGTGGAGGACTAGACCCTTATACTTC
12   E22   AX00004309   TATTCCAAACCTCATCCATTCTTCAGAAACACTACAAACAAATTATCATAACTGGA
12   E24   AX00004310   TGTAAGGATTGATGACTTTTGTATTTTAAGTGGCAAAGTAACGATTGGAAGTTAC
12   G02   AX00004311   TTAATTGGATTACCAGAAATTACGTTAGGTCTATTTCCTGGGGCTGGAGGAACT
12   G04   AX00004312   TTAGCTTTTGGGATAATATTTACCGCACTATTAGCGTTTATTACACTTCCTTTCAT
12   G06   AX00004313   CAAATGATCTCAGCGTTGACTTTACACAACTCTTATTTAGTAGCAGCCAGTGGAT
12   G08   AX00004314   TATTTTAACGCCCATATTATAGGTGGAGTTTTCGGAAGTGGTAAAGCTGAGGAA
12   G10   AX00004315   GGAGATGGAGTCTTTCGAGAAATAAATAGTGATGAGATACCATTAATAGAACAG
12   G12   AX00004316   ACAAAACAAAGCTACTGATGGCATTGATGTAGAGTTCTCTCGTGAACTTGCTGA
12   G14   AX00004317   TATATAGTCAAAAAAATGTTGCTCACTATACGGAGCTATTAAAATATATTTTATCC
12   G16   AX00004318   AAGTCAAAAGAGTTTTTTACCGGAAGTGATTTTTAAAGAGGTAAAGGGATTTTTG
12   G18   AX00004319   GGCTCAAAGCAAACTATTGTTTACAATCGCTTGATAGAGTGATCGTAGCTGTTAA
12   G20   AX00004320   CGGAATCCGTATTTACTATCTTGCCAACTAGATGAGTACCGCGTCGTTATTTTTC
12   G22   AX00004321   GTGCTAATAAACTACTCCACCATGATGATAACGTGCCGAAATGTGGTGCGTATA
12   G24   AX00004322   ATTACTAAAAGTAAGACAGAATGGATGGCTGATGCGAAAAAACGTTGGACAGAG
12   I02   AX00004323   GAAGAGTACGGCGAGTATTCGGAAGCAAGTACATTCTTCTTACGTTTAAATCAAA
12   I04   AX00004324   AAATGGTTGTAGAGAAAAATACAGGGATTATGCTAAAATTCCTTAGTTTCCACGA
12   I06   AX00004325   CTAATTATTGTTGTCGACCGCATTGAAGACGTATATGAACGTTGTAAAGAGAAGC
12   I08   AX00004326   TAGTAACGATCTTGAGAAAAAGAAAGTAGGGCGTATTTGTCTCTATGTTTCTCTA
12   I10   AX00004327   TCCCTGTCCGTTATGTGGGAGATTTATTAATGATGTCACAAGTTGCAGTTGCTTC
12   I12   AX00004328   AGGATGGGAACGTAATAAAGGCGGCATACGATTAACATTTATCGCTGGTTGGCG
12   I14   AX00004329   CAAAGAGTAATCATACTTTTAATGACGTTTCAACGAACTCATGGGCAAGCAATGC
12   I16   AX00004330   AGGTACTCTCGCCTTGTGGTGTATGCCAAGAACGTTTATTTTATTGGGGACCAG
12   I18   AX00004331   GTACGGGATGTGTATCAAACACATGAATTTCATCAAAAAGTAAGAGGGTGGAGC
12   I20   AX00004332   GGTGTGAAGAAGAAGCACGAGCGTTTTATGGTGAAACAATAGGTATGGAGGAAA
12   I22   AX00004333   GAAGGCGTGGAAATATTCGGTGCTGCCTTAATTGGAGCACCCCTTTCTAAACCG
12   I24   AX00004334   TAATTGAATGGAGACTAGGTGACGCTGGAAAACTTCCTTTTGAAGCTAATTACTA
12   K02   AX00004335   AATTTTTGATCGTGGACCAGAAGATATTGAGTTCTATACAATCTTTTATCCTACAA
12   K04   AX00004336   ATTTCTACATTGGGTGAGACAGCAACGATTTCAAATTTTATCACTCCAGCTGTAG
12   K06   AX00004337   AAAACGTTACATTTACAGACCCCCTACCCGCTGGCACTACTTTCGTTCCAAACAG
12   K08   AX00004338   TGTAACACTACCTGGTACAAAAGTAGTGCCAGCAGGAGGTATATCTGTAATGAT
12   K10   AX00004339   CCGATGTCAGCAACTTGTGGGCTAACAGTTTTTGTAGGATTTACAATTGCAGTTC
12   K12   AX00004340   CTAGACCACCTGTATCTGTTACTACGCCTACACCTACTACAAAGACGCAAGTAAG
12   K14   AX00004341   ACATACGGGGTGCCTGTTAATGTTCATTATTATGTCGTAAAAAAAATGGGTGGTA
12   K16   AX00004342   GTTCTTATTGGCCAGAGCGTCTTGTGACACGTGGTGAATTTGCGAACTTCATTT
12   K18   AX00004343   AAAAATGACGGGAACCCAGTATATAGAGCGAAGAAACTATCTCATATTCTATACA
12   K20   AX00004344   TTCAGAGCGCTGGAATAAACAACGCATTCGTGTAGCGAAATTGCATGAAAAGGT
12   K22   AX00004345   CGATAGCCTAGCGGTAGGTGGGAGATGGATTTCGGTTTGGCGTAACCAAACAT
12   K24   AX00004346   TTTTCAAGAACAAGAATTGTGGAAAGACATTCAAATTTATACCGAACTACTAGCA
12   M02   AX00004347   TGCAGGTCTTAACACCACTAAGTTTTGGAATTTAAGCGCAGGGACTGTACTTCA
12   M04   AX00004348   ATACCTACTTTGATGTAGCAAAGGACATAGCTACCTTAATGCAGGGTAAGAATCT
12   M06   AX00004349   GTTCAGCGACAATGACAGTATGGAATGCTGTTAAGAATTTCTTACAGTCATGCTG
12   M08   AX00004350   GAAGTGGAACGGCTACCAGTAAGCAGTTAGATCAAGCAATTGGAATTATCGGAC
12   M10   AX00004351   GTAGCAACTGTTAAGCGTTACAAAGCGCAATTCAGACGTGATTTGTTTGCTGAT
12   M12   AX00004352   ACGAGCTTAAATTCGTCGCAAGCCCAATTATTCTAGCAACTGGTGGTAGACCGA
12   M14   AX00004353   TATTCACATTTCACAGCAACGCCAACTAATCCAGTTCCAGTGCCACCTTATATTT
12   M16   AX00004354   AAAGGCTGGCGGAAAAAGAAGGATGGCAGTGCAATCATTGTTTATAATGCATTG
12   M18   AX00004355   TGTTCATGTCTGGGATTACCAAGATGAACGAAAAGTGAAGTATCGAGATAAAGA
12   M20   AX00004356   GAAGCATCTCGATATGATTTGAAGTTATCTGGTGTTTCTCATCTCAAGGCAAATG
12   M22   AX00004357   GTGTTGCAGATTCATATGAATCAAATGACGCAGAACGTGTAATGTATCTACAAGA
12   M24   AX00004358   ATATGGTCCTTTATCAAACTATCAACTTACTATTTTCTCAGATATGGACGTTCAAC
12   O02   AX00004359   CTTTCACAGAGTCCTTGACTCAAGATGATCAATTAGCTTTATGGAGCCACGACAC
12   O04   AX00004360   ATGGTGGAGGTTTTTTTGCGTGGAATGGGGATATCTATCAAAGTGACATTATAC
12   O06   AX00004361   TTCTTCACGAGAACAGCCAATGATATTTATGATTACAACAGCCGGAACTGTCCG
12   O08   AX00004362   ACTATTCCGCCCGCATCTAATCCAACTTCTATCCAAACTAAAGACAATCAAGTTA
12   O10   AX00004363   AATGTTAGTAGGGATGATTCAGGAGACTTCTAAGTTAGGGATAACGATAATAATA
12   O12   AX00004364   GGGTAAGTTTTTATGGTAGCTACACTGGTGGCATTATTGGAGGTATAGTGGCAT
12   O14   AX00004365   AGGATGCTAATAATTTATCTGCAATTTATAAGGGAAACTTAATCCGTGTTTGGGG
12   O16   AX00004366   ATTTTCAGTGGAAAAGTAGTGAAGATGCAATAGAACAAAATCTTGAAAACATCAA
12   O18   AX00004367   TGCACGTGAGATTGTAGCAATTATGACTATGTTTAATATAGACAGTTATGGACCA
12   O20   AX00004368   ATCAGAGAGAAAGAGCGTGCGATCCGTTGTTAATGCAAAGGTATTTTCGTAGCA
12   O22   AX00004369   TCGCAAGCAGAAACCTATTTTTTAACCTAACATCCTTTTTTATGTTAGCAATAGTA
12   O24   AX00004370   ATCAAAAAATCTCAAAAGTCATAACTATGGGAACGCCATGGGCTGGAGCTCCTA
12   B02   EMPTY        -
12   B04   AX00004371   CCCCGCAAATGTACAATACCAAATAGAACGTAATTTGGAGAGGTGTGTACAACA
12   B06   AX00004372   AGAGTATATGTTAAGAGAAAAGGTAAACAGGTTTCGTGTTATAAGAGAACTTAAT
12   B08   AX00004373   GCTCGTGTACCGCTCTCTGGTGCGATGGACGGGTATTCAAATGATGTGAAGGG
12   B10   AX00004374   CCAAACGCAGCCGCAACTAACCTAGTCTTAACAGTCAATTTACGTGGGCTTTTA
12   B12   AX00004375   CTGTCAGTGTCGGCGCGCCGCATCAAAGATACCGGACATTTATTGTTGGCCACT
12   B14   AX00004376   ATGCAAGATGTGTTGACTGCAAAAAGGGCATGGTGTCAGTACAGAGATTTAACC
12   B16   AX00004377   ATTATGAGAAGCCATTGAATTTAGAGTACGGCGAAATGTTTGTAATGGAAAGCTC
12   B18   AX00004378   AACTATTTGACTACATAAGTTCTACGTTCAATGGTCAATCTGAGGAATCTGAGCA
12   B20   AX00004379   CGTTTAACATCTAAGAAAACACAAACATTGATTAAAACTAGATTAGTAGAAGGAT
12   B22   AX00004380   CGGTATTTACGTGATAAAAGGTTATCTGAATTACTTAAGCGCTGTCGTCGTTTAG
12   B24   AX00004381   ATTCAAAGGTGTCTAGCAAAAGCCATTGCACTACACGGATTAGGTTTATACATCT
12   D02   AX00004382   ATATCATCAGATGGTTGCTGTGAATAAAAAGCGGATTAAAGGTGCATTGATAACA
12   D04   AX00004383   ACAATAGAAAATCAATTACTACAAAAGCAGGTTGAAAAAGCTGTAAGTAGCTTGA
12   D06   AX00004384   CAATTTTTGTTAACTCGTATTGCAAGTAAGAAAAACGTAGAGGGTAAAACGAAAG
12   D08   AX00004385   TGTAAAAGTATCTGATTATCTTAGACTACTAGCACAATATAAATTGCCAAATAAAA
12   D10   AX00004386   TCATGGAATACAATTCAGGATCAGTTCTTCTTTGACCCACGGTTCCCAAAATTTA
12   D12   AX00004387   GTTCAGATGGAAAAGTTGGAAAGTGCAGGAGAAGGGGAATTTACTGAGTCCAAC
12   D14   AX00004388   GTATTAGCTTCTGAGCTAAAAATATCAGTTTCATATTTATCCGACATTTTAAAAGG
12   D16   AX00004389   ACTTAGAATTCGGCAATGGGACCATAAGAAAATGGGATAAAGCATATCCCTCAG
12   D18   AX00004390   ATGCAAAGAACTGTTTGTGCACATGAATTAGGACATGCAATCCTACACACTCACG
12   D20   AX00004391   AGTCCATTAGTACGTATCCCTGCATCTCGTGGTATTAGTACACGCGTAGAAGTA
12   D22   AX00004392   CCTTTAGTAATGGGCGGTATGTCCGGAATATTGTTGAAAAATCGATTCGTACAC
12   D24   AX00004393   AAGAACAAAGAGTCTGTTAAGAATGTGGAATCAAGTAAACCTGTGGCAAAAGCA
12   F02   AX00004394   ATTGGTACGTGGAGTGTCATATGTGGATTATGTCTCGTTCTCATTTCTTTACTAG
12   F04   AX00004395   AGGCTACATACATTGGGATACGATGAAGTGGAACCAGAAAATCCATATTGGAAA
12   F06   AX00004396   TCCTGAAATACATTGGGCATTACTTGGACATATGGTTTCGCGTAACGGCGGTTG
12   F08   AX00004397   ATGAGGAGAATACCTCTATATCGATAGATGGAAAAAATATAGAGGGGGAAATGA
12   F10   AX00004398   TTTACTTAGCTTACATGATAACGGGAAAAAATGGGCGGATACGTTGTTGGAGGA
12   F12   AX00004399   GCGGTGGCTGAAGCGTTAGCTACTATTCCGGAAAATAAAAGGCCAACATTTTAT
12   F14   AX00004400   CTAGTTGCACGAAATGTGGAGGAGAATTACGGAAAGTCTACAAAGAGAAATGTG
12   F16   AX00004401   CCGTTCGTCAAAACGTCAAACCTGCAAACATTAGTGACCAAATTATATATCAAGT
12   F18   AX00004402   CAACAATCCCTCTAAAAAACCCCATCAATAAAAATTTCAAAAACGGCTCTGGTAC
12   F20   AX00004403   ACGCCACCACTACATTGGATTTTAGCGGATAAATGGGGAGATTGCATTGTACTG
12   F22   AX00004404   TGGAAACAAATAGAAGAGAGCAGATTGCTGCTTTGGCACATGACATTAAAACAC
12   F24   AX00004405   GATAGTCCAATTGTATTTCTAACAGCCAAAACAATGGAGAAGGATCTAATCACAG
12   H02   AX00004406   CTTGCTGGCAGCTTTAATGCTTACAGGGATGGGGGATGTGATTTGGAAATACAC
12   H04   AX00004407   TCAATTATCTAGTTACAACTGGTGGTACATTACGATGCTTCCGGGAATGGTTTCT
12   H06   AX00004408   CGCTGTATGAAAATTTAACAGCAAGAGAAAATCTGCAGGTTCGTACGACTGTTTT
12   H08   AX00004409   GAACAAGCGCAAGGAAAAGGTCTTGATGGTGGTGCTGTATCAGATATGGCATTT
12   H10   AX00004410   GTCGTAAATATAAATGGTGTTGAATTAATGGTTTCAGAAGAAGAACATGGGAGTT
12   H12   AX00004411   ATTATACCTGCTGGGAAATGGGGAGGGTTTAAAAAGGAACCACAAGAAATAAGA
12   H14   AX00004412   ATTGCTCCGTATAATAGGCAGTTTGGCTCTAAGAAATTAGGACAACGTGCGTTA
12   H16   AX00004413   TCTTGTACACCAGAATATTTATTAATTGATGCGATGAAACTTCCTGCACCAATTC
12   H18   AX00004414   TACTTGCTCAGCTTATTCATGTATTTGATTGCCGGAGTGAGCATTCTGTTTTCCA
12   H20   AX00004415   CATTATTTAAAATGGAAATAGATATGTATGGTATTTGTGAAGACACAGGGAGAGT
12   H22   AX00004416   AGGGGAAACGTGAAACGGTATTCCCGCAGGTATTCCCAATAGAAAGTATGCCAG
12   H24   AX00004417   TTCTTCCGATAGTTCTTCAGCATCAAAAAACACTACTAAGAATGAAGCGAAAGAA
12   J02   AX00004418   ACAATTCGATTAGCACACAGCCTTATGAGAAATGAAGCGTGGCTCTATCTGTTTT
12   J04   AX00004419   AAAGAATGCTTTCTTATATAGCTAGGATTGGCGGGGCGCTTGGGTTCAGACTAA
12   J06   AX00004420   TGAAGTTTATGACCGAAAAGAATATAAGGGATATTTCAGTTTGTCGCAGGTGTTA
12   J08   AX00004421   CCGGAATCAGCCAATCAACATTAAGTGCACTTGTAAACAATACAAAACTCCCAAC
12   J10   AX00004422   AAGATTTCGTCCCAGATATGGGAAAACAAATCTTTTCATTTATGAGTCATATGTT
12   J12   AX00004423   ACGGTAATGGTCCAGGGAATCGGGAGTCCATTTCTGTAGAAATCTGTTATTCAA
12   J14   AX00004424   ACAAATATTGTTCGAGGGAAACGTGGTAAGAAATTTAGATTATATTACAATCCCC
12   J16   AX00004425   GGTATTAAGCCAAATTCAAAGGTAGAAATATTCAGCGACAATTCTAACTTATTCA
12   J18   AX00004426   ATTTCAGCTCTGTAATTGAAGTACCAGCCATTAGATTCAACTCACTCGGTACTAC
12   J20   AX00004427   GAGACAGATCAGGAAGACATGACTCCACAACGTCTTATGACGCTTATGAAATTG
12   J22   AX00004428   TAGATGTATGGTTTGGAGAGTATCCGCATAATCGTGATTATTTCAGAATAGGCTA
12   J24   AX00004429   ACCATATACAAAACCAAAACCTGTTTACATTGAGATTCCAGTTATATTGGAAGGA
12   L02   AX00004430   GTAAGAGTGGTAGCGAACTAGGGCAAGGGATAATAAGTCAAGATGGCTATATTA
12   L04   AX00004431   TACTGGAGAACGAATGCGTGATACAGGGAATAAAATGCAAGATGTAGGCGGACA
12   L06   AX00004432   GCTACTGATGCTTTTATAGCTTCGGAATGGACAGAAAAATTGAGTGCTGATAGG
12   L08   AX00004433   ACAATGGGAAAAACCGTTTTTATTGCTACTACAAAACGAAATTTGAAATTCCTGA
12   L10   AX00004434   GGAAAAACATGGATTACTTATTCTGAGCTAGATAATGGTGCTGGGAGATACGCA
12   L12   AX00004435   AGGATGAGGTGCTTGTCGGAAAAATAAAAACCCGAAATGGAGTCAAATCAATTA
12   L14   AX00004436   TGAATTTTTTTATGCGATTTCGTAGGGGAATTGATTCGAAAATGCGAGTCTTGTA
12   L16   AX00004437   CAAAAGAAGCTTTATTAGGATCTGGTGTTCCTGAAAGTGAAAAGGCGCTTTACA
12   L18   AX00004438   AACAACATATAAAGATACAGGATTAACAGGTGATACAACATATTCTTATCAAGTG
12   L20   AX00004439   TATATAATGCTCAACCAGAACAAGTTTTAGGGAAACCAGTTAAGTTCTGTGATTC
12   L22   AX00004440   CTAACCCGTGCTGGTGACAAGTTAGATGAAGATACATTAAAACAATTACTAGATG
12   L24   AX00004441   TATGACACGGTTTTTAACCAAGTGTCTGATGTTGTGATGAATGAACCTAATCCAA
12   N02   AX00004442   ACGTAAACAACCAATGATTGTTTATATCACTACAGCAGGATATCAGCTTGAAGGA
12   N04   AX00004443   AAGAAGGCCTGACAATGGAGTATACAAATAAAGCAGGCGCTACAAATCTAACTA
12   N06   AX00004444   GAGTTAGCGCTGATACGAGATAACTATCGTTGCCAAGAGTGCATGAAGCATGAT
12   N08   AX00004445   AGCTATCAATGAATGTGTAAGTGCATTCGAACAGTTAGAAAAGGTTATGAGCAAG
12   N10   AX00004446   GAAAATGGAGAGCGGCAGGAAGATTGAAAGATGTAAGTGACGAGCTTCTTGAAG
12   N12   AX00004447   AAACCAAAGAATGAATTTCTCATCAAAAGTAGGAATGGTAAGAACAAGCCAATTA
12   N14   AX00004448   AAAAAGTATTTGAGGAGTATCGTATGTATTTATCTCAAATGCCAAGTGACATCTT
12   N16   AX00004449   AAATGGTCAGCAATGCTGTTCACGATAACAGCTATCGAGAATGGATTAGAGGTT
12   N18   AX00004450   GTAGCAACAATGGATGATCAGTTTGAAGTTGAGATAAGCGTTTCGTGTGGCGAG
12   N20   AX00004451   CGATCAAGAATCATTCCATCGTTTAATCAAATACAAATACTTTGCAAGAGGTTTC
12   N22   AX00004452   AATTTCAACGAAGGTTTAGATGATAAAGGAGAATTGTTTGATATTACGCTGTTTT
12   N24   AX00004453   GAATGCGCTCAACATATGGGCGTACTTCCTGAAACAATATACTTTTATACGACAC
12   P02   AX00004454   TGCCAATAGAAAAATTCGATGCAATCAATTACGCGGCAATTATCTTGGATCAGTT
12   P04   AX00004455   GTATTAATTCAAAATGATGTTAATATTTTACCTGGCCGAGAAAGAGATGAGAGAG
12   P06   AX00004456   TTCAAACAGTATTCTCCATGGATCAATGCAGATGTATTGTTGGATGAATTGTATG
12   P08   AX00004457   TGGATAATCGCAACGGATAGTTGGGGTTCGTTATTCTTATATCCTGTTTTTGCGG
12   P10   AX00004458   ATATGAATTGCAGGTGAGGCCGCGTAGTGGTATGACGCGTAATACAAAGTTGAG
12   P12   AX00004459   GAATCAGACAAAGCGTATGACAATGGAGATTTAGGTTTATCTGGTTACTATCGTG
12   P14   AX00004460   TCAGTCTGGAATGTTGGGGTTGGTCACAGCGAGAAGAGATTTTAAAACAGAACT
12   P16   AX00004461   TAGCACTTGAGGAATTGGATTTAGTTTTTGATGAAAGCGAAGTAATCCGATTCCA
12   P18   AX00004462   TGGGCTAGATAGCTTAAGAGCTGGAATGAAAGAACTAAAGGAATATGGGTATCT
12   P20   AX00004463   GATCAGCCGCATATGCACTTATGAAGAGAAAGGACTTCCCAACAATCGTAATTG
12   P22   AX00004464   TGATAAATAAACAGAAAACGGTAATCAGTAATTGGGAAACTGGCTACGCAACTCC
12   P24   AX00004465   AAACAGGCTATAGTTCGCCATCTAATGAAACTTTAGTTATCATTTCAGATGTATTA
12   B01   EMPTY        -
12   B03   AX00004466   GATTCCACGTTTATTGAAAGCTACAGCACTTAGTATTTTTGCTGAGAGTTATATT
12   B05   AX00004467   GGATTTGGATTCATTGGACCGTATCGCGTCATTCTTTAATATCTCTGTCGATACA
12   B07   AX00004468   ACGCAAGAGAAAGAATCATCATGTAGACCATCAACATTGTATCAATACAAACGTA
12   B09   AX00004469   TTTTATCCCAAAAGCGACTGCTTCTCTTTTAGCGAGTTATAAACAAAACTACGGG
12   B11   AX00004470   TGGTAGTAGACACGCTGAAATAAAGCTACTTCCTCCCTTATTAGGTAAACACTAT
12   B13   AX00004471   CGATTGGGTGTACAGTGTTAACTTTCTTTGCAGTTTTTTTACCTGTTGGAGAGGG
12   B15   AX00004472   AAATCTGGATATTCGGCGATACCTGTTTTGGACCCGATGTACAAATTGCACGGG
12   B17   AX00004473   TTCAACAAAATTATGCGAGTGAAATTTTAGCTGTGGAACTTACAGATATTGAGAA
12   B19   AX00004474   GTGAAATTTCCATTTTCGGTCTTGATGATATACTGCTAGGCAAACCTAAAATAGA
12   B21   AX00004475   TGCCTATATTCCAAATTCATTAAAGGCTGATAAGGGGATGAGCGAGTTTTTGTTT
12   B23   AX00004476   GAAAAGCAGCATCTATCATGAACGGCCCTTGGGCGTTCCAAGCCATGGAAAAG
12   D01   AX00004477   CTCCATCAATTAGGAAGATATTTAATTGGAGGAGTTATGCTATTGATAACAACGA
12   D03   AX00004478   GTTGGATGGGTGTTTTGGTACTAATTGTTCCTCTTGCGATTATGTTCTTATTTAA
12   D05   AX00004479   GAAACGAGACCGGTTTTACAAGGCGGACGTTTAACGACCTGGGAATTAAAACAG
12   D07   AX00004480   AAATGGAGTTTTATTTGGCATTAAAATATGATCGAGATGGAGTTGACCTTTATAT
12   D09   AX00004481   AAGAGGGCCAATACATACCGCTAGATCCGCATGTTTCCATACAAGTATTAAACAA
12   D11   AX00004482   AATCGTGATAATTATTTAGTCGGCCTCATTCAAATTGCAGTTTCTTTATACCATCA
12   D13   AX00004483   ATACATATTACTACTCCTACTATTTTCAGACATCTGATGGTACCGTCTTCTTTCAA
12   D15   AX00004484   AGTCTTCTCTTGTAAAAGTAAAACAACTGCCACTTCAGAAAGCATCACAGTACAT
12   D17   AX00004485   AAGGGACACCGCTTGGAGATTATGTAGCGAATAAAATAAATGATCCGAAGAAGC
12   D19   AX00004486   GATACGAGTAGGCAATATGAATTATATCGACAACAACAAGTACCGCAACTACTGC
12   D21   AX00004487   TAATTGCAAACCCGGGATGTTTTGCTACAGCTGCATTATTAGCGATATTACCGTT
12   D23   AX00004488   AATGTAGTCCTATGTCAAATGAGGATCAGGAAATGCTTGTTAAACATATTCAAGC
12   F01   AX00004489   ATGCAGCGACGAAACATGCAGTATTAGGATTTACCAATAGTTTACGCATGGAGT
12   F03   AX00004490   TTACTTCTTCCTATATTTGATATAAACATAGCTGGTTTCTTTCCTCGTCTAGTCCA
12   F05   AX00004491   GATTACTTCTATAGCATTTAACCCTGTTGTGGGGGATTATGCCATCCTTAAACAA
12   F07   AX00004492   GGAGGGGGCACCGGTAAGGCTTACAGCGGACGGTTATGATCATGTGGAATTTT
12   F09   AX00004493   TGGAGGCCTTTTTTCTTGGTAGTTTAGGGATATTCGGGGCGATTTGGCTCATTG
12   F11   AX00004494   GGGAGGGATATGGTATTTCCTTCATATATTTTCATTTACAGAAGCGGGACCGAA
12   F13   AX00004495   CTCATATTAGCAAATGCTTATTCAGATATATCACCGTTATTTCCTAGTTTGCATAA
12   F15   AX00004496   TAATTGTACTTCCGATTGAATTCTCAGTAGGATATAGCAGTGCCAAACAAATTGC
12   F17   AX00004497   AGCGATAGTAGCAACTTTGATTTATTGTGTAGTAACGATACCGACTAATTACATT
12   F19   AX00004498   TTTTTGGATGTTTATTAGTGATGGGCTGAATGAAACAGCACCTTCATTCATTGAG
12   F21   AX00004499   CCGGTAAGTCGAAAGGATATCGTCATTGCTAGATATATTTCCTGTGCAATATTTA
12   F23   AX00004500   ATGATTGGGAGTGGGATGTGTTTTTAGGGCAAGTACAATTAGAGTTTCGTGAAG
12   H01   AX00004501   CAGAAAGAAAAAGTTATAAACGGAAATGTATATTACACATATTGGGGAGGAAATG
12   H03   AX00004502   TTATTACTATTAATTATTCCTGATGTAGTTACGCAGCGTTCATCCGTCGAAGGAA
12   H05   AX00004503   TTAGGAGTACCGCTTCAAATAAGGTTTTGGGGAAGTAAGTTAAGTGGTGAACTG
12   H07   AX00004504   AACTGAGTACTGCATGGATGCTACGATTAAATTTGCCCATGGACTAGGGTACGA
12   H09   AX00004505   AACACCAATTACAAAAGAGGTTATCGCTTTCTTAGAGCAATATGACCCAATGAAT
12   H11   AX00004506   GATGTGCTAATGGATCTACCTCGGATCACGCTTGTTGGGCAAGTGCATATCTAT
12   H13   AX00004507   GTGGCACTTGCAAATCATGGGTTGAAAAGTATGAAAGGTTATCAGCAAATGTCG
12   H15   AX00004508   TTTAAAGGTTGCTCATCATGGAAGTAATACGTCATCTATAACGCCTTTTTTGAGC
12   H17   AX00004509   ACATTCTTTCTGGAAAGGGTTTATATAGCGATATTAATTATGTCGTCTTTTGCTTT
12   H19   AX00004510   ATCCACCGTTAACGGATGAGGGAAGGAATCAGGCTAAATTACTTCAATGCAATG
12   H21   AX00004511   TTTTGTACCATTAATCTCTTAAACAAATGGTTAGGTATAGAAACGAGTAATACATC
12   H23   AX00004512   AGGCTCTTCTTTTATGGTCCAGATGTAAGCAAGAATCCATTACTTGAGGAGTACT
12   J01   AX00004513   ATCGGGTTTGGTATTTGGAAAGGTTTTTTTGTTCGTTCCTCACGAAAAGAAAAAG
12   J03   AX00004514   GACCAGCTGTTTCGCATCATTTGAAAATTTTAAGACAAGCAGAACTAATTGTAGC
12   J05   AX00004515   TTTTACCGATTGTAGGGCTGACGATAGGCGGGACATATTTGCTGTTTACACAAG
12   J07   AX00004516   GAAAGCATAGACCCTGAATTTTTATATGAAGAAAATTGGTCTATTTTTGATGAGG
12   J09   AX00004517   GTCGCGATTAATCAATGGTCTTTTTATGAAGGGTTACAAACCGCAGATCCAACAA
12   J11   AX00004518   GAGTTAGAACAGCAGGAGTTACCGATTTTAGCTCAAACAACTGGAGAGAGAGCA
12   J13   AX00004519   AGATAAGTTATCAGCAAAAATTGTAGCATTCCCGCAACACGGTTTGTTACGAAGT
12   J15   AX00004520   CAATTGATGAAAAAGGGAAGGGCTTAGCGCAGCATCCAGTTGGGACAGGTCCA
12   J17   AX00004521   TCGGTATCATTTCTGGTTATTACGGTGGATGGTTTGACACGGTTATTATGCGAAT
12   J19   AX00004522   TTACACTAGGTGCATCTGGCGCAGCAATTGTAGCACGTATGACTCGCTCAAGTA
12   J21   AX00004523   TTACTAGTCCAAAACACCCTTATACAATCGGACTTCTTCAATCTCTTCCAAGTCT
12   J23   AX00004524   TCAGATCGCATCATTGTAATGTACCTTGGTACCATCGTGGAGATTGCCGATAAA
12   L01   AX00004525   CATTAGACATCATTCATGAGACTTTTTCTGACAAACTACACTTAGCAGACATCGC
12   L03   AX00004526   TTTCTTTCTGCCGGCATCCTAATCGAAACGGGAAGAGTATTAATCAGCCCTGCA
12   L05   AX00004527   TTATGCAGTTTACTTCTTAATCGACCCTTTAACAAGCATTTGGTCTAGTATAACTG
12   L07   AX00004528   ATTTTCTACTACGGGTATTCCAACATCGAGCCAAATGCTGCAAGGATTTTTGTTA
12   L09   AX00004529   GCAAGAGGCGGTAAAGGATCACGCATCTTCCTTTGGGATTGGCTATGTTTTCTC
12   L11   AX00004530   ATTTTATTTGCGACAGTGCGTCCAAATAACATCGCAACGCTTGAAAAAGATGAGT
12   L13   AX00004531   AGTTGCACCTCATTTAATGCGCCTGATAGGATACCGTCAACACTTTACTCTTCTT
12   L15   AX00004532   TCATCTGCTTTTGCATTGCACTGTAAAGAGATGGGTGTTCCGAGCTTAATTGTAG
12   L17   AX00004533   GAGAAGCGATCGAAAGGGCTTTAGCATGTACGAATTTGCTAAGTAAACGTGATA
12   L19   AX00004534   GTAAAACAGTTACGCTGAAAACAGTTGGTATTTGTGTGTTAATGGCGCAATCTG
12   L21   AX00004535   AAATATATCTGATAATCTTGGCGTTATGGCCATCTATTACGTGTTCATGAGTTTA
12   L23   AX00004536   AACTTTCAACACTAGAGCACTATCCTCTCCTCTTGATTCTATCTGGCGGAATTTT
12   N01   AX00004537   CCTTTGTCACACTACCTTTTGTTTTTTGGGGCATGGGAATGGAGGGCAATACAA
12   N03   AX00004538   TATCCCTACAACTGGAGAAAATAAGAGTGATTTTCTTTACTTTGGTATACCAGTT
12   N05   AX00004539   AAGGGTATATCATATTAAGAAATGAAACAGTGTTTTTGGCCGATGATAAAACGTT
12   N07   AX00004540   AAAAGTATAAGCGGAAAGATTGAAGTTTTATTCGTTGATGAAAAACACCGAGGAA
12   N09   AX00004541   GAAAGATAAGAAAAGAAAAAGGAATAAAAAATCTTCATCCGCTTCAAGTTCATCA
12   N11   AX00004542   AACAATTCCGCGTCGTTAGAGACATCACCCAAGAACAATTAGCTTCCTCTGTTCA
12   N13   AX00004543   ATCGAGAAGATGAGTTTAAAACTTATGGCACAAATTTTTGGTCTCTCTCATTTAA
12   N15   AX00004544   GCTAGTTGCTTTTGTAAAGTTACCGAAAGAAAGAAGTATATTAGTTGGCCCGTTT
12   N17   AX00004545   TGCAATGGTTGGTGCTGGACTTGGTATCACGTTACTTCCAGAAATGTCAGTAGA
12   N19   AX00004546   AGTGACCATGTAGAAGTACCGGACTTTCCAAAAACGGTAAGTCGATTCGATCGA
12   N21   AX00004547   TATCGACCTTGTCCAAGATACGTTTTTGACGCTAGAGCGTAAGAAACATATGTAT
12   N23   AX00004548   TCAATGATCACAGCTGGAGTTATGATGATTGTTATGTTTTCCATCATTATTCCGT
12   P01   AX00004549   AATAGGTGCAATACAAATGTTTTATGATGACGATTATACGAATGATCATTTCGGT
12   P03   AX00004550   AATATCACTTAACTTAGATAAAGATGAAACTATTATTGCTGGCAATGTGAAACAAT
12   P05   AX00004551   CACAAAACGAACTATATGACAACATGTCTTATGAAGAATCCCAAATACATTACCA
12   P07   AX00004552   TTGCTATACAGTCTGAGCATACGTACGATAATATGTACGGTGAGCAAATAACATG
12   P09   AX00004553   GCTGCACTAGAGTATATACGAAATGGAATCTGCCTTTATATGTTCCGATAGTAAT
12   P11   AX00004554   TTATATTACAACGCGCCAACGGGGTTTTATGCTACAAACCCATCTGACCCGTATA
12   P13   AX00004555   TCTCGGCAAGAATGGTGAGTTCGTTCCTAGATATGAAGTGACGCTACAATTTCT
12   P15   AX00004556   ACGGTTGCAGAGTTAAAAGATATTGTTGCAAGAGAATATAATGTACCAGTCACAG
12   P17   AX00004557   GTAAAGTCCGTTATTATGGTCAACTTGCCGACGAGTTAGATGCATGTTTTACAGC
12   P19   AX00004558   AAAAGCTATATGACAATATTGAAGTAACGTTACTCGTGCTACTTACCATTTCATTT
12   P21   AX00004559   TACGCTCTTACTGGAATCATCATTCACTCGTCACTCGTTTTAATCCCGATGGCAT
12   P23   AX00004560   GGCCCCAGTAGTAAAACTGCGTTCTTCGTCCATGGCTGGCCTTTAAATCATCAA
13   A01   EMPTY        -
13   A03   AX00004561   CACAGAATTTGAAGCATTAACGAGTTACTCAATGAGTCTTTTAATGCCAGGTTCT
13   A05   AX00004562   TCTTAGTGGAATGTGGTCGATCTGTTTAGAAACGCTATTCTTTGTTATATTAAGG
13   A07   AX00004563   ATACAAAAATAAAATGGATTCATATGTGGCTCGAGATGAATATGAAAAAGGGTCC
13   A09   AX00004564   ATGGTGAGCCCATTACAACGAAAACTTCATCTATGGGGTATATGTTGCAGCAAG
13   A11   AX00004565   AGTGATGAAAACATTAATTCATGAGACGGCTCACGTGTTGACGCTCGGGCATAA
13   A13   AX00004566   GGATATTTTACTGGTAATAGAGAAATGATGCCTTATATGTTCATTTTCTTAGGATT
13   A15   AX00004567   TGAAAAAACGCAAGCTTATAATGGATCGGGATCATCGAATACAGGGATTAAAGT
13   A17   AX00004568   GGATCATAATTTCCCGGATGTCGATAGAAATGGATGGGCGAATCCTGCGATTAC
13   A19   AX00004569   GTAGTAAGTATTCTATGGATACTATGTACATGTATGCTCTTTCTATATGTTCCGC
13   A21   AX00004570   TAGCGACAGTAGCCGTTATTAAACGTGAAACGGGTTCAGCGAAATGGACGATTT
13   A23   AX00004571   AAAGCCAGCTGTACAAGGTGAAAAATTACCAAACACTGCATCAAATAATGTAGCA
13   C01   AX00004572   ATAATTGATGTACCAGCGATTCGGATTTCACTAATTGGAATGACTTTAGTATTAG
13   C03   AX00004573   AGAACGTTACTACACATATTCAATTATGCAAGCACCATTCCCTGTGACGAATTAT
13   C05   AX00004574   AGTAAGCTATTAGATCAGATGAACCCATTTCTTGATATAGAGAATCATTACGCAA
13   C07   AX00004575   AAGAGTATTAGTTTCAAAAGTAGGTAGAACTGCTGCGGATAAAGCCTGGGCGGT
13   C09   AX00004576   GATTCCTGGCGATATATCCGCTTCTAGTAGACATTGGGAGAAGGATATTATTTCG
13   C11   AX00004577   CGCGCTTGCCACACTACATATACTTGATGCGCGTATCAACACCGCCTTCGCACA
13   C13   AX00004578   TAGTGTGGCAGTTTTTACAAGCCATAAAAACCGTTCACTAATGGATCACGTTGGT
13   C15   AX00004579   TTGTACTTACTGCTTTTTCCGGCTTTCTTATACATATATTAGAACCGTCGCACTTT
13   C17   AX00004580   AATGAGCGTTACGTACCGTACTGCATCGAGCCATCTTTAGGTGCTGACCGCGTA
13   C19   AX00004581   TACCTTTAATTATGCAGCGTCGTACGTATTATCCGAGTATTCAACTACATGGTCA
13   C21   AX00004582   TTCTTCATTTGGGACAAGTGTATCGCATTTAGGACAAGCAGATGTGTTTATTTTA
13   C23   AX00004583   TCGCTATCTTATCTACCATAAGGAGACGAACGATTTTGTTGGAACGGCTAGCCT
13   E01   AX00004584   ATGATCGCATAGAAGCGAAGAAGAAAGAATTGATCTATCTCGTTGAAAAGTACG
13   E03   AX00004585   AAATTGAATTGCCTCCATTTCTTATCGGAGAGATGATGGTATTGTCCTTAGGAGA
13   E05   AX00004586   TGAAATCCTTATATACGTAGTGGTGCTCACAGTTTTTGCACCAGTTTGGGAAGAA
13   E07   AX00004587   AGCTGGCATAGCGTTTGCTGTTAAAGAATTTAACCCGCAAACGTTTCGCCTTAG
13   E09   AX00004588   CGCAGGTTGCCGGAGTGAAGTGGTGCTTCAAGATTTTTTCGTTCACCCTGATCG
13   E11   AX00004589   GCTAAAAGAAAACAGCAATGATCTATACACGATGAGCCAAGGTACACTCTATCC
13   E13   AX00004590   TCGGGAGATCAGCCTTTTACTTTGGTAATCTGACGTACTTCTTTGAAACAGGTGA
13   E15   AX00004591   TTGGTTCTACGTTATGCGGCGGGCTATTTATTATGGGTAGGTAGCCAGGAACAG
13   E17   AX00004592   AAAGGTGAAAGCTGGACATTTACCTTTGAGGATAAAACTAAGCAAGGAACCATA
13   E19   AX00004593   ATGAAGCGGGTATAGATATACCTATACCATTTACAGATCATGATTTACATCTTGG
13   E21   AX00004594   TCTAATTACGGCAACGATTATGGGAATGGTATTTGCAATGTTATACAAAAAGACG
13   E23   AX00004595   GAAGCCAATGCAACAACCTAGTACTCATAATGAAGTGCGTTTACCAGCTACTGG
13   G01   AX00004596   TTATTAGCACGCTTCTCTTAACAACTAGTCAACCAACATTATATAGTTTCTTAGCT
13   G03   AX00004597   CTATTTTAAAATTTGCGGAAGCAGGGGTTAATTTCGTATTTGGTGGTCTAGCAAA
13   G05   AX00004598   AGATGTGTTTACGGAAATCTTTAAAGGTGCATTCGGTTTAGATTCAGCTGTAGGT
13   G07   AX00004599   ATGGTGTTAACGAAGTGTTCTTTAAAGTGACAGCGCACGGTTTTGAACAAATGG
13   G09   AX00004600   TATTTTGAGTTCACGCTGTACGATAAAGAAGGAAGAGAGAAGAAAAATGTAGCG
13   G11   AX00004601   CCAAAAGGTGATGTAGAAGGGATGCGTGAGTTGCATCAGCGTGGAATGAGTTT
13   G13   AX00004602   CATTAGGTGCGGCAGTAGGAGCTCCTGTTTTAACAGCGTTAACGGCTAGTATGT
13   G15   AX00004603   GGAGACCATTCATGCTATGAATCAAGTGATTCAAATGCAGCAACAAGCACAAGT
13   G17   AX00004604   ATTACAGCGTTAATCCGTTTAATTATCGTATCTCATGAGGAACCGATGGAGACGT
13   G19   AX00004605   GGCTATAAAGGAGAGCAGGCAATTGAATATCCGCTTAGTTTTCTATCCGAAACA
13   G21   AX00004606   ATCAACAAGGGAAGAAATGTTTAACGTGATGAAAGAGCAATACAATATCAGTCGA
13   G23   AX00004607   AAATTTATCAGAGTGGATAATTGAAATGGGAACGTATGCCGATGTTGATATTCAA
13   I01   AX00004608   ATGAATTGTCCCCAAAAGACAATAAGCTCGACAACCGAGTTATCAACCTTGAATG
13   I03   AX00004609   CATACATAGAAGGACGATACAGACATTTATTGGGAACTACACATGCACTAGGGT
13   I05   AX00004610   TCGATATAGTTGGCATGACTTGGGCTGGACATGATTTTTTAGATGCCGCTAGAA
13   I07   AX00004611   AAAAACAATTTGCAATGGAAGAAGCCGAGGAAGGCGATATTGAAACGTTGACAG
13   I09   AX00004612   CCATACGATGAGGAATCGTTCAAATGAAAAATACCAGATATTTGTCTTCGAGGAA
13   I11   AX00004613   TTCACGTTCAAGAATGTCAAGAATGATAAAAGATGGAAAAATAACGCCGATTAAG
13   I13   AX00004614   ATGGGGATTGCCACGTTAGAACGCTACATTGAATGGGGACTTTTAGAAAATGCT
13   I15   AX00004615   CATGGAGCTGAACTGTTAGAAGTTCGTACAGGGGAAGTGGAAAACGACCCAAAA
13   I17   AX00004616   AAGGAGTTTTTCATTCTTGAGCCAAAAGAAAATGGAGTGACGGTTTTAAAAGATG
13   I19   AX00004617   CTGTTAAACAATTACATGTGTATGGTGTACCATTTTCTGTTTGTAAGAAGCTTGA
13   I21   AX00004618   TCTATAATAGCTCATATGAAGGACTTGTGTATTCCATTATCTCAACGTTTACGATT
13   I23   AX00004619   CAAGCCAGCTTCTGATTGGGAATGGTGGAGAGGAAAACGTCAGGTGATTATTGG
13   K01   AX00004620   ACGGAAACGTGTCATTGACCGAGACGCTGGGCACTGTCAACGGTGTAGGATTA
13   K03   AX00004621   TTAGAGCTTCACCCATTGCTTTCAAAAGCTATTGTGGTTAACAAACGAATTAAGC
13   K05   AX00004622   CATCTTACGGGAAAGATTACCACCAATTAATTCAAGACGGTTTGCTTACCAATAT
13   K07   AX00004623   GATGCTTCAATGTCTGATTTCACATTCGACAAAGTAACTCTTGAACAACGTCGTG
13   K09   AX00004624   CTTGGTTTACCTGTTTATCGTAGAAATTTAGGCATTACAGGTTCAGGACAAAATG
13   K11   AX00004625   CACGGAATTTGCACCGAATAGGTGGATAAAGAAATCATGGAGTACACTGATTGA
13   K13   AX00004626   TACGACATTATGCCATTCAGTCGAACCTTAGGAACGGTTTAGACCTGTATTCATG
13   K15   AX00004627   TAGAGCGCCTGGTAGCAGCGACTGAAGGAACTGATTTACAAGTAGGTGCACAA
13   K17   AX00004628   TGCAACAACTAAAATCGTTGGTATCGACTCTATCCCTTCTAACTGGGAAGGCGT
13   K19   AX00004629   TCAAGCAAGCTTAAGCTCCCTTTCGCTAAATTCTACAGACGATGAAGCAAAACG
13   K21   AX00004630   TCTTCAAAGCTATGTTCATACTGTGGTCAAAAGAAAGTAGACTTAAAGCTATCCG
13   K23   AX00004631   AGCATGCTCACCACCTAACACTACAATTGATAAGAAGAATGATGTCGTTGTAAAG
13   M01   AX00004632   TGAGCGTGTTGTGAATAAGATGAAGTCATATTTTACGATTTGTATGACAAGCTTC
13   M03   AX00004633   AAAACAATCTGCAAGCACAGATAGCGCAGAGCAAATTTATCAAAAAAGTTGTATA
13   M05   AX00004634   ACGATACCATCGTCATCCGTTACCAGTTCCTCTATTTAGTTGGTGCGGAAATTGG
13   M07   AX00004635   AAAAATATCTTTGGGGAGACTATACAATATAGTGAATGTATAGATGAATCGATTA
13   M09   AX00004636   GAAGGAGTCGTGACTGGTGTAGTCAATGTGGAGGAGTTTGAAGGGCCTTTACA
13   M11   AX00004637   TCGCTACATGCTTTCTTCAATGAAAACGCTTGCTGACGAGAGAAACGTTGGAAT
13   M13   AX00004638   GGGTCTTGGATCTGATCAACCGGATGTAACACTGGGCATCGGTACAATGATTGT
13   M15   AX00004639   GAATGTTTCTTTACAGGAACGACGATTGAAATTTTGCCGATGACTCACCTTGATG
13   M17   AX00004640   TATGTTTATAGCGGGGTGGATTGGTAGCCTAATTGTCGATGCAGCGATTAACGA
13   M19   AX00004641   ATTTATAATACGCGTAAGCAAATAGCTAATTTACAGAATCAAGGACAGAAAGGGC
13   M21   AX00004642   TTAGGTGCTGGACCAACTGCGTATACAAGTTTAGGACCACTATTCGATCAAGGT
13   M23   AX00004643   ATTCACACGTATGCGTAAACAAGACCCACGTGGTGACTTTGGTCGTCAGATGCG
13   O01   AX00004644   AAAAAGAGGAGAATCGTGGTCGCTTAGCATTCTTCGCAGGCATTGATAATTGCC
13   O03   AX00004645   AAGAACAAATATCTCAATTTCAACATGGCTTACTACAAGAGGATCAAACCGGTAG
13   O05   AX00004646   GTTTGGCTAGTTTGTGGGTTAGTTACATGGTTTTTTGTAGGAACAACAATTACTC
13   O07   AX00004647   ACCTTGTTCATTGCCCAGAGCGAGTTCTTCCAGGACAAATTTTACATGAGTTAGT
13   O09   AX00004648   TGATATTTCGCCTAGCATAAACCTTATAGTGGGAACCAAAGATCATCACTATTTG
13   O11   AX00004649   TTTTGAAAGTTTCCATCTTGCTCCAGCTGAAGGAATGGCGTCGGGTGCCTTTCC
13   O13   AX00004650   ATTGATATTGATATACTTCAGAAGCGACCTATTATTAACAATAAGCTGGTCAAGC
13   O15   AX00004651   TTTTCGATTCCCTATCCAATATCAATCAGCAGTTAAGCCGTCGTTACCATATTCT
13   O17   AX00004652   AAGAGGATCTTCCTTTATGGGAAAAACGTCAAGAGGGCTTTACAGTAACTCGTG
13   O19   AX00004653   GAAATATGATTATATATTTGTTTCCACACCATCCATCTTTATACCTGTAGCAGGG
13   O21   AX00004654   CCCGAAGGATAAAGTAGAGCAACATAAAAAAAATACGCCTTTAAAAATCGATGAG
13   O23   AX00004655   TTTTAAGTTATGCCGCTTATGGCATTACCACATATGGTCATACGAATTTGTTTCT
13   A02   EMPTY        -
13   A04   AX00004656   AGTAAGACTTTTACTCGATAGATTGGGAAGCCATCATTTATCAAACGAGGCCATT
13   A06   AX00004657   ACAAGCCATTCTTCATTAAAGATGAAGAACTGTCTATTACACCAAGTATCGGAAT
13   A08   AX00004658   GGAAACGTTAAAGAAAGAAAAGTCAGCGTGCAAAGTAATGATTTTAACGACATTT
13   A10   AX00004659   AGATAACACGAAGCAGGGCGTGCGAAAAGCTCAGAAGTTAGAGAAGAGATGGA
13   A12   AX00004660   GATTGCACCGCAAGCAACAGGTATTGTTATGTACGGAGATGAAACAGGCGTTCA
13   A14   AX00004661   ATATTTGCTGGATCTAGTATCGGATATGCTATAGCTTCCATTATCCCGATAGATC
13   A16   AX00004662   TAATTGGCGTAGAATCCGTCACGAAAACGGTGGAAGTAATGGAAGATTGTATAT
13   A18   AX00004663   TTACTTGTTGGGGTACCAAGCTATGAAACATATGTAGAGCATATGAAAAAGCATC
13   A20   AX00004664   ATATAGAAGAATCCATTACGGCATTTCGTTTTCAAGCATTTTATTATTTACTACGC
13   A22   AX00004665   GGTACAGCATGCAGTGCTTACTTATTTGGAGTAGCAGAGTCATTAACAGTATTAA
13   A24   AX00004666   TATCTCTCCCTCTTGAAAAAAGGTATAAAAGCGAAATGGATAATGACTGTCCACA
13   C02   AX00004667   TTTATTCACTATTTGCAATTGGGACAAAGGTTGGCGTAGGAGCAATTTTTGGATC
13   C04   AX00004668   ATGAAAGCTATGTTTGAGTCTGCAAAGCAGATTGCAATTGGTAATAGCGTAGAG
13   C06   AX00004669   TCGTTCGATTAATCTATGTCGTACTTCTTTTCTCTTTCATTCATGGGGTTGACGA
13   C08   AX00004670   GTTTTGGTAGAATTATTCGCTTACACTATGGATTCCCTTATTTCTTGCGTGCTGT
13   C10   AX00004671   TTGGGTTCTCAACGTTCCAACCCCTATCGAATCAGATTTTTCAGTGATGTACAAT
13   C12   AX00004672   GTGATAAATTCACGATTATGTGGGCAGATTATGATTCCGCCCCAGTATGGAGCC
13   C14   AX00004673   AGGAACATGGAATCCAGGAGATTCAGCGTTACTATATCATTATAGTGGTCAACC
13   C16   AX00004674   GGGATGAACTACCTGATTGCGAATACCATTGCCTATTTAATTGGTGTTGCCAATA
13   C18   AX00004675   AATCAAATGACTGAGCGAAATCGCTTCATCCGCGGTATGATGTCTTGGGTTGGC
13   C20   AX00004676   TGAATTTTTGAAAGGCACAACGAACAAGTATATTATGACATCTTCAATGGCCGTC
13   C22   AX00004677   AAGATACAGTGGTAGAATTCCCCTACCTTTTACAAGGCAACAACCTAGCAGTGT
13   C24   AX00004678   TAGCAATCTGTTTTGCGGATGTATCTAAAGCGAAACGAGAATTAGGATGGGAAG
13   E02   AX00004679   ATCGATTTCACGTGCGAGTGTCCCGATTTTTGTAATGATTAGTGGAGCTTTACTA
13   E04   AX00004680   TTACAGATACGGGATACGTGAGTGACCGTATGAAAGGTGTTATTAAGGGGGCTA
13   E06   AX00004681   CCTAGGTGCTATATTGATTGATCAGGATGCATTAACTTCAGCATCGGAACTATTG
13   E08   AX00004682   TTATAAAGGCCAGGTAGCTGTCGCGAAGTTTCATGAAAAACAGACGCCTGTCAA
13   E10   AX00004683   CAAAATAAAGGAAATTATTAGAAGTGGTGAATCGCACATAGCGATTTGTGAAAGG
13   E12   AX00004684   CCAGCAACTGGATTTGGAGAACAAATAATTACTTGGCAAGGCGGGAAAGTTGAT
13   E14   AX00004685   AGCCATTATACAGATGAGGCTTACTTTGAAATTGAATGCGTTTGTCCAACAAAGG
13   E16   AX00004686   TATTAGAAAAATCGAGTGTATATCAAGCAGGTTAATTTTAGTTAGCGGGAATGCT
13   E18   AX00004687   GAAACCTAAGAAGAAACGAAAAGAGAAGTTAAGCACACGTGACATTGAAGGTTT
13   E20   AX00004688   GAATGATGCTGCTATCCTTCTTAAGGTGTCGCCTGGTCATATTAAGAATATGTGT
13   E22   AX00004689   ACAATAGGCGATTGTTTGGATTATATCGATGAGTATGTTGAATTAAGAAATCCGA
13   E24   AX00004690   CAACGATCTATTATTAGTTGTACCTAAAGAAGATTTAGCAAATGAAAAATTCCCG
13   G02   AX00004691   TTGCGATGTATTTCAGTTAAAGATGGAAGATGTGTTTGTTTTAAATAAGGAGGGG
13   G04   AX00004692   TATTCCAGTTTTTTGTTTAGTTGTTGGCCCCGTATTTGCTAATTCAGTTACTCCTT
13   G06   AX00004693   GCAAATTCATTCGTTACTCGCTCGCAATTTGGGTTTGGAGGAGGGGTCGATGGA
13   G08   AX00004694   CTATCATGAAGGACGAAAACTAGAAAGTTACCGCGGACACATCTTGCGCAATTT
13   G10   AX00004695   ATGTTCCACTTGGCGAAGCGTATGACCTATATGATCAAATTGATCGCCCGTTTTA
13   G12   AX00004696   TAAAAGAGTTTGTCAAAGCGACTGTGCGCGAAGTTTCAGCGTATTTTTTGCAGA
13   G14   AX00004697   AATTTAATTACTTACGACCCTGCAATCCAGATGGCATATCTGTATGTAATTCCAT
13   G16   AX00004698   CACGTATTCTATCGATTATTTGGAAAGGAAAGTTCATACAGCGCATTATTTACTT
13   G18   AX00004699   ATTTTGGGTAGTGGAATCAGAAGGACAAACGATTATCACTGCAACCTTCGCGGT
13   G20   AX00004700   ATTCAATTTGTTGCTTATTATAGCCGCGGATCTGTTATGTATTTTCAGATGGATG
13   G22   AX00004701   ATTTTGGAATCTTACGTGTTAGACGAAATTGATAGTGGCGTTGCGTTTGTTGCG
13   G24   AX00004702   AATATGTTGGGTTGTAAGTATATTTCTTATCCCAGATTATGAACCGAATAAAGTG
13   I02   AX00004703   AAGATGAAGTTTGTTAATAAAAGTTTGGATGTGCAATCCGGCTGGAACGAGGTC
13   I04   AX00004704   GAAACTAGAAGGTGTAGAACCTGTCATTATGATAATTGGAAGAATGATTGTATCA
13   I06   AX00004705   AGAATTCGGCGTAAGCTTAGGATCTAATACAGCATCTCGTTCTAACGGATCAGT
13   I08   AX00004706   GACTACATATTTTGATGGGATGGATGGGATATATGATGGGGTCACACATGAGAG
13   I10   AX00004707   ACATTTCATTGGTAACGCACAGCGCGGCGGACAGGTCATTTATACATATTCAGA
13   I12   AX00004708   AAGGGAGCGGAAACCAAGGCTCACCGAAATCAGGACAATTTCAGCAAGAGTTTA
13   I14   AX00004709   GTACAGCAACAATCGTATACTTCTGAAACAACGAATACTGCTCAGTCAGTTATTG
13   I16   AX00004710   ACGGGAACATTTTGAGGAAGTGTCTGAGAGAATTCAAGCGATGCTTGCTGATAT
13   I18   AX00004711   GTTGCAATAGACAAATTTACCGTTTTAATGTTAGTTGATGGAAAACAACAACTTA
13   I20   AX00004712   AGAAAAGTATGCCTGTTTAGAAGCCGAACGAAACTCACTAAAGGCGGAAAATGA
13   I22   AX00004713   TTGTTGATAGGGCGACACCTCAAATTTATTATACACCTTGTGAATCAGTGACAGT
13   I24   AX00004714   GCAAAGCAGTGCTGCAAAAAAACAACAAGTGATGCATATGAATCAGAAGCTAGA
13   K02   AX00004715   ATAGTAATATGCGCCACAGCAGTATTATTCATTACATTAGCTATGGTAAATGGAG
13   K04   AX00004716   CGAAAGTAGACGATGTTATTACATTGAAAGTACCAATTACAGCGGGAGTAGCAG
13   K06   AX00004717   AGTGGTAAAAACAGTATTGGGCCTAAGTATCATGCTAATAATGCAGTTTATACTA
13   K08   AX00004718   TTGGGATGGTTGACTATAAAGTATTAAAATACGAATTAGAGTATTTTCGGAATCC
13   K10   AX00004719   GAATCGGTAGTGCAATGATACAAAAGTTAGAATGGGAGAACGGAAAAACTACAA
13   K12   AX00004720   ATTAGAACCAGCTAAAGGTGAAGGGGCTATTATTTTCTTAAAGCAGTTGGTGCT
13   K14   AX00004721   ATTAGCAATTTCGGCTTTTAATGCTGTTGATTGTTTGGAAAATACGCTGCCTTCT
13   K16   AX00004722   GCTAGCAAAAGCTAACTGCTCCGTAAATAAGAAGAACACAATGGTCATTTGTATT
13   K18   AX00004723   ACTTATTGTTTATGAAACAAATAGTTGGTGCTGCTATTGGATTCATTTTTGCAGC
13   K20   AX00004724   ATTAGCATGTAGCATGATTAGTTTAAATGTATCACAACACTCTTCATTTAATGGTG
13   K22   AX00004725   TGATCTAGCATTAAGTGAAGATGATATTGCATCTCCACAAAAAGAATGTTACCCT
13   K24   AX00004726   TATTTCAACTGAAGATAAGAATCCTTCAGTATTACATAGTAGATTTGATCAGTTTC
13   M02   AX00004727   CTGTTATAGAGTTAACTTTACCGCCGGATATAGGCAGCATGTTAGACTCCAAATC
13   M04   AX00004728   AATTATTAAAGGAGCGTTAACAGGGGGTTCCAGAAGAGTTGTAGGTTTTGATAG
13   M06   AX00004729   ATGCGCGGCTAATGGAACTTATTGATGTGAGTACAATAGAAACCATGGCAGAAC
13   M08   AX00004730   TGTAGTGCTACAGCTTGCTCTAATTTAAAAATAAGCGAATCCACTTTTAAACGTT
13   M10   AX00004731   CTGTGGATAGGACCTATCCTTGTATTTGTAGGGTTATGTATGACAAACGTTATTT
13   M12   AX00004732   AACTGCTGGTTGCGCATCAACATTTATTTTAACAGTTTCATTTATTCAAAATATCT
13   M14   AX00004733   GGGGGATATATTAGAAATTGTGAATTTTTGGTTTGAAGATAAAGATGTCACAGCT
13   M16   AX00004734   AACAAGTGCAAATTAATAAGATGGTTGATTGGTCGTATGATTTAGTTCTGCAGTC
13   M18   AX00004735   AACATATCATTTCATATTGTGAAAAATTTGTTAGGTGTGGAGATTGCTGAAGAAA
13   M20   AX00004736   ATGAGCTGAAAAAGTTTAAGGAATTACTAGATATGGGCGTTATTACAGAAGATGA
13   M22   AX00004737   CCTCAAAAAAGTATATTCTCAATCGTTTTTTTATCAGTACTTCTCATTGGATCCTC
13   M24   AX00004738   TAAAAGAAATATCTGATATGGAACCAAGTGATTTTAAGAAATATGCTGGGACATA
13   O02   AX00004739   TGCTTTTCATATGGCTTATCAAGGACCTACTTATCGCGTCCAATGTGCTGTATGT
13   O04   AX00004740   AAAATAAAGGCTCATGATGTCGTTGATGTTGTTGAAAAGCTTGCTGAGAAGTACT
13   O06   AX00004741   GGAGAAGGATTTTTTGGGAGGAAAGGAATTACCTATTGAGGCATATTACGGAAT
13   O08   AX00004742   TGTCTATTTTATAAATGGAATGGTGTTAGGTAGAACCTTCCCTATGAAACAAAAT
13   O10   AX00004743   AAGAAGTTAGGTGGGGGATCAACTGCCCATAAAAGTCCGATTGGTTCAACTAAT
13   O12   AX00004744   GATATTATTCCTTTGCAATTTCTACCTGATTTGTTGTTATATTTTGCACTTTCATT
13   O14   AX00004745   TAACGGTGGGAATTTCTCCACTTTCTAAAGCGGATCAGTTTGCTACTCATGGAC
13   O16   AX00004746   AGATAGTGAGGAACATGCGCGAAAGATTGCTATGGAGCAACTAAAGGAATGTTC
13   O18   AX00004747   AACAGAAGAGATATCTGCCGGCACAGAAGAAGTAAGTGCATCTCTTTCGCTAGT
13   O20   AX00004748   CGATACAGAAAAACAACTCATTATGGCTAAAGTTACAGGTAATTTCAAAAGAGGC
13   O22   AX00004749   ATCGAAAAGTCATTATTGTTCTATGGAGAAGTAATTGGTTTAAAGCTGTATAAAA
13   O24   AX00004750   TGCAGAAATGGAGAACCCAGACAAAGAGAAAACCCGTAAAGCAAATCAAAAAGA
13   B02   EMPTY        -
13   B04   AX00004751   AGTGGTGAGAGAACTATATTCTCCAAGTGAGCAATATAAAGTTGAAATAATAAAA
13   B06   AX00004752   ATTTTGGATTACATTTGAATCTTTAATTCTGATTGGAGCAGCCTGGATGTTAATA
13   B08   AX00004753   GCGTTGGTAGTTGGGGAATGTTATTTACACCATCTCCGACAAACAACGCTGAAT
13   B10   AX00004754   GAAAGAAACGCACCATCAAACAAGAAGAATTTAAAAAGATTCCTATCGTTGAGAA
13   B12   AX00004755   TGATTTTGATGAACGAGCGATGTTAATTGGTGGTAAATTACTTTTAAGCCGTATA
13   B14   AX00004756   GTGATCGAAAAATAGAAGAGGTGTTTGAAGAACTTTACGAAAAGATTTATGGTTT
13   B16   AX00004757   AAGTTATACGATCCGGGAACAGGAATGGGTATTATTTTCGATCCAGGACCAGGC
13   B18   AX00004758   CTATCAGATATTATACGTTTACTAGCGGGCTTTCTATTATCCTTAAAATTACTATT
13   B20   AX00004759   TAGGAAACCAGAGCGGAAATGGTTGTTAATTCTACTAATGATAGGAATGTTAAGC
13   B22   AX00004760   GCGAACAACTTGCAAAGAAAAAGCAAGGTAACGGTAATGGTCAAAATGCCAAAA
13   B24   AX00004761   AAGTAGCGTACGCTCTATCTTTTTTCTTAGCGCAGGAGAGAGTGTGGATAGTTC
13   D02   AX00004762   TCTATTACTTAGTATTGCATTCTTCGGTATAGCAATTGCCACATATATTTTCCGCC
13   D04   AX00004763   CACGTTATTTACTTGTCGTTATACCAATGTTGCTCGTTGGTATGTTTGGCATCGA
13   D06   AX00004764   TGGAATTCCGCTTCTTTTCTTCAACGAATGAATCGAATGAAAGTATGCAGAAAGT
13   D08   AX00004765   TATATTCGCAACGCTTTTTTTACTAAGCAGTGCATTTTGCGCGGGTAAAGCACGT
13   D10   AX00004766   GATTCATATGCCACTTCCGGCAAATGGCATGACGAATATAAAAAAGTATATTGAA
13   D12   AX00004767   AAAAATTTTATTCAGTTATGGAGCGATCCAAATGTTTTGGGGACTTGTAATGCTT
13   D14   AX00004768   AACACAGACATGATGATTGTAACCGCAGACATGGGTGCGGCGGCGGTTTTGCG
13   D16   AX00004769   GAAATTCTCCATGTTCGTACAAAAGATCTAGATGAGTGTGAAGGAAATAAATTAT
13   D18   AX00004770   TCGGTATTCGGCATGATAATTGCGCTACTACCGATATTGATAGTTGTTTTTGTAT
13   D20   AX00004771   ATAATGATGATGTTGTTTATGTATCAAGTGTACAATAACCTATTCGTTAAAGATGA
13   D22   AX00004772   GCAATGGCATGGGGTATTTCATTAGGAGATACAGCTTTAGAGAAAAACCAAGTA
13   D24   AX00004773   GGCAGTATTCTTCATATGTAATCCCCTCTCTTTTTTCTTAGGGTGGATTGAATTT
13   F02   AX00004774   TGTTTTTGGTGTTTCTTCTAAGCCGTTACGTTTTATAGGAAAAGCGCTCTTTCAT
13   F04   AX00004775   GTGAAAAGGACATGGTGAATACGGAAACAGATGATCCGAAGTATATATATTATTT
13   F06   AX00004776   ATGAAAGATACGAGCTCAGTAGAGCGACTTGAAATAAAGAAATTTTGTAAAACAT
13   F08   AX00004777   TGCTGGAGCTGACTTCGTAGGCGATGCTGATTACATCGGTAAAATCCAACAAGG
13   F10   AX00004778   GTGGTCGTGTAAAAGACTTACCAGGGGTACGTTACCACATCGTTCGTGGTGCG
13   F12   AX00004779   AGATTCTCGTGAGCAATTCGAAATGCGTACGCACAAACGTCTAATCGACATCGT
13   F14   AX00004780   TTCCAAGGTGTTATCAAACGCCACGGACAATCTCGCGGACCTATGTCTCATGGT
13   F16   AX00004781   TAAAAACTCGCTCTGAAGTTCGCGGTGGTGGTCGTAAACCATGGCGTCAAAAAG
13   F18   AX00004782   TAGAGAATCCAACTCGCATTCGTGAAGTGCGTAAAGCGATTGCTCGTATGAAAA
13   F20   AX00004783   CGAACGTAACCAACGCAAAGTTTATACTGGTCGTGTAGTGTCTGACAAAATGGA
13   F22   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
13   F24   AX00004785   ACCAATCTGCGAAAAATGTAAAGTTATTCGTAGACGTGGAAAAGTAATGGTTATT
13   H02   AX00004786   AGTCAAATGGGGTTCTTTGCTTATTTAACAATCCACCGTTTTGGACTAGGGATGT
13   H04   AX00004787   GAAAGATATAAAATCATTTTTTGTTTGTTTCGAAGAGTCGCTAATGCAGAGGACT
13   H06   AX00004788   TAGTAATATCGTCTTGCATTATGGGAATTAATTATTTAGTTAGCTATATTTGGTCA
13   H08   AX00004789   AGGGAGAGTGATTCCTTATACTGGTGATAGGGAATTTATTACACATCTGGGGAG
13   H10   AX00004790   CACTTTATATCTCCATGAGGAGCGTGCTAACGCTCGTCCGATAATCGTCCCTAA
13   H12   AX00004791   TATCGGACTTGCAAGTGGAGCGACTCTTCTTACAGCTTTCATTTACTCACTTGCT
13   H14   AX00004792   AAATACAATGGGCATGGTGCTATCCGCACTTGTCGATGCAAAAGCAGTTGCAAC
13   H16   AX00004793   CGTCGGAGTTGCTTGTGAGCTTGCAGCAATTAATCGAAATGGTCGTAAGAAGAT
13   H18   AX00004794   AAACATCACTTTTAACAAATTAGATCTTTTAGGATTAGCTAGCGGCTCAATTCTTC
13   H20   AX00004795   CGTAAAGAAGAAGTAGTGAAGTTTCCAATTAAAGATTTCTGTAGCTACTTTACTG
13   H22   AX00004796   TGCGATGACAATAATGGCTTTCTTCATATTCGTTTACCCCTTTTTTATTGTTGGTT
13   H24   AX00004797   TGTCTGCACATCATGCGCGCATTCAAGGATTACAAGAAGATAACTATAACGGTA
13   J02   AX00004798   ATGCTCAATAACGGAGCATGCCTCTTTTATGGAATCGACATGTATAATAATACCA
13   J04   AX00004799   TGCCTACATGGCTTAAAAAACAAATGCAACGCGCATATTTTGAAAAAAACCGGTA
13   J06   AX00004800   ACAAGGGGCTATCTTCTTCAACTCTGTTCAACATATTATTTTGTTTTTTATTTATC
13   J08   AX00004801   CCTGATTATTTTTTTGAAAATGGAAGACTGGAAAGAAGAAATTCATAGAAAGGAG
13   J10   AX00004802   CTTTGCGGGATCTGATAATGATAGCTCGCATGGAGGTTCACATGATTGTGGAGG
13   J12   AX00004803   AGGGAATAGTATGGACTGGTTAGATGGGTTTGGTATATTTTACATCATTGGCGG
13   J14   AX00004804   AAAGGATAAACAAGAAGCATCTGAGCCTGTTGTTCAACGCATGATGACGGACCC
13   J16   AX00004805   TGAAAAAAGAGCAATTAGCAAGGGAACTAATGGTGAAGTGGGTTTTAGAGAACA
13   J18   AX00004806   GTATAAATGATAAGTGTATTGGCTGTGGTGCGGAGGTTGATGATCCAGAGTGCG
13   J20   AX00004807   TATTGTGTGAAGAATGCGATAAAGTAATCATCATTGGTGTAAAAACGGAATCCGG
13   J22   AX00004808   TTGATAAATATAGAAAGCGAGGTTAAGAGAATGAAACCTTTGAAGAAAAGAAAGG
13   J24   AX00004809   TAAAAATAAGTGGCAGAGTCGTGACCGCTTTTTGGCAGGAAATGTGCCGGTTGT
13   L02   AX00004810   TCTCCTTATTAACGGTAACATTCAATCAGTACCATCTGCTGGTTTCGGATTTTAT
13   L04   AX00004811   GAACAAATTCGGTTGCCGTAATTGGGTAAGTCCTGAAGCAAATTTAGCATATGA
13   L06   AX00004812   ATTTACAAAGTTTGGCGTTCCAGAAGCAAAAAGCTTTTTGGATGAATTAGCACCT
13   L08   AX00004813   TATTCATTAATACTGATACGAGCAGTTTTCCCTACGCAAAACTATTAGCAACAAT
13   L10   AX00004814   GTGTTTATTTTGTGCCAGCCTTTCTTGGGGCAAAAAAATACCGTAGGCTCTAAAG
13   L12   AX00004815   ACGCGGAAAAGCATTTGATCATAAGAAAAAAGGGCACGATCATCAACCACCTAA
13   L14   AX00004816   CCATGACCGTACAGAAACCGTACTGAAAGTTTCTCTATATCATGCATATTTGCTC
13   L16   AX00004817   ATGAAAAAGTGGAATGATAAAACGAAAGTTACATGTTCTATATTAGGCCTTTCGT
13   L18   AX00004818   AACGCGTTATCTAGTACACAAGAAGTTCTCTACCAACGAGAATTTCGTAAAGCAG
13   L20   AX00004819   ATCACTCACATTTCTTACAGCTATTTTTACATCTGGTTACAATGATAAACCCGGTA
13   L22   AX00004820   AAAAGCAAGATCGTAATACGGTTGTCATGTGCATTGCCGTATCTATGGTTATTAT
13   L24   AX00004821   TGAAAAAGATGGTATTTGGAGCATTAGCATTTATAGTGACTCTTACAGTTGCTGG
13   N02   AX00004822   TAGCCAAGGTGTCGGTCTTATTTGTTTAGGGGGATTTGCTGCATCTGTTACGTT
13   N04   AX00004823   CTTCTTACTAGTTTGCTAGAAAGATTCTGTGAATTATTGTTCACATTTGTTAGTTT
13   N06   AX00004824   ACTGGATTGGGAATTAGTTGCACAATATTAATAGCGATTCTTCCAGGAGCCATAT
13   N08   AX00004825   TTTTTTTGGTATACAAGGAAGCTATACGGCACAATCTCTCCTTTATGGAATGTTA
13   N10   AX00004826   CCGTATTTCCCGTATTCTTTATGGCTATTTTATTATTCATAGCTAGGTACATTCAT
13   N12   AX00004827   TTTTCTTTTCAAGCACCTATTACTGTTGTTACAAGGAATAAACGATATCCCGCGA
13   N14   AX00004828   GTGCAACAAGCGATGCACTTCATGTCATTCGCTCTTTTTATTTCGTATTTAAAAG
13   N16   AX00004829   TAATGATCGGGATTTTTGTTGTGTTAGTTGCATCAATGGTAAGTCTTGCAAGTTG
13   N18   AX00004830   ACGACCTGTTTATTTATCGTGTGTTTGTATGCGTTTCTCGTCTTTTCGTTTTATGT
13   N20   AX00004831   ACGATGGGTTGCTTCATTTGTAAAGAACTTGGGGATGTCTAAGTTCTTTTTTATT
13   N22   AX00004832   CTTCTTACTCGGTTATATCGGGGCTTCAAACGGCAACTTAGGACAATTCGAGAA
13   N24   AX00004833   TATAGTGAAGGATTATGTTGGATATTAGCAATACTAACTGACTGTAAGTCTTTTC
13   P02   AX00004834   AGTAACGTTCTTTGCACATGGTTTAGCGAAGTTTCAATCAGGTATCGATAACGTA
13   P04   AX00004835   TGAGGAGCACAACTTTTTATGGAGCCTTCAAGGTGGAGATACTGGTAAGGCAAC
13   P06   AX00004836   ATGTCATATTAACATGTATCTTTGAAGTTTTTTGGGTGTTTGGTTTTAATACGGCC
13   P08   AX00004837   TGTAATGGATTTAGCTCTGTTAAATGGCAGAAAACATTTATATCATTACGCAACC
13   P10   AX00004838   TGCAAAAAATTTAATTAAGCGAGTAAAACCAATTGTGACTGAAGCAGAAAGAAGC
13   P12   AX00004839   ATTTGTTTTAGAGTGGGGGAAAGCACTGGGGGGACCTGGTGCTTTTTTCTTTTG
13   P14   AX00004840   TGGAACTCCCAAAAGAACTGAAACGCTTTTATCAAGAAATAGGTTGTGGGTTTTT
13   P16   AX00004841   GGACTACTTATTGAATCCGCCACATTTTTAGAAGATGCTCGATCTAAAGTCTGTA
13   P18   AX00004842   TGGCAAGATCTTTCATTATAAAGAACAAATGTAGTTTGAATGGTGAAACAACAAC
13   P20   AX00004843   GTACTTGTGGTGGAGGCTGCGGATTCGGCGGCGGTTTCGCTTTACTTGTTGTA
13   P22   AX00004844   AATCGTTTTATTTGTAGGACTCGCATTTTTTGTTTTCGGTATGGTTTATCATTTAT
13   P24   AX00004845   TATTTTTTGGAGATTGCATGTATGGTATAACAAGAAACACAATGTTCCTAAGGTT
13   B01   EMPTY        -
13   B03   AX00004846   ATGGGATATGGTGGTAGTTGCGGCGAAGGCTGCGGTTTCGCTGGAGGATTTGC
13   B05   AX00004847   ATTCCTTGCTACTAGTAGCTTATTAGTTTACGGATTTGCCGCTTGTACTTTTTTAA
13   B07   AX00004848   TAAAACGATAAATAAGTTTATAAAAATAAGGAATATAGGAAAGGACCCGCTGGAG
13   B09   AX00004849   ATGAACGTTGGGTATACAGCTTTATTTCTCAAATCATGGCTGAAAACATGGGCAA
13   B11   AX00004850   ATTACGATGAACGCCATTCACTCTACTACTATTCTTTATAATGAAACACCTACAAT
13   B13   AX00004851   GTGACAATATGTTTTGGTTAGGATGCTTTTTAGGATACATTGTAGGTTCTGTTAT
13   B15   AX00004852   TTTACACTGACTTTAGGGGTGTATAGTTCAACAAATCATCAAAAAAGTCCAACAC
13   B17   AX00004853   GGAAACTTTACCATGGTGGGTGTATCTTGTAATCGTTGGGATCGTATTAAGTGG
13   B19   AX00004854   GAAATTATTATTCATTTAAGCGATCTGTTCGGTATTACGATTGATGAATTGTTAAG
13   B21   AX00004855   TAGCGAACATTGCAATTATAGCGGATGCACCGTATGTAATGAATTTTTTACCCCT
13   B23   AX00004856   TATTTATGTCAGGAGTTTAGACCGTACGGGTTACTTTCAACAAAGGCGAGCGTA
13   D01   AX00004857   TTTTTATTTAGCGGTTTTTGAAGAAGAATTTCAAAATGAAAGAGCGCCTTGGGAG
13   D03   AX00004858   GGTAAAGGTGGTAGTGGCGGTAACGGCGGTGGTGAAGTTGGACAAGCTGGTAA
13   D05   AX00004859   TGGCCCAAATGTTGGCCGCTACTTTAATAGTTGGAGTCCCTGTTGTTTTAGTTG
13   D07   AX00004860   GAATATGAAGGATGGAAATGCTACACTGATAAAGCAGGCCAAGAAAGAACGAAC
13   D09   AX00004861   ACAACTCAATACTTCTAATTTTACACAACCACTCCCCGCTAATTCATTTACACTCT
13   D11   AX00004862   TTATATTTGGGCTATTTTTCATTCTATTATTCTTTGCAAGGCCTTTTTGTAAATCG
13   D13   AX00004863   TGAAATCAACGTATGCGATTCGTTCGGATAATTGGTATAATATTCTTACAATTAAA
13   D15   AX00004864   AAGATTGAAAAAGGTGTGATTTATCCATCTAGCATATTGTTATATCAATTATCAGA
13   D17   AX00004865   CGTTTAGAAATGGAGTTGATACATATGCCACATACGAGTGATAACGACAAAAAAG
13   D19   AX00004866   TATCCAACAAGGAGCCGATGCTGTTATGAAGCATGATGCAAGATTCCCGTACAG
13   D21   AX00004867   CATATGAGTGGGGAATCCCTTCATAACAATTCTAAGCAGGAAGGGAGAGTTGTA
13   D23   AX00004868   TCTTTTATTCGGAGTCATTGTCATCGCCCTCTCGTATTTCAACCATAAAAAACGA
13   F01   AX00004869   ATGAGCTGCAATTGTAACGAAGACCATCATCACCATGATTGTGATTTCAACTGTG
13   F03   AX00004870   TATTACTATCCCAGAATTTTTGGAACATCGCTTCCAAGACAAATCCCATATGCTA
13   F05   AX00004871   GAATGGGCTTCGGAGCTTCCAAACCGAAACGAAAGAAGTAGGCTTTGGCGACA
13   F07   AX00004872   TATATGTGATAAAGGACCAGACGTTAATGCTGCCTCGGAATGGGGTGGTACGAC
13   F09   AX00004873   TGGTTCTTGCGGTTCATCTGGAAGATGGGCGAGAAGGCCGGCGCACATATATT
13   F11   AX00004874   TATATCGCTTTGGTTGTCACTTATGATTTTTGATCGGGGCGTGTGGCTGGTGTC
13   F13   AX00004875   TATTGAAAATGGAAATCGCTTATCCTACATACCTCTCATTCCATATACAAATGGTC
13   F15   AX00004876   CGGGTATGTGCTCGCAACTACAGTAGAATGTGCCCTGCAAATGGTTCGGGATTA
13   F17   AX00004877   TCGGTATGCATAAGATGAAACAGAGAATTAATAAGGGGAAGGAAGAAGGAGAGA
13   F19   AX00004878   TGGACACATTTTCGCATCTCTTTCATATAATTTACCAATACAAAAAAAGTTGGTCG
13   F21   AX00004879   CGAGCTTGGAAAGCACGTAAAGAAAATCAAAAACCACATGGCAAAGTGAAAGCT
13   F23   AX00004880   AAAGAGATATGGTCTCGACCACTCACACAATGGGTTGCAAAGACGGTTTATTAC
13   H01   AX00004881   ATCGTTCAAAAAGAACTGTGAAAACAGAAAAAGGGTATGCAGGTGATTCTGTTC
13   H03   AX00004882   AAACAACCGCTATATTATGAGCGGCTGTTTTGCGTTGTATATTTTCTCTGAACTT
13   H05   AX00004883   TGTGGAATAAGGGAGAGGAATTTATGATTAATATCAAAAACTTAGTAGTTGGCTT
13   H07   AX00004884   TTATTTTCCCCCTTTTTCAGCAAAAGTCGTTGTATATTCCCGAATTTATAAAAACG
13   H09   AX00004885   CAGAGAAAAAAACTACTCCATACAAACTTCTATATACGAAACAAAGCAACATCCC
13   H11   AX00004886   AATTGTGTGAGCGTCATCCGTGGAAGAGTTGGAATAAAGTGAAGATTGATCACT
13   H13   AX00004887   TGCTAAGTAGTATTGCATATTTACTAATGATGTTGGATTTCCCGTTCCCAGGGCT
13   H15   AX00004888   TTGTATTGCATGTGGTGCTTGTGGCGCTGCTGCACCAGACATTTATGACTATGA
13   H17   AX00004889   ACGTTTTCTAACAGGAAGGCCATATAAGAGAAGTGAGTTGGCGAGAAAACTATG
13   H19   AX00004890   GGTTGAATCTGACCGCGACCAATCACTACAATATCCGGGTGCAACTGGACTGGA
13   H21   AX00004891   TAGAGTAGAGTTGGAGGAAAGAATAAAAGGTGTTGGACATACAGTTTGGTTTAT
13   H23   AX00004892   ACAAAACAAACAAAATAAACCCAAAACTGGAAATCCAAAATTAGATGGTCCAAAC
13   J01   AX00004893   CTGTACCTGCTACTAATGCATATACCATACTCATGCACCAACCTTTTTTGATAAT
13   J03   AX00004894   AGAAAATATGAAAGAAATTGAGGAACGAATTGAGAAACGACATGTAGCATATAGT
13   J05   AX00004895   TTTATGTTGACTTGGTTAACATGTGCAGTCGGTGAATTTGTTGTCATGGCCATTG
13   J07   AX00004896   GGATAAAAAGCAACTCATTACAGAGGTAAATGACTTATTAGAAACGTATTGTGAA
13   J09   AX00004897   GGATATGAAAAAGAAGAAAATAATGAAGTATATGATAGGAATTATAATGGTTTGC
13   J11   AX00004898   AAAAGGAGGAACACATATGAGTTATGGTGGAAGTTGCGCTGGTTTCGGCGGTG
13   J13   AX00004899   TATTGTGCGTGATACAGAATCGTTGTGGCCAGATTCGTTAGATTTTACTGGTGA
13   J15   AX00004900   GGAGCAATTAATGGGGGATAGGTATGTTTTTAAGAATGATATTAATGCAAAGCTT
13   J17   AX00004901   AGAAATATGGGATTATCTGTCCCACTCGTAAAGCGAATCCTTACAAAAGAATGAC
13   J19   AX00004902   ACCCATACGTAAAATCTGTAAGCGAGAAAGGTATCACTTATACAGCGAAATTTAA
13   J21   AX00004903   GCTGCTAAATGTCGTAAATCTTTCTTCCTTCTATTTTTCTCACTACCATATAACTG
13   J23   AX00004904   GTCATAATTAGTTGTATGATGATTATGGGGAGTTGTGCTAATACATTTGTTGAAG
13   L01   AX00004905   GGCAGAAGAAACGAATTACACGATTAGTGAGTTAAATATTGAAAAAGTCCCTAAG
13   L03   AX00004906   GCAAGGGTTAAATCATTTCTTTGGACCGCTTGAAGCGAAAATTATGGAGATTGT
13   L05   AX00004907   TACAGGAAGTAAAGGGTGGAACCGTTGGCAATCAAGTGCAAAAAAGAAGAAAGC
13   L07   AX00004908   ATCGATTGGGGCTGTTTTCGAATAGAAACAGAACTGTCATATGTACAGACATGTA
13   L09   AX00004909   CAAAAAGCTGAATCATTGTATACAATAGAATTAGAACAACAATTTGTATGGAGTG
13   L11   AX00004910   CTAAGAAAAAGAGTAGAGTGAAAAATGAAATATTACTTTGGACATTAACAGCGGT
13   L13   AX00004911   AACAAAACCAGAACTGTTGGTTTTAGATGAACATATCAATGGTTTAGACGTTGTT
13   L15   AX00004912   GAAATAAGGTGGGACAAAATTTAGAGTTAGAATTACTTCCAATAGGTTCTGTTGT
13   L17   AX00004913   ATTTTTATTCGAAAAAGATGTAGATGGTAAAAAGCAAGTAGTAGTATTTAGGAGG
13   L19   AX00004914   ATCGATTGATTTGGCACAGTTAAGTAGAATGTTTTTCTTACTCGCATTTGCGATG
13   L21   AX00004915   TTTCTACTTCCCTTCTCACCGGATTATTTCTTATATTTCTTCCCTAAACGCGCATA
13   L23   AX00004916   TTACGAAGAGGCACAAAGGAGAGGTTTTCAGGCCTTCTTTCGATGGGTGAAAGA
13   N01   AX00004917   AGGGGACACCCTCTTTATACGTATTTCTTTCATACTTAAAGCTTGAAAGGGAGGG
13   N03   AX00004918   ATGGTATTTACATGAGTACGATTGAGAAATGGACGGCTGTTGATCAATATGTGA
13   N05   AX00004919   TGCGGCAATTATCCTTCAAAAAAATCCACCGACAGATATTAATGCGGCATATGGT
13   N07   AX00004920   CGGATATAGTTGCTGTGGTTACGGATATGGCGGCGGCGGTTGTGGTTATGGAG
13   N09   AX00004921   GAGCCATTCTCTGTACAAGATGAGGTATTGTACGAGACTGGACAATATATGGAC
13   N11   AX00004922   ACCATACTGCAAGTTCTGTATATTGACGACAAGGTCAAGTGGAAACATTTAAAAG
13   N13   AX00004923   GAAAAAGCCACAGAAAAACCAGTTCTTGATTTTAGTTGATTCTCTAATTTTGCTA
13   N15   AX00004924   AAATTACTGGCAGAATTGTGCCGGTTGTTTTGAAATCATCGTGATATATTTGTAT
13   N17   AX00004925   ATTAATAAGTAATTTAGGAGATGCATCAACAGTCACAAAATTACGAGAGAAAGAT
13   N19   AX00004926   ATGTGTAACAGCCTCTATGGATTGGGTGGATTTCTTACATCCAGTTCGCTCTTCA
13   N21   AX00004927   ACATGGTACTTCCGCTTTTATGTATTTCATATTGATTGTTTTAAACGACAGCAAG
13   N23   AX00004928   TTTGCTAAGTATCCTACATTTCGTATTGCGTTACATATTTCAGCGTACTTAACACT
13   P01   AX00004929   TACTATTCTTATTTTTTGTTGATATTGTCATTGCCCTTATCGCTCTTGGCTTTTCA
13   P03   AX00004930   AAATGGTTCTGCCATTTCTTCTAGTATATTAGCAGAATATAATGTAAAGAGAATG
13   P05   AX00004931   GCTGAGAAATACACACTATTAGGGGAGCGCCAATATATTGGAAAAATCCACGTT
13   P07   AX00004932   GACAAGTGCAACATTACGAGCACCTCTTTCTATTCAGTTTTTATATTGGATATTC
13   P09   AX00004933   AATCATCGCATTTGCGTCTATGTTCTTCCCACGTATTTCACCTTTTGGTGCACCA
13   P11   AX00004934   ACATTTTAACGGATGGACGTTATGCACACGTTATCCGCAAAAAACGGGTAAACG
13   P13   AX00004935   TTGTTGAAGGTACTGCTTCAAATGGATTGAAGTTCAGAGGTTATTTAAATGATAC
13   P15   AX00004936   GTACTTTTGTATTCATAGGAGTCTCCACTTTAAACAACGTGTTACAGCGTAAAGT
13   P17   AX00004937   AGTTCGGTTTGCTGTATAGTACCACTGGAATAGCCCTTTTATTCCTTTTATTTTG
13   P19   AX00004938   TAGTGAAGCGTTAATTTTATATAAGGGAGGGTTATTTGAGCGTATAGATAAGGG
13   P21   AX00004939   TTGATACGGAAGAGATTGCGGAGTTTTTTTATGAGCAACTAATTGAAAGAGGATA
13   P23   AX00004940   TGCACAATGGCTATTGTAAAGCTGATCCGCAAGAACAAGAGGGAATTATTACAA
14   A01   EMPTY        -
14   A03   AX00004941   ATAGAGTGTGCAACTCTTACGGGAATGATTACTCAAGAAGATTTGGTTGGGCCG
14   A05   AX00004942   GAGTATGGAAACAGTCAATCTATTACTATGCATTTCGAACAATTTAAAAAGTTGC
14   A07   AX00004943   TATCTCCCGTGATTTCAAAAACTATAGTTGCTGTTGGCTATAATCCTTTTTCTATG
14   A09   AX00004944   TTACTTGCGAATATGACTGAATTTGGGAAAACGCCGTATTATAGTGCAGAGGAA
14   A11   AX00004945   CAAAATGAACATAAAAAAACAAGACTTAGCGAAACGCATTGAAATAGAAAGAGGA
14   A13   AX00004946   GAAGTCTATGGGATATTAAGAATGTACAAAAGATCAAGTTGAAATTAGAAATTGC
14   A15   AX00004947   AGTACCACCAGAACAAACCCCTGTTTGGGAATGTGAAGCAGAGGATTGTTTAGG
14   A17   AX00004948   TTTAAACAGTTTACATGTGTGTAAAGACAGACGTTTTGATGTTTCGAGATTAGAT
14   A19   AX00004949   GATAGTTGCGTTGTGTTTGTAAACGGACAACCTTTTTTAGTTCTTTCAATAGCTG
14   A21   AX00004950   ATGAAAAAGCTCTTGTTGCTCGTCTACTTTCATTATATGCGAAACAAAAACCTTT
14   A23   AX00004951   AACAATCATTTATACGCCTCCCTATTATGTGGTTAACTATTATGATATCCGAGATG
14   C01   AX00004952   TGCAGACGCTGAAATTCGAGAAAAGAGCAAAGTAAAAATGGAGTCATTATTTACT
14   C03   AX00004953   GTGACTACTTTCAAGAAGATGGGAGAAAAGAGAGGAAAAATAATTCAAAACAAAG
14   C05   AX00004954   ACAAGCAGCTCTCTTTATGACAAAAGACGTGGACAAGCTTCTAAATTTAGCTACA
14   C07   AX00004955   AAGTAGCATTGTAGGAACTCTTCCAAACCATATCGTACAAAATATTGAAAAGTTT
14   C09   AX00004956   ATTAATTTCTCTAACCGATTTATATTTTCCGTTAATGCACCTTTCACAAGAGAGAA
14   C11   AX00004957   GACTTTAATCGGAGCAATTTCTGGAGCAGTCTTTGGTAAAATCTCCTATAGAAAT
14   C13   AX00004958   ATCTAGATTAAGTAGAGCAAGAAGTAAGGTTTCAAAACTAATAGGGGAGGGTGG
14   C15   AX00004959   TTTTCAAATGGATTTGACTCATCTGAAGATATAAAACGCCTTCCTAACGATTATAC
14   C17   AX00004960   TTATAGATTGGGTAGATGCTAGTTCAGGTGACATTCGTGCAGCTAGATTTTCTG
14   C19   AX00004961   GTGTACGGTATCATTATGAAAAAAATCCAAAAGTTATTACAAGAAGACGTCTTAA
14   C21   AX00004962   AAATAAGCTTGGTGCTTTTTCACATAAAATTAACATTTCAAGAGGAGCTTGTCTG
14   C23   AX00004963   GTTTCTTGAAGTGTTTGCAGTATACGAGGGATTCGCTAAAGCGGCAGATCAAGA
14   E01   AX00004964   AAAACTACATCATACGGAAAAGCTATATGAATTGACTCAAAAGAAATTTGAAAGG
14   E03   AX00004965   GATCAACTACCTATTAGTTTTCAAACCAAAAGGAGGAGAAAATATGAGTTACGGT
14   E05   AX00004966   AACAAACCTGTAACAAGAGTGTTTCAAGGAAAAGAAGTAATTTCTGGGGTTAACA
14   E07   AX00004967   TCAAGATGTTCGTACAATGGACTGTCATTTAGATGTAGAAGATACGGAAGAGAT
14   E09   AX00004968   AAATTGGCTTCATCACCATATTAGAGGTATGTTAGGTTCTTATATTGGTGCCGTT
14   E11   AX00004969   GGACAAACATTTGCTGATTTTTGCCCTAGCTTAATATCTAAAGGGGCCCGTATAT
14   E13   AX00004970   GAGCAAAATGCGATCTATAGCGATCCAAAAGATGCAGCTAATATGCAAACGGTA
14   E15   AX00004971   GAATAATATCGGGTATGAAAAAAACACGCTAAGCAAATTCGAAGGAAATAAGCAG
14   E17   AX00004972   TTATCAGCTCTAAGACAGGTTAGGGAAGAAAAAATATACTATCATTACGCAAGTG
14   E19   AX00004973   ATGTATAGTGATGGGCGATACTTATATTTTTCTATGTTTAAAAAAACGGACAATC
14   E21   AX00004974   GTGATAGAGAGGTGGGAGATAGTGGGAATGAAAACAAAATTATATTTTAGTGTA
14   E23   AX00004975   AGAAAGACTCGCGCAGCCGATGTATTACTTGAAGAGAGATAATTTTGCATGGAG
14   G01   AX00004976   ACGCTCATAAATGGGGGGCTAGGGCTCTTATCATTTCTTATATAATTGTTACGAT
14   G03   AX00004977   AAGGAATGATGCCTTGGCAATAGGTATTGGTATAGGGGTTGTAATCGGTGTGTT
14   G05   AX00004978   TCTAACAGATCAGCCTGAAGGAAACTCTTTAGGCATGGGACTGTGGCTAATATT
14   G07   AX00004979   TAGTGCAGCGCTAATTTTGGACTGTTTAGAAAAAGGGATACATCCAAACTGGGA
14   G09   AX00004980   GCAGGAATTTGTGAATTTGTGGTGGAAGTAACAGCAGATGCTATTGGGAATTTA
14   G11   AX00004981   GTCTGAAGAAGAAGAGGTTTCCGAGAAAGTTTATAATTACTTACGTCGTAATGAA
14   G13   AX00004982   TTTCATATTTTTACTGATAACTCCTATTGTTTTTTTTGGCTACCGTAGCGTTCGCT
14   G15   AX00004983   TTTAGCGTTAACTGCACCTGTGTTTTCTGGACAATTAAATATGAATTCGACCATC
14   G17   AX00004984   TTCCAAAGATGAAATTTTTCATAATGAGCAAATTGAAAAAGCTATGAATGATGTTA
14   G19   AX00004985   CTGAAGCTGAAATCAATCGTAAACAACAATTAAAACAACTGACTGATAAAATGAC
14   G21   AX00004986   AGAACAACAATACAAAAAGATTATGGACGAAATTCGAGATCGTAGAACCAAATAC
14   G23   AX00004987   GCAAGGTGGACTGTTTCTCGTTGCATTGTTAACGTTCGTCGTCGTTTTAATAGAC
14   I01   AX00004988   AACTATCCTATTTGGGTCTGGGAAGCAAATAATTACCCAAACCGAAATCATAAAG
14   I03   AX00004989   GTGTGAATCAGTACAAAGATAAGCATGAATTACAGCCTTGGAGCATCTTTTCCG
14   I05   AX00004990   AACGCCAGGATTTGTCATACTGTTAATAACGCAAATAATTGGTTGTTCTTTCTCC
14   I07   AX00004991   AATCGGCGTAAAGGTTGGGCTTGTAATAAAAAAGAAATATTTACTACAACAGATA
14   I09   AX00004992   TGATAGTGTGAAAAAGAAAGAGTTTGGAATAGAAGAAAAATTTGAGGAAGTTGAT
14   I11   AX00004993   CCTGTTATCCTCGTTACAAGCTTTTCTCATTATTCTAATGCTGAGCAGCCAAAAG
14   I13   AX00004994   GAACTTAAAAACATTCAACAAGCGGACTATCTCGTATCCTATTCAAATGCAATGA
14   I15   AX00004995   GTTAGAAAAGACGTTACAAAAAATAGATGATTATGAACGCGGCAAAAAAGACCTA
14   I17   AX00004996   GGGAAATGGGAGGATATAAAAATGCTAGATCAAATTACTTGGGGAACGCCAGGC
14   I19   AX00004997   GTTATGGACACCATTAAGAAGATATTGGAAGGGAAGTCCATACAATATGTTAAAT
14   I21   AX00004998   GTACAAGCTTTTATCTTGTTTTTAATTCCGTATACTATCTCAAGATTTTTTCATTG
14   I23   AX00004999   TGTCTCAGTTACCTTCTCTAATGTTTCCTTTATGTTTCCTTCTTGCAATTTGTCTT
14   K01   AX00005000   GGAATAGGCCTACCTATATACTTACTACCTTTCATATTACGAGGGGATTTTGATA
14   K03   AX00005001   ATGTCCATTATATTAAACTTTCCTCATTTTAAAGGTAATGGGATTTGGGAAGGTG
14   K05   AX00005002   GTCAGAGATGTGCGTGATGATTTGGCGCAGGGTTATGAATCCATCTTCTATGAA
14   K07   AX00005003   GGCTAAATTTTCACGAGAGGAAAAAGTAATGGTAGTAAGAAGATATTTAGATGG
14   K09   AX00005004   AACGCAAACTTTTCTAGAATAATGATTGGATATGCTCCTGAAAACCTTACAGCTA
14   K11   AX00005005   TACAAGCTATTTTGGACAACATGAAGCTGCACATTCTAATCATGCAAATAAGGGC
14   K13   AX00005006   AGAAATTCAAAGCTTTTTATCGCCAAATATCTTACGAAATCTTGCCAGAGAGTTT
14   K15   AX00005007   AAATAATCGTAATCCTGAAGAGGTTGCTACAGCGTATTTCGAATATGGAAACAGC
14   K17   AX00005008   AGTAATAATGCTGGTAAAAAGCAACCAAATTTCGATGATTCATCTAATTTCGCTA
14   K19   AX00005009   AATTTTAATTCAGGTTAATTTGGTGGAGGGAATAAAACTTAATCATGTTGAGGTG
14   K21   AX00005010   ATCTGATCACGCAATCAAAATGATGGAGCAAAGACTCCGACTCGAGCAACATCG
14   K23   AX00005011   TAAGAAAAATTCGGCTGTTATTTTTTATTTGTTGTAAAGGATGGAGCGATTTTGG
14   M01   AX00005012   ACACAACAACTTCGGCAACTTGAAGCTGATGGGATTATCCATCGTACCGTATAT
14   M03   AX00005013   TTAACGGTAAATTGGGATCCTTTACTTTCATTGTGCTACTTTTTATGCTTTCTATT
14   M05   AX00005014   TGACTGAAACTTTAAAAACACTTATAATGCTTGATGCTACTTACGTTGTTATTGCA
14   M07   AX00005015   CTCAAGGCGGAGCAAAAAGAAATGATGAGAGACATTCGAAATTTAGAAACGCGT
14   M09   AX00005016   CTCTCGTATGCTGGAGAGCACCTTGTTTGCTGTTACATAAACAAGGGATTCCTT
14   M11   AX00005017   TGGTTTGTATATTACTTATTTAGTAGGTGTAGTCACTTTAGCGGAATCGATCCCG
14   M13   AX00005018   CTACCTCCAGCTAGATACTATCATCAAGAAACGCGAGATGGGATGATATATTCTG
14   M15   AX00005019   AAAAGAAACTTACTATTTTATTTAGCATCGTGTGTATTTTAGTATTAGCAGCATGT
14   M17   AX00005020   TTTGAAGAGGTTTTTTGAAGCTGCTTTTTTATTTGGAGAAAATGGAGGAATTGGT
14   M19   AX00005021   ACAGGCTCTGCACTATTAACTTCTCGCGGAATTTATAAGATGTCTTTAAATCGCT
14   M21   AX00005022   CGTTTTTAGGAAGTGTATATCAAATATTTGGATTGTATCCAGAAATTTATTATGGG
14   M23   AX00005023   CAGTATGAAGATATAGATTTGTGTAATGCGATTCAATCGTTACATGAAGAGTTAA
14   O01   AX00005024   GGGATTGTTACTTGTAATCCCGTTTTGGATATTGATCATTTGGATCATAATAAAG
14   O03   AX00005025   AAGACTTTGCACCGAATCATATTGGAACACAATCAAAAAAAGCTGGTGGCAATAA
14   O05   AX00005026   TTTATCATAACATGCTGCTATCACTACGTGAAAAAGAAAAGGCAGAAATGGCTAC
14   O07   AX00005027   AGAGTTTGCAAATGAAAACTTAACTCCTGCAGAACGACAAAATAATAAGAAACGC
14   O09   AX00005028   GACGCTTGTTCATTCTCTTTTCTTATACGGGGCAATAAGCGCATTATATGTAGGA
14   O11   AX00005029   TGTGAATGAGTACGAGAAAGAAAAATTAGCCCTTCTTGGAATATTTCATATCGAA
14   O13   AX00005030   AGTTTTACTAAAGCGCAAGGGAATGAGAGGAATGGCATATGTAATTTCACTCCA
14   O15   AX00005031   AGGAATCGGATCAGTAATTGAAACATTCGTTGCTGAAGTGTTACCGTTATTTGGG
14   O17   AX00005032   ATTGATGGAAAGGGAAGGCGTTATATCTATTACAGTAAAGGAATTTGAAAAGATA
14   O19   AX00005033   AGCAGGCGTGGCGTTAGGATTTTTCATTGCCCGCAAATACATGATGAATTACTT
14   O21   AX00005034   GTATTGCAGTATTATCGTTTGGTTTAAATAGTCCTAGTATTGAAAAAAGTGCAGC
14   O23   AX00005035   CAATCAAAGAGATGGCACGAGATCGATTATATTTTAAAGAAGATATTCTGGAAAA
14   A02   EMPTY        -
14   A04   AX00005036   CTCCACATAGATTTCATAAGTCAATTATTGATAAAGTATTAGTGGATGGTTCACT
14   A06   AX00005037   AGCTGATTCAAAAGCAGAACTTATAATAACTGTTTCTGCAATAGTATTAACTCCTT
14   A08   AX00005038   ACCAAGTAGTTTTAACAGCAAATGAAACTGTAAATTTATTAGGTGTCACAACCCA
14   A10   AX00005039   GAGAAACATGGATTGGGACTTAACAGAAAAGGTTCTTAGAAATCTAGCTTACATA
14   A12   AX00005040   TAAAGGTGAGTCCTACGAAGTATGGGGACAATCAAATGGATGGTTAAACCTTGG
14   A14   AX00005041   GGTATTAAACCAAATACAAAAGTGGAACTATTCTCTGATACTTCTAATCTGTTCG
14   A16   AX00005042   AAATAAGCGTCCTCAACGCAAAGGTTCCAGCCGACCAAGCAGAAAACCTAAGCG
14   A18   AX00005043   CAAGTTTGAAGATAAAGAGCAACTGCTTTCTTTTTTACATGATGAGGTATTAACG
14   A20   AX00005044   GTTACACTGTTTTACTTTGCGTATTTTCGAGATTCAGTCGAAGCGAGTATTTTTA
14   A22   AX00005045   CAAAAGCATGGCGGGAAAATCTTCTGTGAAATTTGTGGTTTTGACTTTCATAAAA
14   A24   AX00005046   ATTGAAGATAAGCTTAATGAGATAGAAATATTAACTAGAGTTGATATGGAAGAGG
14   C02   AX00005047   GTTTCGATTTCTTATGATTGGTTTCTTTTCATTAACAGCAATTTCTTTAATGGGAT
14   C04   AX00005048   AAGAAGCTACTGTAGTTGTACAAACTGTAGTAGAATCAATCACTAACACTTTAGC
14   C06   AX00005049   TTGTTGCGAAACAAATATATTCCTTTCCGGTTAGACCATTCTCATCCATATTTTCA
14   C08   AX00005050   AAAGCACGTATGATTTATCCCACTCGTTGTATGCAGGAAGATCCCCACCTCAAA
14   C10   AX00005051   AAGATTTCTCCCTTCTTCTTTTACAAAATACGTTTACAAAGAAAGAGAAGGTACC
14   C12   AX00005052   GTTTTAGCTCGTCTTGGTCAAGAGTTCTTAGATGATGATTTAATTCTTGCTGAGT
14   C14   AX00005053   AGATTGCTACGGTATCGTAGGTATGGCATCAAAGAATCAGTTAAAAGATGGATT
14   C16   AX00005054   TCGTTCTGGTAACTCTCGTTCTCACGCAATGAACGCTACAAAACGTAAGTGGGG
14   C18   AX00005055   AATGCCATCTTATTCGGTGGCATTTTCTCATTTTCAATACCTCTCTTTAAACGGA
14   C20   AX00005056   CCACTTAACATCGATTGGGACGGGAATGAACTTTTATTATCAGATGTATTAGGGA
14   C22   AX00005057   AGCTTATAAGAAAAAGCAAGAAGATAAGAATGTAGTCAGAACAGCAAACCAAGC
14   C24   AX00005058   TAATCGATAATCGTATATACAAGCTTCCAGACGGGCGTGATCTATTCGAGGGAT
14   E02   AX00005059   TCCGCATTATGAAATTCAACGCATTCTTAAAAGTGGAAATGCATATGTAGCGGTT
14   E04   AX00005060   GTACTAGAGAGCACATTATGGGAAATGTTAAAATTAGGAGTATTAACTACAGATG
14   E06   AX00005061   GCTAGTGTAGTTATTATATGTGCGCTCGCATTATCAGTGTTATCGATTAGTTCGG
14   E08   AX00005062   TACTTGATCCAGGTAATGGGGGCGCGGGATTAAAAATAGAACCAGGTGGACATA
14   E10   AX00005063   AAATATGGAGGAATTGACAAAGGACCCTGGTGGTCACAGAGTAGCTGATCCTGG
14   E12   AX00005064   ATAGGAAATGGACAGCTGAAAGTTTTTAGGACCATAAACTTAGGGGGAAATAAA
14   E14   AX00005065   AGTAACAGTACTTTACGGGAAATGTGGATCTTGCGGATGTGATCACACAGAGCA
14   E16   AX00005066   TTTTTTATTATGGAGTGGTTTTTCGATTGTCTTATCATTGTCCAATGGTGATAAGT
14   E18   AX00005067   TATTGCTATCCAACTTGTTCATATCCTTCCTACGGTTATGGCGGTTCTTGTGGCG
14   E20   AX00005068   TGATTTGTCCTAACTGTCACAATTCTGCTGAGATTATTCATGTATTAACGGCTCA
14   E22   AX00005069   GTCGGAAGGTTATTAGTTTTCTACAGCATTAGTGAAAAGATGAAGAAAAATGAGA
14   E24   AX00005070   GAGGTAGCGTAATCTTTTGGGGGATTTTAATTTTCATCGGTTTAGTGTTCGATCA
14   G02   AX00005071   GATTTTTAGAGTAATTGTATTTATGTTTAGTTGTATATTTGCATCCGTTGCAGCCG
14   G04   AX00005072   ATCGTTATATTATTTGTAGAGTTTATGGTGTAACCTATTATTTAATTCCGCATTAC
14   G06   AX00005073   GAAACGTATATTTGACTTTCTTCTTTTCACTTTGTATGATTATCAAGTTGTTTTAA
14   G08   AX00005074   GATCAGCGATTATGATGATGGTTATTGGAATAGTAGTCATTTGGGGAGGGCTCG
14   G10   AX00005075   GCAGAAAAAACTTCCAATCATAATGAAAAGCGTACAAATACGTTTCATAATTTTTC
14   G12   AX00005076   ACCAAATCGCGTCACTTTAGTCGGAAAAGCATGGCAAATTCGCCATAAGCTAAA
14   G14   AX00005077   GGTTATAGACCGTTATGTCTAAAGAGTGGTGAAACGAAACTGTTTCACAATTTAG
14   G16   AX00005078   TTATTTCAGGATATATCGCTTCACTGTTATTCAAAAACGATCCAATTCGTACAGC
14   G18   AX00005079   TATGATTTATGTAATGCTAATTTCTATGCTTGTAACAACATTACTTGCTGGCGCA
14   G20   AX00005080   TTGGTGGTTTATTAGCATCTCTTAGCTCAGGAAAAGTTGATTTCGTAATGGCAGG
14   G22   AX00005081   TGGGTGTAGCGCCTTTTTTATTTGTTATTCAAAATGATAGGATATACAGTAGTCG
14   G24   AX00005082   ATTTCTCCAGACACTGCAGTCCGCCTATCAAAAGCATTAGGTGTTCCACTTGAAC
14   I02   AX00005083   AAAGGATCGTGCGTATCAAAAACGCATGGCAAAGCAAAAACAACAAGAGCGTAA
14   I04   AX00005084   TTTTTCTTTCCATATGAAAAGGGGGAAGCGAGAGGAAATTACGTTTTTGAAAACG
14   I06   AX00005085   TTCCGTGACTATCAATTGTTAGCAAGAATAGCGTTTAATTCTTTACTTAGCCTTG
14   I08   AX00005086   ATATACGTATTCGGGGCATATTTGACTGTTTTCTTCATAGGATTTACATACTACA
14   I10   AX00005087   TCGCTTATTCAGCATCTACATAGATCCAAATTCCCTTACCGCTTCCTTAAACGAT
14   I12   AX00005088   AGTGCCTGCTAATTTCGTAATAGATGATAGCGAAGTGGTTATACTTATATTCTTC
14   I14   AX00005089   TTTCATTTTCGTACGAGCTATTTTGCTAATTAAAGTGAAAAGTAGTGTGTCTACTT
14   I16   AX00005090   GTTCAAAGTAAACGCAATGACGCTATTGATTCAGGGGTAGGATTTATCGTCTCA
14   I18   AX00005091   CTTCATTTTACTTATAAAACAAGAAATTATTAGACGCTCATTAGAGGACAAGCTTG
14   I20   AX00005092   GGAGCTCAAATTATAATTGGAATGAAATTTTTTCATAACTATGGTTTCTCCTTTCA
14   I22   AX00005093   TGAACAAAATAGAAAACGTCAGGGAAACGGAAACCCAGCGAAAAAGAAGCCAAA
14   I24   AX00005094   ATTAATCGCATTAGGTGTTGGAGCGGCAGCATATCAATATGCTCGCAAACAAGA
14   K02   AX00005095   TGTTCATTTATCCCGCTATTTGGATTCTTATTTTTAGGATTAATAGCTGTTTCAGT
14   K04   AX00005096   TCCCGAGCGGTATACTTAGTTCGACAACGAGTTTGTTCTTCTTAAGTTTGTTTGC
14   K06   AX00005097   AGTGGATTCTCCGAAAAATAAACAAGAGAAAAAAGTCAATTTTGCAAGTGATTAT
14   K08   AX00005098   GGTGATGAAACTAATCCGAACTGGACTGTCGTAAAAAATGTGAGGAAGGGATCG
14   K10   AX00005099   AATAAATATTGTCGATAGGGCAACAGCGCTAACGAATGAAAATAAAATAACATAT
14   K12   AX00005100   CAATGGGAAATTGGCTGTGTACGAAAAACGGAATATGTAAGGTTAATAATCTGTG
14   K14   AX00005101   AGTATTGTTAGCTTGTTGTGGAATATTTTTGGTGATTGGGGTTATTTATTTAGTTG
14   K16   AX00005102   TCATTCAAGATCGGGCCTAGGTTCTCCAGAAGTAGAAGGACAAGGAACGACAAC
14   K18   AX00005103   TGGATACGATGGGTCGTCACGTGATCGCTGAACTTTGGGATTGCGATTTCGACA
14   K20   AX00005104   TGGACATACCACGAAACGTTGGGGTTACTGTATTTGTGAATCATTTATTTTTTTT
14   K22   AX00005105   GTATTCTTACTTTCAACGCTCCAAGCTGGGATACAATTAAAACAGGTTGTTCAGA
14   K24   AX00005106   TTTCGTTATTATCGCTTTAACTTTTTTAAGTGTGATTAGCTGGGATGCGTTTTTTA
14   M02   AX00005107   TATTTACGGGCATTTTGTTTTCATGTACCTTCGCTCCAGCAGCAGGGAGTTACG
14   M04   AX00005108   TCATTATTTTTTCTTTGCTAAATGCGGGTCAGCTTGCAGAGAATTCGAAGGTGGA
14   M06   AX00005109   TACTGTATAGGGCTTCGCTGATAAGAAAAGCCTTATCATTTGCAGCTCGTTTCAT
14   M08   AX00005110   TCCAATTGTTCAAGTGAAACAGCGTAACAGTAAAAAAGGACAACCGCAGAAATC
14   M10   AX00005111   ACCTCATTATCCCTGCACTTATTGGGCTTTCATTGTATTGGTACACGAAGAACCA
14   M12   AX00005112   CCTATCTTCTTAAGTCTACTCGGTAGCTTTTCTATTTCTAGCGGAATGCTATTAC
14   M14   AX00005113   TAGAGGATTTAGGTTCATTTGTACGCTCCCACGTTCCATTTGTTGAGTATCATCA
14   M16   AX00005114   ATCGGTATTATCATCGTCCTAGTCATATTAGTACTCTCTGTCATGACGATTAATA
14   M18   AX00005115   GAGTGCTTTTTTCTTATGGAAACATGCTATTTTGTTAGGCGCTTTTCATAGAATG
14   M20   AX00005116   TTCATACTTTGCGACAGGAGAATATGATGGAACAGGTATCATATATACTGCTATC
14   M22   AX00005117   TGCTGAAAAATCAAAAAGCGGTACACTGGCAGATATTTTAAAGAAATTGGGATTA
14   M24   AX00005118   CATTTCATTTTACTGCATGATATATTAATAACCGTCGCTGATGCAGAAACGCAGA
14   O02   AX00005119   CAACTAGGGTGGAACCGCGGGCAAACGCTCGTCCCTAGGCAATTAAGCCTTGG
14   O04   AX00005120   CATGTTTAGCATGGTTGCAATATCTAAAAACGAAGCTAGCAAATTGAGATTTGCC
14   O06   AX00005121   GAACAATCTAGCCGCTGGAGCTGGACAACGAAAAGCGCAAGCGGCTCGTTCAG
14   O08   AX00005122   TGAATTTTGAGAGGTGTTACATGTTTACAAACAAGAAATTAATTCGATTCGGTCT
14   O10   AX00005123   AGGAAACGCTGGACCAACTGATCGAGGCGTAGAAAAAGGACGTCAAGGTAATA
14   O12   AX00005124   AAAGATACTTGCGATTTTATTAGTTATCTTTTTAATCGTAGAGCTCGGCAGTAAA
14   O14   AX00005125   GTATCTTTTTAGGAGCCACTTATTATTACAATAAAAGATTTCCAAATCACAGGTAT
14   O16   AX00005126   GCTTTGGTTTATTTCGATACTATGTATCGGTGTTTCCGCGATCACGTTGTTTATG
14   O18   AX00005127   GGAGGGAAATGCGGTAGTAATAGATACAGGTGCGCGAGGTGTTCGTCTATTTAT
14   O20   AX00005128   TTCGTGTAGCTAATCACTACAAGATATGGAAAGGTCACCGTTCACTGAGTCGAT
14   O22   AX00005129   CTATTACGGAAAAAAGTTTAAGGAAGCTGTCGATATTACAGAGCAAGAAATGGA
14   O24   AX00005130   TTGTGGCCTTTGCGTGAAGGCGAAACAAGTTTTACAGGAAGTGCAATGTGAATA
14   B02   EMPTY        -
14   B04   AX00005131   AACGAGCGTTGTTGTTGGAGCACTTATTTTATTTTGTGGGCGTGCTGTACACAA
14   B06   AX00005132   GTTATTTGTACTAGGGCAGTTTGTTTATTTCTTTGTGAACTATTGGCCGAAATGG
14   B08   AX00005133   AAGGCCAACAAAATTGTTGGCGCATGTTGAGGACAATAGAGGATATACAGAGTT
14   B10   AX00005134   AGCTCTCTTTCGGAAGAGGGTTTTTTTACGGATATTTTACGTTCAGTTGACAAGT
14   B12   AX00005135   TACGCGTAGTGAGTATGATCGACTCGTAGAATCGCTATATAGACCTTCTAAAGA
14   B14   AX00005136   AAGCATATTTGTTTGAAACGTGTGGCACATCGTAGTGTCCAAGAAAGCACGGAA
14   B16   AX00005137   GAAGGTACAAGTCCTTAAGTAACTCGAAATTAGGAAGATTAACTTTATGGTACTG
14   B18   AX00005138   TTACATTGCCAGTAAGAAAGAGGTTCCCCACCATCAATTGTTAGAAGAAGAGTTT
14   B20   AX00005139   GTAGGGCTTTCAGTGACAAAAATACATCTATTCCGTGACGAAAATGTAAACTTTT
14   B22   AX00005140   GCAAGGGGGAAGCGAAGCATCACTACTTGCGGAAGTACACTTTATAGAAAAAAC
14   B24   AX00005141   CCTACCGATAAAGAAAATCAAACCGAATTTCATCTTGCACAATCTTACAAAAACT
14   D02   AX00005142   CTTAAATGAAGGTTCGCTTTCTACTTGGAAAGCTCCTACATTGCATGAATCTAGT
14   D04   AX00005143   CAGCATGATGGAAGATACAACATCGTTAGTAGCATTCGCAATGTTTATCGCATTT
14   D06   AX00005144   AAAAAATGAAGCCGCTAGCTATAGAAGAGAGATAGCGAAGCAACGTTTACAAAG
14   D08   AX00005145   ACGAACGGTTGTAATTGTGAAGTGGCAAAGCGACAGCAAGCGGAAAACGATAAG
14   D10   AX00005146   CATGGTAGTTGAGGGGTTAATTGTTGAAGCAGCAGATCTACGCGTTCGATTAGA
14   D12   AX00005147   CTGCAATCGAAACTGACGGTTTCAAATCTCTAGAAGAAGGTCAAAAAGTTAGCTT
14   D14   AX00005148   CCTTATTCCTCCAGCGTTGCTGTGGAGTGCACCTGATATTCCTCTAAATGTTAAA
14   D16   AX00005149   TTTATCGAAATGGAAGGCGCTGACGATGTATTCGTACATTTCTCTGCGATTCAAG
14   D18   AX00005150   TGTGAAGATGCAGTTTTGCAAGTACAAACCATCCTTTCCTCCCAAAAAGAACTTC
14   D20   AX00005151   TTCGAAGATCTTTTACTTACACAATCTTGATACATTTTCAACAAACAAACGCACAA
14   D22   AX00005152   ACCAAACTATGCGTACTACGGCGTACAAACAATGCGTGCAGTAGAAAACTTCCC
14   D24   AX00005153   TCGTAATTCTAATCAATTAGCATCACATGGAGCACAAGCGGCTTTAGATCAAATG
14   F02   AX00005154   TAATCATGATAAGATTGTAGAGGAAATGCATAGAGGATATATGACTGAGAGTGA
14   F04   AX00005155   ACTTATCCCTCCGGTACTACTGTGGAGTGCACCTGATGTTCCTTTAAATGATAAA
14   F06   AX00005156   GAATTCGATACTTTAGAAGCTTTTTTAAATGTGGAGGTATCCACATTCGGTGATT
14   F08   AX00005157   AATTCGATATTTTAGAAGCTTTTTTAAATATAGAGGTATCTGAATTCGGTGATTGG
14   F10   AX00005158   ATCGTTGGTGAAGCGGTAATAGTATGGACGGCAACAGGCTTGTCAGTGATTACA
14   F12   AX00005159   CGCAAGCGAGGAGCCAGTAGTTGTTAAGTTCTTTACTACATGGTGCCCAGATTG
14   F14   AX00005160   ACAGCGAAAAAGGTTTCGGTTTCATCGAAGTTGAAGGCGGTAACGACGTATTCG
14   F16   AX00005161   ACATAATAGAATTGTAGTTTGTCGAGCAGAAAAAGGTTGGACTCAAGAAGAATTG
14   F18   AX00005162   TATTCATTAGTCAGATGTACGTAATACAATTTCAGTCCAGTGATGAAGCAAAAGA
14   F20   AX00005163   TATCCAATCAAGAATGGAAAGATTTGCGGACACGACAATTATATTCTCGCGGAG
14   F22   AX00005164   TGGTGGTGAAATTACGAAACGTCTTGTATCATTAGCTGAGCAACAACTTGGCGG
14   F24   AX00005165   TGGTGGTGAAATTACAAAACGTTTAGTAGCAATGGCTGAACAACAACTTGGTGG
14   H02   AX00005166   GCATAATAAAATTGTAGTTTGTCGAGCAGAAAAAGGTTGGACCCAAGAAGAACT
14   H04   AX00005167   TTGTTATGTTCTTTGTTTGGAGCAGTACTTTAAGTTTGACTCCAGATGATCTTAA
14   H06   AX00005168   ATTAAATCAGCAATTAAGACAGGATACCGTAGCATCGATACTGCTGCGATTTATG
14   H08   AX00005169   TGGAGTAGCGCATTGAGCTTGACTCCAGATGATATAAAAATGGCAAAAGAACAA
14   H10   AX00005170   TATTGTAAGCAAAGATACGGTGTGGACAAAAATTAAACAATTGGCAGAAGAACAA
14   H12   AX00005171   GTTAACGGAATACGGTCATTCATTAGATGCTATACTTGATTCTCTTTGTAACTGG
14   H14   AX00005172   AATCAATTGAACTGATGCTTGATTTAGAAGAAGCGCAGCCAAATATATCCTTACT
14   H16   AX00005173   ACGGTAAAGTAAAATGGTTTAACTCAGAAAAAGGTTTCGGATTCATCGAAGTTGA
14   H18   AX00005174   TGGGTAATGAATTACTTTCACTTTTAGAAAATGCTGGTCGAATGGGCATCCCGTT
14   H20   AX00005175   CCTCTTGGTAGTAGAGGGTCTAATTGTTGAAGCGGCAGATTTGCGTGTAAGATT
14   H22   AX00005176   TGAGAAGAATAGTCCAGTTGTTGAAGGAGTAATGTTTGATGAGAATGGGGATTT
14   H24   AX00005177   ACTTGCAGGGGAAGCGGTAATTATTTGGACAGCAACAGGGTTGTCAGTAATTGC
14   J02   AX00005178   TAATGAATTACTGTCGCTCTTAGAAAATGCCGGGCGAATGGGTATTCCACTCCC
14   J04   AX00005179   GGACCAGCTACGCGAGTGGAAAAAGCAATCAAAACAAGCAAAGAAGAAAAATAA
14   J06   AX00005180   TGAGGTTACTCCACTGAATCCTCCAGTAACAGGGTTTGGGGAACAAGTAATCAC
14   J08   AX00005181   GAAACGAACGGCTGTAATTGTGAAGTAGCAATTCAGCAACAAGTAGAAAATGAT
14   J10   AX00005182   AAAAAATGAAGCGGCTAGTTATAGAAGAGAGATAGCGAAACAACGTTTACAAAG
14   J12   AX00005183   TAAAGGCTGGGGCCTTGGAGTAAATAAAGTAGAGGCTATTGAACTTATGCTGGA
14   J14   AX00005184   TCAAGAAGTTTCTTTCGAAATCGTTGAAGGTAACCGTGGACCACAAGCTGCTAA
14   J16   AX00005185   GAAGCTGTAAAATCAGCAATTAAAGCAGGATACCGCAGCATCGATACAGCTGCA
14   J18   AX00005186   TTGTTCTTGGGGCGAATGCCATCTTGAAAAAGAAGGTAAGACATCGATGCTAAT
14   J20   AX00005187   TGAACATGCGCATTACAGTTGATGATTGTGGGCAAGGATGGTTAGAAATTGCAA
14   J22   AX00005188   TGTGAAGATGCAGTTTTGCAAGCACAAACCATCCTTTCCACCCAAAAAGAACTTC
14   J24   AX00005189   AACGTCAATTTTTATTTTAGATGCTAGACAAACTAACTTTATTGGAGAGTTTGATC
14   L02   AX00005190   CGTAGGATCAGCAAGTGGAGCAGTAGTATTAACAGCATTAATCGTATTTTTATCA
14   L04   AX00005191   ATTAGGATCATTAGGTGGAGCGGTAGTATTAACATCATTTATTCTATTCCTTGCA
14   L06   AX00005192   AATTCAATTTTAAACGAGACATTACCAAACGGGACGAGTAAATCATACACATATG
14   L08   AX00005193   TCAGTTGCTGGGATTGAAATTGCTAGATTAGAACTTTCTCTTCAAGTAGCATTGA
14   L10   AX00005194   GATAATGAAGATACAACAGATTTCTCGTTAATAAAAGGAGATACATTACAGCAAG
14   L12   AX00005195   GAGAGAATTCCAGGTAGGAGTTAAAGGTAAAGGTACATCAGATTTCTCGTTAAT
14   L14   AX00005196   AAACGCAGTTAAAGAGTTCTTTAAGAAGCAAGAACTGGAACGAAATATAAAAGCA
14   L16   AX00005197   CTCAAAGTGAGATTTTACGTGAACAACACATTCAAACTATTATGGATGAAGTAAA
14   L18   AX00005198   GCAACACATTCAAACTATTATGGACGAAGTAAAAGAGCATCAAGCTTCTTATTAC
14   L20   AX00005199   CAAAGATACGATATGGACAAAAATTAAACAATTAGCAGAAGAACAAGTGAAGAAA
14   L22   AX00005200   AGATGTGGAGAAGTATCAGGTTAATAAAGCTTGGAGAAACATTTTTGTACAAGCT
14   L24   AX00005201   TTGGAGTGACGTAAAACAAAATAAAAAGACCCACGGCAATGGGTCCTTTAGAAA
14   N02   AX00005202   ATCAACAGTACTTTACGGAAAATGTGGATCTCATTGCGACTGTGACCATAAAGAA
14   N04   AX00005203   GTCACGTTGATTGCGGTTTTAGCGGTGGGTTCGCATTACTTGTTGTGTTGTTTA
14   N06   AX00005204   AGAGGCGCACTTTGCCTCGCAGGAAGAAGCGAAGCCACCGAACATTCTAGCCA
14   N08   AX00005205   AAACGTGGAAAGAATATCATAATTGGAAATTGTGGAGCATTCTTCACAAAACTGT
14   N10   AX00005206   CATAGAGGCGTTTTTTGCCTCGAAGGAAGAAGCGAAGCCACCGATCATTCTAGC
14   N12   AX00005207   GCTAAATGAAACTGAGCAAAAGCAAGTTGTTAAAACTTGGTCTCGTCGTTCAACG
14   N14   AX00005208   GAACTTCATCGCCAGTATGAAGATTACTGCATTGAATTAGGGATAGAATCGTATT
14   N16   AX00005209   AAAGAAAAGCATTACCTCTTTTTACACACCCTTTGATAATATTACCGGACAAACA
14   N18   AX00005210   TCATTAATTGATTTTCAAAAGCGTCCGTGGTTATGGATTCCACCTGGTTTCGCAA
14   N20   AX00005211   ACACATTGCGATGCCCCTGCCCATTTCATTTCAGGCGCAACTACCATTGATCAA
14   N22   AX00005212   GAACGCAAAAACATGATTGAGTTTATCGAAAAGAAAAAAGGGATTGAACGTGAC
14   N24   AX00005213   TTTTGAATAGGGTGGGTGAAAAGGAGATGAAGGTGTTGTTACTAGGAGATATAG
14   P02   AX00005214   GGTTTAGGCACGTTATTTATTAACTTCTTTTTTGATAGTTTAAATGCATGGAAGAA
14   P04   AX00005215   AGTACGATCATTAGTCGTTTCGCATATATATGCAGGAAAAGGTATCGGACGTATG
14   P06   AX00005216   AACCAAAATTCTTCAAATCAATTAGTAGTACCAGGAGCAACAGCTGCAATCGACC
14   P08   AX00005217   ATTCTTTGTAGGTTTGTTTCAATATTGTCGGCAGAATGAGATGAGCTTTTCTCAT
14   P10   AX00005218   AACCAGCTGTTGCTGCTGCAAAGCAAAGAGCTCATTCTGGACGCCCAACATCTT
14   P12   AX00005219   CATTCTATATAGCGCATTTGAAGCACAAGAAATGCCGCCAACTCCTTTATGGTAC
14   P14   AX00005220   TGGTATGGGACCGGCATCTTTGCCAAAGCTTAGAAAGGCTTTGGAGGAGAGCG
14   P16   AX00005221   AATGGATCCGGAGCCTCTAATGTTGGATTTGTCGTGAATACGTTTAACGGTGTT
14   P18   AX00005222   TCTCAAATACTGGCGGATTTACAGAGCCCCTTCGCCCATTACAGGCGAAAGGAC
14   P20   AX00005223   AGAGGAAGAGAAATTTGATGCCGTTTACTTTTGTCTGTATGAGCCTAACCAACAA
14   P22   AX00005224   AACGAAAATAAACACCATGGCTCTTCTCATTGTGTAGTTGACGTTGTAAAATTCA
14   P24   AX00005225   TGTGTTTGTTGTGTTAGACAAAATAGTCGGCCAGCAGACAGTTTTTCAGGATAAT
14   B01   EMPTY        -
14   B03   AX00005226   CGCTGGGATCGCCTTGCAAGATATCGAACATTTTTTCAAACGTATGAAGCCATC
14   B05   AX00005227   CAAAGGTAGGCGTAAAAGGGAATTATCGAATAGCAGCATTCTCCCGTATTCAGC
14   B07   AX00005228   TGGTTAAAAGAACAAAATGCTCCTTTTGGGATTCAACTGCAAATTTTACAAGCAT
14   B09   AX00005229   CTTTATTAAACCAGCAGCCGGATCAAAAACTTCTGGGTTTGGCGTGCGTTCTAT
14   B11   AX00005230   GACGAAAGCCAAAAAGACAAGTATTGTTCGGGTGTTCGGGGAAGGGCTACTGT
14   B13   AX00005231   AGTAGTGCTCTTGTGTATGCCGCCGTTTTATTACATGAGGATCGCATACTACGA
14   B15   AX00005232   GAAGAAATGGATTCGGAGCTAAGAATAAGAGTAGAAACGGAGCTTTCGAAAAGG
14   B17   AX00005233   ACAATTGGGATTTACTCACCTTCTTCACCAGTAACCTACACTTCTCCCAAAAGAT
14   B19   AX00005234   TACAGCAACAATTCGCTTCTAAGCCAGAGAAGGTAGAAGTACGCTATAAGCAAT
14   B21   AX00005235   GGGAGTGTATTGGGGGACAAAAAGACATTCTTGGCTTAGTTATGTCTCATTTTG
14   B23   AX00005236   CGCAAATGAGGATGACATCATTCAAACTGGCGATGTCGTAGCAATGATTCCGCC
14   D01   AX00005237   TTAAAGGTATCTTCAAAATCAAGCCCCAATTCAGTCGCAGGTGCAATAGCAGGT
14   D03   AX00005238   CGTGTCGATGAGTTGCTACAGATGGTCGGACTAGATCCAGACGTATATCGTAAT
14   D05   AX00005239   CTAGCTGAGGATGGAGCAGTACTTATGCCTTTAGGTGCCTATCCGTTTAGTAAA
14   D07   AX00005240   CGGAGATTACCATTCCATTACGTGATGTAATTGAGGTTACTGAAGATGCTACCTA
14   D09   AX00005241   TTTTGTCACTCAGTTTGCGACATTAATTTGGGCAATGACTTATTTTATTAAACACT
14   D11   AX00005242   TGGGCTAACGGTAATAAATGTAGCGCAGACGCAATTTATGTAGTAAGTCATAAA
14   D13   AX00005243   TTCGTGATTTAATTGTATTCACAAATCGTCGTCTTATTTTAGTGGATAAACAAGG
14   D15   AX00005244   CGGGAACGCTTTATAAACAGTATTACGCAAGATATTACATACTCTCAAGAAAGTG
14   D17   AX00005245   ATGTAAACATATTTTAGTTTATTATAACAATCTTCCTGTTGGTACAGGTCGCATAC
14   D19   AX00005246   AATGCTTGAATTTATGGAGAAAATGCCGGATATTCCTGGATTTGAAAAAACACAT
14   D21   AX00005247   ACACGTAGATTAAACCGCTTAAACCAACGTTTACGTACAATAGAAAACAGACTAA
14   D23   AX00005248   CACAGTTCCTGCTACTACTCAGCTATTAGCTATTGAAAAAGTGCGTGCAGAATG
14   F01   AX00005249   GTTAGAACTATGTGTACTGGCACTTGTGAAACGTAAGGATTGTTACGGCTATGA
14   F03   AX00005250   TGGTATAGAAAACTAACGCGAAACCCTGAAGAAAAAGAGGCATTTGAGTTAGCG
14   F05   AX00005251   TATCCATATTATCAACCAATCCCAGTCCGTTCAGCACCTATTGGTCCAGTAAGCG
14   F07   AX00005252   AAACAGGAGAGGCAAATTGCACATGTGCTGTGAATGAATCGGTTGTTCACCTTG
14   F09   AX00005253   AGTGGATCAAGATGATAGGTAATGTAGGGTTTCCAATTGTTGTAACATTATATTT
14   F11   AX00005254   ACAAGAGAAAAATATTGAACCGAACGCATTGATTGTGATTCGGTTTTTTGATGTG
14   F13   AX00005255   CAAATTCACGCTATTTTACAAATGATTGAGAGAGTAGCGAGTGAAGCGAAAGTT
14   F15   AX00005256   GTATTTGCTACGCTTAGAACACTTCGGGAAAAGAATTTTCTCGCGGGTGGCTTT
14   F17   AX00005257   AACGACTAGAGCTCTTAAAACAAATAGCAAAAGTAACCTCCCCTGCTACTGCCC
14   F19   AX00005258   AAAGGAAGGGGCGTTTCTTTTGAGAAAAATTGGCATCATTGGCGGTACATTCGA
14   F21   AX00005259   TAAAAGATAGTCATTATAAAGGCGCAGAGGCACTTGGAAGAGGCATTGGATACT
14   F23   AX00005260   TATATGTACACGTCAGTAGCTGTGCAAACAGTGAAGGACGGAAAAAGTGATAAG
14   H01   AX00005261   TGCAGAAGCTCACGGTTTACAATACGCTGATGCAAAAGAGCTTCTTGAAAAAGC
14   H03   AX00005262   ATTCTGAACGTATTATTTTAGATGTGAATGGGAAAGAAATCGAAATGTTAGATAC
14   H05   AX00005263   GGCACGTAGCACAAATAAATTAGCGGTTCCTGGTGCTGAATCAGCATTAGACCA
14   H07   AX00005264   TGCGTATCCAGTGTATACGGCAGAGCGTGGTACAGAAGTGTGGCAACCCGTTC
14   H09   AX00005265   CAGGGATTGTTTGTGTTCTATTTATCATCGGTGCGATTGCTACGTGGCGTATGT
14   H11   AX00005266   AGGTGGAGAATTGGTATGTGTTGGATTCGGAGCTTCCTTGGGATGTCAAAAGGC
14   H13   AX00005267   AAACTTTAGCACATTCCTTTTATACTTAAGCGCTACTTACATAGTTGGTATCCTCT
14   H15   AX00005268   TGTTATCAGACAAAGAAGCTCATGATAAAATGTCAAAAGCATCTAACCCGTACGG
14   H17   AX00005269   TGATCCGCATGGCGTTACTGTTTTAGTTTTACTATCAGAAAGCCACCTCTCTATT
14   H19   AX00005270   CACATTACAAATTTGTCCAATATGGAGTCAAACCCGGCTCACAAAAGCCATTCCC
14   H21   AX00005271   AGTCGAAACAATCGTAATGGATTTAACTTTACGTCTTGTCTTAAACAATGGCTTA
14   H23   AX00005272   GGCAAATTTTCTCTCTGTTTACGATGGCTGTAGCAGCAGCGGAAGCCGCGGTAG
14   J01   AX00005273   TATGTTGGATTATGGCGTAGATGTCATTATTACCGATTGGCCAGCACGCGCCTT
14   J03   AX00005274   GCAATATGATACCTTCTTAACACCAAGTGTACAAGTAAGAGAAGACATCTTAATG
14   J05   AX00005275   GCCCGAACCGTGGATAGAAGCGGTTCGGGCCTTTTTATATTTCGAAAGAAACAG
14   J07   AX00005276   GCGAGCTGTACTATACAGCTCGCTTTTGTTTATGATGTGAAATATGATAAATTTT
14   J09   AX00005277   AGCGCCCCAAAACAAAAATGTAGAATTATTGTTTTGGGGTATTTTCTTTTCTTAG
14   J11   AX00005278   ACAATAGAAGTAGGTGTTATTTCTATAAAATATGGAAAACGTAAAGAGTATGTAA
14   J13   AX00005279   TTATCTAAAATTGTTTATTATGAAGGTGTTATGGTAAAAAACAAAACGAAAATCTT
14   J15   AX00005280   TGAAGAAACGATTTACCATTTTGATTGCATATCATTTTTATCAAATGAGTGTTTAG
14   J17   AX00005281   ATTTGAAATGGAGGAGCAACAAAATATGAATAAATTTAAGAGTTATAAATTTGGG
14   J19   AX00005282   GAATCATGAAGATATCTCTAGTGTGTTACATCTTGGTTTTATTAATGAAACAGAA
14   J21   AX00005283   TGTATCCATATTCATACGCAACATTAGAAGAAATTGAAATAGGTATAAAAAAACTT
14   J23   AX00005284   GTGCAGAATTAAAAGAAGTTTTAACAAGACGTATTAAAAATGCTTTCATTATGATG
14   L01   AX00005285   GAAAGAAGAACTTTTATATTTAGTATCGGATTACGGAATTCAACATGAAAAAGTA
14   L03   AX00005286   GCATTAGCAAAGTATATAAAGTACTATAATCATGAAAGAATCAAGAAAAAATCAAA
14   L05   AX00005287   GAAGAACTGGTTAATGATCTTATAAAAACACATATAGGTAAGATAAGAAAAGAGA
14   L07   AX00005288   TACATTATTTATATAATTGTGTTATACTATTGTTGGGGATTACGAGAAATATTTCA
14   L09   AX00005289   AAGAAGCGAAGCCGCCGAACATTCTAGCCACTGTAGCTGGATTCCAATAA
14   L11   AX00005290   GCTTTATCTTTTTTTATTCTATTTATAAATTATAAAATAGATGGACAAACTGCTTTT
14      L13   AX00005291   GGGAAATGAAAAAGAAATTTTTGAACTGATTCAAGCTGAAGTAATGGTGAAATTT
14      L15   AX00005292   GATAACGGATATTACATTTGATTTCATTTACTTGTTAAGTAGTTCTCTTGTAATCC
14      L17   AX00005293   CTGTACTATTAAATCAGATTGAGATAGTAATTGAAATTTTTAAAAATATACAAAAA
14      L19   AX00005294   ATTATTTTACTTAAATGTAACATATGTAATTCATACTTCGACGATTAATTTCGTGG
14      L21   AX00005295   GTGTTGAAAGACACGATTAAAGGTACATATGATAAATTAGCGAGTACATATAAAG
14      L23   AX00005296   TGAAAGATTTCATTGTTACTTGGAAAAGGAGCAATGAAAATATACATATTGAGTA
14      N01   AX00005297   GGAATGGCATTTTTGAAGAAACGTCATAAAAAATTGGATAAATTGAATTATAAGT
14      N03   AX00005298   GGTGGAGTGTATAGTTTTCTATATGTTTTAGTAATTGTAAGAAAACTATTAAGTAT
14      N05   AX00005299   GGGGATTTTTAAGGAAGAAAAAATTAAATTTATAGATTGTAAAGGCGAAGAAGTC
14      N07   AX00005300   AAAACAGCAAGTGAAATTTCTATTTATGAAGATAACACTTCTAAATATCCAATTTC
14      N09   AX00005301   AAGATCGTAATTCTTCATGTGACAATATACTCTTTTTCTTTTACTACAGAGAAGAA
14      N11   AX00005302   ATGAGGGGATATTATGTAAGGAGCAGTTTTTATATGTAGTTTTATTTGTTATAAAG
14      N13   AX00005303   GTGTATCTTGTAAATGGAACAATTTTCGAGTTATCTCAATCGATGTTTCATTATGA
14      N15   AX00005304   ACAATTTGTACAAGTATTATAAACAATATGAATGATTTTCGTAAAAAAGGTGCGAG
14      N17   AX00005305   GGATATTTTTCATGATAAAATTAAATATAAGGATTTTCGTATATGAAGAACTGAAA
14      N19   AX00005306   GTTCTTTTTGTGATTTGTTTTTTGGGTACTATTATTTTTACAATGTTTGATGCTAC
14      N21   AX00005307   GTGTATTTTAGTGAAGAAAATACATATATAGCATGGGCAAATAAAAGAAAAATAT
14      N23   AX00005308   AGACAATTATAAGAAAGTAGAAATAAACGATTCACATATTTCTTTAAGGGATCTTA
14      P01   AX00005309   AACAGGATACATTTCCAGCACACAAAAAGGAAGTTGGAATCATTCCAACT
14      P03   EMPTY        -
14      P05   EMPTY        -
14      P07   EMPTY        -
14      P09   EMPTY        -
14      P11   EMPTY        -
14      P13   EMPTY        -
14      P15   EMPTY        -
14      P17   EMPTY        -
14      P19   EMPTY        -
14      P21   EMPTY        -
14      P23   EMPTY        -
AXCON   A01   EMPTY        -
AXCON   A03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   A05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   A07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   A09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   A11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   A13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   A15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   A17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   A19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   A21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   A23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   C01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   C03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   C05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   C07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   C09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   C11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   C13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   C15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   C17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   C19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   C21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   C23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   E01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   E03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   E05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   E07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   E09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   E11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   E13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   E15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   E17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   E19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   E21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   E23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   G01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   G03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   G05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   G07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   G09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   G11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   G13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   G15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   G17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   G19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   G21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   G23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   I01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   I03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   I05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   I07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   I09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   I11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   I13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   I15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   I17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   I19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   I21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   I23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   K01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   K03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   K05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   K07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   K09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   K11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   K13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   K15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   K17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   K19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   K21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   K23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   M01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   M03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   M05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   M07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   M09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   M11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   M13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   M15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   M17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   M19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   M21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   M23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   O01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   O03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   O05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   O07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   O09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   O11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   O13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   O15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   O17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   O19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   O21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   O23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   A02   EMPTY        -
AXCON   A04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   A06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   A08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   A10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   A12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   A14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   A16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   A18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   A20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   A22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   A24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   C02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   C04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   C06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   C08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   C10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   C12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   C14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   C16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   C18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   C20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   C22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   C24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   E02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   E04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   E06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   E08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   E10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   E12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   E14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   E16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   E18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   E20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   E22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   E24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   G02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   G04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   G06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   G08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   G10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   G12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   G14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   G16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   G18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   G20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   G22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   G24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   I02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   I04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   I06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   I08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   I10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   I12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   I14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   I16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   I18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   I20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   I22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   I24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   K02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   K04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   K06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   K08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   K10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   K12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   K14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   K16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   K18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   K20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   K22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   K24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   M02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   M04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   M06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   M08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   M10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   M12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   M14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   M16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   M18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   M20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   M22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   M24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   O02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   O04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   O06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   O08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   O10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   O12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   O14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   O16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   O18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   O20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   O22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   O24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   B02   EMPTY        -
AXCON   B04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   B06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   B08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   B10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   B12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   B14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   B16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   B18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   B20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   B22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   B24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   D02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   D04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   D06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   D08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   D10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   D12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   D14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   D16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   D18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   D20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   D22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   D24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   F02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   F04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   F06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   F08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   F10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   F12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   F14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   F16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   F18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   F20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   F22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   F24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   H02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   H04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   H06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   H08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   H10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   H12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   H14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   H16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   H18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   H20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   H22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   H24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   J02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   J04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   J06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   J08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   J10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   J12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   J14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   J16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   J18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   J20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   J22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   J24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   L02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   L04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   L06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   L08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   L10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   L12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   L14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   L16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   L18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   L20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   L22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   L24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   N02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   N04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   N06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   N08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   N10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   N12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   N14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   N16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   N18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   N20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   N22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   N24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   P02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   P04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   P06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   P08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   P10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   P12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   P14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   P16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   P18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   P20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   P22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   P24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   B01   EMPTY        -
AXCON   B03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   B05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   B07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   B09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   B11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   B13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   B15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   B17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   B19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   B21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   B23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   D01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   D03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   D05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   D07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   D09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   D11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   D13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   D15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   D17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   D19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   D21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   D23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   F01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   F03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   F05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   F07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   F09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   F11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   F13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   F15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   F17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   F19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   F21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   F23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   H01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   H03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   H05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   H07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   H09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   H11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   H13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   H15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   H17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   H19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   H21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   H23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   J01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   J03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   J05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   J07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   J09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   J11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   J13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   J15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   J17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   J19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   J21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   J23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   L01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   L03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   L05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   L07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   L09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   L11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   L13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   L15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   L17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   L19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   L21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   L23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   N01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   N03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   N05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   N07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   N09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   N11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   N13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   N15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   N17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   N19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   N21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   N23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   P01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   P03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   P05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   P07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   P09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   P11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   P13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   P15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   P17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   P19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   P21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   P23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
Ext1    A01   EMPTY        -
Ext1    A03   AX00005310   AAAGAATTGCGTCCAGGTCATGCGATGACATTTTCAAAGAACGGTTTGTGTATAT
Ext1   A05   AX00005311   TGACGTATGCCATTATTAAAGCAATCAACTTCTTCCTCCCTGTCCGGGTAGATGA
Ext1   A07   AX00005312   AAAACGTGAAGAATCAAACGTGTATAAAGTTAACGGAGAAACAGGTGTGAATTG
Ext1   A09   AX00005313   AAAGATGAACCGCAAGCGAACGCAAAAGGGGATAGCGGGAAAAGCGGTGCGAA
Ext1   A11   AX00005314   CAACGATTCCGTCTAGAGAACATCCGGCAGGAAGTGTTGCCAATGCGCTGTTAT
Ext1   A13   AX00005315   TTTCAGCGATGCTTGCAGCAATGATACTAGTTTCTGGCATACGATGGCGTTTTAT
Ext1   A15   AX00005316   TGCGCTCAAAATAGTCGTACCACCCCATTCCGAGGCTGCTCTAACGTCTGGTCC
Ext1   A17   AX00005317   TTAGATAAAGATACGACAGGTGGTGTCGTGTTTGCTAAGCATAGAATTGCTGGT
Ext1   A19   AX00005318   GTAATGAATCATGCGGAAATTATGCAGATTGGAACACCAGAGGAGATTTATCAA
Ext1   A21   AX00005319   TACAGCAATTCCATTTTCATAAAGCGTTTGTTTCGATTGATGGGTTATTACCTAG
Ext1   A23   AX00005320   AAATGTTATCACTTCCCATTCCACTCACTGTTGCTGTTATGCCTTTTCTTCCTTCC
Ext1   C01   AX00005321   TTCAAGCACTTCAAAAGTTGAAGGTGCAATCTTTTACAATTGAGATTGGGCAAGT
Ext1   C03   AX00005322   ATGCTAGCTTATATGAATGAAGAAGCATATAAAAAAACGTTAGAGACGAAAAGAA
Ext1   C05   AX00005323   GATTCAGAGATTGAAGGATTAGAAGAATCCAAGGGCATTTTAGAAAATCAACGTC
Ext1   C07   AX00005324   AGGAAAAGTATTTTATGGTAATGATTGTTGCGAAGTAAGAGCATGTAGCCATATT
Ext1   C09   AX00005325   TTCAAGACTATATCTTTGATCCATTCTTCTCAACAAAAGATTCCGGCACAGGTTT
Ext1   C11   AX00005326   AAGACTGCGGATGTATTCCGTAGAAATTACGTATATCAATATCCATATCCGCTCG
Ext1   C13   AX00005327   CGTAAAGAGATGGCTATTGTACAATTAACAATTCATGAAGGACGTAATCGTCAAG
Ext1   C15   AX00005328   AAAGATTTAACGCTTTGGATTCTCGGCATTGGAGGATTTATATTTATGGTTGGTG
Ext1   C17   AX00005329   GTGATCGTCTAGATTTGGCATTGGCGGATTGTAAAGAAGATGGTTTTCGTATCC
Ext1   C19   AX00005330   ATAGGTTGTCTACTTCTTGGTATCGTTGGTCTTGTAGCCGGCGTTTCCGCTTTC
Ext1   C21   AX00005331   ATGAGTTTATAGGGAATATGGATGCTTTACTTTTATTATCTTTTCGTGAAGTGTTT
Ext1   C23   AX00005332   CGTATGGTGCCGATTGAAACTGTGTTCAATCGTTTCCCGCGTATGGTACGTATG
Ext1   E01   AX00005333   CAAGTAACCTCAGGGAAGAAAAACCTTCTTATGAGTGAAGATCCACTTGCAGCA
Ext1   E03   AX00005334   GTGTGCAAAAGAATGATGCTCCATGGGTTCGAAAAGAAATGAATGGGATGGGCT
Ext1   E05   AX00005335   ATTATGGCTGGTATGCTTTCTTCACATACGTTTTCACCTGAAAGAATAGAAGAAT
Ext1   E07   AX00005336   TGCCAAAAATGGATGGACATCATTTAACGAAAGTGGTTAAGGATAGTGAAGTAA
Ext1   E09   AX00005337   ATCTGCTTCATATTACGAAAGGTACATTGTATCGTCTTGAAAATTCAACGAAAAA
Ext1   E11   AX00005338   TCAGACAAGCGCAAAAAGTATACGTCTGAAGTGGAAGTGAAAGTAAATCAAGTG
Ext1   E13   AX00005339   TGAATATGACTTCGGGGCAATTTCAAGGTCCTATGGTAGGAGAACTAGCGTATG
Ext1   E15   AX00005340   CGAACAGAAATCAAAAATTATTCATGATTTTAACGAAGGTTTATTTTTAGATCGCT
Ext1   E17   AX00005341   AACCTTTCCCACCAAGCAATTCGTATTTTACAAATCGTTTCTCGTGAGAAAGATA
Ext1   E19   AX00005342   TGCTGGCTTGGTGGGATCCTGAATTACAATTTGAATTTGTTATGATTTTTGATAC
Ext1   E21   AX00005343   ATCTTATTACCGATTCTTATTTTTGGATGGTTAGGAGCTCCGAAATTAGATGTGT
Ext1   E23   AX00005344   TGCAAAAGAGAGTGATGTATCTTTAACAGCAGTAACAAATCAAAAAGAAACACAC
Ext1   G01   AX00005345   CGTACAACTAGCTTCTATTTTTGGCGGGGCATACTTCGTAGTAGAAGAAAATTTC
Ext1   G03   AX00005346   ATTAGGTTGGGCGACTGCTTGGAGTTTTGATGCTTTAAAATTATGGTTAGAAAAG
Ext1   G05   AX00005347   ATGTTCGATATATGGTATTTAACTATTGGACAGACTCATTTGAAGGTGAACTTCT
Ext1   G07   AX00005348   ATATGGGACACCACGGTCACGGTTTAAGTGCAGTAGGACTTGTGATAGGTTTTC
Ext1   G09   AX00005349   GAAAGAGGGAATTAAATTAGAGATTAGTAACTTTTTAACAGAGACAGTAGAGAAA
Ext1   G11   AX00005350   TAATAATCAAGTTGATAAATATATTGCGGATCCGTTATGTGGTTTCATTTGTACG
Ext1   G13   AX00005351   GAACAGCCAGTTCCGTATTTTTTACAGTTGTTAGCACTACCTATATACTTACCAC
Ext1   G15   AX00005352   TTTTTGCTTATCCGCATGGCGGGGGAGCGTATGTTGTATCAAAAGAAAATTTAG
Ext1   G17   AX00005353   TGGACCAGCAGGATTCCAAGATGTAATGGCACAAACGACATCAAGCATATTTGC
Ext1   G19   AX00005354   CCAAGTGTTCACTAAATTCCTTCCGATGCAGGAAGTAGGATTAGGCTGGATCTT
Ext1   G21   AX00005355   CAAAAATTCGAATTTATATGGTATTCCTGTCGTTGTAAAAGATAATGTACAGACG
Ext1   G23   AX00005356   AAAAGAAGAAGAGATGGTTGGGCTTTCTTTATGACGAGTTTAACGATCATTTTAC
Ext1   I01   AX00005357   ATTGGAAGTTATTCGCACATATCAGCGTATACAGCGTTATATGGAGGGGAAGTT
Ext1   I03   AX00005358   CCAATCCACTATCCTTTAGGTGTTATAAAGGAATCTAAACATAAGAAAGAGGCGA
Ext1   I05   AX00005359   TCGTTTGTTTTAATGGCACTACTTGTTATTATCGTAGGATATGGCGGGATGCGAG
Ext1   I07   AX00005360   CGAGTAGGGAATTATCGAAGGTAGTTACAATTCGATTGGCGCTTTTATTCTTCGT
Ext1   I09   AX00005361   AGAAGAAGCTATTCAGCAAGGGATTACATTTTTTGATACAGCAGATTCATATGGT
Ext1   I11   AX00005362   ACCAATACGTAACAGAAAAAGAAATGTTCCCAATTGTTGAAGGTAGCGAAGATCG
Ext1   I13   AX00005363   GTTAGCTTTACCACAGTCTTCACAAATTCAGTTTTCAGATGGATTTGTTTGGGAT
Ext1   I15   AX00005364   TTTACGTTATATATGCTAGCTCCGCATTTAGCTAAACTTGTCATCGATGGGAATG
Ext1   I17   AX00005365   TATATGTTACAAGCATATAATGAACAAGTAAATTTTCAAGAAGGAGAGAATGTGC
Ext1   I19   AX00005366   GATTTTGATCTACATGGAGATATTCTTGTAACAGATCGAAAAGATATGATGGATC
Ext1   I21   AX00005367   TACAAGAAGATGCTGATATTATGGTTACAGCATCGGCTCCTACTAACTTAGAAAT
Ext1   I23   AX00005368   CAGCAGTAGATGCTTATAATAAAGGGTTTAAAATTGTTGTTTATGAAAAGGCGGT
Ext1   K01   AX00005369   AACGTTATATACATCAACACGTGAGACTGAATTCCGCACAGAAGCAAGTTCATCA
Ext1   K03   AX00005370   CAGAACGAGCACCGAGAACATCAAATGGATTTTCACGAGAAACAGCTTATTTATC
Ext1   K05   AX00005371   TAGATCTACTGTTATACCAGACTGGTTTGATCCTATTTCTCCAAATACGTGGCTA
Ext1   K07   AX00005372   GGAGATACATCATCCATTCATGCTTTAGAAAAGCTTTTAAATGATACAGTTCAGT
Ext1   K09   AX00005373   TGACGTTATTTTCCCATTACTACATGGACCAAACGGTGAAGATGGAACGGTTCA
Ext1   K11   AX00005374   TGACCAAGTGAACCCAGGTGATGATGTACGAGTAAATGGAGAGCAGCTTCGAAT
Ext1   K13   AX00005375   GACCAAGCGACAGGTGGTAGTGTGACGATAGCTGGTACAAATATTACTTCTATG
Ext1   K15   AX00005376   TACAACGGTCTCAATCAAAGCAACGAATGTGGAATGGGATTTTTGTTGTACTTGA
Ext1   K17   AX00005377   GAGGCTGCTCCATTTTCACCGTCGAATAAATTTTGGTTCGGTAGTGATGAGAAA
Ext1   K19   AX00005378   GATGCTTTAAAATGGAAAGCATTATTTGATTCTTACAATCGAGAAGTTTTACAGA
Ext1   K21   AX00005379   ATAAGAAAGGGTCAATAGTTTTATGTGATTCAGTATCTCGTTTCAGTGCGAATTC
Ext1   K23   AX00005380   ATACTATCGAATGCGATTAAATATTCATCAGGTAGTAGAGAGAAAATTAAAGTGA
Ext1   M01   AX00005381   AAATGGGGCGTGCCAACGAACGATTTTCATACTTTAAGTGGTGGTGAAAAGCTG
Ext1   M03   AX00005382   TGATAAAAGTAACGGAACTTGTGGAACTTATTCGAGCAGAGGAAAAGCCAAAAC
Ext1   M05   AX00005383   AAATACACCATGGATTGTATCGAAAGAACCTATTAGACCAGAGCAGCTCGATTAT
Ext1   M07   AX00005384   GTAGCATCTTCTCTTTCTACGAAAATAATTTCGGTATTTTAAATTCATTCATAGCC
Ext1   M09   AX00005385   GGGAGGATGGGATGCAACATTGAAAATCTTAGTGACGATGGCAGTTATTGATTA
Ext1   M11   AX00005386   ATTTTGTACAAGAAGATTATTTTGATCAATTTATAATTGAATGCGCGAAAAGTGTG
Ext1   M13   AX00005387   GGCACAAGACGTTTTATGTGAAGTAAATAACTGTAAATTTTGGGCGAACGGTAA
Ext1   M15   AX00005388   ATAGCCGAAATGATAGGGTCGGCAAAAGTTATATCGAACAGCAATACGAAGATG
Ext1   M17   AX00005389   ATATTTCAATGGGAACACTGCTTGAAGGACTCGAACCATTCTTTAATACTTGTAT
Ext1   M19   AX00005390   GTTTTTGGAGCATTATTTGGTCCAGTGGCAGGACTGTTAATCGGACTTATCGGT
Ext1   M21   AX00005391   GATCATTTTCCAGTTCAATCTGGATATGTATTAATTTTCGATTGGTTTGATGGTG
Ext1   M23   AX00005392   GATATGAGTATGTTCCAAAAGATGCAACGAATTGGCGTTTTTTTAGAAAGGGAAA
Ext1   O01   AX00005393   GTCAAGGTTCTACAGTAACTCCAATTCAATTAATCCAAGCGGCTACTGCTATAGC
Ext1   O03   AX00005394   TTGTTTTATTTTCACAAGTAAGAACAGAAGTAATTAGGAAAGAAGGAAGAGCTGT
Ext1   O05   AX00005395   AATGAACAGTTTGTCATAGGGACGACTGATTGCGAATCAGGGCAAGCCATTTAT
Ext1   O07   AX00005396   TCACGATCGGTTGGGAGTTTTTAGTGAGCGGATTCTTTCTCTACATGGCAGATA
Ext1   O09   AX00005397   AAAAAATCAGTGATGCATCCAGCTCTTGGAGAATTATCCCTTGATCAGTGGATAG
Ext1   O11   AX00005398   TTTCCATTACCTATTGAAATCATCCCTTTTTCATGGAAACAAACCGAAAATAAAAT
Ext1   O13   AX00005399   GCTTTTATTAGTTTAATGTTTTGCTACGGGATTGAAGCGAGCCAATTGTATCATG
Ext1   O15   AX00005400   AATTGCAAAGGAAAGAGAGTATATGACCTTAATTGCTGGAATTGATGCAGAGAA
Ext1   O17   AX00005401   GAGATTGTTAGGACAGTTGCATCAAGAGCCTACTGGAGAATGGTGGAACGGAA
Ext1   O19   AX00005402   AAAGTGAAAGCGAAGATGAATTAGCAGCGCTTCAAAGTGGGGCAGATGAGTACG
Ext1   O21   AX00005403   ATATTTTGGCGTCGTTATCGCTCCATGCATAAGTCAATAAAGGGATCGGGAAAA
Ext1   O23   AX00005404   TTTTAAAAGACATATTGCTTGAAGAAGAACAAGTTCCATCGACAAATCAATTTGC
Ext1   A02   EMPTY        -
Ext1   A04   AX00005405   CGTACCTGTCGGTTCACATGGCATTATCCCTACTTTTTCAAACGTTATGAACTAC
Ext1   A06   AX00005406   TATTAGAAGGTGCAAAACGTACTGGTCGTGCAACTGGAATTGTTGCTACATCTG
Ext1   A08   AX00005407   ATGTGGAATGGTGTTGGAGGAAAAATAGAAGAGAATGAAACGCCATACGAAGGA
Ext1   A10   AX00005408   TGACGCCGCAAATCGTTAAAAAAGATGTAAGTCAAAATGAATATGCTGTCGTTAG
Ext1   A12   AX00005409   AACAAGGATTGTACCTCCTGTATCGCTCGCTAAATTGGAAGGAAAGATGCGGTC
Ext1   A14   AX00005410   CATTGCTATGACTTCGAAAAATATAAATGACTTGCTTAAATTGGGGGATATGCTC
Ext1   A16   AX00005411   ATTATATGTCTGTGCATGAACTAGTAAATATCATTATACGGGCAAATACGAAATA
Ext1   A18   AX00005412   TTCAAAACTCATTTGGTACAGATCGTCTAACAGTTGGGATAATCATGGCCATTGC
Ext1   A20   AX00005413   TTTCTTCTCATCGTGGGAATGAAATTATGAAAGCTCTTACTGTATTAACTGCTGT
Ext1   A22   AX00005414   CTGCAGCTAATGTTGCAAAACAAACATTACCACAACTGCTTACAGCCACACCAG
Ext1   A24   AX00005415   ACTCTATTGAGGAGTCTCTGTCTGGAAAAGGATGGCTTAATGAACCAGTGGAAG
Ext1   C02   AX00005416   GAAGTGTTTGAAGAAACTGGACTTATTATTAAAAATCCAGAACTATTCCGTACAT
Ext1   C04   AX00005417   GAGAGTAAACAGGGGTGGTCCAGAATCTCAAAAAGGAACAATAATATCAGTATG
Ext1   C06   AX00005418   AGAGTCTAGTGAAGAAAGTGAAAGAAAGTAAATGTGGCGATTGCTATAGTTCAT
Ext1   C08   AX00005419   TGGAAGCATGGTCACCACTTATGCAAGGTCAATTATTAGATAACGAAACATTACA
Ext1   C10   AX00005420   CTGGGATTGCTCTTGGTGCTTATTTAGGCGGTATTGTAACGAACTCGTTAGGGT
Ext1   C12   AX00005421   GTGACATACGATATTCGTAATAATGAAGTGGAAGGTGCGGTTGATAACTATTTCG
Ext1   C14   AX00005422   CATATAGCTCAGGTATTCTTGCTGGAGGCGCTCACTTCGAATATCAAAAAGCAT
Ext1   C16   AX00005423   AGAGCAAAAGTTATTAGTAGAACATGACAGATATATATTTCAATTTCCGCTTTACT
Ext1   C18   AX00005424   CAATATCTCAGTTAAACAAGAATGTATGGGTTCATACGGAGTTAGGTTATTTTAA
Ext1   C20   AX00005425   ATACGATGGCGGAATTAGGTGAATTAGCGGAAGTCATATTAAAGCGTGATACAA
Ext1   C22   AX00005426   TTTATATGATCTGGGGGAATTCAATCAAAAGGGCACAGTGCGGACGAAATATGG
Ext1   C24   AX00005427   TGGATCAATCTGCTGCTGATGATTGGACGTTAGGCTATGCATTTTATATAGAAGA
Ext1   E02   AX00005428   ACCTTTAATTGTTCAAATTGCCATTCTCTATTTTGGGATTACATCCGTTGTTGTTT
Ext1   E04   AX00005429   GCCGGAAAACCATTAAATCTTGATGAAATGGGAATTGCTATTCGCAAAGATGATA
Ext1   E06   AX00005430   TGGAAGTGTTAAAGTAGGAGTAAATGATAAAGGGCCAAATGCCGATGCAAGTAT
Ext1   E08   AX00005431   AACATCGAACCCTCTTGTCAATCCAATTCCAAACCGTGCAAGTGCAACATTTACC
Ext1   E10   AX00005432   CGCCGAAAGAAGCAAGGAAAAAGGGATACGCATCTAAGTGTGTAGCGGCACTT
Ext1   E12   AX00005433   AAATAATGATATGATAGAGTTGTTACATTATGGGGATGTTTTAGTCGATGGAAGG
Ext1   E14   AX00005434   ACGTTAGCTGCCGGTGTGCCGACAATTTGGCTCGGTGTATTACAAGAGTTAGAA
Ext1   E16   AX00005435   CTGGAATGATGGCTGGTTCATTTGGGATTGGTTCTGCACCGTTTATTCAGCTTG
Ext1   E18   AX00005436   AATAAACAGTTAGAATCAGAGAGTCAGCAAGTAGAATTTGAAAAGAAACAAGCG
Ext1   E20   AX00005437   GGGTACCGACTGAAGTTTTAACAGGAGAAAACCAAGGATATGCAATGTGCCATG
Ext1   E22   AX00005438   TCAGGCGTTACGTCAATTTTGGACTTCAATTGAGGCGCCAGTAACATTATCTGA
Ext1   E24   AX00005439   TATTACATCGAGTACGAAATTCCCAGCAGAAACAGCTGAAAAGTTTACGAAAGTA
Ext1   G02   AX00005440   TCGATAGATGGAAAAAATATAGAGGGAGAAATGAAACTACAAGTTATTCATGAAT
Ext1   G04   AX00005441   TGCAAGAGCAGGACAAGAGGTGGAACGTCCAGTTCGTACAATTACAATTCATGA
Ext1   G06   AX00005442   TATTAATTGATGCGATGAAGCTTCCTACACCAATTCCGCAAACATCAATTATTAA
Ext1   G08   AX00005443   TGAATCAGCTTGTAGCAAAAACAGTAACGAGACGTTACAAAGCGATTGTACACG
Ext1   G10   AX00005444   CGGCAGAACAACTCGGAAAAAAAGTGGCTACCTTTACTGTAAAACCATCTACAA
Ext1   G12   AX00005445   AAAAAAGATGTTAGAAGAAATGGAGTTTTATTTGGCATTGAAATATGATCGTGAT
Ext1   G14   AX00005446   TAGAGAGTATTTCAACAGGGGCAGCAGGTAGCTGGTCATTAAGTAATTTAGCTC
Ext1   G16   AX00005447   CCAATTGTAGAGCAAATGCCGGTATCGCTTATACTAGATAGCGGAAAAACATATA
Ext1   G18   AX00005448   TAACAGAGGACTTTGGACCAATTACAGTTCCCGAAAATAAGATTTTTGTTATGGG
Ext1   G20   AX00005449   ATACGCATCATTGGGAATGGGCACGTGTAGATGTAAGTGTAGATCGGAATGGG
Ext1   G22   AX00005450   TTTTGAAAGACGAGTCGTTATTGACGACGAGGACACTTAAATATTCTTGTAATAG
Ext1   G24   AX00005451   TTATTTATATCCCGCTTTGTATAGACGAGGAACAGGTTGTTGTTCGCTTACAAGG
Ext1   I02   AX00005452   GTCAAATCCGGAAAAAGTAATCATCAGTACCATGAACCACTAATCTTTTACTCAC
Ext1   I04   AX00005453   AGTAGAACAGACGCTGGTGTACATGCTTTGAATCAAGTTGCTAACTTTCAAAGTG
Ext1   I06   AX00005454   GTTCAACATTGTGATGATGATTTAGTACCCGAGAAAGAACTTTGGGCTATTCATA
Ext1   I08   AX00005455   TCCATGTAGCTGATTTAGAGGAAGCGAAATGTTTCTATGTTGATGGTCTTGGTTT
Ext1   I10   AX00005456   GGCCAGGGATAGGGGGACACTGTATTCCCGTAGACCCTTTATATTTTCAATGGA
Ext1   I12   AX00005457   AAGTTGTCGTACAAGAAGCGAAGATGCATCGACACCTCGTTTTAATTTTAGATGA
Ext1   I14   AX00005458   TCGGTTATTGAAAGAATTTCGAACAGATAAAAAAGAGAAGAAAACATCAAAGTGG
Ext1   I16   AX00005459   GAGCAATTACAATGTTCATCGGTTTCTTCGTAGCGGTACTGTTCTTCTTCTTCGC
Ext1   I18   AX00005460   TTGTTAGCCTTTGTTTATTTGGGCTCGTTTTACAGTTGCAAAGTCTTTTAGAAAA
Ext1   I20   AX00005461   TTGTTATTTGCATTGTTTATCGTTTTATTCGCAATGAGTAGTATAGATGCTGCGA
Ext1   I22   AX00005462   TATTATTGATTATATCAATTACCCAGAGCGAATCTTTCCAGTTGGGCGATTAGAT
Ext1   I24   AX00005463   CGTTTGAACAGAGAGAGTATTTGTCGGCTAAAGATGTAATGGTGCAAATGGTGC
Ext1   K02   AX00005464   CCCAACGATGGCAGCATATTATGCGATGAAAATTGTGAAAGAATTAGGCTTACC
Ext1   K04   AX00005465   GTAGTCTACCTAAAGAGAACAGAGATGGGTCCGTTAGTATTAGATGAAGAACTA
Ext1   K06   AX00005466   TCTTTTTATTTGCTCATACATACTTAAAAAATGTTTCCTTCACACGTTACTTGCTT
Ext1   K08   AX00005467   ACAAAAGTGCTGAGCTTACGCAACAACGAATTAAAAATTCTCAGTTACATGCTCT
Ext1   K10   AX00005468   TTGAACTCGATAATAATGGCTATACGTGGAAGGATAAAGTATATGCTACTCTCCT
Ext1   K12   AX00005469   CGAAATAAATCCCAGTATGAAGGACCTCTTATTCGTTCCTTTGAATCAGCAGGAT
Ext1   K14   AX00005470   AACGATTCAATTAGGAATTTTATTTTTCGTTCCTTATGTCGTTGCTGGTGTTCAC
Ext1   K16   AX00005471   AAACAGATGTAGTGAGGCACGCCCTGCGGGGCGGAGTAACAGATTATATCGTA
Ext1   K18   AX00005472   TGCCAGGTGGAAGAGATGCTAATTTATATGGTGGAGAAGATGTGATTGATATCG
Ext1   K20   AX00005473   AATCTTGAGGTGAAAGGATTCGGATTTCGTGGGAAAGTGATGGGGAAAATGATT
Ext1   K22   AX00005474   CTAACATACATGGCGAACATGGGGAAAATGTCCGTTAGTAATTACTTAGCGCAA
Ext1   K24   AX00005475   CGGAGGGATCGCTTTAGGTTCTTATATAGGTGGCCTTGTAACGAATTCATTAGG
Ext1   M02   AX00005476   TTTCTGAATCGGGATATGGTGTATATCATGGGCCACTTTTTCAGTTAGCGGAAAA
Ext1   M04   AX00005477   GGAACGGATAAAAGCTTAATCTTATCGTCATTACCAAAATCGGTGACAATGCCAG
Ext1   M06   AX00005478   TCCGCCAACGCTTGGCCTAATGAATTACGGTGCTTTTTTTATGAGTAAAGGAATT
Ext1   M08   AX00005479   AAATTCGCGGAGAGCAAAAAGAAATCGGATGGGGTAGCCAAATCCGTTCTTACG
Ext1   M10   AX00005480   CGGCGCAAGGAGTTATAGAGGCTATTAAGCAAAAAGAATCATTTTTTATTTGGGC
Ext1   M12   AX00005481   TAGAATCATAGGCGCACTTCCACAAGGTCAGAAGGTTCAAGTAATCTCTGAAAA
Ext1   M14   AX00005482   AGATGCGGCAATTAGTTTACTTGCTGCGAAGGAAGATGTTTCAAAAATCGCTGT
Ext1   M16   AX00005483   CTTAGTATTTCAGATGGTGAATACTTCTGTGTTTACGATGCAGATAACCAGCCTG
Ext1   M18   AX00005484   CCGCAAATGAAGTTAGAAAGAATACCTGCGAAAGTGAACGATAAAATCATTTTAC
Ext1   M20   AX00005485   GTCAGGGCATTTGTTCTGTCTCATACTTAAGTAAGATCGAAAATGGAAAGATCGA
Ext1   M22   AX00005486   ATTGTTAATAAGGATGGACACGATGTTCGTACCGATTTAACTACTGATAAAAACG
Ext1   M24   AX00005487   ATTGAACTCGATGTCCACTTATCAAAAGATGGTGAACTTGTCGTAATTCACGATG
Ext1   O02   AX00005488   CAGTTGGATTTGTTGGTCTTGTAATTCCGCATATGACTCGTTTCCTCGTAGGCTC
Ext1   O04   AX00005489   GTACGGAGGAAGAAGATGGATAAACAAATAGCGCAGTTGAAAAATCATATTATAG
Ext1   O06   AX00005490   GGCGCTACTTTAAGTGTCATTTTTAACGCACCATTATTCGGTTATTTAGCACCAA
Ext1   O08   AX00005491   ACCAGAGGCACTTACATATGAAAATAAACGCCCGATGTGCGAAGGTGAATGTTG
Ext1   O10   AX00005492   GATCATCCTTATATGTGGGTGTTTTCAGCGGTTTTATTTGCATTTAGTAATATGA
Ext1   O12   AX00005493   AGTCGACAGAAGAAATCTATATGCATCCATCCATAAAACAGCTTAAATTTGAAGG
Ext1   O14   AX00005494   AAGGATGTTGATAAGGAGTATGCCGATATAACAGGAAGCTACCCAAATAGTGTT
Ext1   O16   AX00005495   TGGAGATATGTTCACGGGAAAAGAACGTGCGAAATGGCAAGGTATTTTTGGTGC
Ext1   O18   AX00005496   TTGCAAATGCATTACGTGCAAAGGGTATTGAAGATGATAAAGGTTTAGCGAAATA
Ext1   O20   AX00005497   ATCGGAACACAAGTCGTTTCGCAACTTCAGCAAATTGTATCTCGCCTCACGAAT
Ext1   O22   AX00005498   AAAGGGGTTCCAACTCACTACACACTTGAGTTACCTCCGTACCGCAAGCCAAAA
Ext1   O24   AX00005499   TACGTATCCAGCACGTTGGATTGCGTTACGTATATTAGATGGAGATAAAAATTTC
Ext1   B02   EMPTY        -
Ext1   B04   AX00005500   ATGCCACGCGGTGCTGATAAGATGGGGTTATCCAAAATGAATTTTGCTGGTATG
Ext1   B06   AX00005501   GTACTATTTGCTAAGGCGAAAGGGCTGGGGCGCTTTCATATTTTAAATCGTCAT
Ext1   B08   AX00005502   AAAATCCACAAGTGCCACCGTTTTCACCTTCATTACAATTTTTACTCGGGACAGA
Ext1   B10   AX00005503   GCTTACGATTGATGGTCACGATGTAAAAGAGATGCCGAAACAAGCAACCCGTGA
Ext1   B12   AX00005504   CTTATTAAATCCACCACAAGGTTGCCCATTCGCAGAGCGTTGCCCGCATGCGAT
Ext1   B14   AX00005505   ATTTTTAGAAGATGAGGTGAAGGTACAAAAAAACGGATTGTTTACTCATGTTGCA
Ext1   B16   AX00005506   ACCAAAAAGAAAGTATGAGTACTTTTATGATGGTATTAGCGAGTATGAAAATCGT
Ext1   B18   AX00005507   CAACATTATGTTAAACAATGATTCACGTTGCCATACTAGTAATGTAACGGTAACT
Ext1   B20   AX00005508   AAATATACAGGACTTATTAGAAGAAGACACGTCCAATCAATGGAGAAGACACAAT
Ext1   B22   AX00005509   TGTATATATCGGAATTAATTTTTTATTTGCAGGTTTGATGGCTCTTTTAGGACTTG
Ext1   B24   AX00005510   TGCACATACCGAAAAAGGTAGAGGGGCGTAAAAGTTTACGCATTGCGATGGCTT
Ext1   D02   AX00005511   ATTTTGGCGTTAACAAAACGTGGTGTTTTTTCAGGGGATGGCCAAGGGAATTTT
Ext1   D04   AX00005512   GAAAATTCAACAAGCTTTATCGAGGAGATATTGGCTTTAACGGAAATGGGAATTT
Ext1   D06   AX00005513   AATGGCTGGACGTTACTGGTATCTAGAAGAGCATAAAACAGATATTATGCATGA
Ext1   D08   AX00005514   GCTCTGAATACCCCTAGTAAGGAACAAGAACAACTGTTAGAAACATCTTCTCAAA
Ext1   D10   AX00005515   TATCGTGAAAAACTCAGCTAGTATTATATTCGGTTTATTTTTCATTCTGCTATTCT
Ext1   D12   AX00005516   AAAACCAAAAGAAAGTTTTCTCTCTCTTCTTTCAGCGCCAGCAAGAAGGGCATTA
Ext1   D14   AX00005517   TTCCAAATTGGTACTGCCGGAAGTATTAAAGCCCTATCTAAATTTTCAAATACGG
Ext1   D16   AX00005518   TGAACGCTATGGAATGACTTCTCAAAAAACAGTGGATTGTAGCCAAGAACTGGA
Ext1   D18   AX00005519   TGGCTTCATTACTCAACTCCTACTACACTCACACTACTGAAAGCATCATTTTGGA
Ext1   D20   AX00005520   GCGTAATGGGATTGAGCAAACGATTAGTATCGTATTAGCGCCGCATTATTCTAC
Ext1   D22   AX00005521   TTCAATTCAGGTACAATGGCCCCTGAATTCGAAACCGCTGCCTACAAACTAAATG
Ext1   D24   AX00005522   TGGGAAAATGGAACGAACGGGGCGCATCTTGGTATATACAATTTACTTAGTGGT
Ext1   F02   AX00005523   GGAAAGAGAACGCTACGAGTAGTAGTAACGGAAAACAGATTCTTAATTTAACAG
Ext1   F04   AX00005524   GTCATTACAAATAGCATCGGCGAAAAGCTCTTTGGTGGAAAAGAAAAAATGAAG
Ext1   F06   AX00005525   TTAGTTGCATCTGAGCAAAAACAAGTTGTTAAAACTTGGTCTCGCCGTTCAACAA
Ext1   F08   AX00005526   CTTTTGGCACCCTTAAAGAGCGACAATATTCTTGTAGTGTTGATATGGCCTCATG
Ext1   F10   AX00005527   CGAATTTCGCAGTTGCTTATCCTGAGACAGATATTTGCAATCTATTGAATAAGTA
Ext1   F12   AX00005528   TTAGTACCGCCAGGGTATATTGTCCAATTTATGCCGATTCGAAATGCGAAAAGTA
Ext1   F14   AX00005529   AGTGCAGATAACCATCGGCAATTACTAGTGCCAAAAGGGTTTGCGCATGGATTT
Ext1   F16   AX00005530   ACTTCAACACACGTTGTTATATATGACAACGATGTTCCAGTTGGTGCTGGACGT
Ext1   F18   AX00005531   TCGCTCCTCGCTTACGTACCTACTCAGAAATTGCAAATAACTCTATTACTATCCC
Ext1   F20   AX00005532   ATTATCCGTAGCTGCAACTTATATAGGGATTAGTATAACTGTAGCCGTATTAAAG
Ext1   F22   AX00005533   ACGTCCTGTAGTAAAGAAGAACATGAGCGGTGGTACAAAAGTTGGCATTACACT
Ext1   F24   AX00005534   CTGGCAGTTATGCTTGATGGTAGCATTGCTGCGCAAATTTTGTGGGGCGGAGC
Ext1   H02   AX00005535   AAAATTACATCTGCTGATCTATCCGTTGCTGTAACAAAAGCAGTGGGAGAAGTTA
Ext1   H04   AX00005536   ACGAAATGATTTCAGAAGAGGTACTTCGGATGTATCTTAAAGTTTTGAGAAAATC
Ext1   H06   AX00005537   TAGCCCTAATAAATGCTTGGTATTCAATACAGATAAACAAAAAGATAGAGGACTT
Ext1   H08   AX00005538   ACATGGCTTAGTCATGCTGATACGGCAAACATTAAGCGTTTGAAGCAAAACTTAT
Ext1   H10   AX00005539   GTATGTAACAATAAATCGTGCTAAGATGTACCCTATAAATAATGCTCCTTCTCTT
Ext1   H12   AX00005540   CTATATACATAAATGGCGATACTCTAATTTAAGAAAACCGGCTAGAATATCACTT
Ext1   H14   AX00005541   TGGCAATAAAATTGCATTCAATTGAAACTCCTATTATATGTAATATCTCAGATGGA
Ext1   H16   AX00005542   CCTACTCCAAATTGTCAAGCTAGGCTTATTTTCAACTCAGGTTTACGGAGTTATC
Ext1   H18   AX00005543   GAATCTGCTATAAAATTTTTACTGCACAATTATAACACACGGTTGCCGATACATT
Ext1   H20   AX00005544   TGCCTTAACAAATCTGCTCTCAGAAGTTCATACTGGAACATATGTAGAACCTAGC
Ext1   H22   AX00005545   TGAAAAAGATTGTCCGTATTGTTTTGGGAGGCAATATCTATCAAAGAAAACAGTG
Ext1   H24   AX00005546   ATAAAGATGAGTCGATGCAGCAAGTGTCCATATATGTAAATGAAGGATTTCGCA
Ext1   J02   AX00005547   CATTGCTGCTAATTTGAAAAGCGTAGCTGGGAAATGTGTCACAACGATTTTGATG
Ext1   J04   AX00005548   GATTTTTCAAGTGATGGCATGTGGCATATTGTTTTCATTGTTTTTGAACTTAGAG
Ext1   J06   AX00005549   TATGGATGATCAAAGAAGTTGCCCGTTCGGGTATGTGTCCGCAACTACGGTAGA
Ext1   J08   AX00005550   AACAAGTGGGCTAAATAGTAGGGAGACAATTCAAGTTAGTCAAGAATTGGACAA
Ext1   J10   AX00005551   TGTTGTTACGAAAGATGTATTTTATACGTTCAGAGAAGTTGTTGTAAATAGAGAA
Ext1   J12   AX00005552   ACTTTATTGACATGAGTTTTAGAATGTTGTTTCATAGTCATTGTATTGAAAAAAAA
Ext1   J14   AX00005553   TTGCAATTCTTTTAACAGGTATATCGTCTTTTCGGAAAATGTTAAAAAACTCTATG
Ext1   J16   AX00005554   TGCATCAGAATGTATCGTACCTAGCTCTCACAGTACAGTTACAGGTACGTTAGTT
Ext1   J18   AX00005555   AACGAGGAGATACGTGAAGAGACCAATGAGAGTTTTCTTTATCAAGCTGTAGCG
Ext1   J20   AX00005556   ACACTAGATTGGTTCGTCATTCATACTGCTGATGATTGGATAGAAAGCGTACAAA
Ext1   J22   AX00005557   AAAGGGGATTTCATTACTGAAAAACATAACGGTGGGCAAAATCAGCATAAAGAG
Ext1   J24   AX00005558   GAACAGGATGCACAAGGGTGTGATTGTTGCGTTGTAACTGGGCAAGATTCTAAT
Ext1   L02   AX00005559   AGTGTGTGTACTAAAAGAGGTTTGTGATATAGGAAAACCACTCCTCGGTATATG
Ext1   L04   AX00005560   TTGATGTATTTTATCACTGTTTCGTTTTATTAGCTGAAAAAAATATTGCATTGGAA
Ext1   L06   AX00005561   GTGAAGAACAGGCATTTAAGCTTGCGGAGATTGAGCTTGAAAAGCATTTTTTAC
Ext1   L08   AX00005562   GCGCGATATTGTAGCGATATGTTGTTTAATGAAAGATAAGGAGCTTCGTGCGCA
Ext1   L10   AX00005563   TAGAGGGAGAACTTGCAAGAACGATGAAAGCTCGAAAAATAAGTACCGTTCGGA
Ext1   L12   AX00005564   ATTGCGTTCAAATATTCGTGATGCCTTTCAAATGCAAGAGCTTCATCGTCAGTAT
Ext1   L14   AX00005565   ACAAGGAGGTGTTATTCATTATGGGTAAAGATCGCCAAGAACGAAAACTACGAG
Ext1   L16   AX00005566   GGTGGATAGAGTGTTTCTGCTAAGTAGTGCTCTTGTGTATGCATCGGTGTTATT
Ext1   L18   AX00005567   ATTTGCAGGTGGTGCTCCTTTATTCGTTTGCGAATCGACGGAGGAACTAGAATT
Ext1   L20   AX00005568   GATTCAGCAGTTTGCTTGTAATGATTGTATGGTGGATGTCTTTAGGATCCTCCCA
Ext1   L22   AX00005569   ATTTGTGCCAGCTCTGTTCTTTATGGTTGTTGTAACGATCCTTGAATGGGTACCG
Ext1   L24   AX00005570   ATAGAAATAAGCAAGAGGCTGAGGGACCAATGATTCTTTTTGCAGCTCACTTGT
Ext1   N02   AX00005571   GAGGAACTTTTATTTGATTTTGAAGATGAGCGTATTCATGAAGTTGTAAAAAAAG
Ext1   N04   AX00005572   TTAGGAGTAAGGTTTATAAATGGTAAGGGTGAAGTAATAGATCCATCTGGAGGC
Ext1   N06   AX00005573   TCTCTTCATTCAGATATTATATATATTCAGCGAGACGGCATGTCTATGGAGTTCT
Ext1   N08   AX00005574   ATGAGTCTGTGTTAACGGGAAACGAAGCGAATATAGAGAAGTTTGAGAGCTGCT
Ext1   N10   AX00005575   GTAATTTGTCTAATTACTTATATTGTATTCCTGCAAAAAAAACAGTACATACAGGG
Ext1   N12   AX00005576   AGCTCTTAAACATTTTAAGAGGAGATATGTCTTTTGTAGGCCCTAGACCAGAGAG
Ext1   N14   AX00005577   GAATCTCTTGTTCTCACCTATGATCGCTTATGATTTAGTATTTGGAGTAGGTCAA
Ext1   N16   AX00005578   ACCTGCATTTGGAGACGTTACATGGGCGTGGGTATTTGCTTTTTCCCAATTTATC
Ext1   N18   AX00005579   TACAATTTTCTTAAAGAGTGGCGTTAGAATAATAGGAGAAGTTGTTGGAGTGGA
Ext1   N20   AX00005580   ACTACGATACATTAATTGCTGAAACGGGGAAGTTCACAAGTCAAGTAAGTCGTC
Ext1   N22   AX00005581   AACTATTTTTCACATCGACTACTGCAGGAGAAGCTGGAGAGCTGAAATTAACGG
Ext1   N24   AX00005582   TTTATACGATAGTTTATTTGGTTTATATGATTGGATTAGCATTCAAATTCAAACGA
Ext1   P02   AX00005583   AAGCAAAACGCATTTGGAAACCTGTATTTAATAAGTTAAAAGCGGAAGCTAAGGG
Ext1   P04   AX00005584   GATATCAGTCATACGGTACATATGACGAAACATATTCCCCCTTCCCCTACACAAC
Ext1   P06   AX00005585   CGGTAATTCTTTCTTAGATACAACTGCCACTCCTCCCGGAAAAGATATCGAGATT
Ext1   P08   AX00005586   ACAGAGGAACTGCTGAGACTGAAATAAAAGCTCTTGACACTGCTATCCAAGAAC
Ext1   P10   AX00005587   AACTTTTTATGCGTTACTTCCCGAAAAGATTAGTGAGTTCCTATTCCTACCCATT
Ext1   P12   AX00005588   GTGCAAGAGGTAATTCTGGACTCGGAATAACAATTTCTTATTGGGAATCACTTGA
Ext1   P14   AX00005589   GCGAGATATCTTTAAAAGCCGATATGGACTTTCAGCGTATTTGGTCAGATCGGT
Ext1   P16   AX00005590   CTGCCCTTCCTCTCGTGAGTTTACTTAGTTTATTTTGGATTTCATTCGAAGGCGG
Ext1   P18   AX00005591   TTTTTGTCAAGGAGTAAAAGATGGAGGGTTATCGACTAAATGCTTTGCAGTAGA
Ext1   P20   AX00005592   ATCTACCATCCTTCAAAGGTTAGCATTAATGAAACAACAGGAGACCAATGTCTTA
Ext1   P22   AX00005593   TATTAAAGAATTCAAGCAACAGTAAAATAATAAATGTAACAACTGACATGGCCTC
Ext1   P24   AX00005594   TCTTCATTCTATTTCTCTCACTACAACATAACGGAATCATCTCTTGTTGTAAAACA
Ext1   B01   EMPTY        -
Ext1   B03   AX00005595   AAACCGTATATTATTAATTTTTGGGCATCATGGTGTGGGCCGTGTGAAATGGAG
Ext1   B05   AX00005596   TGGGTGGCAAAATTGCTGGTCAGTTGAAAAATCCTAATACGGGTGAAGTTATGT
Ext1   B07   AX00005597   TGACCATTATCAACTTTGGAGATCTGATATCGACCAACTTATTACCCATTGCACA
Ext1   B09   AX00005598   TTGTTATTTCCCATATGACATTATGCCAAGTGCAGTACAAAAAGTAGCTAATTTTC
Ext1   B11   AX00005599   TGATCAATTGACAAGTGGTATGTTTCAGCTGTTTGCAGACAAACCACTGAGGCC
Ext1   B13   AX00005600   AGCTGAGCGAGATGAATATGCACGAGAATTAGTAAGGTGGAACCGTACTTTTTA
Ext1   B15   AX00005601   GTGGGGCTGTAATTGCCGCATTAATATTTGGTGGGAAAGAGCTGTGGCATAAGA
Ext1   B17   AX00005602   TATACGCTTGGTCCATGGCAATCTTAATGCTTTGCTTTCCGATTGCCACGGAAG
Ext1   B19   AX00005603   TTTAAACCTTCTACACCTAATGAAAACATTTCTAAAAGTCATACAAGCTTTGACTA
Ext1   B21   AX00005604   CAATACATGCAGACACCTGTAGAGAAGGATGTTTTACGTTCGGATTTTTTAATGA
Ext1   B23   AX00005605   ATGTTTATACAATGACGATTGCAGTACTTGCCATTCCGTTAGGGCGGATAGCTG
Ext1   D01   AX00005606   CACCTCTTTCTCACGCTGCAGCTTATTGTTTACCATTTGAAGAAGCCTTTCCTTT
Ext1   D03   AX00005607   GAATGGGAAACGAAAGCCTGGTTCTCACATATAATTTGGGAAGATAGCCTTGCT
Ext1   D05   AX00005608   ACAAATTCTTTTAGTTTTGGACAGATGCTAGTAATTTCCATTGCAATCGGAATTAT
Ext1   D07   AX00005609   CTATAGCAATCCTGCTTTTATGTTCCTTTTATTCTGTGAGACTATTTAAAAAAATA
Ext1   D09   AX00005610   TTTTACTAGAATTACCTCAAAATAATAAACATTACGGTTTATATACTCCCGATGGG
Ext1   D11   AX00005611   CGGCTTCTACAAACTCTTCATCAAAAAGAAAAGTATCACTTCTTTTTATACCCCTT
Ext1   D13   AX00005612   ACGTAGTTCTCATACTGGTGGGAAAGGAATGGGGCTTGCAATTTCGAAAAGTAT
Ext1   D15   AX00005613   CTTATTAATGTGGATGAAGGCTCTTGCTATTTAGGTGAAGTAGCACTTGTACCAC
Ext1   D17   AX00005614   CATACAAGCTTTACCGATTTACATTTGTTCTCACCTCTGTTGCAGAGCCCAGGTG
Ext1   D19   AX00005615   CTTTATGCTCTGCTTTTCCATACCTGGGAACAGGTACATGAAGGAAATGTGGCT
Ext1   D21   AX00005616   CAATTGCCTTACTGCCCGAAAGTCGAGGACTAGGGATAGGTACCAGATTAATTG
Ext1   D23   AX00005617   TATGAAACCGTCAAAAGCATTCATATTTATTTTAGTAGGCTTATTAGCTGTACGC
Ext1   F01   AX00005618   GCTAATTTTGATCAGACATCACTGAAGGGGATAGATATTAGTTCTTCTACCTTTG
Ext1   F03   AX00005619   AGAAAACCACTTTAATGAACCCGACTTAGATTCGTTAGATCGAATCGCATCCTTC
Ext1   F05   AX00005620   GAGGTACTGGGGGTACAAGAAGCCCCACGTTTGTTAAAAGCTACAGCATATAGT
Ext1   F07   AX00005621   TGATTCTACGTATAGTGGATATGAGACAAATAAAAGAAAACCAAACGCTGAGGTT
Ext1   F09   AX00005622   GGTAAAAAACGTATGTCACAGGTGGCTCTAGCAGATAAGGTTGGTGTGACTCCT
Ext1   F11   AX00005623   TGCTTTAAACTTTGCATTTCAGCTCGAAGCCCCGTTCTTAATAAGTGAGACACCG
Ext1   F13   AX00005624   AAGTATAGGAGAAAAGAGTATTGATTTTGCTACCCGACCAACTGTGTTGGCCTG
Ext1   F15   AX00005625   AAGTCTTCAGCTGAAAAGCAATTAACGGAAATCGCTGAACAAATGGCGCAGTAC
Ext1   F17   AX00005626   GATTGGCCGTAGGGGAGATTAGTGGTGTAAGAGGACCATTATTCTTAGATGAGG
Ext1   F19   AX00005627   ACCGATTCGTGAAAAGTATCTAAAACGAACTGAGGAACTATTAAAGCCGGTTTTT
Ext1   F21   AX00005628   TGATAGACCTGAGGTTACAACAAGCGTATTACTGGAGTTTGCGAAGGTACTGAA
Ext1   F23   AX00005629   ACAAGTGGTAACCCGTTTGGACGCCCTAACTATAGTAATAATAAACATGATTGGA
Ext1   H01   AX00005630   GAAAACCGCTGTAGAGCTAAAAGAAGCTGAAGCATTTATGCAAATTCAAGGTGA
Ext1   H03   AX00005631   TGAAACGTACAGAGAGTCGTAGATTTTCACTAGATTATATGAGACCGAATCAGAT
Ext1   H05   AX00005632   TTACGGAATCTGTCCGGTACTGTTTTGTCTTGCAGAAACTCGTACAAAAGCTATT
Ext1   H07   AX00005633   TCAACGTTAAGACCAGACGACTTCCCTCGTATCTACTTAATGAGCTTTAGCCCG
Ext1   H09   AX00005634   CTGGAAAGCTTGTAAAAACGCGTGTCATGGTTGCGGGTAAAAAGCATACGCCTT
Ext1   H11   AX00005635   AAGTACTTGAACTTTATGAGTGGACGGATCCATGCAGGGTACAGTCCATTCACA
Ext1   H13   AX00005636   GGTGAAGTGCAGCAAGTATCCCTTTTATCGTATAAAGATGGCCGAACATTAGCA
Ext1   H15   AX00005637   GTGTATTTGGACAATTCGGAGCAACAGTTAAAAGATGTAATGCAAGAAAATCGTG
Ext1   H17   AX00005638   GAATACCTGAAAAGGACTCTTTAAAATTCGCAGAAACTGCACCCTTTGTTAATTC
Ext1   H19   AX00005639   TTAAGTGAGTTACTTCATGTGTGGCGTGGTCATAAGTTTTGGAGCGAAAATAAC
Ext1   H21   AX00005640   CTAAAAGCAAATCGTATAGGGTTAAGCGATCCACGGTTACATTTCAATGGGCTT
Ext1   H23   AX00005641   ATCTGAAAATCAGATGAATATCATAATTGCCCGTGTAGAAAGTCGTTCGGATTGT
Ext1   J01   AX00005642   TTGGTTAGTCTCTATCTTAGCAATTAAGACTGAAGAATTTTCTAGATTATTGCCG
Ext1   J03   AX00005643   CTTGGTATTCCTTTATACAGCCAAAATATAGAGTCTGCATGGCAAGTAGTCGAGA
Ext1   J05   AX00005644   TGCAAAGAGTGTTTTGAAAAGATACTTGTTAAAAACGGAGACAACAAACCAAAAA
Ext1   J07   AX00005645   ATCGGTAGAGCACGTGCAGTTACCGATGTAGCGTCGCAAATTATTGAAAATGGC
Ext1   J09   AX00005646   CCTAAGGGATACGTAATTATCTTTGGTGATGGTAATCGGCGTAACTTTCAACAAG
Ext1   J11   AX00005647   ATGAATCGCTCAGACGTATAAAATACGGTGAATATAATGGCCATCATCAATGGG
Ext1   J13   AX00005648   AATTTTACAGCATTCCTGCACGTTACATGGATTACGGATTAGCAAAGGCACAGTA
Ext1   J15   AX00005649   AGCACTGGGATTTATCCCAGATAATCTTAAAATGAACTCACATATGCCTAAAGGA
Ext1   J17   AX00005650   AGATGCTCACAGCACGATTATCGAACCGTGTGGACAAGCACTATTTCATTTGTC
Ext1   J19   AX00005651   CGGCTGTTAAGATGACCACGGATAAGCAGACGCGTAAACTGCCAATCGTAGACG
Ext1   J21   AX00005652   TGAAGGATACAAAAAGCTAGAAGGGGCGCTATTTACGGAAGGAAATGCGATAGA
Ext1   J23   AX00005653   CAAGTTTATGGTGATGGAGATACGTTCGCGTTACTTTGCAAAGCGAGTTCTCAA
Ext1   L01   AX00005654   ACGCCGTACATTAGGTATTCAGGAAAAGGATCCAATGGAGATTTTCGTAGATGG
Ext1   L03   AX00005655   CATTACCAATGCAAATGCGTATGCAGCGTGAGATGTCTAAAGTATATAAGGCGC
Ext1   L05   AX00005656   TAGTAGAAATCACAGAGGAAAACGGAAGTATACGCCAGGGACGTGCCATATTTA
Ext1   L07   AX00005657   TACGATGGGTATGTAACGGTACAAGAAGGAGTTGTTACGGGTAAGCTCAGCTGG
Ext1   L09   AX00005658   TGTGCTGGATCAGGCGATTAAACAATTACCGAAGAACATGAAATATATAGTGCTT
Ext1   L11   AX00005659   AGCAGAAACTTACGGCTAAACAAATTCAAGCGGCGTACCTGCTTGTAGAAAACG
Ext1   L13   AX00005660   TTATTGGAGCAATTTGAAATGTATCCGATGCACCCACACGATGACGGTCCGGAT
Ext1   L15   AX00005661   ATTCTGAGTGGACACGCATTATGTCCGAGGTTCGTTTGTATGAGCGTTATGAAG
Ext1   L17   AX00005662   AACACCTAAGTTCCCACTTCGATTAGACCTACAGTTTTTCTCTGATGGTGGTCCT
Ext1   L19   AX00005663   CACGTTACTTAACTCCAATTTATGATCAAGATGCTACACCAAATGGTGCTGACTA
Ext1   L21   AX00005664   AAAAAGTAGCTCTAATACCCAAAAAGGTTGATAAACAACCAGATAGTACAGCGAC
Ext1   L23   AX00005665   TGCGGCAGACGCGGCGCGCTATTTTTCTTATACAGATGGCGAAGAATCGGTTG
Ext1   N01   AX00005666   CATCGCCACAGATACCACTCAAAGCATATGTGTTACAAGCTAGCTAGACGTGAT
Ext1   N03   AX00005667   GAGCAAGGACGTAGGGAACCGGTGACATTATACATTAAAGGTGTTTCTGAAAAG
Ext1   N05   AX00005668   ACATACACGCTTACAAGCTAATCAAGCCTCTAATCGAGCACCGATATTACACGG
Ext1   N07   AX00005669   GTAGTGCAACCGCTTCTGAGTTTAAAGTTAAATCAGGAACATACATGTTGAATAG
Ext1   N09   AX00005670   TGGTAGGGATGGATTGTAAGGTTGGGGTTTCATTAGATGGAAGAGTTGTAGCG
Ext1   N11   AX00005671   CAAGACCTTGTAAATGAACGCATCGATAAACAGAAATTAGAAAGTGTACTTCCTA
Ext1   N13   AX00005672   ACCGATGCAATTCGTTTCTCAAACCATGCAGGGCGGAATTACTAATTTCACGGA
Ext1   N15   AX00005673   GCTTTGTTTAATCGAAATGCTCAAAGTGACAAAATCAAGTCATTAGCGGATATAT
Ext1   N17   AX00005674   TATGAACGCAGCAGGTAGCATCATTTCTTCAATTTGGAATGCGGCTAAGTCAGC
Ext1   N19   AX00005675   AGCGCATGAACTAATTAATGAGGGCGATACAATCCGAATCAAGGATACAGGCTT
Ext1   N21   AX00005676   TTTAGAGATTAAAGGGTTAGAAATACGAACAACTGGTAACGAGAAAGATATTGAT
Ext1   N23   AX00005677   TTTATTTTCCCAACCTTTTGAAGTCAATGAGCTCTATAAGATACATGGGTGTAGT
Ext1   P01   AX00005678   TTTTGGCATCCTACTTTCTGTTATCTTAGGTATCACAATAGTTGGGTTATTTTTTG
Ext1   P03   AX00005679   CTAGTTAATGGTGAGGTTGGTCTTGTACGTTTTGACACATTAAAGTCAATCCTGG
Ext1   P05   AX00005680   ACGTATTGGAGTTGATGATTCTACTCTTAGTGCAATTGTTCGTAATCGTACTAAA
Ext1   P07   AX00005681   CACTTTACAACATGTACGCAGAGGCTGATGATCATGATGAAGTGCAATGTGTGT
Ext1   P09   AX00005682   AAGGTGAAGTAAACTCTATTCTAAAACATATGGAAAGACACGAGGTATCTAACAA
Ext1   P11   AX00005683   TAGTGGTGATGAAGGTAGCTGAGAAAATGGGGATGAGTGTTCCACATTGGCTTC
Ext1   P13   AX00005684   AGTCGACTAGCACACAGCTTAATGAGAAATGAAGCATGGCTCTATCTGTTTTGTC
Ext1   P15   AX00005685   AAACGAATTAAGAGGGCTAGCCTGTTGTGCTCATTGTAGGACACCGTTAGCCTT
Ext1   P17   AX00005686   GGATGCTGGAACTATTTCCGGATTTAAAGCAGTTTTGGAATAAGAAAAGTGGGC
Ext1   P19   AX00005687   AAGCACTTTTTACCCATTTGTTCTATAAACTTACAATGTATTGAACCGGAATTGG
Ext1   P21   AX00005688   AATCCATTAGATTTTTACCTTGAAAGAGGAGATGGAAGTATCGTGGACCATACAT
Ext1   P23   AX00005689   AAAGATGAATCATTGACGCTGCCTTGGATAAATGCTGAGTGGAATACCACTCCT
Ext2   A01   EMPTY        -
Ext2   A03   AX00005690   AATGTTATCGCCATGAAGGGCATGGCATTAAAACAAGCATCAGCATTAGAATCC
Ext2   A05   AX00005691   CAACAAGTAATTAAACATTTCGAAATTTCAAAAGCATATTCACATCGCGGGATTA
Ext2   A07   AX00005692   ATTATTGGCGGGAATTTAAACACGATACAAGGAATTTGGGGTAGCCCCTATATG
Ext2   A09   AX00005693   CATGACGGACTCAATAGAGCGGAAACAGGTAGTCCAGTTGATATAGCAGGCGG
Ext2   A11   AX00005694   TAGTTGTTGCCCTGCTTATGTCTTAATTATAGGGAATATGGATACTTCCAACTAT
Ext2   A13   AX00005695   ATTTGATGGTGGAGATGTAGATATCGTTGAAGTCGGTGATTTTACAGGGAACGG
Ext2   A15   AX00005696   CAATTCAAGCGCTGCAACTTATCTCTATGGGGCTTCTTCCAAAAGGGGCATCCA
Ext2   A17   AX00005697   TTAATACTGTATTTCCTTGTATAAAAGTTGTGCCAAAGCAGCAGGGAACTGTTGC
Ext2   A19   AX00005698   AGCAACAGTTTGCAGCCAAACCAGAAAAAGTAGAAGTACGATATAAGCAGTCCA
Ext2   A21   AX00005699   TTTGTTTTTCATATCATTTACTTTGTTTATTAGAAGAGTATTACAAAGCAGCGTTG
Ext2   A23   AX00005700   ACTTTATCTCACCATTTCAAAGTTTTACGTGAGTCAGGTGTTATGTACACGCGCC
Ext2   C01   AX00005701   GCTATTATTGCGTTGCTATTTATGTTAGTAATGATTATACCAAGTTTTTCGGTTGG
Ext2   C03   AX00005702   CTCTGAAGTATTTAAGTGAACAAAGTGATGAGTGGCTCATGTCAGAAAGAAAGT
Ext2   C05   AX00005703   TTAGACGAAGATGAAGAAGGTATTCAATTTGTTTTAGAGCGCATGCCTAGTCGA
Ext2   C07   AX00005704   CTTATGTAAAAAACTTAGCAATATGACACTATCTGAAAAAGAACGTGAACAACTA
Ext2   C09   AX00005705   TGGGATGCACTTTATACTATTCCATACGGCGTAAGTGCTTCATATTTAGATATTG
Ext2   C11   AX00005706   TATTTTAGGTAGTAAAGCATCACGTATGCCTGCACAAAAAATAGGGAGTACGCG
Ext2   C13   AX00005707   AGATATTATCGGAGATGGATATGGTTGCTTCTATTTCAGCATCCAGACATTCGAG
Ext2   C15   AX00005708   GAAACTGAAAAATGTGTTCTATTCTTTGCATCAACGGAATCATAGACGTATTGTT
Ext2   C17   AX00005709   AATCGAAACTTTCGCAGGGACAATATGGATTGGTGCTATTACGATGGCATACGT
Ext2   C19   AX00005710   TAGCTGGGAATCCTTCTTTCCATTATTACCAGGGGCAACTGATCCATCTAGCCC
Ext2   C21   AX00005711   AGTTGTTACAACTGGAAGACCATATAGTTTATGCTCACAATTTAAGGAACTAGGT
Ext2   C23   AX00005712   AGCAGGGCTGTTTGGTATGTTGCTCTCACCACTTGCAGGTCGTTTAACAAAGAG
Ext2   E01   AX00005713   TTGGCACACGTCTACCCTCACACAGAAATTTAGCATCACAACTTAATATTAGCCG
Ext2   E03   AX00005714   GGGAAAGTATTACTTTCGTATATAGAGAACTGGGGAAAGGAAAACGAATGTGAG
Ext2   E05   AX00005715   GTGCGCAAATAAGCGTTAGGAAGGGAGATATCGTTTCTCTCATTGATGATAGCT
Ext2   E07   AX00005716   AGAAAAGATAAAGATAGAGGCGGGACAAGCTGTGTTTTGGGAAAAGGGAGAGC
Ext2   E09   AX00005717   TTATATATGAATTGTACGTTTTCCCAAAATATCGCGGGAGAGGATTATCGCGAGA
Ext2   E11   AX00005718   AATATAGATGTTTTCTCTCCTGTAACATGGCAGTGGGAATTGAGTGGGACTCAT
Ext2   E13   AX00005719   CTGTTTGTCGCGCTACCGATAAGGAGCGCGGCTGACAGTTATCTTGGTGATGA
Ext2   E15   AX00005720   TGAACAGACCGTTGCTCAAATGGAAAGCTTAGATGCATTACTGCAGTTTCTTGAT
Ext2   E17   AX00005721   TGACGTTGGTGGATACAGCAGAGTATAGTTTCGTTCAATATAAAGACGATGTGA
Ext2   E19   AX00005722   GATAAAGGCAGCAGACTTCACACTTCCGGGAAGAATGTATAAAATTCCGAATCA
Ext2   E21   AX00005723   AAACACATTCTATGATTATGGCGGAGTGTTGCATCCAGTGGGTTTAACCGAAGA
Ext2   E23   AX00005724   TGCTAAGGATACAAAGGAAAATCCGATGGAAATAACAGAGATAACAATTTCGATA
Ext2   G01   AX00005725   ATTGTATACGTTGGAAACCAACCGAGCCAAATAGGCTATTTAGCAACCGATGGA
Ext2   G03   AX00005726   TTGAGGTAGATGGTAAAAAGCATAATGTATGGGTAAGTGAAGAGACATATAAGG
Ext2   G05   AX00005727   TCTGATTCTTCCTGGAATGTCTGATTATACAATCGACGGAATTACATTAGTATAT
Ext2   G07   AX00005728   CAATGGAATTCACTACAATAAGCATCACAATGGGATATGAAAAAAAGAATAAAGA
Ext2   G09   AX00005729   ATGAACTTAGTAAATTGAAACCGAGTGAAGATACAAAAAGATCTAGTGAACCGAG
Ext2   G11   AX00005730   ATTAGACTCTCATACTCTATTTTGATTTACCAGAACTATACGCGCTCAGTAAAAC
Ext2   G13   AX00005731   GGAGTTATTACCCGACTCTCTTTGATAAAATAATTGTTAGCCTTGAGTTAGTGCT
Ext2   G15   AX00005732   ATCATCGCATCCGCCTCTACTTCCGCTGAAAATTCATTATCCGCTATGGTAGTTG
Ext2   G17   AX00005733   CATCCAGGTAATGTGTATATTCTTCGTGATGGCACTCCTGCATTACTTGATTTCG
Ext2   G19   AX00005734   TGATAGGAACTGGAAGCAGTTCCACAATCCTAAAGATTTAGCTATTTCTCTTTCT
Ext2   G21   AX00005735   AGTAACTAAACTTAAAGATAATGAATTACATGAGAATGTATGTATGTGGGGAGCA
Ext2   G23   AX00005736   AACATTTGTATCGGAAGCCAGCCGAAAAAATTATATGGAGGCCCATCATCTAATA
Ext2   I01   AX00005737   ATCTTTTCACGAGGAAGAAGAAATACATATCTCATACTATCGTGATGGAATGGTG
Ext2   I03   AX00005738   TGCTAATTCGGGATATGGATAGTACAAAAGATATTCTGGACAAAATCGAGCCTTT
Ext2   I05   AX00005739   TGAGGTTCTTGAACAGGCTAAGGCTTTAGAATTCGCCAATATCCAAATCGAAACA
Ext2   I07   AX00005740   AACTAGATGAAGCTTTAACGTATCCATCATCAAAAGTTATTACTTCAGCGATTGA
Ext2   I09   AX00005741   TTAGGTAATGCATTGCAAGGGGACTTTGGCTTCTCGCTTCAATATCAAGAGCCT
Ext2   I11   AX00005742   ATGCTTTCGAAGGTTGGGGAGGCCCTACTCCATTTATAAACTATGTAGACTTCTG
Ext2   I13   AX00005743   CATTAATCGAATGTATTTTCACAGAATTATGTGCTGCGATGCAGTTTTCTTCCTT
Ext2   I15   AX00005744   ACTTAGGTCTTGGAGTCGTTCCACCTACACCATCATGGGGGAACATGATTAGCG
Ext2   I17   AX00005745   ATATGAGTGAAGGAGAGGTTGAACGTGCAGTTTTTTACTTCCGTGAGTATTTAAA
Ext2   I19   AX00005746   ATCCTCCTATTGGGTTAGTGGGACTCATTATCGCTGTTGCTTCGCTCGTTATCG
Ext2   I21   AX00005747   CTACGATTCTAGTCCGAACAGGCGCTGGGTATGATGCTTTGCATACGTACCGAG
Ext2   I23   AX00005748   TAATAGATTATAGTGTACAAGAGGAACGGGCTGTTTTATCACAGCTAATTATTCA
Ext2   K01   AX00005749   TTATGTCATATAATCATTCGGAAAAGAATGATTAAGAAAAAAAAGCCGTATGAAT
Ext2   K03   AX00005750   AGTAGCTCCAAATCCACAACCTCCTAACCCACAACCGGTACCTCAAACGAAGGG
Ext2   K05   AX00005751   TTGCTTCAATGGAGGCAGGGATTAAGGTGACAGTAGAAGAGGACATCAGGTGG
Ext2   K07   AX00005752   GGCAATAATTTGGTTTACGATACAAGAGTTTATGCAAATAACGCTCAATTATCAA
Ext2   K09   AX00005753   GATGGAAGGTGTTTGTATGAGTGTATATTCAGTAGCACTCGCAATCAGGGATTG
Ext2   K11   AX00005754   GGACTTCCAACTGCAATTATTTCAGGTCCACTTTACGGGAAATGGATTGGTGCT
Ext2   K13   AX00005755   TATCGGTACATCAGGCGGTGTAGAAGGAGCTAGATACGGTGCTTGCTTAATGGT
Ext2   K15   AX00005756   TCATTTATAATGGGAAATCCGTTTCTTGGAAGGAAATGATGTCTTGTAGTGGATT
Ext2   K17   AX00005757   AAATCGCGGACGAACTTGGTATCAGGGGAAAAGTATAGCAGATGTATTGCCGCT
Ext2   K19   AX00005758   AAAGTGAAGAATGAGTGGTTACGTCAGAAGAGAATGGTCGAACAAAGTGTAGAA
Ext2   K21   AX00005759   GGTTTGGATTCATACAGGTCTTGATATTAAACGTAGTATAGACCCAAGTGACCG
Ext2   K23   AX00005760   GGTCTGATCCTGATGTTACTAAATTCATGAATATAAGTAATTTCACTGATGAGAA
Ext2   M01   AX00005761   TTCATGTGGTCGCAAGTACCGGTTACGATTTCGGTATATTTCCTTCAAGGAGCG
Ext2   M03   AX00005762   AACAATTGCAAATGCAGCAGCAAGGTGTACAACCGTATTATTCATCCGTAGAGT
Ext2   M05   AX00005763   ATGAATATAATCCAGTAACGTCGATTTTTACTCCGAAAACTAGAGGGGTATATAG
Ext2   M07   AX00005764   CGGTCCTTGTAACGAAGTAATTACAAATGTGTCTATAATTAATCAACTATGCACC
Ext2   M09   AX00005765   TTGTGGTACAGCCTCAGTTCCCTGGCGGACCGAATGTTGTTTTTCCGGTTTTCG
Ext2   M11   AX00005766   CTTAACAGGTTATTGGGGAGGCGGTGAGCAAGATATGATTTGTTTAGAGAACGA
Ext2   M13   AX00005767   AGAAACGAAAGGGATTAAAATTGGGATGGTTGAGTATAAAGTGTTAAAGTACGA
Ext2   M15   AX00005768   TGAAGATGGTTACATATTAACAAGCTACATGACTGTTGTACATATCAATCCGGTA
Ext2   M17   AX00005769   GCTTTTTCATGATACGGGTGTTATATTAGTGAAACAAAATGTTGATTATGGTAGT
Ext2   M19   AX00005770   AGCTTGCGCCATATTGTGCCTCGAAATTTGCTATTGAAGGTATCACTAAATCTAT
Ext2   M21   AX00005771   GAATCGGATCTTGTTATTGTAGGAAGCTCATTACAAGCCCTCGGATATATATTAC
Ext2   M23   AX00005772   ATTAACATTAATATTTTGGGTTCCAGGAGTTATACATGCAATTCTTGTAGTGCAT
Ext2   O01   AX00005773   TCGGCATTGAACTTCCAGCAATTTGGCAACAATACCAATCACCAGGTCAAGCTA
Ext2   O03   AX00005774   GCTTTGCAAGCGGCAATGCTTACAATTGTCGATCCGAGTAAAAGAGGAGTTGCA
Ext2   O05   AX00005775   GGATAGTTCAATTCAGCCCGGATATTCTTTAGGGGTTGTTGCTGAGAAACCCGA
Ext2   O07   AX00005776   TTAGGTATCGTGACGTCTACTGAAGTGGCTGAGAGAGCAAGAGATTTAGTAAGA
Ext2   O09   AX00005777   TCCAGACTTACCAAGGGCATTTAAGGCTCCGCTTGTACCATTTTTACCAGCATTA
Ext2   O11   AX00005778   AGCAATGAAGCATGCAGATACTTTAATTATGGTCGGTACTTCTTATCCGTTCACC
Ext2   O13   AX00005779   GCATTTGGTGGATTCATTATTTGCGCAGAAACTATGGCGATATATTCACTAGGAG
Ext2   O15   AX00005780   GAGGCTTGTTCAGATGTTGTAGCAATCTCTATTTCTAATACGGTTATTAGAAACA
Ext2   O17   AX00005781   GGACAGTGGTTAACAACTACATGTGTCCTTGGAATAGGTCTCATTAGTTCTATTC
Ext2   O19   AX00005782   AAGAGGTTGCGGACGAAGTGAGGCACCACAAGATGACGGTGAGTACTCAATCA
Ext2   O21   AX00005783   TGTTTTTGGTGTTGCCTCTAAGCCATTACGTTTTATAGGTAAGGTGATTTTTCAT
Ext2   O23   AX00005784   AAGCCATTATTCCCATGAAGATAAGGAAGAGATTGCTGTTATTATGAAAGGGGA
Ext2   A02   EMPTY        -
Ext2   A04   AX00005785   TTAAAAAATCCGGTAATACTTATAGAATATCCTTCAGGAAAACAAGAAACATGGA
Ext2   A06   AX00005786   TTCTTTCTAATAGTATTTTTTTGTTTGCTCTTGGTTCTTCTATCGAAAAGCAACTC
Ext2   A08   AX00005787   GATGACCATATATTCAACTCCGCTATTTAAACCTGCAACAAATGGCCCTGAATTC
Ext2   A10   AX00005788   TTGAGCGCTGGAATATAGCTGTTCAGAAGTCAGAGCAATATGAATTAGTAATATT
Ext2   A12   AX00005789   AAAAATTCCCTATGATGTGTGAAATTGATATTGAAGGTGACGAGGCCGTAATTCG
Ext2   A14   AX00005790   GCAACACTTCAAAAAGTTTCTTTTGGGGTAGTTTTATCATTCTTACAAGCTTCATG
Ext2   A16   AX00005791   TCACAATAATTCGCACGGGAACTATAGAGTCGGGAGACATGGTTCGCATTATCC
Ext2   A18   AX00005792   AGGTGTCGCGTATATGCTATATTTAGCCTTTAAAATAATTACTAGTAAAGGCGGT
Ext2   A20   AX00005793   ACATAAACGATTGTCAATATACGTTAAATAATGGAGACTCAATTCGCTTTAAGGC
Ext2   A22   AX00005794   CATTCCACTTTCAAATAACCAAAGTCTTGGTAATTTTACAGTTAACGCTTCAAATG
Ext2   A24   AX00005795   AGAGAAGCTTATATATACAGATGCTGACGGGATACCCCAATATGGTACAACGAA
Ext2   C02   AX00005796   GCTTCAGGTACAACACCAGCAGCGTTAGTTAATGCGTTAGTAGCTAATACAGGA
Ext2   C04   AX00005797   AAGATTCCTGCCCCAAGTCCTCAAATTGTCTCCGGGGATGGGCATTATTTATGT
Ext2   C06   AX00005798   AATGTTTATAACAAGTTGAACTTTAAGCACTCAACGCCAATTGCAGCAAGTGGCA
Ext2   C08   AX00005799   CGTTCGAAAGGCATTTTCTACGCGACCTATTTCCCATCGCTCTAAGTCATTTCAA
Ext2   C10   AX00005800   CGTGACACAACTCGCAGAGGCTTTTTATGTGACTCGCGGTGCTATAAGTAGAAT
Ext2   C12   AX00005801   GAACAAGCATTGGTTGTTACACTACTAACTTCCGTATATGCGGCCTGCGTGTTT
Ext2   C14   AX00005802   TAGCCGCTTTATCTTATTACGTATTAGCAATCGATTTCATTCCAGATATAGCTGC
Ext2   C16   AX00005803   ATCTTCTTAATTACGGATTTAACAGATGCATCTTTAAATACATTAGGCTGGAGAG
Ext2   C18   AX00005804   AAAGAGGATGTCACTAAGGCGAAAAGGATTGTCTCCAATCCCGATATCCACGTT
Ext2   C20   AX00005805   TACATGGAATACAAATAACGATTTTGGTAGAGTTGTTTTAAATGCAGCATTAGGG
Ext2   C22   AX00005806   CATTTACAGCCCCTATAAATGGTATCTATTTATTCAGTGCCAATATAGGATTTAAT
Ext2   C24   AX00005807   TGTCAAACAGCGTTATCATGGGAGAATAATCCCTCCTAATCCACCTGCTCCATAC
Ext2   E02   AX00005808   CTGGTATTAAAGGATTCTCTAAAGTAGATAATTGGATATCAATGCTTAGAAGCAT
Ext2   E04   AX00005809   GAATGGATTAAGCAAACATCATTTCGTATTGACCAGTTTCTTAGTCGTTTGGGTA
Ext2   E06   AX00005810   AGGTGCAACTTATAACCTCTCCAAATTCAGCTACTTGCCAAGGCAAGACGGCCA
Ext2   E08   AX00005811   ATAGTGTCAGTGTAGTGATAAGCAAGTACAACATGACTGCAATGAAAAATTATTT
Ext2   E10   AX00005812   TATAAAAATAACTTCGACAGAGATATTAGGTGTTGCTAAATCCGTATTTATGCAA
Ext2   E12   AX00005813   GAGAAGTCTGTTAGATCACATGTATGCCCAAGTTATGGGCAGTCTAGCTGGAAA
Ext2   E14   AX00005814   TTCTTCTTCGGACACTACTTCTCATTTTATAAATCCTAAAAACGGTGATTTACCAC
Ext2   E16   AX00005815   ACGGGGACAGGGATTTTCGTGAGTTGTTAAAGAAAGTTGATGCACCACGTTTTT
Ext2   E18   AX00005816   AAAGAAGGTAAAGCGTCTGGATCACAAATAGGGCCTTTAATACGCTCACTGGTG
Ext2   E20   AX00005817   GTTTAGTGAATGCCTTGAATCCCTAGGAAACGAAACTCTCATTTTCTCCCAAGAA
Ext2   E22   AX00005818   AAATGGACCTGGTAAAGAGGGAACTGTAATTCATGCAACTTTTACGCTAAATGG
Ext2   E24   AX00005819   AATTTAGCGATATTGGCAAGACAGTTCAATCAATAAAACGATCATTAATTGCATC
Ext2   G02   AX00005820   ACTATTGGCTGTGAGAGAGCGTCACTAAATAGAATTGGTAAAGATGTATATTACA
Ext2   G04   AX00005821   TAATCAGCCGATGATTGCACTCATTATGTGGCAAAATGGCGCTAACATCGGACA
Ext2   G06   AX00005822   TGGTTTATTATAAAGGGTGAGCAGCCAGAAGGACTGATTGTTGCGAATGATACT
Ext2   G08   AX00005823   AATGTTTATAGAAGAGGACCAGATTATTTTACGAAAATATCAATCTCCAAGAGCT
Ext2   G10   AX00005824   GAAATTTGACATGTTTTTAGAACTCTTACGAACAACGCCTACTTATAAGGTTCCA
Ext2   G12   AX00005825   TGTCTCCTTCTGTAGCGATAGCGACTAATAAACTACAAGGGAGTAGCGGAACTC
Ext2   G14   AX00005826   ACCAAAGGGCGATACAGTCATTCAAAGTGATGCTTGGATTGGAATGAATGCTAT
Ext2   G16   AX00005827   GCGCCTATTAAAGAGGGGGGAACTATTAGTAAAATGATTATCTCTCCTAAAGATA
Ext2   G18   AX00005828   AAAGATAGTAGGCCCCCTTATAGGGGGCATGTTGTTGAGCTGGTTTCAACCAGA
Ext2   G20   AX00005829   TTTTTTGATTTCAGTAATGTGGAGAATACAAATTTGCTTGAGGAATGGATTGAGC
Ext2   G22   AX00005830   CACGAAGTTCTAGTCACTCATAAGACAAGGATTGATGAGGTACTATTAACGGCA
Ext2   G24   AX00005831   GTATCAAAGCTTCCTTTCTCGTTATACAGGACAGGACGACATTATAGTTGGAAGC
Ext2   I02   AX00005832   TGCAACAAATTGTCGAATTCCTTCCTAGCGCATTACCTGTAAGGGATTACTCTCA
Ext2   I04   AX00005833   AACATCATTCCGTTATCAACCGCCTACAGTGGATGCAGAAAAAATACCCATTGTC
Ext2   I06   AX00005834   TTACTAGGATGGATACCTAAAGACATCAAGACAGTTTGCCTAGATAGGGACCAA
Ext2   I08   AX00005835   TTATTAAATTCATGCGACATTAATAGGACCCTGATAGGGGATTTACTAATCCGAT
Ext2   I10   AX00005836   AAATAGTTATGCAGATAGATGATTCGCCCTACATTCTATTCGGGCATAGCATGGG
Ext2   I12   AX00005837   TATCCCTATGATCGGTTTAAAATGGAGATACAGCCTGTAATTAACAAGTTTGAAA
Ext2   I14   AX00005838   ATTTTATTAGGAATTATGTATCAAGAGAGTAGAGGTGAGGGAAACGATCCTATGC
Ext2   I16   AX00005839   ATTCGGTCTACGTGCATATGATGGAGATCCGTTTAAATATGCGAAATATTTACCA
Ext2   I18   AX00005840   AGATTCCCCTGGTAGTACGATGCACGATTTTTGGGAAGTATTTTTGTTTATTCAG
Ext2   I20   AX00005841   GTTCATGCAACAGTCGAAGACCTGGTAAAGTGGGGAGAAAATTTAACTACAGGT
Ext2   I22   AX00005842   CCAAATATAATAGTTAGAGGAGCATCGAAAGCCCAACGAGAAGCATGGAGTAAC
Ext2   I24   AX00005843   GTTCTAATCCAGAAGTGGCTAAATTTCAGTCATGGGTTAATTATCAATATCATGA
Ext2   K02   AX00005844   ATATACGAATGAGCGGTTGGATTTGGTTTTATCGGGACATGCTCATGGAGGGCA
Ext2   K04   AX00005845   ACATTGTAATGATGATTGGTGGAAATCTAAAGAAAAGTGTCATCGTGATGATAAT
Ext2   K06   AX00005846   TCTGTCAGTTGTGATGTAGTTAGGCTTGCGGCTATTCCTGGATCGGTTGGAGTA
Ext2   K08   AX00005847   ATAAAGACATCTCTTGGTTTGATCCAGGTAAATCACATTGGAAATCAGATGATTT
Ext2   K10   AX00005848   TTCCAGGAGTTACATTAGGACCCTACTTATATTCTCAGTGGGAAAATCATTTACA
Ext2   K12   AX00005849   AAGGCAAACCTGCTGGCGTAATACTAGGTGGTATAAAGGATTATGAAAGTATTA
Ext2   K14   AX00005850   ACCAGGTACATACATTGTGGAATACATGGTTGTTGATTCTCAAGGGCGGAATGC
Ext2   K16   AX00005851   TAAGCACCTTTTCAAATAACAGTGACTCACTTCATATAAGTCATAGCAGCATCTT
Ext2   K18   AX00005852   GAAGTGGCAGGACCTCCACATGTGAATCTAAATCCCAATACGTATACAGTGGAT
Ext2   K20   AX00005853   TATAAAACTGCCAATCTATCAAGGGACCTCTGAGGAAGTATTGAGTCGCGGGAT
Ext2   K22   AX00005854   ATAGTTCCTACATCACAACCATATTCTCCTAATTCCCCGTTTACTGAGCTATATG
Ext2   K24   AX00005855   AAAAATGGATGCCCAATTTACAGATTGAAAGCCTTAAAACTGCTGGAATAATAAA
Ext2   M02   AX00005856   ACATTTGCTTTATGGAGTACATATTGGCTTGCTCCTGGAATTGCTTTCGGAATCG
Ext2   M04   AX00005857   TAATGTCTGGTGCATTTAGTCAAAGACCACTTAAAGGCGCTCCTGCTTATGGAG
Ext2   M06   AX00005858   AATGGAAGTCACTCATTTTGTTTATTTTGCTAACAGATGGAATGAAACGTTTTGG
Ext2   M08   AX00005859   TCAAGTTGTCATGCCCCGTTTCTGGCATCTGAGTTAGCGAAAGTAATGAAAAAG
Ext2   M10   AX00005860   ATGAGAAGCTACCGGCTAATATTGTATTACTTCGAGCTACAGTCCCACAAGTTTG
Ext2   M12   AX00005861   GGGTAGATGCTAGTTCAGGGGATATTCGCGCAGATGTATTTCGAACATATTTGT
Ext2   M14   AX00005862   TATCGTGGGTATGGGTTCCAGTTTAATATTCAGTTACATTTTTGAACCTGCAACT
Ext2   M16   AX00005863   TATCGTTAAAACAATCGCAGGATCGATAAGCATTGGGGCCGAGTTACCACAGTA
Ext2   M18   AX00005864   AAGCTGTTACTGAGTTACCTGAATCGGTTATACTTCGTTACGGCACATTATACGG
Ext2   M20   AX00005865   TGTTTTGAAAATGACAGGTAGTACATCTGTGAGCCAAATGACAAGAGCTGAAAT
Ext2   M22   AX00005866   CCACTTTGACGGACAAAACAACTTGCAAGTACTTGACCTTGGCTCTGGCGTTGG
Ext2   M24   AX00005867   GAATCCCTTTACTGGAGAACAAATATTAAGCATTCCAATTCCCGCGTTATATGTA
Ext2   O02   AX00005868   TATATTGGTATGCCATACTGTGATATTCCAGATCCGTATGGATGTCATAACTCGT
Ext2   O04   AX00005869   GAATCTACTGCACAAGCGATGATGAATGCAAAGCTTTTTCGTAAACGTGATCAAG
Ext2   O06   AX00005870   GATATTAAATGGGTAATTCCAGAAATTTGGAAAACTATTTTGCTAGATGTTCCTC
Ext2   O08   AX00005871   ATATCCATATTACTATATTGAAGATGCTGCTCGTCGCTGTGGCGGTTGTGGTCG
Ext2   O10   AX00005872   AAACAATATGGTTCGAGTACAAGTAGGTCATTTGTTCCATTATCGCAGTCTTCTA
Ext2   O12   AX00005873   GCTCATTCACAAGAATCACGATATCACATTGGATATCTACTTGCAATAACTACAG
Ext2   O14   AX00005874   TATCTTAGTAGTTTTCAATTGTACTATATGGGGCTTGCGGTCGGAGGAGAAGAA
Ext2   O16   AX00005875   GCATTCCCAAGTCGTGAAACCATAGAAAAGATAGCGAAGAGATTTAATGTACCT
Ext2   O18   AX00005876   AATATCGCTGTTTGTAGAATGTATGAATTAGCAAGTCATCCACAGTTTCCAGTGA
Ext2   O20   AX00005877   TTGGTGGTATTAGATGATCTTGGGGCAGAAAGCGGGTCAACTGATTCGAATAGA
Ext2   O22   AX00005878   ACGAGTGGTTGTAATTGCGAAGTAGCAATCCAGCAGCAAGAAGAAAACGATAAG
Ext2   O24   AX00005879   AAAGGAATCAGACAAAGCGTATGAAAATGGCGATTTAGGTTTATCAGGATACTTA
Ext2   B02   EMPTY        -
Ext2   B04   AX00005880   TTCCAATTGACCCCCTAAATTTAACCAGCTTTGCTATTACAGAAAACATCTTCAAT
Ext2   B06   AX00005881   ACTGGCATTACTGGACCGACTGGTGTTACTGGTCCTGCTGGTGTAGGTTTAACA
Ext2   B08   AX00005882   TGTGACCTTTAGTAATGCGAAAAGCTTCATACAAGCTGGAATTATTATGGTACTT
Ext2   B10   AX00005883   AAATCTGGAGTAAAAATCTATCATTCGTAATGCTCGGTTTAGGGATAAATATAAT
Ext2   B12   AX00005884   AAGCTACTACATTAGATGAGATAGTACTGCAAGAAAATGAGTTATATTGTGTAGG
Ext2   B14   AX00005885   ACTTGCAAACAGAAGTGATGAATTGGTCAAGAACTACATGTGTGAGGATGATTT
Ext2   B16   AX00005886   ATTCGGAGTAACTGTTAATCCTGAGAGTATGATCTTGGGCATGGACTTATCAAG
Ext2   B18   AX00005887   GGTAGAGCATCAGAAATGACGAAATATGTTCGTAACTTTTATGAACAAGGCTATA
Ext2   B20   AX00005888   GAGAGAATGGATGCTGTCAACGATGTGGAAGGTTCGTCTTTGGTAGACGTGCT
Ext2   B22   AX00005889   GGTTTTGCTCCTACAAAAACGCATAAAAACAAGGCTGGAGCAGTAAATGAAATG
Ext2   B24   AX00005890   CGTGAACAACCAATGATGCTTAATATTTCAACGGCTGGTAAGGGTGCTTCATCT
Ext2   D02   AX00005891   TGTTTGGTTGACCCAGAAAGGGAATAGGACAACTCAAAAAAATTTATTAGAGCAG
Ext2   D04   AX00005892   TAACATTCTTGCTAAACTTGGATGCTCATATCAATCCACAGAATGGCGCGCAGTC
Ext2   D06   AX00005893   GTGGACAGAGAAAGTCGAATGTTACCTTCTCCAAGGGGATATTTCAAAGAGAGA
Ext2   D08   AX00005894   CAACGTTCCGCTATTTCAGCATCTATTGCAGCGGCTCTTTCTACTAAAGGTCATC
Ext2   D10   AX00005895   AGGTCAACGATATGTAAAAAAAGCATGTGGAAGAGAAGTGGAATACCTGGTCAT
Ext2   D12   AX00005896   TAGGAGAGACGATTGATCCAGTAACAGACCGTGTTGTGATGGGATATCCATTAG
Ext2   D14   AX00005897   ACCCTTATATTGTGTATGAATTTGTGAATGAGCAACATAAGAGGGCTTCTAATAA
Ext2   D16   AX00005898   AGAAGCTAAGCGTAATAACGTACAGTTAGGAAATCATGCAGCTAGTATGGGTTT
Ext2   D18   AX00005899   GTTTGGATGCGTTAGATGAAGCAGCCAAGTATTTTGCTAGTAAATTAAAACCAAA
Ext2   D20   AX00005900   ACAAAAATATTACGTTGGTACCCAAAATGTACAGTTGCTCCAGTAGAGGAATCTT
Ext2   D22   AX00005901   CGTAGTGGTGGTACAGAATGTACATTAGATGAATTGAAAGGTGCTATTCCTATG
Ext2   D24   AX00005902   CATTTGGTGCGTTGAATCTGGCGTTTTTACCTGTGATAGCTACCATTGCGGCAG
Ext2   F02   AX00005903   AAAACCTTGGTTGTTACAAGGGAGAACACTCTTTTTCACAGATGACGAGGTGTA
Ext2   F04   AX00005904   GTACATTAAGTGGGAACTTTGTTCGAGGGGGAGAAATAACAGGTTCAACATTAC
Ext2   F06   AX00005905   AAAGGACTTGATGGCAATGGATACTTGAATGCAGCTTCTTTATACTTTTCACAAA
Ext2   F08   AX00005906   CTTTTCCAGCACTGGCATATGGATATACACCCGCAGTTTGTGAAGTTACAATAAA
Ext2   F10   AX00005907   TTAAATGCCATGAATGAGCGGGGAATTAAAGGAAAGGTTATATCTGATCCTTTAA
Ext2   F12   AX00005908   GATGAAGGAACCTGACTTCCCTTTTTGTCTTTCTTGGGCAAATGAACCATGGAC
Ext2   F14   AX00005909   AGAGTAAGTGGGAGAGCTAATAGACTAGCAAGTATAGAACCTCCTAAGGAGTAT
Ext2   F16   AX00005910   CACATGTATATTGGGCTTTCGGAGGTAATTGGGGGACAAATAGTGTTATTCCAA
Ext2   F18   AX00005911   TTTGCATACTACCTGCTATTGCCTTATTCGTTACTTTCGATGTCATCTTTGAACTA
Ext2   F20   AX00005912   TCTTCGCCCTGGTGGAATCTTCATCGCAACAACACAAGCGCGCTATTTTCTTGA
Ext2   F22   AX00005913   AAGAAAAGAACCTAACTTAATTTTAAAAGCGATTGAGGAAGTATTACGCTATCGC
Ext2   F24   AX00005914   TGGATTATCGGGGGATAACATACAACTAAAAGAGGATGAGGTATTTATTAACGG
Ext2   H02   AX00005915   AAATGCATACGTCTTTCTTAGTAAAAATTACACACCAATAGCTGGCGGAGCTTGG
Ext2   H04   AX00005916   TTCACTAGACCAGCTGCACTTTATTCCGGAAGGTCAAATGATAACGAGAGATAA
Ext2   H06   AX00005917   CAGCTCGATAAAATTATCGATTACGATGTAAGTCAATTCTCTGTGACGCGAAAGA
Ext2   H08   AX00005918   CAAATAGAATTCAATAATTTGAAAGTACATAATGGATACTTGCAAGCTGAGGTTC
Ext2   H10   AX00005919   AGGATATAGAATCCATACTCCGCACTATTCGCGCTGGGTATCCACAAGGAGCTT
Ext2   H12   AX00005920   CTACAATGACTCCAGAGGTTATTAAAAGACTTATGGAACGCCTTATCCCTGAAAT
Ext2   H14   AX00005921   AGTTACAAAATGGTCTTCTAGAGGGTAAAAAGGATGTTTGTAAACTTGTGCGAAA
Ext2   H16   AX00005922   GAGTTCCACCCACGCTACTTCCTGGAATCTACAAATCTGTATTCACAATTGAAGA
Ext2   H18   AX00005923   GCATGGAAACGCTTGTACTCCGAGTGGGTCCCAACCTCTAAGTATGAACTTGCA
Ext2   H20   AX00005924   AACCCTTCCCTTATTCCTTCCGCTGTTGACGAACTATTACGCCATTCCGGCCCA
Ext2   H22   AX00005925   TCCAACAGGCTCAACTGAAAGTTGCCTTTGTGATTGCTGCGTTTTACCTATGCAG
Ext2   H24   AX00005926   TGTGGTCACATCAAAAAAGTATGATGTGAATATGTTAGGTTTGTTAAATGGAATG
Ext2   J02   AX00005927   GGACCTGAAGGTAGCTGTTTTAAGATGGGTGGTGAATTCGAACTTTTATTACAA
Ext2   J04   AX00005928   TCGTGGGAAGGATAACAAGTGTGTTGGAATGTTAAACGGCGAACAGACAGTGG
Ext2   J06   AX00005929   GGCGTTCAGTCTGAAATATGTATAGACGCGACGTGTCGACGTGCATATAGCTTA
Ext2   J08   AX00005930   ATACAACTAGCACAATTAAATCAATTGAAATCTTGCGTATACAATATAGGGAGTG
Ext2   J10   AX00005931   TCCAAATACCACTAGAACCGGAGCGAATCAAAGGATCTCACGGTTTACCAGCAA
Ext2   J12   AX00005932   AAGGCATATTATTAGGCATGATTACAAATGGATTCACTGATTTTCAACTCCTAAA
Ext2   J14   AX00005933   AGAAAGCTATAGATCAGTTAACAGAGCGAGATTTACATTGGCGTCCTAACAGTG
Ext2   J16   AX00005934   GTGTACGTCGAAAAGTTTATAGATCATTGGAATCAATATGGCTTTGGTGTATGGG
Ext2   J18   AX00005935   GGTACAATGGATAGCTATATCTATTGGAGAATCGGCAAACATCTTCGACAGCTC
Ext2   J20   AX00005936   AAATTGCTGAGAAATCATGGCTTGTACGTTTAGACTTCCCAAAAGCACCTGGAG
Ext2   J22   AX00005937   GCTGCCCCTCTAATAATTGATCTGTCCCGTTTTATGGAGCATGCACTTAGAGAA
Ext2   J24   AX00005938   TGAACGTGGAGAAAGGAATATTTCCATGCTTACTCTGCAAAAAATTGCTGTTGGC
Ext2   L02   AX00005939   GTGGGCTGCATGGGGACAATAGACTTCAAAATTTACGTACACTTTGCAGACGTT
Ext2   L04   AX00005940   TAACAGGTTTCTTCCACCTATTAGCGAAATAACAAGGGATGATAAAAGAGATGTG
Ext2   L06   AX00005941   CGTTGGCTGCAAACATTGTATAACGCTGTTTCACCTGGTGGTTTATTCATTTTCA
Ext2   L08   AX00005942   CTATTGGACTAGGATGACGATCATCAGCATAGCTTTTGGTTTACCAGATATAGAC
Ext2   L10   AX00005943   ATAGTTTTTGGATCTATTATGAGCCACAACCTAAGTACGGTCTATGTTTTAGGAC
Ext2   L12   AX00005944   GGAGAAGCAAGTTTATGGGTTCGTATGAAGAACCGTGTTTTAATTTTCTGGCCA
Ext2   L14   AX00005945   TTAATTCCGGGAATAGGAGGTGGTGTAGCTACATTTGCCATGTTATTCGCGAAA
Ext2   L16   AX00005946   TGTTCTTATACACGCGGTATATTACCATCCGCGTCCGTTCGTATCACATGATGTA
Ext2   L18   AX00005947   CCAAACCTACCCTCTTTACGAACTAATTTTCTTAGACGATGCCTCCACTGATCAT
Ext2   L20   AX00005948   CCAATCGGTTTTCCTTCTAATGTTGAAAATCTGAATCGCTCGGTCAATATAATAC
Ext2   L22   AX00005949   TGCGCCAACAAAATGGGCGTTAGAATCTATTCAGCCGTTTACTTTGTTATTTATT
Ext2   L24   AX00005950   CCAATGAGTGTTTGGTTATGGGATGAGGAGCAAGAGCGGGATATAAAAAGCGA
Ext2   N02   AX00005951   AATATCGCACATAGAGGTGCTTCTGCGTTCGCGCCTGAACATACAATAGCAGCA
Ext2   N04   AX00005952   AACGTGAATATGTTCGTAAAGGAGCATCACAAACGATGCGCTCATATCACTTAG
Ext2   N06   AX00005953   AAAAATTGGCTCCATCACCACATTAGAGGCATGTTAGGTTCTTATATTGGTGCAG
Ext2   N08   AX00005954   TGCTCAACCGAAGCCAGTGCGTAATCAAAATGCATATAGACACATGATAGTGGA
Ext2   N10   AX00005955   GAGGATGATATATACCGAGAGTTATGGCTTGATGAATCACCTCCAGCTCCTTTA
Ext2   N12   AX00005956   AACTTAATCCATCTATGGAAGGACCTTTGCTACATGATGTGGTTGCAATAAGCGG
Ext2   N14   AX00005957   AAAAACCGCACCAATAAATGAGTTCTCAACATCATGGCATCATCAAACTCCCGCC
Ext2   N16   AX00005958   CGCTATATACGATGGTGACCTTATGGTTGGTTTTGTTATGCATGCTGTTGTAATA
Ext2   N18   AX00005959   ATAAAATTGGAGCATGTAAAACGGGCGAATATGACCATTGTCTTTCCTATAGTTC
Ext2   N20   AX00005960   ACCGAAATCTAGCGAGTCTCATTTAGCATTTCACTGGATAGATTATAATAAAGAA
Ext2   N22   AX00005961   AAAATTGTAGGTGGAATAACTGCAATTACATTTTGGCACCACGTACATGTTGATT
Ext2   N24   AX00005962   CTTATTTTTTTAACCGGAACCAATTCGTTTCACTCAATCTTCATAAAAATATTATC
Ext2   P02   AX00005963   CCTGTTCTTACTGGGGTGCATATAGAGTTATCTAATAATAAGTTAATTTGTGCTG
Ext2   P04   AX00005964   TAGTAGCAAAAAAACCGAGCACCGGACAAGCTTGGATAAATGCCAATCGTTTTA
Ext2   P06   AX00005965   AGGGAAGAGCACCTCAGAAATCGCCATGCTTGCTAATGTGTCTGCAAGGTATAT
Ext2   P08   AX00005966   AGAAGAAAGAAGTACATATAATAGAATGCTACAGGGGAGGAGAGAGGAATAGCT
Ext2   P10   AX00005967   GTTTCAACAAATAAAGTGGTTAAGAAAATCGTTTTTCGAGTGGTTTCCGCAATAT
Ext2   P12   AX00005968   GCAAAAAAACAGAATACCATTCTATTCCTTATAAAAGTATTACACAATATAGCATC
Ext2   P14   AX00005969   AAGACTATGAAACAAATCCAGCAAATGAAACTATCGAAAAAACTATTTGTAGAAT
Ext2   P16   AX00005970   TTTCAAGCAGCTGGGAACTTAGTTCCTGGTATAGGTTTGCTCATTAGTCCATTTT
Ext2   P18   AX00005971   AGCGGTTATGATGAACGCGGATTGCTTGGACTTGCGTTCCATCCACAATTTTAT
Ext2   P20   AX00005972   AGAGAATATTTTTCAATATGCTAGTCTAACAGATCATGCTATTTATCCATATTGGG
Ext2   P22   AX00005973   CGTAGCAATTGTGATTTCCAGTCATCAACTGTCTGAGATTGAGCAGATGGCACG
Ext2   P24   AX00005974   CTGATGATACGGTGGCTCAAATAGTAAATGCTTTGCTTGGCCTATCGGGAATGC
Ext2   B01   EMPTY        -
Ext2   B03   AX00005975   TTGATATAGGTATAGCTTCGTTAGTACCTCTTGTTCCTGTACCTTTTACTGGCGA
Ext2   B05   AX00005976   AACGCAGAATATGCCGGATGTTTATTCCACTTAAATAACAAAACCATTCGTTTTA
Ext2   B07   AX00005977   CCTGGAATGTCACTCTCAATACTTGCTGATGGTGAAGTGTTCTACTTTTCTTCTG
Ext2   B09   AX00005978   AAAATGAATACATGCTTGGACAATTCAACTATAAAAGCTCGATTCAATCCGGTGA
Ext2   B11   AX00005979   AACAGCATTCTTTTGGATTGAGGAAGGGAAAAGTTGGCTAGGATTATGGGCGGG
Ext2   B13   AX00005980   CAAGTTGGAGATATTGACGTTTCAAAAGCTTTACCAAGCAGCCATGTTTTCTCAT
Ext2   B15   AX00005981   GTACGATTTTTGCTATTTCGTTAATACTTAGTAATTTAATTAATCACATTACTTGG
Ext2   B17   AX00005982   CTTATTCGCTTTCCGGCCTCAACAATTGGATCGGCATATGCCATGACTTTCACAT
Ext2   B19   AX00005983   AAAAACCAAACAGCAACTTCTTCTACTGTGATGGAAAGGCAACAGAAAGAGTCT
Ext2   B21   AX00005984   ATTAAGAAAATCACTTGGAAACAAGCTGCAAGTTGGCTTTTATTCCCATTTTTTTA
Ext2   B23   AX00005985   AAGAGTCAAGTAGGGCGCAATTTGAAACATATGAACATGTGGGCGCATATGGAT
Ext2   D01   AX00005986   ACGTATAATGATCCAAAATCAAGTTAGAGCATTCCTGCAATTAGCAAATGAAGAA
Ext2   D03   AX00005987   AGAAAAAACTTCCGTCAAATGTCGTTCAGTTACACAAGGCATCATTACACGACAG
Ext2   D05   AX00005988   TTTACTTATTTAGGTGGGACGTTAATCTTAAGAGCATTGATGGAATGGAAGTATG
Ext2   D07   AX00005989   AGTACGATTTGAAAGTTGATGTTCAAGAGTTAGCAATTGTAAATGAACAGATTTT
Ext2   D09   AX00005990   ACTTTATACTGCCTTCAATCATTTATGGAGTGGAAATTTGATAAAGAATCGAGGG
Ext2   D11   AX00005991   CTGCTTTACGTTGGACATGTCCACTGGGATAGTGAAGAAACATACTTGGGTTAT
Ext2   D13   AX00005992   CGATGAAATCGGAGAGCAATGTAAACATATTTTAGTTTATTATCATGAGCTTCCT
Ext2   D15   AX00005993   TCGTTTATTTTTCAATAGAAGCTTTCAGGGAGCGGATTGAGAAGACAGGTGCTA
Ext2   D17   AX00005994   AGAGATTCATGACGTTGGCCAAAAAGAACCGAATGCATGGGGACTTTATGATAT
Ext2   D19   AX00005995   TCTAGATTTCGCAAATCCATATAACAGTTATTATGAAAGACCGGCGATGATGGAG
Ext2   D21   AX00005996   CATCTTCATATCGACTTTTTATGGGTTGACGAATCAGTTCGTCATGACGGTTATG
Ext2   D23   AX00005997   TAGACTTACAAAATCCGTCTGGCCATGCGTTATCATGCATGCGATTGAGGATGC
Ext2   F01   AX00005998   TTATACCGGACAAGTATTTCCTTTCTTAAGTGCAAAAATAGGAAAAGGTCTTCTA
Ext2   F03   AX00005999   ATCCAAGTGAACTATCCCTAATTGAACTGGTCAACAAATCCTGCTCGCGAGATTG
Ext2   F05   AX00006000   GCCCCTTCAACGATTTCTGTTTGGAAAAAACAGCTCGAAACACAAGGAATTGATG
Ext2   F07   AX00006001   GGCTACCGTCGCATTCGTGATGAGTTAACGAATCGTGATCAGAAAGTGAATCAC
Ext2   F09   AX00006002   GTGTGATTTAAATAAGCTGATTGGAAATAAGCCGTTAGCTTGGTTTACAAATCCA
Ext2   F11   AX00006003   ACGTTTTAGATAGGCAAGTTAAAGATGCTGTGGCGGCTAAGTTAAGATCCCTAG
Ext2   F13   AX00006004   GTGTATATTAGTCCGTTCGGAAAAGCATGTCAGGCGTACGCAACTATGTTTTTC
Ext2   F15   AX00006005   ATCATCCCAGCATCTGAAGGCTATAATTATGTCGGCTGGAAGTTATTTGTTGGG
Ext2   F17   AX00006006   TAATTACTCTTTGTGACGCTCTTGCTGATGCGGGTGGCTTTACTACGCTGGAAA
Ext2   F19   AX00006007   AAGTCTTCTGTGGTTCTGAAGATTTAGTTATGGAATCATATTTAGTTGGTGCCTC
Ext2   F21   AX00006008   GACATTAAGAGTTCATGAAGATAGCGGAACACCGCGAGGTATTTATTGTAATATC
Ext2   F23   AX00006009   CATTCTAATCCCATCGAAAAGTTTAGTATCGCTTATTAGTGATAAGAAGGTAGAA
Ext2   H01   AX00006010   TATCTCCTTGACCCAGAACATTGGAGGAATGGGTATGCATTAGAAGCAGCAGAG
Ext2   H03   AX00006011   TTCGTAGCATTTATCCTTGTTAAGGATACAGGGGAAATTGTAGATGCAGACTGC
Ext2   H05   AX00006012   TAAAAAGAAGTTAAGGCGTCTTATTTTAATGGTCCTTTTTATTGCAGCAACTACTC
Ext2   H07   AX00006013   TCAACGAAAGGTGGTTTAATCGGACACCACTACGACCCTAATGGAGTTCCTGTA
Ext2   H09   AX00006014   CTATTACTGGCGAAAGCAGGTTTACTGGAAGGTTTAAAAGCAACAACACATTGG
Ext2   H11   AX00006015   AAAGGCGAGTCCAAGTATTGTTAACGAATGTAGTGAAGATGGATGGACACCACT
Ext2   H13   AX00006016   TGATTTTTACGTATATATGGGCATTTGACCTCCAAGAGGATTGGGATTATATACA
Ext2   H15   AX00006017   ATGGGCGATAATTTTAATACATATATGGAATCCAATGGTGTGAAAAATGAAGATC
Ext2   H17   AX00006018   AGGATCCGTACACAAAAGACAATAAGATTGGGCGGTTAAGGAGATTTTATATTTC
Ext2   H19   AX00006019   CCTCGAATCCTCATCCATCTTTTAAAAATGCTAGCGTTTCAGAAGCAGCTGCGC
Ext2   H21   AX00006020   CGAGTTCCTGAGCCAAAAAAAGAGGATTGTGAGCCAAAAAAAGAGGATTGTGAG
Ext2   H23   AX00006021   ATCATAGAAGAGAGGGCTTGGCAACTGTAGTAAGTGCAGCTCTTATATTGGATT
Ext2   J01   AX00006022   GTTCAAGTACCTGAACTGGTAGGTTTTCGATTACTTTTATCACATCTAGCTGGAG
Ext2   J03   AX00006023   GTAAAGGGAGAATATCACTCCTGGGTGGATTCAATATTTGGTCATAAGGTTGAA
Ext2   J05   AX00006024   AATTGAAAAAGCGTGGGGGAAAGCAAATAAAACCGAATATACAGGGAATGGAAT
Ext2   J07   AX00006025   TTGGGTTGGTTCGAAATTACTTGGTAGTTTTGGTCCAGTCATTGGCGGATATGC
Ext2   J09   AX00006026   CCCTGAAATCCACGGGGATCACGGTTTAGGTCCTATTATTCCACCTGAGATGAG
Ext2   J11   AX00006027   TGCCGGACATTCCTGGATTTGAAAAGATACATTTGAGAGAGCCGAGAAAAGGAA
Ext2   J13   AX00006028   CAAAACGTTAGCAGTGGAACACACGAATATTCATTAACTGTAGAAAACCTTACTA
Ext2   J15   AX00006029   ATATACGGTTCTTGGGAAGTCGTTGACAATAAAAATGGTGAATGCCCTGTATATT
Ext2   J17   AX00006030   GAAAAGAAAGTGCCGAATTAGCTGCTGAAGTAGTGAAGGAGATTCCTAGTTTTC
Ext2   J19   AX00006031   AGATTTCAATGGATTGGTCTCATGATTGGTGGGTCGCTTTTCCTTTCAACAAATA
Ext2   J21   AX00006032   AAGAAAAAAGGCATATTGATCTTCAAAGTCTATTACATTTGGTTGAGCATACAAG
Ext2   J23   AX00006033   ACGTTGGTAATAATTCAGATGTGGTTGCAATTGTTAATCATTTACCCGGTGGTGG
Ext2   L01   AX00006034   ACTGCAAATGATACTAAGTTAACAATCCCAAAAGGGAGTTATACAATCGCATATT
Ext2   L03   AX00006035   TGTATGCCCTTCCAATTGTACCAGTTGCGCCGAAAGAAGTTGTGCTTGGGTCAT
Ext2   L05   AX00006036   AGCAGTTCCGTATTATGAGCAGGCAATCGCAAATGGACTTGATGGCGAATCGCT
Ext2   L07   AX00006037   TTTGCGGAGAAACCGAGTGATGTACATAGAGGGTTAGAATTACATCCATTTGAA
Ext2   L09   AX00006038   GAAGCAGTACGTCAAGAAAACCCTCTTGAACGAGTTGCTAGTAATCTTTCATCC
Ext2   L11   AX00006039   ATGTAACAAAGCATTTAGTTTTACCAGATCAATATCCTCCGTTCACTCGTGGAGA
Ext2   L13   AX00006040   AAGATAGTGAATCGATTAAGTAATATGGGCTATCATGAGGTAGAACCTGAAAACC
Ext2   L15   AX00006041   TTTCGGATCGGAAATGGGTAAGTTTTATGTATAGTTATCCCAATCTCATTCCATT
Ext2   L17   AX00006042   TATGGGGAACTATCGGGGCAATCGCGATTAGAGCCCTCGCTACCTTAGTTGTTG
Ext2   L19   AX00006043   AATATTCGTGAACAGTTTAGTCATACGTACAACCGTTTATTTGAATTTGCGAGAA
Ext2   L21   AX00006044   ATACCATTCCGATTGGTTACATACAAATGTACCCAGTGGATTCAGAGTGGAAAG
Ext2   L23   AX00006045   ACTGAATGGTTCACACTCTATACAATCCCGCAATTTAACGTATTTACAGCATTTT
Ext2   N01   AX00006046   ATGATGATCTTCCAAAGGATTTGGCGTGTCCAACTTGTGCGAAAGAGATGAAAT
Ext2   N03   AX00006047   TATAATTGATTGGCTAATTTTTTGCTGGATTACTCCAAGGTTTGTTGTGATTCCTA
Ext2   N05   AX00006048   CCTAATTTAAACATAACCGGCTATACTCATATGGCTTTTTCTGTCGGTAGTGAAG
Ext2   N07   AX00006049   CGCTTTCAGGTATGCTAATTGGGATTTATACGTTAGATGAAACGCTTAGTGTAAA
Ext2   N09   AX00006050   TGGTGCTAAGCGACCCCAAAGCATTTAAGGGGAATAAGGAAGTGATGTATCCAG
Ext2   N11   AX00006051   AAACGATGCTATCATCGTTACGATCGCTGCTGGGAAAAGTATTGAAAGTACTGA
Ext2   N13   AX00006052   GGAAAAGGAAATCAAGAGCCAATTGTCCAAAGGTGGATGCCTGCTGCAAGTGTA
Ext2   N15   AX00006053   TCGTTCAAAACTAGGTTCAAAACCATATGCAATTGATGGCACGAAATCTTCTGTT
Ext2   N17   AX00006054   CGAACGATATCGTCATAGCTTTGATGTCTTTCCTGATTCTAGGCGAACTCAACCG
Ext2   N19   AX00006055   TATGGTTACAATTGACGATGGCTTTCCCCGAAAGCCCAACTCTTTAGCTTATAAT
Ext2   N21   AX00006056   GAATACACAAATGAAACGATGAATGCTTTTCATATGGCTTACCAAGGACCTACAT
Ext2   N23   AX00006057   TTTCTTGGACCATCAGAATCTAGAATTCCTTATATATTTAAAGGCATGATAGGAT
Ext2   P01   AX00006058   GTTAAGAGGAACCTTGAGCAATCAAGATCAGGGGGATAAATTTGTTATTGATGT
Ext2   P03   AX00006059   GCCGATTGGGCAAGCTTCATAGCACGCCCACAAAAGGACAACAAGTTGTTACAG
Ext2   P05   AX00006060   TAATCATACTTTTCTTTGCGATTAGTGCGATAACGTTATCACAAGGTGTTGTGTA
Ext2   P07   AX00006061   AGGCTGTTGGATTGAGTTAAGCACCTCATTGTCAATATACGACAATAGGTGCTT
Ext2   P09   AX00006062   ACCTGGATATGTGGGGTATTGGAGCTTTGAGACAGCTGCAATAGTAAAGATACT
Ext2   P11   AX00006063   AAACTAGAGCATTTATATGAATTCAATCATTCATCCAGCAACAACTACAGCACCG
Ext2   P13   AX00006064   AATGCTTCAGATAGAATGAAAAGTGCTACTAGTCGCTCTATAAATAAGGCAACGC
Ext2   P15   AX00006065   ATACGCATATGCATAGCCTTTTGAAAGACTCCTATACCTCCCGTTTATGGGCAGC
Ext2   P17   AX00006066   ATACATGCCTTTTGACTGTTTATTATTTTTTGCTGATGGGGGAAATGGTGATTTG
Ext2   P19   AX00006067   TGGAAATAATAATGTCATTGCAAGAGGAAGGAATAGAGTGCATCCAGAAAAAGA
Ext2   P21   AX00006068   GCAGCCGAAAGGTGTGGAAACAATATATGTTGATTCCGGAGCAGATGCTGCTG
Ext2   P23   AX00006069   TTTTTACATGACGATTTTCATCCGGCTAATATAATGATTGACCAAAATGAGTTTCG
Ext3   A01   EMPTY        -
Ext3   A03   AX00006070   CCGCATATTGTAGGGCATGTAGAGAATGTGAAACAAGATGAGGCTTTATTACCA
Ext3   A05   AX00006071   ATATTACTTGTCCACACCCGAAAGACGGCAATTGTCTAGAGTATGAATTGACATT
Ext3   A07   AX00006072   TTGCTAGACGTGAAGATGGAAGATTAAAATTCATATCACTTATCTCTTTCTTTGTT
Ext3   A09   AX00006073   TGATTGTAGAAGATACCTCCATTAATGGAAATCCGCTTCTTCCCGATTGGGGTC
Ext3   A11   AX00006074   AAGATAAAGTGTATAAAATAGGGGAGACAGTAGACGTAGATGGTTTGCAAGTAA
Ext3   A13   AX00006075   GATATTGAAACATACGAAGAGTTTAAGGAAAGCAAGTGTGAGGTAGTTGTATTAG
Ext3   A15   AX00006076   AAAGCATTTCCACAACTTTGTACAAATTTATACGAACTTAACTGGCAGGCAGCCG
Ext3   A17   AX00006077   AAGAGTATATTCCATCGCATCTTATGAATGCGGAAGTGACGGCGGATATTATGA
Ext3   A19   AX00006078   CCAGACTGGTAGAGAAGTTCTTGCAAGAGCATCCGAAAAGTCTTCTGGACCTCT
Ext3   A21   AX00006079   AGTTGCTGGAATCGGCTTCTTTGGAATCGTTATCCCAAGCATTCTAATCTTCACA
Ext3   A23   AX00006080   CAGCATTATCCGTTTGCCGATCTCAGCGATGTTTCGACGTCCTATTTTTTCAAGA
Ext3   C01   AX00006081   ACAGGAGAATCGGTGGTTACTAGATTAGAAACTGTTAGACAACGGAGTGATGGG
Ext3   C03   AX00006082   CAACCTTGATTGCTGGTGGCATAATGATAGGTGATGCAAGAGGTAAGTTAGGTT
Ext3   C05   AX00006083   GTAATGAAGGGTGCTATTTTGGGTCTACCAATAATTGGCGGTATTATAGTCGGA
Ext3   C07   AX00006084   TCACCTTAATCAAGAGCTGTCACGAATCAATGCGAATTACTGGTTAGATACAGCG
Ext3   C09   AX00006085   CAGCCGCAGCCGCAGCAAAAACACAAGAGTATGACCTGATGAAGGTCATTGATA
Ext3   C11   AX00006086   TAATAGAGGATCCGCTCAGGAATCAAAAAAACCTTGGAATTATTGCGATTACCTT
Ext3   C13   AX00006087   TTTGAACTAGGAGTCACACTGGGACCTGATACATCACATCATCTGCAAATGGTT
Ext3   C15   AX00006088   CGAAAACCATGTCCTAAAGACCGCCGTGTCACGTATGCGTCAATTACTTCAGAA
Ext3   C17   AX00006089   AAAATAGACGATTTTCAACTCAGCATGTCGTTTAGTCCTGTTGCAGAGCGTCCAT
Ext3   C19   AX00006090   AAGGATTTACTTATTGAACAAACCGGATTAGCCCCATTTTTATTTCAAGCAACGC
Ext3   C21   AX00006091   ATGGCATTCATGCAATGGTTACCAAAAGAAGCCTACTTTTGAGACTGCAAGGGA
Ext3   C23   AX00006092   TCTTATCCTCGTTTGGACGAAGATATAAAATGTGACGTACTCATAATAGGAGCAG
Ext3   E01   AX00006093   TTTCGTTTATGTATTACGTTACAAGAGTTTTCTTATTTTCTCCGGAATGTCCTTTT
Ext3   E03   AX00006094   TAATAGGGAAATGGAACTCTATCCCAGCAAAAGGGGTAGCTAATGAAAGTATTA
Ext3   E05   AX00006095   TCTAATTACAAGGTTCATTGGGGCACCTCCACATAATAATATTTCTTCTAGTTCTT
Ext3   E07   AX00006096   AGTTGGAGATAGAGCAAAATTAAAAGTTACGATAGATATCTCTCCAAAACCTTTA
Ext3   E09   AX00006097   CAGACGCCTCTGACCGGTTTCGATCAGGAATTATTCATACCTCCTTTCGGAAGC
Ext3   E11   AX00006098   AAAGTGAAGCGCTTCTACTAGGGCGAGTAACCTATCAAGGTTTTGCAGCTGCCT
Ext3   E13   AX00006099   GTTGAAAGGGTTCATATTCTTTCTTGTGAAAAATCATGTCTGGGTCAATCTTACT
Ext3   E15   AX00006100   GAGGGATTATGCACACCGCTACGGTTTCCAGAAGCGGATAGGCATGTTGTCGG
Ext3   E17   AX00006101   GAGCATTTATAGAACATTGGGCATTTCAGTGTGGGTACTGTACGCCGGGGTTTA
Ext3   E19   AX00006102   CAGCACGGAACAAAATTACTTTAGGTGGAAACATTGCAGGGGAAATCTGTTATA
Ext3   E21   AX00006103   AGTAGAATTTATAGAAACTCCTCATGACGATTCTCCGTTTGGTTCCCGTGCTCTT
Ext3   E23   AX00006104   ATAAGGGGCACACAATGCTGGAGCACTCTGCTAATTCATCATTAGAAGAACGTT
Ext3   G01   AX00006105   AGCTAGTTTATCAAAAGTTTTTGGCTATGCCAAACCGAAATTCATCGCCCACCTA
Ext3   G03   AX00006106   TGAAGTGCGTGGAGAGGTATTAAAGATAACGCATTCTGAATTAGGAGAATTGTT
Ext3   G05   AX00006107   AGAACGCTTAGTAACAGCTATGAACAAGAAGAACGTAAAGCTAGAACAGGCTAT
Ext3   G07   AX00006108   GGGAAGCTCTTGTAAGCACTCTTGTGGTCATTCAACCTAAACAAGGAAATTGGG
Ext3   G09   AX00006109   ATCGCTTTAATACCTGCTGTGATTGTTCTCTTTATGTTAAGTTTCGGCTTAGTTG
Ext3   G11   AX00006110   TTGCATTTACTTTGGTATTAGTGACAGTTGGTATAGTGACATACCAATTGTTTAC
Ext3   G13   AX00006111   TCCAGGGATACTTGCTAAAACTTCTGAGAGTGGAAAAACATGGAGTTATGCGGC
Ext3   G15   AX00006112   TTTATTGTGAATCAATTACATATGAAAGAGCCCTCAAGAGCCATTTTATCGCTTG
Ext3   G17   AX00006113   CTATAATTCAGTACGATCAGCTCGAGAAAGAGCCTTTTATTATGCCTGCTTCTTC
Ext3   G19   AX00006114   TGCCCTGATTTTCGAAGAGCCGCAACTTCCATCCACTAAAGAAAGTTGGATCGC
Ext3   G21   AX00006115   TCGCCGGCGGGAAATGCGTGGCAACAATAAACAGGGATGAAATACGAGCAACA
Ext3   G23   AX00006116   ATAGACAAACACAATAAACCAAGAATCATAGAGTCTCAAGTTAGAATAGGTGGCG
Ext3   I01   AX00006117   GGGTTTGTTGTAGGCTCAGCAGCAGTGGGATTTTTAATAGGCAATACGGTTCTC
Ext3   I03   AX00006118   CGGACTTGCGAGGTTTCAGCCCCCGCAAGGTGGTATGCTAGAACCTATTTACAA
Ext3   I05   AX00006119   AACAAGCCAACACAGAAATAATTCCATCCGAGTACATCTGGGCGAAAGCAACGG
Ext3   I07   AX00006120   AGATCGTCGCACTTGGTGTGCTGTCTATTGGCTAATGCAGAAATTTACGATTGG
Ext3   I09   AX00006121   GTTGCGCCAAGTAATAGCTATTGGATTATGGTCACCTATTATGGATTCGCATATG
Ext3   I11   AX00006122   AATATCTCATCAAGACTTATTTTCATAATGCAGGATCATTAAGTGCGGATGCTGT
Ext3   I13   AX00006123   GATGTTCTTCGCCTTGCAGTTGCTTTATCTGAAGGTGATGTGAGTTTAGCATCC
Ext3   I15   AX00006124   GCTTTACTGGTTGGATGGTTCGTCAATATCCTGGTTCAGGTGAAGTATTTGAAC
Ext3   I17   AX00006125   AAGACTGAGCAAACTAGTAAAGCAATAACAATACTTTCCGAACAACAGTATCCGT
Ext3   I19   AX00006126   CTGCAAACTTGGAAGGACGTGAATGGACACATAATCTTGACGGTAATGACACCT
Ext3   I21   AX00006127   AAAACTTTAAAACTTATAGTTTACCTGTAGGTACCAAAGAATTGAAATGGGTTATT
Ext3   I23   AX00006128   AGTGATGTATTGGATGTAACAACAAAGGCAGAGGATTCCACATATGAAAAATGG
Ext3   K01   AX00006129   AAAAGGTGAGTTTATTAGAGGTAATTCGTTATTTATTCGGGAAGAAACAAACTGG
Ext3   K03   AX00006130   TTTATCAGTTTCAACAGATATCGACATGAACCTTGAAACAGGGGGAATTACTGTA
Ext3   K05   AX00006131   AAAGGTGACTATTCATATTATAGTGGTACCTCTTTTGCTACTGCGTATGTTACGG
Ext3   K07   AX00006132   ACAATTGACGGGAAGAGTTATGAACTTTCATCTGGCACTGTTATTGGTTTCGTTC
Ext3   K09   AX00006133   GGGCTGGTTTCGTACAAGGAATTCAGTGGTATGCAAATATAAATGCGCAGATTG
Ext3   K11   AX00006134   TGAAGCACAAAAGCCGAAAGCAGTACAAACGGAGAAAAAGGACTATATGGATTA
Ext3   K13   AX00006135   GTGTATAAATTAGGGGTAGAGTTTGATAAGTTGTTTGCGGAGCATAACAATATTA
Ext3   K15   AX00006136   TTTGGATCTATAACGGGGGACGCTACATATTTTCAAGACCATAGTTGGCCAATG
Ext3   K17   AX00006137   GTTGTAGCGTTTAATATTATGGAAGGTGTTGATTACGAACTTTTAGCTTATTACT
Ext3   K19   AX00006138   TTTTATTGAAAAGGAAGTGTTAGAAGAAGCGAGTGATGACATTTCTATGTTATTA
Ext3   K21   AX00006139   GAAATGTTTTCAAAGATAACCACCAAGAACTTTGGTATTCCTTTACAATGTCTCT
Ext3   K23   AX00006140   ATGCCTATAACTTTTATAGGCAATGTAACTGAGATTGATTTGATGATAGATGGTG
Ext3   M01   AX00006141   GTCTAATACATTTAGAGAGTTTTATTATCGATTTGCAGGACCATTTTGGGAAGTG
Ext3   M03   AX00006142   ATGTCGATATAGATTACACGATAGATGGTGATTCAGTTCATTCAAAGTTTGGGAC
Ext3   M05   AX00006143   TTTACTGATTTGGATGGGTTTATCGATGACCATTATATTAGTTTAGAGGCTGTAT
Ext3   M07   AX00006144   CACAGGGGCATTAGGAATCGGTGCATCAAAAGGCGGTGACAACATTTTGTGGA
Ext3   M09   AX00006145   GGGAAATTGCGTGGTGTGTGAGGAAACAGGAAGTAATATCATTATATTCCGTTC
Ext3   M11   AX00006146   TGTCGTCTTTTGGGAACATGAGGGGGCATGGGAAAAGGAAACATTGATGGAAA
Ext3   M13   AX00006147   GGGGACCTTATGGGTTAGGAATAGTAGAGTGTGCGGATGATGGTAAAGAAAAA
Ext3   M15   AX00006148   TTTAGCAGATCAGGTTGTTGAGGAGTTACAAGCTGCTAAAAAACAGATTGAAAG
Ext3   M17   AX00006149   TTATGTTGCTTCGGAACGGAATTTTTATGCAACTACATGGGCTGCACCAAATCCT
Ext3   M19   AX00006150   CCAATGGGAATTCCGTCTATAGAAGGATATATAAATGATGATAAAGATCTATGGT
Ext3   M21   AX00006151   TACATTTACAGAACGTGAAACTAGTCCTATGGGCATTCCTAGACTAAAAGGGTAT
Ext3   M23   AX00006152   ATAGTTTTTGTTGGGCGTATTGAAGGTATAACAAAGAGGCTAAGTATGTTTAACC
Ext3   O01   AX00006153   TTATAGTATAGGTAATGGGGATTACTTTTGCCTTCATTCAAAAGAGGGGCAGAG
Ext3   O03   AX00006154   AAATGATATAATTCCTGATCTTTGTATAATTTTTGAGGATCATATTGCTGAGCCAT
Ext3   O05   AX00006155   GGTACTGATAAGTGGGTTTGTATAGGGAAAATTGAAAGATATCCATTGTTTATTA
Ext3   O07   AX00006156   TATCTCCAGAACGAATGTTTCAGGTTCTACAAATTATAAGTGAAGATATCGAAAG
Ext3   O09   AX00006157   TCAATTACTTAAGAGGATCACTTTAGTTGGAATTGTAGTCCCATATGGAGATATT
Ext3   O11   AX00006158   TTGCTAAAGGGTTCAAAAAATCTTCCTTATATATTAGTAGAGAGATTTCCATACG
Ext3   O13   AX00006159   TTAGAACTTATGAACCTAGAGCATAAAAAACTTAGAGAGTATGTGAATTTTGATG
Ext3   O15   AX00006160   TAAAATATGATAATGAGGGGAACAGGATTCCTTCGCGTTTTATGACTGATTTTCA
Ext3   O17   AX00006161   GGTTGGGGAAGGTGCTCAAGAGGCATATTTTTATTACTACACTGAAGAGAATAG
Ext3   O19   AX00006162   GAAAATAACGCCGAATTATAGCGGGAATTCAAAACGTCCAGACAGTGTTGTTAT
Ext3   O21   AX00006163   ATGGAGAACAATATGCTAGGGAAAAACGTAAAAAGATATTAAAGCAAAATGTTGA
Ext3   O23   AX00006164   CCGTATGATTTCCTTCGTGATGGACGTGATGTAGGGATCTCGTTTGATTGTTCA
Ext3   A02   EMPTY        -
Ext3   A04   AX00006165   TTGAAGGGGTTAGAGGTGAGTCTTTATGTACCCTAAAACCACCACCAGATCCTA
Ext3   A06   AX00006166   GATATGTTACCGACCAGTTTAATCATAGGAGATGATCCGAGTTCAGGGTTAATTG
Ext3   A08   AX00006167   TTGGGAGATTCCTCCAAATCGAGTTTCTTATCCTGGAGGTTTTCCCGACTTTAAA
Ext3   A10   AX00006168   CAGAGGTGATGGCAGAGGGTATCATGGCAAAACAAGTCCATTTAAGAGCTTCTT
Ext3   A12   AX00006169   CTATACCGGTAAGGTTTCTTCCTAACGGTCCTTTGGGGGTAGGCGCTAAAACAT
Ext3   A14   AX00006170   ACAATATCAAGCGATAAACCCGATTTGAATGGGATTCCTCCTCATCCAAGACCAA
Ext3   A16   AX00006171   ACTGAAGGAGAAGATTTCGTTCAAATAGATGTAGATCGTAATCAATATGACTGGG
Ext3   A18   AX00006172   AAGCATATGTCACAGGTGCGAAATGGAATGGAAAAACGAGAGATGCATTTTTAA
Ext3   A20   AX00006173   CGGATAAAGAGGCTAGTGCTAAGGCATTGGAATATCTTCAGTATCCTGGTGCAA
Ext3   A22   AX00006174   TTTAGTGCTTTTAACCGCTTGTGGTAATACTGATGTTAAGACATCTAAAGCTTCA
Ext3   A24   AX00006175   TGTATATGCAAGTTTCACCAGCTGTAGTTCCTTTACAAATGCAGCAGCCACTAAC
Ext3   C02   AX00006176   TCCTGACCAAATTGCTCACTTCCCTTCCGCATTGCAAAACTTAGACGATTTTGCT
Ext3   C04   AX00006177   TGCAGTTGCACCTAAGAATGACTCTAACATTAGCGTATATACTCCCTTTTTTGGT
Ext3   C06   AX00006178   ACTAAGGTTGCACCTGAAACGAGGCAAATCTTTAATTTCACATTGCCTTCAGTGG
Ext3   C08   AX00006179   TTGGGCGGAATGGTGATGCAAATTATAGCAAAGCGACAAAGGGGAATATTAAAC
Ext3   C10   AX00006180   AGCGTTGGTGTGCGACGTGAAACAATTAGTCATCTCGAAAAAGGTAAATACAAT
Ext3   C12   AX00006181   CATGGACAATGAACTATGGCCCAAAACAAATTATAAACGGGTTAGAGTTTTATTC
Ext3   C14   AX00006182   GAATCGCAACGAAACTCCTAATTTATATATTTAACATGTTTCCCTCTTCAATGGC
Ext3   C16   AX00006183   AAAACGTAACGACATCAACTGTAGTAATCGAACCAGCCATTTCAAATACACTTCT
Ext3   C18   AX00006184   TCTACAGTTTTTGGTTCTGATGTCAGTTTAACAAATGCAACAACTGTAACGTTAA
Ext3   C20   AX00006185   ATTCTATCCCCTTAGTAGAACAGCGATACCACGGTGTCTTCCCTTATAACCCAAA
Ext3   C22   AX00006186   TGTTACTGCCGTACAACCTCCTGGTAGATTTGGTTCTCTCATATTAGATAAACAG
Ext3   C24   AX00006187   AGCTTGCGCTGAAATAGTGGCAACATCCTATCAAAAATCATTCTTCCGCACTAAT
Ext3   E02   AX00006188   CCCCACAAAATATTTTTCATAACTATTTATACTTCAGCTCTTACTCCTCAAGTTGG
Ext3   E04   AX00006189   CGTATGCACAACAAACAGGCCTCAGCATGTGTTGGGGCCGCATTTTTCATATGT
Ext3   E06   AX00006190   AATTGGTCCGACTCTTTCTGAAGCTAGTAAGCATGGGGGAATGGGGACGCACC
Ext3   E08   AX00006191   TCCGGAAAACTGGGAAAACTGGATGTTTTGTCACGAAGAGAAGTATAACCGGAA
Ext3   E10   AX00006192   CAGTTTTATATTTGTGAGGAGTATGCTCCACTTGAAGAAGAGGATGATGATTGG
Ext3   E12   AX00006193   CCGGATTTTCTACTATAAGAAAAATTCGGCTGTTCTTTTTTACTTGTTGTAAAGG
Ext3   E14   AX00006194   GAGGTAGCAGTAACGACTACAGAACGAATAAATATCGGTAGTGAAGTGATAAAT
Ext3   E16   AX00006195   ACTTCGGAGGAAGGCAGTCATATGTGGAATAGTTTGCTGGATGAGATTTATTAT
Ext3   E18   AX00006196   AGGAATTAAGAAGGTAGTAGTTGCTACACTTGATCCAAACCCGCTTGTTTCTGG
Ext3   E20   AX00006197   GATGCCCTAATTCGTATGCATAGTATTTGTCACACCGGTGATATCTTTGGTAGTA
Ext3   E22   AX00006198   AACTTTTTTCTGGATCTCAGCGCTTTTGTACGCTTGAATCTTCTCTTCCTGTTAG
Ext3   E24   AX00006199   CATCTGTTGTCAGGGTTAAAGGGATTCGCCCAGATGATAGGGAAAAGCAGTTTA
Ext3   G02   AX00006200   AGGGACGAAGCGAACGAGTGAGTTGCAACGTTTGATTCCTGAAATTTCTGTGAG
Ext3   G04   AX00006201   GCTCGAGATTGCCTGTATTATCAGTCAATCCTTATGATGAACCTAGATTTTCAAG
Ext3   G06   AX00006202   TTCGTCAGGTAAAGTGCTGCTTATTAGCCCTGCGCCAGTTGATGAAGAGAGGCA
Ext3   G08   AX00006203   TATCCTGCTATGAATATTAGTGGAACAGCGGTAGGTTGGCCAGAAGGTAGTCTT
Ext3   G10   AX00006204   CCGTTAGATTTTGTAAAGTTTGGCACATGTACATCGTTATTTAACGGAATTGGGA
Ext3   G12   AX00006205   TCCAGAGAAGGGATCGTTGCTTTTTCAAGGTGCAGTTTTGGGACTTGCGCAAAT
Ext3   G14   AX00006206   GGGAGCGCCTTTTATTCATTAAGCAAGACTAGTGATGAAGGGAAAACATGGGAG
Ext3   G16   AX00006207   GAAGCAACTTTAGTATTCACTCAAAAATCCATTGTCTATGAAACAACTAGATTTG
Ext3   G18   AX00006208   TCATTTCTCCTGATGAAGTCACAACAGAAACATCACCGATTCATCACATATTACT
Ext3   G20   AX00006209   AGAAATGGGAATTGTAGAAAGAGAACCTGAAATTAATAAAGAACTACGCCAGCT
Ext3   G22   AX00006210   ACTCTAAACTATAAACTCTTTAACAAGAAAGGCAATTTCAGCACTTATATATCGGA
Ext3   G24   AX00006211   GTGTCATCGTTAACGCTGGTTCGATTCATAGTTTTGTTTCATTACCTACACCAAC
Ext3   I02   AX00006212   GAGAGTTGTCGATTTTAGATATCGATGAGGAGAACAAAAGAGCAGGATTCAGAA
Ext3   I04   AX00006213   GAACATGACAAGTTAGGGCTGCAAATTATTGAAGGTCAGTTTCCAGGAAGAAGA
Ext3   I06   AX00006214   AACAACTAAGTCCACATCATATCGTTACTACTATGCATTATGGAAGTTACGACTA
Ext3   I08   AX00006215   GGATTTAGATGTGAGCCGAGTTATTATTATTCCTGCTGAAGAAGGGGATGTACT
Ext3   I10   AX00006216   CTATTGTGCGTCTCATCATTATAGATCACGATAGTCCGTTAGATTTATTGTTATAT
Ext3   I12   AX00006217   GAGAAGATTGATTTCTTTATCGCGCCTACTGATGATGTATGGGCAAGGGACAGT
Ext3   I14   AX00006218   TAATTTAGGTTTATTGTATGCGAGTCAAAATCTTTCAGTTTTAGCAATTAGACACT
Ext3   I16   AX00006219   AAAGGATATGGCTACGAGTCAGCTTCTGCGATAATCGAATACGGTGTACAAAAG
Ext3   I18   AX00006220   TCATTTGTATCGTATATGGAATGTTGTACAATACCGTATTAAATTTAAATATGCCT
Ext3   I20   AX00006221   AGTACATATCAACCTGATTGGAAGATTGGAAATTTAATAACTGGTGATACATTTT
Ext3   I22   AX00006222   GCGTAGAATTGGATTCCTTAGCTGATATTGTTAGTTTCGGCGTCGCTCCTGCGC
Ext3   I24   AX00006223   ATCAAGAGAGCTCCTGTTCTTATTTCTTCTTCTTTTCTGTCGGTTGGCTTTGTTT
Ext3   K02   AX00006224   TATTGTTAATTTCAAGGAGGGTATATCTAATATTGTTGAACAAAATTGGGGAATA
Ext3   K04   AX00006225   GAGGACATTCCCAAACCATTAGTTCGAGTTCAAGGAAAGCCTCTCCTCTTGCAT
Ext3   K06   AX00006226   GAGTATTGTTGGACATTAAAAGCGCCCCTATGTCTACATGTCCTTAGTCTTTATC
Ext3   K08   AX00006227   ACTCCTGTGGATATCTATGGAAGTACCAAAGCTGCTGCTACTATACTCGCCCAT
Ext3   K10   AX00006228   CCCTATGGGCGGCCATGACATATATAGCTCAAGCAAAGGATGCTGCGAACTTTT
Ext3   K12   AX00006229   GGCTTTAGGATTTACATTAGTTGTAATAGAGAAAGGTATTAAAGCGGGATATGAC
Ext3   K14   AX00006230   AGATCCTGGGAAATCCACAAAGGGATTACCTGAAAGTAAGATTGTACTAGACAC
Ext3   K16   AX00006231   AAGGCTTCTCCAAATGGTTACGTTCTTGTTAAAGAACCGATTATGTTCGAAATAA
Ext3   K18   AX00006232   ACTATGCTAGAGGCACCTACTGCTCAAGCAGCTTCTTATAACTCAACGTCATCCT
Ext3   K20   AX00006233   AACGAATTGCTTTGCCATTCTATTCAACAACAGAAAAAGGAACTGGGCTTGGTAC
Ext3   K22   AX00006234   CATATGACCAAAATAGACAATTCCAACTTCCAATCTCTTTTCCTGGCACTGGAAA
Ext3   K24   AX00006235   GTAACACAAGCTACGGTTTCTCGCGATATTCGTGAGTTAAACTTAACGAAGGTA
Ext3   M02   AX00006236   ATTTCGGTTTGACATGGGAAACTATTCATCCGTTTCTTGAGTATGGCAGTGCGG
Ext3   M04   AX00006237   ACAGCTGAGGAATTTCAGCTGGAAGGTAGGGGAAATTATATTCCGTTATGGTTA
Ext3   M06   AX00006238   GAGAGAACCAGCGCGTAGACGTGAATCATTATTCATGGAGTACATCATTAAATA
Ext3   M08   AX00006239   AAATTCTGGTGTGCCAGTTTGGAATGGATTAACAGATATGTGGCATCCAACACA
Ext3   M10   AX00006240   AAATATTTTGGTGTACGTCCCATTGTTGCTGCAGACGAGCGTATGCAATTTCAAG
Ext3   M12   AX00006241   TTTCAGAAAAGCAAGAAATGACAGTGCAGCAATTAAAAGAATGGCTCAAAGCCA
Ext3   M14   AX00006242   TAGTGCATGGGGATACTGGCTATCTGCTTGGCTTGGGAATGTAGCTTACGGTAC
Ext3   M16   AX00006243   TACTGGTTCCGCGCTATTAACTTCTCGCGGAATTTATAAAATGTCATTAAATCGT
Ext3   M18   AX00006244   ACGGAAAAGACACCTGCAATGCCATTAGATACTTGTGGGGCAATGAGCCAAGGG
Ext3   M20   AX00006245   GGAGAAGATAGAATTGCTGGGTTGTTATCGGTCGGAGCGATAGCAGGGCTAAC
Ext3   M22   AX00006246   AAAGTATTTTGGCTTAACTTGTAGTGGAACAAGGGGGAATGCCTTTGCAGTTAT
Ext3   M24   AX00006247   ATTGTAGAAAAAGGTAAAGGCGAGCTATTAACGAAAACGAAAGAACGTTGGGAT
Ext3   O02   AX00006248   CATGTTCTGGGTCAGGTGGGGAAAAGAAAACGACTACTACATCAAATAATGGGG
Ext3   O04   AX00006249   ATATTCCAACGGTAATCTTTGAAGATATGGTAAAGTCCAGCAGAACACAATTGAT
Ext3   O06   AX00006250   ATTCTAGCTCATCAAGAATTGCTACAACATATAAGTATGCGATTGATACGGAGAA
Ext3   O08   AX00006251   ATAAAGGAGCAATGGCATACTTGCTAGCAACACCTGTATCTAGAGTGCAAATTG
Ext3   O10   AX00006252   AAAAGGTGAGGAGAAAGCATTGGTTGCCCAATTTATTCGAATAGAATCTAAATTT
Ext3   O12   AX00006253   TGGGAATACAAAGCTAATGATAGCAGAAGATACAATGAAGCATAATGAACGTTAT
Ext3   O14   AX00006254   TGGGGAAAAACTATTCAATGTCTATAAGATTCCGATACATACGTATGTTTATATG
Ext3   O16   AX00006255   ACACATTCCAAACCTTTATTATGATCCAAATGATCAAGATCCAAAACGGGATTAC
Ext3   O18   AX00006256   CCTCTGAACTCCATTCCCTATTATCCCCTCTTCTTGAAACTGGTAGCCCCTCTCT
Ext3   O20   AX00006257   TAGTAAAGATCCTGAAAAAAAACAAGTTGGACGTATTTGTCTCTATATCGCATTA
Ext3   O22   AX00006258   AAAAAACTTATAGGCACGTGTGGATTTATAAAATACGATTTGGTCACACATACAG
Ext3   O24   AX00006259   GATGGATGGGACGTGTATAAAACGCATGAATTTCATCAAACTGTAAGGGGGTGG
Ext3   B02   EMPTY        -
Ext3   B04   AX00006260   GAAATCAAGAAATCCATATTGGTGTCGAGCGGAACTTTACACCAGCTAAAAAGG
Ext3   B06   AX00006261   TAGATCCAAAGTCAATCGGCATTCTTTTCTACACTCTTGCGGTTTGTTATATAGT
Ext3   B08   AX00006262   AAATGTGTAACAACATGCTTGACGCATTTGATCTAGCGAAAACATCACCAGCAG
Ext3   B10   AX00006263   ACAGAAGTACATTTGAGGAGCAATTTAAATTAGCAGAAACTGAAAAAGACTGGTA
Ext3   B12   AX00006264   AAGCTTGCATATGCAGAAGGATTTTCACTTGGAGAGGTAATTGGCAGCCAATAT
Ext3   B14   AX00006265   CAACAGGAAATACCAGGTTCATTCGTCTTTATGGGAACGAGCGGTACACATGAA
Ext3   B16   AX00006266   TTAACGATACGACCAGCGAGTCGCTTTAAAATTTTAACAGCAAAATTTTTAGCAA
Ext3   B18   AX00006267   GTGACAGAGTTATCATTATTCAGCACGGGGAATATGTGGCTACGCAAAATATTC
Ext3   B20   AX00006268   GTCTGTCCCAAGTGGAGGACTTGAAAAGGGAGAGACACTAGAAGAATGTTGTAT
Ext3   B22   AX00006269   CCCGCGACTACTCAGCTACTAGCCATTGAAAAAGTGCGTGCGGAATGCAAACG
Ext3   B24   AX00006270   GACAACGTGGACAGCGTGGCAGTACACAGATTCCGGACAAATTTCAGGCGTAG
Ext3   D02   AX00006271   TGGTGGAGTGACAATTTTTCAGTTTCGCGAGAAGGGGGAAGGTTCTTTAATCGG
Ext3   D04   AX00006272   TTAATATCGGAAGGGTCAGTATACCCTTTATTACGTCGTTTGACGAAAGAAGGG
Ext3   D06   AX00006273   TTATCTTCGTAGTCATGGTGTATCTGAGGCTAAATTTCGAGCGGATGTGTTAAAT
Ext3   D08   AX00006274   TGAATTGCATAAAGGACGCTGGAATGTTAGTAAGAGTGATGCTGTGAACCCGTT
Ext3   D10   AX00006275   TATCGCTGTTGCCTACAATGGTGGTTATCGATATAAAAACGGGGGGAATTTCTT
Ext3   D12   AX00006276   AAGCGTTGGATTAGCGGTGATTTGCAAAATGTACGATTAACGGCTGAATCGGAA
Ext3   D14   AX00006277   TTGTAACTTTATTAAGGGGATGGGCATTCCGTTAAGTGAAATTGCAATTGCAGAG
Ext3   D16   AX00006278   ATTCTTATCAGGATATCGGCCTTAGAAGGAAGTTATATAGAGATATTTATAGTCA
Ext3   D18   AX00006279   TTTCTTCGCATCTGAAACTTCGCCACGCAACAGTGAGCGACAAAATAAATGGTA
Ext3   D20   AX00006280   TATGAAACCATCCAAAACGATCAATCAAACATTATTTACATTCCTATCATTGGTTC
Ext3   D22   AX00006281   TTAACAAATGCGTTTCCTATAAAGCCGGGAGATTATTATGAACAACCCGCTCATT
Ext3   D24   AX00006282   CAGGCTACTTTAATGATATATGTGAAGAATGGTTACAGCGTATACAGGCCGTAG
Ext3   F02   AX00006283   AGTTAGAAAAAAAAGCAGTGAACTTGGGACATAGGGAGATATATACAGAGGCGA
Ext3   F04   AX00006284   AAACCGATGTTGCTGATCCCGTTAACTAACAGTTCCAGTAGGGGAGATCAAGTT
Ext3   F06   AX00006285   CCGCCATGCTTGCCACTATTTTTTAGAGCAGGGCTTTCATGTAATTCCTATGTTT
Ext3   F08   AX00006286   TTAAAGCCGTATATCAAGGTAGAGGCGGGGAAATCTTTGTTATGAAAATGCCGG
Ext3   F10   AX00006287   TACGAAATGGCGCTTATCGCATATACAGCCCTGCACTCATCTATGCATGGCGAG
Ext3   F12   AX00006288   ACTAGTTGCAAGAAACGTGGAGGAGAATTACGGTAAGTCTACAAAAAGAAATGT
Ext3   F14   AX00006289   TGGATATAAAGAGTGAGGAACATTCTCGAGAAAACTCAACGCTTGCTCCAGGTA
Ext3   F16   AX00006290   CAGTTCCTCTAAAGAACCCCATTGATAAAAAATTCAAGAACGGCACAGGTACACA
Ext3   F18   AX00006291   TTTAGAGCAAGCGCAAGACAAAGGTTTAGATGGCGGTGCGGTATCAGATATGG
Ext3   F20   AX00006292   AGCATTCGTTGTTTGGTATGTTATTTATAAAACACCGTTCGGTCTTCGTCTACGT
Ext3   F22   AX00006293   TTCACAATGTGAAAGTCAAAAAGTTGTAAATATAAATGGTGTGGAATTAATGGTT
Ext3   F24   AX00006294   CGGGCAAATACAAACACTTATAATACCTGTAGGGAAGTGGGGAGGTTTTAAAAA
Ext3   H02   AX00006295   ACGTAGAGAAAATAGAAATATTACTACAAGACATGCAAGAGATTGCGGGGCGAT
Ext3   H04   AX00006296   CAGCAGTTCGATCGAACAAAAAGAAGGTGAACTTGGCGAAACAAAATAACATAC
Ext3   H06   AX00006297   AGTAAGGCATCATTGCCCGACTATTGCGATATTAGGGCATGGATTGTCTTTTATG
Ext3   H08   AX00006298   TGAAATAGGTCATGCGGCCCAAGATTGGGAATTTCATTTGGTGTATAAAGAAGG
Ext3   H10   AX00006299   ACAAGAAGTACGTTCCAAAACAATCGAGACTTTTCAATCGTTACCTGATGAATGG
Ext3   H12   AX00006300   CTTCTTTGCTTAGCGTCCTTTCCCGTTACAATGATTGTTATTGGTGGGTGGGAA
Ext3   H14   AX00006301   AGAGTTGCAAGAGAGACTAGCTAAAGAAGTAATGCACAAATATGATGTCGAGTT
Ext3   H16   AX00006302   GCAATCGTGTTAAAGGCGATAGCAATTCTCAGGAGGGCACCGGTTCTCAAGGG
Ext3   H18   AX00006303   GGCTTGCTGGAGGAGAGGAAAAGACGCAAAAAGATGTGGCTGATATGCTTGGG
Ext3   H20   AX00006304   AAATGGTACGAAATGTGTGTGAAGGAACGTCTCGTAATACATCCTCTATGTTAGC
Ext3   H22   AX00006305   TTTGAGTTAGCGGCGATGCAACATTTCAAAAAAACAATACCAGATAAAGTGGAAA
Ext3   H24   AX00006306   TTTATTATTTACGAGTGCAAGGAGTTGCTGTTGAAGGTGACATTGGCAGTAGAC
Ext3   J02   AX00006307   GTGGTTACTTTATGGGACGATTATTATATTAAGTGCTCTCGTTTATAATTTAGGG
Ext3   J04   AX00006308   CTGTCTTAGATCCAATGTATAAACTACATGGTTTGATTAGTACTGCCATGATATT
Ext3   J06   AX00006309   GACTATATTGAAGGCTTCTATACGATGCAGGATTTAACTCTCTATGTCAATCGAG
Ext3   J08   AX00006310   TTCCTCAAGTAGCCGTTACATTACAAATTGGTAGTATGTATACAGAACAATTTTC
Ext3   J10   AX00006311   CCCGTTTTCACAGTGGCACCAAAAAGAAATCTCAGCATTTACAGTGGCGGGACC
Ext3   J12   AX00006312   TATATGAAGAGTTACAGCATAAAGCGGGAGATGAAAACTGCACATGTGCTGTGA
Ext3   J14   AX00006313   TAAATTTATTGGCTTTTACGATGATGAAGAGCGTATTCTTTAGTGAAACCGACCA
Ext3   J16   AX00006314   CGCAATTATTGTGGGGGCGGATCGAATTGTCGCAAATGGAGATACAGCCAATAA
Ext3   J18   AX00006315   GCTTCCCGCTTACAATTAATTAATTGGATTGGACGTCAAAATTTAGAATTTCCTG
Ext3   J20   AX00006316   TTATCAGATTCATCGTTAGAGAAGCAGTGCATAGAGTTATGTCAAAAACAAAACC
Ext3   J22   AX00006317   AACTATTGTTAGATTTCGTAAAGTTAACACCAGCTCATTTAATGGCAACTTTTGTA
Ext3   J24   AX00006318   TTACCACCCTACTGTCCAATCAGATAAAGATCATGGAAAAGTAATACAAAGGGGA
Ext3   L02   AX00006319   TTGGATTCCCTTTTATTTTGCCGACTCTAATTGCCGGAGCTATTTCTATTCATAC
Ext3   L04   AX00006320   AGCACTTTATATACCGAGACTATCGCAATACGTATCAAAAATAGGGAAAGAAAAC
Ext3   L06   AX00006321   GCAGTCCAATATCAAAAGAAGATCAGGAAATGCTAGTGAAACATATTCAAACGG
Ext3   L08   AX00006322   TATGCTATGCTTGCAATGGCTTCTGTGTTAAACTTTGGATTGCTACCAGACTTTA
Ext3   L10   AX00006323   GATAACGTTGTCCTTGTTCGTCACTTAGATCCCAAGGGAAATGAATGCAATCGC
Ext3   L12   AX00006324   TAGAGGGCTAAATACAGCAGCTACTTTATGGTGTGCAGCTGCTGTCGGTACTCT
Ext3   L14   AX00006325   TGGGATAGATGGAGACGTTTTTTAGAGCCAGCACCTATCATTCTTATACATAATG
Ext3   L16   AX00006326   GAGAGGTGGATGGGGTCTTTGTTGATGTGTATGTTACTGAAAATTCTACTGAAA
Ext3   L18   AX00006327   ACCCTTTCCTTTTATTTTACAACAAAAAACACCTCTTGCGGAGCTTTTACAAAATT
Ext3   L20   AX00006328   TACAAAAGATGCTGGTCAAGGTGCCATCGCTTCGAAAATTGAACTTGCTGGGAA
Ext3   L22   AX00006329   CAATGAACCTAAGTACATGCATCATGGTGTGAAATTCTCAGCCCAATCTGTAAGA
Ext3   L24   AX00006330   CATTAACTGGCGTTGAGACTGGCGAAATAAAACCATTTCAAATTGTTTTGACTCC
Ext3   N02   AX00006331   TGGGGCAATGTGTTCGGAATAGTGTGTATGGGACTTCTTTCAATTTTGATCGCC
Ext3   N04   AX00006332   GAAGAAGTGTACGGATATGAACTGAGCACAAAATTAAATAAACACGGATTTACAT
Ext3   N06   AX00006333   CTCATCGAAGCACAAGCAGAAAATAAAAACGCTTATGACATCTTTGGAGATAATT
Ext3   N08   AX00006334   CCATGCTCTGTATGATGTTATTCATTAATGCCGATGTAAGCAGCTCTCCTTATGC
Ext3   N10   AX00006335   AACTGGATTTACGCTGTGGGGAGAGATTCTTGGCGGAATAACGGGAGGATTGG
Ext3   N12   AX00006336   CTATTTGATCTTACCAATATACGGAGCATTCCAAAACTCTATAGAACCATTTCAAA
Ext3   N14   AX00006337   GGTATGCCGTAGTTAGAGTGGCGATATGCTCTTTAGTTTATATAGCGGTGCTGT
Ext3   N16   AX00006338   GTGGAAATTATGTCTTTGAAAATGATTTAATTCTCGTTACGTTGCAGTGCACACT
Ext3   N18   AX00006339   AATAAACAGTCGAAAGGGTTAAATGATTGGGAGTGGGATGTGTATTTAGGGCAA
Ext3   N20   AX00006340   GTAGTTACACAGCGCTCATCGGTCCAAGGAAAAGGTTGTGCAGCTTACGTGAAA
Ext3   N22   AX00006341   GTACACAATTGTCCATTTAAAGAAGTTGCTGTTCATCATCCAACTGAAATTTGTA
Ext3   N24   AX00006342   TATGGGATTTGCAAGGGAAAAAGAGAATCCCTTTGAGGTGGGTTATTATTCATC
Ext3   P02   AX00006343   CCGCTCTCAATAAGAGTTGTCTTTATTATTTTATTTATGTAGCTAAAAGGAAATGC
Ext3   P04   AX00006344   AATATAGCAAAGAATATGAAGTTCCCATTACAGCCGCACAAGCTGATCAAATCGT
Ext3   P06   AX00006345   TATGGTCCTATTATGCGTAGTCTACCAAGCATTGTTAAAATCCTCACCTCTGGAA
Ext3   P08   AX00006346   AGAAACAATACATATACACCTTTTTACAAGAAGAGTAGCAAGCCACATATACTGT
Ext3   P10   AX00006347   TGTATTAATGGATCTACCTCGGATTACTCTTGTTGGGCAAATACATATTTATATAG
Ext3   P12   AX00006348   AATGACCAATTTGATATCCTTACAATCCAACAAACAAATGGCGTTAATTACGAAG
Ext3   P14   AX00006349   GAATCAGAAATTTTGGGTAGCTCGTTTTCGGCCTCAGAAAAACAACAACAGTTAG
Ext3   P16   AX00006350   TTACCATTTACCCAGCTTATCTTCGGGGAAACGCCCCTCAATCTTGTAGCTGTAT
Ext3   P18   AX00006351   AAATCATTGCAGGCGTTCTTTTATCTGTGACGGATGGGGCAGTAATTGTTCGTA
Ext3   P20   AX00006352   ATCCGAGCATCTCTTGAATATTTTGGTGCAAGGGTTGTGACATATTGGATTGGT
Ext3   P22   AX00006353   TGCTTCATCCGCCATTGACGGATGAAGGAAGGAATCAGGCTAAATTACTTCAAT
Ext3   P24   AX00006354   GTACCATTAGCCTCTTAAATAAATGGTTAGGTTTAAGCACAAACGATAAATCACC
Ext3   B01   EMPTY        -
Ext3   B03   AX00006355   GATGTAACGATTAAGTACGATTATGCGATTGGGAATCCAGATTATTTATTGCGAG
Ext3   B05   AX00006356   GCAGCATGTTCATTAGACATATTTATTTATCGTTCCGTCGCAAGGCCAGGATTGC
Ext3   B07   AX00006357   ATCGGGTTCGGTATTTGGAAGGGGTTCTTTATTCATTCCTCACGTAAAGAAAAAG
Ext3   B09   AX00006358   TTTGTTCTGTTATAAAAACTATAACAGATTAGGAGATAAGAGTATTACAGCTCTAC
Ext3   B11   AX00006359   CACGAAAAGTAGCACCTGACATTGCCTTTGGTGTTTGCTTACAGTTCTATGGCG
Ext3   B13   AX00006360   ATTCGTTCATACTCCTCAGCTTTCACTTAGCAACACCGAACCCAGGGCGCCCTT
Ext3   B15   AX00006361   CCCTCTTTTAATCTGGTGGAAGCTTACCAATGTTATACCTATAAGAAGCGTAGAA
Ext3   B17   AX00006362   AATCTTTTTGGAGAAAACAAGGTCGCCTAGGTAGAGAATTAGTAGATGAAGCAA
Ext3   B19   AX00006363   ATCATTAACAGTCTATGACAAAAAGAACGACAAAGACGAGTTTTATGGTGTTAAA
Ext3   B21   AX00006364   AGACACGATTCAGAAATACCTATACGACAAACTGAAACAAACCTCTGTTACAATT
Ext3   B23   AX00006365   ATCATACAAGAGTAGGCTCCCAGCTGGTAATAAGACCTTTCCCGACACAACAAA
Ext3   D01   AX00006366   TTTCTCGAACCAATCGTACCTATCCAGGAAAGACAAAAGGATTGATTGTGACATT
Ext3   D03   AX00006367   TTGCGAAACAAAAGGTAAACGTTGATGGGCGTGATCGCCGATTTGACGTGACAC
Ext3   D05   AX00006368   AAGGTGCACGTAATCATGGTCTTCTAAACATAAGTGTGAGCGATTTTTTTGAGAC
Ext3   D07   AX00006369   ACCTTTGATTCTGTCCTTATGAATCCACCATACTCTGCAAAATGGTCTTCAGACG
Ext3   D09   AX00006370   TTTGAGCAGTGCCGGAGATGTTGTTTTCAGCTTTGTTAGTTCAAAAGCTGGGAT
Ext3   D11   AX00006371   AAATCAAGTTATACATAGGCAAACGATCTTTATTGGAAGTTTAAACACGTCAATT
Ext3   D13   AX00006372   CTTACTGGACAAGGAACGACAGGAGGAAGTGAAGTGACAGCTTCAAGGCCGAC
Ext3   D15   AX00006373   TTCGGACACTATAGCGTCTCTTGTGGGTGGTTTATTAGGTGTAATTAATGAATTG
Ext3   D17   AX00006374   TACATAAGGAAACGATTGAATCAGGTGAATATAGTGATGATACTCAATTGCTTAT
Ext3   D19   AX00006375   AATGCGGCTGCGGGGGAGGGTAAATACTTAAAGAGCGGTAATGAAGGGTTGAG
Ext3   D21   AX00006376   ATGACAAGAAAAGCGTTGGGCGCCAAACCTGCCTTGGTAAAATTTGAAGGTATG
Ext3   D23   AX00006377   ATAAATTGCCAAGCGAGAGCGCTGGCTTTATATGTTTCTTTGCATAAGGCTGATA
Ext3   F01   AX00006378   AATCGAGTATCTAGTAGAATTGTTGCGTTTCCGCAACATGGATTATTGCGCAGTA
Ext3   F03   AX00006379   TTTAGATGGTCTATTCCATGTGACGGAAAAGGGTGGGGCTCCATCGATTACATA
Ext3   F05   AX00006380   GAAAGTTAAAGGGGTCTTGGATGTCATCAGAAAGTACAGACAGGCCAGTTGGG
Ext3   F07   AX00006381   TCAACATTACTTAGTGTCATGTCTAGAAACCACGCTCCTAGCAGTGGAGAAGTA
Ext3   F09   AX00006382   AACTGCATTTTATCCGCCAGGAAATATATAGAACAGAAGTAGCGTTGAAGATGTT
Ext3   F11   AX00006383   TATCGGAAATTACTCGTTGGTTTAATGGGGCTACTTAGCCTATCCTTTGTCACAC
Ext3   F13   AX00006384   ACTACCAAGAAATTATTCAAGAACATGCTAGAGATGGCTGGAGGTTCGTACAGA
Ext3   F15   AX00006385   GGGAGAGTATTTGATGGATATGAAACACCAGATTATAAAATAGCGTATGCTCTTT
Ext3   F17   AX00006386   AATGTCTCCCCGAATCCTCACGCTCAAAACAACAAGTTAGTGAGGAAAATTAATT
Ext3   F19   AX00006387   AAGAGCATCCAGCACATATAGTCTTGAGCTTTAAGGACAAAGACGCATATAAACA
Ext3   F21   AX00006388   TTTGGAGTGTTTTACAGTTTTGGGATAACTCCCAATATTATTGAGAGCATTCTAG
Ext3   F23   AX00006389   GAAATGCTAGATACGATTCGCACTCATTTTAAAGAGAAGCACGGCGTTGAACTA
Ext3   H01   AX00006390   ATAACGAAGAAGACTTCGAAGTTTCTTGTAAACTAAATTCAGAAATTGCCGATCT
Ext3   H03   AX00006391   TGTTGCTTTTGTAAAGTTGCCGAAAGAAAGAAGTATATTAGTTGGTCCATTCGAT
Ext3   H05   AX00006392   GGGGTATCAAGAGAACCGGAAGTTTTCAATTGGTATACTACCGAGTTTAGCGGA
Ext3   H07   AX00006393   TTTACGCGAACTTTGACTGTACGATTTTAGACGTATGCCCGGTAACAATCGGAG
Ext3   H09   AX00006394   GTGATTACTTTGCGGATGTTTTTACTGCTACGCATCGTGTATTTCTCATTAATTTA
Ext3   H11   AX00006395   CTACGAATGATCATTTCGGTTGGTTCTTTTTTGCGATCTTTTGGGTAATTAAAAG
Ext3   H13   AX00006396   TTTACCTGTCGTTGTCGATGTAACGCATTCTACAGGGCGACGTGACCTTCTCTT
Ext3   H15   AX00006397   TTGCACTAGAGTATATATGAAATGGGATTTGCCCTTATATATACCAATATTAATAA
Ext3   H17   AX00006398   ATAAGTTGCTCCAAACAGCAATTTCATGGGCTGAGAATAAAAAGCTGAAAGATAT
Ext3   H19   AX00006399   AAATGGGAATACTCCAGATAAAGCATTCATTGGTTTGTTTGCGTCGCAAGGTAAA
Ext3   H21   AX00006400   GGCGAATTTATTTTTACGTCTTCATGCAGATGGTTCTGAAAATCCAAACGAAAGT
Ext3   H23   AX00006401   AACGGAAAGTGGCAAGAAGGATGGATTACAATTGGATATGAAACGGATATGGGC
Ext3   J01   AX00006402   AACATGAAACTCCATCATTCATCTTGAAAGAAGCGCCTTACTTATATCATGCGTA
Ext3   J03   AX00006403   ATTTCAAGGAGCGCATAATCCCCCGAACGATAGAGTTACGCTTACTTTGGAAGA
Ext3   J05   AX00006404   TGTTGCGAACGAATATAATGTACCAGTTTCAGAGCCAATTATGGTTGCGATTAAT
Ext3   J07   AX00006405   ACTCTTTAATAAGATAGCCATGAGGCCCGGAAGTGTAACGACAGTAGCTGAAGT
Ext3   J09   AX00006406   TTGCGACAGAGGGTTTGGATGTAAGAGAACTTCTTAGAGGAAATCTTTCGGATG
Ext3   J11   AX00006407   TGCTATACCGAAGAATGCGATACTAAGCAATAGAAATAAGAATGACATTTCTTGG
Ext3   J13   AX00006408   AATCTACGCATCTTTCAATTGGTATTACTTCTTTAATTCATATTGATTCGTATAAC
Ext3   J15   AX00006409   GTACACGAAAAATCATAGCATTTTTTACGCTGTCCTCGGTGTTCTTCTTCCAGGT
Ext3   J17   AX00006410   TGCAGAAATGTCCCAACAAACCTCACAACCCCTTCTTCTAGCTACATCCTATCTA
Ext3   J19   AX00006411   GTTAGTTCCAGCGATACTTATCGGAAAGTATGCTCTTACAGGAATCATTATTCAA
Ext3   J21   AX00006412   AGAAAACTTTCCTGGTGGACAAACTATTTCTCCTACATTTGGGGGAAATACGGC
Ext3   J23   AX00006413   GATTGCGATGAGTGATCGTATTTATTTACTTCAAGCGAATCCTGGAAAAATCGCG
Ext3   L01   AX00006414   GTCAGCGACAAGATAGAGAGTATCATGAAACCTTATGGGACATGTATCGCACTC
Ext3   L03   AX00006415   TCTATGGATTTTTTACTGGTAATAGAGAAATAATCCCTTATATGTTCATCTTTTTA
Ext3   L05   AX00006416   AAAAGACGAAGGCTTATAATGGATCGGGATCATCAAATACAGGAATGAAAGTAC
Ext3   L07   AX00006417   TTGTAGTAGGTATTCTATGGATACTATGTACATGTACTCTTTTTCTGTATGTTCCG
Ext3   L09   AX00006418   AAAAGCCGAGCAAAAGAATGAAGTAGCTAAAAAAGAAGTAGCAAAGCCAGTTGT
Ext3   L11   AX00006419   TCTTGGCCTGTTGGCTTACGTAATTGATGTACCTGCGATTCGTATTTCATTAATT
Ext3   L13   AX00006420   TACTTTATTAGAGGTTGTTTAGAGATTCCTATCATTGACTACCACGAAAACTTCA
Ext3   L15   AX00006421   ATAAAGAAGTATTTAGGGTTACCACCTGGTTGGAGATTTTTAATTGCTGGAGATT
Ext3   L17   AX00006422   TTCATGTGGAATGCAAGCATTTAATCTACCAGACGTTGTTTTAGACGGAGGGAT
Ext3   L19   AX00006423   ATGTCAGCATGAAGTGGCTTATGCTGACGTGTACTTAGAAATAAGAGAGTATAG
Ext3   L21   AX00006424   GAAGGAAGAGAGCAATTCAGTGACTTCTATACAATATTCCGCAGCGGTATTGAA
Ext3   L23   AX00006425   TATTTTAAATCAGTATCCGTATGAAGCTTCAGGCGGACAAAAACAACGCTGCGC
Ext3   N01   AX00006426   TTTCGCCGTAATCATTTAGGATTTATTTTTCAAGATTATAACCTTATTAGATACGT
Ext3   N03   AX00006427   TCGTTATGCGGTAATTGATAACGATGGAAAAGATTTAGGTGGAAATAAAGGCCG
Ext3   N05   AX00006428   GCGTTTGCTTGGCCACATTTACCGGATACAATTGCAACGCATTGGAGCGGCGG
Ext3   N07   AX00006429   GTATTTCACACCACTTAAATGCACTTAAAAATGCTGAACTTATTCAAGATGAAAAG
Ext3   N09   AX00006430   CATTCTGAACGAGCTGCTTTCGCTTTTGGTCTCATCCAGCTACAGCGGCTAGAA
Ext3   N11   AX00006431   TAGCTAGTAGCTTTCGTTTCGTCAACTTGTTCGATGTCGTCCCACTTCTCCCTCC
Ext3   N13   AX00006432   CTTATCCCTTACATTCGGCGGTGTATTCGCCTATTTCAGTGATTCAGAAACATCA
Ext3   N15   AX00006433   TTGGATTTTTACTCAACATGATTTTGCGAGCTACTTGGGTAATGGTTATTGTGTA
Ext3   N17   AX00006434   GATTGTAAACAAGGCGATTGTTGATGATAATAATCCGACGCCGCCGCCAGTTGA
Ext3   N19   AX00006435   AAAAAAACGATCGTGTACCGTGGTATAAAGATGTAAACAACAATTCGGCAGCAG
Ext3   N21   AX00006436   TTGTAGGAGGCATTACATTCCACTTATGAACTTATCGAAACTAAACAATCGAATA
Ext3   N23   AX00006437   TAAGTACGGGTTTACACACGAAAAAGATTGATGCTAACATACGTTACTTGCAGCA
Ext3   P01   AX00006438   AAGTGCACACAACTCAATACCTTCTATATGGGTGGTGGAATAAATACAGCGATG
Ext3   P03   AX00006439   GCTACACTTCTTGATTAGAGAAAAGGCGTTAAAACGGAAATTAGCGTCTTATCAA
Ext3   P05   AX00006440   TATGAATGGGAAAAATTACTGATGATCCGAAAAAATGACGGTGAGCTTAAAAAAA
Ext3   P07   AX00006441   ATCTATTTGGATAGAAAGGACGTTATCTACGTATGCCAACAACTACTTTGTAATG
Ext3   P09   AX00006442   GTTGTCGAGGTAGAGTGGTACTTCAAGATTTTTTTGTTCACTCTGATCGCCAAG
Ext3   P11   AX00006443   TTAGGGAGCTTAGGACTTCAAAATAGTCTACAAAGTATTATATATGTGTTAAGTG
Ext3   P13   AX00006444   AGAGAAAGAGAAGCATGAAGACATCTTTGCTGGATTAGATGAAGCAACAAAAAC
Ext3   P15   AX00006445   GCACGTAATACAGCTTCACAAAAATTGTGTGAACGAATAGGTATGAGAAAGGAA
Ext3   P17   AX00006446   AAAGAAGTTACCCTCACGGCAACTTCTTTTCCACATACCCCACTTCGTATTCACT
Ext3   P19   AX00006447   TCTCAAAACGCTACTGCATGAATTCCGCCATGCGATGCAGCATAAGAGAGATAT
Ext3   P21   AX00006448   TTGTCTTATGCAGGTTATTTAGTATCAACAGGAAGCATTACATTTTGGGGCGCTG
Ext3   P23   AX00006449   GATCGATTTGGAAATAAGAAGGTGACGGAAGTTCCTGTAGAAGTGACATATGGG
Ext4   A01   EMPTY        -
Ext4   A03   AX00006450   GCATAGGAAGCCTCTGTGCGATAGGTATTGGCTTTTTCCTAGCTGGTAGAGCAC
Ext4   A05   AX00006451   ATTAATATAACAGGGGCGTTTTTACTTGGATATATAATCGGCAACGGAGTTACTA
Ext4   A07   AX00006452   CAAGCATATTTTGCACAAATGATGCAAAGTCAGTATATGCCGTATTCACAGCTTC
Ext4   A09   AX00006453   CCTTTAATGGTAACTCGTTCTTTCGGGGCCGAAATGTGGAGACTTACTGCTAGT
Ext4   A11   AX00006454   CAGTTTCCTAAACTGAATATGAAGGAAATACGCCATCATTTAGCTGCGTGTGGA
Ext4   A13   AX00006455   CTTATTATGTCAACAATTGATAGGGTTGTCTTTAACGTTAGAGGGGTTATTGGAA
Ext4   A15   AX00006456   GTCGTCCCGAAATAAGACTAAACTGGAGAGTGTAAGAAAAAAAATACATACTATG
Ext4   A17   AX00006457   GACTATTTAGTAGATTTTAATGGTAAGATTCGACCCATAAGTGAAGAAATGAGTG
Ext4   A19   AX00006458   ATATTGGATCGCAACATGGGGTAGTTGCCAATGGTCTAAGAGCCCCCTATTGTA
Ext4   A21   AX00006459   GACGCACATCAATTAAACTTTAAGTCAGGTATGTTTGATGGTGCATACGCTCTAG
Ext4   A23   AX00006460   AAGAAGTGTAGCCTCAGGTGGCGGCTTATATCCTGGGGAAATTTACTTATATGT
Ext4   C01   AX00006461   GAGTACCTAGAATCGAAAGTTTCAGAAATAATAGATAATAACAACAGAAGTAGCT
Ext4   C03   AX00006462   TTGCTTTTATAGTTACAAGTTATGTTCATATGACAAACAATAGGCTTGGTATCATG
Ext4   C05   AX00006463   TGAGGAATATTGAACAGTCTCTAATTAATTACCTAAGTCGTATGATATTTAAGCC
Ext4   C07   AX00006464   ATTGACAAAAAGACATTGAGATTCAATGGTCATAATTTTTTACCTAATCCACATTG
Ext4   C09   AX00006465   TTGGTGATACCCACCAGGAAGCGAGGTTTAATACTTATTATAAAACCATAGAACA
Ext4   C11   AX00006466   AGCTGGGAGTATAGTTATTCATCATTCTTTAACTTTGCATTATGCATACTCTAACA
Ext4   C13   AX00006467   AGTTACGACTGCAAATAATCTGGGAGTATGATAATTATGTAGGATTTCATAACGG
Ext4   C15   AX00006468   ACAGATGTTTGCTTGGGGCACACCTAGATTCAATATTGGAATAACTCTAACTACA
Ext4   C17   AX00006469   AGGATTCATATTAGAGGTATCTCAATTTAAAAATCGAAGAAAAGGGGTTCGTCAA
Ext4   C19   AX00006470   TAGGGCGAAGCTAGAAGGTTCTATTATGACCTTTGTTACACTATTTTTACATGCA
Ext4   C21   AX00006471   AGGATTAATTTTAAAATAAGGGCGTTTGCTAATAAACCAGCTTGGGGTGGCTTC
Ext4   C23   AX00006472   TGTTTACGATGAGAAGGTGTACGATAAAAAAGGGGAAGAAAGAGAACTGAAAAT
Ext4   E01   AX00006473   ATGTCATAGGGAAAATCCCGTATTATCGCCGAAACTTAGGATAGATTACTGTCAT
Ext4   E03   AX00006474   AACAAGGTTTAGTAAGTAAGTTAATCCCTTTCTCTGGAAATACTTCACATCGTAT
Ext4   E05   AX00006475   CATCAGCAAAATCCTCAAATAATCAAATGAATATGATAAAATCTTTGGCTTCTACA
Ext4   E07   AX00006476   AAAAACGCCGTGTTATGATCGAGTTAAGAAGAGAAAAGGTCCTAAAGCAGCTTA
Ext4   E09   AX00006477   AACTAGAAAAGGTGAGTATCCAAGTAGGAGGGAAATGGAAAAAATTCTTGGTGA
Ext4   E11   AX00006478   CAAAGAGCTTGGTGCCCTTCTTGTTATGAGGAGGATCTTTCAAATCAAGGGACA
Ext4   E13   AX00006479   TACAAAAGCAGATTAAGGACGCCAAAGCTAATGAAGATCTGGATAATAAAAAACT
Ext4   E15   AX00006480   GCGATTCAAGAATTAAAAGAAGAAAAAAGCATGCCTTTTGGCAAGCAAATAAGAC
Ext4   E17   AX00006481   GGAACAAGTTGATGCAACTGAATTTGCAGGTTTTACAACAGCCGGTAGCGTAGC
Ext4   E19   AX00006482   CGTTATTGTGCCTGTATCCATTGAGTTATATCGTTTCATCAGTATTTCGCAACGG
Ext4   E21   AX00006483   AGGATTCTGGTACAATGCATCTTTCAGATAAACAAACATTATTATTGGAAGTTGC
Ext4   E23   AX00006484   AGCGGGCTACTGGGGCATCAACTTAGTCTAAAAGCAACTGAATTAGATCTGAAT
Ext4   G01   AX00006485   AACTTCTTCATCACAGGAGTTGACACTCTATGATTATGAGGTTGCAGTCCAGTTT
Ext4   G03   AX00006486   AAAGGCGGTTAACTGCAATGTAATTCCAATATTTTTTGATGTAGATACAGTAATT
Ext4   G05   AX00006487   CTCTATACGATGCATCGACCATTAACGGAGTTTATACTTTTTGCCTGAGGGCAG
Ext4   G07   AX00006488   AAGGAGCAAAGAGTATTAAAAAAAATCTATGACCCGGAATATAATTTATTTGGTT
Ext4   G09   AX00006489   AAAAGATTCTCTTAATAGAGCCCGATATGGATATATACAACGCGCAACTGTAAAG
Ext4   G11   AX00006490   TGCTAGTTTTTTTAAGCGGTATTCTGTTTATCCATGAAATGTTACATGTTGTCATT
Ext4   G13   AX00006491   AGTTTTCGTGATTTAGTCGAAATGATGGAAGAACGTGGATTATCGATGGCTTAC
Ext4   G15   AX00006492   CAAGCAAGTTTAAGCTCCCTTTCATTAAATTCACAAGACGAAGAATCAAAACGCG
Ext4   G17   AX00006493   GATGTCATTGTAAAGGGAGTAGGAACTTCCAATCTAGATAAATTCGAACAGTTCG
Ext4   G19   AX00006494   GCAAAACTTTTCTCGTAATCCAGTGCCGAGTATTTGTATTATGATTGGTACTGTA
Ext4   G21   AX00006495   CGCAATGGAAGAGATGAAAACTCTTGCAAGACAAAAAAATGCGAATGCCATCGT
Ext4   G23   AX00006496   AAAGAAGTTGTGCGGGATGTCACGCAACAGATTTATCAGGGGCAACTGGACCTG
Ext4   I01   AX00006497   GTGCATCTTTTTTAAATGCGGGCATTGGCTACGGAGGGTCGTGTTTTCCGAAAG
Ext4   I03   AX00006498   TTATATTTGTATGGTCCACTGGAGCAAGGGATTAGTTTGAACGAGGGAAGTATT
Ext4   I05   AX00006499   CGGAACAAAATTTTGCGGCTATTGACTGTTATACTTGCGGTACAACCGTTGAAC
Ext4   I07   AX00006500   AAGCCACATGCAAAACGTGCTCTATGGACACACATCATTCCAAGTATTGCTACAT
Ext4   I09   AX00006501   TATTTGCAAGTATCTCGTGGTGTACAAGCTCGCACACATGTATTTTCATATGACA
Ext4   I11   AX00006502   AATACACATTACAAAATTGTGCAATATGGAATAAAACCAGGCTCTCAAAAGCCAT
Ext4   I13   AX00006503   AATGCACATGAGAGCACACTATCGTTTTCATTTATATCAGGCGTCTCTGTAAATG
Ext4   I15   AX00006504   ATGTGGTGGACCTTTATCAATAAATGATAAGTTTTGTGGTTCGTGTGGAAAGCCT
Ext4   I17   AX00006505   AAACAATTTAAACGTGTTAAAACAAATGCGAGCTTAGATCAAGTACACAACGTAG
Ext4   I19   AX00006506   TATATATTCTTCTCAACATATACGACTGAGTTTGATATAGGTGAAGAACATTATAA
Ext4   I21   AX00006507   ATCGTACAAAACTTATCGACAGTAGCGGAAACCATCTTTACTCCTGTCAAACTGC
Ext4   I23   AX00006508   TTTAGGTGGATCGGGTCAAGAAATGTACACTGGCCTAGGACCAATTTTCGCCTC
Ext4   K01   AX00006509   AAGGTGCTTGGGCAGCTAAGCTAACGGCTAATTTAGAAACTGCTTATGGTAAAG
Ext4   K03   AX00006510   GATGAGGCACTATCATTCACACGTATGCGCTATGAAGACCCACGTGGTGACTTC
Ext4   K05   AX00006511   AGGTTGGGAATATAGCGACTTGCGTAAGCCCGTTTTTGTTTCACAGTATTGGTT
Ext4   K07   AX00006512   AATTTAGAAATTGTATTGGTAAATGACGGATCTACAGATCAGAGTGGATTGATTT
Ext4   K09   AX00006513   TTGTTTAGGGCTGGTATCTTAGGAGCCTGGATGTGTCTATCTATGACTCGCTTA
Ext4   K11   AX00006514   GGAACAATCTCAACTAATGTACTTAGTAATACTATGAACGATCAGTTATATATTGT
Ext4   K13   AX00006515   AGATAAGGGACCTGTTTTCTATAATGCGCCTAGATTAGGAAAAGGAATGAGAGA
Ext4   K15   AX00006516   TACTCTGATGAAACGTCCCTACCGTGGAATGAGAAGGAGTTACCGTTACCTGAT
Ext4   K17   AX00006517   AAAACCAAATTTCTGTTGTTTACTCTACAGGTTCAGACTTAGCTATGCCGATAGC
Ext4   K19   AX00006518   AACGAAAGGGAAAGAGATGTGGACAAGTTGCTGATTTTACTTGCTATTCTTTCCA
Ext4   K21   AX00006519   GATATTACCCGTTACTTTATGACCATTCCAGAGGCATCACGACTTGTAATCCAAG
Ext4   K23   AX00006520   ACGCGTTACGATGTTGGGGAGAAGTTTGGATTTATTAAGACGACGATTGAGATG
Ext4   M01   AX00006521   CAATTATTATACGAATTACGTGTAAAAGGAATGATTCCAATAATCGTTCATCCAG
Ext4   M03   AX00006522   ATTCATTACTGGTAACATCTGCGAATCCGAGTGAAGGGAAAACGACAACGACAG
Ext4   M05   AX00006523   GCAGCTATTGTAAGTGCTATCATTAGCTTTTTCTTCATGACACCAATCTATCAATC
Ext4   M07   AX00006524   GGGCGATGGACGAGGCGTTGCTAGAAGCATATAACATGTTTGATATTATATTAA
Ext4   M09   AX00006525   GGAAGACTTGCTTTCTTTGCAGGTATCGACAATTGCCGTTTCAAAAAACAAGTAC
Ext4   M11   AX00006526   TGCTGAATGCTGCCAATTTAAACTTAGTGGCGTTTAGTAAATTAGGCTTATTTCC
Ext4   M13   AX00006527   ATCGGTGAAGAGTATCTAGGGCATAATGAATATTTAGGATTATGGCGAGACTAC
Ext4   M15   AX00006528   TGGACAGCTATATTATCAAAGAGGTGAATGCCTAGGGAAGTTGGAGTACGATGG
Ext4   M17   AX00006529   AAGAGAATAAGACTATAAATCAAGTAACATCACCTAGATTATCCCCTGCAAGTGA
Ext4   M19   AX00006530   TTTTGAAAGAGCAATGAAAGCTGGTGTGCACGGCTATTTATTAAAGGATAGCCC
Ext4   M21   AX00006531   CTGGCATAAAAGCCGTCCCACTCACTTTCCCTCTAGGTACAGTAGCTAAGACTA
Ext4   M23   AX00006532   AAGAGCTAATAAATAACACGAAGCAGGGCGTGCGAAAGGCTCAGAAGTTAGAG
Ext4   O01   AX00006533   TTCTTTATGTAGAAGGTAGAGAGGCCTTTCTACTCGTTCTATCGTTTCGCTTGAT
Ext4   O03   AX00006534   CTGAGGCCTCGGAATATTTAAATGTCAGCTACCGTCATCTTTTATATGTATTAAA
Ext4   O05   AX00006535   TGCTCGTTGGGGTACCAAGTTATGAAGTATATGTGGAGCATATGAAAAAGCATC
Ext4   O07   AX00006536   AACAAGGTGAGAAAGCAAAGAGTTATTTGCGAAAACTACCGATAGAAAGTCAAG
Ext4   O09   AX00006537   TAGCCTTGCAAAAGGATTGGGGATTAAGTACGCAAGAAATGGGCTGGATAGGC
Ext4   O11   AX00006538   GCGTACCATCAATTGTGACTAGGGCTGGAGAAATTGAGCCATTAATCGTAGATG
Ext4   O13   AX00006539   AACAAAAAATCTCTTGCACTTAACGCAGTAATTGCTATTATCCTATTAGCCGGTG
Ext4   O15   AX00006540   AATTCAGTTCGATGCTGATGGACAACATAATCCGGATGATTTATACAAAATTATA
Ext4   O17   AX00006541   TTTCATTTCCAAATCCGCCTGAGCGCAAAAGTTTTCCAGAAGCAGCCGGTCTTA
Ext4   O19   AX00006542   GCAAGCGATTATAAGTATAGGAATAGGACTTATTGTACTTGGACCATGGTGGGC
Ext4   O21   AX00006543   GGATTGAAAATGCTAGCGGAGAATACGTGGCTTTCCTTGATAGTGACGACTTAT
Ext4   O23   AX00006544   TGTATGGGATATCTAGTCTTGTAACAGGAGTCATCGCCTTCATAATGGTACTCCG
Ext4   A02   EMPTY        -
Ext4   A04   AX00006545   TACAGAGGATTATCAGCTTGCATTCCCTGTTTTCATCCTCTTCCTTATTACTAGC
Ext4   A06   AX00006546   AACTGGTGATTCACCTGTTCGCTCTTTCGTCTCTCGTCTTTACTATAAGGTGATG
Ext4   A08   AX00006547   AACGGGAGTAGATGCTTATAACCTGGGAACAGGTATGGGCTATAGTGTACTAGA
Ext4   A10   AX00006548   TTAACCGTGCCAATTCTATTATTACTGAATTTCTCTCAATGGGTAATACAAGGAA
Ext4   A12   AX00006549   GTTAAGAGCGTTAGCTCACCCACTTCGTCTACGTCTAGTAATGGAACTTATGCA
Ext4   A14   AX00006550   TAAGTTTGGCGCGGAATTATTAGAGAAGGGATGCTACTCTTACACCGGCATTGA
Ext4   A16   AX00006551   TTTCCCTGGAAGCTTTGCAGGAGGAGTGTTAGGCGGACTGACAGCTGGTGCAT
Ext4   A18   AX00006552   GATTCGTCTGTTATGGAAAACACAACAAGATTACCATACATGGCTTTCTCAAAGA
Ext4   A20   AX00006553   GACAAACAATTGCTGCAATTGAAAAAGGGGATTACGTTCCTTCTTTGTTATTAGC
Ext4   A22   AX00006554   GATTACGGATAAAGCTTGTCGAACAACATTTGTATCGTTATGGTTTGTGTTACCT
Ext4   A24   AX00006555   GGGAATATCATTATCACAATAAACCAGCTTCTAGTAGTGGCGCAACGAGCCCAG
Ext4   C02   AX00006556   GTCTTAGCGATATCAGTTGTTGTAGGTTTACTCCCATGGCAAGAGGCTAATCTA
Ext4   C04   AX00006557   CCTATCAGATGGTACTCCCTAGTAAATTGTCTCAACAGGGTGGACAAGGGGGTG
Ext4   C06   AX00006558   AGAGCTAATGGCACAGCATCAAATTAGACGATTACCAGTAGTTGATAGTGGTCA
Ext4   C08   AX00006559   AAGGATTATTCCTCTCTCAGCAAGTCAAGCACCCCTAGTGGTTTCAATATGAAAT
Ext4   C10   AX00006560   TTATTTTTTGAATAGGGCGGGGGAAGAAATGATGAAGGTACTATTACTTGGAGA
Ext4   C12   AX00006561   GAAAGCGCTTCAGACAAATTAGGGTCCCATGAATCTGGAAGAGCATTAAACGCA
Ext4   C14   AX00006562   AGAAGTGCTTTCGGGAGATGTTCAAATACTGAATGAACGAGATCTTCAGGAACT
Ext4   C16   AX00006563   CTTCAGCAATAGAATTTGTTAGTAATCTTTCGGGATATCGAAAAATGATGACGGT
Ext4   C18   AX00006564   AATGGGAGAATAGCGGAGTAATTGAAATTCAGAAAGGGCTAGAAAATAGTATAG
Ext4   C20   AX00006565   CATTATGGGCCCCTCTGGTTCGGGGAAGTCTACTCTCCTTAACATTATTGGCTT
Ext4   C22   AX00006566   TTTTGGAGGGGTATTTCTACTTCGCTGGCTCATACATGATGAGATGCTACTGGA
Ext4   C24   AX00006567   GCCTATATCGGTTACGCAATGTTCGGTGCCAAGAAACCAAATATAGTCGGAACA
Ext4   E02   AX00006568   CATTCACTTAGCGGTGGAAACCAACAAAAAGTCTCAATTGCAAAGTGGAGTGGA
Ext4   E04   AX00006569   ATAAACGGTATCCAAATATAAAAGAAGTCGCAAGATTCGGTACTGCTAGTAATAA
Ext4   E06   AX00006570   AGCAAGTGCGATCATCGTTCAGCCTGATGCAGATGAAACTGGTCAAACTGAAAA
Ext4   E08   AX00006571   AAGAAACAGTATACTTTTATCAAACATCTTGCGTTCATTGCCAAAAATTATCTCCT
Ext4   E10   AX00006572   ACTTACTACATTATAAAAGGTGGCTTCCGTTCTGTGACAGGGATATGTTTTTGGG
Ext4   E12   AX00006573   GGAACTATTCTCTTCCCAGAGTACACACATGGTGTAAAGTCTAAACCAGAAACTC
Ext4   E14   AX00006574   AAAGATGTCTTCTACTATCCGGTTGTTACGCTTTCCGCTTATTCTTTTAGCCGGT
Ext4   E16   AX00006575   TGGTTAGGATATAGAACTACTAATGTAGA