Bacillus_anthracis_genelist

Document Sample
Bacillus_anthracis_genelist Powered By Docstoc
					The genelist of anthrax AROS V1.0 was generated based on the
following Genbank accessions and associated annotations. If an
oligo has 97% identity or greater to a transcript/feature sequence, the
oligo is considered to represent that transcript/feature.
organism/strain                                                           genbank_accesion
Bacillus anthracis str. A2012                                             NZ_AAAC02000001.1
Bacillus anthracis str. A2012                                             NC_003980.1
Bacillus anthracis str. A2012                                             NC_003981.1
Bacillus anthracis str. Ames                                              NC_003997.3
Bacillus anthracis str. Ames Ancestor                                     NC_007530.2
Bacillus anthracis str. Ames Ancestor                                     NC_007322.2
Bacillus anthracis str. Ames Ancestor                                     NC_007323.3
Bacillus anthracis str. Sterne                                            NC_005945.1
Bacillus cereus str. ATCC 14579                                           NC_004722.1
Bacillus cereus str. ATCC 14579                                           NC_004721.2
sequence_type      date
complete genome           16-May-05
plasmid pXO1               5-Nov-04
plasmid pXO2               5-Nov-04
complete genome            2-Dec-05
complete genome            3-Dec-05
plasmid pXO1               3-Dec-05
plasmid pXO2               3-Dec-05
complete genome           18-Jan-06
complete genome            2-Dec-05
plasmid pBClin15          21-Jan-05
plate     well   oligo_id     oligo_sequence
        1 A01    EMPTY        -
1         A03    AX00000001   TGATCGGCCACCAAAAGAAATTCCAACTTTAGAAGATCGTCTTCGTTCTCGCTTT
1         A05    AX00000002   ATTTGCAGTCTCCACTTCTGAAACAAGACCAATCTTGACAGGTGTAAACTGGAAG
1         A07    AX00000003   CTGTAAAATGGTTTTTACAAGAATATGAAGTGTACGTGAATCAAGAACTTGAAAA
1         A09    AX00000004   GTTCGCAAGGACAACAACGAACGACCGCACTGTCCCTAAAATTAGCTGAAATTG
1         A11    AX00000005   CGTAAGAGCGCGTTAGAAGTTTCAAGTTTACCTGGTAAATTAGCAGATTGCTCT
1         A13    AX00000006   AATGGAACGTTTTGGCTTAAGTGAAAAACAAGCGCAAGCTATTTTAGATATGCGT
1         A15    AX00000007   TATAAAGGACCTTTAGCAGATACAGTTCACCAATTAGTTGGTGGTTTACGTGCAG
1         A17    AX00000008   GCCAAAAGATACAAACGACCCTGGATTTTTAACTGGTAAGTCGTTGCAAGTGGA
1         A19    AX00000009   AACAATCGTTGAAGAAGTTATGGGTGCTGTGTCAATTCCGGTTATGGCAAAATG
1         A21    AX00000010   TATTTTACCAGGCGGTGAAAGTACAACTATGCGCCGTCTTATTGATAAGTATGAT
1         A23    AX00000011   CGTTTCCGTCGTGAGCCAAACGGCAAACCAGAACATGTTCATACATTAAATGGA
1         C01    AX00000012   AGAACAATAGAATTTTAAACAGTGGTGCAAATGTATCACGCATTATTAGCGATGA
1         C03    AX00000013   ATGCAACTCCACTTACTGAAAGAGATTGTTGATGAAAACCCCTTTTTAGGAAAGT
1         C05    AX00000014   AACATTAGAGCCTTGTCCGATGTGTGCGGGTGGAATTGTTTTATCACGAGTAAA
1         C07    AX00000015   TATGCGTGATGCGCTTAGTCTTATTGATCAGGCGATATCTTATAGTGATGAGAG
1         C09    AX00000016   AAAAAACAGTTGAAGGTACAGCTGGTGGCGGTATGATCACAGTTATTGCAAATG
1         C11    AX00000017   GGGAAGCTACAGCGATGTATATATCCCGCCTCTTAAAGCCGACAGGTATTAAAG
1         C13    AX00000018   GAAGGCTATAGAGATGATCCGAGTAGCATTGCAATACTATGAGGTGAAAGACAA
1         C15    AX00000019   ATATGGAAGATATCTCTTTCCATAAACGTGTGCGTGAAGGGTATTTACAAGTTGT
1         C17    AX00000020   ACCGTTACCTACGGAATCTTTAATTAGAAGATTGCAGGATGAAGGTATTACGGTA
1         C19    AX00000021   ATGAAACTTGTAGATGTAGAGTATACGTTCGATCGCAATAAGATTATTTTCTACT
1         C21    AX00000022   GCAGAGTTATTGGAAGAAAACCAACATATAAAAATGGAAAATGAAAATTTGCGAC
1         C23    AX00000023   CAAGAACAAAAGGGAATATTACTGGTGTGGAAATTCAAGAACGCTTATATGATAT
1         E01    AX00000024   TGAGTGGACGAAACAAAATGAAGTTCGTGGTGAGTTTTGTATTTTAGTAGCTGG
1         E03    AX00000025   CGCCGTACTTTAGGTATTGCAGAAAAGGATGCACTTGAAATCTATGTTGATGAC
1         E05    AX00000026   GCATTACGTTATTACTTACTTCGTGAAGTTCCATTCGGATCTGATGGCGTATTCA
1         E07    AX00000027   AACTTGCTTCTCATCCTAAGGTCGTTGCACTTGGAGAAATGGGCTTAGATTATCA
1         E09    AX00000028   GATGCAGGTTTAGTGGGCGGAGAAATGGCAAAGAGTCGCAGAGAAAGAATGGG
1         E11    AX00000029   TTATCCATTGCTATTCAGTATTATACAGAGGTAGAAACAGTTATGACTGTACCGC
1         E13    AX00000030   ATTTTCAAATGCCAGGACGTGTATTGCACATAGATGGAGACCCGTTATATTTGCG
1         E15    AX00000031   GAAATTTTATCCCATAATCGGTATGTCCCAGACGACCAAAGAAATCTGGCTTATC
1         E17    AX00000032   GGTCGGCACATTGCAAACGATACCAGGAGCAGCAGGAGGAGTGAAATATATAC
1         E19    AX00000033   GTACAAACAGAGCAAGTATTTCAAAATTTACAAGCAGTATTAGAAGAAGCAGGTG
1         E21    AX00000034   TGCCAAGTAAACGTACTCCAGATGGAGAATTCCGTGACATTGCACATCCAATTA
1         E23    AX00000035   AAAGCTTCACACTTAAGTTATATCGGGGATGCGCAAGTTGGAGAAGACGTGAAT
1         G01    AX00000036   GAAAAATGGCAGATCGCCTAAAAGCACCAATCGCTATTATTGATAAGCGTCGTC
1         G03    AX00000037   AGGCATAATATTGGATTTATGGCGATTGATGAACTTGCAAAGCGTTGGAATATTT
1         G05    AX00000038   CGACGTTTTATTTCAACTAACAGAGCAAGAAGTAGTAGAGATGATTCATTTTCAT
1         G07    AX00000039   AGAGACAGAGGATCAATTACGTTCTATTGAAGAGATTAAAAAGGATATGGAACG
1         G09    AX00000040   TTATATGATAGCTTAGGACATAATGTGCTTGTATGCGATCGAGATTCTATTATCG
1         G11    AX00000041   GGTTCTCTATAGATGATATTATTCGAACTTTATCTGAGAAAATGGTTCGTCGCCA
1   G13   AX00000042   GAATATCCATTAATGGTCAAGTGGCAAAAGCGAGTTCGGATGTGAAAGTAGCTG
1   G15   AX00000043   TATTACCGGTGTAAAGCAGGTAGAGAGTTTTGATAGTGAAGAGTTTTTACTTGAG
1   G17   AX00000044   CGTCAAGAACGTAAGCGTTGGCTTGTATTTATACATGATATACTATTTTGGATTG
1   G19   AX00000045   AATACAAACGGATGAGAACAGGAAGCGACTTTATCGCCGTTTAGCGGTTTTTCT
1   G21   AX00000046   AAACAGAAGGAGATCGTCCACGTGGTGAATACCAACGCGGTGGTGATCAACAA
1   G23   AX00000047   TAAGTGTTGGTAAATATGCTCTTGCGATTAGTGATGGTATGGGAAATGGGCAAA
1   I01   AX00000048   GAAGAAAACCCACAAGTGCATGAGAAATTCCAAAAATTTAGCATGCAGATGCAA
1   I03   AX00000049   CTGTATCTAGTTACGGTCACTCTACTGTTTCAACAGGCGAAGTGAAAATTTTGAA
1   I05   AX00000050   CTAAGAAAAGTCGTGTTATCTCTGAAAAAGAACGTAATATCGTTGCTTTCCATGA
1   I07   AX00000051   AACATTGGCGCATGGAAACAGATCGTCATAAGACAGAAGATGAATATGGAATGC
1   I09   AX00000052   GGTATGCGTGAGCCGTTTATTGGTCAATCTCCAATTGTTTCAGGAGAATTAGGA
1   I11   AX00000053   CAGACAGCGCAGATATATACTTAAAATTAGAATTTATGAATCCGGGGAGCAGCG
1   I13   AX00000054   GAACCTGTTCGCCGAGGGATTTATACAGGTTCAATCGGTTGGATTGGTTATTCT
1   I15   AX00000055   TCCCTAATCCATTTACTGCGACGCGCTATCATTCCCTTATTGTTAAGAAAGAGAC
1   I17   AX00000056   ATGTCCGTTTTAATGTATCGGCGGGTATAGATGAAATTGGATTGCAAACGGAAA
1   I19   AX00000057   CTTGAGGGAACGGGAGCTACCGTTTGTCTTGGTATTGAAAAGGGTTGTGAGTTT
1   I21   AX00000058   AAAGTGATGACTTAGAGCATTCTGTTAATTATGGAGAGCTTTTCGAGTTATGTAG
1   I23   AX00000059   AAATGACCTAGGAAGAAAAAGGGAAATTAGGTGGGGCCCTAGGACTATCGACC
1   K01   AX00000060   TGCAAAAGAATTAGGGGTATCTGTATCTGTTTTAGGTGAAGTTGAGAGAGGGAA
1   K03   AX00000061   TCGCAACGCCACAAGATGCAAAGCGTATGCTTGATGAAATTGGTGTAGATGGTG
1   K05   AX00000062   GTGGAGCTTCTGCTCGTCCTTTCATCACGCATCATAATGCGTTAGATATGGAAT
1   K07   AX00000063   AGAGGATTTGTAGTAGAAAGTAAACGTGGTGGAGGAGGTTACATTCGCATTATA
1   K09   AX00000064   AATCAACGAGAAGAAGGCGGAAGTTCATCTTTGTGAGCAATGTGCAGAACAAAG
1   K11   AX00000065   TTTTGACTGAGCTAATGGTTCTTACACAACCAGGCATTTTACAACAATATGCAGG
1   K13   AX00000066   GCAATTCGTATTGGGCATAACAATATTGGAACAGAACATATTTTACTTGGGCTTG
1   K15   AX00000067   CAAGACCAGTTTTAGTAGAAATACAAGCATTAATCTCTCCTACTAGTTTTGGAAA
1   K17   AX00000068   TAGCAAAGCAGACAGGCAGCCTTGTTGTGGCTATTTCACAAAGGCGTAACGTAA
1   K19   AX00000069   TTAATCCCAAAAGTTATTAACGTATTAGACATCGGTGCCGTTCCTTTGTTGGAAG
1   K21   AX00000070   CTTCCATTTGTGCGGTGCCAGTGAAAGATACTGTTAAGAAAGTAGAGCAGGGTG
1   K23   AX00000071   TAGATTGTACAATTATTGCTCAAAAGCCAAAAATGGCACCACATATTGAAAGTAT
1   M01   AX00000072   GATTTAACTGAAGCGCAAGTGAAAGAATTTGAAGCTGAGGGACGTATTCCAAGT
1   M03   AX00000073   TTTCGAAGTCATTTTGACTTACTCTGGATTACATGCAGTTTGGGCCCATCGAATT
1   M05   AX00000074   GCAAACATGCAACAGTTCACCCGCGTGTAACGGAAAATATGGATATCATTATTG
1   M07   AX00000075   AAAAATACGGATGTACAAACATACCGACATAGTACAGCCTTTGAAGCGCTGATTG
1   M09   AX00000076   TTTGGATTGCTGGTACAGATGCAAAAGGGAAAACGGATTACCGTAATTTAGATG
1   M11   AX00000077   GAGCAACTTGCAATTGAGCTTAGAAATATAAATACGCAAATATATGTTGCGACTT
1   M13   AX00000078   CGAAAAGGTAATACTGACGCTCTAGAATATTTGATTCACAAATATAAGAACTTTG
1   M15   AX00000079   AAGTTGGCCTAAAAAAGATGAATTACTCCGTTCAACAGCGACTGTTATCGCTACA
1   M17   AX00000080   ATTAGTAGAATTAATCATGACTGATGACTCTTGGTATGTTGTACGTAACACGCCG
1   M19   AX00000081   CAGTTGGTCCAGCATTAGGACAAGCAGGTGTTAACATCATGGGCTTCTGTAAAG
1   M21   AX00000082   GCTGGCGTTGAGTTCAAAGTTTACAAAAACTCTCTAACTCGTCGTGCTGCAGAA
1   M23   AX00000083   TCTTGGCTTAAAAGAAGCTAAAGAATTAGTTGACAACACTCCAAAAGTAATCAAA
1   O01   AX00000084   AGATGGTATGTATGCTGCTATTCTATCTAATCCTCCAATTCGTGCAGGTAAAGAT
1   O03   AX00000085   ATATGATCAAACTTGCGCACATGGTTGACGATAAACTTCATGCTCGTTCTACTGG
1   O05   AX00000086   CCGTAACTCTGGAAATGAGCCATCTTGGATGATCTTAGATGTTCTACCAGTAATC
1   O07   AX00000087   CGTGTTGGTGGTGCTAACTACCAAGTTCCAGTTGAGGTTCGTCCAGAACGCCG
1   O09   AX00000088   AATCATGACTGACCCTTATGTTGGTAAGTTAACATTCTTCCGTGTGTACTCTGGT
1   O11   AX00000089   AGTACGAAACTGAAACTCGTCACTATGCACACGTTGACTGCCCAGGTCACGCTG
1   O13   AX00000090   GAACATCATGAACTACAAGCCGAAAGCAAAACGCGTTGGTCGTCACGCTGGTTT
1   O15   AX00000091   TACGTCATCAAGGTGGCGGACATAAGCGTCAATACCGTATCATCGACTTCAAAC
1   O17   AX00000092   TTGTTGAGAAAGTTTTCGTTGACGAAGGTCCAACGTTAAAACGTTTCCGTCCAC
1   O19   AX00000093   TGGGAATCTCGTTGGTTCGCTGAGAAAGATTACGCTACATTATTACATGAAGAC
1   O21   AX00000094   ACGTATGGGTTCCGGTAAAGGGGCACCAGAAGGCTGGGTAGCAGTAGTAAAAC
1   O23   AX00000095   TTTGATGAAAACGCAGCGGTTATCATTAAAGACGATAAGAGCCCACGTGGTACT
1   A02   EMPTY        -
1   A04   AX00000096   TGTGGCTTTCCCAAAGCAAAACCGTGTTATCGTTGAGGGTGTCAATATCGTTAA
1   A06   AX00000097   GTAACTTTACGCGGCGAGCAAATGTATGAGTTCTTCGACAAATTAGTATCAGTTT
1   A08   AX00000098   CAAGAGTATACACGTTGCGAACGCTGCGGTCGTCCGCATTCTGTATACCGCAAA
1   A10   AX00000099   AACGTGAAGGTTTCATTCGTGATGTAGAATACATCGAGGATAACAAACAAGGTA
1   A12   AX00000100   AGTTGAGCGTCCATCTGAACAGAAGGAACACCGTGCATTACACGGTACAACTCG
1   A14   AX00000101   GCTAAACTTACTGGTACTGCAGAGCGTCCACGTTTAAACGTGTTCCGTTCTAAC
1   A16   AX00000102   ATTCTTTCGAAATCTCTTGGTTCTAACACACCAATCAACATGATTCGCGCTACTG
1   A18   AX00000103   ACAAGATCAACGTGCGACGGTAGAAGCTTTAGGTCTTAAAAAGTTGAATTCAAC
1   A20   AX00000104   ACGTTCTGGCGGCGGTGTTCGTCTTGGCTTCGAAGGTGGTCAAACTCCATTATT
1   A22   AX00000105   CAGATTGTTGCCAAGTATAACATCCCTCACATCTCAACAGGAGATATGTTCCGTG
1   A24   AX00000106   ATTAAAGCCGGGAATGGTCATCTGTGTTGAGCCGATGGTGAATCAAGGAAGACG
1   C02   AX00000107   GGTAACGCACTTTCTTGGTCTAGTGCTGGTGCACTTGGTTTCCGTGGATCTCGT
1   C04   AX00000108   TATCTTCACTCCCTGGTGCCGCTGTTACTGCTATCCAAATCGATGGCGTATTAC
1   C06   AX00000109   CAACGTCAATGCTAGACCCTCAAGGGAGACGTGAAGTAGTAGAAACGGTTAGAC
1   C08   AX00000110   GTAACGCATAATATGGAGGATGCTGCTAAATATGCCGAGCAGATTGTAGTCATG
1   C10   AX00000111   CGACGACACCCATTGAGATTACAGATGGTTTGGAGACGTTATTAAAGCCGTTGA
1   C12   AX00000112   TTACTACCGTCACACTAACCACCCAGGTGGACTTAAACAAAGAACAGCTCTTGA
1   C14   AX00000113   GCGAAGGACGCGTTATCATTAACGGTCGTGATTTTGAAAACTATATCCCATTTGC
1   C16   AX00000114   TTATAAAATCGTGGCGAGCTTGGAATTTACCCTTATCAGGGAAAGTAATTGTATT
1   C18   AX00000115   AGGTAATCTCAATGGGGTTCTTTGTAGAAGATAATGCACCGGTTATTTGGAGAG
1   C20   AX00000116   ATATCGTCAATATTTACAACAAGTACTAACAGAAACTGCTGAAAGCCCACTCTTC
1   C22   AX00000117   CCTTATTTACCGCATGGCTACTCTTTTTGAAAACATATTCACACGAGTCTGCTTT
1   C24   AX00000118   GTGCATTTATCATTAGATTTAGATGGTCTTGATCCTCATGATGCACCAGGAGTTG
1   E02   AX00000119   AGCCGTTATTATTATTTTCCAGCCAGAATTGCGAAGAGCACTTGAGCAGTTAGG
1   E04   AX00000120   ATCGATAGAGGGGGTCGAAGTAGATCTTAGTCAATTGACAGAGTCTACAACATT
1   E06   AX00000121   CACCTGAATTAGCGTTCAAAATTGGACGTTTCGGTGGTTATGTATTAACAAAGGA
1   E08   AX00000122   CCCAATCGAGAGGAAGGTGAAAGCCGTTACAAGCTTACAGGGCTAGCAATATG
1   E10   AX00000123   GAGCTAACCCATGTATCATCTCAATGAAAGGCTTAGAAATGGAGGGTGACAGCT
1   E12   AX00000124   TTATTAGTAGTAATTCACGGTGGTCCGGCTTGGGCATCCTTTCCGATATTTTCAA
1   E14   AX00000125   GAAATCATCAAGCTGGGTACAAACACCTTCAGATATTCGAGAACTCGGTGGTGC
1   E16   AX00000126   CTATTGCTCAAGCATCAGGTGACCACCCTGCCGTACAAAGTTGGTGGGCAGATT
1   E18   AX00000127   TTATTGCACTACCACTTGGTGTCACACTTGTTTTAACAAGACCTGGTGGGCAGC
1   E20   AX00000128   ATATTTTATCCGGTAATATTACTCAATTAAAACATGAGGCATACGGGAAACTTGT
1   E22   AX00000129   GATTCTATCTTCCGTGAAGGAAAAGATTCACCATATGTAAACTGGGTCGTTGTTC
1   E24   AX00000130   GGTGGTTATGCCGAATACACATGCGTGCATGAAAGTGGATTAATAACATTAAAA
1   G02   AX00000131   CGCAAAATATTTTTACGGTTGGTGGTTCATTAAGTGTAAATGTACATGGTCGTGA
1   G04   AX00000132   TCCTGATGCAGAAGCGAAACTGCACCTCGGTTATAAAATGAAATACGTGCCAAG
1   G06   AX00000133   ATACATTTCGGGCTCACCATTTGTGTTGCAGAACATATACGGAGCATCACCACA
1   G08   AX00000134   AAAGGTAACGACGAGCATGTTAGAAGATATTGATCATATACGAAAAGAAATTCGT
1   G10   AX00000135   TCCATTTTCATCAGATGCAAAAATCTTTCCTGAAGAAGTGATCCAAAACATGAGG
1   G12   AX00000136   TTAACGCCATTTACTGCGAGTGAACAGGTAAAAAAGGCAACAAACTTACCACCG
1   G14   AX00000137   ACATGAAGCAGAGAAACGTTTTGAACAGTACCCACATCAATTAAGTGGAGGTAT
1   G16   AX00000138   AGCTCATAGCTGGGATCGAGAGCCCAACGTCTGGTGAAATTGATTATAACGGTC
1   G18   AX00000139   TCGACAGATAGCACGTCAGGTTATGTAATTGGACATTTATTCTCAAGCTTATATA
1   G20   AX00000140   TAACAGGAGACGAAGCTATCACAAAATTAAGCCCACTTCTACAAGAATTGAAATT
1   G22   AX00000141   AACGGATTATATTCGAAAGAGAAGGTTAACTCATGCTGCGCAGGTTTTAGTGTC
1   G24   AX00000142   CCCGCAACATATGCAGCAAATGGCTATTATACAATAATATTTGGAGGAGTTAGTT
1   I02   AX00000143   CATTAAAAAATCAGCATGCGCGCCTTGCTATTAACGGCGCAATGAATAAAAAAGC
1   I04   AX00000144   TATTTAAAGACTCCGTTATCGCTCCTCTTTACCAGAAAGGCGAATCTTATTTAGA
1   I06   AX00000145   CAATCTATCAAAACGAAGAAGGCGTTGGACAAGCGATCCGTGAATCAGGTGTTT
1   I08   AX00000146   TGGAGTCGATGAAGCAACCGCAAAACACCTTGTCATTCAAATGATTTCTGGCTC
1   I10   AX00000147   CTACTGGTATGCAACTTGTTGCAACTTCTATCTTTGGAGTTATCGCTTTCCGTGA
1   I12   AX00000148   CGCTCGGTGAGTTTGGTGCTACACTCATGTTTGCTGGGAACATTCCTGGTAAAA
1   I14   AX00000149   CTGTATACGACTTGATTAAAAAAGGGGAACTTCCTTCTTATAGAGTTGGTAGACA
1   I16   AX00000150   GAAACAGTAAGTACATTACCTACCATTTTATCTTCTTACTATAAAAGCTATCCGAA
1   I18   AX00000151   TTATACGATGGGTGGTCAAACGTGTAGCGATTGGTCAACATTACGTTATTCTACG
1   I20   AX00000152   CATATGTTGTTGCGTGTACACATACAAGTTTTATGGATGTATTAATGTTAGCTAC
1   I22   AX00000153   ATTGGTTATTGTACGGGAAGAAAGCTAGGACCGAGTAGTCAAAAGCGTTTTGAT
1   I24   AX00000154   TTTTTGTTGCCACTACTAGACGTCTCCTGTTTTACGGGAAATTTCCTTACTATCC
1   K02   AX00000155   AATACGCGAAGCTATTACGAAAAACATGACACGCGGTGTTACTGTATTAGAAGG
1   K04   AX00000156   GCCCAGTTATCGATAAATATAATCCGTTTTATAAGACGAAAGAATACTATACGGT
1   K06   AX00000157   TAAGGAGAAGATTAGAAAAATTGTTTCGTATTATCCTCTTGAATATATGATGGTA
1   K08   AX00000158   AGATAAACCCGAACTAGTCGATCTTTTACGCTCTATGCAAGATGATGGTGCAAC
1   K10   AX00000159   TTGCCGAACATGAAAGCCGTTTAAATCCAAGAAGTGTTGGAGATAACGGAACTT
1   K12   AX00000160   AAAGTTGTTCCTAGATTTGTCGTTTCACCGTTATATGTAGGATATAAAATACCGC
1   K14   AX00000161   TTTGGATGCAGGGGCCATTCATATGAAGAAAGGTACACGTATTGGTCATGTGGC
1   K16   AX00000162   GGACAACCTATTCCAATACGTCCTGCACTATGTATTATTAACAATTATGATAGTC
1   K18   AX00000163   TGCTTAGTAAAAATGAAGCATATAAGAAGGCAATTGAGTTAATTCGTAAAGTCGG
1   K20   AX00000164   TATACAAAAGCATTGTTATCCGCTGTGCCAATACCAGATCCAACAGTGAAGCGA
1   K22   AX00000165   TATCTTATGTTCTTGTGCAAAAAAACATGCGTTTTGTTGTGTCTGGGGCTTTAAG
1   K24   AX00000166   TCCAAGATATTTACTATACATTTGCTGAAATGATTGAACGTGCTTCGGAAGATGT
1   M02   AX00000167   ATTCCAGATGAAGGAGAGACTAAGTTTCTTGTTGTAGAGGCAAATAGTCAAATTA
1   M04   AX00000168   CGAATTTGGCCCCTGAGCATTTAAGAGGGACTTATATGGGGGCTGCAAGTTTGC
1   M06   AX00000169   GCGACATTATGGGTGAAAGATGTAGCAAATCCACCTGAGAATCTTCCGGTTATT
1   M08   AX00000170   AATGCCGGACCCAATTCGTCGTATTGCTGAGCGTTTCATGACTGAGCCTCAACA
1   M10   AX00000171   GATTGAACATAAGCAACGATGTGTAATGCATGTTGGGGGCGGATATAAAGATAA
1   M12   AX00000172   GAAGGGAAGCCGCCTTACAGAGTTTGTAGCTGGAAGATTTGCAGCGAAAGAGG
1   M14   AX00000173   ACAATTGGAGCATTGACGAAAGACTCTTTAACGTGGTCGCATAACGGAGTAGAA
1   M16   AX00000174   AAATGGTAAAAGGGTACCGATTGTAGGGCGAGTAACGATGGATCAATTCATGAT
1   M18   AX00000175   TGCCAGGCAACACAACTGTTATTGCGTCAACATAAGACGAAGAAACGCTACCAA
1   M20   AX00000176   GTACGGTTTTGAGAGAGATTCTGTTATTTTACTTGAGCAGATTCGAACAATCGAT
1   M22   AX00000177   TTCTATCGGTAGACGTCTGCAAGATCCACTTGCTGAACTTGTAAAGATTGATCCT
1   M24   AX00000178   GTATCGCTTAGCAGAAAGTGAAGAAGATTTAGGCTTCGATGAGTATTTCTACGG
1   O02   AX00000179   CAGGTGTTCGTATAGGCGTAACAGCTGCAAAAACATTGGCTTGGTCACTTCAAA
1   O04   AX00000180   CCTTGGACTGCAGATGCCTTTCACCGTGAGTTAACGATGAATGAACATGCACAT
1   O06   AX00000181   AATCAGCAGTTATCAACACTGTGCATAACGCAAAACAACGCGGTATAGAGATTG
1   O08   AX00000182   CATCTTTAACAATTTGGGATGAAATGCTAACCGTCTTTACACACTTGCAGCAAAT
1   O10   AX00000183   AACACTCGACCAAGATGATATAACACGTGTAGCGCTTATTGGAGTAGGTAATTTA
1   O12   AX00000184   TCACTTTGATTTTACTCACTTATTGGTATACACTGCTATGGGGCTCGTATTCGCC
1   O14   AX00000185   GGTCGAGTGCTTGAAAATGGTGAGCGTGTTGCTTTAGAGGTAGCAGCAGGTGA
1   O16   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
1   O18   AX00000187   CTGACTGGGCACGTATCCCTTGGGACGTATTAGAGAAAATCTCTGTACGTATCG
1   O20   AX00000188   TTACAGCAGTTGTAACAGCAGGATTCTTCTTACTGGCACTATTCTTCTCGCCATT
1   O22   AX00000189   AAGAATTAAATCTCAGTTACGCCGTTATATGAAAATGAATGGTTTCGCTATACAA
1   O24   AX00000190   TTCCCTTCAAAGGCAGCGCTGGGAGATACAAATTGTAATTGCGAATCATAGTGA
1   B02   EMPTY        -
1   B04   AX00000191   TACATTTATAGAGCATAATGATTGGCTTAGAGATCACTACTTATGTTCTACATGTC
1   B06   AX00000192   AAAGGTTGTATCCGCTCATCGGACTCCGGATTATATGTTTGAATATGCAGAGAC
1   B08   AX00000193   TCATGGTAAACATTTTAGGCGAACATATAGAAGGGGTCCTAAGACAAGTGAATA
1   B10   AX00000194   CAGCTTATGAGAATGTTCCATTATGGCATGAGCGTGATATTTCTCACTCTTCAGC
1   B12   AX00000195   AACGTTGCATCGCCAGAGCAAGTAAGCGTATTACGAGATATGGCTCTACAAATC
1   B14   AX00000196   AGGAAAGCCAATTTTAGGTGTATGTAATGGATTCCAGATTCTTGTTGAATCAGGA
1   B16   AX00000197   GCACGTAATATCGTATGTTCTGGGGGAGAGCCTCTTGCAATTACAGATTGCTTA
1   B18   AX00000198   AATGGGGAAAAAATCGTCGGTCACAAGGGGTTAGGTTTAATATCGGAAGTGTTT
1   B20   AX00000199   CCAAGGAGCAGAGCCGCTTTTCTTCCTTGATTATATTGCTTGTGGTAAAGCTGA
1   B22   AX00000200   CGCTGTTGGGCGAGCGAATTATCATCATATTCCGTGTTTTGCTTTTTCAGCGAA
1   B24   AX00000201   GCAAGACTTACGTTATGGCGAGAACCCACATCAAAAAGCAACTTTCTATAAAGCG
1   D02   AX00000202   TTGCAAGATGTGATTGTTTTCCATGCAGGTACAGCAATGAAACGTGGTGACTTT
1   D04   AX00000203   ATTCAAAGCGAAACGGCAATCCGCCACGTCGCAACGAAATATCCTTATGACAAT
1   D06   AX00000204   AACTCGTACGCAAACCTTGGTGCACTTGGTCTAACATTTTGCTATGGATTGGTG
1   D08   AX00000205   GTACTACACATGCTAGTTAGCATTCGTAGATATGCAGTTCCTTGTGTGCTAGAG
1   D10   AX00000206   TGTCGGACCAGAAGCCGAAGATATTTGGATTTCTACGTTCCACTCTATGTGTGT
1   D12   AX00000207   GAAGAGGTAGCACTTCGTTGTATAAATCCAACTTGTCCTGCTCAAATTCGAGAAG
1   D14   AX00000208   CATTTGCGATTTATCGTCAGGCTCCAAAGTCTTCGCTCGTACCAGGTAACTTTG
1   D16   AX00000209   TGGATTTTATTCAAGCGGCAGCATCTGGAAAACTTTTGAATTTTGTTAGTAATAT
1   D18   AX00000210   ATGTAGGTATCCGTATTTATGAGCGCGCAGCGAAAGTAAACCCAGGCCAAATCT
1   D20   AX00000211   TTTTCCTACCCAATACAGAAGGTGTACATATTCATGAAAGCGTACGCCCACTTAG
1   D22   AX00000212   CTGGAAAGAGTACATTATTACGCCTAGTAAACATGTTAGAGAGACCAACGGCAG
1   D24   AX00000213   TTAGCAATGACATATGGTTATCAACGTTTTGATACATCAGTTATGTTCGTAACGG
1   F02   AX00000214   TTATTAATAACGGTGTTGCTGGTCAAGCTGGATTAGATCCAGCGAAGGATCCAA
1   F04   AX00000215   CAACAGATGTAAAACCAACAACTCATGTATTAACTATGAAAAATGTTATGCGTGA
1   F06   AX00000216   TAAATACGCTCTAGCAACGTATTACTTACTATCTTCTTCTGAAGCATCTGCTAAC
1   F08   AX00000217   CGAAAATTTTCTCTGCGAGTCCAACAGAATTCGGAGCGGAGCCAAATACACAAA
1   F10   AX00000218   AAAAACTGTGCCATTAGACCTTGGTAGAGCAAACGATACATATTTTATTAACATC
1   F12   AX00000219   AAAAATGGTGATTGCTATGCAATTGGGGTGCTATCTGGTACAGGAGATCGTCAA
1   F14   AX00000220   CCGCCAAAATATAGTACCAAAAGGAGTAAGTAACGGCATCCCAACGTTTGTACA
1   F16   AX00000221   ACACGTTCGTACAAGGCCTGTTTTTGATGATGAGGGAAATTTAAGAAGGGTGAT
1   F18   AX00000222   ATTCCTGCTTCTCATCCAAATAAGCGCATTTTAGTTATGAAGCAACCAGTTGGCG
1   F20   AX00000223   TTTCAGCGTGTTCGCCATCGTTGTAAAAAAGATTCATTTAAGTATTGCTTATGCA
1   F22   AX00000224   GCCCTGGAACAGATTTAACGATCGAACTTCCAGAAAAGCATGTATGGGCTGGTG
1   F24   AX00000225   CATGCAATCGATGATTATCACGGTCAAGGTATTAAAGACTTATTCGTATCACCCG
1   H02   AX00000226   CGCATTAATGATCGCTTTCATCGGTGTGATGGAAGTTGTAAACTACGTAATTAGC
1   H04   AX00000227   TCATCCTGTACTTGGCATGAAGAATCCGTGGGTATACCGTAATAAAGCACAAGT
1   H06   AX00000228   AAAGCAGGCGGACTACCTGTCAGCGTAAAAACAAGACTTGGCTTTAAAGAGTTA
1   H08   AX00000229   ATGCGATATGATGATGTTAGAGGCATTTTTCAATGGATTTATTACTTTAAAAAGAG
1   H10   AX00000230   TTGTTCATGAAATGTGTCATATGGTTCATTTAAATCACGATCGCTCTTTTTGGCG
1   H12   AX00000231   GAAAACGAACTCATCGCATTTCGTGCCCTACTCGTCCCTCCTATCGACGATGAA
1   H14   AX00000232   ATTCACGAAGGACATCGGAAACTTACATTACGACGTACCATTTATTCGCTTAAAC
1   H16   AX00000233   GAATTCCAAGTACGTACTTACAGCAAGACGAGACGACTGTCGCATCTTCCATTC
1   H18   AX00000234   TGCAACAAATCTTACTTGCTCTGAACAATATATTTCGATTGTTGTTCCTTCAAGAA
1   H20   AX00000235   ATGCTTGGATTAGGAGCAGACTTACAACCTGGATTACACCATCCGTATATGAAG
1   H22   AX00000236   AGATTTTGGGTGCGGAAAAGGACGATTAAACTTTTATATGCATCATAAGTGTGG
1   H24   AX00000237   ACTATGGGCATTGAGAACTTCATCAGCGTAAAACGCACTGAAGGTCCTAAGCTA
1   J02   AX00000238   ACTCGCACAATCACTACAAACTTCAACGTTTTAATGGAAGAAGAAGGTCTTGCTG
1   J04   AX00000239   AGATGTTTTGCAGTTAGAGGAAGAGTTAGCACCTGGACTTGTTCCGAAGGTGTA
1   J06   AX00000240   AAAAATCTATTCCGATGAAACGCGTCCTAGATTACAAGGTTCAACGTTAACAGCA
1   J08   AX00000241   GCAGGCCCGAATGTTCGCTGTGCACCGTATGAAACATTTGGTACGAAGCAATTA
1   J10   AX00000242   TTATCGGACTGATGGCTCCTCATATCGCGAAATCTTTAGTAGGTCCAAGACATC
1   J12   AX00000243   GCTATCTGGTGGAGCAAATGCTGCGCTTGCACTAACACTTGCTTTCAACCCTTC
1   J14   AX00000244   AAAGAAGGTTATTACGCATTATCTACTGAGGTATTACCTGAGTTTGCTGGTGACT
1   J16   AX00000245   GATGCTGGAAATGCTGTAAATAAAGCGAAACAATTTATTCAACCAGATGCAAGTG
1   J18   AX00000246   GCAGCAATACAAGAAAACAATTGTTACCATACAATTGGGGAATGGTACAAAAATC
1   J20   AX00000247   TTACGTTAGCTCGAACGTTTGAAGAACAACTTATTAAAATGTCTGGCAAAATCAT
1   J22   AX00000248   ATTTCTAGATGAAGCGATATGGAGTTATCCGATGTATATGAGTCATCATCGTCCC
1   J24   AX00000249   GCATTGGCAATGATGCGTGACGGTTTTTTATTGGGAGAAATTGAGGAGAAATTA
1   L02   AX00000250   AAGGCAGCGGAAGAAAAAGGGTTTGAAGTTGAAGTATATCATTGCGGATTTGAT
1   L04   AX00000251   TCGATCCGAAAGCAACGATATATCATTATTTACATATGGCTTCAAAAAATTATCG
1   L06   AX00000252   GGATCCGTCGGTATTACTCAAATATTAAATGCATATGTGACACAATACTTCCCAT
1   L08   AX00000253   AGAAGGAAAATTACATATTGTCGATACAACTTGTACACATCTCGGCTGCGAAGTT
1   L10   AX00000254   GAAAAAAGCATTTAAACCAGTTCCTACTCGTTTATTTGGCGGACTGGCTTATTTG
1   L12   AX00000255   TTCGCTGTCTTAACTTTTTAGAAATGTACGATGAAGGTGAAATTCACTTACAAGG
1   L14   AX00000256   TCTTCTGGCGCTGAGCAATCAGCGGCATCAATTCAAGCGATTGTTTCCGCTGTT
1   L16   AX00000257   GAATGGCGTTAAGATTGAAGATGCTGAGCTTTGGGTTGGAGAAGAGCAAGGTA
1   L18   AX00000258   AAGTTAATTGGAATGTCTGCTGGGGATATTAACGCAGTTCATACAATCGCTCGC
1   L20   AX00000259   TTTGTACGACACATATGAATTAGCAATAGAGAAGGATGAAGGAACAACTGTCCA
1   L22   AX00000260   ATTCTTAACGATGGGTCTTTCACAGGCGTTTATCGTATCGATGGGAGATATATTC
1   L24   AX00000261   TTCTCTCCTGGTCTTTACGATTTAACTGAATTGCAACGTGATGCCAATAAAAAGT
1   N02   AX00000262   TAATGTCGTAAGTATTGCAAAGCAGGCAGCAGATGAACTAAATACAGTTGCGGT
1   N04   AX00000263   GAAACTTAAATATGATTCAAGGATCAATTCAGCATCTAGTAACAAGTGCGCCATG
1   N06   AX00000264   TGAAGTTGTGCAACAATCGGGAGTTCGTTATGAAGTAGGGGCAATGGAAACAAC
1   N08   AX00000265   TCTCATTGCGATATGGGAAGGATCTGTGTCATTATTTAAAATCGAACCGTGGATT
1   N10   AX00000266   AGAAAGTCAAAAATGGTTAAGTACGAAGTATCAAGATGATGCAAAAGCGTGGGG
1   N12   AX00000267   TGTAAGTTATATGCCGCAACAGGATTTATTACTACCGTGGCGATCAGCTTTACAA
1   N14   AX00000268   ATTATTTCCGTTGGTGGCTGGACTTGGTCTAACCGCTTTTCTGACATGGCCGCT
1   N16   AX00000269   CGGGAAAAGGAAAACCACTACAATTAGAAGATCTTTCAATGGTACCTCCAGAAC
1   N18   AX00000270   ACTAGAGAATCGTATGTTATGTTTGAGACATTAATTGAAGCAGGCATACAGTCTG
1   N20   AX00000271   TGGATTACTAGTTTCATGAGATTTGGAACAGGTATTTGTTTAGCTTGCGTTAATA
1   N22   AX00000272   GATAAATGTAAGGTTTCTAGACAAACGATAAATGCAATTGAGAATAATAAATATG
1   N24   AX00000273   TTTCACATTCTTCTTTGGACTCGGCATTGTATTTACAAGTATGTTAGCAGTCGTC
1   P02   AX00000274   TGTGACGGCTCTGCCTATGTATATGTGAAGGACAAAAATGATACGGATACAATT
1   P04   AX00000275   TGCCAAAGCTATATAATCAGTGGTGTTCAGTAGTTCGTTGGGAGAAAACAACTA
1   P06   AX00000276   GTCGTCAAGATTTCGGGATGATTCGTAATGCATATATTCGTATTCAAAACCCGCA
1   P08   AX00000277   AATCCAGGTCTTTCAAAAGTTCTTGTAGGACTTGGTTGGGATACGAATCGTTATG
1   P10   AX00000278   TGTACGAAGGAAACTGATTTTATCTTCTATAACAATTTACAGTCTCCTTGTGGAT
1   P12   AX00000279   AGCTCATGGTATGAACCAAAACAGTATTCTCTTCAGAATGTTTGGTGTCTTCTGG
1   P14   AX00000280   GAAATTGAACAAGTACTTCACCACGATAATTCACTATTATACAAGCCGTGGCAAT
1   P16   AX00000281   ATGCACAAAATATCGCAACGCAAAGTGTGGAAGTAGCGAGATTATCAGGTTCTT
1   P18   AX00000282   GGTGTTCTTATGCAAGTTTGTATCATCTCCATCCCGCCCCTTGCAAATATATTCG
1   P20   AX00000283   TATTAAAGAAAAATTACGTATGGTTAATGCTGGAGCAATGAGAGCTGCTAGCTTT
1   P22   AX00000284   GGCTATATTGGTAGGCTGTCCGATTTTGTTCCAGACGGTGGCTGGACAGACGT
1   P24   AX00000285   TTTTAGTAAGAAAAAAGTTGAGCCAGCAGAGAAGCCAGAAACGATTGAAATTCAA
1   B01   EMPTY        -
1   B03   AX00000286   CAGCTCGCTTATTTCTTCTTGCTTGCGATTTTTCCTGGGCTTGTTTTCTTAATTAC
1   B05   AX00000287   ACTCGTTGTTACGCTTATGATGTTCGTCCCTCATTTCTTACTGGATTGGAGCTGG
1   B07   AX00000288   TCCATGTACATGTTCTTTATACCCGTATTTGGTGTATTATTATCGAGCATGATTTT
1   B09   AX00000289   GGATATGGTTACAAGATCCATCAGTAGAGTATAGTACGTGGGTTGCACTGGGTA
1   B11   AX00000290   GAAGAAATCACACGAGATATCCATTCTCAAATTCCTGAATTATTACAGAGCTGCT
1   B13   AX00000291   CTTTGGCCGGTGGGATTGTTGGATTACCGATACCAGACGAGTTTTTATTGACCT
1   B15   AX00000292   TGCAGGTGCTTCGTCATGGCTATTTTATTTTCTTGCCCTCAAAACAGGGAAAGTT
1   B17   AX00000293   GTTTTTCCACGAAGATTTTGTACTGTATGTTGCAACAGATCGACAATCCAAAAAG
1   B19   AX00000294   TCTATGTTCTTCGCGCAAAGGATGCCTTTAGTATTTACAATACCAGAACTTGTTT
1   B21   AX00000295   GGTACTGGACATGAGAGAGTGTATAATATTAGCCCGAGTCAACTCGGATATTTA
1   B23   AX00000296   AATGTTGAGTTTACAACGACGACGTTATGCAATATGCGCTGTGAGCATTGCGCT
1   D01   AX00000297   AGCTATCTATCATGCGCTTGAGCGGGCGACAAAAGATGGTAAACTTCGTCCAAA
1   D03   AX00000298   TATTTAGTGAAAGAACGTTAGCTCTTACGAAAGAAATGGGCTACTATAATGTATT
1   D05   AX00000299   GTGTACGTATACATAGACAATTTGGGATGATGCGTAAAGAAATGAAAGTCACTC
1   D07   AX00000300   GTAATTCGTACATCCTCCTCCATACTTCTCGTAGGAGAAACAGGAACTGGAAAA
1   D09   AX00000301   AACAGAAAGTAGAAATTAAGGTAGGAATAAGTGGGTATATTGAATCATTAGAAGT
1   D11   AX00000302   TTTTAGATATGTCTGCAACGGTAACGGATGGTGGTTGGTTTAGTGAATTTCATAT
1   D13   AX00000303   ACGTGCCTTATCTATGCGCCAACTCGGAATGCTGACAAGTATTGATCCTGCAAC
1   D15   AX00000304   ACTCGATGAAGCTCACCGATACATATTCAATTTAGAAGTACTTGAACTGTTAATG
1   D17   AX00000305   TATTTTCGGCTGCGTAAAAGGAGAAATGGGAATTGGTATTTTCGGACCAGCTTT
1   D19   AX00000306   ATAACTGTGCAACACGTCTACGCTTACAAGTGAAAGATGCTGGTCAAGTAAACG
1   D21   AX00000307   GATTACGGGTTTGGATGGTACGTAGACCCGGGAAGTTATTCGAATCACGGTGTA
1   D23   AX00000308   GATTATTTTTTAGATAATAAGTTATTGCCTGCTGTAGAACGACTTTTATTTTCACA
1   F01   AX00000309   TGAAAAACTGGGGTGGTGGAATTTAGCAGATCCAGCATTATTTCAAGCGATGGC
1   F03   AX00000310   ATATGGAGATGGAGAGCAAACACGTTGCTTTACGTATGTAAGTGATGCGGTAGA
1   F05   AX00000311   TTATCGCTGTACCGAATGCGTTTAGCCGTAAGTGTTTGAAACAAATTGGGTATAG
1   F07   AX00000312   TTTGCACCAGGTGCGAACCCAATGCATGGACGTGATACAAAAGGTGCGCTAGC
1   F09   AX00000313   ATAACAGTCGAAGAAGTAATGCAGGATGTGACATGTTACCTTCCTTTTATTGAAG
1   F11   AX00000314   ATTCCTGTGTATAACGTATTAACGGATTTTTGTGTGCACAAAATATGGATTCATC
1   F13   AX00000315   ATTTATTTTTAACGAAACAAACGATTGAAGCTGAAGAGCGTGGGGAATTAATTTC
1   F15   AX00000316   GATGCAAATGAAACATCTGAAGTTTCAACACCACATATCCGTTCTTTAGACGGAA
1   F17   AX00000317   TGAAACTTCTCACCCTAACCTTCAGTATGTGCAATGGACACCAGATTTACAAACC
1   F19   AX00000318   ACAATGAAGAGGTACAAAAAGCATATTTACAAGCAATCTCCTATTTATCCTATCA
1   F21   AX00000319   GACGTATGAATTAGTAGAAGAACCTGGTATATTATTTGAAATTACGTATTTCAATG
1   F23   AX00000320   GTGCGTGGGTTGAATTACTGTGGGAAGATTTTCAAACAACTTATGCGAAATCAG
1   H01   AX00000321   CCATTTAGCAGTCGTTACGGCTGATTATTACTACGTTGCGAGATGGCACCGTGG
1   H03   AX00000322   TCGGAAATTATGTTGCAGCAAACGAGGGTAGAAGCTGTAAAACCATATTACGCG
1   H05   AX00000323   ACGCGATATGACTGAACTAACAATGGTTTCAAAAAACGAATGGAAAGAAGATGA
1   H07   AX00000324   AAGCACAAATGCTAGTTATGGTACAGAGTTTGCGACTGAAACAAATGTACAAGC
1   H09   AX00000325   ATCGTACAGTAGTGACGGAATCAGATGGCCGAACATGGATTACTCGTGAACCAG
1   H11   AX00000326   TTGGACGGCGAGAACATTTTCGGCAGTAAATACGTTAACAGATTTAGGGCCGTT
1   H13   AX00000327   AATTCGTAAGCTCGTTTTATTCAGACAAATGTTAGCGACGACAAGCCGTGCTTTA
1   H15   AX00000328   TGACTCACCACTTGCCGCACTCGATACTGATAGACGAAATATCGCTGACTTCAT
1   H17   AX00000329   TATGAAATTTGCTGGTTGTTACCATGGTCATTCTGATTTAGTACTTGTAGCAGCT
1   H19   AX00000330   AGTTTGTTGCACCAGTTTCCTATCAGGCTTTATCAATGGTTATGCCAGATAGTCA
1   H21   AX00000331   ATGACTACGTATATCGCAATTGCGTGGATGGCACGTGCCTTTTATTTTAATAATA
1   H23   AX00000332   TTACGCTTGCAAGCCTTGGTTTTTGGTCGGATGCGAAAAGTTCAATTATGCCGC
1   J01   AX00000333   TTCAACTCGTTGAAATTTGTTTATATTTTAGCGCAGTTACTTTATTGTCTGTTGGA
1   J03   AX00000334   ACGGGTGTACGCATTACTCCACAGCGTCATGCTATTTTAGAGTACCTTGTGGAA
1   J05   AX00000335   ATTTATCGGCCTCTTCATTGCATACTTAGGAGTCTTTTTCCGTGAGAACATTATT
1   J07   AX00000336   CCAACTATCTATCAAGTGCGATTCATGAAATTAGATGAACCAATTCAATTTGAGT
1   J09   AX00000337   ACATGGGTGTAAACGGTTCTGTAGCTTACATGTTTGATGCGACAGCTGTTATCG
1   J11   AX00000338   ATGAAGTGTTATTAGCAAAGGTACACTGGCGAGCTGATACGTGGGAGTTGCCAG
1   J13   AX00000339   TCATTGGAAATGTAATGATCGAGCAAAGTGATATTAGTAAATTACATGTACCGGC
1   J15   AX00000340   TAAGGTAGTTGAATTTGGAGACTTCAAATGTCCTGCTTGTCGTACTTGGGATGT
1   J17   AX00000341   GTCGCGGGATTTTTTGTCGTGCTTCTTGGGGACAAGATTATCATCTTGTTTTAAG
1   J19   AX00000342   AGTACCAATGAATGGATATCCTAATATTCGTAAAGGATGGTGGCAAAGGGAGAA
1   J21   AX00000343   AAAGACGGTGAATTCTTCTATTTAACAAAGTATGGTGAGAAAGCTCATACAGCGT
1   J23   AX00000344   GTATCAGCTCATTTATTAGCAATAGAGGTTACAGAAGGAGCACTTATACATAAAG
1   L01   AX00000345   CAGAATCAGATCCACGTGCGTATCGATTTGATGGAGAATTAAATAAGGCAAACC
1   L03   AX00000346   GGATACAAGTGGATCGATGGGAATATGGGAGAAATATATGGCACGGAGCTTCTT
1   L05   AX00000347   AGCAAGAAGAAAGTAAGAAATCACTAGGAGCAACAGGTGGACAAGAGAATACAT
1   L07   AX00000348   TAGCCACATTTTTCGTTACTTCTGCCGACTCGGCAACATTTGTTGTTTCTATGCA
1   L09   AX00000349   ATGTAGTCTTCCACGGTATCGCAAAAGATGACGAAGAAAATAAAGCTCCAACGG
1   L11   AX00000350   GCGGATCTGTATCCATTGTTACTTTATTACTTAGTTTTTTCGCCATGTTATGTGG
1   L13   AX00000351   GGATAAGAACGGTTACTTAGATGCACTTGGTCAGCCGCAAATTGCGACGGTTAA
1   L15   AX00000352   GGAATTCAGCGTGTTGCAGACAGTTCTTCATTAGTATCCACAGCATCTATGTATA
1   L17   AX00000353   CTTGCGTTTGAAATCTGAAATGGATCAGTTAACAGCAGAGTTATCTCAGACGAAG
1   L19   AX00000354   ACCTATTTTGACAAAAGCTGCTGCTACTTATGGAATTAGTGCAGCTGAAATGGG
1   L21   AX00000355   GACGAAAGAAAAATTTGTTCGAGATTATGATTCGAAAGATTGGATTTCGTTAGAA
1   L23   AX00000356   GAAGTTGATTCAAGATGGAGCGAATATAAACGTAGAAGGTGACAACGGAGAAAC
1   N01   AX00000357   GCTGGAATTACCAGAGCGTGTATATGAATTACAGAAACATGGACATGATGTCTT
1   N03   AX00000358   TGGAGTGCGAAAGTCATCGGACAGTTACTCCTGAATAAAGGTGACAAAGTAAAA
1   N05   AX00000359   GCTATCACCAACTTTATTCTTTATCGTGACAGTAACGTTAATTAGTGCGTTCCAA
1   N07   AX00000360   TTCAAAACTTTGGCTGGATCAATAGTTTCGCTGGGATGACAGTGCCGTTTTTTG
1   N09   AX00000361   AACGAAGCCAGACGTACAAGCAAAGTGGCATACTGCAACAGGTTATTTCTCTAT
1   N11   AX00000362   AATCATGAAGATATGATGATCAAGGCGTTAACGACTGATGAGGAACGTTCATGG
1   N13   AX00000363   AAAACAATATGAGCTTCTAGAGTACCTTGTTCAAAATAGCGGAAAGATTTTAATG
1   N15   AX00000364   TTGCAACAAATGAGAAAACGGGCTGGAAAGTAGTTGGAGTCATGTTTGATGAAG
1   N17   AX00000365   TCGGTCTTGAGCCGCACAGGATAGCAAAAATTCTTGAAGAAAGAAATACGATGC
1   N19   AX00000366   ATTTGGCAGAAGATCGAGTCGTTGAATGGAAGAGTGTTTACAACAGATGAAATG
1   N21   AX00000367   ATTCTTCTTTATCATCGTACCAATTGTGAGTGGTGGTATCGGGGAAGGGATTTTA
1   N23   AX00000368   TCCCGTTATGTTTAGGGACGACGGATGTGGATGAAATCGTTACCCTTGTAAAAA
1   P01   AX00000369   CGCAACGTCATCCACTCAAGTTAATGCACCTTCCTTCTTTCACCTTAGCGTTTTA
1   P03   AX00000370   CCCTAGATATTCTATACAACTTATTATTTTCTCTATTCTCGGCATGCTCGGTGCG
1   P05   AX00000371   ATTTGTATGAATCTAGGGGTGTGCGTTGCTCAGCTAGTCAAATTGTATTAGGGG
1   P07   AX00000372   GCACAAGATGAAAACTATACGCTAGGTGCATTTAAAGATGGAAAATTAATCGGG
1   P09   AX00000373   AAGAATACTTGCAAATCATCGAGGATGAAACAGATAGTGTAACCGATCTCGTCC
1   P11   AX00000374   ATCTGTTCTTAAGCCCTCGCGGCTATTTTTGTATGAAAGCTACCTCTGGCCTTGA
1   P13   AX00000375   TGAAACATGAGGATCCTGTAGCTGCTATGGCAAAACGATTAAGCAATCCGGATA
1   P15   AX00000376   CCTGAAGAATGTTTTCACTTAATGAATACTTTACAACAATCTTCCACTACATTTCG
1   P17   AX00000377   ACGAATACAGAACGCCGTATTCAAAGATTATATGAAGTGTTGAAACCGCTTGGT
1   P19   AX00000378   TCAAATTCCTAACTTCATTACAGGAGAACTGTTTAAGACAACGATGGGACAAGTG
1   P21   AX00000379   GCGTTGTTCATTATGCAGTTGCAAACATGCCAGGTGCGGTTCCACGTACATCAA
1   P23   AX00000380   GCTAGGGGCATTTGACCTAACAATGCTAGGGATTGGTGCGATAATTGGTACAGG
2   A01   EMPTY        -
2   A03   AX00000381   TTCGTGTGTTAAAGCAAGCGAAACTGGTAAAGAATCGTAAAGAAGGAAAGGTCG
2   A05   AX00000382   GACATAGTCACGATCATGGTGAAGCAAATGTGAAAAAGATGGTAGGCCGATTAG
2   A07   AX00000383   AGACGAAGCCGGGTTTACAAACACAAAAATTATTGCTTCTAGCGATTTAGATGAA
2   A09   AX00000384   GAGGCTATCCCGTTGTATAAATCTGCGGGAAATAAAATAGAATTAAAGAAAGTAT
2   A11   AX00000385   GTAACTGATTCAACAGTATTACGTTTGCAACAAGTTTACGAAGGAGTACCTGTAT
2   A13   AX00000386   GGTAAATCAGAAGAGGATTTGAAGAATCGCTTGAAGACAGATAAAGTATCAGCA
2   A15   AX00000387   TTCTCGAAGCAATCATTCTATGCCCGTAAATTATTTACCACTTGGGCAAGATGCA
2   A17   AX00000388   GGTTCCTTCTTATTCCATTACTGATTATAGCACTTGGAGCAGGGGGATACTCCTT
2   A19   AX00000389   TAAATGGTCTTGGGAAATTAGAATCTTATAATGCTATCGCCTCTGCCATTGTCGG
2   A21   AX00000390   ATAGAGTAGCAAAGGAAATTATGGTGCCTCGTACGGAAGTTATAGGTTTATATG
2   A23   AX00000391   GAATTTGAAGCGTATAGCCGAGTGCTTGCGCGTGATATAAAAAGAATTAAACAG
2   C01   AX00000392   TTAGGATGGATTGGCGTATTCATTACAGGTTCAGTAGTATCAAGTGGTTCACTAT
2   C03   AX00000393   TCGCAGAGCGTAACGTATCTAAAGAACGTATTTCTGCAATGGATGGTGATGTAT
2   C05   AX00000394   CTTCTTGGCAAAATGTCATGGTACTTGCGCCGTGGGTTCTCATTTTAACGGTAA
2   C07   AX00000395   TCCGTATCAAACATGGCTGAAGCAATGGTCAGAAAAAGATGAGGAAATGGTACA
2   C09   AX00000396   AACGCCAGCTGATGCAGCGGCTTGCATGAGATCAATTGAAATCTTAATGGAAAG
2   C11   AX00000397   GTCCATCAACGCCGAAAGATAATACGCCACAAGATACAATTCAGCGTCCTACTA
2   C13   AX00000398   AATATTAATGGTACATAATGTAGAACAAAATGTTTGGTCATTGCCGGGTGGGGC
2   C15   AX00000399   AATCGCAAGAGCTTGACGTTGCATTCCAACTGTTAGTGGACTGTTCTGGTTCTA
2   C17   AX00000400   GCAGCAAGTATTCGTGGCATTATCGATGCATGTGATTTAGGTGTATATATTCCTG
2   C19   AX00000401   AAAAATTTGGAGGCGGGCCTGCAGCAGATAGAACGACTACCAAACTTTTAACAA
2   C21   AX00000402   TTATGTGCTAGGAGAGAAAGATGTTCTGGCTAGGCTGGGTGGCGACGAATTTG
2   C23   AX00000403   TTCTACACTTGCATGGAGTATTACAGGCCTTGGCGTATTTATGATTGCACTCGTA
2   E01   AX00000404   TAAATGGAACAGATTATGTTGTCGTTGTGAAAAACTTTACGCATTTTTATGATGG
2   E03   AX00000405   TTGGCCAATGATTGCTCTTTCTAACATTGCGCAAGGTAGTGCGGCACTTGCGAT
2   E05   AX00000406   TCTAATTGGCAAATTGAAATGCAAAAGGGTGGAGGATGGAATGCGTTATTCTGG
2   E07   AX00000407   TTTAGATGTCAGCTTTCGGGACCCAACAAACCCAACTGCTTTAGTAAAACTTATT
2   E09   AX00000408   GATTTCCGCTCTCATCGCTGGGCTTGCAATTCAGCTTATTATTTTACTTATGTGG
2   E11   AX00000409   TCGCTTAGTGAGTTTCTTGATTGCTTTTCTCTTACCAGCTATATATATCGCAACC
2   E13   AX00000410   ATCGAGGTGTTTTTTATACATTTTTTCGTAATAGATATGGCATATGGAGCGGTAT
2   E15   AX00000411   TAAAGGCTCTTCCAGTTGAAAGAGAAACGTTCGGCCTTATGCACGGTGACATTC
2   E17   AX00000412   ACAACAATTATGGCGTATTACTACATTGCAGAAACGAATATCGCGTACTTAAACC
2   E19   AX00000413   TGTACAAAATACGGAGGTACACAATGCAAAAACAGATATGAATGAATTACGCCG
2   E21   AX00000414   GTTGGGGTGAAGAATGATACGAACTTGTTTGGATTGAAAAATCCTTCAACAGGG
2   E23   AX00000415   ATTTAATGTATCAAGGAGATTTAATTTCAACGAAGACGTTTGTTACGTTCGATGT
2   G01   AX00000416   TCCAGAAGCAGGATTGAAATTAGAAATTATAACAGCTGTAATTGTTGCGTTAACA
2   G03   AX00000417   GGTAGCAATGCCAGTTTCAGGATCTTTCCAAAAGTATGCGACGAAGTTTATTGG
2   G05   AX00000418   GGGTATTCACCGTTACAATTACTCGTTTCTTCTATCGCAGGATGCAGTGCAATTG
2   G07   AX00000419   ACATTTTGAGGGTCGCGAAAAACAAGGCGATTGATAGTTATCGGAAAAATAAGC
2   G09   AX00000420   CTCTAACGTAGTACACAGTCCTACTCAGTTACATGTTTTACTGACAACAGAAGGC
2   G11   AX00000421   AATAATTTAATTGATGAATATGTTGTTACGATTACACCACATATATTAGGTTCTGG
2   G13   AX00000422   GTAAACGCCATGTATAAAGAAAGATACATTACAGTTTCTTTCTCTTGTCCTCCTA
2   G15   AX00000423   TAAAACTCGGAGCGGATGATTACGTAACGAAACCTTTCCATGAAGAAGAGCTTT
2   G17   AX00000424   GGATATGGGAAGCCTGCCGAAAGAATTACCGTTCTTTAGTATTCCAGACGTGCC
2   G19   AX00000425   TGTTGAAGTTGTGTACGTAGTTGATAATAGAACGGCAAAGTCAGATATTATACAA
2   G21   AX00000426   TTATCGCCGTTCTTGTGTACTGGCTAAACCCTCCTGGTAATCCAATGGTTGATAG
2   G23   AX00000427   CAGGACTTACACCACCGCAGTTTTATATTTTAAAGATTTTAGATCATTATGGAGC
2   I01   AX00000428   AGCGTGTAGCGGTGGAACTATTAGAAGAATACCCGCATATTGATGGAATTGTTG
2   I03   AX00000429   AAGGTTCTAACGGTGTACGTTTCCATAATGGTACGGAGATTGTACATGTTCCTAG
2   I05   AX00000430   TGGTGGGGCGCAGCATTGGTGAACGTTACCCAGAACGAAATAGTCAAATTGGC
2   I07   AX00000431   TCTTGGTGATCATTTAATGTTCCAAATGTTTGGCCGCGGTTATTTTCTCGGTATT
2   I09   AX00000432   GAAATTATCGCAGCATCTGTACGTCACAGTGTTCACGTAACTGACGCAGCGTTA
2   I11   AX00000433   TCGAAGCTTGGTCATTAATGAGTGGAGGTAGTTGGACAGGGAAAATTGCAGGAA
2   I13   AX00000434   TTGGTGCTTTCACACTCATGTTTTCACAAGGAATTGTCACTTACATGTTACCAGT
2   I15   AX00000435   ATCTCATAAAGTGGGAGACCGCGTCGTTGTAGAACCAATTTATTCTTGTGGTAA
2   I17   AX00000436   TACAGTTGAAGGATTACGTCCTCTTGACGCTTTATATTTTAGTGTGGTCACGTTG
2   I19   AX00000437   AAAGAAGGCGTAAATTCTCATTTATGGATTGTAAACCGTGCGATTGATATTATGT
2   I21   AX00000438   AGCAACTTGGGATGCAACGACAAACAGTATTGCAAAATATAATTTCCCTGATAGC
2   I23   AX00000439   GAAGATTCGTATAGCGAGTAAATCGTTACGTTCTGTTCCGGTTATGCAAAGGAT
2   K01   AX00000440   GAAAAAGGTTATGCGCAAGAAAATTTAGGGGATATTGATTCGCAATCCATTGCA
2   K03   AX00000441   AGTCGGATTCGTTCGTCGCTTTATCGCGATGCAAATTGATTGGATTTTCTTATCC
2   K05   AX00000442   TCGTTTTAGCACAGCACTTGCTAGGACTAAAAATAGAAGGGTTTAGCTTCGAAC
2   K07   AX00000443   CTGTCGTTGCCAATGAAGTAAGAAAACTAGCAGAAAGTACAGCGGAAAGCACAA
2   K09   AX00000444   CAGTCGCTGTTAAAGCAGAGTCAAACGACGAGAAACTTAACAACATGCAACAGC
2   K11   AX00000445   CAACCAGACTTGGCAGAAGTAGCGAATGCATCATTAGATAAGAAGCAAGTAATT
2   K13   AX00000446   CAAACCGAATATCTCTACACTGGTTGGGGAATTATACGAAGAGAATGATCCAAA
2   K15   AX00000447   AGGTTTCCTCGGTATGGTGACTTCTATTAAAGGAAAACAACAGATAAAATTGTAT
2   K17   AX00000448   TCACAAGCTATGCAAGGAGTAGAAAGCTCTGATTGGCTATCTGACAACTTCGGT
2   K19   AX00000449   GTTATTTTTTTCATTATGCGAGCGCTCGGAGAAATGGCAATTGAACAACCTGTTG
2   K21   AX00000450   CGTGTGAGCGGTGCATTATTTATTAGTATGATTGTGACAGGAGTTATCGCCTTTT
2   K23   AX00000451   AGTGTATGAGCATACAGGGGGAGTATCACGTAGCTATTTCATGAAACTATTATTA
2   M01   AX00000452   TCGCTTCTTTCTCAAAGGAAATGCATCCTGACTTACAAGCAGGTATGCATTATCG
2   M03   AX00000453   TTACTTGCTGTATTCGTCGGATTAAATTCCGAAAGCGGCCAAAGCATGTGGCTC
2   M05   AX00000454   GGTCACACGTTTTCGGATTTATTTTATCGCTTGCACTAACGTTTCTAGCTCTATA
2   M07   AX00000455   AATTATGCTGTTCGCAACACTTTTCGCCTCTTATCTAGTACTTGCTGGTCGTACG
2   M09   AX00000456   GCGGTTAACTCATTCTTCTCGATTTCGACAATGGCGATTTCGATTCCAACCGGT
2   M11   AX00000457   TTCAATTCAAACTGACTTCTGTCGGCCCAATGAATGCTTTCTGGGTACCAGAACT
2   M13   AX00000458   GCAACTTGCTAGTGAAATTCATCGAGTTCCATTTGAACAAGATGGTTTGCGTGG
2   M15   AX00000459   GGTCAGTTGGAGGAAGAGGCTTTGGTACTATTTTTGTTTTTCTTCTTATGGCAGG
2   M17   AX00000460   GTGGAGGCTTTTTAGAAAGGTTCGATGCAATTTTTTTTACGACTTGGATTATTAC
2   M19   AX00000461   AGTGAAAATTGATGGTGCTGAACCAAAAGTTGAAAACATTGCGTCTGGTAAATAT
2   M21   AX00000462   TTCAACGGTGGTTTCATTGGGTGCGGTTATTATTAGTGCGCCAATTGCTATAGC
2   M23   AX00000463   GTTTTTGGGATCCTAATTTCTTGTTTGGAGAACCAAGCAATACAAGAGCTGGTG
2   O01   AX00000464   GAATGGGCATTGATTGATTCTTATTTAGAACAAGGGCATAGTGTTATATTGGATA
2   O03   AX00000465   ACAATCGTTGCTATGCTCCCACTCCTATTTGGCCAATCACAAGCAGGAAGTATG
2   O05   AX00000466   GCAGTTTCATAAAGATGAAATTCCAACTTTAGTACGTATTCTTCGCTTATGCCAA
2   O07   AX00000467   AAGTAGTGGAAACTGTAGGAACTTGGTATAAAATTCGTTTTGGCACAGGATACG
2   O09   AX00000468   ATAAACAGTATGCAAAAAGACTTGGAATTTCTATAGAGGAGATAGAGTCTGCAAA
2   O11   AX00000469   CCTTGCCGCTAGAGTGCCAAGGTGTACAGAAGAAAGAAGCACAAATAAAGGCAA
2   O13   AX00000470   TGCGAGTTCATGGATGGAGAGAGCATTTTATCCATTATTAGTTGCTTCACAAACG
2   O15   AX00000471   CGGTAACAGGGGCATACATTAACCATGAAGTACCTGTTATGCGTCATGAAGGTC
2   O17   AX00000472   AATTGAGAGTGAGATTGATTATTTGCATATTCGTGAGCGTGAGAAAAGTACGAAG
2   O19   AX00000473   TTCATGGAGCACGAAGTTACTAGGTTATTTTCACCGCGAATGGGGTACATATCC
2   O21   AX00000474   AGTAGCCGAGCTACTTACACATTTAGAGTTAGATAACAGAATTGTTGTAGTAGAG
2   O23   AX00000475   CTGTGTCAGGAGCAAAAGATCCTATTAAGATGGCACAAGCAATGAAATTAAGTA
2   A02   EMPTY        -
2   A04   AX00000476   AATATTCTATTCCATGGATTTACGGAGCATGTGTAGGGAGTTACGGCCTTTCTTA
2   A06   AX00000477   GCTATTACGGCAATTACTGCTCAAAATACGCTTGGCGTTCAAGGGGTATATCCA
2   A08   AX00000478   CATTCGTTGCCATTAAGGAACTTGGAAATAACGGCGGTGGATTTTTCGGAGCTA
2   A10   AX00000479   CAGTAAAACCTGGTATGCGTGAACGTTTTGAACAGTTGCGTCAAATGGGGATTA
2   A12   AX00000480   TAGTGACAAATTCAGGTTCAGGGCTAGATCCTGATATTAGTCCGAAGGCAGCTT
2   A14   AX00000481   TTTGTGTACAATACAGTTCAACAGCAGAGAAATTAATAAGACGGGGATGGCGCA
2   A16   AX00000482   ATCGTTACATCTTTGTACGGTTTTAGCATGGGACTTTCTATGCCAACCCACACTA
2   A18   AX00000483   CAAAACGAGAAGTTTCTTTATGAGACGGGTGTAAGTAGTATGTCTTTATCTGAGT
2   A20   AX00000484   CGTCTAGTTCATTGCCTTTCATTGCACCAGTAGTAAATTATCGTGGTAAGCAACT
2   A22   AX00000485   GACGCATTTGATGAAGCATTCCCAGCATTCTTAGTAATCTTAAGCATGCCACTTA
2   A24   AX00000486   CAGCAATATCCGCAGCAAGGACTAGAGTATATTACAGCAGAACAGTTAGAAAAG
2   C02   AX00000487   GAAAACGGTATTGCCAAACGAAAGATATGCAGTGTACTCAAAACGAAAAGATGG
2   C04   AX00000488   CAATGTTTCTTTAGTAAACGGTTCAAATTTCGAAAAAAAGGCTGGTGGAGCACCT
2   C06   AX00000489   CAAGTGAAATCACATATCCTTCTGATGATTATATGTGGGCTCATTGCCTAACACT
2   C08   AX00000490   AAAGATATCGGTGTCAATTTCTTACTCCCTATTTGGTCAATGGCGAACGTTGCAC
2   C10   AX00000491   TATCGTATGTGCTACAGATAACATCGCTCTTGGCGCAATGAAAGTTATTCACTCC
2   C12   AX00000492   TGTATCCATTCGTTTTATGGCTCGGTATCGCTGTAGTAAAAAAAGACTATCGCAT
2   C14   AX00000493   CAATTATTTTCTAAGCGTATTGAGCATTTTTTACACGCTTATCAATACAGTAAAGA
2   C16   AX00000494   AAATTAAAAAGAATGGTGAAGTTGTTTGGGATTCCCACGCAACGACTTGCGTCA
2   C18   AX00000495   AGACGTTTTAGCTTACTATAAGCAAAATAATTCTTGGGAGAAAACAGCCGAGCAT
2   C20   AX00000496   AAGATTACGCTGCAACATGTGCATTTATGCAAAACTTCCAACTTCTTGCTTGGGA
2   C22   AX00000497   TGCGTACAAATGGTGGCTTCCCGTACTTAGTAGTAGAAGACGGAGACTACTTAA
2   C24   AX00000498   GCATTCCGGTCCAGAGACGGTCGGTGATGATCCGCTAGTGCAGTCGTATAAAA
2   E02   AX00000499   CAAGGAATGATTAAAGGCTCTATTAATATTCCGTTAGATGAATTACGTGATCGTT
2   E04   AX00000500   ATTGCCGAGAGGTTATTACACAGTTAACGGCATCTCGTTCTGCACTTGATCGTA
2   E06   AX00000501   GCCGATTGTGAAAACGAAGAAGGCGATAGAAGGATTAGCATCAGGGCAAGTGA
2   E08   AX00000502   CCACCAAAAGATGCGGAGGAAGTTGTTTTCTCATATGAACCGCTCGTTGAAGGA
2   E10   AX00000503   GTGTTAGAAGTACAGGTAACTGATAAAGGGTCAGTTAAGGATATTCCAGCGTGG
2   E12   AX00000504   ATTGATATTTCAACATCTCTTGCATTCTCAGAACCAAACTTTAATCCAGCGCTTG
2   E14   AX00000505   GCTGTTCGAAATGCCGCACACGATTTAGCACGCGGTGATAAATCTGATTTACGT
2   E16   AX00000506   ATGGAAGAGGAAGAGATGCTACTACGTCTAGGAGCGAAAAAAGTGATTCATCGC
2   E18   AX00000507   CAGGTATGAAGCCTCTTCGCTCTTTAGAATCATTCCAAGAATTAACGGTTAGCAT
2   E20   AX00000508   GGCGCTCGGCCCACTTATCGGACTTTGGCTTATGCAAACATATAACTTCACGAT
2   E22   AX00000509   GAACTAGGTGCGTACGGTATTCGTTTAGATGTTGGTTTCTCAGGATTAGAAGAA
2   E24   AX00000510   GTTTATTAGTTTGTGCGACTGGTCAAGGAAGCGCCCAGCTATTGAAATATAAAAT
2   G02   AX00000511   AGATTGCCGGACAGCGACATTTATTAGCAATTCGAAACGGGGTTATTTCTACATT
2   G04   AX00000512   TGACGTTATTATCGGAAATGCTTATGCGAGTGAAGAAGAGTTAGAGAAACTAGG
2   G06   AX00000513   AGTGCACCATCATCTTCTCGTGAGTTACGCGTTGTAGCAACAGCTTACACAGCA
2   G08   AX00000514   CCTGTCATTTCGGGAGTAACTGAGTATGACTCTGTAAGATTAACAATGACCTCTC
2   G10   AX00000515   GACCTCTTTTACGAATTAAATAAACAAGGCTCAACAATCATTATGATTACCCACG
2   G12   AX00000516   CAAAACGGCTTCCACGTTTACGTAACGAGTAAATCTGGCGAAGCAACTGGTACA
2   G14   AX00000517   GCAGTATGCTTTTCCGCATTTTCGTTTCATTGAATATTTTATCGCGCATATATTGC
2   G16   AX00000518   TAGCTGCTGCACTCCGTTACTTAAATCAGCGTTATACAATTCCTGATAAAGTCAT
2   G18   AX00000519   TAGACACCCACCCAGACGATACAGCAGCTATTAATCAATTTAATGACTTTTCCTA
2   G20   AX00000520   ACCCCTCCTAATTTATATTTAGGTTTTCAACCGCCAAATTTACCACAGTTCTCAC
2   G22   AX00000521   CAGTTGAAATGACGGGATATTTAAGAACAGAGCTTCATCATTTTCCTGCATTAAA
2   G24   AX00000522   CTGCGTTGCAAAAAGCTCACGAACCACGATCTATTCGTATTATATCTTTTATCCA
2   I02   AX00000523   GGCGGAACGACAGGACCGTTAACGTTATATGCACTCGGTTATTACGGTGGTCG
2   I04   AX00000524   TGTAGTCCGTGGTCTGCTACTGTAGTTGCAACAGCAATTGATAATGTTCTCTATA
2   I06   AX00000525   TCCAATTACAGTTGATTTTTTAGTAGGTGCTACAGTAGTTGATACAATTACTGTA
2   I08   AX00000526   AATCATCATTTGCAGTAGCGGCTGGTGGAATTATTTTTCCTTTCATCGGTGGTTA
2   I10   AX00000527   TTCTATTTTCTCGGAAGAAGCAGATGGTGAGTACGACCAGAAGCTGAAATATAC
2   I12   AX00000528   GTGTTGTTCGCTTTTGTAAATCGATTGGAATCGGAAGTTTTAAAGCATTTAAAAT
2   I14   AX00000529   AATGGTGCAAGGATTTATAGCAGGTGGATTGAAAGCGTTTACTAAAGCGGTGGA
2   I16   AX00000530   GAATTGGTGAGGTGGCAGATTATCACCTTGAAGATCTTGGGCAAGAGATGAAGT
2   I18   AX00000531   CAATTGATAATGAATTGTACGGTAGATATGCAGGAGAGATGCAAGTTGCTATAC
2   I20   AX00000532   GGTGTAGAAGCAATAATGGAAAATGTATTTAGCCGATTAGGATCAGAATGGGAT
2   I22   AX00000533   CTACATTTTAATAGTGGCGATTTATGGATGATTGCGGCTGTTTGTATTTGGGGAA
2   I24   AX00000534   AGAAGCGATGCCTGAAGTGTTAGAATGTCACTGTTTAACAGGGGAGTATGATTA
2   K02   AX00000535   TATATGTGGCTAAGTGAATTTTTAAGTGAGGCGAAAGAAGCCGGTGAAATTCGT
2   K04   AX00000536   GGTATGAACTCGACTTATACGAGTTTAGGAAATATAGCAGGACCAGCGATGGGC
2   K06   AX00000537   CGAAGGAACATTACGCTTTAGTGATTTACAAAAATCAATGGACGGGATTAGCCC
2   K08   AX00000538   AGGCATTGAAGGGTTAAAGTTTGCAGCGCAAAATTTTCGTAAAGTTGTGCCTGA
2   K10   AX00000539   AGAAAGAGTATATGTTCTCTACAACTTGGAATGCACCTGAAAATTCATTTGGAGA
2   K12   AX00000540   AAAAATGGAACCACACATTGCGCATACGTGGGAATTAAGTGAAGACTGGCTTAC
2   K14   AX00000541   AAACGGTGCACTTTTTCTTCGGGAATGGTTTTACGTTTGATTTAACAGGTATTCG
2   K16   AX00000542   CTGTTTTCGCTATTTGTCACGGACCTCAGCTACTCATCACTGCACAAACACTTGA
2   K18   AX00000543   AAATTTCCTGATTTTGTCCATGCAGTTAAACCAGAACCACATAATGATATTCCTC
2   K20   AX00000544   TTACTACTTGCTTTCCTGCTTCTATACACGAACAAACAGCCTACAAAACGAATAC
2   K22   AX00000545   CACTCGCCTATCTCATTCCATATCTCGTTTCACCAATCTTCCAGTTAAAACTAGT
2   K24   AX00000546   ATTCTTGGGTGTACGCATTATCCACTTTTAGAGTCCTATATTAAAAAGGAACTAG
2   M02   AX00000547   ATGCCATCTTTAGCAAGGCGTATTGCACGGAATAATTGTATCGATGCCAATATAA
2   M04   AX00000548   AACCATATCGTAAGCGGTGCATTCTCTTACTCTGGTCAACGTTGTACAGCTATTA
2   M06   AX00000549   ATAGTTGGATATGGCCTCACTTTCGTATGGCAACATCAATTGTTTGGCGGTGCA
2   M08   AX00000550   TAAACCATACGTTTCATCTTCAGCGGCATTAGTTATCGCAAAAGATAAAGATAAA
2   M10   AX00000551   TGGCAACGTTAACGGCGCTTGCACGTATTTCAGGTAGTCGTATTTTACAATGGA
2   M12   AX00000552   ATTGTCAATCTTCGTACGCAAACAGGTATGGTATTCCAGCACCATAATCTATTCC
2   M14   AX00000553   CAAAATTGCCAAAGTATACTCCAAGATTATGGGAAGGCTGTAGATTACATAGACG
2   M16   AX00000554   TTATCGTCCAACAAGGTATTTCCTTACTTCGCTTCGATGGGCAACCTGTTGATTT
2   M18   AX00000555   TAGAGCTTTCCACTATTATGGATCAAAAAGGGGCAATTTGGCTTATGTATGTCAA
2   M20   AX00000556   ATGTAAGTGTAGTGGATCGTGTGCAGCCAGAAGTTATTAAGTTTTTAGGGCAGG
2   M22   AX00000557   TTCAAGCTGATGCAGCTTCAAAGAACTTATTCGATGAGTTCCGCACAATGCAAC
2   M24   AX00000558   ACCGTTACATGTGACATCGGTTCCCATTCTATTTGGATGGCGAGATGTTTCCGT
2   O02   AX00000559   ATTTTGGACGCCAGATTATGCGCAAGGTATTGGTGTAGCTGGATTCCACTTACA
2   O04   AX00000560   GGACGGATCGCACAGAAGTCATGTTTGGTGCACCGGGACATGCTTACGTATATT
2   O06   AX00000561   TGTATCAAAATTACGCGGATTACAATTGCTTGGAGAGCATTTGAATATTTCGCTA
2   O08   AX00000562   TAGCAGAACTGAAAACAGGTGAGAGTGGAAAAGTGATGTCACCGAAATTACCGC
2   O10   AX00000563   AATTTTGGAGCGGAAAAAACTGCCCTGCATTTATGATTCAACGCGGACAATGGG
2   O12   AX00000564   TTCTGTTCTTCAGCAGTTAACTGGTATTGAGCAAAGCTGGGGTATTTTAACGGG
2   O14   AX00000565   GGTCATCCGAAAGGTGTATTACATCGCCATCGTGAAATGGCTGAGCATAGTATG
2   O16   AX00000566   ACGGTCATATCCTTACTCTTATCTCAGAGGATGATATGTGGAACGTGTACGCTG
2   O18   AX00000567   TATTAGGATCGATTGACTCGTTGTTAACATCGGTCGTAATGGATAATGTGACGG
2   O20   AX00000568   ATTCCCGATGGCGGCGGCCATTTCTTCCTTCAAAAGCGCGTTGGTGAAAATATG
2   O22   AX00000569   AGGACAAGCATACATACAAGCTTTAGCGAAAATTGGAACAGAAGAAATTCGTGA
2   O24   AX00000570   TATTTGTGCAAAAGACTCTAGCGGTCCGTATCATTATGCACTGCGTAAACATTTA
2   B02   EMPTY        -
2   B04   AX00000571   CTCTTGGAGGACGCTGGTACTTCGGGCACTATGTAGAAAGTGAACCAGTTTGGT
2   B06   AX00000572   GTATTGTCGGTAACAGCGGTACATACATATGAAGCTGTCGTTCCGAAAGTAACA
2   B08   AX00000573   TGTGATGCTATCCGACTTTCAAACGGGAGAACCGCTCGCACTTTTAGAAGGATC
2   B10   AX00000574   AACTTACAGCCTGTAGGATCAGGTCCGTTTAAGTTTAAAGAGTATAAGTCTGATG
2   B12   AX00000575   GAAACTTTGTCACGCCGAATATGAGTCCAATTGATGTTGAGCGTATTCGCAAAA
2   B14   AX00000576   ACGGTCGCATCGATTTTCGCATTCGTATCGCCTTACGATCCTAGTAAAATGTCAA
2   B16   AX00000577   GCCGATAGCGAAGACCTATACACAAAACCGGCACATCCATACACACAAGCACTA
2   B18   AX00000578   TATCGGAATGGAATCACTATTCTACTTCTACGTAGCTGGATGTATCGCCATCAGC
2   B20   AX00000579   TTGTCGTTCTCCTGTTAGCAGGAATATTTGTTTACATTCAGTCCGTTGATACGAA
2   B22   AX00000580   GGCATTTCGCAAACACAAGACATAAAAAACTTACCGACAGGTGTGGATCCGTTA
2   B24   AX00000581   CAAAAAGGTGGTCACGTACTGGCGATTAACTCAAGCTTACTCATAACGAACAAT
2   D02   AX00000582   TTACTCATGTACATTACACTGGCACGTAAAAATGAAGTGTACAAATACCATTGCC
2   D04   AX00000583   TTTGATCGGCGCTTTATGGATGTGATAGGGAAGTTAAAAAAGTATAAGGAAGAA
2   D06   AX00000584   TATGTTTCTTCAGAAGTGCGTAGATGAGGAGCTGAGTGTTCCGATGCTTTTAGC
2   D08   AX00000585   CGTTCTGTAGAGTCACGGCAAGATAAGCGTCCTCTTTTATCTGATTTAAGAGAG
2   D10   AX00000586   ACACCACTCGCTATTCACCTCTACCTGTTGAAATCTTTTTACAGAAGGCTCAATC
2   D12   AX00000587   AATTATTTCCAATCACTTTCATAGGTTCCATAATAGGGGCATGGACCGTTCATTT
2   D14   AX00000588   ACGATCACGATTAACCAAATTTGTGAACGCGCGATGGTACACCGAACAACCTTT
2   D16   AX00000589   AATTGGTACAGCTATCTTTATTTCGAAAATGTCTTCAGGAACAACTAGCTATATG
2   D18   AX00000590   CCTTCTACCTATTTTGAGAACATAAACGAGCTGGCTGAACAATTGGCAGTAACAA
2   D20   AX00000591   AATGAAAAAACACTTATAGGAATTCAAGAACGAATGGATCAAGTTACATCTAGCA
2   D22   AX00000592   CTTCTACAGAATTGTTAATGGCTCCATTTGGGGCGAGTTGTGTATTAGCGTTTG
2   D24   AX00000593   TCGCATCTTGGTAAGGTTGATTTTGTTCCATATGGCCATCATTTTCCTCTTAGCC
2   F02   AX00000594   AGTCGAGAGAGTATAAGGGGGGCTGTCCATTTATTACTCTTTATATTCAAAGTCC
2   F04   AX00000595   CTTGGTCCAAACGGTAGTAAGTATATGGAGCAGTTGTCTGAGTTAGATGATGTA
2   F06   AX00000596   TGTTTGATGGCATGGTTGCTCGGAAACTTGATTCTGTTTCGGAAATTGGCGGAG
2   F08   AX00000597   AGTTCGTAGGAATAAGCATTGGCCTTTTAGTTAGTATGTACTGCGCCTGGATTTT
2   F10   AX00000598   TTTCGCTAGTGTATAAGGTGACGCAGATTGCGACTGTATGGGATATAAGTAGAT
2   F12   AX00000599   TCTTTTACGGCGTCGGCATTCACGGAGAAAAAGGTTACCGTAAAGAAGCACTAT
2   F14   AX00000600   ACTATCTGTGAGCTGTGGATTCAGCCTTTCTGATGAGACAAAAAATACGATTGCC
2   F16   AX00000601   AATCGGATCATTCCTTGACGGTTGTTCCATGATTATTATGGAACATTGCGGCGG
2   F18   AX00000602   CAAAAGAACTCTGTATTACTCAAATGGAGTATATGCTAATAGTTTTACTGAAAATG
2   F20   AX00000603   CGTTTCTTCTATTACGCAAGTTGGAATGGATGATCACGAAAAAGTGAAGGCGAT
2   F22   AX00000604   TTAGAGCCAGCTCATGGATATTTAATTATGCAAAAGGTGGAGGAATTAAGTAATC
2   F24   AX00000605   ATAGTGGCTGGGAGCATATAGCCGGTAATTGGTGGTCAGGTACGCACTATTTTA
2   H02   AX00000606   TTGGGACAAGCATTATTAACGTTTTTCAAAACACGGGAGATCAGTTAAGAAATAA
2   H04   AX00000607   GGAATTGGTGAGGTTACAGAAGATAGAAAGTTGAAAAATGAAGGGAAGTGGGAC
2   H06   AX00000608   TCTTGGGTTGGTAGTGCATTATTTGGTCATTGGGGTCCTGAATGGGGAGGCATT
2   H08   AX00000609   ATGGTGAAATTGATGCATATACAGCATCAGATTTGAAAAATAAGATCATGCCTAT
2   H10   AX00000610   AATTGTCTTTGGGCTATATGAAAATCGATTAGAAATTATGGTTGCTGATAATGGG
2   H12   AX00000611   TATCGCTATTCAAAAGGCGGGCCAATGCATGAGGATATTATACAAGTAGGCATG
2   H14   AX00000612   TGCCCTATATTTAGCGGAGAAAATTAAGACGCTAGGTGGTACACCTACTACGAT
2   H16   AX00000613   CTTGTATCGCTGAATTCTGCACAAGAGCTTTTCGAATACATCCATTTTGGAAAAG
2   H18   AX00000614   TTTCTCGATCAATGTAACTGAGATGTTCCGTAACCCTATCTTTTTTAAGGCGCTA
2   H20   AX00000615   GAGAAGGCAGTACTTTCACCGTATATATTCCCAACCTTCCAAATGGATTACATGA
2   H22   AX00000616   AAAATCGGGTGAAAAAGTGAATAGCGAAACTGCACATAAAGCAGATATCTTTTCA
2   H24   AX00000617   GTCCAAAATAAAAATGGGGATCAGTATGTGAAGAAATGGTTTCGTAAACATGAAA
2   J02   AX00000618   GCTATTATGGGTGCAAATATTGTCCGCGATTTATTCGCTTCTGTTCGTGATGTTG
2   J04   AX00000619   TACGTCCAAACGGGCACTTTTTAACGATCGGCCTTCTATCAGGAATACAAGTGA
2   J06   AX00000620   GAAAGCAAATTGATGATCAGTTTTTACGATTGCAAGAACCATCGCTTACAGCAAA
2   J08   AX00000621   ACGAATCATTCGAGGCGGCAACTGAAAAAGAAGCGAAAGCAAAAGGTGAATCTA
2   J10   AX00000622   ATTTAGGGGGAAGCTGGGCAGCAATTGAGTTTCCGGAAAATGTTCATGTGTTTA
2   J12   AX00000623   AAATTGAACGATTACCAAAGACGGCAGCTGGCGAGGTAACCGTTTATTTTGAAG
2   J14   AX00000624   AGCGACGGCGGAGCAGTTGTATTTATCGCTGAGATTTGCATTAGCGAAAACATT
2   J16   AX00000625   AACGAATTTTTAGACTATCCAGCAGCGACGAAGAACCATCACGAGTTCGTATCT
2   J18   AX00000626   AAATGATGCAGAGCTTGCTTATTGGGAAGAACAGGTGATACAAAGAGGCTTCCA
2   J20   AX00000627   GAGAATCAGTAGCGTAGGGCTTCCTTCATCTGGTTATGTAGACCGTCACTTCTT
2   J22   AX00000628   TGAGTTAGGAAATTTTCATCTCGCTAAAGAACATTACGAAAAGGCTGAAAGTTTT
2   J24   AX00000629   TACTTATGCTGCACGGGTTTGGTGGTTCTTCTGATGGATTTAGTGATATTTATCC
2   L02   AX00000630   TTTCTTTTTGAGGATTATGGCAGACCATGCTAAATTTATTGGTCATCTTCTTGATC
2   L04   AX00000631   GTACCTGGTTATATCGCAGCACAAATGATTGGGGCAATTATCGGGGCAGTTATC
2   L06   AX00000632   GGAACTGGTTGCTTCATGTTAATGAACACGGGTGAAAAAGCAGTAGCTTCTGAG
2   L08   AX00000633   GTTCTAATCCCACTTGTATACGCAATGGATTACGAAATGACAGCAAAACCAGTCG
2   L10   AX00000634   TATCGTCTCTCATGATGCAGACATACTTACGATTGATGTACTTCTTTCTTCACCT
2   L12   AX00000635   TTTACAATACCGACTCCTCCCTCCGCTTCCATAGTCGAATTGAGAAGTTAACGG
2   L14   AX00000636   AAATTGTTACATCTAAAGCTGGTGACATTACAAAAGACGAATTCTACGAGCAAAT
2   L16   AX00000637   CATGACACATACACTGTGTGAACGAAAACAAATATCTGCGAGCCGCCAACCCGG
2   L18   AX00000638   AGGGCTTCTGTTGTTCGATGCGCTGTTAGATCAATTTGAAAAAGCGCTTCCACA
2   L20   AX00000639   AGGGGCTTCTATTTCTGAGATTGCTAAGTTTGGAGTTATGCACGTATCAACGGC
2   L22   AX00000640   CTGTTCTCTTCTCAACTCCTTCTTCTGGCAAAGACATGCGTGGCAAGTTAAAAGA
2   L24   AX00000641   CCACTTCCACCTTCATTTAATTCCACGCTACGGTGAAAACGATGGTTTCGGTGC
2   N02   AX00000642   AAGGAACTGTCACAATTAATGGGAAAACAATTCGTGATGATATGACTGCGTACC
2   N04   AX00000643   TCTTTTTACGTTTATGATTCAGTTATACATAATCGCCATCGTAGCAGCAGCGCTT
2   N06   AX00000644   AGTACCGAGACTATATTGATTTAGCAAAAATGCTTCAGCTCGTACCAATAATCGG
2   N08   AX00000645   CTTATGGCAGAGCACGGCATTGAGAAGATGAGCCTTTCCATGATTGCGAAAGAG
2   N10   AX00000646   ACAGCTACCAACTAAATGAAGAAGAACTTGAAATTCAGCATGGCCTTTTCGTCGT
2   N12   AX00000647   AATTACCGGAGCATTTAGAAGGAGATCGAAACGTCGCCATTATGTTTGCAAACC
2   N14   AX00000648   CCGCTCAATTATTTTGTATTTCCAAATTTACGTCAACGCTATTATAGTTACAGATT
2   N16   AX00000649   TTCCAAGCAATCCGCGTTCTACGCCCATTAAGTAACGATACATATGTCATCTTAA
2   N18   AX00000650   TTATACGGGTTGTCTCATCAAGAAGTACTCCGCGGAGGATATACGTTTGTCGTA
2   N20   AX00000651   GAGCTCCATTTACGTTAGCGAGCTATATGATTGAAGGCGGTCCATCTCGTAACT
2   N22   AX00000652   TAACAGAGCGTTACCGTGCAATTGGTGGTATTTCTCCTTTAGCTACTATTACATT
2   N24   AX00000653   AATTCCAACGCAAATTACGCCGTTTCTATTTTCTGGGCTGTTCTCCCCAATTGGG
2   P02   AX00000654   AAAACAAATAGTGAAACGGCTCGTATGGCTTACAATGCGAAGAATACTTTCGGG
2   P04   AX00000655   ACGGTGGATTTAAGCAAATAGGCGCAAATATTCAGCCGCGTCTTGATAAGTTAA
2   P06   AX00000656   GGAAGATCCAATGGACTGGAAGCCGAAAACAATCCGCACATTAATTAATCGGTT
2   P08   AX00000657   AAATTGGTTCAATCCGATTCTTTGGTACGCCTATTTTTGTATGCGAGAAGATCAA
2   P10   AX00000658   TCGGTTATAAAGCAACAACAATGGATCAAGTAGCGAAGTTAGCGAATGTAGGAA
2   P12   AX00000659   TACCGATGACATACTCTGTATCTGGATTGAAAGCAGTCGTATCTAGCGGAGACT
2   P14   AX00000660   CTTTTTTGATAAAGAGGATCGTTTAAAATCGATTCCAGGTCAAAAGAAGAAAAAA
2   P16   AX00000661   CGATTTTGGCAGGAGGCGATGAGGTAGCAGCTGGAATTATTTCAGAGGCGAAA
2   P18   AX00000662   CGTCGGGGTATTTGTTTGAACACGATGGTTTTCGTTTACTTGTAGACTGTGGTA
2   P20   AX00000663   TCTCAACGAAAGGTCGTATGTTCAGTCACGGTACGTTACTATTTGACTCTGAAAT
2   P22   AX00000664   ATGTTTCAAAATAAGAAGTGGAAAAGAAATGAAACATTCAGCACTGTTAATAAAA
2   P24   AX00000665   CGATTTTGATGTTACCGAAATTTAGCCCGAAAGAAGTATTCCGTATTTGCCGCAC
2   B01   EMPTY        -
2   B03   AX00000666   TTCCTGATCAAGGTAATGGAGAAAAAATAATTAGCAGACTACAAGAGCAGGGCT
2   B05   AX00000667   TAGATGATTCGAAGTGGACGTTACTGGAACGGTCAGCGCCCGAATTATGCGCA
2   B07   AX00000668   CGCTATCTTCTCTCCCTAACCGGAGATTCCCATTTTGCTGAAGATCTCATGCAAG
2   B09   AX00000669   TTTCTCATACGGATGAAAAAATTATTGATATCGCATTTGAGCATGGCTTTCAATC
2   B11   AX00000670   CAAAACTGGGTTATAGAAAGAGAATTAGAAGAAGGGGCTATTTGGACGTTAATA
2   B13   AX00000671   GAAATCACAAAAACTATAGCTAGAGAAGGTATAGTTATGGGATTTAAGAAATTAA
2   B15   AX00000672   AACCGTTATTACATGCGATGCGCTGGCTTAAAAATATTGCTGGTGGAAAGTACG
2   B17   AX00000673   TTTGCGAGAATCCGAACTACGTATTTTCAAAAGAAGAAATATACGAGAAAGTTTG
2   B19   AX00000674   TTGCAGATTTCTCAAATTATACGACGTTCTTTCCAGGGCTTATTATTTTTATAACA
2   B21   AX00000675   GTTTGCCATTGGCTGCAACCTGTAGTAGATACGATTGTGTTTCCAGAGTATTACT
2   B23   AX00000676   TCAACGCAAAGTACACAAAGCTGGATAAAAGATCACGTTATCGGTTTTTGGGAA
2   D01   AX00000677   GGCAGAAGACATGGCTCAAATTTCCCAAAGATCATCTGACCGAACTGATAGGGT
2   D03   AX00000678   TTCCAAATGGAACGATCAAAGCAACGGTGTTACTGGAAACGATTCACGCTTCGT
2   D05   AX00000679   ATTAAATTACGGTATGTTTGAACTAGCACGTGGCTATAAAGAGCGCGGCATGGC
2   D07   AX00000680   GCTCCTGGACCAAGAATTTGGGATATCGCTTATACACTGTATACTTGTGTGCCT
2   D09   AX00000681   GCAAGCATGGTTCTAGTTTTTTAGGTAGAAAAGAAGGAACGAAAGAGTTAACTC
2   D11   AX00000682   AGTCGTTTCTTTTCTTTTGTAAATAAGCATGAGAAAGTACGAAAGGCAATGGGAT
2   D13   AX00000683   GCAAGATGGCAATATGCTCGTTGTAAATAAGGTGAGTTATCATGTGGGGGACTT
2   D15   AX00000684   TTACAGATTATAATATCCCGCACTTCATCGATGAAAAACGCCCGATGTCACATCA
2   D17   AX00000685   TTACTGCAAGGATGGCGTGAATTCGCACGCCAACAGTCTCTTTCTGATTTAATTT
2   D19   AX00000686   CGCCCCTCCTCTTCTATAGGAAAAGTGGAATACAAATTCGATCAATTAAAAGTAG
2   D21   AX00000687   ATGTATTTGCGATTAGGCCTATTAGTTATTCACGCGCTTTCGCGGGGGCCGGCT
2   D23   AX00000688   TGGAAAAAACTATCGTGAGCATGCGATAGAAATGGGCGGAGTAGAGTCAATTCC
2   F01   AX00000689   TCACTGAAGTTCGCGGTAAAGGTTTATTCATCGGTATCGAATTAAACGAGCCAG
2   F03   AX00000690   ATGTGGTATGGTTTAAAAATGATAGCTGGTATTTTAGTTATCGGTGGAATGGAAA
2   F05   AX00000691   TTAGAAGTGCGCGTTCCATTTGCAGATCACCGACTTGTCGAATATGCGTGGAAT
2   F07   AX00000692   TGGTGCGATGCAAATCAATCAAAACCCATCTACAATTAACTACGAACCGAGCCG
2   F09   AX00000693   AAAGTAAAAACACAAGTACAAGATGATCAAGTACGTGTTACAGCAAAAAGCCGC
2   F11   AX00000694   AATGGAAGATGATGCTGCAGTGATTTATGCATATATGGAAGAACGAGGCGGAGC
2   F13   AX00000695   ACGCGATTGGAATGAATTTATTTTTAACGCCAGCGAAAGTGTACGCGAGTGGCT
2   F15   AX00000696   CGAGCAACAAGATCTCGTATATAGAGCAAAAAATGCTTTGCAATCCGCTTACGC
2   F17   AX00000697   CGTAAACTTTAATGGCGCTTACGTACATCACCCTCTTGATTCAAAGTGGGGTAC
2   F19   AX00000698   TTACAGTCTTTAATGACAGTTCGGGGGAATCAAAGAGTGACTAGCCAAAATCCA
2   F21   AX00000699   GAGCTACGTAATCGGCTCTATGACTGGCGGTACATACGATTTTAACCAAGCGTC
2   F23   AX00000700   ATTGAGAATGGTACAAGTTTATGGACACAACATGCGGGTAGATCTTATTTTTTAC
2   H01   AX00000701   TCTATCTTTCGAATTAGGAGCGGACGGAAGTGGCGGTAAGCATCTTTATCAAGA
2   H03   AX00000702   ACAGAAGAAAACGGACCTCGAATTGGTGTATGGATTGGTTCTGGTATTGGCGGT
2   H05   AX00000703   AAATGGATTGCACTCTTATCCGAAATTGCTTGGCTATGCGCTTGGATTTCATATT
2   H07   AX00000704   AATTACATACAACGAAAAACACAGCAGAAATTCGCTATTGGTTCACAGAGTGGG
2   H09   AX00000705   AAGTAGAGGAACCTATCGATAAGAAAGAACGTATTTATAAAACATATTCATTCAA
2   H11   AX00000706   GGTACCATCGTTCGTATTCGCCGCATTACTACAATATTTCGTAGGGGTAAAACTT
2   H13   AX00000707   ACAGATGATCTTGGCCGCGATTTATGGACAAGAACATGGGAAGGTACGCGCGT
2   H15   AX00000708   TTCCGAATCCTCCTGGACGCATTAAAAATGGTGAAATCGTATTTGAAGGTCGTG
2   H17   AX00000709   TTATCAGCGATTCCACTTCCAGATCCAGATTATGAGCGTAATCGTAAACGTATCG
2   H19   AX00000710   CATTATCAGACGATGCTGTATCTGGGGTTGGTGCAGCGAATCAATATCTCCATA
2   H21   AX00000711   TAAGATGATTCGTGACTATCCAGGGATTTTACGTCGTCCAATTATGATTGACGAG
2   H23   AX00000712   CATGAAGACAGACTTGCAACCTTTTTTCATAACAATCCAAGTTTCACTGCAGGCA
2   J01   AX00000713   AGCTCTTTTGGGAAATGATGGACGAAGCTCGTGATCATGACGATTTCTTTATTGA
2   J03   AX00000714   GATTACGAAGAACGGATTTTGCGCAATCATAAGCATCAAGAGCTGTTATTTCGTT
2   J05   AX00000715   GCACTCTGCATACTGGATGAAATTCTCCTCAATTATGGCTTTCTCCTTACAATCT
2   J07   AX00000716   ATTCATAAGAAAGTACAAGAGGGACATGCGGTTACGCCAGACATGTTAACGGAG
2   J09   AX00000717   AAGGCAGCGGAGTTGCAGGGTCGAAAAGCAGGTTCGAAGTTTTTGCGAAAACT
2   J11   AX00000718   CGGTCATCCTATGTTAAGAGCACGCCATCTCCCGTTTGAGATTACTCCAAAACG
2   J13   AX00000719   GAAACACCGAACTTCTCATTAAAGGAAGCTGGCTCTGCACTTCGTATTCGTCAT
2   J15   AX00000720   TAAAGGGGTTAAGTGCGCGTAATCACGTACTTGTAGACTCAGACAATTTATCATT
2   J17   AX00000721   AAATCGTGGAAGAGCGTGATTATGTCACGCAAAAGAAAGATAGTGGTTATCGTT
2   J19   AX00000722   GGACCATTTAACGATGGTTCATCAAGATGTGAAATCAATTCAGTATCGCGTGGC
2   J21   AX00000723   GAGAAGCTAGGGTATAACTGGAGTAGCGGTCTACCGGTTCACCCTGATCAACG
2   J23   AX00000724   AAATATAGAAGGCGATTTTATTGAAACTGGTGTATGGCGCGTAGGATCATGCAT
2   L01   AX00000725   GTTGGATCTCAGTTTGGTACAGCAATTTCTCAATTAGATGCTGATACTTTCGTAA
2   L03   AX00000726   CTAAAATTGATGCTGTTTCGATGCCTTATCATCTTGCAATGGATTCTAACGGGAA
2   L05   AX00000727   AAAGCATATAAAAAAGGAATGGAAAGAAGTTCTTGATATCGGTTGCTCGAGCGG
2   L07   AX00000728   GAGTTTCAAAAGGCAGGTTATTTAATTGGTATCCCTAATCAAGCAAATTTATGGT
2   L09   AX00000729   TGATTATTACAGGTAAAGAGCATATGGGGGATGTTGTTAGCTTTTTAGGGAGCG
2   L11   AX00000730   AGATTGGTTACATGTAACAGATCATTGTAGTGCGATTGACGTTGTTCTGCATAAG
2   L13   AX00000731   GTTGCTTCACAATTAGTTGGGGCGAAGTTAGTTTATATTAGTACGGATTATGTAT
2   L15   AX00000732   AGCTTCATTAGAAGCGAGCGTGAAATATTTAGCTAACGATTTAGGCCAACACGG
2   L17   AX00000733   ATCGCCCTCATTATATTCCGAAAGTAAGGTGCAGAATAAAAACAGCTACAATCTC
2   L19   AX00000734   GCTGTTATTGGTGTACAGGTGTATGGGTTAGTGCTTTTTTATTAGTTTTATATAA
2   L21   AX00000735   ACTACTATTACCTAGCGTAAGTCCAAACCCAAATATTACTGTTCCTGTAATAAATG
2   L23   AX00000736   TCGCACACATTCTGTAAGCCGTTCGTTACTTGATCAGCTTACCATTCATAAAATC
2   N01   AX00000737   ATGATCCACACTACGCATTAGTTCCGCCACATATTACATTGAAAACACCCTTTGA
2   N03   AX00000738   TCGTTTACTTACCGGTAAATTACACACCACTGCACAAACATACAGTTGTCATTGC
2   N05   AX00000739   CATTTCATTCGCAGCAGTTTTTGTAAAGATGTCCTCAGCACCATCTTCCATATTA
2   N07   AX00000740   ATACGAGACATAAAACAAATTTCAAATACGAAAAATCCAATAGCAGCTTATGCAT
2   N09   AX00000741   GCGTCTTGTTTGAACATACAACCTAATCCACCTAAAATTTCAATTGCTCCTTCTG
2   N11   AX00000742   AGCGTTTGCAAAGCGAATGTATTGGAGATCCATTCGCGTTATATCGAAAACTTCG
2   N13   AX00000743   ACAGCGATGGACGATGGAGAAATAATGGCAGTTCGTCACAATTATTATCCGCTC
2   N15   AX00000744   TTAGCACAACATCCGCATTTGTACTGGCAGGAGCTGGCGTAAAGGTTGCAAAAC
2   N17   AX00000745   GAGCAATTTACTGTCATCGCAGAAGTAAAGCGAGCATCACCATCAAAAGGAGAT
2   N19   AX00000746   TGAATATTCCGTCTATAAAGTCGCTCGGAGTAACTTCAGAGAGTGATATGAAAAA
2   N21   AX00000747   TCAAGAAGCGCACTCTATTTCAGCAGGACTTGATTACCCAGGTGTTGGTCCAGA
2   N23   AX00000748   TCGAGAACTGTATGGAAGCAGGTGTAGACGGCATCATCGTTCCAGACTTACCGT
2   P01   AX00000749   TGGAATCGTTTTACTCTCGCCAACGTTTCAATTAGGGATAAGTGAAACTGTGCAC
2   P03   AX00000750   TATAAAACGAGCAATAGAAGAAAAAGCAATTATTTATGCGTTTGGTGAAAGATGG
2   P05   AX00000751   GGCGTTATCATTGTAATTGGATTTCTATTAGGCTATTTAGAATCTCTCACACGAA
2   P07   AX00000752   GGGTTACCGTATGTCATTAGTGGTGCTATCGCTTCAACGGAAAAGTTAATCGCG
2   P09   AX00000753   TTCGGTAAGAAAGTAGAAGTATTGTTCTTCTTCCAAGACCATGTCGTGATCGGA
2   P11   AX00000754   GTATATATATTTAAAAATTGACGATTATCCAGACGGCATTTACCATTACGACGCC
2   P13   AX00000755   TTATAGCCTCGGTCATCGAGATGCTTGCGTATATGAAACATCAAATGGATGTGC
2   P15   AX00000756   ATCGTGAAGAATGCTGGGAGTCCGCATGGCATCGGCTACATGAAACGACTTTAC
2   P17   AX00000757   CAGTTGCAATCGATAACGAACGTATGGAAAACCGCCCAATGATGTACATCGCTT
2   P19   AX00000758   TGACGCCGAAAAGTTTATTACGTCACCCACTTACGCTTTCAACTGCTAATCAGTT
2   P21   AX00000759   CCAGACAAACCATCATTTCAATTGAAAAAGGAAAATACGATCCATCACTTCCGTT
2   P23   AX00000760   TAATGACGCATTCTGCACCGCCAGCTATAACGTATCCATTGCTTGGGATGATGA
3   A01   EMPTY        -
3   A03   AX00000761   ATTCTTATTTATTCGTAAAGACGTGCAAGGTGGGACGTTAACGAAAAGAGGCTT
3   A05   AX00000762   TATAATATGTAACAAACGAGAACAAGTGCCACCTATGTTAGTATGGGAGGGTCA
3   A07   AX00000763   CAGGTACAGGGATATTTAGCCGCCAGCTGCTTGACAGTGGTTTACATGTTATTG
3   A09   AX00000764   GATGTTACACATGATGAGTTTTTGCAAGAGTTTGTTGAGTGGGTCGATTCTAAAG
3   A11   AX00000765   TACGAGAGGTGTGCAAAAGTATCCTGAAATTTTACAAGCGATGAATACGAAAAG
3   A13   AX00000766   CTTCAAAAGCGAGCGGTGGTGATCCAACGGTGATGGGATATCAATTTAAGAGCG
3   A15   AX00000767   ACGATTTAGCTGCTTGGTTCTGGGATGAAAAAGGTATTTCAGCAGGTAAATCTG
3   A17   AX00000768   GGTGAAGACTTTGGTAAGCACGTTAAAGTGAAATTCCTTTGGAACTGGGATAAA
3   A19   AX00000769   CTTACATTAGTTCTATAGAACGAAATTTACAAAAGAACCCTTCCATTCAGTTTCTT
3   A21   AX00000770   ACAGTTGAAAGTAGTACACGATTCCAAATCGCTGATGCGGCGTTCTCATTCGAT
3   A23   AX00000771   TACCATGGGGAAGAAAGTTTTCGGACTTTTTCACATTATAAAAGCATTTTAGCCC
3   C01   AX00000772   TAACGATTTGCCACCATATAAGCGTCATATGAACCTAGTGTTCCAACATTATGCG
3   C03   AX00000773   CAAATATCGTTCCATTCTTTTATTATTGGCAACGATCCCGTTTTGGATTAACTTCC
3   C05   AX00000774   GATTTAGGAGCAACGCCGTGGCAAACGTTTCGTTATGTAACGTTCCCAGCAATT
3   C07   AX00000775   CTGCGTTTGATCCAGAGAATAAATATTCTTTAGTATACACTTGGGGTGTAACTGG
3   C09   AX00000776   CCAAAGCTACCGGGAGTATTAGGTGGTGATGGCTTTCAAACGGAAGGGGACTA
3   C11   AX00000777   GGTATACGATGGATGCGGAAGAAGAGGAACTTGTAAAGGTCATTCAAGTAGAGG
3   C13   AX00000778   AAACTTCCAACCAAACTGCTTCATTCCTGGTCAACAACCTACTGAAAATGTTGTA
3   C15   AX00000779   CGTATCAAGACTCTTGTCATTTACGCAATGTCATGCGAACATCTTCAGAACCTCG
3   C17   AX00000780   TGTAGATACATCCAATATGGGGCGTTTAACGTATAGTTATGATGCCACTCCAAAC
3   C19   AX00000781   ATATACAAGGCGTTATTATCGCAAGTACAGATATAGAAAGAATCGGTCAATTTCA
3   C21   AX00000782   AGGATATGTAGCCAGCTATGATAGTGATGAAGTGTGCGTTATGGATATGAAGAA
3   C23   AX00000783   CTCTTACAGTAAAAGAGTTTGATTTACTCTATTTTCTTTGCCAACATACGGGACA
3   E01   AX00000784   CACCACTTAGTTATATAAAAGGGTATAGCGAGGCTATTTTAGATGGTGTAGCGA
3   E03   AX00000785   CATTTTACTTGAACTCATGAATCATGTTTCAGAGATGATTGCTGAAACGATTGGT
3   E05   AX00000786   CGCCATCTGGTTCTTGTGCGACAATGTTTCATGAGTATCCGCATGTTTTTAAAGA
3   E07   AX00000787   TGGTGCGGTATTAACACCACTTTTAGGTGGATATGATGATTACAAAGAGCTTCC
3   E09   AX00000788   TTTACCTACTGTATACTTTGCTATTATTCCACGTGAAACACTTGTGCCTCGTATTA
3   E11   AX00000789   GTATAGTTGGGAGTGGCGTTATATTCATTTTGTTATACTGCATGCAAAAGATATA
3   E13   AX00000790   TCATAACTTAATTCCAGTTACAATCGGTAACATTATTGGTGGGTCAGTATTTGTC
3   E15   AX00000791   AAACTGCAGCATTCTTAATTGTAGGTTGGGTTGGTGTGAAACTAGCAGTTTATAC
3   E17   AX00000792   TTCCTCTATTGATGAGTGCTTTCGAAGTATTTTCAGCATTTGGGACCGTTGGTCT
3   E19   AX00000793   CTCGTTTCGAGTTTTATTTCTACCATCCTTGGAACGAAACTCCCAGGTAAAAATA
3   E21   AX00000794   CAATTCACTGCTCAGTTCAATAATCAATATACAGATTACGTGAAGCAATTAACTG
3   E23   AX00000795   CTTATTCAAATGCTAATGGATATCGGCTTCTCTTCTGTTGACCAAGGTAATGTGT
3   G01   AX00000796   AGCGCTCAATGAAACAATTAAAACAGAAGAATATTCTGCTTGGATGGGCAGCGT
3   G03   AX00000797   AAGAAGGTAGAATTATTAGCATTTCTTCTATTATTGGTCAAGCGGGTGGATTTGG
3   G05   AX00000798   ACTCGTTAAGGGTGAACTCGTTATTCGCGGACAAAAGGTAGACCTTGCAAATAT
3   G07   AX00000799   CGTTAGAAAATGATATGATATGTGATGTGCTTGTAGTCGGAAGTGGCGAAGCAG
3   G09   AX00000800   ACTTTATTTTCCAACTTGGCAAGAAGCTTATTTTCACGGTTTCTTTGCGGCTGTT
3   G11   AX00000801   TCCGCTTCACAATTGGAGTGATGAAGTAGATCCTGCCATTATGGCTGGCGATGA
3   G13   AX00000802   TGATAATATGGCAACTTATACGCATTCAGGCTCAAAACCAGCGAAATTAGCAGG
3   G15   AX00000803   GCTTGTTTCGCAGTCGATGGGCATTCCGTTTTATAAAACATTCTTTAGAGTAACA
3   G17   AX00000804   CAGAAGAAGCCCGTAAGCCAATGGGATTATTAAAAATTGATCATGTAAGGGCAC
3   G19   AX00000805   TATACGATCAGTGGGAAACGATGGAAAATCAAAATGGGAAATGGCGTTTTACGT
3   G21   AX00000806   TAGAAAATAAAGGCGTCAAACTAATAGAGACGAGAGGAACTTGGCCAAAGCAAA
3   G23   AX00000807   TGCGAATGCGAAGATAAAAGATCCGTCGTTCTTTGCGAACTTAAAGCAATTAAAT
3   I01   AX00000808   GAAGATTCGTTTGGTATGCGGACAGGTGGTTATATATTAACAATTGCAACACAAG
3   I03   AX00000809   AATTATTCAATCTGAGGCGAATCTACATAACATTGTATTCCATTTACATTTGCCAG
3   I05   AX00000810   AAGTAACGGGTTAAATCCAACTGAGTTTGCTGTATTAGAACTGCTATATCATAAA
3   I07   AX00000811   CACAAATTTGCGCACTGCAATTTTGGAAACGTGCAAGAGATAATAGACAAGAGG
3   I09   AX00000812   ATGTAAAACCACGCCGTGATAAATGGAGTATTATTCAAATTTTGCATCACTTGCA
3   I11   AX00000813   ACTTGCTATTATCTACAGTCTCATATACGGATTTAGTTGGATACCTTTCTTCCTTT
3   I13   AX00000814   CACGTCATATTGTAACGGGTGTATGTGAAACTGATTTTAGTGGTTATCCAGATTG
3   I15   AX00000815   AATAAAAGAGTAATGGTCAGCAAGGAATTTACATTTGATGCAGCGCACCATTTAC
3   I17   AX00000816   GGACAAAAGACGATGTTTATCCGTACAGCTGGCTGTGATTATAGCTGTGCTTGG
3   I19   AX00000817   GTTACATTGAGGTATGGGGGAAATTCACACCACGTGGAGGGATTTCAATTGATC
3   I21   AX00000818   GCAAAATTGATTGTAACGAGTGATCAAAGGTGTGCTGTACAGTCAGCAGCTGAA
3   I23   AX00000819   GGCAGTTGGAGTTATTGTCGCTTATCACGGTAGTGAAGCAACAATGCTTGATGC
3   K01   AX00000820   TAACTGTACAAGTTCAACATACGTATCAGTACATAGAAGGAATGATTGTATACTT
3   K03   AX00000821   AAAGGCGTATCTGCAAGCGGCAATCGTAACTGGGGAGACATGTTCGGTGCAAG
3   K05   AX00000822   AAATAACCAACATCCATTGAAGGACATTGGAACTGTGAAGATGTCCAACTTGTGT
3   K07   AX00000823   TTACTTATTCTATAGTGGATTCTTCTATCCACTTTACTTAGCTGGTCAAGGAAAAC
3   K09   AX00000824   AATACGATTCAGCGTACATTTCAAGAGCTAGAACGAGATGGAGTGGTTGTAACG
3   K11   AX00000825   TGTTGGAGATAACGGGAGCGGGAAAACGACGTTATTGAAAATGATTGCAGGCTT
3   K13   AX00000826   GGTCTTATTTCAATGACAGAGGGCGATATTACAATTTGTGGCCATAGTATCCGC
3   K15   AX00000827   CTTCTTACAAGGAGCAATTAATATGGTATTAATGATGTTTGCAAAAGGCGTAGCG
3   K17   AX00000828   TATTTAACAGTTTTTTTGACAAGCCAGGACGTTTAACGTGGGGATTAATTGTGTT
3   K19   AX00000829   CAACACGTATGCAACAGTTTATTCAGTCCTATCCATCTGCAAGTTTTTGTTACCG
3   K21   AX00000830   GAAGAACATTAGCGTACGGGAATGAATGTCCATACTGTATGGCAAAGGGAAGAC
3   K23   AX00000831   AAATGTAATGCAGTAGTGATTGTAGGATTAACGACAAATCACTGTGTGGAGACT
3   M01   AX00000832   GGCGACAGAAGGGATACTTCGTTTGCGTCATTTCCAAGGAGATGGTAGATGGA
3   M03   AX00000833   CACAACTGTAACTCGGGCGTTTTCCGGGAAATATGCACGCGGTATTCGTAATGA
3   M05   AX00000834   CGCTTGAAGGTATCGCCTACGATGATACGAAGTATAAAGTAAAAGCACTTGCTG
3   M07   AX00000835   TATTTGAAGAAGGTATTCTTGATTCTTTCGCTGTAGTATCTTTATTAGTTGAATTC
3   M09   AX00000836   CTGGGAATTCGTTTTATTCTTCCCTGCGATTTCAAGTGGACCTATCGATCGTTAT
3   M11   AX00000837   ATGGGCTGTAGAAGACTTCAACTTACAAACAGGGCAAGTATTCTTAAACCAAGC
3   M13   AX00000838   GGCGTGATGGACGGTGTTGATTATGTAATAGGTTTACATGTTATGTCAGGACTT
3   M15   AX00000839   TATTGATTTAACTGGAAAAAAAGCGGCAGTATTCGGATCATGTGATTCAGCTTAT
3   M17   AX00000840   TTGGTGAGTGGAGTACTGAGTCGTTTGTAATTAAAAAGTATGTTGTCGATGCGG
3   M19   AX00000841   GTTTCCCGCGAAAACAGGAATATGCAATGCGAATTCCGTTAGAAAAAGAACTGT
3   M21   AX00000842   ACAAGTATATGGATTCCAGTTAGTACGGGATTAACAGGAATTTTGATGGCTACG
3   M23   AX00000843   AGCGCTTTGGCCAGGCTTTTCTCGTTCTGGTTCTACAATAAGTGGTGGTTTATT
3   O01   AX00000844   ATGGCTGGCGTGTTATCGTATTAACAGCTGATTGGTGTGGCGATGCTCTTTTAT
3   O03   AX00000845   TTGAATCGTACGAATAAAGAAATGGTATCACGTGTAGCGAATGAGTTAAATGTGT
3   O05   AX00000846   GCTGGTCTTGGAGATCCGAAGCAACTTGGAAGAATCGGTTTAAAATCAATTTCA
3   O07   AX00000847   CCATTCGCAACGAAGGTACATATTAGTTGGGTAGATGCTTTCTTTACGGCAACG
3   O09   AX00000848   TTTGGTCTTGTTTCTGTACTACTGGGTATTTACGCTTATAATCGCGGAGCTACTG
3   O11   AX00000849   TATTGTTGTTGAGACGATCCGACAAAATAAATTATCTAATGGATACATTCGCCTA
3   O13   AX00000850   TGAAAGTATTTCAGTAGGTCATACGGAATCATCGGACATATCGCGGATGACGAT
3   O15   AX00000851   TATGTATGAAGGTGGACTTGAAAATATGAGATATTCAGTTTCAGATACAGCGCAG
3   O17   AX00000852   ATCCAAAGAATTTTAGGATTGGAATGTGAATTGGCGGATTATCGCATACAATCTA
3   O19   AX00000853   GAAAAGGGACCTTCCTTATATGAGCCTATTCACGGATCGGCACCGGATATTGCC
3   O21   AX00000854   TTGGAATATTACCGATCGCATTGCGAAGCAGCAACTAGATACGCTTCGGGAAAA
3   O23   AX00000855   ATTTAAAGAGAATTGAAAGAACTGGGTTTGGAAAGTTTTTATTTGATGAGTGGCG
3   A02   EMPTY        -
3   A04   AX00000856   CTTGGATTGGCAGATGCGATTGTTGATATTGTTGAAACAGGAAAAACATTACAAG
3   A06   AX00000857   CTGCTTTAGCATACGGGACGGAATCGATTCCAAAAGTAGATAAAATAGTTGGAC
3   A08   AX00000858   GTTGGAATTGATGCGAAAAATGGTTTCGTAGCAACGAGAGGTTGGCTTGATGTG
3   A10   AX00000859   GGCGAAATTTTGTTAACGAGTATGGATGCAGATGGAACGAAAAACGGATATGAC
3   A12   AX00000860   ATGATTTTACAAAGGCAATTGAAGAGGCGAAAGAACGATGGAGTAAAAGAGGTG
3   A14   AX00000861   GATGAAGAAAACAGCGTATATTGTAAATGCTTCACGTGGACCAATTATGCACGA
3   A16   AX00000862   CGTGTTGCTCGTTTATTACGTGTTGATTCACAAATGGGAAAAGAGCTTGACTCG
3   A18   AX00000863   TGGAATCGGGATGTAATGTATCCTGCACTTGGATATGATCGTTACTTTAATTTAA
3   A20   AX00000864   ATGCAGTAGTGTTATACTTTTTGCTTCACCGAGTGTGTCGGTAGCTCAATATGAG
3   A22   AX00000865   ATACGCTACACAGAGTCAGATACACCATTAACTCTTGAGACATACGTGCGAGCT
3   A24   AX00000866   ATTCAAAAAGTGCGGGAACGATTTCCTTCATTGAATATTATAGAAAAACAGCCAA
3   C02   AX00000867   TGAAGCAATGGCTTCGACAAAAACATGCCCGCACGGAAAAGAAGATCATGTTAT
3   C04   AX00000868   TGGGCATCATAGTTTTGTAATTTGGTTTACTGGTTTATCAGCTTCGGGTAAATCT
3   C06   AX00000869   GATATTCCGTGATTTTGGATATCGCGAAAAACGTCATTTAGCTCGTTTGAAATTT
3   C08   AX00000870   TAGCGAAAGGTGTAGAGACTTTAGCAGTATATATGGGGGTTAGCAATTTACCCT
3   C10   AX00000871   GGCATTGAACAGGAAAATAAGAATGAAGTGACGTTACTTCTCGTTGCAAGAGGG
3   C12   AX00000872   CGTTGGTATCAAAGAGAATATGAAAAAAGTGATATTAATGGTGCTTTTTTAGTTG
3   C14   AX00000873   AAAGTATTGGTGCCAAATAGCAAGTTATATCCTTGGATTGGTCGTATGGGAGTT
3   C16   AX00000874   TCATTCGTTGTATTATTAGCGACACTTGGTACAGTAGGTATTCCAGCTGAAGGC
3   C18   AX00000875   ACATTAGTGCAATATTATATCGATGTGGCGAAAGAATATGAAATAGACGACCGTG
3   C20   AX00000876   GTATTAGATCTTTTCTCATGCTGTGTGCAAGGATTAATTCCGTATGGTGCACAAA
3   C22   AX00000877   GTTGTGTACTGGAGCTATAAATCATTTGTGCGAGCACAATCATTTTTTGGAAAGT
3   C24   AX00000878   ATTAATGGCACGTGAAAATATGGCACATGCAAATCGTCGTATGAATACTGCGAT
3   E02   AX00000879   TTATTGTCGGACGTGTGCTCTTGCCAGGTCATGAGGAGACAGGGTTTAACCGTA
3   E04   AX00000880   GCGTATACAAGGGTTAAATACGTTTCTATTTGAAGTGGAGCGAGGGAATTTTCC
3   E06   AX00000881   TTATTCAAGAATGGCCAGAAGCAAAAATTGTAGTTGTAACGAGCTTTTTAGATGA
3   E08   AX00000882   AGGGGATTATGTGAACGCATTACAAGCGCTTTGTGAACAATATAATGTTGAAACA
3   E10   AX00000883   TCGCTTATGAAATGGGCGTAAGTTCTTTCTTACCAGAAACAATCCGTTCTAGCAG
3   E12   AX00000884   AAACAAGCAGAAGTTTTACTCTTTCAAAAAGGTAGTTTGTTGACAAATCAGTCTA
3   E14   AX00000885   TTCTGTAGAAGCATTATTGCAAGATTTATCCCCCCGAACAGGTCGATCCATTCTA
3   E16   AX00000886   TCGATAAAGCTGAGAAACAAGAAATAACAGGTAGCTTCGGTGAACCTGAATATG
3   E18   AX00000887   ACCGTTAGTTACGTATTATTATTAGATTTGTTGCCCAATCATATATTTATTGCCCT
3   E20   AX00000888   AATAATTTCTTAAATTATGGTAAAGCAGAGAATTATACAGAAGGGGACTGGAACC
3   E22   AX00000889   ACTGAAGCAGAGTTTTATTTCTGTGGTCCAGTACCATTTATGAAACATATAAATG
3   E24   AX00000890   ACAACCGTCTCTCCGAAAGAACGTCTTCATCGCTTACAAGAATGGTTCACACTAT
3   G02   AX00000891   AGGTGGAGTCGTGTTATCCGTTGAAGTAGACGGCCAAATTATTTATACGATGGC
3   G04   AX00000892   TGCTGTAGCAACTTCGATGTTTATCGTATTTCTATCAGCAATTGTAAGTTCTGCA
3   G06   AX00000893   GGAATCATTACGATGGCTCTTATGGCTAATAACTATCATACTTCGAGCGACATCC
3   G08   AX00000894   ACAAAGCGTTTATTACTCCTATTGAACGTGAGGACATCCTACAGCTTGCAATGAG
3   G10   AX00000895   TCAAATTGTAAATGGCCCGAGCACCGGTGCAAAGGATTCATGGTTTGTTGGATA
3   G12   AX00000896   TTTCTATCCACAATGAAAATAACGGTAATTATGAAGAAGAATTACCTTACGAACC
3   G14   AX00000897   TATCCAGAAATGAGAGATAAGACGTTACAGTTTCTAGAGCAGGAGAAATGGATT
3   G16   AX00000898   AGCTTATGAAAAGAAAACAGGTGCTTCTATTTCTGAGAGCACTCTTGTTCAAACA
3   G18   AX00000899   ACAATCTTCGAAACGTGATGGCTTATTATTCGTATTAGCTGTAAATTCTGGCTTA
3   G20   AX00000900   TGTTAACGAGTTAATCCAAAGCTACGGAGTTAAAAATTTAATTCGCGTTGGAACT
3   G22   AX00000901   CCAATCGATAGTGTACTTACAAAAAAAATAGGGGAGTATGAAGTTTCTCTTTTAT
3   G24   AX00000902   CTTCCTCCTACCGTACTGTGTTACAGGAGTTTTTAGCTGAGGCTGATCGATTTG
3   I02   AX00000903   GAAGAAGGGCATGATGCATGTTTTGTTTTGTTAAATAGCCAGCCATTTCGAAAG
3   I04   AX00000904   TCGTTTGGGTGCCACGATCTGGAAGGTTAGAAATTTTGCAGAGTACACTTCATC
3   I06   AX00000905   TAAAGCCTGGGCAAAAAGTGAAGCTAGAGGATTTAGTATACGGACTTATGCTTA
3   I08   AX00000906   TTATGCCGATAGTAAAAAGGTTGTTTCCAGAAATACCGAAGGATCATCCGTCAAT
3   I10   AX00000907   TCCGACGTATGAATCGTTCGTTGAAGGAGGAAAAGAAGGGATTCAAATTGCAAT
3   I12   AX00000908   TTTGGGGTACGTGGTGTAAACCTTGTGAGAAAGAAATGCCTTATATGAATGAAC
3   I14   AX00000909   GATATGCGCTATGAGGGGAGTGCTCGGAGATCTCTCACGCAAACAAAAACGATA
3   I16   AX00000910   ATATCACCGCTTATTCCATCTTTAAAAAGTAATTGGTTACATATTCACGTGACGA
3   I18   AX00000911   TTACGCCGTTCTGTACCAACAACATTCTTTACACAAGATACAACGACAAAAGATG
3   I20   AX00000912   TTGCGAACGTATCACATGAACTTCGTACACCGATGGTCATGCTTCAAGGGTATA
3   I22   AX00000913   AGAAGAAGCCCCGCCACTAGAACGCTTTATTTTGCCAGGTGGTAGCGAGGCGG
3   I24   AX00000914   CATCTAGAACTTCATCAAGGAAGATGGACGATGGCGAAAAAGAATGCGATGAAC
3   K02   AX00000915   GAAATCTATGTGCTATCAGTTTCCGGGGCTTATGCGAGAAGGAACCGTGCTTGT
3   K04   AX00000916   AGTCTTGGTTTGATGATGGTGGTATTAACGATAAGATGTTTCGAGGAATGTCCG
3   K06   AX00000917   TCATTCTGCTGCCGATTAGTATTTTGTGGTACACGGATAAATATATTCAGGTGAA
3   K08   AX00000918   GATATCAAATGATTGCCCCAAAGCGGAATCATGCGGGGCATCGATTATATACAG
3   K10   AX00000919   ACGAAAGAACATCAAGAAGCGGATACAGATGATGAGTTCCGTGACGAGTTTATT
3   K12   AX00000920   AATTTATGCATGATGCAGGTGCGAAAGTTATTGCAATCTCAGATGCTTACGGCG
3   K14   AX00000921   TAAGCGCGGCACATTATTACAATCAGTAAATAAATTTTTCGGTTTAGATACGAAA
3   K16   AX00000922   CTATAAATGAAGTTGCTTATCATGTTCGATATGGTGTGCCGACAGATAATGACTT
3   K18   AX00000923   TCGTAAGCCTGTTCGAAATCAAGCGCTTGCGTATTATCGTGAAGTAGTAAAGCG
3   K20   AX00000924   GTATTAAACGACGAAATTCATTGCGCTACAAACGTAACGAAAACACATACAAGCA
3   K22   AX00000925   CATCGCCTTGTTCGTGAAGAGATGGTACGCCGTCAACAAGAGTTAGCGGAAAAA
3   K24   AX00000926   GGTATTATCTGTTGATGCTGACACACAACGTATTTCTTTATCAATTAAAGCAGCT
3   M02   AX00000927   TTTCACTAAGTTCGCCGATTTTTATCAATGCGATGACTGGTGGTGGAGGAGAGA
3   M04   AX00000928   CGTTTGCAACGACATTTGCGTATATAGGATTTCGTTCATGGATTGCCGGAGTAA
3   M06   AX00000929   AAAGTGGACAATCCGGAAATGCGCAGTGACATTTATGATTTCTATGCATTAGGA
3   M08   AX00000930   CTTGTACAAGTGTTCATAGCCGAAATTGGCGCGCTGGAAATATGCTTGGAAAAG
3   M10   AX00000931   AATTGATTCATCAAGTGGCTCTTATGGCAGGACGTGAAGTGCCGAAAGAACAAG
3   M12   AX00000932   GTATTAATAGACGTTGAAACAAACCCGACAGTAAAGCTAATTGATGTTAGGATGG
3   M14   AX00000933   TATGGCAGTTTAGTCAGTATGAATTTATTGATCGAGCGAGCTTAGCTGGCATTG
3   M16   AX00000934   AAAAAGGACGCAACAAAAGCAGTAGACGCTGTTTTTGATTCTATCTTAGAAGCTT
3   M18   AX00000935   TAAAAGATATACCGTTTTATTCGATGTGTGAGCATCATTTAGTTCCATTCTATGG
3   M20   AX00000936   ACTTATTGTCTATGAATCGTGATATTGTTTTAATTCGTGCGCTTGCTGAAGGAAT
3   M22   AX00000937   TAAATACGATGTGATGAATTCTGTAATTAGTTTTCAAAGACATAAAGCGTGGCGC
3   M24   AX00000938   AACTTATTGAAGCTGGTGGGAAGCGAATTCGTCCTGTATTTGTGTTGCTTGCGG
3   O02   AX00000939   AGCTCGTAACATGATGGGTAAAACAAGACCACATGAAGCAGCTCCTGGAACAAT
3   O04   AX00000940   AATTGTTGTGCGCGGAGTGATGAAACCGATACCTACACTATATAAACCTCTTCAA
3   O06   AX00000941   CGGAAGCAGTTGTATATCATACGCCATTTTTACAGTCTCTTCCTGAAAAAGAGTG
3   O08   AX00000942   TTGAAGGAGCAGAAGTTCGTGAAGTATCACTTAAAGATGGCATTCACGATTTAG
3   O10   AX00000943   CGAAAGAAATGATGCCTGACGAACCTGTCATTACGTTTGGATTAGCAGAGTTAT
3   O12   AX00000944   GCAAAATATTGTCCGCGTGGCTTAGTAATGTCCGCGAATTGTGTAAAAGACACA
3   O14   AX00000945   TTGCTTATGTTACAAGTGATTTTTCATGGAAAGAAGATATGCAAGAATTACAGGG
3   O16   AX00000946   GATGTACAGTGAACTGGAATTCGGACAAATCACATCCGAATCAATTCTTTTGTCC
3   O18   AX00000947   TACCTGAGCATGTAAACCCGGCACATCACTTCTCTGCATTCGTTTATTGTTTTGG
3   O20   AX00000948   TTGTTTAACATGTCATGGTGACAATTTACAGGGCGGGGCAGCAGCACCGGCAC
3   O22   AX00000949   AGAAACTTCTCCTATATTTTGGCCGTTTGTACCAGATAGCCCTATGGCGAGTCTC
3   O24   AX00000950   TGGGTTTTTGATCCTGAGAAGGATCCGATTATATTAATGCTACCAGAAGAATTCT
3   B02   EMPTY        -
3   B04   AX00000951   CATTTCTCGGAGCAGTTTGTAATAAAGGGGAATGAAAAGAAGCAGGAAGTAACG
3   B06   AX00000952   ACGTAGTGCCTATAGCAAGTATTCACAAGTTTATTCAACATCGGGTATGACAGG
3   B08   AX00000953   CGTTTAGCGGGAGGGCGGGAAAACAATTAATGGGGTTTTTAGAACGTATTCACG
3   B10   AX00000954   GATGGAGCGCGGAGCAACCTTTTTAAAAGCTGTTGGATCATATACAAAAGTGGA
3   B12   AX00000955   GCATATATTGGTCAGTTTAAAGAAGGTTATTTCAGTCCACTTGCAATGATGGCTC
3   B14   AX00000956   AATTATCGCTCCAAACTTTGCAATTGGTGCAGTTCTGATGATGAAATTCTCACAA
3   B16   AX00000957   GTAATTTTCTTCCGCGATCCATTAACAGCACAACCGCATGAACCGGATGTGAAT
3   B18   AX00000958   GGAGGCATTAGAAGCGTATGAAAGTCAGTTTTCAACAGGGAGTGATGGTGTGAA
3   B20   AX00000959   ACCCTTCGCTAAATAATTTAATTCGTTTTGGTATTGAGCAATCTGATGTTGTGAC
3   B22   AX00000960   CATGAGGCTTACTTTGTCGGTGGAAGCGTAAGAGACCTTATTATCGATAGGCCG
3   B24   AX00000961   TAAAATTCTTTGGGAAAGTTACGCTGTAAGCATCGGGAAAGAAATTAACGCTCG
3   D02   AX00000962   ATCATGATCTTATCTCATATGGGGTAAATCGTGTTCCGAAATTTGTGAAGCAATA
3   D04   AX00000963   TTTATCCGAGTGTAGAAGAAATGTATCCAGCAGAACAAACGACAACGGTAGAAG
3   D06   AX00000964   ATAATAATGGTGCTCGCTTAGAGACATATGTTATTAAAGGCGAACGAGGTAGCG
3   D08   AX00000965   TCATATACAGTCGTGCAAGGTACCGATGAAAATGGAGAACAACTTATCGTTTGG
3   D10   AX00000966   GCAGCTTATTAAAGCGATGACGAACTTAGCGAGTCATAGTACGTCAAACCCTAC
3   D12   AX00000967   TATCACTAGAAGGTGGACAAAAATCAGAAGCGATGATGTGTGAAAGTTATTCTTT
3   D14   AX00000968   GTTACACTAAACTGGTCTGGACCAACAGAAGTTGATGCGTATGCAGCAAGCTAT
3   D16   AX00000969   AGATTACCCCGCTCGAAGTGCTGCAGTGGTAAAAGAGGCGTATTTTAAACAACC
3   D18   AX00000970   GAAATAGTGAAATTAGGTGGGCTTTTTTAGCGAGTATGGTCTCGAGAAATGCGG
3   D20   AX00000971   ATACGATTTTTATAAGGATATGAAACCGTTTGTAGATATGGTAGATGAGGAATTA
3   D22   AX00000972   ACTATATGCCACCACCATCTCCCTATGGCAATCAACAAGCGATGTTTTATCCACC
3   D24   AX00000973   AACAATGCGTAACACATTCTTTTTCAACAACGGTGGTGCCACACATTTTCCCGAC
3   F02   AX00000974   GAATATTACGAATTTATTCTCTCTCAAGCAGACCATGTTGATAGTATCACAAAAC
3   F04   AX00000975   TTGATATGATCATTAAAGATTATGAAGCTTTTCACAAGGAATTTGAGCAATTAAAG
3   F06   AX00000976   TTGAAGCAGATGAAAAGGCGATTTGTCGCACGAATTTATGGTTACGTACTGCGG
3   F08   AX00000977   TGGATCATATTTGGACGTACGATGCTCGTAAGCGTGAAGGGCAAATTCCGTTAT
3   F10   AX00000978   ATGCTTTCATCAGAAGTATTTGCCATGTCGACTTCAGATGAGATGGGGAACTAT
3   F12   AX00000979   TTTAGCCGAATTTTTACATGATGAGAGTAGAGGGGATCATACATTTTCTGTGAAG
3   F14   AX00000980   CAACGTCCGAGCAGAAAGGTTACAACGGATATCCTTATGCGGTATGTGCATCTG
3   F16   AX00000981   TTAGCAAACGGTCAGGCTGCTTTAGGTTTAATGAGCCTAGTAGAGCAAGCTGGA
3   F18   AX00000982   GTACTTGGCGGTGCGATGTTAGCGATGTTCGGTATGGTAATGGCATATGGTATT
3   F20   AX00000983   CTACACGTTACAAATCTTTATTAGCCGCTGGTGGCTGTCACGTTATCAATACGG
3   F22   AX00000984   TGAATCATCTATATAAAGCGCAGTTGTTACCGACAAGTCCAATTCCGACAAGCG
3   F24   AX00000985   ACATATGAATTTTCTTCATTCGTCTTATGCGGTGAAACACCAGACGGCAGACGA
3   H02   AX00000986   TAGAAACTGCTAAAGAACATGGTATGTCAAAACTTGAAGTTGGTACAGGTAATTC
3   H04   AX00000987   ATGTTTACAATTAGATGCGCAGCGTGAAGCAGCTATTGAAGCTGCCGTATCACT
3   H06   AX00000988   CCAAAATCTTTCGAAAGATAAGGAAACAATTGTATATTGCGGTTCTGGTGTTACA
3   H08   AX00000989   GGATTGGGATGATGAACTTGGGGTATGGCAGTGTGATGAGAGTAGCTCAAGTT
3   H10   AX00000990   TAATCAATCCATTGTCAGCATTTTTACTTCAGCCCAAATCAGTTCAGTGTCTTATT
3   H12   AX00000991   AGGAAATAAGGCGGTAAGCTATGTACTTGGAGGGCGATTACTTGGTTTAGCTAT
3   H14   AX00000992   CCGTGGCAAATCGTGCATGCGAAAGCTTTCATGGGAGATACGAGCGATAATTAT
3   H16   AX00000993   TTCGTTTATACTTGCGATGCTTTCGTATATATTTGTAGAAAAATTTGCATTCAGAG
3   H18   AX00000994   ATTCCTATCTCTGTAATTGTTAGTTTTTTTGTTGGGATAGGTTTAGCAGTATTTCG
3   H20   AX00000995   TTAACTATACATTGCCACTAAGTATGGTCGGTGTTTTTGCAGTGGCGTACCGGA
3   H22   AX00000996   TGGAAGTGGCAGATTTACATTATGGGAAGCTGCTTTTAAATATTATTTAACTAAT
3   H24   AX00000997   ACAGCCGGAAGATACGGCGTTATGGCTGAAATTATTACATGAAGGGCATGAAGC
3   J02   AX00000998   TAGCAATTCAGCAAGCTATAAATTATTGTGTAGCGAATCGAATTTCGACGGTTAG
3   J04   AX00000999   GAACGCTCTCCACTAGCGAATCCGAATATCGGTTTCCTAGTCGCTACTAATTTG
3   J06   AX00001000   TTTGGAACAAATAGAAAAGAGTTTTTAAAGAAAAGAATTATGCAAAGTGAACAGT
3   J08   AX00001001   AGCCGTGCAGAAAGCAATAGATGCCAATGCCCTTATTGTTTTCGTAAGAGATAT
3   J10   AX00001002   TTATTTGGGGAGCTACGTTTGTCGTCGTTCAAAATGCTATGTCTTTCGTTGGCC
3   J12   AX00001003   AAAAGAAGACAATACAGAATACTTATGGCAAGGTGATTCTACTTATTGGGGACG
3   J14   AX00001004   AAAAGCGAAGCAAATGAAATTAAAACTTGTATGTGAGCCAATCTCTAGAAAACAA
3   J16   AX00001005   CAATTTCAATGGATCCAGATACATTAGAACACGCTACTACTGCTGTAGAAGCAGC
3   J18   AX00001006   GGTATATACGGTAGTACACTTAGCTCATTGCTTACGAAGGTAACGAAACAAGAA
3   J20   AX00001007   GAAAAGAAATTACTGATAGAAATCCACTATATGAAGCGGTATTTCAGAATGCAGC
3   J22   AX00001008   GTCCTGTTACTAAGTTTGGAAGATGGCTAAAAAAACAGCACATATTACACCATTA
3   J24   AX00001009   CAAATGTTTGGAACCCTGTAGCTGGAAAAGCTATATTTGTTGGGGAAGCGATAT
3   L02   AX00001010   CACATCGTTATAAATTTATGTCACGTTACCGCGGGTATCATGGGAATACAATGGC
3   L04   AX00001011   GAAGTGACGGCGTACAAAAGAATAAATGAACCAGTTTGGGATGCTTATATTCCG
3   L06   AX00001012   CTATTATTTTAATCGGATGGAAAGGTGTTCCTGCGATTATGCGCTGGTTATCACC
3   L08   AX00001013   AAGCAAGTGAGGTAAATCGTTTAGATCCAAAGCAGGTAGCAATCCTTTGTACAG
3   L10   AX00001014   TTCGTTGCAAAAAAATATGAGGCAAATGGATGATAGCTTATTTTCTGGAGATATC
3   L12   AX00001015   GCAGGAGTAAACGTGGCTATTCCAGCGTTTTCAATTTTCTTCTCTATTTCATTAT
3   L14   AX00001016   TATCTTTTTATCTTATTTAGCTTTTCAGGCCATACCAGTCTCTGGTGCTTTGCAAG
3   L16   AX00001017   TGTATTAGGCTCGAAAGTAAACGGAACGAAACCATCGTACTCATTGCAATATCG
3   L18   AX00001018   GTTTAGGATTCAATCAATCTGACGGTGCTGGAATTGGAATGATGATCACATATG
3   L20   AX00001019   CCGAGAGAAGTGAGCGAATTGCTTCATTTACCGGATAAAGTATATCCTGTATTCG
3   L22   AX00001020   AGTACAGGTTTTGGCTTTTCTATTATGGCAACACCTTTCTTACTCATGTTATTTCT
3   L24   AX00001021   TCTATGCCGAAAAAATTTTCCACACGAACATTGGAATTTTATATACGGTTCAAGG
3   N02   AX00001022   GAAAACAAAAAGAAAGAGCTAATTCAACTTGTTGCTAGACATGGATTGGATCATG
3   N04   AX00001023   TGGCTTTCTAACGGACGTCAAGAAAGCGTTGCTGAACATACGTGGCGCATGTCT
3   N06   AX00001024   AAGATGTTGAAACGGAAGTGTATGAGTTAAGAAAAGGAGCGGCGTTATTAGATA
3   N08   AX00001025   ATATGTAGATAATAACGGTATTAGTCAAGTGAATGTATATCGAGAGGATACGGG
3   N10   AX00001026   TGTTATTTGTTCTGCAATGGGACAACAAGGTATGGTATTAGATGCAATTAAGGGT
3   N12   AX00001027   AGAACTGAGCGGTATTAAAGAAATCATGAACCAAATGATGGGGCATGCTGCAAC
3   N14   AX00001028   TTGCAAGGTGATTGGAATCTTCAGCTCGTTCAAAGTTACAAAGAAAATGAGAAAG
3   N16   AX00001029   CGCATATAAAAGAACTTCTTTTGTTAGATGGAACGTATGATTTCGCAGAAGTACA
3   N18   AX00001030   AAGTATGGAGTGCCGCTTGCGCTGCCGGTGAAGAACCATATACACTCTCTTTAA
3   N20   AX00001031   TTAAAAAAACACGGAGCCGAGTATGTCGCTTTTGATCATCCTTCCGACTCCATTT
3   N22   AX00001032   ATGTCAGGACAGGACTTGCATTTTCGGATAATTTGCATGCAGATCCAAAAAAAG
3   N24   AX00001033   GCAATTGCAGTACATTGATGGTTTAAAAAAGTTATCAAGTTCATTTGAAGAAATG
3   P02   AX00001034   GTTGCAGCAGAAGTAAGTCCATTCATTATTAAGGCGGCACAGCATATTCGAGAT
3   P04   AX00001035   GCGAATACACCCGGCTATAAAGCACAAGATGTAACATTTGCTGAGCAAATGAAT
3   P06   AX00001036   AATACAACGGCGGCTCCGGGGGCAGATTTATATGAGCGTCGTAGTGTAGTGCT
3   P08   AX00001037   TAACTAAAGGGGTAGGAGAAACGCATGACGTTTTAATTCAGCAGAAGAAGGCGG
3   P10   AX00001038   AAGAGATGATTCTAGAAGAATTAGATGGCTTAGGACCGCTTAAGATGACGGATG
3   P12   AX00001039   GTACATCCAGAAACATTTGAACGTATTCAAGAAGAGAAGGGAAATACGAAAGAA
3   P14   AX00001040   TAGCACGTGGTATTTTAGATGGACATATTGTATTAAAGCGTGAACTTGCAACGCT
3   P16   AX00001041   ATGGATAAAGATGATTTCCTGAAACTTTTCTTAGCAAGCTTTCAACATCAAGATC
3   P18   AX00001042   TACGAGAAAAGGGTCTTTCGGTGTATCGAAAGATAACTATGTTACAACTACAGG
3   P20   AX00001043   TGCTGAGCAAGTGTTAAAAATGGAACGAGAAGAGCATATATATTTACCGGATCA
3   P22   AX00001044   ATGCGAGCATATGAAAAATCAGCGATTACATGGCTGAAGTCTGAGCTAGAGTTA
3   P24   AX00001045   GTAGAATCTGATTTTAATCCGAAAACGGTGTCACATGCAGGTGCGAAGGGTCTT
3   B01   EMPTY        -
3   B03   AX00001046   ATATGAAAGTCGGCATCGGGGAAGCGATCGTAATGGACGAGAAGTTCGGTATT
3   B05   AX00001047   GTAAGCAAGTGTTCACTGTTATTAGTAATAACGGTGTTCAATCTGTGCAATTAAC
3   B07   AX00001048   ACACTGTTAATGTACCTCGGGATGATGATGGTACCGCCGATGATTTTAAGTTTAC
3   B09   AX00001049   CTGACGTTTTTACCGAAAATGGCGAGTATTGTACTCGTTATTATCATTTTAGGTC
3   B11   AX00001050   CTGACGACTAGTTTTTTAGATAGTCTACTCGCAACGTTATTATTTGCGATCACAT
3   B13   AX00001051   TTATATATACGAACGCTTGCCCGTGAACAAGAAATACCAATGGTGGAAAACCGT
3   B15   AX00001052   GTTCGGTCGATTACGCTGTAGTACCAGCCGCAACGCATGTGAACTTAGTACAAG
3   B17   AX00001053   TGCGTCATCACTCTTTACTGCATCTTATCGGAGCTGTCGTTTATGAAAAATATGG
3   B19   AX00001054   AAGTATTAATTGCGAACTTCTCAAATGATAGCACTTCGTGGGCTGTTACAACGTA
3   B21   AX00001055   ACTATCATTGGCGGGCTATTTGGTGAGTGGATACCAGATCCGCATACGTATGGG
3   B23   AX00001056   ACTCGTGCCACGTATTTTACCGCTACTCGTATTTAGTAAACTACAAATTCCAGAC
3   D01   AX00001057   TACACATATTGGACTTATCGGCTTTAGTGTTGGTGCTACCATCTCATGGCTATGT
3   D03   AX00001058   TGTTAGTTTTCAAGGCATGCCTGTTATGATTCAACACGTCGACGAAAGCAATGAA
3   D05   AX00001059   AAAATGGAAAAGCTACACCTTCGATGAAAACATTACAATATATTGCAGAAAAACT
3   D07   AX00001060   GTGGGTAAACTTTTTTGCTTGTGGGCTAACCGTTGCACTTCCGTACATTATTGTC
3   D09   AX00001061   TATGACACATATATTGAAACAGGTATGCAATCATTGAAAGATGAAAAATATAGTG
3   D11   AX00001062   TTATTCGAATTACGTTCGGGAAGGTATTTCTTAACAGAGGCTGGTGAGGCGTTG
3   D13   AX00001063   ACCGCTCAGTGCACTCGATGCAATTTTGCGAGAAGAAATGCGATTAGAGCTTAT
3   D15   AX00001064   GCAAAGGGTGAACCGGTTGATATTGTTTATCCAAAAAGCGGAACAGTTATTAGC
3   D17   AX00001065   AAGTCCTCTGAAAAATGGCTTGATATGTGCGGTATGTTACCGAATATGGTACCA
3   D19   AX00001066   GTTTGCTGCTAGTCCAATGACACCTAGTTTTGAAGTGAAGTTATTATTAAAGCCA
3   D21   AX00001067   GATTGGAGTTTTGCATACGAAGGCGGAGAATCCAATGATGTAGCACAAAGACGC
3   D23   AX00001068   AACAAATATTCAGTTAGACGGTTCCTCCTACAAAGAGTTACTTCAGGAGTTCCAG
3   F01   AX00001069   TACCTCTCCTTCATTATATAAAGCGACAGCTTCTGAACTATCGGAGTGGAAAAAC
3   F03   AX00001070   CTGGTTTAGACGCTCCTTGGGTAAAACGCGTTTCTGAACATGTAGGGACATCTC
3   F05   AX00001071   GGAAGATAGAGAAGAATTATTGAAGCTTATTAATCAATTAGAACCGTTAGATCAA
3   F07   AX00001072   AATGCAACAAAGCTTATCGTTACACCTCGTGTACACTTACGAGTTCATACACCTG
3   F09   AX00001073   GGACGGAACTGAAAAATATGAAATCATTATTATCTTCTTATACGTGGGCTTTTCC
3   F11   AX00001074   GCGAAAACATACGGGTATAAGCGAGTCGAAATGTTAGCGGCATTATGTAACGGT
3   F13   AX00001075   AAAACTTTGTTCCAGCAAGTCAATCTATTGATGAACATCACGCTATCATTCAAGC
3   F15   AX00001076   TGATTTCATTTCAATTACCCTTTCATTAGTAGGTACTTTCCTCTTACTAACAAACG
3   F17   AX00001077   TGATAGGTCTTCTATCTCAAGCAGGTTCCTCTATTACAATTCAAGGAGCCGGTG
3   F19   AX00001078   TCCAATGTGTGAATGTGTCATTATACCAATTGTAAGAAGGCTCATTCAAAAGGGG
3   F21   AX00001079   GAAGTGTAACAATTGATGGAAGTTTAGCAGGAAAAAGGGGTATGAATCAAAGTG
3   F23   AX00001080   TAAAAATCGACCGCCGCGTATTAGCGCGTAACTCAGAAGTAGGTGGAACATTAA
3   H01   AX00001081   GGAATGAACATTTTCCGCTTGTCGTGTGGCAAACAGGTAGTGGTACACAATCAA
3   H03   AX00001082   GAAAATGGTTCAGTTTTTCCATATGGGGCTGAATGATAAAGAGATTGTAAAAGAG
3   H05   AX00001083   GTGAACAAAAGGTTTTGTCCACATTATAATCAATTAAATAGAATGAACGCCTTCC
3   H07   AX00001084   GAAAATCGATGTGTTACAGCTTCATTTGCAAAAACAGCAATCAATTTACGAATCG
3   H09   AX00001085   TCGCTCGATTTTAGTCGGTATGACATATGCAGCGGGTTGGACTCCATGTGTTGG
3   H11   AX00001086   ATTCTGGCTCTTTGTATAGTGGGCTTGTTATGGATGAAAAATGAAAGGCTTGGA
3   H13   AX00001087   AGCAACAGCAATTATGACCATCCCGCCGAATACAGCTTCATCAGAAAATGTACTA
3   H15   AX00001088   TAACAGACGCAGACGGACTTGCGGTAGGAAGGCCATCTGGATTTGTTGGTAAA
3   H17   AX00001089   AGTTACAGCATTATTCCGTCATCCAATGGGAATTCCAATTCCGCATACAGCTTTG
3   H19   AX00001090   CGTTTTAGGAAGCGTTGGAATTGCTTTTTACTGTTTATTATCAACTGGATTGCTA
3   H21   AX00001091   GACAGATTCCTCTAAAGAGAGCGAACGATTTTATATCATTCTCCTATCAATCATC
3   H23   AX00001092   AACCTTCCAATGATAAATGATGATTCATTTACGAACGAAGTTATGACACAAATTAA
3   J01   AX00001093   AAAAATTACTCATCGCTCAAAAACTGAGAGAACTTCCCGAAAATTACCGTGACGT
3   J03   AX00001094   GATCCAGAGCGTATTCGTGATGCGATAAAAGGAGTATATAACGGTCAAACTGTT
3   J05   AX00001095   TTTAAGTTAGAAGAGAGAAATCGGTTGTCACAAGAAATTCATGATAAAATTGGCC
3   J07   AX00001096   TGTCGTTCCGCAAGATATTGCAATCTATGAAGAGTTAACTGCCTATGAAAATGTG
3   J09   AX00001097   TCTACCTCTTATAAAAGAAGCGGCGTATCCATACATACGTCAAGCTATTAATAAT
3   J11   AX00001098   CGTTATGACTTCCATCCCGTTTAATGCTGTAGCTGAACCATACATTCGCTTGCGT
3   J13   AX00001099   TTATTATTCGTTCTCATGTTAACATCCAAAGGTATGGCGGGAGTTCCAGGTGCA
3   J15   AX00001100   TCGGAAAATTAGCTGTTTATACGGCAGCAGTTGGAATCGATCCTAGCCGCGTAT
3   J17   AX00001101   TCCGCGTATGTCTTGACTGGGTCATGCAAGGTTCATTTCATATGACAGAATCATT
3   J19   AX00001102   TACTATCAGAACTCGGTATTGCGGGAGAGAACGGAAGTAAAGATTTACTTAGTA
3   J21   AX00001103   CGAAAGGCTTTGGTTCCGCGGTACCACCCAAATTAGCAACAGAGGTTGCTCACT
3   J23   AX00001104   AACTATTCCGCGTATCTGCACCATTATTCGTAACGAAAAAATCAGGATTAAACGA
3   L01   AX00001105   TGGTCGCGTAACCGGACTCGGTTCTCAGTGCGTAGAGATTGCTATGATGGTTAC
3   L03   AX00001106   AATGAAGGAACTGTTCATCTCTCCTTCTCCATCCATTCTAATGATTTAAGAGAAA
3   L05   AX00001107   CGATTACAATTGCTCAAATGGTTTGGATTCACGGTGTTGTTAATGGAATTGGAGT
3   L07   AX00001108   CTATTTTTGATCGCTCATGGTACGGCCGTGTGTTAGTGGAGCGTGTTGAAGGTT
3   L09   AX00001109   CATTGTCGCTACTACTACTGCTGATTACGTTTTCCCTAGTGTTGCTTGCCAAATA
3   L11   AX00001110   CCTTCAGTATATGATGCCTCGTTTAATTGGTCTTCGTGAGTCGTTAGGAAGACAG
3   L13   AX00001111   TATGTATTCGGATAAGAAGCCGTCACCATTTTTATTACCGCTCGGTATGTTTTCA
3   L15   AX00001112   TAAAACTAGAAATGTTTAATCCATCGCGCAGTGTGAAAGACCGTGCTGCCTATA
3   L17   AX00001113   GGCTAATCGAGTACCATCTAGTCAGTTTTTAAGTTTTGAAAAAGGCGAACTTATA
3   L19   AX00001114   GAAATGGAGCATACGAAGCTACGTTTGGTGAAATCATTTCCAATCCGTATTTAGC
3   L21   AX00001115   ACCGAGTAGAAACAAATGAAAAAGTGGTTGCTTTAACTTTTGATGATGGCCCTAC
3   L23   AX00001116   AAAACAAGAAACAAAACATTATAAATGGGGTACACGATCTGGAGGAAGAAAACA
3   N01   AX00001117   AACATAAGCCTGTATACTTACCAATTTCATTAATTAGTGATGGGAAAGTAGTGAA
3   N03   AX00001118   GGTCTGCAAGGAACGTTCCAAAGTTTAAATAAAAAGAGCATTTGTTCTTTATGTC
3   N05   AX00001119   ATCAATGTGATGTAAACGACTGGCATAATATTGTAGCGGTTGCAGCAAGGTGGC
3   N07   AX00001120   GCCACAAATCGATCCAACTGATGATGGCGGACAATTCTTTGACCGTGGTCCATC
3   N09   AX00001121   ATTAGAAGGCATTACGAGAAATAGTGTTATCGAGCTATGTGAGCGACTGAGTAT
3   N11   AX00001122   AGAAGCTTTTTACATCGCCGAAAGCGGGCGGCCAGGACCAGTATTAATTGATAT
3   N13   AX00001123   ATCTCCGCGAAGGACAAATGTTACTTTTCTCACATGGATTTAATATTCACTTCGG
3   N15   AX00001124   TCGGTATGCGCTATTCGCTTCCGAGTCGAGAAATTATTGCAGATTCAGTAGAAA
3   N17   AX00001125   GTGTTAGTCCTGCTACACAGGTCATTGGGGTAGAGCCAATGGGAGCTGCATCT
3   N19   AX00001126   AAAAAGCGACAAGAAAATAGAAGACCCGGAAATCACACTCACCTTCTCTGGTGA
3   N21   AX00001127   AGCTACTTTAATTTTTGCAATTGGCGCGATGGGGATACTTGGTGCACTCGACAG
3   N23   AX00001128   TGTTATGATGTAGTGAGAGGAAAGAAAGGATTGTTTGGTCCAATGGGCACGGCG
3   P01   AX00001129   GATTATTACCTTCCGTACAAACTCTACTAAAACAACATACACCAACTCATGTAAC
3   P03   AX00001130   TTCCAGTCCATCATAATATGACGAGAGGTTTAGATCATGGCTCATGGACACTCTT
3   P05   AX00001131   ACGGCTGGGTTCCGGTTCCTTTTTCAAAGGTCATGTATTTAGAGGCGAAAGATA
3   P07   AX00001132   TTACACGTGCAGGTGATGTGAAAGCAGTCCCATTTGCGCTTGTAAACCGAGTTA
3   P09   AX00001133   CATTCAAAAGCAACGTGGGATTATAGCGAAGAATTTATACTTGCTTGTAAGGAAG
3   P11   AX00001134   TGATATGTTATTACAACCATGGCTTGAGACGAGAATTTGGCCACTTGAAAGTCAA
3   P13   AX00001135   TCCAGGATCCTACTTTCAATCCTGACCACCCTCCAGCTGGCTACAATTTTGCGT
3   P15   AX00001136   CAAGGGTATTACGATGTACAAACGCTTAAAGCTGAAAAAGGAAATGTGGAAATC
3   P17   AX00001137   GGAGGCCGTATTATCATCCGTGATGGCATCATGACCGAAGATAAAAGGTTAATG
3   P19   AX00001138   AGTGTGGTGTTTGTGAGTTTCGATATGTTTGTGGGGGATCTCGTTCTAGAGCAT
3   P21   AX00001139   TTTTCTAATACTGACGTACTGCGCTATTATGGCCAAAAACCATTACAGGATATTG
3   P23   AX00001140   ATATATGAGAGCGTTTGGAAAGAAAGGGCCTATGAAAGCAATAATACAGTAATG
4   A01   EMPTY        -
4   A03   AX00001141   AGTAATGGCACCAGCTTCCGGGACGGTTGTATCAATTAATAATAATGAGCAAGA
4   A05   AX00001142   GACTATCTAGCTCTTCTGTCGGTACAATGTCAGGTGATATTATTATGCAAGGTTT
4   A07   AX00001143   AAACGAAGCGAAATATTTACGTGCATGTTCTCACGAATGTCGTGTAAGCCCACG
4   A09   AX00001144   AGTGGGCCAAATGTTAGGATTTACTATGATTGACCTGTTAAGAAACACCGATTCA
4   A11   AX00001145   GTTTCTTGTTCGTAGTAAACGGAAAAAACAATTGGAGGAAAGGGGACTTGTAAT
4   A13   AX00001146   AAATTGTAAATGCTGCCGATAGTCAAACGAGAGAAGCAGCTCTTCGCATTCAGC
4   A15   AX00001147   GATTCAGCACAAGGATACAGCTAGAGGAAATGCGAAGCAATGGTTAGATGTATT
4   A17   AX00001148   AATCAAAGTCATTTCTTCCAATTTCTTTTGTTAGGACTCACATTTACGACTTTGAC
4   A19   AX00001149   GGAACAGTGCGAGACGAAGCGCTATTATTCCGATTAGGTTATTTCGATAAGGAT
4   A21   AX00001150   AAAAGCATCTGGTGGTGTTCGTACACGTGAAGATGCAGAAAAAATGGTAGCTGC
4   A23   AX00001151   TGTCTATCGTTGGATCATACATGGTCTTATTAAAACCGCAATATGTTGTAACCGC
4   C01   AX00001152   TAAACAATCAAGGCGGAGATAGCTCAATTGTAGACAATCCAGAAAAAATGCCAC
4   C03   AX00001153   TATTACAGGAGAAACGGACGGACCAATTTCACCATGTGGTGCTTGTAGACAAGT
4   C05   AX00001154   TTAACAGTTGATGAAAAACAAGAACAACAAATGTTGCGTCAAAACTATACACAAA
4   C07   AX00001155   TTGATTTCACACTGAAGTCATCTGGCATTAAGCATCATGCGTTCAATACAATTTT
4   C09   AX00001156   CAAAAATTAAGTAACGGTGTTATTGTTCCGGTCTGGACATTTAATGGCTCATCTC
4   C11   AX00001157   TTTATCGGTCTACGTTTTCATCTGTACACTGCTTTAGAAGGAATGTTCTCTGGAT
4   C13   AX00001158   ATGGAGCGTACTGTACATGGGCAATTGGTCATTTGACGCAGTTATGTAATCCAG
4   C15   AX00001159   CTTTCTTCTTACGGGATTACACCTAATAGACTTGCTGTTTTAGGGGTAAACATAC
4   C17   AX00001160   CTCATTCCGTTTTTCAGCTCTGCCCAAATTGTATTTTTAAGTTTAGCAATCGTAG
4   C19   AX00001161   AACAAATGGCTCCTATGGAGATGGCAGTTAATTACGTAACAACTGTACTTGGATT
4   C21   AX00001162   TACGTAAGTGAAGCGCCTGGTGTTGAAAGTGAAGTAGCCATTCTTGAAGTGGAT
4   C23   AX00001163   TGTATTGGGATATGATTAAGCGTTTTTCACCGTGGGCAACATGTGCTGTCATTG
4   E01   AX00001164   ACTGTGAAGCCAGCAACTTCTGACATCGGCTCTTGGGAGACTTACACGATAAAA
4   E03   AX00001165   ACACCACCCGTTTTATTTGCAGGCGTTCGAACTTTAATTGGAGGATTCATTTTAC
4   E05   AX00001166   GACGCAGCCAGCTGTAAGTCATGCGATTTCAAGTATTGAGTCAGAGTTAGGAGT
4   E07   AX00001167   TGTCGTACTTGAAACAAGCTGGCTTTGTTTACGTAAATCGTGGACCGGGTGGCG
4   E09   AX00001168   TGCGTTTGCCACGTGTTTCTCCGCATCCATATACACATTTAGCTTTCGAAGGGTG
4   E11   AX00001169   TGGTCTCATCAAGGAAATGCGATGTTACAACATACTGTGTGGATGTTATTATCTG
4   E13   AX00001170   GGCTTCTTTTTTCTGTAGACCAACAAGACGAAAATAGAAAAGCAGTAGCAGAAAA
4   E15   AX00001171   GAAGTATCAAAGTATATAGAACAAGGTGTAGATGTCATCTATCAATCGATAGCAA
4   E17   AX00001172   ATACGGTCAAAAAGATGTGTATATCGGTGTACCTGCTGTTTTAAATCGCGGCGG
4   E19   AX00001173   CGAACCAGGCCAAGAGCTCGAGTTATTTCCGTATATTACATCACCATCTGGAAA
4   E21   AX00001174   AATGGCTTTCGAATTTACCAGATAGTATTTATCGTGTGAAAGGTTTTGTGAAATT
4   E23   AX00001175   ATTCAAAATATCATTAGCTCAAAACCAGATTATTTATTTATCGTTTGGGCAGGGG
4   G01   AX00001176   GATTACTATAGTTTTTTTCCGAGTTCGGCAAAATTTAAGCAACAAGTTGGAGAGG
4   G03   AX00001177   CGATATTTTCTTTCGTCTTTTTATTAGGAGCAGGGATGGCAGCGTTGGGAGGTT
4   G05   AX00001178   GTATCATTTGGTCATTGTATGTTCTTTGGAATAGGAGCATATGGCGTAGCGCTTT
4   G07   AX00001179   AAGTGTACCGTTGACTATTCAAAGGAACTCTTCTTCGTTAGCAATGACAAAAAGT
4   G09   AX00001180   GGAATGGTCATGAAGGAATGAACAAATTTATCTTTGAAGGGTATTACGATAATAT
4   G11   AX00001181   TTAAAACGTTTTGATTTAACGACTGCTCAATTTGATGTGCTGTTGCAAATACGTA
4   G13   AX00001182   TGGAATGGACAGTTTAGAGCACCGCTTGCACATGCATCGGTTATTCCAAGAGCT
4   G15   AX00001183   TTCAAAACCCACAATTATGGGTACAATTCCCGCATACAATTACAGCGGCAATTGC
4   G17   AX00001184   GGTCTACTCGTGAAGAGTGGCAAAAGAATATTGCTTATATTCCGCAGCAACCTT
4   G19   AX00001185   GAACCACAGGCGTTATTTTTCCGTTCGCGATTCCAAACGGGTGATATGTTAGGG
4   G21   AX00001186   AGGAACTTGAGGAGATTTATTTTTTCAGTGCCAAAATCAGTGTATGAAAAGAAGG
4   G23   AX00001187   ACCCGCATTCAATGAATTAACGCCACCTGATGTAGCAAAGGATCTTCATCAGCA
4   I01   AX00001188   ACATATGGCAAAGACGGAGAAAGATTTCGTTCAGCTTATGAATGCAAAAGCGAA
4   I03   AX00001189   GAAGTGATTTATCATGCTGTAAAACATACACCTTCAGCTTTTAACTCTCAAAGCG
4   I05   AX00001190   ACATCTTCAATCGCTGGATTCGCTAGATCTTTAAATGGTTCACCGTACAGAACTG
4   I07   AX00001191   CCGTTTCGGATTGCAATTACATTCATCAATTATTGCCCAATCATTACGACATCGG
4   I09   AX00001192   TTTTGAAGGGAATGAACGCACACTAGACGTTCATATAAATCGGTTACGTGAGAA
4   I11   AX00001193   AATGAGACCGAAGCGAGAGGCGATGATTTGGACTATTATTGAACCGATACAAAA
4   I13   AX00001194   TTTAACTCCAAGTACAGTAGCAACTGATATGGCTGTAGATTTAGGACTAACTGAT
4   I15   AX00001195   CCAGTGCGAGATATGTTAATTGTAATGCTAGAATGGCATATTGGTATGAAAACAG
4   I17   AX00001196   ATGATTGTACAGTGGAGTGTTGACACGGTTGATTGGAAAGGTGTAAGTGCTGAT
4   I19   AX00001197   GCAAAACGGATTCATCATGATGTTCATTGGAAGTGTTATTAGTATACTGTTTAGA
4   I21   AX00001198   TTCACAATGTCATCGATTCACTTCCATTCGCACCAGGTGAAGAAGTAGACGATG
4   I23   AX00001199   AGAAAGACCAGGCAATCGTCGTATAGACTCCATTTTGAATATTATTTCCAATCCA
4   K01   AX00001200   CAAGGGGATGAAGAAGTCGTTTCGAAATATTTCTTACGTATTTCATTACGAGATG
4   K03   AX00001201   TGCAATTGTAAAAGGGCATGTAATTGACGAGCCAGAAACAATTGCAACTGCGAT
4   K05   AX00001202   AGGAAGTAGTGCATCAGCAATTGTAGCTGGGATAGAGCTTGCGAATCAACTAGG
4   K07   AX00001203   CACTTCCGTTATGGGAAGGGAAGCAAATTCCGAGTAATGATGAGAATTGGAAGA
4   K09   AX00001204   ATATCGATGTACCAGTTACTTTCACTGAACAAGATAGTAAAGACCAAGCAGGTAT
4   K11   AX00001205   ATTTGTTCGTACTGTACGTCCAAAAGGTTGGGAAGATAAACCACATGGTGATAG
4   K13   AX00001206   ATATGATTTGGGGAACGAATTATGTAGGAGAGACGAAAGTAGTAGATGTAAATA
4   K15   AX00001207   AAAGCAAGGCATGGGGATTATTTCAGGTGAGACAGACAGATTAATTCATTTAGT
4   K17   AX00001208   ACAAAATGCAAGTTGATGCAGCTGCAGCACAAATTGCTCAAAATGTATTAACAAA
4   K19   AX00001209   ATTTTGCAAGAAGGTAAAGATCATAATGACGCTGTTATGAAGAAAATAGAGCAAG
4   K21   AX00001210   TCTGTAGCAAGTTGTTTAATTACGATGGTTTCAATTGAATCCGTACATGTATATTC
4   K23   AX00001211   ATGGAGAAATAGTTGGATTCATCGATGGAGGAGTAGAAAGAACTGGTACATACA
4   M01   AX00001212   AGCAAAATAGCGTTGTTCAGCTAAAGGATGGTTATCCGGTCAAATATTATTTCCG
4   M03   AX00001213   TTATTCAAAAAGCGATTATACCAGTTATACATCTTGTTGTAGAGCATGGGATCGC
4   M05   AX00001214   CTTTATTGCAATATAGTTCTGGAACTACAGGAGAACCGAAACTGATTCGTAGAGC
4   M07   AX00001215   TATATAGAAATGGATGTAAAGCTATGCGTTCCAGAGGATGAGGTAGACCCAAAA
4   M09   AX00001216   AAGGCGTAGCGACATAGATTTTCGCCCATTTTATTTTGGACTATGGGATGGAGA
4   M11   AX00001217   ATATTGTTCAATTTGCATATGAAAACGGTTTTGAAGGCATTGAATTATGGGGGAC
4   M13   AX00001218   GCGAGCCAACCAAATATTTGGAGGGCAGCCCCTGTAGTATTAACTGCCTCTATA
4   M15   AX00001219   CACTATAACGAGCCTATCTCCATGTTCAAAGGACTATTTAAAACAATGATGCAAG
4   M17   AX00001220   TTTAATAAAGAAGGAGAAGTATTACTGCAAAAAAGAGGCGACTTTAACGCTTGGG
4   M19   AX00001221   ACAGGATTCTTTACAAAATTCGGAGATGGTGGTGCAGACCTATTACCATTAACG
4   M21   AX00001222   ATTCCTAAAGAATTACGTGATGTATTGGGAATACAAATCAAATCACCGCTTGAAA
4   M23   AX00001223   CCCGCAAGATGTTCCAGAATTACATGAAGCAATTCAAAATGCGGTAAAGCAAGA
4   O01   AX00001224   ATGGGGCAAGGGATTACATTTTTTGATACAGCAGATTCATACGGTTTCGGTAGA
4   O03   AX00001225   GAGGAACTGCTAGAAAACTATAAATGTTTACGAGAAGCCCGCACAAAAAGCGAA
4   O05   AX00001226   ATCCATTGTGACTGCTATTTCCGGTCAGACTTTTTTACTACATCAAGCTCTTGGT
4   O07   AX00001227   ATTTTAGAATCGTTCGGCTGGGATTCTTTTTTTGAGGAACAAGCTGTAGAGAACT
4   O09   AX00001228   CGATTAATACGGCTTCTGCTCATACTCGTGAAAAAGCAGAAGATGGTGGAAAAC
4   O11   AX00001229   GATGTTACTCTCCTCACAAATCGGTGCATTTTCAGCGCAAGAATTTAACAAATAT
4   O13   AX00001230   GTTATATGTGAAACTACATAATTATCACTGGTATGTGACAGGACCACACTTCTTT
4   O15   AX00001231   AGAGCACCTGGCGGTATGCCAATTGCAACTCGCGCACTTCAAGAAGGAAAAATG
4   O17   AX00001232   GAGTTGCAACCAGCGATTGTCAAACCAGAGGGAAGAATATTCTTCGCTGGAGAC
4   O19   AX00001233   CGAAAGAAACAGGTGAATTTATTGCATCAGCTGGATTGCATCGTATTAATTGGG
4   O21   AX00001234   ATGCAAATCATCACAAAATGTGGAATCGCTCCCCCATCACCGAAATTTCCAGAG
4   O23   AX00001235   AATCAGTTGATTATGAATGTTGAAGAAGAAATTATGGAAATGACAAACGGTTGTT
4   A02   EMPTY        -
4   A04   AX00001236   TTGAAAGCAATGCGTTTTCTCTAGCAGAATCATTATATGAGGGAAACGGAACGT
4   A06   AX00001237   CAAAAGTAGCATCCGTTATTCAAAAAGAAACGGGTACAAAAGTTTTACGCTTAAA
4   A08   AX00001238   CTATTACTTGAATCAGATTACTACGATTCGGTTACTATTTTTGTAAGAGAACCAAT
4   A10   AX00001239   GCTTACATAAAACGACAACTTTTATACATGATAACGGTGCAAAAGCTGCCATTCA
4   A12   AX00001240   TGTAGGGAGACAATATCCGTATTACAAAAGGAAATGGGAGCTTGAGGAAAAGCG
4   A14   AX00001241   TTCTAATCCGAAGTATGATGAGTTAGTAGCGAAATCAAAAGGAGAGCTATTAAAA
4   A16   AX00001242   AGCGATTAGAAGAAAACGATGTTCATATTTTACAAGGAAGAGAACGGGATGTAA
4   A18   AX00001243   AACGTGATATACCGATAATCGCGGATGAGCATTTCTATGAAATTAACATGGGTAT
4   A20   AX00001244   CAAAACGATGTTACTGTAAAAAATGCGAATTCTTCCCTCACGGACACGGTGGCT
4   A22   AX00001245   ATTTGAAGTGATACCGTGGGATTATGATGCGACTTGGGGGCGTGATGTACAAGG
4   A24   AX00001246   TGAAAGGTTATTATTTGTGAAAGAAAAAAGTGATGGGAAATGGGCACTGCCAGG
4   C02   AX00001247   GCTTGGTGGAAATTGGCGACATATTAAAGAGTATGCATCTGATTACACACATTAC
4   C04   AX00001248   TTTAATAATCGTGGATATTCCAACAGTTAGACATGATGAAGAAGGAAATTCGATT
4   C06   AX00001249   TTTGGAAGTAGTATGCACATGGTATGGTATCGTTCGATTGTAGCGATTATCGTAG
4   C08   AX00001250   AGAACAATACTTCTTATTCCGTTTCGGTATTATACATTGTGTAGCGGATTCTGGT
4   C10   AX00001251   ATTAATGGTAGGTTGTAGTAAAGGTGAGGATAAGAATAAAGAAGAGGATACAAC
4   C12   AX00001252   GAAAGCCATAGAAGGAAGTGATATAGTAATTAGTGCACTTGGAACGGATCAAAA
4   C14   AX00001253   TTGGTGAACCGACTGTGGAACATTTACTACGACCGCTCTTTGAAAAGATTAATAT
4   C16   AX00001254   TTAGCGCTTACTTCGAATCATAAATCTATTTTAGGTTCCATCATTCTTTCATTCGT
4   C18   AX00001255   TGATGCCTTATTAGTTCGTAGAATTATGTTTACATTAGGAGAAGAGTTTAACGAT
4   C20   AX00001256   GCTTGTGCTGGCTTCTTTACAAACTTATTCCCAAAACTTTCGCATAAAACGATTG
4   C22   AX00001257   CGCGGTGAAGCACATACTGTCATACAAGCAATTGAAAGACAAATTTCTCATTATG
4   C24   AX00001258   ATGTACGCAGTTTTGTCGGCAAAGAGCTACCGGGTTTCGGTAAGTACGATACAG
4   E02   AX00001259   ATGGCCCACAATACAAGAGCTCAGGCACTATATAAAAAAGCTGGATTTGAGAAA
4   E04   AX00001260   AGTAGGCGTTTACCAGATGGGTATAAACCGCCAGATTTAGTTATTCCGAAAGTG
4   E06   AX00001261   TATTACGTAGTGAGGGAGCGACAGTAGTAGAAGATATTGATATTCCGTCTTTTCA
4   E08   AX00001262   TTTTACATGCTTTGGCTTGGAATTGGAGCTGTTGTCGGAGGTCTTATTGCTTTAT
4   E10   AX00001263   CGAAAGGGCCAGCAAATAAAGTCTTTATTCCATCTAATGCAATTGAAACACTTGG
4   E12   AX00001264   AAATATCCCGAGCCAAAGTTTCTTCATGATCGTTTTGAAAACGGGGAATCATTTA
4   E14   AX00001265   TGAAATGTGTGCACATCTTTCTCTTATTTGCCATGCTGATTTACTCATTTTAAATG
4   E16   AX00001266   GTCGTTAAAATCAAAAGTAGCCCATATTAAGCATGCGAAGAAAAATCGCGGTGT
4   E18   AX00001267   ATCTACTACACTATCAGGATTCGCCGTTCACCCTTCTTATCAAGGGCAAGGATAC
4   E20   AX00001268   AAGCTTACGCAGTTGCTCCTCGAGAGTTTGAGTTTATCGGACTAGAATATGTAC
4   E22   AX00001269   GGTATGAATAGTTCGAGTGAAGCACTATATTACGGTGTCCCGTTAGTTGTAATTC
4   E24   AX00001270   AGCAGGTTCATTAGAGCTTATTTTAGCGCCTAATGGATTAGTAGATGGCGGGGT
4   G02   AX00001271   ATAGAAAATAACGGTCAAGTTATAGGGACGGTCGGATTTTATTGGGAGTATAAA
4   G04   AX00001272   ACCTGTTAGACTGCAAAACGAAGCAGAATTAGGTGCGATTTATTTGTTACCAGAT
4   G06   AX00001273   CTGTTCAGACGGCTGACGGTGGTGTAGTGTTAACGGTTTCTAAAGTAGCGTTCG
4   G08   AX00001274   AGTTTGCAAGTAACATCCCTTCACCGCTTCATCAAGTGTTGCTTTTAAAGCATAA
4   G10   AX00001275   TACAGATGCACGAAATGGTGTATTCTTTATGACTGTAAAGCAAACATTTAAAACA
4   G12   AX00001276   GTACAAATACCGGTGCAATGATAGGCTATGTCGCTTTATTTCTTTCGCTTTTCTC
4   G14   AX00001277   AAAGTTGTAGATGGTATCGGTGTATATAAGCGCGGAGTAAATGAGAAGATGTTA
4   G16   AX00001278   TTTACTGGAGATATCCATGCGATCACAACTGCTAATAACGCGTTAGCCGCGTTT
4   G18   AX00001279   TAGTACGTGTAACACGTGCAGAGTCAAAAAGCTTAGTTGAGCATACGTATATCA
4   G20   AX00001280   AGTCGCAGCGGGGAATGGTGAAGTAGATTTCGATATATTCTTCAAGGTATTAGA
4   G22   AX00001281   AGCGGTGCTGAAACGAGCATTATACTACATAATAAAGAAGTGATTTCTAAAATGA
4   G24   AX00001282   GGATTTTTTCTACCTTGGTTAAAAAATAGAATAGAAAATGACGAGACGATCGCAC
4   I02   AX00001283   CTCTATACTCGGTTTTAGCTTTGGAACTACACGAAAAAAACGTCCTGAACTACTC
4   I04   AX00001284   CATTTTTTGATTGAAGATAAAACGGATGTAGATGATGTCGTTCAAGAAGTATACA
4   I06   AX00001285   TAAGTATGGGCCTTCAACCATACTTTGATAAATTAAATGGTCATAAATCAAGTAA
4   I08   AX00001286   AGACGCGCAAGTGAACTTTAACGTTTATCCAAGATTATTCTACTTTACACTCTTC
4   I10   AX00001287   GGCTGGGTAATCGATGTAAATGGTTTATTCTTAAGCTCCTACTTTAATTTAGCGG
4   I12   AX00001288   CCTCTGTATACATACATGACAGAACAAGCACCAGGTTTACTCGGTATGAAAGCA
4   I14   AX00001289   CAACCATCGCATACTTTGCGCCAAAATTTGGCCCTCAATGGCCAAACCCAATGG
4   I16   AX00001290   ACAATCCGAAAGAGCTCCAATTCGAGTTCAAGCCTGGACCAATCATGGGGAATT
4   I18   AX00001291   CCAGAAGGGAAGCTTGATTTACTCATTAACTTAGACTTCCGTATGGCTGGAACA
4   I20   AX00001292   ATGTATTTACCACGCATATGCGAACATTGTATGAATCCATCTTGCGTATCGTCTT
4   I22   AX00001293   CAAATGAGCAAGACAGCGAACCAATTATGAGTAAATACAAGGAGAATATACAAG
4   I24   AX00001294   TTCATTTTCCAACCGAAAGTTGAATATATGACGGAAGTACCTGTATGGTTTAAAA
4   K02   AX00001295   CACTTCGAATTTGTTCGGCATACGACATTATTGGAGAATTAACATTGTTCACGGA
4   K04   AX00001296   AGAAATACAGTTACGTTTCATTGAGTTTATGGATGTAGGCAGTACGAACGGATG
4   K06   AX00001297   TACGGTGTAACGTACACAATTCTTCCAGGAAAAACACCATGTTTTCGCTGCTTAA
4   K08   AX00001298   AGCCGCAATTCCGAGAGGGTGTAATGCGGTTGTTATGTTAGAACTAACGGAAGG
4   K10   AX00001299   TAGAGTATGTAGCTTATAAGACGATGGCGGAGAAACAGCTTGAGAGAATTGGTA
4   K12   AX00001300   CGTCCGATTGGTGGTTGGCTCGGTGATAAATTTAACCCATTTAAAATATTAATCT
4   K14   AX00001301   AATCGGAGGTATTATTCAATCATTTCTAAGACTGCCTGTATTTCATGCGCTCGTA
4   K16   AX00001302   ATTTTGAGCAGGTTTGTCAGCAATTTATTTCTGAGGGCCGGAAATACAAATTGTT
4   K18   AX00001303   GATATTAAAGATGCTCATCTTATTTATGCAGCTACAAATCAACATGCTGTAAATCT
4   K20   AX00001304   AGCAATATCCACATATAACATTTTCAGTTGTACCACCTTTTAGTACGCATCCGCA
4   K22   AX00001305   GCAGTCATTGAATGGGGTACAACTGGTAAACAGCGCGTTGTTACAGGGACACTA
4   K24   AX00001306   ATTCCGCCTTTCAAATGGTGATATTCGAGCTGTAGAAAATCGTTGTCCTCATAAA
4   M02   AX00001307   CGGCATTGTAGTCAATGACTATATGCTAACAAATGATGAGTCCATTTATGCAGTT
4   M04   AX00001308   AAATCCTATAGAATAGATTTTTGTTGTGGCGGTAATAAGCCACTTATTGATGCAA
4   M06   AX00001309   AAAATATGGAATTGAAATTGCAACTAGCAAAATGGAAGCTGCACCGTTTTTAAGA
4   M08   AX00001310   GTAGCCGGTACTGTTTATGACCTTTACGATAATAAATGGAAACCTGATGATGGTC
4   M10   AX00001311   GCGGATTTATCATATAGTTGGTGGGCAGGATGGCTTGCTTCTATATTAGGTCAA
4   M12   AX00001312   TTATGTGAAGTTTAGTAAGAAAAGCACAGTAGATTCTTCTATTGTTGGAAAACGT
4   M14   AX00001313   TTCAACAAGTTGTCGGTACACAGTTTTTACCTTTAAAAAAACCTGTACTAGATTTC
4   M16   AX00001314   AGCGTGTACATAAACTGGCGATTTCTTTATCCGAGCAAGAAGGAGGAAATCGTT
4   M18   AX00001315   ACACAGGTGCGGTATTACTTGTAACCCATGATCGTTATTTCTTAGATCGTGTGAC
4   M20   AX00001316   GCAAGGCGTCGCGTATGCACGAGTATGTGTTGCGGTGAATAGAGGATTTCGAA
4   M22   AX00001317   CGATGTTTGTTATGATTAAATCTCTGAAAGATTCAAGTAAATTAGTACGCTGGCG
4   M24   AX00001318   CATTCCATCTTATTGGTTTGCGGTGCCTTTTATAAAGCTATCTATCGTACTTGGA
4   O02   AX00001319   CCTCCATCTTCACCATCAATGGCATTATTAAAAGGAAAAGAAGTTGTTCACTTCA
4   O04   AX00001320   GAGAACACGACCCGTTTGTACAAGCCACGCAATTAGAGAGTGGAATGACAGTG
4   O06   AX00001321   ATACCTTTATGTGCGCGTTGTACAGGCATGCTTATCGGTATATTAATGTTTCCAA
4   O08   AX00001322   CAATTTATAGGACGTTTAATAGACAGAGGATTAACATATGATGATGCGCTAGCTC
4   O10   AX00001323   TCGTTACAATTAGACGCGGATCAGCCGATTGCTTGGAGTTTTCTCGCTTTATCG
4   O12   AX00001324   AACGGCATTACCGTATTACCGAATTGGTGAAACACTTATGGCATTAGGGCAATT
4   O14   AX00001325   TTAGCTGTATCAGCACTATATACTGGAAAAGTACCGTATAAACGAGTGCTATCAC
4   O16   AX00001326   AAAGATGCAATACAAAAATCAATGGCGTATGTTGGAGAAGCAAGTGAGCAAAAC
4   O18   AX00001327   GAAACGTATGCTTATTCACCAAAATCTTTACCAATCTCCCAAAACTCTGATCAATG
4   O20   AX00001328   TGTTTCACAAGGGGCAGAAGGAGGAGCGAATGTTTTTAAGCTTCCATACTTCCA
4   O22   AX00001329   GCGGGTCTTGCTATTTTTCCGGCCGTATTTTCATTAGGAATGGAGCCGACAGAA
4   O24   AX00001330   GAGTGGGAAGTATTTTCAAATCGCTCCAAGATCCATTTTGATAGATTAAAATTAG
4   B02   EMPTY        -
4   B04   AX00001331   GAATATGGATGCTGCTATCCCTTGGTCTGTAAAGAATCAAGCCCGTATGCATGT
4   B06   AX00001332   ATTGTCGATGAAGCAAAACTAGATTCTTCTATTGATTTAGAGAATATTATGCGAC
4   B08   AX00001333   CGTATAGTGGTGTTAGTGTGTATGTAGTAGTGTTTGCTGTATATCCGTTCGCAG
4   B10   AX00001334   GAGGCAAGAGAAGCGATGATGATAGCGTCCTTACAAGCTGGAATTGCATTTTCT
4   B12   AX00001335   ATATTCAAACAGTTGGTTTGCTTGGAACTAAATATACAATGGAGCAAGATTTCTA
4   B14   AX00001336   ATGCTATTGATGGCACCCCTATATTGGATATAAAGCCAATAATGAAAGAGTTTAT
4   B16   AX00001337   TGCAGAGCAATTAGCAAAGAAGCATAATTGCATTGGCACATGGCTAGTTAGTGG
4   B18   AX00001338   CAGCTGAAAGAATTTGTGAAAGATTTTTACTCATCTCACAAGGTACATTAGTCGC
4   B20   AX00001339   CGGTCGGTAACAGATTGGACAGTCGCATTATATATTATTATTCCAGCATTTATAT
4   B22   AX00001340   ATATTGCTTGATAATGCCAAAGCTGCGGACAAGCCTACAAGCACAGCTGGGCAA
4   B24   AX00001341   AGGTTACGGAATTGCAGTCATATCATCGAACTCAGAGGAGCATATTCGGGCGTT
4   D02   AX00001342   GACAGTTTTCTCTTCAGTTGTCTGGACATTACGAGCAGCACCGCATATGTTAGA
4   D04   AX00001343   ATACACCACACAATTCAATTCCAGATCAACCAGTTTTATCACTTCCTGAATCTCC
4   D06   AX00001344   GTAAAGGTTTTCCTTTATTAACGACAAAGAGAGTGCCGTTTCGCCTTGTAGCAAG
4   D08   AX00001345   TACCTTGGCGTTTACCGAGTGAATTGCAGTATGTAAAGAAAACAACGATGGGTC
4   D10   AX00001346   CTTGGAAAGTAGATTGGACTCCTGACTTTATCTTCCCAGGTATGACGAAAGATAG
4   D12   AX00001347   ACGAAGTTGTAACAATTGATTTATTCAACACTACAGTACCAGCAATCGATGCAGA
4   D14   AX00001348   CGAAAGACAAGCCGGTACTAGTTGTAAGTAATCACCAGAGTAATATGGATATCC
4   D16   AX00001349   ACACATGGTATCGGTGCCATTTTAAGCATCCCTGCCTTAATCATATTGATTATTC
4   D18   AX00001350   ACGAAGGATATTTATTTTTGGCTTGTCAAAGATTTACCAATGAAATTAACTGTTCT
4   D20   AX00001351   ATCCCTGTCCTACAGGCGCAGCATCCATTATCGTTTCTAATTCAGTCTCGTCTTC
4   D22   AX00001352   GCATCAATGACCGACACAAAAGTAACAGTTGTTGATTCGCAATTTATTACACATG
4   D24   AX00001353   ACTGTCACATGGATTGGGCATTCCACTTTTCTTATCCAAACGAATGGACTTAATA
4   F02   AX00001354   GGATGTAGTGGATCAGGTTCAAAGCTTCGTAAACCATTGAATTGGGATTTAGAA
4   F04   AX00001355   AAACATCCCATAACTATTATCGCCGAGAACGTTCTATTTCAGAAGCATCCAGATT
4   F06   AX00001356   TGGTGGTTATAACATTTACCGTGAGCCAAACTCACTGAAAATGTTCTCTTACATT
4   F08   AX00001357   AAAGAATGGACAGAAGATCCACTCTTTAAGCAACTGCAGGCTTCTAAAGATAATA
4   F10   AX00001358   AGCAGGGAAATTACTTACACGTTCTTTCGGGCCATATGCAACAGCTTTCTCGGA
4   F12   AX00001359   ACATTCGTATTTGTAGATCAAGTGTATGCAGATAAACATCAAGTAACTAGTACAA
4   F14   AX00001360   ATGGCACATATATTCGTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAG
4   F16   AX00001361   TATTCGTTTTATGCAAATTCGTGAATGGTCAGGAAAACTCCTTACCATACCACAT
4   F18   AX00001362   CAAAAGAAGAAGCCGATGTGTGAAGGAGACTGCTGGTGTGTAGAGCGTTTTGT
4   F20   AX00001363   ATTAAGCAGTTTTTCAGAGCAAGATTATGTTTTACCAGCACTAGAAGCTGGAGCA
4   F22   AX00001364   CAGATGGCCGTATTCTTGGTCATGAGGGTGTAGGTATTGTGACGAAAATCGCTG
4   F24   AX00001365   AGATACCATCCCAAAAGCTCCCCAGTTACTTTACAATGACAATAACGAATTACTT
4   H02   AX00001366   AATGGATAAACCGAATTGTGTTCATATTAGAAGCTGTCCCTGATATGATGATGAT
4   H04   AX00001367   GGTAGGTTCTGCTTCAATTGTAGGTTTAGGTGAAGCCACGCATGGGGCTCATGA
4   H06   AX00001368   ATATTAAGTATTGGCTTACACGCCTTTTAAAAGCTTCCTTACCATGGAAATCTGT
4   H08   AX00001369   TTAAATATTCACTTTTACTTATCAGGAATTCTTGAAACACCTCGCGTTTCTTATGC
4   H10   AX00001370   TGATGGGGTAGTATTATGTACACCAGAATATCATAATGCGATGAGTGGAGCGCT
4   H12   AX00001371   AATCGGCATAGCTGTAATCGGAATAATGGTTATATGGGGATTTGCTGGGCAACC
4   H14   AX00001372   TAATACGTATCATTTATATAGAACGAAAATAATTGCAAAGCGTTTAGGCATGAAG
4   H16   AX00001373   TTGGTATTGATCGGAATGATCATGCACTTATTATTTTAGGGGCCGTACCAGCCG
4   H18   AX00001374   GTTTTTACTTGTTTCTGAAATTTCCCACGTAGCAGGAAAAGATGGCGTGTTTCCG
4   H20   AX00001375   TCAGAAGAATTTCAAGCTGTAAAAACGATTATACAAACAATTGAGCGTAATGGAT
4   H22   AX00001376   TACTTTACAAGGTGTACCAGTACGAATTCATGCCCGAAAAGGGGCTACGCATTT
4   H24   AX00001377   ATTACGAGAAGACTAGATCGAATGGAAGAACAAATGCAAGATAAGGCAAATGAT
4   J02   AX00001378   GCAAAAGAAATAATGGTACCCCGAACTGAGATGCATATTATAAGGAAAGAAATG
4   J04   AX00001379   AAGAAGAGAAGAATTTGCAGAGATTATTGCAAAAGAGGCTGCAAAACCAATACG
4   J06   AX00001380   AACGTAATATGTATTTAACTACATTACGTGAGCGTGTAGAAATCGCTTTAACTAT
4   J08   AX00001381   GTACTCTTTAAACAAATAACAGATTTTTTAGAAGTTAGCCCTGGTACAGCTGATA
4   J10   AX00001382   GCAGGAAAAGAAGATAGTGCACTGCTTGTGGCACCGCCAATGACAACTACATAT
4   J12   AX00001383   ATATGACATTAATGTTTGGGGGATTTGGGGGGATCGGATCCCCTCCATCTTTAA
4   J14   AX00001384   TTGGTATACCATCGCTTGTACCAAATCATTTGCCTGACGATATAAACGTTATGTT
4   J16   AX00001385   ATGCGGTATTGCGCCGAATGAGACTATAGAGGCAGCAAAAGAAGAGTTTGAGAA
4   J18   AX00001386   ATTCTTTCACTAAATGTATTGTTAAAGGAAAGGGAGAGCATGTTTCCACATGGCT
4   J20   AX00001387   TGCAGAAGGGAATACATTAACAGCCAATTGTTTACCGCGTACATTTCGGAAAGA
4   J22   AX00001388   CTATGTATTGTCGTTACTGTACACGCCGCCGTTTTAGTGGACAAATTGGAATGG
4   J24   AX00001389   TACGAAAGCCATTGAAATCCAAGAGACACCATGCATTTCTTGTTCCTCATGTGGT
4   L02   AX00001390   TGTATGATGATTTAAGTTTTCCGAAGCAATCTGAAGATTACGATGAAATTAGTTC
4   L04   AX00001391   GAATGGTTAGAAGCGGATGAGTCAGATTTAACGTTACTTGCTAATGCTCAAACG
4   L06   AX00001392   ACAAACAAAAGAAGAGTTCATGCATGAAGATCAATGGGCAGACTCTCTTATTAAA
4   L08   AX00001393   AACGAGCTACAACTTATGAAGGTGAACAAGCTTTGATGCGAGAGGTTCACTTTC
4   L10   AX00001394   AGCTTTGTTGTATTATCTATTTCAGTTAGCCGAATATATCTTGGCGTTCACTATCC
4   L12   AX00001395   TAGCGATATTAATTGGTCTAAAAATCTCTCGGAAACCTCGTGATCCAGATCATCC
4   L14   AX00001396   TACATGGTACCCAGATTGCGTGCGTATGGACAACTTTATCGGAGATGTGATGGA
4   L16   AX00001397   GATTATAGAGCGCGTGTAGAAATTCGTGTGAATGGAAACGCAGCAATAGCTATA
4   L18   AX00001398   AACAATTATTTCATGCGTAGTACTGGCATTATCTGCATGTGGTTCCTCAGACAAC
4   L20   AX00001399   TGATGTAATTGTTTTTGGTCCATGTTTTTCAGATGAAAGTATGCTTGAAATTGTAC
4   L22   AX00001400   TCTACAGCGATTGGTACAAACGAAGTATCACCAACTGAAATAGCGGGTGCTTAT
4   L24   AX00001401   ACCAACTGAACTTGAGGAGAAGATCTTCGATCGTTCCCTTGTTTTATATAGTGAA
4   N02   AX00001402   TACAGTTTAGATTACCTTGACCCGAACAAGCGCTCAATCGCCAACGCTGTTCAA
4   N04   AX00001403   TAGGGGAAGTTGGGAAAGGGCATCACGTAGCTCTTAATATTCTTAACTTCGCTA
4   N06   AX00001404   ACCTATTAATTGGTTTTTATACAGCTGGTGTGAGTGAAGCTTTAACGTTAGCGAA
4   N08   AX00001405   GTAAACATGCACAAACGTTCCGTGATAACATCGATGCGGGTATGATCGGTGTAA
4   N10   AX00001406   TTTTAAATCCAAATCATAATACGTTTATCCAACTTCTCGTAATGGGCCTTACTTAC
4   N12   AX00001407   CAAAATGGGCAATGCCAGAAATGAATATCGGCTTCTTCCCAGACGTCGGTGCTG
4   N14   AX00001408   CGCAGTATTTTCATCATACAGATACGACAGAGGAAGTGAAGGATAAAGTACGAC
4   N16   AX00001409   TGGACATTTACATCAAGCGCATTTCGTACGTAATGAGACAATTCGATATTCAGGT
4   N18   AX00001410   GACTTACAAAAATCAGGCCGATTTATCGGTGTCATTTCACACGTTCAAGAGCTG
4   N20   AX00001411   CTACTGTTTCACAACATTTATCAAAAATGAAGGGTAAAGTGTTACGAGCAGAGAG
4   N22   AX00001412   ACAAGCTTCCTCATTAATATTGCTTTATGTACTAGCGGGAGTTGTTGTAGGATAT
4   N24   AX00001413   AACTTAGTTTCTCCTGGTTCTACTGAAACTGAAATGCAAAGGTTACTATGGGCTG
4   P02   AX00001414   AATCCGAATCCTATCGTTGTGGGGGCTTTGCCATTTGATCGTAGAAAAGAAGTC
4   P04   AX00001415   GAGAGCGTCTATATGGCAGTTCTTCCAGTAGCACATAATTACCCAATGAGTTCTC
4   P06   AX00001416   GAACAAGGAAGAGATCAACTCATTATTTGCGGTATTTATGCGCATATTGGCTGC
4   P08   AX00001417   TTCTCGGTTTGGGAAATTTGGGGACCTTTATTATATGGAGGGCGTTTAGTCGTA
4   P10   AX00001418   GTTGGGTATTTAGTTAGCTTAGCTGTCTTCCTTCCGATTTCTGGTTGGCTAGGA
4   P12   AX00001419   AATGAATCCGAATGTGGATGTTATGAAAATGGCAGAAGGCGTATTAACAGACAT
4   P14   AX00001420   GCATTACAATCTGGCGATAAAGTTCAATTAATCGGCTTTGGAACTTTTGAAGTGC
4   P16   AX00001421   CCATATACTTTTATGGATTGTCCAAGTTCATTACGTTTTGTCTTTTATACGATTGG
4   P18   AX00001422   CATATTGCATGGTAAAAGTATGAATGAAGCAATACAAGACCGAGAAAATTTACGA
4   P20   AX00001423   CAGGAGTCGCTGCTCTTTTAGCAAATCAAGGATATAGCAATACACAAATCCGCC
4   P22   AX00001424   TACTACAGGCGCATGGAAATCTGGTAAAACTGGCGTTGAAGCTACAACACTTGC
4   P24   AX00001425   AACCTAAAATTAATGAATTGACTACTAATTATAATGACATCATCGAAAAAGATTGG
4   B01   EMPTY        -
4   B03   AX00001426   GTGTAATGCCTATTATAAAGGTAAGTGGATGGGAGAACTTAGGGGAAAACGGGC
4   B05   AX00001427   AGGTGAGGCATGTGTATTTACTTTATGGGAAGATCGAGGTGCATATCAATCATT
4   B07   AX00001428   TCGCCATGAATTTAGTGGGGCGTTAAACGGATTATTAAGAGTACGTACTTTCTG
4   B09   AX00001429   ATAGTTTTACATACGCACAGCTACGCTTTCGAGTAAATAGTTTATCGAGAGTATT
4   B11   AX00001430   TCAGACCAATATGGTGCAGCAGCGGGGATTAATCAAATGGTAAATAGTTTGTAT
4   B13   AX00001431   TATGGGAAGTGCTATCGGTTCACTTGGCTATGTCACAATTCATGAAATGCTTTGG
4   B15   AX00001432   TAGGAGACTGTCTATATGCAGATATTTTTTCTTCTAAGTGGAACTATACGACGAA
4   B17   AX00001433   CAGGCAATGTACATGAACCTGAACATGATGGAACAGCCGAATGGAATTCGTTTT
4   B19   AX00001434   CAAGAACTTCCGTATTGCGGTGGAATACTAATTCTCCATACTCCAGGGCATACT
4   B21   AX00001435   ATTTACCGCTACTATGATTCAAATGATGATACGTATACGTGAGAATATGTCGCAA
4   B23   AX00001436   ACCTATTCAAAATGATAATACTGCAAATCTTAATATCGAAGAACAAGCAATGAAC
4   D01   AX00001437   TACAAGATTGTTTTGAATTTGTAGAGTTAGCAGTTCATCCACAACATCAAAATGA
4   D03   AX00001438   TCATTTGTTGGCAGCAATATAAGGAATATGAATATGAGCAATTGTAATGTAAGTC
4   D05   AX00001439   GACGTTTTACCTTATATGGTTTTCTTACCTAGCATGCGTGTAGATGCGATGGAAA
4   D07   AX00001440   TACAATATACTTCTGTAGCAAGTTCTACAGTTATCGTAACGTTACAACCTTTATTC
4   D09   AX00001441   AAAAGAAACAAATGATATTTGGCATGCACATTTCGGAGCAGCTGCAATTGCTAG
4   D11   AX00001442   GACAAATTGCGCCAGTGCTTTCAGGTGTATATTCTGGTAAATTGAACGAGCTTA
4   D13   AX00001443   TTCATTGGATGAGGTAACATGTTATTACGGCATGAATTCTTTTACGGAGTTTGGA
4   D15   AX00001444   GCTGCTGGAGCAGATTTAACTTTTGCTAACACAGACTTCACTGATGACACTGGT
4   D17   AX00001445   TAGACCAATGGTAGATCGTTTTTTACGTCAAAGCGGGAATATTCCAGCTAAAACA
4   D19   AX00001446   ACCCTAGTGAACAGCTGTATCCAATGCCATTATATGCAGAAGGGAAAATAGATA
4   D21   AX00001447   ACGAGCATGGATTATCTGTTACATTTTCAGCATGTGGTCAACCGGTAGGAAATA
4   D23   AX00001448   GAGATATTCGTGAAAAATTATTACAAAACGAATTAGATATTGGCATTACATTTCTA
4   F01   AX00001449   CACTATATTTTCAAGAAACAGGATATACGGGGTTTTATTTTCGCGTATTAAAAGA
4   F03   AX00001450   AAGCTGAAGTTCAATTGCGTATGAATCCAAATTCAAAATTCGATCAAGCCGGTCT
4   F05   AX00001451   GAATTATGTAATAAAAATGGGGCTTCTTATGATAGGAGCTGCAGCACTCGGCTT
4   F07   AX00001452   AAAACGATTTTAAAAGAAGTGAGTCTTAAAGCGCGGCCAGGGGAGACAATTGCT
4   F09   AX00001453   AACAACAATGGAAACAAGCGGTTTCTCCTATCCAATCAACTGCTGTAATTGGTCC
4   F11   AX00001454   ATGGTAAGACGGAACTTGGCCATCTTCATGGTGATAAATTAGTTGATTTACCATT
4   F13   AX00001455   AATTCCATCTACAAAAGCACATGGAATATGGAAAGGGGATATATTCACCATCCCA
4   F15   AX00001456   GCGGATCGAATTATACGTTTGTTCTTTGGGATTGCGCAACGATTGACAGAAGCG
4   F17   AX00001457   GTAACAACTGTAGAGCTTTCCTCAGAACGAGTTGGAGAGGCACTTGCCAATTTT
4   F19   AX00001458   ATGACGCAAAACGTTGTAACAGTTTCCGCTGCTATTCAGCTAGCATTAACGAATC
4   F21   AX00001459   AATCATTACCGTTTCTACAAGAATTTACACAACATCCACTCTTTTATCGCTGGATT
4   F23   AX00001460   ACGTAAAGTTTGGTATAAGTCCGTTCGGCGTATGGCGAAATATAGCTGACGATC
4   H01   AX00001461   AGACACCGATTTGACTCTGTAAAAAAATTTGCAGAAGAGGAGTCTATTCCGTGTG
4   H03   AX00001462   TGCGGCAAGTGTTTTGCTTACAGTAGTTGTTTCTTTCATTGATGGATCGTTTGCA
4   H05   AX00001463   TTCCACATTGCAAATTGGGGAACCTGCAGTAATAGCATACGAAACGAACACGAC
4   H07   AX00001464   TGGGGCGCGTATATGGAAAAGGGTATTTCGTTGCTACATTTTTAGGTGATGCGA
4   H09   AX00001465   TTATCTGCTCATTTACTTGGTATTAAGAGTAAAATTGTTATGCCGATTTCTGCACC
4   H11   AX00001466   GTACATGATGGTCAAATGATTTTGAATAATGAATGTCAAGTAGTGGAAACGCCAG
4   H13   AX00001467   ATCGCAAAATTAAGTGAATTAGAGTGGTTTCGAAATCTACATGAAGATCCGAAGT
4   H15   AX00001468   TATAATTGTGCTGAACTTCATGGTGATATACCTCAAGCGAAACGTGAAAGAGTTA
4   H17   AX00001469   CACTACTACTACCTAGTACAGGCCCAAATCCAAACATTACTGTCCCTGTAATCAA
4   H19   AX00001470   GTTGTATCCATCTATGTGATTACTGTAGTCCAAAAGAAAACACCAAATGAAAACT
4   H21   AX00001471   TTTACGATTTCAGCATTTGTTCGTGATGTTCAAATGAACCCATCAATCGTTAGTT
4   H23   AX00001472   TTTTCAATTTAGAGGTTCAAAATGAATTTGATTTTGTATACGATTCGGGCTGTTTG
4   J01   AX00001473   CCAAGGCCAAATTGAAGCGGGTTTTATTATAACAGGTTTTTATGAGGATGATTTT
4   J03   AX00001474   CTTGGTACACAGCTCGCTAATTTATCGCGGCGCAACATTTTAATTATTGGTGATG
4   J05   AX00001475   GATGTACAAAGACAACAAATGGGTGCTATTTTTTCAAAATTTGGTGAATCGTGTG
4   J07   AX00001476   TGGTGAGGAGCAAGTTCATATTTGGAGAAGAAGTATTGATGTAAGACCACCTGC
4   J09   AX00001477   TGGCGGTCTAAAAGGCGGACATTCTGGTATGGAAATTGATAAACAACGTGGTAA
4   J11   AX00001478   ATAAGCTTCATCATATTGACTTTTGGAATCATCATGTAGTTAATGACAATACGCTT
4   J13   AX00001479   ACCAAGTGGATTGACAGAAAGTAACCAACAAAAGCAAGCACACTTTATATATGCA
4   J15   AX00001480   TTCTCTATTCATTGCATATGCTCCTACCGAAGATCCACAGATTGCCGTTTCTGTC
4   J17   AX00001481   ACATTCGTGACACCAGTACAGCGAAAGCAATTGCTACGAATCTTAAAGCTTTTAC
4   J19   AX00001482   AAACCTGTATTATGAGGTATTTAAGAAATATGGCCTTGCTAATGAGTTACCTAAT
4   J21   AX00001483   ACATAGAATTATAGCTACATGTCAGCCAGAAAATACCCCATCATATCGAGTGATG
4   J23   AX00001484   AAAAGTCTTATACTTGCTGAATTCAACTACGAACATGAGCCTCAAGAAACGTTTC
4   L01   AX00001485   CCCAATCGTTTTACAATGTCGAACCGGATTACGTTCCGCTATAGCAGCTAGTATT
4   L03   AX00001486   AAAAATATGCAGAAACATTACAATATGCACATTTATATCCCGACACAGTTATATTA
4   L05   AX00001487   GTGGGGATAGATCCGCTTCTTAGAAAAACGATTTGGGAAAAATTTTATGATTTGA
4   L07   AX00001488   CCGCTCACATACGGCGCTGACGCAATGAGACAGGTGATGATTCGAAATCAAGG
4   L09   AX00001489   AAATGAACGTCAAATGCGTATATTAGAGGCGGCTGTTGATATGTTTGGAGAAAA
4   L11   AX00001490   GGAACTAATATGAATAGAGTTAATAACACTGACATTTCAACTCGAGTGAATGACA
4   L13   AX00001491   ATTTGCAGCCATTTGTTACATTTATACCTGTTTGTCCAGAAGTCGAGATTGGATT
4   L15   AX00001492   AAAACAAGAGCACAAAACTTCTTCGGTAATGGAGAAATGTATTTAGAGCGCTATA
4   L17   AX00001493   GGATGTCGTCATTTTGGAATCTATGAAAATGGAAATTCCAATCGTTTCAGAAGAA
4   L19   AX00001494   TATGTGTCTACTGTATTTGGATGTCCTTATGAAGGGGATATAAGTGCCATAGCAG
4   L21   AX00001495   AGAACAAGTTCGCCATGCTGTTAGTATGATTCGCACTACTATGGAAATGGTTGA
4   L23   AX00001496   GCGCCGCGGTGCAGGAAGAATCTTCTATAATCAAGTGAAATTATCAGGTAAAGT
4   N01   AX00001497   AAAATGGTACACCGTTTGCACAGTGGTATAATGGCGGAACATGTAACGTTGTAG
4   N03   AX00001498   ATGAAAGCAGTACTTCATATTGCATTTGATGAATTAAAACTACATAGAGTAACGC
4   N05   AX00001499   CATTAAACTCCAAGGTGTTGATGGCTTACAAACTAGTTTTTCAACTAATAGTAAT
4   N07   AX00001500   ACACCTCTTACCTCTATAGTTGGATACGTAAATTTAATCCACCATGATAATTATAG
4   N09   AX00001501   CGTGAAAATAATACTGTACCTATTCTTATGCTGAGTGCAAAAGCAGAAGATATGG
4   N11   AX00001502   GAAGATGGATTTAGTGTTATTTGTTGCTGATAAAATAGAATGGGATCAAAATGGG
4   N13   AX00001503   ACATTTTTATCTGGAGATCAACGTATCCGTAGTTCAGAAATGAGGTATTTACTCC
4   N15   AX00001504   ATGGGAAGTTTTATTACAATGAATGGGATGCAAACGACGGTGTTATTTTCCGTTC
4   N17   AX00001505   TAGCTGCTCATCCAACTAATAAAGATACGAGAAGTTTTGATTTCTATTCACAGGA
4   N19   AX00001506   ACAATTACGTCTCCTCGAAGACTCAATGAAAACGATGAGAGAGGATGTTGTTGA
4   N21   AX00001507   TCTACTCGAAATTATCGCACATAGTTATGTTAAAGAAGATGTATTAGTACCGCAA
4   N23   AX00001508   AGAAAAATAGAGGTTGAACAGTTGCGAAATAGGAAGAGTGAGCTATTTGATAAA
4   P01   AX00001509   GCATTATCAGTCTAACGTCATACATATTGATGGCTACGATAACTGGATAGCAACG
4   P03   AX00001510   TGAAGATTCTATAGTTATGGATATTGCTACAGCAGCGGTAAAGGAGGAATCTTTT
4   P05   AX00001511   TATACGTGCGCTTTATGAATTGGAAAAGCGTCATATTATATATTCTGTCCCTCAA
4   P07   AX00001512   AAAAGCTCCAATGTACGGAAAAGGAAAACAGTTGGATAAAGATTATTATGAGATA
4   P09   AX00001513   GCTCTTTGGTATTTCCGTCCAGTTGGAGCTTGTCCGCCCGAATGGTATAACCAG
4   P11   AX00001514   ATTTCATGTGGCACACCGCATGATCACGGCGGGAATATGGACTGTAAAGAGATA
4   P13   AX00001515   ATAGCGAATCCTATGTTGATGATAATACATTAAGTGTAAATACAACACGTGTGCG
4   P15   AX00001516   GGTTAGTTCCATCCTTTTTCGTGGCTAGCCTTAGTTATTCTAAGCGTACAGCTAT
4   P17   AX00001517   CATGCAGTGAGAATTACGACTAACATAGATGATCACATATTAAAACTAGGAATAT
4   P19   AX00001518   TAAACATTACAGATATATTGAGTAAAAGAACGTTTGAAATATCAGGGGGGCAAGC
4   P21   AX00001519   TCCATCTAATCTTGAGCATAATACTATCTCTTCTACTAAACTTGAAAGTAAGAAAG
4   P23   AX00001520   CATAAGTGGTACAGTGCTGGTAGAATCAACAGTTACAAACCTTAAAGATGGAAA
5   A01   EMPTY        -
5   A03   AX00001521   ACTTAGTGTAAGCAGAAACACTGTACTCGCTGCTTATGCAGATTTAGAGCAAGA
5   A05   AX00001522   CATTACACGGAAAATACGGAGAAGATGGGACAGTTCAAGGAACGCTTGAAAGTT
5   A07   AX00001523   GTGCTTCAAGATTCCTATTATTTGAGTCACTTTGCTAGAGTACAAACATTAGGAG
5   A09   AX00001524   GTTTTCCTTGAAACCACCGCTCCACAAACTGTATTTGAGGATTTTACAAACAATC
5   A11   AX00001525   AGAGAAGGATTTGCACGAACAAACCGTATTTCAGCATTTATTAATTTATTTATAG
5   A13   AX00001526   TTCGGAAGAGACTTATGGTTTTTTCCGACTGAAGTGAGAAGAAACGGAGTATCA
5   A15   AX00001527   AAGAAGACTTGGTTAGTGCTTTAATACTTGCAGAAAGTGAAGGACATAAACTTAG
5   A17   AX00001528   AACTTTGCTAGGGCTTTGCTTTATGGCAGCAGGACTAGGGATAGGATTAATTCA
5   A19   AX00001529   GCAAGTGGAGTTACCTTTATTATGAACGGAGCGAATCATCGGATGGATGGGTTT
5   A21   AX00001530   GCCCTCACTTTTGCTTAGGGGCACCACTTGCGCGTTTAGAAGCTGAGATTGCAT
5   A23   AX00001531   GTTTATTTAACTCATACAGGAAATCTTTATTTGGGAGAAGGAGAAACAGATAAAG
5   C01   AX00001532   ATCAGCTTTATACTGATAAAGGTGTGTACGTACCAGATTATGGAGTAGAGAGTG
5   C03   AX00001533   CAGGATCCCCCACAAAATTTTACGTACCCGCAGAAGCTTTTATGGGAAAAAAGT
5   C05   AX00001534   CGCTTCTTCATATTGGTGATGTAAGTGCTAAAGAAATGGTAGAACAGAATATTAA
5   C07   AX00001535   TATTTGCTGGGGCATTCGATATTATTGTGATGGGAGAACCGTTTGATAAAATTGT
5   C09   AX00001536   AACATGTAGGCACAATTTTGCAAGATCAAGATGCACAATTTATTGGTCTTACAGT
5   C11   AX00001537   CGGTATTCCAGATTATTTTGATGAAAGTATTATGGATAACTTCGAAGATCTTTGG
5   C13   AX00001538   GGAGAGATCCTGCAAAAACATTATCAAAGTCATGAAAAGATTATTTTTTCTAATAC
5   C15   AX00001539   GTGAAGAAGGTGTGCGTGAGCGCGTTTATAATGCTTTAAACGAAGGTAAAACTG
5   C17   AX00001540   GATGTCCAGCTTTTAGGAACGAAAGAAACTCATATATCCATGTCTGGCTTGCGC
5   C19   AX00001541   ATTAAGTCCACTCTCTATAGAAACTTTTTTGAAGGAGTTGGAGCAGGCCGTAGC
5   C21   AX00001542   GTGGTGCAACTGATGCCCTCGCGAATATGGGATACTTGGATACTAGAAAGCATA
5   C23   AX00001543   AGCAGGATGAAGAGGGATACTACGAATATTTTTACAAAGGAGTCAATTTATCGTT
5   E01   AX00001544   GAAGTTCCCTGTTATACATAACACCAGCCTCAATTGTAAAAGCAGAACCCACGC
5   E03   AX00001545   AAAATCTACAGTTTCAATCCATTGATGAAAGTACTTCAAATTATTTGAAACGAGG
5   E05   AX00001546   ATTTATAGTTTCGCCTTAGGATTGTATGTATTACAAATAACCGGATCGGCTTTAA
5   E07   AX00001547   ATTGGTGTAGTATTCGCTGATTTATGTAGTATAGATCGATTTAATTTCGAGTTTG
5   E09   AX00001548   TGGTGCTTCTGAAGCAACAAGTTCTCTATATTTAACGCCAATAACTGCATGTTTT
5   E11   AX00001549   TAGTCGAGTACCTTTAAGAATTGTAATGGACTATGCGATGTACGGCGAGAAGCG
5   E13   AX00001550   ATTGGGATCCACAACAAAGTCAATATCCATACTACTATATTCAAGACGATGCACG
5   E15   AX00001551   TGGACAATCTTGGGCGTATAGAGATATTAATGTAAGAATGATGACACGTCTTATT
5   E17   AX00001552   GGATCATTTATTGGAGCGATACTCGGGGGATTTCAACCAACTTTCATTATAATCG
5   E19   AX00001553   TCTGGACGAGGTATGACAGATAGAGATTGTTCATTATGGTGTTCATGGCTTATTC
5   E21   AX00001554   TTGAGAGTAAGTTTGGTGGTTATCCGTATTTACCTATAAATCAAGAGCATCCTAA
5   E23   AX00001555   TCAGATGACTCAAAAAGGCTCAAACACTACTTTAGTGAAAAAAAGACTCAAAGCA
5   G01   AX00001556   ACCTAATGAACTAACGAAGGCAATTAAAGATTTAGATCAGAAGCAGTTAGACACA
5   G03   AX00001557   ATACAGAAACTCGAATTAGTTCGCTAGGGTATCGGGTCGGAGAAAAATTTACTA
5   G05   AX00001558   TGTAATATGCTAATGTCTCCAAGTTTCCCTGATAATCCTTATGGCGTTCTTATTC
5   G07   AX00001559   TTACGCCAATCAATGGTTTTATCGACTTCCACTTGTTCCCTAGAGATAAAGGCGG
5   G09   AX00001560   AAATCATTGGTACAATCGAAGTTGGTCCAGCAAGTACATTGATTAATAGTTGTAC
5   G11   AX00001561   CAAGGATTAACCCCCTGTGATGTTCACGGGAAAAATGTGATGATGGAAAAAGGA
5   G13   AX00001562   AGAATGTCCATATATACAATTAGATTCTGTGTCTTCACTACCAGTAGAGGATGTA
5   G15   AX00001563   AGCATTAACAGTTGCACCTGGCTTAGAAAATGCTACCATGCTTGAAACGAGAGT
5   G17   AX00001564   CAAAAAGATTGGGCACGTAATTTATTTTCTGTAAAACAAGAAAAAACACGTGAAA
5   G19   AX00001565   GATACTATGGCAACTGTTCAATATGAGGTAAATGCGAAGCATATTATTATCCATA
5   G21   AX00001566   GATAAACGTATATTCGAACTAGCATTAAATAAGCTAAATGTACAGCCGGAAAATA
5   G23   AX00001567   GTATTATGGCGTATCGTTTGTTATCTATCGCTCGAGGCGAGACAGCGGAACTTC
5   I01   AX00001568   GCGGACGAAATACGGTGATCATAATAGTTACAAATCTCCAGATTCGATTAACCAG
5   I03   AX00001569   GAAATACGTAAATAATGGAAGCTTTAACTGGACGATGGGAGAACAAACTGGATC
5   I05   AX00001570   AAATAAACTTTATCCACTAGAGCAATCATTTATCGGAATTTCATTAGATAATCCTG
5   I07   AX00001571   TTCCAGTCATCTTTGCTTCCGCATTTTTAATGACGCCGCGTACAATTGCGCAGC
5   I09   AX00001572   GTGGCCTATTTTATATCTCATATTTATCGGATCAATTGGTGGGCACGGATTATAT
5   I11   AX00001573   GATGATATTTGTCAAAGTAAAAATCCCGTTTTATTGTATACGAATCCAACTTTCCA
5   I13   AX00001574   TAAGGCGCATCTATTTGGTATGTCATTAGGTGGTATGATTGCTCAAATTGCTGCT
5   I15   AX00001575   CGTCAAAGCCCAACTTCTAGCCATATTAATATTCGATATGATTTATCTGTTGCTC
5   I17   AX00001576   AATGTCAATTATACGAATAAGTCAAATAAGCCAAATGAAAAAGCAGCGGATCATC
5   I19   AX00001577   CATCTGAAGCTCGTTCAGATGTAGGGCAACTTCCTTTAACATTAATGCCTTTTAA
5   I21   AX00001578   ACGGATTTTATACGGGAAAAGTGGATGGTGTTTTCGGATGGGGTACATACTGGG
5   I23   AX00001579   CAAATATATATACCGGCTCATCAATTGTTCATGCGCAGCCGCCGTATGCGAAAT
5   K01   AX00001580   CATTGAGTTTCGTGACTCGCTCGGTCAAGCTTCAGGTTTTCAATCGTATCAATAT
5   K03   AX00001581   GGTCAAAAGAAGAGAGTGGCTCAGTAAATGTCGGAAAGTTAACGATGAGTATTC
5   K05   AX00001582   ATTAGAGGATGAAAAACGAGGCGGGCATATTTATTTAGAGCATGCAGAAGCAGC
5   K07   AX00001583   CTGGCGGAGAATACTGGAGCTTGCCAGCTGGAGCAATTGAACCTGGAGAAACT
5   K09   AX00001584   ATCTTGGTTTTGATGTTCATTATATGTATATGGATCCCGGACATTTATGCTTACG
5   K11   AX00001585   CGATACACCCCATATTATTTCACTAGGTAGTGAAATGAAGCAAGGATATTCAGCG
5   K13   AX00001586   TAATGGGGTATTCCATTTATAGTTGGAATGATACTTCGGAACTGAGTATGCTAAT
5   K15   AX00001587   ATGGAACTGAATTTGAAGAACGAGGAATTATAAAACCTATTTACTTGGAGTCGTT
5   K17   AX00001588   ATTGGTGTTCTAGATTTCTCCTGTCCAATTGAATTTTCGCATCCATATATGCTCG
5   K19   AX00001589   TGGTTCCAGGCTAATAGGACGATGGATGAAAGATAATAAGAATGGTACGACTGA
5   K21   AX00001590   TCGGAAATTAGAGTTCAGATCGATGGAGAAACTGAAAATATGGATAGAGAAGCT
5   K23   AX00001591   GATCTTGCGGAAAGTTTCGATATGTCTATCGATTCTATAAGAAGAGATTTGTCTA
5   M01   AX00001592   AGAGCGCTATTGAAAAGAATGCAATGCACTATGGGGAAATAGTTAAAAACGAAT
5   M03   AX00001593   CTATGGTACTGGTGGACCAAAAGATGTTGATATGCTGTATGATCCAATTGATATC
5   M05   AX00001594   TAGATATCATCCATGCAATTGAAGGTAAAACATCATTGTTTGAATGCTGTTTACA
5   M07   AX00001595   AGCTGGAACGACAGAATTTCTTCTGTAAGTACGGCTTCACCTTCTGCAAGTTATT
5   M09   AX00001596   TCAAGGAACTGTAATGATTCATACGGAAGTTACCGCTGATATTATGAGAGATTAT
5   M11   AX00001597   CTGTTGTATTAGCGCTTGGGGAGCATAAAGAAATGAACAGCGCTTATATAGATG
5   M13   AX00001598   GTTGATCATTTGCAAGATGATGAAGCATGGGGCGGTGTTCTTGGTGTTACGAAA
5   M15   AX00001599   GGTGAAGAAGCGGTAGCAGTTGGTGTATGTGCCCACTTAACGGATAGTGACAG
5   M17   AX00001600   GTAATAGTATAGCTGAAATTGTACAACATTTACTGTATTGGAACTCAACGTGGCA
5   M19   AX00001601   ATATGGGTAAAATACAAAAACATATTAATAGCGGCAGTGATAGATTTGGTAATCC
5   M21   AX00001602   ATACACCATATTGGCAGTACTGCTATTCCGCATTTAAGTGCAAAGCCCATTATTG
5   M23   AX00001603   GGCGCGTTAGTTTGGTCAAATGGTGATTGGGAATTTGCAGCTATTTTAGATGGA
5   O01   AX00001604   TACAATTACCACTCGCAACTGGAACGATTATGGCTGGTGTGAATCAAAGCATTA
5   O03   AX00001605   TTTTTAGGTATATTAACTGCGGATGATGCAAGTAAAGCCGTTCAAAAACAGTGGC
5   O05   AX00001606   GAACAAAAAGGCTACAAAGTTGAACTCATGTATTTAGAAAAAGCGGCAATTTGGA
5   O07   AX00001607   CAGGTTTTGCTATATTAGATACGATGAATTTAATTAAACCAGACGTGCAAACGCT
5   O09   AX00001608   AAAAATAAGAGACCAAATTACTTTTGAAGAACCACATGAAAAAATTGCAGATTTG
5   O11   AX00001609   GATGACAGAAAAAGGAATTGAAGATCATTTACGATTATCTTGTCAAATGCGTGTA
5   O13   AX00001610   TGAACTAGCATGGACCGCTTCTACGGATAATGTAGGGGTAAAAGGATATCAAAT
5   O15   AX00001611   AGACCGGATATGGGCGCGGGATGTGAAGAAAGATTTGATTTGCAATTTTTTAAA
5   O17   AX00001612   GCCCAAACGTACTTTTCAAAAATTCATATACAAGAGGACGCTAGAGATGAGAAAA
5   O19   AX00001613   AAGTTTGAAGTTTTTGGAGGGTTAATGTGGACAGCAATTTGGGCTACACTTTACT
5   O21   AX00001614   AAGCAAGAGCTAGTGACGAGTAGTTGGGATAAAACAGAGAGTAGGCCTCGTAAG
5   O23   AX00001615   GCAAATTATTTGATACAAACGAAGGATATCCGGCGATGACTTATTCGAATGAAGA
5   A02   EMPTY        -
5   A04   AX00001616   CGTGAAGTACGTAAAGAAATTGCACAAGGAGAAGGTGTACCTCCATTCGTTATT
5   A06   AX00001617   GATCTTGTTAAAGCCGCAAAAGCTGGTGACCAAAATGCAGCTGCCGCTATAGAG
5   A08   AX00001618   ATCACCGTATTGCTAACTTTGAAACAAGCGATCCTATTTACTACCGTTGTGAGCC
5   A10   AX00001619   AGAATCACCAGCGAGCCGTTCTTATTTATGTAAGCAAGGGGTAAATGTAAATTG
5   A12   AX00001620   ATTTAGTTACAAAGCCTAACGGAATTCATAGAGCCGAGATTTGTAAGTTAATGAC
5   A14   AX00001621   GTAGTTTTACAAACCAAATTCCTGAAATTGCTGAAACATATAATGCATTCACGCA
5   A16   AX00001622   CATCGCTTTTATGGAATCTTGGAGATTTAGGAATCGGTAGTATGGCATGGTTAAA
5   A18   AX00001623   TTTCCAAACGGTGTTGTAAACTTTGTTCCAGGGTTTGGTCCTGAAGCAGGAGCT
5   A20   AX00001624   TCGCAAAAAGAAAAGAACCATATAAAGTCGATTACCTTTCATGAAGATAACTTTA
5   A22   AX00001625   GGAGTATGACTGGATTCGCAAATTGTTAATGAATGAACCGCGTGGTCATGATGT
5   A24   AX00001626   ATTTAAGTGAAGAGTTAGAGCACTCATTTGAATATAGGGCGCCAGGAAGTATTC
5   C02   AX00001627   TCCAGCATTATGCATGAACTGCTTCATTACAATTGGCCAGGTAATATTCGCGAGC
5   C04   AX00001628   AATTAAAACTAAGAACACGTGCTGGCATGGGATTTTGCGGTGGCCGCACATGTA
5   C06   AX00001629   TGACTATGGTTTCTCTGCTGAAGTAGAGGTAAATGGTCGCCAGCAAATTTTAATT
5   C08   AX00001630   AACACAGCACCAAAAAGTAATAAAGGAAGCTTTATGAAAGGTTTATTACTAGGTG
5   C10   AX00001631   TGACCCAGCTGATCGAAGTGATGACTTAATCAATCCTGTTCATTTATATGGAGCT
5   C12   AX00001632   CCTCTGGTGTATTATGTTCAGCACATGATGGTCAATTATATGTGTATGAATACCT
5   C14   AX00001633   GGTCGCTGCAAACTATTACGTACCAAAAGGATTTTTAAAGGGTCCAGATAAAAAA
5   C16   AX00001634   TCAGCAGTTACTGCAGCACATTCAAATGAGTTGCATTGGAAATCCAAGTGCGAA
5   C18   AX00001635   GATGCGAATTGGGAAACTTGTATATCAAAAAGTGGTTATGTAATTTATGTAGCAA
5   C20   AX00001636   GGAGTAAAGGGCAGTTAGTACAAACGGAATTGCAACGCTTTGCGGTGCGTTGG
5   C22   AX00001637   CCAATCGATTAGTGTATACAATGCCTGTACTGCAAAAAGATACGCGTATAAGTGG
5   C24   AX00001638   TGAAAAACTACAGGAAGCGCATCAAGATTTAACAGATCGTAATGAACATTTAAAA
5   E02   AX00001639   CGTTCGCAAATACAAATCAACAAATTGAAGTATTTGATTGTCAAAAAGAAATGGT
5   E04   AX00001640   AGAGACACCAATTGGCCAAAAGTTATATTGGGATTATTTATGCTATGTAAAAGAA
5   E06   AX00001641   ATGTCGGGTCTTTCTTTTTGGAGCTGCTCCAGAAAGTAATAAAAAGGCATTAGAA
5   E08   AX00001642   GCACGTAATGCGATAGAAAGTGGTTGGGTAGATGCAGAACCGAGAGAGAATAA
5   E10   AX00001643   GTAACATTAGAGTCAGTTACATTATTGCAAAAAATGAGAGAAGGCGCTGTTTATA
5   E12   AX00001644   GTGTTGGACGATTAGTCCAAATAGATGAAGATACTTTAGAAATGGGCGGGATTT
5   E14   AX00001645   GTTATGGTTAATGCTTCTCAAAGCAAAGTAAGAGACTTAGGTGCTTACGATGTAA
5   E16   AX00001646   GAATACAAACGCTTTAGGAGATTCAAGAGCTATTCTATCAGAATCGGCAAGATCT
5   E18   AX00001647   CTTTTACTAGTCATGCTGGTAACCTCCAAACTTCAATTATTGAAGGAGATGATAT
5   E20   AX00001648   AGTAGCAGTGCACGAATTAGCGGATCAGGTAAAGTTGATGGCACAGTTCATGCG
5   E22   AX00001649   CATACGGACAGTTATATAGGTGGAAAAGAAAAAATTTAATACCGGAAGATTGGTT
5   E24   AX00001650   GATTGTTACTACAAGGTGTTGCAATCGGTAGTTTCGTTTTCGCTCAATCCGTTTT
5   G02   AX00001651   GAAAAAGGCACTCGTCATCTATTTGATTTAGATACAAATGTTGGATTCTTCGTAT
5   G04   AX00001652   TAAAATTCATGCTAAAGGACCGGATTTACAATATGTAGTTCAACAAGTTGAGTCT
5   G06   AX00001653   CTGGATGGATATGGATTGGTATGGATCAATTTGGTTTACATGCTCGAGAGGCTA
5   G08   AX00001654   TTCAAATTTCAGCAGCATTTTATTTCCCTGCATTACAATCTGTAATTCCACTCATC
5   G10   AX00001655   CCAATTAGCTTCCTCTCTGTGCCTGGTGCGAAAGATGTTGGCGTAGAAATCAAC
5   G12   AX00001656   CCCGGTGATAAACTTGATTTACATTATGAGTTAACTCGCAATCGCCGAGGTTTTG
5   G14   AX00001657   GACCAATATATTCGCGCTGGTGGAACCGGTGTTGGCGGTGGTACTATTATGGG
5   G16   AX00001658   ACCAACTACAGGTTTAGACGCAGCACATCGTGAGTTGTTTTATAGTTTACTACTA
5   G18   AX00001659   CATTTATCGGTGCAGCACCAGCTGTTATCGTAGGTCTGTTCGTATCTCCGATGC
5   G20   AX00001660   ATTTGTGATACTTGTCATGAACAAATGACAACAAATATTGATCGCCCCTTAATTC
5   G22   AX00001661   TTACAGATAGTAAAGTTGTGTTCCCGCCAGTTCAAACGCCATATCCTCCTATATA
5   G24   AX00001662   TAAAAACAGGAGAGTTATTCGGTCATTTAAGTATTAGTGTATTCAGGGCTGCGG
5   I02   AX00001663   AAATGGACAGAGTTTCAAAGTGGTCCTCCTTATTTTGAAGCAATTGCATCAAATC
5   I04   AX00001664   CACGTGAAAATGATCAAGTGAATTTATCAGCTTGTCCTGATCACTATGTACTAAG
5   I06   AX00001665   TGAAAGGATTTGGCATAAAAGATGTTGTGAATCATGCAGGTGTAGCAACGGGCT
5   I08   AX00001666   TTGAATGTTTTCGTACATATCCGAATGTAGTACGTAGTAACCATCCATTAGGAAG
5   I10   AX00001667   GTTATGAAGTATCAACAGGCGGGCTACCGTCAAGTAGCCAAGTTTTCCAATGTT
5   I12   AX00001668   TTACGGATACTTTGGATGATTTTATTGGTGCATCAAAAAGAGAAGAAGAATTGTT
5   I14   AX00001669   TAGAAAGAATGGAAGAATGGACAAAGTCTGATGATGAATGGATTGGACGAGCAG
5   I16   AX00001670   AGGCCACTACGTTGGGATGCACAGTATGACTCATAACTACAAGAAACTTTACAC
5   I18   AX00001671   TCATAAACAAGTTGTTGCGTTCCGTAACGGCAACTTCGTAAGCCCAACAGTTAC
5   I20   AX00001672   ACCCATTCGTTGGCTTCACACCTGAGCGTGAAGTAGGAAATGACTTATTAACTG
5   I22   AX00001673   ACCCAGCCGACTATGATGGTGTATCTTGTTTTAATAAATTTGAATTCGACAGATT
5   I24   AX00001674   TCGTACCACTGCATAATGAAGCACGAAATGGTCTATGGAACTTTATTTGCCAGC
5   K02   AX00001675   ACGGAAAATCAGCTCTAAAAGGTAATACAGTTAATAGTTACGGTGATCACCGCA
5   K04   AX00001676   AGACGCGAAAGAATACCGAGACTCTTTACCAGTACGAAAGAGAGGGGCAATTCC
5   K06   AX00001677   GCTGTTCGCCACGAGTTTTAGATGAGTTGCAAAAATCGTGGTTGGATCATGCTT
5   K08   AX00001678   ATTCCAAGCGAGTATTGAAAGATCTGATAGCTGTGCAGTACCAGCAGCAGGTGT
5   K10   AX00001679   GATGAAAGACCAAGGCTTAAAATTAATGCGCGGTGGTGCTTTCAAACCGAGAAC
5   K12   AX00001680   AGCGATTTATTAAGTACGCGGTAGAACATTTGGAAGTATTACATCCGCATACGAG
5   K14   AX00001681   CCATAATGACCCAGTAATGAAATATTTAGCAACTGGTTTACCACCAAGTACAAGA
5   K16   AX00001682   TCGAATTGGCAATACTGGTGCCATTATGTCGGATTTTTTACTAACATATTTAAGC
5   K18   AX00001683   CAACGCGCAGAGCATGTAGTGAAGGATATAAAATAACGTTAGTGAGTGATGCAC
5   K20   AX00001684   CGGACAAGGCACACTTTTAGTATCACAGGATGTTGTACGTAGAGATATGCTTAG
5   K22   AX00001685   ACAACTGCTACTGCAGAAACGATCGTAACAGCAGATGTACTCAACGTACGTGAA
5   K24   AX00001686   CGCGATGTATTCCACCTATATAACAACATGTGGGACCGGGACCTTCATATTGAT
5   M02   AX00001687   AAAGCTCTAACGAATGGAATAATGCAGGTACAGGGCATTCTGCGCTATGCGAAC
5   M04   AX00001688   TATCCGAACTGGGAAATTGTAACGACGCAGTACGGTGAAAATAATGCGCAAAAG
5   M06   AX00001689   GATGTAGAACCACTCGTCGTTACACTCGGCACGATGTTTTTATACGGAGGAATT
5   M08   AX00001690   GAAGATATGTGCGTTTATAATTTCAGGCATAAGTGCTGCACTCGCTGGTTGCAT
5   M10   AX00001691   CATGTTCTTTGCATAAAAGGCTAGACGAAGGACTAGTTTATGTGTCGGAGGATA
5   M12   AX00001692   GATACAAATGGCGGTTTATTAGAGCTCTCGCATCACAATCGTCTAATTGGCACG
5   M14   AX00001693   AAGTTCGTCCTCATGAATCTCACTATCTTATTAACCATTCTGACAAACCTTTTAAA
5   M16   AX00001694   TGTACTTAACTCCTGCATTCCTGAAAACTGCAGCACACCGATGGTTATGCGTGT
5   M18   AX00001695   TGGCTTAATTATCGGTCGTTCCACGCTTGAAGAGCCGGAGATTGCATACGAGTT
5   M20   AX00001696   TGTTCTTGTGAAAAAAGTAAGACGCGGCGACGAAGAAGTAGTCGTTATGATTCG
5   M22   AX00001697   CATACGATCCGCTATGCCGTCAGGTGTATTAGTAGGGGGAATATTGAGTGAAAT
5   M24   AX00001698   TGAGAGAGCACTTACAATTTGTCGAAGAACATAATACGTGGAAAGCATTGCTTC
5   O02   AX00001699   GAATCTTACAGCTGAACAAGCATGTTGGCAACCAGAAGGTGCTGCCAGTAATAC
5   O04   AX00001700   TTGTTTACACACCTTCCAAACATGAAAAAAAGGATTTCTTTTCTACTATTTCAAAC
5   O06   AX00001701   GAATGAAATCAAAAGTCGATGCTGCAAAGACAGCACTCTCTCTTGGTGTCAGTG
5   O08   AX00001702   GCGAGTCCTCCGCCAACTAACTTACTTCAACGGGACTTAAAGGAGGATTATTCT
5   O10   AX00001703   GAAACGAAGGATATGCTGTCAGTTATGGAGAAAAAACAGAAGGGACAGCTTCAG
5   O12   AX00001704   ACAACTGCTGGCATTACAATGCAGCGCTGGTTCCCTGATATTCCTGTTTGGGTT
5   O14   AX00001705   GGCAATCGTTCCTATTAGTACATGGTACGATATTCTTAATTGCAGGTTCAGTAGG
5   O16   AX00001706   CGCCCCTGGTATTATTGTTATTGGAATGATTATAATTTTTGCTTCAATGGTAATCG
5   O18   AX00001707   CAATGGCTAACCTTTCGATCTTGAAAAATGGTAAAGCAAAAGCAGTCCGTTTTTC
5   O20   AX00001708   CGGGCCAATTAATCGGAACGTGCGGTTTTCATTTAATTAACCATCATCATAAGCG
5   O22   AX00001709   ATAAAAGCAGAGCATGGTACATATATTGAATTTAATACGGGTACTACCATATTAG
5   O24   AX00001710   ATTGTTGAAGTTGCCTCAACAGATAGAAAGAAGTGCTATGAGTTAACGCCGTTTG
5   B02   EMPTY        -
5   B04   AX00001711   TTTTACGTGGGAGAGAATATTGCACACCAGAAGATATACAATTTTTAGTTCCTTC
5   B06   AX00001712   AATTATTGTGTATCCATCCCCTAAAGAAGTAGCAGGTTTGCAAGAACTTCAGCAA
5   B08   AX00001713   CAGCTATCGCTATTTACGTCGTTTGGAAAATAGTAAAGAAACGAAAACAATTTAG
5   B10   AX00001714   GTTACCATTTTGACGTTATTGTTAACAGATGAACAAATGCTCAGCTGGGGCTGG
5   B12   AX00001715   GCTGTCCCTCATGCTTTTAGTCGAAAATGCATTGATACAATTGGTTTTCATTCAC
5   B14   AX00001716   GTCCTACAATTGTAATTAGTCCTAGTGGATCAATTGTTATTACTTTACCATTAGTT
5   B16   AX00001717   ATGATATCTTGCAGAACCCTATTCTATCCCAAGTAACTCTTATTGAGAAAGGATG
5   B18   AX00001718   TCTAGTTTTCGATTTATCTTATCCAGGTTTATCAAGAGAAGAAGTTGAAGAGAAA
5   B20   AX00001719   TATAGCTAAAAGACTTGGTGCCACTATTATTAAATATAACGAACGACTTGGTCAT
5   B22   AX00001720   AATCGACTGATGTTCAAGTACAATTGCATGCCACGAATATGGATAGTATATGGAT
5   B24   AX00001721   GGTAAAGGAGCAGGAGGCGGGATACCGCTAGGTGGAATTATTGTAGGTGAAAA
5   D02   AX00001722   TATTATGTAATCACATTCCTGTCTTTTCTGTTCGCGATCCGATGCGTTTCCCTGA
5   D04   AX00001723   TGAACATAGTTTTTGGGAGGTGAGTAAAAGAGATCTGGAGGCTGCCCATTTGAT
5   D06   AX00001724   ATGGTGCGATTGCGACAGGTAGAATTGCTAATATCAATATTTTAGAAAGTAAAGA
5   D08   AX00001725   CCAGGAAAGAATCATGCTCGTGGATATGTGAAAATGGAAGAAACAGGCGAGTTG
5   D10   AX00001726   TATTAACACCATGGAGTCTCAGTTTAATGGTGTGGTATTGGTTGGTAATGTTAGT
5   D12   AX00001727   GTCATTCATCAGTTAAAACAGCCATTACCGACAGATACGATAAGAAAAACGCTAG
5   D14   AX00001728   TGAAGATTTTCGTTCCATCCACTGGAGTGCAACAGCGAAAACAGGGACGATAAC
5   D16   AX00001729   ATTACTGTACGCCAGATGATATTAAGACGCTTGCTGCATCCGTTTGTGCTCATCG
5   D18   AX00001730   AGTATGGAAAGATGAAGAGGCAGTTGCGAGTCATAATACGAGTGAACACTTCAC
5   D20   AX00001731   GGTCTTGTAGCAATGCAATTTATGCTAGCAGCTCGTGCTCACGGTTACGATACT
5   D22   AX00001732   GTTCGAAATTTGAAGGGTGTACGGGTATGAGCCAGTCTCGATTAGAGCTTATAC
5   D24   AX00001733   AACCAGTAAATGAGTTTGAATTAACTGTACCAGAGCATGCAATTAGTACCGCAAT
5   F02   AX00001734   GTTCTAGTACGGTTTGCTTTATGTTCTCAGGTTCAGGATATAATTACGATAAGCC
5   F04   AX00001735   AGAGGGTAGAACGTATTTGTTTAAGTGGGTGCCGGTAGAAGAGTTACATGCATA
5   F06   AX00001736   TCGTCTTCCATATTGGATTCAGCGTGTAGCAAAAGGAGGTAAGGTGTTAGTTCC
5   F08   AX00001737   ATAGGAAAAGGCGGAAACATTGGGGCTTTTAAATATTCATCTGCAGGAGCGCAT
5   F10   AX00001738   ACGACAATAGCAAGAATTGCAAAGACGTAAGAAGAATTTCTCAATACAATGAATG
5   F12   AX00001739   GCGAAACGTTAGGTTTCTTATGCGGATTCCTTTCGCAAACGCATAAAGAGGAAG
5   F14   AX00001740   AGAAGAATTTCTATGTGAGGACTGTTTGCAAAAAGGAATTGCGAGTGGAGAAAT
5   F16   AX00001741   GGTATGGAAGGTACTGAAACAAAAGATGAATGCTTACATCGTGAACTACTAGAG
5   F18   AX00001742   GAGTATGCATGGCTCGGAAATATAATTGGATTAGTCGCAGCAATTGCGTGGGGA
5   F20   AX00001743   CACATATGTGGGGCGTTTCTCCGACATTAACGCCGAACTGGAGGAATTTCGTAG
5   F22   AX00001744   GCGGAAGAGAGTTAGATTATATGACTGCTCTTAATGAAGCCAAATCAGGGAAAT
5   F24   AX00001745   TGGGAGAACTGATTAAATCAGTAAACTTGCTTATAGAAAGAACAACTTATCGAGA
5   H02   AX00001746   ATACATGATAAAACCTTTTGACCCTAGAGAGTTGTTGTTAAGGATTCAGAAAATG
5   H04   AX00001747   CAAGAGAAGCGCTTATTCGAAGCGGGAATAAACCACCATACATCTTAGTACCAC
5   H06   AX00001748   ATGGGCACACTCTACTGCACATGCAGCGGATGCGCTCGATGCGTTAGCTCGTA
5   H08   AX00001749   GTAGATACAGATTTTGAGATTGCGAGAAAACGTGGTGCTAAGCGGGAAACTGAA
5   H10   AX00001750   AAACCAGATGTCGTTTGCTACGGTGATGTTCACCAAGCATTCGTTCAAAATTTCA
5   H12   AX00001751   GAGAAAAGATGGCCGCCTTTTAGAATGGAAAATGTTATTTGTAAAGCAAGAAGA
5   H14   AX00001752   GTTGGGGACCGATTACGACACCTGTTCTTCTAGCAAGAGGAAATGAAGCGAGAA
5   H16   AX00001753   CATCACTTGGCTTTGCACTTGGATGGAACTATTGGTATAACTGGGCAATTACTAT
5   H18   AX00001754   ATTCGTATTAGAGGGACAATGACAAACTCTTGTAGTATTTTCGTTGATGTCGATT
5   H20   AX00001755   GGAATACTGCTGAATATGCCATTCGGCCTTTTCTTGAAACATACCATGAAGACAC
5   H22   AX00001756   CCGCCAACTATTTATGCGACTGAGGGTTATGCTCCAAACTTGCCAATTGCTCGG
5   H24   AX00001757   TCTTTTACTTTATGTAAAGTGGAAGGGAAATCAATGCAACCGACTTTATATGAAG
5   J02   AX00001758   AATGGATTGTATGCTGATGCGAATGTGGAAATGTACTTATCAAGAGGGTACTAT
5   J04   AX00001759   AGAGCAAGCGAGTAATTATCCAGGGCAACCGAGTATGTCACTTTCTACTATTCG
5   J06   AX00001760   GTTGCGGCAATGCGTATTACAAAATCGAAAATAACAACGCCTGTACAAGAAGGA
5   J08   AX00001761   GCAACTGGTGCCATTTTATTAATGAAAGGATTCTTCGATTCAGTAGGTATGCATG
5   J10   AX00001762   GAAGGCTATGTAAATTCGGTGAATGGTGAGAAAGTAGCAGTTCAGGCGCAGAC
5   J12   AX00001763   GCGGGACTCGAAATGACGATTATGGGACCGAAATTGTTAATAAAGAAAACGACG
5   J14   AX00001764   ATGTTAGGCTTTACACCAGGGTTCCCGTATTTAGGAGGACTATCAAAAGAACTA
5   J16   AX00001765   GATGGAACGGTTGTAGCAGGCATTAGTATTTCAGGATTAGCAATTGAGTACAGC
5   J18   AX00001766   TGATGCCGACTTTAGAAAATAACGAACGAGTTCTCGTCAATAAGATTGGTTATAG
5   J20   AX00001767   TAGAAAATCCAGTAGAAGCGATGAGAACGTTAAAGAAGTTTCATAAAGTGACTCA
5   J22   AX00001768   TTTAATGAATAATCAAGCACTACCTGCTAGTGAATTGGCTTATATGGCAAGAGTG
5   J24   AX00001769   TGAGGCTATGTCCTTTGGTGAAATGATTCGTCACGTATGGAGTTCAACTTTTTAC
5   L02   AX00001770   AGATTATTTTTACAGGTGGTACAAAGTTCGAGGCAGAACTTGAGGAAGCACGTA
5   L04   AX00001771   CGGGAAATTTGGGCGTATTTAATCTCTAAAATGGATAGTGTGCAAGATATGCAG
5   L06   AX00001772   GGACTACTCTCGTTGTAACATTCATCGTAACTGCTATCACCGTAAGAATCCCGC
5   L08   AX00001773   ATTGCGAAAGGAAATCCGTCTGAAGCGTATCCATGGCCTTGGTCTATTAATAAG
5   L10   AX00001774   GGAAGTTTCTAATTCATTATATATTCATAGATTTGCGGTAAAACGGAAGTATAAA
5   L12   AX00001775   TCTTCTTAATGATATCGGCGGTACTTTCATTAGTTGGACTAAAAGGAATCGGTTT
5   L14   AX00001776   TTGACGCCATTACAGTGAAAGATATTACAACGAAAGCAAACATTAATCGCGGTAC
5   L16   AX00001777   AGTGCGACGGCTGAAGATTTACCGTATGCCTCGTTTGCTGGTCAACAAGATACG
5   L18   AX00001778   TCTGTCGCTAAGGATCGATTTGGTACCAATAGCCGCCCAAAAGCAATTATTTTAA
5   L20   AX00001779   CCTAGAGTATTACTAATTTCTCTTTTCCTTACAGGAGCTGCCTATTTAATCGGAG
5   L22   AX00001780   TAATGGTGTAGCTTTACCGCCTGCTCCGCCAGAACGACCAGTTGCATCTATCGA
5   L24   AX00001781   GAATCATGCGAACTTGAAGATGAATCCCTACTCTTTTTATCGGATGTTTTGCCAA
5   N02   AX00001782   GGTGGATTACCTTTTGAAGGAAGGAACTTGCTTTCGAAAATTCAAGAGTTGACT
5   N04   AX00001783   AGCAGATCGACTTGGGATTGCGAAAAGCACCTATGCCGGGTATGAAAATGGTTA
5   N06   AX00001784   GAGCATAGAACTTCAAACTTTAATTATAATGAAAGAACACCGAAACAAATTCCCG
5   N08   AX00001785   CCGTTAAGGACATGGGTGTACTTTAGCATTTGGATTACTATTGGGGTAGTAATAT
5   N10   AX00001786   ATTAAGAGCACTGAGAATGAATTTGATAGAAAGTTAAAGGTTATTAGAGTAATGC
5   N12   AX00001787   GATTTTACTACCGTAAGGAGAAAGATGACAGAATTGAATAATGAACCAACATTAC
5   N14   AX00001788   ATTGGATTACCAGCTAAGAGTGGGGTATCCGGCGGAATTATGACACTTGTTCCC
5   N16   AX00001789   AAAAAGGATTTAGTACTTACCATTTCACTGATACTAGCAATTGTAAGCTGCTTAA
5   N18   AX00001790   GCAGGGGGAATCGAGTACTTAGGGGCTTATTTACGTGATCGTGAAAAACAAAAT
5   N20   AX00001791   CCGTTAAGTGGTCGATCTTGGGAATACCAAGTTCCCGCTCTTGTTGAGGCTGGA
5   N22   AX00001792   CGAATTACAACGCGATTGGCGCAACGATGTCGAAGGTTTTGGCAATTTACTTGC
5   N24   AX00001793   TGTATGCAGTTGATGATGCTTCAGGTGGGACTAGTTTGACAGCACATAACGCTG
5   P02   AX00001794   GTCCCAAGCAACAAATCTAGAGAGTATACTGTTATTTTTCGCTTTGATACGTATG
5   P04   AX00001795   AGGTGTGATTACTATAGGCGGTCTATTAGAGGATCTCACTTATTTAACACCTTAT
5   P06   AX00001796   CCGGGCTTCCTGTCACTTATTTTGGTAGTCAGCATGAGCAATTACAACGTGCAC
5   P08   AX00001797   TCTAACAAAAAAGATTGCGGATGATACAAACACAAATACGATTGGAGTAAAAGAA
5   P10   AX00001798   ATGGTATGTTGCAGGGCATTCAATGGGCGGAGCTATGATTTCTAAGTATGCCTT
5   P12   AX00001799   GGTTTTATGCATAATCGCACAAGAATGGCTGTAGCCTCTTTTCTTGTAAAGCATT
5   P14   AX00001800   AAAATATGTTGACTATACACAGCTGCGATTCTGTAATTGTACATCCTTTTGGAGA
5   P16   AX00001801   GAATGATACGATGGCGCTCGCAACAATCAATTGAGGAACAGGAACTTCTCATAG
5   P18   AX00001802   TGGAGATAGAGTTGTGGGGCCTTGGCATCTAGATACTTTAGCTTGGTTAATGGC
5   P20   AX00001803   AGGCAACATGCCAGGTATCATGCTTGAAACGCAAAATAATAATGTCGCAGCATG
5   P22   AX00001804   ATGGATGGGTTATATAAGCCCTTGGGCATTAGTGATGTTCCTAGGTTTGAGAAA
5   P24   AX00001805   TCCAGATTTGTTAATTGTACCTGGTGGTGGCTGGAATCATAAAGCAAAGCACGG
5   B01   EMPTY        -
5   B03   AX00001806   AATATTTCAGCACCGTAACTTAAAGAGTTGGAATCAAAGAGTGTATACGCTAAGA
5   B05   AX00001807   CTACTCCGCCGCATGTGAATCGTGTTCACTGGGGATTTGATGATCCAGCAGGCA
5   B07   AX00001808   TATTCCCTAGTGTAGTAGACGGACTGAATACATTACAAGTTGGAACGACGTCTA
5   B09   AX00001809   GAAAAAGAGGGTTTCTTTGCGCGTGATGAGATCGATACAACTTGTTGCTATGCA
5   B11   AX00001810   TGTATGAACTTTGTCAGCGGGGACAGACGTGTGTATGTGATTTAACAGAGATTT
5   B13   AX00001811   CAATGCAAAATTGCTAGATGATCCGGAAATACGAAATTTTGCTGCGAATTCATCT
5   B15   AX00001812   GAAAATGCGAGAATTTCTGTTTCAGAAATAGGACGAATTATATCCATGACGCAAC
5   B17   AX00001813   ATTCATCCGAGCGGAAAAACAGCGACAACGAGCCCTTCACTAGCAGTCGATCCA
5   B19   AX00001814   ACAATCCGACAACGTACGTATGGGGACCACCTGGAACAGGGAAGTCTTACAATT
5   B21   AX00001815   TTGAAGGCTACAACTCTTCCCTTCCGGCAGAAGGAAAAGTACATCACATTTGCT
5   B23   AX00001816   TATGGTCTTGGCTGGGATAGTGTGAAACTATACCCATTCAGTGAATATGGGATA
5   D01   AX00001817   ACAAGATGCTGAAAAATACGCTGAAATGCACAAGAACAGACTTGAAGCAGCTGG
5   D03   AX00001818   TATATCTGGGAAAATGGCAGATGAATTTAAGCGATTTGGTTTACCTTCGTTTTTT
5   D05   AX00001819   GTCAATGGAGAGAAAAGGGATTGTAAAGAAGGCTTTGAATGAGCAAGATCGGCG
5   D07   AX00001820   TATTGTAACTTCTTCTTATAATGGAAAGCCGCCAAGTAATGCAGGGCAGTTTGTG
5   D09   AX00001821   ATGATTTTAACACCAGCTTATGTACAAAACGTTCGCGGTATTTCACCGCTGAGCT
5   D11   AX00001822   CAGCCTGCTAATTGGACTCCATTCCCAGGGCATACAGGTTTTAATTTTCAAAAAC
5   D13   AX00001823   TGAAAACTACACAGAGAAACAAGTTCGTGAAATTTCTTTAGCCCATACAAATGGA
5   D15   AX00001824   CGAATGATTCGAAGCAAATACAAGATTTCAAAAACGAAGTCTCATCTATTGTAGA
5   D17   AX00001825   TGACCTAGTGGTGGATTGCAATATGCATAAAGTAACAAGAGGAGACCAAGTTAT
5   D19   AX00001826   AACTGTTCCGTGACGAAACCAACATAATAGGTAAAGTCTCCGATAATGGCATAG
5   D21   AX00001827   GGTTCCATTCACAAATAGCGGTCAAGGATTCCACGATGCTGGCTGGCGAAAAGA
5   D23   AX00001828   AATGGGATACGTTGCTTGTGCGCAAGAAATTATAGCGCAATCATTTGACCAAGG
5   F01   AX00001829   AAAAGACTATCCGCAAGTTGTTTTCTTCACGAGTCATACGCACTGGGATTTAAAC
5   F03   AX00001830   TGACGCCGCTTTCTAGAGCGCTTATTATGAATGGGGATATAACGCCAACTGGAC
5   F05   AX00001831   ATGGATTACACAAGTGCAATTATCACCAACACCTTTAGCACGTGCGGCATATTG
5   F07   AX00001832   GTACTTTACGAAAGAGTGGCTCGAAGCACGCGAAGTACGAATATTTTTAGAGGT
5   F09   AX00001833   CTCCTCAGCAAAGTACGGGAGATCGATTAGCTGAAATTAAGCAACATAAACAAG
5   F11   AX00001834   AGTACGTTATTATCAATCGCGGGTGCATTACTATCACCATCAAAAGGGGATATAT
5   F13   AX00001835   AGCAAATAGCTTAGTCGTGCAGGCGTTATTCTTATCAGTCGTTGCGATGGGAAT
5   F15   AX00001836   CAAGTGAAGACCCAGCTAAGTGGAATTACGTTTCATCTTGCTGGGAGTTTGATG
5   F17   AX00001837   TCATCATGCCCATCGTAGCCTTTATCGAACAATTCGCCTATCCTGCACAGTCAAA
5   F19   AX00001838   TTGAGGGCGAAAGTAAGCGAATGTCTAGTTTATGTAAACAGTTACTTACGCTCG
5   F21   AX00001839   TAATTACACTTCACGGGACGACAATTGATCGTAAAGGTGTTGAAGTAAAGTGTAA
5   F23   AX00001840   CTTCATTTAACAGAAGGATGGACGATTGCTTCGGATGAAATGCTCGTAAATGCC
5   H01   AX00001841   CGATGGAAGATCAGGGAGACGGTGCTACTAAATATGTCGTAGTGGAGTATCCAT
5   H03   AX00001842   AAGGGCGCTTAATTGGTGGTTGCATTGAAGTACTTGAATTTGCAAAAGGAACGG
5   H05   AX00001843   TTTAGCTGAACAATATTCACTGGAATTGGGTGAATACATAAGCTATGAGTTACTT
5   H07   AX00001844   AAAGGAATAGTGCTGCTAAATTTAGCATTCTTGAAGTATGGTTTGGGGTTGGGG
5   H09   AX00001845   AAAAGTACTATGGGGTGGCTGTATTCTGATCAAAGTATGTCTACGTTAGCTATTC
5   H11   AX00001846   TAATTGGTGAGGTAACACGAAACATTCAATGCGTAGCTGATAATGCTTCTGAAG
5   H13   AX00001847   CACAACGTCCTACCCTGGTTATGGAACGTGATGAAATTCAATTAAAGCAAAGCTA
5   H15   AX00001848   AAGTACTCGTACCTCTTGTATCATATCTTTCATCTGAGAATGCACGCGGTCGCG
5   H17   AX00001849   GATGTTGAATTAAGCATCGATCTCATTTACGGACCAATTTTTTATCGGTTGCTAG
5   H19   AX00001850   ACATACTTGATCGGAGATTTCATGCACAACCAAATGCTTGCTGGAAATGTGGAC
5   H21   AX00001851   ATGTTAGGTGTTAATCCAATGTATCTAGCTAATGAGGGCAATGTTTGTATGTTTG
5   H23   AX00001852   TATTATTACGGGTATGCAAACTCAAATTTGTGTCCAAACAACTGCAGCGGATGG
5   J01   AX00001853   AATGTCACCGGATTGCCGGTATGTATAGTTATCTAACAAAGGTAGTCACGGAAT
5   J03   AX00001854   GTACATTGCAATATCTTTTGTAACAATAGGGACCCACTCATATGGTGATAAGGAT
5   J05   AX00001855   TGTGTCAATAACATTGGACCAGTGGCTAATGAAGAAAGACTAATCAAAGTTAATA
5   J07   AX00001856   CTTGGTGCATCTACGTCTGAATCAGAAGAAAATTGTGCAGTCATGGCAGCGCGT
5   J09   AX00001857   GAACGCGGCCTTGTTACGTTAAAAGGACATCGATCAGTCGGTGGTATGCGCGC
5   J11   AX00001858   ATTTGTAGCGTTAGATTACAATGTAGTTGAGAAATGGTTTGGTTCTATGCCGGCG
5   J13   AX00001859   AATCCATCATATGAAGAAGTGAAGCAAAGTTTATTTGCGACGACAGTGTATAATC
5   J15   AX00001860   ATATGGCATGAGCATCCTAATACGGATAAGCTATTTATTGTGCTTGAAGGGGAG
5   J17   AX00001861   CAGGACAATCTCCTCGTCTTGTCGAATTACTTATGCGTCTTTGGGATGTGTATAA
5   J19   AX00001862   AAAGTATATGGCGTTTGATTTAGGCGGACATTGGCACGGACAGGCATTTCGATA
5   J21   AX00001863   TACATATATTTGTTAACTGGTACGAAAACGAAGCAATGTGGAATTTACGTATTAC
5   J23   AX00001864   GAAAAAAATATACATATCTAACGGTGCGCACGAGCCAGTTTTCGGCGTAGCTAC
5   L01   AX00001865   ATTCTGAAGAAATAAGTGCACTTGAGCTATGCGAACAATTAATACGATCTGGCAA
5   L03   AX00001866   CGTATGGAACAAGAAGGCTATGCACCGTCTCGCCGTATGGAAGAGCCAATCTTT
5   L05   AX00001867   CTTTTTCATTCTGGGTATGGTTTATCCTTAGATTTCTAGTTGGAGTCGGAGATCA
5   L07   AX00001868   ACACATAATCAACCTGAACCAGATCGCTATGAAAAGTATTTAGACGATATGTTAA
5   L09   AX00001869   TCTCCCACTGGGTTATTTAGTGCGCAATGGGCTGTAATTTTCCGCATCAATCAAA
5   L11   AX00001870   GTGGTTCTGCGACAGCTACGTACTTCTCATTCTTTGATAGTGGTATTGGATTTGG
5   L13   AX00001871   ATCACTTACAACGTCACCAGTCGATATTTTGATTATTGATTCTGTAGTGAATCGT
5   L15   AX00001872   GAAGTATATAAAACGTTAATCGCTCAAGGGAATAGTAAAAATTATCATGTGTTTA
5   L17   AX00001873   TGATATAGTCGGTGTTGAGTCTGTCATGGCAGAAGCTGAACTTATGAGTATGGC
5   L19   AX00001874   CATTATATAGGTATTATCGTTACTCTAGTTGCCTTCTTTCCTTATATAGACATCGT
5   L21   AX00001875   AAGGAAGCGGCCCTGGTAGTACAGACTTCTATAAACGTACAAATCAAGGTAGCG
5   L23   AX00001876   CATTGGAGGGAAATGGAAAGGGGTTATTTTGTATCATTTATTAGATGGTACAAAA
5   N01   AX00001877   CAGGAAACAGATTTTAACTTATTACAATCCGACCGTGCTGTATTTGATTGGGCAT
5   N03   AX00001878   GAAGTGCTCGGAGCGATGGATGTCGAAGGTGCAGAATATATTGCAGTTGCCTTT
5   N05   AX00001879   TTCAATCTATGGTAGATCATTCGATTCCAACAAGGGCTGAGGTAACTGATGTGT
5   N07   AX00001880   AAAAGAGACGACGGGAAAAACAAATGATCAAACGACTAGCGGAAAAACAACAGA
5   N09   AX00001881   CAGAGGAGCTGAAGCATCATTTAGTATGGAAGTTCCCGCAAGGTAAAGTAGGAG
5   N11   AX00001882   TTACTGTTTGGTTCTATCACGCATGCAATGTATGAGGGAATGATACATTTAGGGC
5   N13   AX00001883   AAGCGAAAAGGACGTTTGGTTATGTCCCAGATAGTCCAGATATGTTTTTACGATT
5   N15   AX00001884   TGTTTACTATGTTTTGTTTCTTCTCCTTTTTCACCTCATATAGAACGGTTCAACAC
5   N17   AX00001885   AGTAAGGACAACATTCGCGTCATTGCAAAGGATGTAAGTAGGCAGCGTCAAAGA
5   N19   AX00001886   GGAAAAACACGCATTACATAATGCGTTTGTACAGTTCGGTATGCCTACAGGGTA
5   N21   AX00001887   GTAAAATGGGGCAAGTTGTACCGTTCTGAAGAATTAGCAGGACTAACAGAGTGG
5   N23   AX00001888   ATGGAGTTTTCACCCGTTCATACACTGTTTCGTTAATTGCGTTAATACTCCAATT
5   P01   AX00001889   AGAATTAGCTTGGATATTAGCTTGCCTAACTCCGAAAGGGCTTATGAACCGTGC
5   P03   AX00001890   CATTCTTTAGTAGAGTTTATCGATGGATCAGTTATAGCACAGCTCGGTGCTCCTG
5   P05   AX00001891   CATTCGTTTCACTTTTAGAAAAGAAAGGTGTTTCAAGAATCGTATCGATAGCCTC
5   P07   AX00001892   GTGCTTCGTTAGGTGGTAAGTTATTTGGATCCTTTGGGCCATCATTTGGTGGGA
5   P09   AX00001893   GACTTGATCTTTCGAGCACACAAATTGAAACGGCACATGAAACGTTACAGTCGT
5   P11   AX00001894   TGTCGCTGGGTATTTTACGACCATTCGCGAAATGGGAGCAAAAGATGGTGCGG
5   P13   AX00001895   TTGCAGGAGGGTTCTTACTCTTACTCGATCCAATCTATGCCTTCTCTCTAACAGG
5   P15   AX00001896   TGAATGGTTCGAAAAGGGATACAAAGAATGCTGGAAAAGCCCCAATTGGATTGG
5   P17   AX00001897   GAATGGTGAATCCTACAAGCTTAACATTAAAGATATCGAACACGCTCATAGGACG
5   P19   AX00001898   ATTTATCAAATTGGATGAACATCGTTGCCTATGTCATTGGCTTTAGTGCGGGACT
5   P21   AX00001899   AGTGGTTTACTACTTATGTGGACGATTACTCCGTTTGGAAAACAAGTAACAGGG
5   P23   AX00001900   TCGTTGGTTTCTACCTGGAAGATTCAGTAGAAGAACACATGAAAGTAATCCAAAA
6   A01   EMPTY        -
6   A03   AX00001901   TAAAGAGAAAATCGAGGAGAAGAAGAAGCTGCTCGGTATCAATGAACACGTTTC
6   A05   AX00001902   CGGTATGTATGTTGTTAGCAAATATGTACTCGACTTTATCCCACCACTAACACTC
6   A07   AX00001903   TTTTAAAGGCAACACAGCCAATTCATAAAGAGCTGAAGACCGCAATTGAGGAGA
6   A09   AX00001904   TTATCTGTAAATCCAGGGAGTGGTCCGAGACATATTACTTTTCATCCAAATGGAA
6   A11   AX00001905   TGGGTTATTATTTCACCCGTATTTAGCAGGAGAAAGAGCTCCTTTATGGAATGCA
6   A13   AX00001906   CAGCTCCTTATGTTCCGCTTTCTACTACCTTGATGAAGATTGTCACATTAATCGG
6   A15   AX00001907   ATTTTCACGGTGAACCAAGCACTTTTAGCTGCTCGAGCAGGTGCAACGTATGTT
6   A17   AX00001908   GATCAAGAAGCTTGGGACATCGTTGAACCTATCTTCCGCGATACTGCTGTAGAA
6   A19   AX00001909   ATCCCGTGGATTGGAAAATACGTGAAGGTTTACTGCAAGACGTAATTTCTTATGA
6   A21   AX00001910   CAAATGAACGTCCTACACCGATACGTTTAGGTTACCGTACAGGGCGTAAGGCAC
6   A23   AX00001911   AGCTACTGGTGGCGTAGGACACGTAGCCATTCAATTAGCTAAATGGGCTGGTG
6   C01   AX00001912   AAAACGATGCAACTCTCACTTTCTCGCAGTTTAGCTGAGCTGACGACAGGAACG
6   C03   AX00001913   TAGGGAATCCTAAGCAGTGGTTTAATGCATTTAGTAATGGGGCTATGCTAGTAT
6   C05   AX00001914   AAATAGAGATGAATAGGGCGAAAGGTTATCCGGCAGTTACTTCTTTAGCGTATA
6   C07   AX00001915   GAAATTGTGGAGTTTGCTGTGAAATATACTCCATCCGCTTTCAATTCTCAAACTG
6   C09   AX00001916   TTCTTACATCACATCGCAATGCTCCAAATCGTTTATACGGGGTTTTAGGTGATTC
6   C11   AX00001917   GGGAAAGCTGGAGCTGTAGCAAGTGATGCTACCTTTGCTGAGAAAAGTAGGGT
6   C13   AX00001918   AGTTGTTTCTCTGCATGATCGTAGCTCGTATTATATGCAGATACAAAGTGAAATA
6   C15   AX00001919   TGTCAACAAGTAATGCGATTTCAGAAAGTGCAGGTGTTCACCCAGTACGTATTC
6   C17   AX00001920   CTTTCGCTAAATGAATTTTATAAATTAATAATTGAGCATCCGCTAATGTTGCGTCG
6   C19   AX00001921   TTCTCCGGCCAATGGTGGTGCTACGAATGGTTGGATTGAAAAATATATATTCCC
6   C21   AX00001922   GATATTACACGTATTCAATCATGAATGCTCCATTTCCAGTCACTAATTATCTATCT
6   C23   AX00001923   AGCGGATGGGATTACTATACATCGTCTGGGAGGACATTTTAGTGGCGGTTCTGT
6   E01   AX00001924   TTGATCCTTTACCAGTGTTAGGAGATCCTATATACGATTTAATTTATGCGTTCTG
6   E03   AX00001925   GACAGCTTACTTATCCATCATGATGATGCACAGCAGTTACAACAAGTCGCTAAAA
6   E05   AX00001926   GCCTTACGATTGAAACGAAGGCCGGGATTTTACCAATACAAATAGGTGTAAATG
6   E07   AX00001927   AAGTTCATGAAGAAGACGACGCCATTTACTTATTTACTTCGGGAACGACTGGAC
6   E09   AX00001928   CAAAGTACAATTAGTCAACATTTATCTAAACTAAAAGCTGCTAAAATGGTTACAG
6   E11   AX00001929   CAAAGTAGCACGATGCAAGTACGAGAGAATGCTATAAAAGCTGGAATTGGTACA
6   E13   AX00001930   GGAGCTGTTCCGGAAGAAAAAGTTACCGCTTAAACATATTGAACCGCGTGTTAG
6   E15   AX00001931   TACTTTTTAAGTACGGAGCTGTATCTGTAGGGATTTTTTGGTGTTATAGAAAAGA
6   E17   AX00001932   ATCCCTTTTAACTAACAGCAACTTAGTTGAATCAGAATTTGCTCTTAGTGCCATC
6   E19   AX00001933   ACTAATGGGATAACTCGCACATCCATTCAGGATATAATGACAGCTACTGAACTAC
6   E21   AX00001934   GCGGGTGTTATGACAGAAGCACAAATAGAAGAAGAATCTAGAGTGATTCAGTTT
6   E23   AX00001935   GCATAACTCTATCCTGCCCGTTGTTCGCTTTACTGATAACGAAGTGAAAGCTCTT
6   G01   AX00001936   CGTTTCATTACGATGCCTATTAAGCGCTCATCGATATTATGGGCTCACGTTTTAA
6   G03   AX00001937   GAAAACTTGATAATGATCGCCAAGTTACGTGGTGTTTCCAATCCCGCTCAAGTC
6   G05   AX00001938   ATTACTCGCCACCTGAATGATCTTGGGTTTACCGAAGTCGTGGAAGGAACGGTC
6   G07   AX00001939   TACAGGTGCCATATTAGCGACAACGAACTGTGTTATGCCAATTAAAGGATCATAC
6   G09   AX00001940   ATGATTTATATATAAAGGATGCGTATCCTCAATGTGATATATGGATTCGTAGTGT
6   G11   AX00001941   CACTAGCTTATTTCATCGGAGTAAAACAATACACTTGGCTCTTATCAGGATTCAA
6   G13   AX00001942   TGATTCTTTACAGCTTTTTACCCCAAGGTCTTACAGTAGCTTGCCAGGTATGGCG
6   G15   AX00001943   TGATGCTGTGATGCATTTATCAGAACATCATGGTGATGCCTCACCAGGTGGTGC
6   G17   AX00001944   GCTTGAAAATAGACTTGCGAGTTACATGTTAGCAGCAGGAGAACGGGCAGTACA
6   G19   AX00001945   TTTTTTTATACAGTGCTGGAGCGATTGGAGTATTCACTGTTCTTTTTAATAATATA
6   G21   AX00001946   TTACTCATCTTTATCGGACAATTATTTGCAGGAACTATCATTGATTTCTTCCTAAC
6   G23   AX00001947   TTATAAAAAATATTTCATATGGGTAGTTGATCATCACAATAACGAAGTGATGATTG
6   I01   AX00001948   TGTATACGCCAGGCCATTCTCCAGGCCATCAGTCGCTATTCATTGAGACGGAGC
6   I03   AX00001949   GGGAGCAGAGATGAAAGATCATCCGTTCAAAATGCCGTTTGCTCCTGTTACAAA
6   I05   AX00001950   AACGATTCTTCGTGAAAGTGTAGAAGGGCATAAGAGGCATGTTATGTTTGCTCA
6   I07   AX00001951   AGTAGATTGTGAAGCAGATATTGTAAAGGTTGAGGATGGAATTTTTGAAAACAAT
6   I09   AX00001952   ATTCGCTTATTAACAGATCAAGGAGTACCTGTAACGTATGCGTGTGGTACTTTAG
6   I11   AX00001953   CACGGCTGGGTATATGCTGAAGGTATTACGCACTGGGAAGTAGACGATAAAGAG
6   I13   AX00001954   TTTAGGCTTTATACTTCATTCGATTATTCATGTAGACGCTGCCGTTATCGCGATG
6   I15   AX00001955   AGTGCAGCAACTAAGGCACGAAAGACCAGTTGTTGAAGTGAGAAAAGGTGTTCA
6   I17   AX00001956   CAATTCATGGCATAGAGTGGAATAACAGAACGGGTTTATTAGCCATTGGTATAG
6   I19   AX00001957   GACCGATGGGACCAATTTTGTTCCAAGACTTAGGGTTACAACCTGCAAATGGTG
6   I21   AX00001958   TCGGTTTAGTTGCTCCGCATATCGCAAGGAAGTTAGTAGGTACTACATATCAAC
6   I23   AX00001959   TAGCGTTTTGGTACGCTGGTGGTGTTGCAGGGGTTAAGTGGGAACACTTGAAA
6   K01   AX00001960   AATTACTGTCTTCCACCTCATCGGCCTGTTACTAGAAATATATAAAGTACATTTC
6   K03   AX00001961   CTCAAAAAATGGCAATAGCCAAACAACTGGGTTATGCGGAAACCGCATTTATATC
6   K05   AX00001962   TGATTACCCGCTCGCAGTTTTACTAGCAGGACAATCAGAGAATGTAGAAACGCT
6   K07   AX00001963   TAAAAGAACAAGCAAAACGTATTAACGAAATTCCAGCAGAAGTATTTGAAAATAA
6   K09   AX00001964   TGTAGCCGATTGCTACCGATACTGGCTTGGATCATTCGCATTCAAGCAAAAACG
6   K11   AX00001965   CGAAAGAGAAGAAGTGGATTGATTCCAATTCTTATGTGGAATTAAAATTTAGCAC
6   K13   AX00001966   GGGACAGTGTATTTACGTTATAGCAATAGATGTCATGCAGCATGGGCTAAGTTT
6   K15   AX00001967   TCGATCTTGCATTTATTTTGGATGAATGTAAAACAGAAGATGCTTTACATGTGGA
6   K17   AX00001968   TATGGATACTTCAAAAACTTTAACTGGCGGAGACCTTTGGAACGTGCTTACTACC
6   K19   AX00001969   CGGCGGGAACGTTTTAGTTGTCGTTCATGGGCTTTTGATTACTACCTTAATAGA
6   K21   AX00001970   GAGTTTAGTGATAAAAAAGAACATGAACTTGTAAAACGTATTAGAGAATGTGACG
6   K23   AX00001971   AGGAGTTTTATCTTGCAGGATGTATTACAGTTGCGAGTACGCATTACGGTGAAA
6   M01   AX00001972   TACTGGAATCACAGGACCTACCGGTGCGACAGGTTTTACTGGAATTGGCATTAC
6   M03   AX00001973   AGAGAAGGTGATAGTGTACATGCTAATTCTGGTTTAGCAACATTAATCTCTGATG
6   M05   AX00001974   CACTCTTACTCACGAATGTGGGCACGGTATGCATACGCACTACTCACACGGATA
6   M07   AX00001975   TTACAATTTCCTGCAGGGACAGGATGGAAATATACAGACTATAATTATATGGTGC
6   M09   AX00001976   TGCCCTTATTTTACCGAAACGGAAAAGGTGTAACTTTAACTTCTAACGGTGAAAT
6   M11   AX00001977   GGAATAAGAATAAGTTTTTAAATATTGCACATCGCGGAGCAAGTGGACATGCAC
6   M13   AX00001978   AAACACGTCAAGCTATTTTGTTAGTTCTCATGGAAACGGAATGTCAAACAGGATT
6   M15   AX00001979   GAAATGCCCCTAATCCTTGGGAATGACTTTGCCGGTGTCATCATAAAGGTTGGA
6   M17   AX00001980   TACGGTCCTTGTGCATTTATGGACAATTACGACCAAGGAACCGTATTTAGCTCC
6   M19   AX00001981   GTGTTTATTTTAAGGTAGATACCGTTATAATGATTGGTTTAATATGGACAGCGCA
6   M21   AX00001982   CTGCTGCACTTCCAAGTGTATTAGCAGCAGTATGGCATAACATTGCAGGGCCAA
6   M23   AX00001983   TTAGAAGTCGTTCTTGCTGATGGAGAAGTAATACATACTGGGAATTTAGCTGCG
6   O01   AX00001984   CATACACATACACTTGTACTTGGTTTTTTCTTCTTTTTAATTGCTTTAGGGTTAGC
6   O03   AX00001985   CATTACGGTCAGAATTTTAGTGGAATGATGGTATATAGCTTTCATGCAACAAAGC
6   O05   AX00001986   GCCATTAATGACATTGCAACTTGGCTAGATATGATGAGGAAAGGGAAAGTAGTA
6   O07   AX00001987   TAACCGTCAATTGTACGGGTATGAAACGAATAACGGCGGTCTTTATATAGAAGG
6   O09   AX00001988   CAGGTACAATTATTATTCAAAAGCAGGCGGTGAAAGGATTAACGACAGCAGCTG
6   O11   AX00001989   TTAATATACATCATAGTTTAACTGAACATTTATTTAACGCTGGCGGTCATATCGG
6   O13   AX00001990   AACCGCGTACGACTGGTATATATCATGTAGCCTTTTTAGTTCCGACTCGTGAGA
6   O15   AX00001991   GGTGGCCGTATTGAAAATATTCGTTTGTCAGCAGCGAGCATAAATGGGGTTGTA
6   O17   AX00001992   CAGATCATATCTCTGTGAAGGCCCTGCTTGCTGATTTCGGGGATCAAATACATA
6   O19   AX00001993   ATTCTTCGTCTAGTAGTTGATTTAGAAAGTAAAACGATTAGGGCAACGAGTGTCG
6   O21   AX00001994   CTTTCGTTTGGAGTACATTTGAAAGTAGTGACACGTGGGAAAGTATAACGGAAA
6   O23   AX00001995   ATTAAAGTTAGTTTAGATGCTTTTGATCATGAAGTAGTATTGCAAGAAATGGAAG
6   A02   EMPTY        -
6   A04   AX00001996   GGTAACACTTGTAGCATCATCTCAAAAGTTAGGCTTAACAGATGGCGTTTCACTA
6   A06   AX00001997   ACGAATCTTACGACAAAAGAAATGATGGCGGTAAAAGTAACGGAAATAAAGCGA
6   A08   AX00001998   TGGTCACCCTTCTTCTAAAGGTGATATCGTAGTCGGCAATGATGTATGGATTGG
6   A10   AX00001999   CTGCCAGTAGTAGTGGAGGGTGATAGCAATACAGTTGTTATCCCGTTTATTCCT
6   A12   AX00002000   TTTACACAATGCGTAGCGACTGAAGAAGTGGAAAAAGAATATCCCGTAAAAATCG
6   A14   AX00002001   GTGCTCCAGGGGAAGCATTTACAGTATTTCAAATGATTCATAATACACCATTTGG
6   A16   AX00002002   GATGTGAATCGTTATTATGTGCCGAATACAGATGGTGGAGCGCAAGATAGATGG
6   A18   AX00002003   CGACAAGTAATGCGGCATATTTATTGCAACTGGCAGGACGGGAAGATATACCTA
6   A20   AX00002004   GAAGTGTTACCTCCTTGGTTAGCTGGAGTTTTCTTAGCTGCACCGATGGCGGCA
6   A22   AX00002005   TATGGGCTTGGTAGTAAAAATCCAAGTGAATATACATATGTATTCGGTTTTCCAG
6   A24   AX00002006   TATGCTCTGCTGGATCACGCCTATTTGTTCCGAAGAAAATGTATGATAATGTCAT
6   C02   AX00002007   AGATAAAGTGAAAGAAAAGATGGTCGGCGCGATTCCAGTTGGTAGAATTGGAAC
6   C04   AX00002008   CATTTAGTACACCATCCCAAACTGCATGGGCGTTAGATGCTCTCATTTCTTACTA
6   C06   AX00002009   ATTAGTCAAAACGGGTGAATTTGATTTTGCAAAGTTTTTCGCTTCAGGTGGGATG
6   C08   AX00002010   TTAATGTCATTAACAATAGCTTCAGTCTTGATTAGCGGAAACTGGTTTGTCTACA
6   C10   AX00002011   TCCGGTTATGTGGCGCGGACCGATGTTAAATAAATGGATTCAAAATTTCCTTGC
6   C12   AX00002012   GTAGCAATTACGCACCGAGTAGGACGGCTAGAAATAATGGATATTGCGGTAGTC
6   C14   AX00002013   TGTCTCAAATCCGAAGAGCAGGCGGAAGAGTAAAATATTTTGGGAAGTTTAGCG
6   C16   AX00002014   GTCGTATTGGCAGGAGGAGAATTAATTACCGGAAATATGATGTCAATGTCTATG
6   C18   AX00002015   TCTTTAGGTGTTAGAAAATTACGGATTACAGGCGGAGAACCGTTACTTCGAAGA
6   C20   AX00002016   AACATATAGAGGACAGCATTGTAACAGAGTTTCCAGTCACGATTAAAATGAACGG
6   C22   AX00002017   CGATTGCGACCCTTTATGGAAACTTAACACCTACTGAAAAATTCATTTCAAGTAC
6   C24   AX00002018   CATTTAGAGAGTAATAAAAAAGTAGGGGTATTCGATCTTATGAAAGTATTGAAAG
6   E02   AX00002019   TGAGCTGTGGTCAATGTGTAACGATTTGTCCTTGTAACGCTTTAATGGAGAAAAC
6   E04   AX00002020   GTTGTAGATCGCTCACCAGGCGTATTAATAGGACCTATGACCTTTTCATCCTTTT
6   E06   AX00002021   AATTATGGAAAAGCATCCTGGATATACTTTACTTGATGTGCTGACTCGTTATCTT
6   E08   AX00002022   AAAATCTAGTTTAACGCCGCATTTAGATAAGTATTGGCACTTACCAGCCTTCATG
6   E10   AX00002023   TTATTACTGTTACTAGTAGGAATAATCGTTTTAGGATGGATTGTCCGTCCGAGAT
6   E12   AX00002024   ATTTAGAAGACGGATTTGAAGTGTATACGTATGTGCAGGGGGATTTGGATTTTG
6   E14   AX00002025   TATGGATTGAGCCGGTGCAACAGCGCTCATCTTTTGATTCAGGATTCGGATACT
6   E16   AX00002026   ACAATTGTTAGCACAACTGCCTTTTAGATATGGAGCTAACGTCCTTGAGATAGGC
6   E18   AX00002027   TTCAATTAGCAGGTGATGATTTATACTTACCTAATGGCCCAAACGGCCAACGTG
6   E20   AX00002028   CAAGGAAACTATCAAACTGTTTTACAAATACTTTCAAACTATAATGTAACGGCAC
6   E22   AX00002029   ATGACATGATGCAAAAAATGATTGTACGAAAAATGAATACTGGCGGGTTATTTCA
6   E24   AX00002030   CCAGGTGCAGAGGTGGATGATTATTTCCACATAGTACTTCATTACGGAGTTAAA
6   G02   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
6   G04   AX00002032   GGGGAAACTAGGTACAAGTGAAGCTCGTTCTTCAATTGATGCCATTGTATCAGA
6   G06   AX00002033   AAAAGCAATGCAAGATGCTGGATACCGCATTATTCCAGTTAACCCAACAGTAGA
6   G08   AX00002034   TGTAGGTGTTATTAACATGCAACAAAGCATTGATCCATTTGCAATGCAACCGACA
6   G10   AX00002035   GCGGATGGCGTGGTAGGAGTAGCAGAAGAAAATGCTATGTCTTTAGCTGGAAT
6   G12   AX00002036   CGAACGGTTTTCATACCGGACATGGACATATGAGACAACCGCAAGACATTAAAA
6   G14   AX00002037   AATGGTTTTCGGATTAGATATTCACCCACTATGGTTCGGGTTAGCGGCTGTTCT
6   G16   AX00002038   GGTGGTTGCAGTACTGTGCAAAAAGGACTTTCTTTAGGTATTCGTAAAGATGAT
6   G18   AX00002039   ATTTAGTGTGGCTTGAATTAGGTCGCACGAAACTTATACAAGATTTAGGGTTTTC
6   G20   AX00002040   GCACCTGAAGATCGCGAAGCGTATAATCGTTTTTTACGAAATGTGAAAACACGC
6   G22   AX00002041   TGATAACTTTAATGAAGCAAAAGAAACAGCGGAGCTTTCTAATGAAAAAGACCGT
6   G24   AX00002042   GTGTTTCGGATGCACCGACGATTGAAGAAGTGTTACCTTTATTTTTAGCATTTTT
6   I02   AX00002043   GTGATTTTAAACTTTTGGGCAACGTGGTGTGGACCTTGCCAGCAAGAAATGCCG
6   I04   AX00002044   GCGGGTACGGCAGACGCGCTTGCCTTCAACATGGACTTAGAGTTTAAACGTAAT
6   I06   AX00002045   TATCAAACTGTTCTATGGTCGTGGCATCAAGATCCACGTGATTGGGCAAATCCA
6   I08   AX00002046   AACGATCCAAACTACGGTCATGATTTAAAAGAATTACGCCAAGAGGTTCAGGAA
6   I10   AX00002047   GGAAACAGATGTACCAAATGTAACTGAACAAAATGTAGTTATTAAAAAGATGGAG
6   I12   AX00002048   GTACTTCTCGATTATTACGGGTACCAAAATGGATTTGTAGTATTTTCAGCGCTAG
6   I14   AX00002049   ATTTTAACGGATTGTAATCGAGAAAGCGTGAAGTTTGATCGGTTATATGTAAAAG
6   I16   AX00002050   GACAGGGTTAGAAGTTAATATTCAGAAGCTACTCTATGTTTGTGATAAACCAGAT
6   I18   AX00002051   GACGCGGTAGCTTTTTGGCATGAAGAAAACGAACGAAAAAAAGACCCTACATAC
6   I20   AX00002052   ATTTCATTCAAGGCGGGGGCGGTAAGTGTTATATCGCCGGAGGAGTAGAGAGT
6   I22   AX00002053   TTGGTGGTATTTTCGTAGTTTATGTATTTGGTATTACTGTACAAGCTTTCTTAATG
6   I24   AX00002054   GGATAGTACGGAGATGGGAGAACTATGTTTACGAGCGCCATGGATCGCTGAAA
6   K02   AX00002055   GGAGAAGGTGAGTTTGTCGGTTATGCACAAATACGGAAAAAGGAGACGATGTTC
6   K04   AX00002056   CTACTTTGTCAGAATTTCAGCGTAAAGGCTGTCATACTGCATTAATTCAAAAGCG
6   K06   AX00002057   TGTCGGGAAAGTAACTGACAATAAAAAATTACAAGCTGAAGGAAAATGGGATAA
6   K08   AX00002058   AGAAGAAATGATTAAATTAGTAGGACCTTTTGCATACAATCAAGCAATTGGAGAT
6   K10   AX00002059   ATTTATGGTGTATGTGATGGTGCAACACCGCTCGTCCCGTTTCGTGATGAAAAG
6   K12   AX00002060   TCGGTATGCTTTTATCCCGCAAGCGAGACATTAAACTTGGCGGATTCCTTATTAT
6   K14   AX00002061   ATGAAGGACGCTGGCTTGAGGCAAATGACTACGCACTTTCTTGTTTCAATTTCC
6   K16   AX00002062   AGCAGGAAAATCCGTGTTTATCGCTGCTGGGACAAATGACCCGATTTGTTCATC
6   K18   AX00002063   GTGTCCCGTTTTGGATACCACGTAACTCCTGTACAAGACCGAAATTATTTTAACG
6   K20   AX00002064   ACGATTCCAGATTTTTTAGAGAATCGGTTTAAAGATCGTACGAAAATACTTCGTT
6   K22   AX00002065   TATAATGGCGCTTCAATGTAATTCTGGCCAATGTCCATCTGGTGTGGCCACGAC
6   K24   AX00002066   AAACACTTCTTCGTTTCTCTGCTTTTAAAGGTGATAATCCTACTTATATGTGGGA
6   M02   AX00002067   CAAAGTGAACACTGATAAAATAAAAACGGGTAAAATGCAAGAAGGTGCTGAGGT
6   M04   AX00002068   GTGGGTCGTAAGGCAGATTTAGTTTTATGGGATGCTTACAATTATGCTTACGTAC
6   M06   AX00002069   CGCCAGACTTGGTTACAGATCAAACATCTGCTCATGATCCATTAAACGGTTATAT
6   M08   AX00002070   TATCTCATCTTGCGCTCATATTATTAGGCGAAGGTGAAGTGTTCTATAAAGGGAA
6   M10   AX00002071   TGAAACAGACGTTTACAGAGAAACACATGCACTTTATCATGCAATAATGGAAGCT
6   M12   AX00002072   TCGTCAATTTCACGAACAAGAAAAATTAGTAGCTGCTATTTGTGCTGGACCGTAT
6   M14   AX00002073   CCGCGATAACGACTACATTTCTTTACCTACACATATAAGCGGCCTATCAACAGCA
6   M16   AX00002074   AACGAGGCATTTATGGGATGACGAACAAAAACAATTGTTAGAAGAGCTCGTCAG
6   M18   AX00002075   TTTATTCGTTTAAAAGCAGCTAAGAAACCTGCAACATTGAAAAAAATTATACTTCC
6   M20   AX00002076   CAGGTATGTCGGTTTCTGAGCTGAAAGAAGAAAATGCAATGCTTCGCAAAAGAA
6   M22   AX00002077   TATGTCAGGAGCAATTATTTATTTATGGAGCAGCGTTTGTTTTTGGATTAGTTAA
6   M24   AX00002078   AAAGTGCCCAAAGGGGAGAAGTGGGCTCACTTTCAATTGGTTTTGTAGGTGCGG
6   O02   AX00002079   CCTTCTGCAGTCGCTGTCATACGCTACAAAGATACACTATCACAATATGGAATCG
6   O04   AX00002080   TGGAATGGCTATTTTACTTAATGTCATTGTCGGTTCGTTTCTATCAGTTATTACTT
6   O06   AX00002081   GGATATACGTCAAAGTTTAATCAAAATAGATGGCTAAATCATGCAGATAAGCGTG
6   O08   AX00002082   AATAATGTTTGCGATTATGGTGCTATATCGCCGGAAAAGTGCAGCTTTTTATTTA
6   O10   AX00002083   GGTGATCTCGTTACATTTACGACGTATTTAGGTACTCTTGTTTGGCCAATGTTAG
6   O12   AX00002084   TTATACAGGAGCGGAATACGGCGAAATAATGGTGAAACCACACTATATTCGCAT
6   O14   AX00002085   CAGAGTCTGTACCATCATTCTTCGGTGGATCTGCTGACCTTGCTGGTTCTAACA
6   O16   AX00002086   TATTAGGTACATTTATTTCTGCCTTTTTATCTGTTCCATTTGCTTTTTGGGCGGCG
6   O18   AX00002087   GTGCCGCCAGATTGGAGTTATTTTCAAGTTATTACAACAGCGATGTTAGATACAA
6   O20   AX00002088   ACCTTGTAAAGCGATCAACAGTATTAAAGAACGTATTAGCTGGCCGTGTTGGGT
6   O22   AX00002089   TCAAACGAAAATAGTGAAATTTACGGAGAAAATTCCAAACGATACGATTTCGGTA
6   O24   AX00002090   CTGAAGAAGAACAACGTGAGCGTCAATCGCTACGTGAACAATATTTAAAAGGAT
6   B02   EMPTY        -
6   B04   AX00002091   TTGCATTTAGCAGAGCGCTATCAAATGAATGTTATTAAGGTGATTGAAGAGCAGG
6   B06   AX00002092   GTGAAATCGGTCAAGCAGTCGGCCTCGCTTCTAGTTCTACAGTGCACGGACATT
6   B08   AX00002093   TCTACATTGACTCTCCTTGTGCCTGAACGCTCTTACCAAGATGTAAAAGTAAATT
6   B10   AX00002094   CAACTTCAAATGTGACAAGAGCTGTCATGGCAGTGATTGGACTTAGTTTGTTTAA
6   B12   AX00002095   GAAGAGCATAATCTTGTTTCTCCAACCCGTACAAAGGGGAATCGTAGATTATTTT
6   B14   AX00002096   AGCGTTATTTGGTATTTTACGTCCAGGAGATGAGTTATTGTACATCACTGGCAAG
6   B16   AX00002097   AGTTGCAATATACAATGCCGCGTCTTATGGGACAAGGATTGTCTTTATCACGTC
6   B18   AX00002098   ATCCGATTGTCGCGTTTTGGCAACAAGACATGTTATTTCAAATCGCACTTTTATC
6   B20   AX00002099   ACAAAAGCATCCCTGAACCCGTTCGTCCAAAATACCATAGTAATGATCCATTATT
6   B22   AX00002100   GGAGTAGGAATTTCAATAAATGGAGCAGTCGCAACTGACAACTTCTCTTCAAATC
6   B24   AX00002101   GTACTTATTAAATGGTTTCCAGCTTCGTGGATTAATTAAAGGATTTGATAATTTTA
6   D02   AX00002102   GACGAATTCACGTCGTTATGCAAAACGTCAATTAACGTGGTTCCGTAATAAGATG
6   D04   AX00002103   AGGATTTATTGCGAGTTCTATTGCTGATCGTCCTGGTTTTATGCCTGGTGTTGTC
6   D06   AX00002104   GATTTGTAGGTAAATATGAACAGACAAAAGATATTGAAAAGGCATTTCAATATGG
6   D08   AX00002105   AGTAGGACGAAAGCTTTAATCGGTGCTATGGCACAGGAAAGTATGCAGAAGTAT
6   D10   AX00002106   TGCACTTGTATTTGGTTTTACAAATCAATTAACACGTCATCGTAAAATTGTACGTT
6   D12   AX00002107   GAGCAAGGTATGTTCTATTCCTTCTCATCCCCGTTCGATATGCAGCGCGAGCCG
6   D14   AX00002108   CAGCAGGACCAGGTTCTATCGTTTCATATGCATTAGCAGGACTTTTAGTCGTTTT
6   D16   AX00002109   CATACATTCACGTTCAACACTACAACGCTGGCAGTGGTATTGGAATGGACGGTA
6   D18   AX00002110   AAAATATATGGAGGAAGCTGGTTTCACTGTGTTAGTAAATGAAGTGCAGAAAATT
6   D20   AX00002111   GATATTCATGTTATTGGAACAATGCCAAAGGCTTGGGGATCATTTACTAGTTTTC
6   D22   AX00002112   GGTGATTTTGGCGGAGCACTTGAGAAAATGATAGCAGTACTTGTTATCGCTTGT
6   D24   AX00002113   AGCTAAACGGTGTTGAACAAGTGAAAGTTCAATTAGCAGAAGGAACTGTTGAAG
6   F02   AX00002114   TAGATTAAAGAGAATTGAAGGACAAGTCCGCGGTATTCAAAATATGATTGAAAAT
6   F04   AX00002115   GCTATGATTTTACGCCTAGCGTAATTTCAAAAGATGCGGCTTTAAAACCAGATGG
6   F06   AX00002116   TTACAAGGACAGGATTTACATACAATTCCAACGAAACAAATTGCGAAGCAGTTAG
6   F08   AX00002117   ACCATGATTTAGTTATTTTTGAGTTTCGTCTTCCGCGCATCATAATTGCTGGATT
6   F10   AX00002118   TAATTATTCCGCACATTACTCGCTTTATAATTGGAGTAGATTATAAGTGGATTTTG
6   F12   AX00002119   TATTCAGGGACGGCTATTTTTTCGAAAAAAGAACCGCTTTCTGTTACTTATGGTT
6   F14   AX00002120   TCATGCAGAGCAAGCATTAAGTGAAAACTTTCGCCCGTGCAAACGTTGTAAACC
6   F16   AX00002121   TGGACTATGTTTCATTGGATCACAAGACGAACAATTTGAGGAATTAAATATATGG
6   F18   AX00002122   GCCAACTATGTTTTAATGCGTTGTTTACGATTTCCTTCTGCTTTTCCAATTGACG
6   F20   AX00002123   AAATTGGCCGTGGCCCAGCACATTTTGATGTAGAAGCGTTTGGTGCATCATTCG
6   F22   AX00002124   TAAGTGGCAGAAGCATTGATGTTCTTTCTGGAGATAAAGAAGCAATTCAGCTAAA
6   F24   AX00002125   GAGAGTCATATGCGGATTGCCAGAGAAGAGTAGTGAAAGTGTTAAAAGAAATAT
6   H02   AX00002126   AGGAAATTAAGCCGGGGTTAGATGTTGCTAATTATGAGTTTATTGAAAGGTTGC
6   H04   AX00002127   ATTGCAATGATGGATGAGCGAGAAACATTAATAAAACTGCGTACACTAAAGAGTT
6   H06   AX00002128   AACAGTACTTAAGTTTTTCCGTATAACAAGTACGATCGGAAAAGGAGTGGGAAT
6   H08   AX00002129   AGTTGGTACGTGGATTCAAGGAGTATTCCATTTATCAATGCCAGGAAGTTTAATA
6   H10   AX00002130   GGTGTGTCACATAAACGAATACCGAACTGGGGTAGGTACGTTGAGGATGGATC
6   H12   AX00002131   AAGCTTGTCTTCTGGTGGTACAGCATGGAATAGTCCATATTACTATGCCTCTTAT
6   H14   AX00002132   GGGACGTCTGTACTAGGAATTGTATCCTCTGAGGACAATGAAGTTGGGAATATT
6   H16   AX00002133   GGACGCATTATTAGAAAGTACGAAGAAGGTTTAGTTATGCCTGACGGTCAAAAT
6   H18   AX00002134   AAATCGAGGAGCTGTATTTTTCACACACGGTAACAATGATTATACTGCGACGCC
6   H20   AX00002135   AAATTGGTTAAAGGTAGTCAATCCGTCTTATGCTGCATTTCCATCAGCAGCTGTA
6   H22   AX00002136   ATGCATGGAACATATATTTTCGCTCAAAATGATAAAGGCTTATATATGATTGACC
6   H24   AX00002137   CTTCATAAAATTCAAGACGGGGCAGCAGATAAAAGTTACGGAATTCACGTTGCG
6   J02   AX00002138   ATGTGAATCGAATAATGAGCCAACAAGTATTTTAGGGTGCTGGGTAATTAACCAC
6   J04   AX00002139   GAAGTTGATTTCTTTAAGAAAGCAGAGGCGCAAATTCATAAAAATGAAAACGTAA
6   J06   AX00002140   TATGTATGGCTGTGATAAGTTCTGTACATATTGTATCGTACCGTATACACGCGGA
6   J08   AX00002141   GTATCGGCTGTTCAGGTCGTATTTCAGGTTATATTAATTCATATGGTGTGCATAG
6   J10   AX00002142   GAGGGTATGAAAGTAAACCATGCTCATGTGCGTTTAATTCACCCGTTCCCAACA
6   J12   AX00002143   GACACGTGGGGCGGGTTTAACGACTTCTGGTAAACATGTTGTACAAGAACTGAA
6   J14   AX00002144   GTTATTCGCGAACGCGGAACAGCAGAAATTCAAGCCATTGGTGCAGGTGCATTG
6   J16   AX00002145   AGTTATTAACTTACAAGGACGTACATTCCTTCCTCCAATTGATTGTCCATTCCGT
6   J18   AX00002146   TAAACAGTATTGCATCTCACCATGGGGACACAGAACCAACTTCTATCATTGCAGT
6   J20   AX00002147   GATATGGCCTCTGAACTTGATATCGTTCAAAAGAGCGGTGCTTGGTACTCTTAT
6   J22   AX00002148   GGACATTACGCAAGAAAGTATAATCTTGTAACGAATTTAGGGAAGTTTCTTGATC
6   J24   AX00002149   ACGCAGATGCGGTTGGATTAAATGGAGAGGAACTACTTGTAGAATATCAGAGTA
6   L02   AX00002150   GAAATTATGAGGTTGCCTGCAACGAAAGTTGTGGAACATCCTGACGTATTTGTG
6   L04   AX00002151   GAAGTGATTCCTGTTCAAGCGAATTTAGCTTCTAGTGATGGAGCAGAGCAATTG
6   L06   AX00002152   TATGAAACGTTTTATCATCCAAGCAATATGTTAATGTTTGTTGTGGGTGCAATTG
6   L08   AX00002153   TTTCGTTTGAAAGCACCTTTAAATGAGGAGACGGTGACAGAGCGTGCCCTATTG
6   L10   AX00002154   TTGGGATTGCAGGGATTGATGGAAATGGTCAAAGTGAATTAATAGAGGCGATTA
6   L12   AX00002155   AAAAGGTGAAAATGTTTGGGTAATCGGTGTTGACCGTGACCAAAATCAAGAAGG
6   L14   AX00002156   CAGTGATGATTGAGCGTGTGCGTACAGCAGATGGGGAACCTGTTGTATATTGTA
6   L16   AX00002157   GGTAGCGGGAAGAGTGTATGTATTAACGGTATTATTGTTAGTATTTTAATGCGTG
6   L18   AX00002158   GAAGCTGGGCTAGCAATTTCTGAGATGGTCGCTTCACTTTCAAAACCGACAGTA
6   L20   AX00002159   TTTGTACCCGTACATGGTGAGTTTCGTATGCAAAAAGCACATGCATACTTAGCTG
6   L22   AX00002160   TACAGCGGTGATGACGGTTTAACGCTACCAGCTATGGCAGTTGGAGCGAAAGG
6   L24   AX00002161   ATTGCGATGCATGCAAAAGTGCCGCTTCGTGTACGTTCTACGTATTCTGATAGT
6   N02   AX00002162   AAAGAGCTTACTTGCAAATGCGGAAGGTATCGTTCTACAAGATAATCCAGAAGA
6   N04   AX00002163   GAAAGCGACGCTAAGAAATGGCAAGCCTGTCGTATTGGCTGTTTCGACGAATGA
6   N06   AX00002164   TGAGTGTTGCCAGAGCATTTCAATCATTAGGAGCCCATGTCAAGGTTGGAGCAA
6   N08   AX00002165   TTAGGCGGTAGTATGAGTAGCCGTTTATTCCAAGAAGTACGTGAGCAACGCGGG
6   N10   AX00002166   AATTGATTGGAAGCGACCTGAGCCAGATGTACTATTGCAGAGAGTAATGAGAAA
6   N12   AX00002167   AAGGTGACGAAATCCGTCCATTAGCATCAGAGGTTGGCATTTTATCTCGTACAC
6   N14   AX00002168   ACGGAGCAAATTAACACTCTAAACGAGCACTTACGTACTCACAAGAAAGATCATC
6   N16   AX00002169   CTACTGTAATGGCATTAGGATTTTTTGATGGCATTCATTTAGGACATCAATGTGT
6   N18   AX00002170   CACTAAAAGGTTTAGCGAAGGCAAAAGGCTTCATTCGTTCAGAAATTGGCCAAC
6   N20   AX00002171   ACGTACGGAAATTGCAATTGTTTCTGTATCCTCTAATCGTGTTATTTGTGAAAAA
6   N22   AX00002172   ATCGATGAGCAAGATGATGAAGAGAACTTAAAAGAGCGTCCAGCTGTAGTTACA
6   N24   AX00002173   AACGACGTACTACAACGTACCAATGAGAAAGGTCGAAAATCGACAACAATTAGG
6   P02   AX00002174   CAAAACGAGAGCTCGTTCGCATTGTTCGTTCCAAAGAGGGAGAAGTGTCTATTG
6   P04   AX00002175   ATGCGATTGAAGCAGCGTTAATCTCTGCTTATAAACGCAATTTTAACCAAGCACA
6   P06   AX00002176   TTCTTACGCGTATTCATCGATTCTGAAAAGGGAGTCGACATTGAAGAATGCGGT
6   P08   AX00002177   TGACATTCCGTTCGAAACGTTCCTTGGGTTTAAAGGAGATAAGGTACCCGATAT
6   P10   AX00002178   ATACTCTTTCCATGCTACGCAAGAGAGCTTAGATGAAGTGTACGATCGCTTATAC
6   P12   AX00002179   ATATGCGAGTACCAATTCAATACGCGCTTACATATCCTGATCGATTACCTCTTTC
6   P14   AX00002180   GTTTGTGGAATTATTGTGGCACTTGTTTACAACATGTTCTTCCCAGTTGAATCGA
6   P16   AX00002181   AATGACGAGTTCTTTACCTGACCCAGAGTTGTTAATCCGTACGAGCGGAGAGCT
6   P18   AX00002182   GCAACAGTTCGTGCTGGCCGTGCAAGCGCGTCTGTATTAGATAAAGTACAAGTT
6   P20   AX00002183   CTCGCGTACAAACTTCAATTGAGATGCGTCAAGTGGCAGAGCCTTACATTCGTC
6   P22   AX00002184   TTTGCTTACTTGACCAAGCATTCGTTAAAAACCCTGATATGAAAGTTCGTCAGTT
6   P24   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
6   B01   EMPTY        -
6   B03   AX00002186   GGAGCGTTTCATATGTCTAAACCGTCAGATTTAATTCCGGAATTACAAGGGAGA
6   B05   AX00002187   AGGTGACGATGGGAAATGCTGTTGTAATGAAACATACAGCTCGTAAAGTTCGTA
6   B07   AX00002188   TAGCCCGTAAATCTGTCGCAAGAAAAGTATCAAGCTTACGAAGTTTATATCGCTT
6   B09   AX00002189   ACCGGTAAGGCAAACGCCAGCTCATCACACAGATAAATTTGCAGAATTAGTATG
6   B11   AX00002190   GCTCGAATTTCCCAGATTGTCGTAATACAAAACCGATTGTGAAAGAAATCGGTG
6   B13   AX00002191   TAGATATGGTAAACGTAAAGAGATATATGGCTGGTAAACATACACGTTTACTTGG
6   B15   AX00002192   GGTTTAGCGATGGCTACGATGGATATCATTAAACATTACCATGGCGATCCAGCT
6   B17   AX00002193   CTAAAACAGGAGATCGTCCTGGTGTGACAACAGCTCAGCAATGGATTAAAGTTG
6   B19   AX00002194   CTTACGGTGTAGGTGTAGAGCGTACATTCCCAGTTCACACGCCAAGAATCGCGA
6   B21   AX00002195   ATGTGGGCATTATGAAGGATATGACGAAAGAATTCGTGAACACCTCGTAACGGA
6   B23   AX00002196   AACTAGCTGAAGGTGAATATTACTATCATGAAATTATTGGTTGCAATGTTGTAAC
6   D01   AX00002197   TTACAACGGAGAGATAAAGTATCGATTAACTGTACATCCTGAGGATGTTGGAAA
6   D03   AX00002198   TCGTGTAGTTGTTGCAGATTCTCGTTCTCCTCGTGACGGACGTTTCATTGAGGA
6   D05   AX00002199   TTAGAGCGAGAACAACCGGAAATAATCAATGCTAGTCGCAAAAAACGCATTGCC
6   D07   AX00002200   GAAATTGCGGAAGAATTTGATGTAAGTCGCCAAGCCGTGTATGATAACATTAAA
6   D09   AX00002201   TGGCTCATAAGTTTAAATCAGAAGGTAAGTCTGTCTTATTAGCGGCAGGAGATA
6   D11   AX00002202   TTTCTACTACGTTTGAAGGGATTCGAATGGAGTTTCAATCGGTGTTCTCTGAATT
6   D13   AX00002203   TTGCAAACGAGTTGTCATTTGGTAGCCTTGTTTTATTAGGCAAAGGTGAGGAAA
6   D15   AX00002204   AACAGAAGTAGTACCAGCTGCGAGCTTCAAGGAAGATTTAGGAGCAGACTCCCT
6   D17   AX00002205   ATTGATTTAGCGAAACAAGGGGCAAATGTGGTAGTAAATTATGCTGGTAATGAG
6   D19   AX00002206   TAACTTTTGAGGATGCAGTATATGCTGTAAGGAAACGTGGGGAATATATGGAAG
6   D21   AX00002207   ATTATTCGGAGTATGGAGGAGCGGCATTATTTGGATTGAAAGCTCCTGTCATTA
6   D23   AX00002208   AAGTCTACCATTCGATACATTCGTCCTGTAAAATTAGGAGAGCGTGTTGTTGCAA
6   F01   AX00002209   TGGTAAATGGGATCAGCATCGTCAAACGATTGCGGTATCAGAACTTCATTTTGG
6   F03   AX00002210   GTCGGCGTAAGTTTAGCCAAAGGATTATTAATGGGAGCTCGTGGTAACTCTGGA
6   F05   AX00002211   CATTAATTCGTATTTTTGGTGCTACCGGCGGAAGGCTTGATCACGGTTTAGCGA
6   F07   AX00002212   TATGACAGTAAACCCTGGATTTGGTGGACAGAAATTTATCCATTCTGTATTACCG
6   F09   AX00002213   AGGTAGAAGATCTTACATATTGCTTTCCAGAGTTGAAAGAAGCGAGCCAATACT
6   F11   AX00002214   CTCGACTATTCAAATAACGAAGAGTTTATTAAACGTTTCCATCGAGAAGCGCAGT
6   F13   AX00002215   CGAGCTCGATGACCATTCAATTATTCCATGATTATTGGAAGCAAACGCATAATAT
6   F15   AX00002216   GCATCATTAACCATGAAAAAGGACTTCATATTGGCGCGAGACATATGACAGTTTC
6   F17   AX00002217   AGATTGCAAAGCGTCGCGGACATAAAGGCATTGCTGGTATGGTAAACGGTGTAT
6   F19   AX00002218   ATCACATTCGCGGATTGAATCCATGGCCAGTTGCTTATACAACTTTAGCAGGAC
6   F21   AX00002219   CTAGAAAAACGTGGTGAACAAGTAGGTCCCGAGGGCTGTTTAAGCTTCCCGGG
6   F23   AX00002220   TTACAAAACTATTTCCAGAGGCACGAGTCATTCGAATGGATGTAGATACGACGA
6   H01   AX00002221   GATTACAACTACTTTGTTAGCTACTACAGCCCCAGTGTGGATTGCACCTGCTATG
6   H03   AX00002222   ACAGTGGCTGCAAAACGTGCGCGCGAAATGCAACTTGCTAATAACTGTGTTGTA
6   H05   AX00002223   AAAGAGCTGTTTAGTCATGAGGATACACGTTTTCAGTACTCCATTTCAGTAACGA
6   H07   AX00002224   AGTCCGGAGTCAGCTCCTATTAAACGAACAGTACAGGAAGCACGTGAACATAAT
6   H09   AX00002225   CTATTAGTATAGCGGGTGAAGGGCTTGTTGAAAGAAAATTAAGTGTGAATTGGT
6   H11   AX00002226   GCAAAAGAGTCTAGTTCTGTACCTGTTGATTTCACAAAAATACGCCATGTGAAAA
6   H13   AX00002227   GTGCACTTTACGACGGATATTGTTCCGATATAACACGTACTGTAGCAATTGGGG
6   H15   AX00002228   ACCAGTTATATTATGTATAGGAGTATTGATTTTTGCTCCTATGTATCGTTGGGAT
6   H17   AX00002229   TATTTTAATAGAAGGTCAGAAACAAATGGAGAAAATGTCTATTTTTCAAGAATGG
6   H19   AX00002230   CCCCTACACTCGCCTACTGGATTATCGGCCTTTTAATGATGACAATTTCTTTCTT
6   H21   AX00002231   AAACGTATTACGTAATGCCGATTGTAACGTTTGCTAGTTTTTTAATAATAGGTGT
6   H23   AX00002232   AGCAACTGCTGGTATTGCGCACGCTGCATGGGTAAGCGATCGTATGGATTTACC
6   J01   AX00002233   TGGTAAATGTTCATGCTGGTGGGGGAAGCAGTATGATGAAAGCTGCGATTGAG
6   J03   AX00002234   TTAAGTGTACTAGGATCAATCATGATTAAAGCGACGACAGAACAACCACGCTATG
6   J05   AX00002235   ATTAAGGTAGCAGAGGGCATTGCGCCCCTTCTGCGCCGCCCAATTAGTATTTGT
6   J07   AX00002236   CGTTGTAGCACCAAGCCAAACGCTAAGCGATCGTGAATACCAAATGTTGCGTAA
6   J09   AX00002237   TTCCTTTATTCGGAATTTGCCTAGGACATCAATTGTTCGCTCTAGCATCTGGTGC
6   J11   AX00002238   ATATCCCATCAGCTGATCCTAATTTTAAAATGAACCCACCGCTTCGTGGAAAAGA
6   J13   AX00002239   ACTTTATACGATACGATAAGAACACTAGAATCAATCGGAACAAAAGCAGTGGTCA
6   J15   AX00002240   CATACAGCAGTTAACATGGCGATGAATGGTGCGGATGGCAAATATAGCTTTACA
6   J17   AX00002241   GAATTAGTCATGAAATCGTGGAACGAAATAAAGGTGTCGATAATTGTGTTCTTGT
6   J19   AX00002242   AGTAGTGGATTTCATTCACGTGTATATTTTCTCGTACAACTATCCAGTATTCAATA
6   J21   AX00002243   ATTCCGTAAAGAAACAGACATCATGGATGTATGGTTCGACTCAGGTTCTTCTCAC
6   J23   AX00002244   AAAGTATTCCGCACTCGTTTCCGTATGTTATTAGAAACACAGCTTGAAATGTTAA
6   L01   AX00002245   TTGGAAATTGACTATCCTTCCAAGTTTTATACGCTAGAGCATAGGCAAATATTAG
6   L03   AX00002246   TTACAACGAATGTCTACTGATCAAGCTGTACGTATCGTTGACTTTTTAAGTGGTA
6   L05   AX00002247   TAAGAAGGTGAAATGTTTTATTCAAGTGAAAACATCATCTGAAGAATCCAAGCAA
6   L07   AX00002248   TGGGGTAAGTACGGGCTCCTTTCATGCGATGAATTTAGGATTACATGTGAATGA
6   L09   AX00002249   GTGATGAAAAACAAAAGGACGAGCAGTGGGTTGAAGAGCTAGCACTAAAAGAAG
6   L11   AX00002250   CTATGATGACACATCCGATTATGAAACTACTGTACTCGTTACTTATCGTGTATAC
6   L13   AX00002251   TGATAGCATTGCAACTCAACCACCAAAACCAATTATCCGTCCGAATGTGAATCAC
6   L15   AX00002252   AACCAGGTACAGCTACTTCCTTGTCACGGAGTAGTCGCTGTTTCAAATGAAGAT
6   L17   AX00002253   GTGACGTATGATACAAGTTATTTCCGGGTGACAGCACATAAAGCAGAAGAAAAC
6   L19   AX00002254   AACCTTCTTGTATCTGATCTAGGTATAGAAGGTGTCGTTATTCGTTTAGGAGAAG
6   L21   AX00002255   TCCGGAAGCAAGGTTTTTATATATTGGTACGGAAAATGGATTAGAGAGTACAATC
6   L23   AX00002256   CATCAGCACCGTATCGGATGAAACGTATTACATCATATTTAGATCCGTGGTCAG
6   N01   AX00002257   CCGTTAGCAGAAAATGTACTCGCTGCAGAATTACAAGCAAAAGGAATGGACGTT
6   N03   AX00002258   GAGTATTCGTGATGAGGGACCAAAGTCACATCAAAAAAAATCAGGAACACCGAC
6   N05   AX00002259   TTGCGGAAAGACCAATTGATGTTGACGTTCCAGTTGTACTTGTGAAAAACACTTT
6   N07   AX00002260   CTTCGGGATGCACTTCCTGTTATGGGAGTGAAACCGAGAAAAGAACAGGTTGAG
6   N09   AX00002261   TGATGAAGGAGTAGAGCGCTCTTCAAACGTAGCATTTGCAATTTTAGGGGATCA
6   N11   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
6   N13   AX00002263   TTTAAACGAAATAGTACAACGCCGCAATTGCCGCCAGGATTACCAATTATTCCTG
6   N15   AX00002264   AAAAGCGCTTGGAGATGAAAATACATATGTTGTTATAGCTGGACAACAAGCTGG
6   N17   AX00002265   ATGAAAAGGAACGGCGGGGAACCATTCGAAATTACAGGTACTTACCTAGAACTC
6   N19   AX00002266   AGAGTTGATTTTGGCTCCGGTAAGTTTACGTTCCATCTACATATAACTGGAAGCA
6   N21   AX00002267   AAGAGTCTGGTGATTTTATGCTTGTTACGGTTTCGATGGGACCAGCAAATGTAG
6   N23   AX00002268   TTATGCAACATGAGCTTGTGATGAATCGGCAAATTGCATCGGATTTAATGATGCG
6   P01   AX00002269   TTTCTCTTGTACTCCACCCCCAAGCTGCTTTACAAGCTTCCATTCGAGGGTTAAA
6   P03   AX00002270   AAGAGCGCTTAGATTTAATTCGAGAAGCCACAAAGGATATCCCTAATGTAAAAGT
6   P05   AX00002271   TTTAATATGATAGGTCCTTATTTTGATGGCGGTATCGCTCTTGATTTATTTGGCG
6   P07   AX00002272   AATTGAGCATATGATGCAAAAGTTGAACAAACTTCCTTTTGTGAAAAAGATAGAA
6   P09   AX00002273   CGCCTGCTTATTCTTCGGTAAAAGAAAATAAAAAAGAAAAAGATAATCGAACCGA
6   P11   AX00002274   TTGTCGGTGTTCGTTATATGGATGACGAAACGTTATTACGCCAAAGACCGTATC
6   P13   AX00002275   AGTATCGTAAGCTAAATCCTTGGGTGCCAGTTGAACCTTGGAAGGCTGGAGATT
6   P15   AX00002276   AACAAAGTCAAATTGCTCATCCTATTTGTCTCGCTATATTGTTCTTTACAGCAATC
6   P17   AX00002277   GTAATTTTTCAATTGTACTATTTTATGCATATGAGTCATAAAGGACATGAAGCCG
6   P19   AX00002278   TGGCACATATTTAGCGTTAAAGAATTCTACAAATGGTGGACCAACTTCTCAAGAG
6   P21   AX00002279   CGTGCGCCAGGAATGACGTATATGCGTATGCCGATGTTTACATGGACGACATTT
6   P23   AX00002280   AAAGCTGTATTGGTTGTCACGCAGTTGGATCTAATGATAGTAGACCACCTTCCG
7   A01   EMPTY        -
7   A03   AX00002281   TGGTTCTGGATTAGTTATGGCAGGGGTATGTTGTTTAAACAACTACATTGATCGA
7   A05   AX00002282   GCTTTAGTACGTCACGAACGAGCTAGCCTAGCTTGTCCAGACTTCCCTTTATGT
7   A07   AX00002283   CAAGTGCGAACACGCTATACTATGCGTTAGGCGGAAACGAAAGACAGCCAGATG
7   A09   AX00002284   GAATTGCAAGTTTAATTGGAATACAAACTTTTGTTAATGTCGGTGGTATGTCTGG
7   A11   AX00002285   GTGTTAGACACACAAATGTTTGGACTATCCCGCGAAGTCGATTTTGCAGTTCGC
7   A13   AX00002286   GAGAAAACACTTCAGAACTAGAAGCTTATTTAAAAAACACTTCAGAACATTGGGA
7   A15   AX00002287   GTATGGGGGATACGACCACGAAATGTGCAGCAAATTATGGGGTTAGAATTGTTG
7   A17   AX00002288   AACAAGTTCCTAACGTAAGTGCTATTTCTTGGGTGTATGCAGTGAGTAAAACTAG
7   A19   AX00002289   GTGGATCGTATCTGGACGTGGGGAACTACATTTATCTATCTTAATCGAAAACATG
7   A21   AX00002290   ATTAACTGCAATTATCGGTGTTATTTTCTTAATTGGTATCGGCATTATGATTGCTG
7   A23   AX00002291   AGATCATACGGCTGTGCAGCATTAGAGATGGTATACGTTGCAACCGGAAGAATC
7   C01   AX00002292   TACGTTTGGAGCTAGATTATGAATTAGCAACTTTATATGATGCGATGATGGAAAA
7   C03   AX00002293   ATCCAAACAAACTGATGAGAACTTTTTTTATCATGTAGCAAAACACGCACGTCGC
7   C05   AX00002294   GAATTATAAGAGAAGAGTTAATGGGATTATATCGTCGTTTTAAAGAGATTGTTCC
7   C07   AX00002295   TGAGCGTTTGCGGTCCTGGTGACAAAATACTAGTGCCACGAAACGTGCATAAAT
7   C09   AX00002296   ATTGGAAAAGAACGTCTCTTGGAGGATTCGAGCTCCTTCCAAACATACCCCCTT
7   C11   AX00002297   TGACACATGATACTCGTTATGATTTTGGTGTTATTTATACAAATATGTTCTTTGGA
7   C13   AX00002298   AAGCAATTAGTGGCCATGCATCAGCTATCGATTACATCGGAATTCCTGCAGTAT
7   C15   AX00002299   CGCAGCTGATACAGACAAAGGTCTATTAGTACCAGTTGTTAAAGATACAGATCG
7   C17   AX00002300   TTGGTGGACTTGCAGTTGGACTTGCACTTGAAGGATTCCGTCCAGTTCCAGAAA
7   C19   AX00002301   TGAAGGTCCTACTTTAATCGAGACTTTAACATTCCGTTACGGTCCACATACAATG
7   C21   AX00002302   ATAGCCAAGATCCTGAAATGGCTGAAAAATATAGTTTACGCCCTGGAATCGGAT
7   C23   AX00002303   GAGAGCATCAGTGGAATATCATGATTATGTGAAGGAAGGCTTTGGTAGCTTAAA
7   E01   AX00002304   GCTACGTCTGAGAAGGATGTTCGTACAAAATTAAATAAGTTCGCATATAATATCG
7   E03   AX00002305   TCTGTTTCCTTCTTCCGTACAACTCACAGTATCCCAGATTCATACGGAGTTGTTG
7   E05   AX00002306   AGCGTGATATGGGAAAAAGGATTGCTAATAATATTGCATCAAGTAATGTGTTAGA
7   E07   AX00002307   ATTACATGTACTGAGGCAATGACAGGTGAAGATTTTGGTTATATGCTTCAAGAGA
7   E09   AX00002308   AAGGTTCTATGATCGACATGAACGCGGTACTTGGTGGACGTGCAACTGTTGGTA
7   E11   AX00002309   TGGTTGTGTTAGCACAGGAATCAAATATGAGAAAAGCGGCGGAACGTTTATTTG
7   E13   AX00002310   GAAGTAGCACAACGCTATTTTGAAGTGAACGGTGAACGCAAATGTAGCGTGAAA
7   E15   AX00002311   ATATGAAGAATTTGACGTAAAAAAAGACGCCGCTGCACGCAATCGTCTTTTATAT
7   E17   AX00002312   ATTTACAGATGAAAATAGTAGAAGTGATAAACAAAGTGGTGAATATTTACTTCCA
7   E19   AX00002313   TACTGTAATTGGATATGAAGTAGTAGGGCGTATTCAAACAGAAGAGGGCATACA
7   E21   AX00002314   AATCCGAGTTAACGCGATCGCGCCAGGACCAATTGAACGTACGGGCGGTGCTG
7   E23   AX00002315   ACAAGCTGGAGTAAAGGTGGAACTCATCGTTCGAGGAACATGTTGCCTACGACC
7   G01   AX00002316   TTTCAATTTCAAGAAAGTACACGATTCCATCAGTTGCACCATGTACTTTGTGTTG
7   G03   AX00002317   TCCTACCACATCTCGGTCATCTTGAATCCTCCTATCGAAATCCGAAAACAACCTT
7   G05   AX00002318   GTTTGAAGATGCAAAAAAACTTGAAACTTTAGAGAAAGAGGGACAAGAGTTATAT
7   G07   AX00002319   AGTTACAGAATGGATTGCGCTTCAGGATGTAATTACAAAACTGGATTCACGATCA
7   G09   AX00002320   ACAGGGCTATTCGGTGCTGTTTTCGGGACATCTAGTGTATTCGGTCCTTTATTA
7   G11   AX00002321   AATATTTTGGTGAGCGCCTTGCTGGCTTCTCATTCACTAAAAACGGTTGGGTAC
7   G13   AX00002322   CTGGACGGATGAAGATTTTGAAAGAGGTTATGCGAAGGCAGATGGAACTGTTAT
7   G15   AX00002323   CGTGATGAATGGCCAATGGCGATGTGTAAAGAAGGCGGAAAAGGAGCACATAT
7   G17   AX00002324   CATATAGTTCGCAAATATAGTCAACTGTTAGAGGAACATGGTTATATGATTTCCA
7   G19   AX00002325   TCATTTGCAGCGATGCAAGGTGTATATTTGCAAGTTGAGATTTCTGAAAGCCTTT
7   G21   AX00002326   TAACAATTGGACAATCCGATTTTCCTACACCTTCTCTCGTAAAAGAAGCGGCAAA
7   G23   AX00002327   AAGATGGTGCAGGGGCGCCAAATTGGTGGCATTATTCTTTTATATTCAAGAGAG
7   I01   AX00002328   GTATGGATGGAGCAGGACATTTCCGTATTTTTTGGCAAATCATTATGCCGCTTG
7   I03   AX00002329   GAAGCGGCTACAGTAGATGGAGCTACAGCTTGGCAACAGTTTCGTAAAATTACA
7   I05   AX00002330   ATCTTTCTTTCATCGGCTCTCCTTGTATTTATTATGGAGACGAAATTGGTATGGA
7   I07   AX00002331   TAGTCTGTATTGGAATAACCATGATCAGCCTCGCGTTGTATCTCGTTTTGGTAAT
7   I09   AX00002332   ATTGTTTTAGGTATTCGTCCTGAGGATATTCATGATGAGCTACTATTTTTAGAAG
7   I11   AX00002333   CAAAGAGATTGGCAACGCGTTATCAGTATTACTTTGAATGCATTCAGTCGCATTG
7   I13   AX00002334   CTAATTGACATGTTTTTAATCTCGGTTATGTATGGTGCAGTAGTAGCTGTTATGA
7   I15   AX00002335   CTCATACGTACTTCTGGAAATGCCTTTGAACTTTTCCCCACGCAAGATGCTGTG
7   I17   AX00002336   GGTGGGCGTGAGCTAAAAAAAGTAGGGCAAAAAGTGAAAGAAACTGGATGGGG
7   I19   AX00002337   TAACGGCTCTTATATTAGGTAGTATGGCGCCTGACTTTGAATATTTCTTGCACTT
7   I21   AX00002338   ATATCCTTATTGCTTACCCGCTATCCGAACATTACAATCACTAGCTTTCCACCCA
7   I23   AX00002339   ATATGAAATTACAAGAGAGGAACAAGATGAAGTTGCGCTTCGCAGTCATACATTG
7   K01   AX00002340   AGAAGTATTGCTTCAATATCGTTCAGATACATATGATTGGGGTGTACCTGGTGG
7   K03   AX00002341   GAGTGGAAGATGTATATGTAGAGGTGGGAGAACCTTTATACGAACATCCATTAA
7   K05   AX00002342   ATTTACAAGACGTGTTCACGGAAAACTTACTCACGCAGATCCTCATTCCCCAACT
7   K07   AX00002343   CCTAATTTTCTACTTCGCAAAATGACTTTCGTAACAAGTTTTACAAAAACATGGTT
7   K09   AX00002344   TTTCTGAAGGTGAAATATACGGTTATGAAATGAGTGAGAAGCTAGCAAAGTATG
7   K11   AX00002345   ACTGCCATATGCGAAAGTAGTTGGTGAGAGCTGGCCATTGTCTATAAAAAGAGC
7   K13   AX00002346   TATCGTCTTACCAGAACTATGGACAACAGGTTATGATTTAACGAGACTTTCTGAA
7   K15   AX00002347   GGTGATACGATTCTCGTTCCCGATCCAGGCTATCCAGATTATTTATCAGGAGTT
7   K17   AX00002348   AGCTTTTCCGTTCCGTCTGCTGGTATTCACCCTGGCTTCGTTCCCTTTATTATAC
7   K19   AX00002349   TGGAATGGATTTCTTCGTCTATCCACTCTTACAAGGACTCATTCCAAAAGAGCAA
7   K21   AX00002350   ATACAGGGAGATTCGGGGGCAGTATTAATCCGTAACCATGGTATTACCGTATGG
7   K23   AX00002351   ACGTTGAACTTGAGCCAGGCGATCTCATATCTGTTCCTGAAAATGCAAGACATT
7   M01   AX00002352   TGCTATTCCTATTTCAATTCTGTGTGCATTTTATATAATACGCCATGCTCGTACAA
7   M03   AX00002353   GCAGAGCTTATGAAATCTAAAGTGGAGCAGCAACATGTGTTTGCAAGGTGGGG
7   M05   AX00002354   ATGCATCTTTAGCAGCTATGCAACTTATGCTTGCAGCTAAAGCAACTGGCTGGG
7   M07   AX00002355   GAGAGAGGTTAAACCACAACAACCAGCTGTATGTAACGTACTTGCTAGCATTTC
7   M09   AX00002356   TGAACCCATTCTTAGGCTACCGTGCAATTCGCTTATGTCTTGATGAGCAAGATG
7   M11   AX00002357   ACGGAAAGAACGTTAACTTAAAATCAATCATGGGCGTTATGTCTTTAGGCATTCA
7   M13   AX00002358   ACTAGCAGTTATTTACTACTTCGGATTCCGCTTTGCAATCCGTAAATGGAATCTA
7   M15   AX00002359   TGCTGAAGGTGTTGTAGATCTTTTAAATTCTCGTTTGCAAATTACATTGCCAGAG
7   M17   AX00002360   GTTATTCTTTGCTTCGCCTCTGGACGACTTGATAATGAAATTGCAGACTTAATGA
7   M19   AX00002361   TTGCGATAAGTTCGAAGTGAGTCGTATGACAATCAGACAGGCGATTAATAATTTA
7   M21   AX00002362   AACTTATGTACCAAACGGGATGGCAAGTGATTTAGAGGAAGAGTGCAAACGTTA
7   M23   AX00002363   AACGCATTTATACAATCAAATGCGTGGATTACATCACCGTGAACCAGGAGTTGT
7   O01   AX00002364   ATAAGGCGTTACAAACGTTAGTATCACACTTACTTATAAAAGAAATGGGAAGAGC
7   O03   AX00002365   TAACGGTGATGACTTTATAGATGATCCTCGTCAAGAATTGATGGAGAGGTTAATT
7   O05   AX00002366   ATTTGAGTGTGAACCCATCTCACCGTCATATGGGTATTGGGACGAAGATGGTTC
7   O07   AX00002367   CTGATGGAAATCCTCATAGACACCTTGTAGGATCACTTTCTATGGCTCATGCTG
7   O09   AX00002368   CTAGAAGGGATTGTTCCAAAAGCACAAATTGGTACGAGAGCAATTTCCTCTTCTA
7   O11   AX00002369   CAAATTGAAGCAAATGAGGTTGCATGCATTGGAGATTCTTTCAATGATATTTCCA
7   O13   AX00002370   TGGCAGAAGTAGGACTTGAATTTTTAAGGATGGCAGCCATTCATACTCCAACGC
7   O15   AX00002371   ATGCAAAAAGGGAATTTACAACGAATTTTTGTCGTTGCCACTGGTGCTTTATTAA
7   O17   AX00002372   TTGTACTATTATCGGCGATTTTAACAGGTTGTGGTGTATATGATAAAATCGGTCA
7   O19   AX00002373   TTACATTTCAAACGTCGCAATATTGGCTTGTTATATTAGGAATATTTTGTGGCAC
7   O21   AX00002374   AGGTATGGTCTTATTTTTTAATCATGTATTTCAAAAGCGAATTAATGAAGAACCG
7   O23   AX00002375   GTTGTTATGTTCCTTATTATCGTAGTTCGTGCAGTGACAATGGAAGGTGCGATG
7   A02   EMPTY        -
7   A04   AX00002376   ATGGATCAGTGAAAGTAAGTAGGTCTTTAAAGGAAACAGGAAACAAAATTCGAAA
7   A06   AX00002377   ATGAAGCGAGACAACCCCTTTTTACAACTAAACCTGAATTAGAGCGTTCCGGAA
7   A08   AX00002378   TAGGTGGAGAAATGGTTGTTTGTGCAATTTCACCTCCTGTTAAACGTTTATTTGA
7   A10   AX00002379   GGAAAATTAAAACTGACCGATAAAGTTAGAGCGAGTGAGCATGCAGCTTCAATG
7   A12   AX00002380   TTGTATCCCAATCGATTACCCCAACATTAGACGAAAGGAAAATCGGGATGGTTG
7   A14   AX00002381   ACCAAACAAACGAATTCGTAGTTATTCAAAAGGAATGAAAGCACTGCTTGCCATC
7   A16   AX00002382   TTCTGTATTACGCGCGTTATTTTTAAACAGTCCACAGATGGCTTCGCAAATTGCG
7   A18   AX00002383   AGTACATACAATTTAAATATTAATCCTGTTCCACTCTCATTCGTTGAAGAATCTGC
7   A20   AX00002384   ATTCGCTAATTACGGCGATGTGTTTGGAGCTATGTCATTTGGCAAACTCTCTTCC
7   A22   AX00002385   CGGTATTCTCGACTATTTTCATGCCATTAACATTTATTGCGGGAGTATACGGAAT
7   A24   AX00002386   AGCGCAAGGCGGCGATGCATCTGTTGTTGATGATCCTTCTAAATTACCACAAGC
7   C02   AX00002387   GCAGCTGGTGGTGTAAATACATCATTCGAACCAGGCGATCTTATGTTAATTTCAG
7   C04   AX00002388   AAAGAAGATGATCTATTATTAATTACAGCAGACCACGGTAATGACCCAGTTCACC
7   C06   AX00002389   GGAAAAGGTGTTTATGCTGTAGAGAAAACGTTTGAAACGGATGGAGTATACCAT
7   C08   AX00002390   GAACGGAAATTACCGAAAGTATTGTCAGTTGATGAAGTAGAGGCGTTACTTCAG
7   C10   AX00002391   TTTCGCTATACTATGGATAAATGAAGAATATGAAAGCTATCATCGTTATGAAAAG
7   C12   AX00002392   TATCTGAGTTAAAAGTTGTCGATAAGATTAACTTCGGAGACGGTGTTTCACGCTA
7   C14   AX00002393   CTATTACCATTATTGATCCGTTATACATGCTTCTTTCTTGTAATTGGAGCGGTGT
7   C16   AX00002394   CCAAAGTTTTCACTTCACTTCTGGCTACATAGCGCTTATACAAAACAAGGCTATA
7   C18   AX00002395   TTCTTTCTATACATCTCCAGGATTTGCAGATGAAATTTTATATGTATATAAAGCGA
7   C20   AX00002396   ATTAGCGTCATTGCCCGCGGACCGCTTGCAAAAGGAATTCTAACTGACAACAAT
7   C22   AX00002397   GGGAAGTATGTTGATACGTACCGAGCATTAGAAAAACTGTATGAAGAAGGTAAA
7   C24   AX00002398   AACGTTCGTATCACTTACACGTGTTTGAAAAAGGAGATCCTGAGATAGTAAGGC
7   E02   AX00002399   GAATTATCTCCATCTAAAACGTATAGCGTAGTTGCGAATGCTTTCTTAGCTTCTG
7   E04   AX00002400   ATGGAGAAGAACCGCGTCACTTACAACTCCAAGAAGCGACAGCCCTTCAATATG
7   E06   AX00002401   GGCACATTCGGAGGTGCAATCCAAAACGGATCTTCCTTTTCGTTCATACGAAAA
7   E08   AX00002402   TTTCTTATGCTTGTGATTGGACTTCTCGTTACGATGGGGATTGGTTCATCCTTTT
7   E10   AX00002403   ATACGTTCATGAGGACACAGTAAAACAAGTAAAGGAAGCAATTGAGGAGTTACG
7   E12   AX00002404   GTTCATGTGTGAGAACTGGGGGAGCTCATTGATGGTTTCACGTGGAAAGGGGC
7   E14   AX00002405   GAAGATGGCGCTGATTTCTATATTGCAGATTGTCCTTTCTCTGATTTTTACGGAC
7   E16   AX00002406   ATCATCCATATAGTTTGTTACATTGGTCCATTGCTGGTGTAGGACAAGAGTCGAA
7   E18   AX00002407   TCTTTTCGCGTTACAGGGGACGTGGAATTAGTTGATTCACAAGGGAATGTATTC
7   E20   AX00002408   TTCACCAATACCGCCATACACATGATGCGATTCTCGTTGGAGTGAATACAGTTAT
7   E22   AX00002409   AATGGCTGCAAATGGACGATTCGGTGGACATTTCGTTTCAGGACATATTGATGG
7   E24   AX00002410   TCATACTGCATTTACAGTGAGCATTGACCATGTTTCTACAACAACAGGCATTAGC
7   G02   AX00002411   CTTTAGATGGGTTAAAGCGTCACGGTGTAGAAGAAAACGATATTGATGTTGCTT
7   G04   AX00002412   GAATTGAACAACATTTTCGAACGAAAGCTGAACATTTTGGATTGAAAACAGAAGG
7   G06   AX00002413   GTTGGCAATGATGCGTTTTGTAAACCCAACAAAAGAAATTCGTATTTCAGGAGG
7   G08   AX00002414   TCATATTGTCAAAGTCCCTCACTCTTTCGTGCGATGCTTCGCATATATGAAAGAG
7   G10   AX00002415   GTTGGAATACTTTGCATGTAGAACGGCTGAAAAGAAATTTGGCGAGAAGGAAAG
7   G12   AX00002416   TCGTCCGCCCACTGTACCGGTCCATAGTTCTCGAATTCGCTTTGCAGTTACATC
7   G14   AX00002417   ATTTGTCCTTATTCTATTGAAGAACCGCTTGCTCCGAGACTTGCCATGAAAAGAG
7   G16   AX00002418   AGTATGTAAACGCTCAAGAGAGCTGGGTATGATTTTGCGCCCGCTCGGTAACAC
7   G18   AX00002419   AGCAAATACAGCAGTCAGAAGTGAAGAAAGCGAAAGAAGCTGAAGAGAAGAAG
7   G20   AX00002420   TATTATCTCGCGGTGGCCTGCAAAGTATGATGATGTCAATCGCTCTTATTTTCCT
7   G22   AX00002421   GTTACAACTCGATGACTCCATCGCAAGTTATGCAGATATGTTTTTAGATGGCTGG
7   G24   AX00002422   AATGGCACATTAGCAGTTTCCGAAATCGGCAAGCGGCTAGCGATTTCACGGCCT
7   I02   AX00002423   GCTCGTATATGTAATATTTTATCCAATCGTCAGGTTAGTAAAGGGATCTTTTCCT
7   I04   AX00002424   CATTGTTGTTAGCGAGTGCGAAAGTCGGAATGCATATGACTGTTGCAACGCCTG
7   I06   AX00002425   CGTAAGCATACTGGAAAATCTCTCGTCGTAACGTGTGAGCAGTCTTTTCACGGT
7   I08   AX00002426   GCGGTAGGTTGTTCAGGGTGTGACGGCAAATTACTTCAAGTTCAACCTGTCAGC
7   I10   AX00002427   GGTTCAAGTCTTGTGAAAACAGCAATACATGGTGAAGACCCAAATTGGGGGCGA
7   I12   AX00002428   ATGCTAAAAGCAAGTGAAAAACACCCTTCTATTTTGCGAAAGGAAATTACTTCTC
7   I14   AX00002429   TAACTGGCGGAGATGCTGTAAAAGTTCAGGCGTATATGAAGAGCGGAAAAGGC
7   I16   AX00002430   ATCGCTTCGGTGCTATTGCAGCAGTAGCCTCAATCCTTGCGAAACAAGAGATTA
7   I18   AX00002431   TATTTGATTGTGGTGAGGCGACGCAACATCAAATATTACATACATCAGTACGTCC
7   I20   AX00002432   GGTAAGTTCTTTCGTGTCTGATCACCCAGCACAATTAGAATGGACGACTTTGAA
7   I22   AX00002433   ATGGATGATAGGGAAGTTGATCCGAGTCAAATGGGTCAACATAAAAGTGTTGGT
7   I24   AX00002434   TCTTCACCAAAGTGGTGGCGGAAGTGATGCAAACGTAATTGCTGGACACGGAAT
7   K02   AX00002435   CAATACTACGACAGAAATCGTGAATTTTTAAAAGCTTGGGAAGAGTATAGACCAG
7   K04   AX00002436   GTATGTATGGCATTACTCAATCTTACTTTTGTTATTGGAGCATTCCAGCAGAAAC
7   K06   AX00002437   GAGGAACGGATGGAAGTAAATATGGAATACATGGAACGAACCAACCGAGTTCAA
7   K08   AX00002438   GAGAATGCATTTATGCGAGAAGATGACTATTACTATCGCTATTTCAATATGCGCA
7   K10   AX00002439   TTTACGTTGTATGAATGTGTTAGAAGCACCGACAAATGGTCACATTTGGATTGGA
7   K12   AX00002440   GTACTTGCATTTAGCTTAAATTCAGGTGCATATATGTCAGAAGTAATCCGTGCTG
7   K14   AX00002441   TTGTGCAGGTGGTATTGCTCGTCCTGCTGCTGCACATTCTGTACATTATGATAA
7   K16   AX00002442   ATCGGTATGATCGTTGGATTAATGCCTGTAAAAGGTATTGCATTACCTTTCTTAT
7   K18   AX00002443   ACCATCTTCTTTCACTGGTATTGTGAAAGAGTTGATCGCTGGTGAAGGTGATAC
7   K20   AX00002444   CACATACGGATTATGTGTTCATTTTGCTCTTCAAGCAGCTGAAAAGTTAGCACAA
7   K22   AX00002445   TCGACGAACGTATGTGGTTATTAAACCGTGCTGGTAAAATTCCATTCGTAATTTC
7   K24   AX00002446   TGATGTGTTTGAAGGTATTGGCCGTATTCTTGGCCCATCTATTTTCTCTCCGATG
7   M02   AX00002447   TTTAGCCCAGAGCGTGCTGGTACAGTACCAGTAGGACAACTAGTTGAAATGTGT
7   M04   AX00002448   TTCACCATCATTCGGTTCTTCTGGTAACCCATCTCCAGTAACTGCATACGGTGTT
7   M06   AX00002449   ACTTTCTGTTAAAGCTGTAAGAAATGGCGAAGCAGATGTGCTTATGAAGGGGAA
7   M08   AX00002450   ACGAGACCTATATTGATGTACAACATTTACCGCCATTACATAACGAAGAGCAGG
7   M10   AX00002451   TCCATACAGAGGTTTAGAGGAAGAAGTTATAACGCTTGTACGGAAATTTAATCTA
7   M12   AX00002452   TCGTGGGAATATTGATTCTATTTCGTCCTTATTCGGTTATACAGTATCCATGTCA
7   M14   AX00002453   CCGATTCAAGTCGAAGATGGACAAATTATGCGTTCGACAGTTACATCAATTGAAA
7   M16   AX00002454   ATTAAAGAATTGCACTTAGTGAAAGTGCCATTACATGATGGTCGCTATAAATATA
7   M18   AX00002455   AACGAACAAACTTCCGTTACGTAACACCAGCAGACTTAGAACGTGGTTTACCAC
7   M20   AX00002456   ACATTAAGGCAATATCAAGGTCTATGTGGTTTCCCAAAACGTTGCGAGAGTGAG
7   M22   AX00002457   TGCAGCTTGTGCTCTTGAAATGATACATACATACTCGTTAGTTCATGATGATTTA
7   M24   AX00002458   TATTTTAAAGAGGGTATGGAATTATCTAAGCTTTGTGATGAGAAGTTGAAGAACG
7   O02   AX00002459   GGTGTGATTACGTCACCAACAGGAGCAGCGATTCGTGATATTATAACAACGATT
7   O04   AX00002460   CAGGAAAACTTTGTGGTGATGTTGACTTTGACAACGTGTTAGATGTTGCAAGTTA
7   O06   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
7   O08   AX00002462   TTGAAGTAATCGCAGGTATTGCAGCTGCTGAGGTAGAAGGTGTAGCGGCAATG
7   O10   AX00002463   CACTCAGTGAGTTTGTCGTTGAAGGCGTACATACAACAATCCCGTTCCATTTGC
7   O12   AX00002464   TTCTTCTTCTTCTCCTGATACACCTCCATATGTAAGTGTAGGAGATAGAGTATCG
7   O14   AX00002465   GCATCGCCGGCAACAGGTGAAAAGATTGGACAAGAAAAACAAGGTACTGATAAA
7   O16   AX00002466   ATGAGAAGGGAAAAAAGGTAACACCTAAGTTCTTACTTGTCCTACTCATACTTGG
7   O18   AX00002467   AGAAACAGTATGGTATGTCAGTCTCTGAAATACAAATAGTCGCAGCGGAAAGCA
7   O20   AX00002468   AAGTACGATGAGTGATCAATATAAAGTAACGAAATTGTCCAAGCTTTTGCAAAAC
7   O22   AX00002469   TTTAGCTTTCATTCATACCGTACTAAAAGAATTAAAGCGTGAGGATATTGCAAAT
7   O24   AX00002470   GGTGAAACGCTCGGACAACATGATCGTGAATCGCAACAAAAACATATTCGCTTA
7   B02   EMPTY        -
7   B04   AX00002471   AAGATAGTGAAGCAATTATGGAGGCAGTACATGCAGGGGTTCAGCTTTTTATAA
7   B06   AX00002472   CGCTTTGCTCATGCTTTATGTGAATGATGCGAAGAAAGCATTGTTTATAAATGGT
7   B08   AX00002473   ACACTTAAACATATTAATTATGAGAAGAAACAATCTCACATTGGTAGTTGGCTCG
7   B10   AX00002474   GAAAGTAGAAAAAGCACACATCGAAAACCGTCGTATGCAATACTTATACGCAAG
7   B12   AX00002475   ACATTCTACTGGTCATGGAATCGGTCTTGAAATCCATGAAGCACCAGGTTTAGC
7   B14   AX00002476   TTATTGAAGTACATATTTCTAACATTCATCAGCGTGAGTCGTTCCGTCACGAATC
7   B16   AX00002477   CTGAATTAACGAGACCGATTTTCCCATCTCATACAGGGCAAATCATTGTCGAAAG
7   B18   AX00002478   ATTCGCAAAGCTCATATAAGCGCGCTGCAAAACAATCGAGCCGCAAACATGGGA
7   B20   AX00002479   AGAAGCGAAAGAAATGGGATTAAAAATCGCATTAGCTTCCAGTTCCTCTAGAGA
7   B22   AX00002480   TGATGAAAAGGGTTATGCCCGCGTATCTGATATTGCTGAAGCGCTTAGTGTACA
7   B24   AX00002481   GATGTATGGGACATTGTCATTATTGTTACTTGCAAACGACACTTGGGAGTAAGC
7   D02   AX00002482   AGGGCTTAACGCCGAAATGTAACGAAGAATTATTTTTGAGCGGAAACGTGGATT
7   D04   AX00002483   TATTGTGTCTGAAGATCATCCGAATATGCCAAAAACAGTTACAGAAGCGTATCGT
7   D06   AX00002484   AATATACTGCAGGGCATATTTTAGGCGCACGTAACATTCCGTTATCACAAATTCG
7   D08   AX00002485   ATTTCAAAGGCGTTAGAAATTTCAACAATTGAACATCCCGGTCTCGCAATGGGC
7   D10   AX00002486   ACCATCGATTTACGCACACTTTAAAGGAAAAGAAGAGCTATATTTTATATGCTTA
7   D12   AX00002487   GAGGCTCCACTTGAATGGGCTGGTGTTGCATTATTAATTACAATTAGTTTCGTCT
7   D14   AX00002488   GATGGGAACTGCTTACGCGATTTGGACTGGAATCGGAACTGCCGGAAGTGCAC
7   D16   AX00002489   CTAACATGACACTTGAAATGATATCAATCGTTCGGTCCATTATTGCCTCCATTGC
7   D18   AX00002490   GTCGGTTGTTTTACGATGGGAATGAAGAATGGGGTTAACCTATTTGAATTTATTG
7   D20   AX00002491   ACGTTCATCAATGATGGAGAAATTATATTTACTGGTGAAAAAGACGACTTAATGG
7   D22   AX00002492   GACTTATGTTTCACGTAAAAATAATGAACTATTAAAAGAACAGCGGCTTCGCCTA
7   D24   AX00002493   GCAAACTTAAATGCAGTATTAAGCCAAGCGCGCCCAGGAGATATGGGATTTGAC
7   F02   AX00002494   ACGCAGTTTGGTGGACCGCACTGTGGTTACTTTGCAACAACGAAAGCATTTATG
7   F04   AX00002495   TGCGCCTCGCAAATTAGTCGGCATCGAAGTAATTGAACGTGGAATTCCTCGTAC
7   F06   AX00002496   TTCTTCCGTCCCATTCCGCGGCGGATTTAAACGCGGGAAGAAAGATTGGATGAA
7   F08   AX00002497   GCACTATCTTGAGAAAACAGGAGGCGTACCGAATCCGATGCGCCTTACTCTTAT
7   F10   AX00002498   TGGAGAAGGTGGCCGTTCTGTATTAGAAAATTTAATGGTGAAGGCATCTATCAG
7   F12   AX00002499   CTCATTTGGAAATTTGCAAAACCTTATATCGATCCTTATTACGCGATGTTACTTTC
7   F14   AX00002500   GAAGATCGAAAACAAAAGAAAGAACAACGCCGTGCTGAAAAAGAGCCATTTATG
7   F16   AX00002501   GTCCACTATTTCAGAAGAAAGATATAGATGCATTTGTAACGAAATTCGAATCGCG
7   F18   AX00002502   ATCATGAATGTTCCTGCGTCGCATGGAGAAGGATTACACATTTTAAATTATGAAG
7   F20   AX00002503   TCCAAATCCGATGACATATAATCCGAGTGGAAATATTAATAGAGGTGGCACGAT
7   F22   AX00002504   ACACATGGACAAGCAAACGGTAATTTGGCGATTGAATTAGGTGACTATAGCGAT
7   F24   AX00002505   CTGCACAGCGACTTGTCGAATTAAAGTGTCCGTTTTGCAAAAGAAAGTGCTCAA
7   H02   AX00002506   ATATGGGTCGTACAGCTCTTAACGTAAGTGGTTCTATGACAGCAGGTCTTATTTC
7   H04   AX00002507   ATGGAGCGCATCGGAACCGAATTGGAATTGTAAAGAAAAACGAGACGAAATTAG
7   H06   AX00002508   AGCGGCTATGCAGAAATAACATATAGTAGTCAATTTGAAAAATTCAACGTACAAA
7   H08   AX00002509   GGTTTTCATGTGTTAGATTGGATCGTTCTTCTTGAAACAGAATTTGGCATTGATA
7   H10   AX00002510   AGCGAATGAACTGAAACATGCAGGATGGCACCATACATATGATTGGACCAAAAA
7   H12   AX00002511   GAGCTAAGTCTCTATGAAAATACTGCACTTATTATATGCTTTGTGTTGTACGTTG
7   H14   AX00002512   TAATTGGAGGATGGCTAAATAGAGTACCAGTTTTATTACATGAGTCTGATATGAC
7   H16   AX00002513   TGTATTACGAGATGTTCCCGCCCTTCATCTCGCACCATTTCTGAATAGACAAATG
7   H18   AX00002514   GATCCAGCACGCGTTGGTGATTTTCCAGGTGCCACTTCTGTATATGATTTATCC
7   H20   AX00002515   GTCCTTTCCCTATTCCGCTCTGGAGACGAACTTATTGTATCCGAAGATTTATACG
7   H22   AX00002516   CTACTGCATTCCTCCTTCTTTCACAAGGTGATCACGTACTCATTTCAGAAGACGT
7   H24   AX00002517   AAAGGATTAATTGAACGTGGTCCAAGCAACGTTTCTACAATGTACACTGGCTTAA
7   J02   AX00002518   GTTGCTCCGAATATTTGTGAGATTGGTGGGGGAACAGGAAGGTTTGCCTATGAT
7   J04   AX00002519   GTATTTTCTGGAGATGTATTGTTCCAAATGAGCATCGGAAGAACAGATTTACCTG
7   J06   AX00002520   TAGAACCAATTCAACGTTATTTCGAGCAATACGCTTTCTCACGTGCTGTAAAGAG
7   J08   AX00002521   CGAATTGCAGATTTACAATTAATGCAAGATGAATTGCGTGAATTAAATCAATCAC
7   J10   AX00002522   TTGGATATGGCGGTGGCTATTATGATCGTTATCTCGTGCATTATAAAGGGAAAA
7   J12   AX00002523   TTGAGCTAATAGCATTGCAGGGAAAAACATTTCTCAGCATAGTAGAGCAATCACC
7   J14   AX00002524   GCTTATGCTTATTACGAAGCAGCAACCTGTAGCAAGTGATTTAAGAAGGATTTTC
7   J16   AX00002525   TAGAGAGCGCAATATATTTGATAAATCATACCCAGTTGAAGAATTACGAACACAT
7   J18   AX00002526   TGGGGCACTTGCATTTGCAAATTATGTTCCGTTTAGTATGTTTGATAGATTTACA
7   J20   AX00002527   GTATACCGACAATTGTATATGGTTTTTTTGCATTAACAGTTGTTACACCGCTTTTG
7   J22   AX00002528   ATGCTTATTATATGGCCAATCGAGATAAGGTGAGAGCAATAAAAGTGAATGGTG
7   J24   AX00002529   GGATCAACTGCAGAGGCTCGCTTAGAAACAGCGAAAAAGCTAGCAGATTTGATT
7   L02   AX00002530   GCTCGTATGTTAAAGAAAGAGTGGCGAAAAAAAGCAATTTTACTTGGAGGCATT
7   L04   AX00002531   AATTCGCAAAAGCTGGCGCAACTCGCTTCGGTTCTGGTTGGGCTTGGTTAGTAG
7   L06   AX00002532   GCACGTGCTTTTGATTACCCATTACATTTAGGTATCACAGAATCTGGAACATTAT
7   L08   AX00002533   AAAGACGTTTTAGAGCATATGAAGGATGATTATCCAGGTCTTAGCTTTGATACGA
7   L10   AX00002534   TTTCATTATATTGGTTGCTCTTGTCATTGCAGTATCAATGCGTGTAGTAGGGGTT
7   L12   AX00002535   GATATGGGAGCTGTTACCGAGAAAGTAACACATGTTGCATGCTTAAATCAACAT
7   L14   AX00002536   AAATGCGATTTTACATCGTCTTGGTCGTGGAACTACAAAGCTTGTAGCGAAAGG
7   L16   AX00002537   TAACGCCAGATCAGACTGTTAACATTGCGTTAGAAACGATGGCAGGAAAAGGAA
7   L18   AX00002538   CATACTTACTTCCTACATTGAACAGAATTAACCCAGGTCGTGAAGAAGTACAACT
7   L20   AX00002539   GGAGATAAGATTGGCCTGCAGATTGGAGCGCTTAATAAACCCGTGCAGCACGT
7   L22   AX00002540   TTACAAGATAAAGTAGATGTGCGTAAAGGGAATGGACTAGCTGTTATCACGCCA
7   L24   AX00002541   GGCTAAATAAATCTAAAGAGTTAGCTGATGCAAAAAATGGTGGGAAGCCAGCAC
7   N02   AX00002542   ATGGATCTTGCTCCAGAAAAAGTGCGCGAAATCTTAAAAATTGCTCAGGAGCCA
7   N04   AX00002543   CGTTCAACTTAGAAAACAGGGACGTAACTATTTCGGCCTTTGTCCGTTTCATGG
7   N06   AX00002544   TTTGGTTGTTCGAGCAGCAATGGGCCAATTCCCATTTGCTCCTGATATTAGACG
7   N08   AX00002545   TAACCTCACTTCCGGTTAATATTATCATGACAAGGATGCCAAACATTGCGATGTG
7   N10   AX00002546   AAACGAAAATGCTTCCGGTATTAGGGATGCGCCCGTACTTTGACACATGTGCGA
7   N12   AX00002547   ATTGATACACCAGGAATACATAAACCTAAACATAAACTAGGCGACTTCATGGTGA
7   N14   AX00002548   GACAAGTTATGGTAGAATTATGTAAACAGGATACGAAAGTATACCTATCAAATTT
7   N16   AX00002549   ATTTAGCCGCAGTCATTGTTTTATGCTGCGGCTTTTATTTCCATATTACGAAAGT
7   N18   AX00002550   GAATTGCGTATGTTGTCCCAGTTGCGATGGGAACAATACTTGTAAAACTAATGAT
7   N20   AX00002551   GTTTTAGTTCTAAAATGGTTATTACGGGGGATCCTTCACAAGTAGACTTACCAAA
7   N22   AX00002552   CAGCTTCTCGTATCAGGGATATATGGTAATGAGGAAAGTCCGACGATTGTTTCG
7   N24   AX00002553   CTGGTCGTGAAGACCTTGTTAATAAACTGCAAAGTGAAATTCAGATTTTAAGCGC
7   P02   AX00002554   AACACCTGCAGCACGCATGGAAGACCAAGTTCCTGAAGATGTAAAGAACGATCG
7   P04   AX00002555   TTCCAGAAGTACATGCTCCGGCATCATTTAAACAATTGCTTTCAATGAGTGGTGA
7   P06   AX00002556   AATATCCGGCGGAAGGTGTATTAATAAAAGCATACTTCCCGCAAACGGATTCTT
7   P08   AX00002557   ATGCCATTAACGTTTGCGCAAATGGCACTTGGTGCTGAAGTAGAAGTTCCTACT
7   P10   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
7   P12   AX00002559   GTCGCACATTACGTCTACAAGCTGATTTTGAAAATTATAAGCGCCGTGTCCAAAT
7   P14   AX00002560   GCAATCGGCTCAAATTTTATCAGAGCTTACGAATTATACGGCCATTGTTCTTGGA
7   P16   AX00002561   GTAGGCATAATCTCACATACTGGAATAATGAAGAGTATTATGGGTTTGGAGCTG
7   P18   AX00002562   CCTCATCGTTTTAGTGAATTACAACGGTTATTTCCAAGCATTTCTCATAAAGTTTT
7   P20   AX00002563   CGCTAGGATTTGGTTTCCGTTGTGGATTCTTAGGACTTCTTCATATGGAAATCCT
7   P22   AX00002564   CTTGGACCGATAGTGGTAGAAAATGTATTGGTAACGAGACATTTGTTTCAATTGC
7   P24   AX00002565   ATAACGCTTCTATCAAGTCTGACATGCGTTCTGCTGTTAAAACTGTAGAAGCTTT
7   B01   EMPTY        -
7   B03   AX00002566   TTAACGTTATACGTCGGTATGGGCGGAGAGATTACGCCGAAACTTGTTGCAGAG
7   B05   AX00002567   GCTGGTGGATATAATGGTTCAATTAAAGGTGGCGTACATTGTATAGATGATGGA
7   B07   AX00002568   TGCCTTACAATCATTAATCGAACGCCAGCCAAAGCATATCATATAAAGGAAAAAT
7   B09   AX00002569   CACAGTGAATGGGGAAGAAATATCTCTTATTTGGAATTGCTTCCCTGGTGAAGA
7   B11   AX00002570   GCACGCTGGGTGTTAGTTGACCTTGGAGATGTAGTTGCTCATGTATTCTATAAA
7   B13   AX00002571   AGATTTGCCGAAAGATTTACTTTGTTATAACAAAGAGTTATGGCATGCACCTGTT
7   B15   AX00002572   CTATACGTATGACACTATGCTACAATTGACGAAGAAGTATCCGGATGTGCAGTT
7   B17   AX00002573   AACAAATTGCAGATACTTTAGAAGCTCGTGAGTTATTTAAAGTAAGTGTGCTACA
7   B19   AX00002574   ATATTATCATTCAGACGACAACGATAGGTATGCATCCACGCGTCGAACATACGC
7   B21   AX00002575   AGTGGCGGTCGTCGTGCATTTACTTGTCACTTCTCAAATCGCTTAACAATCCATC
7   B23   AX00002576   AGAGCAAGGCATTCAAGTAACGGTCGTTTCAAATAATAATGAGCAACGAGTGAA
7   D01   AX00002577   GTCATTATCATCGTATTCATAGTCCGCTTTCTGGTTCTGTGACTGAAAGATTTGT
7   D03   AX00002578   TATGTGAAGAACAATGCGTTTCCGCAGCCATTATCATCAGACGATGAGAGAAAG
7   D05   AX00002579   CTAAAGGCTCTTAATTTACAGCAGGAACCAGAAATTCATAATATGTTTTTAGAAA
7   D07   AX00002580   TATAGGCTTGTTGTAGATGATCAAGAAGGTGTGGATGACCCATATCATCTATTAT
7   D09   AX00002581   ATACGTGTCCAATGATCGGTTTTGATGAAAAAGCAGTACAAAGTGAATTAAATAT
7   D11   AX00002582   CTAAATTTGAAATTATGAACCGGGAAGCCCAATTTTTAGAGGATTACAACCCGTT
7   D13   AX00002583   TGCCTAGTGCCGAAGACTTAAAAACGCAAAAAGAAGCAGCTTTTCAAAAGGGAA
7   D15   AX00002584   CAGGAGAAGATGTAAACGTATATGCATTTGGCCCTGGTAAATACTTGTTCTCTG
7   D17   AX00002585   GAAATGATAGTAGCGTTTCATGGAAAGAAGGAGAAACGTATCATCAATTCTTAAA
7   D19   AX00002586   AAACAGCGGTCTTTTTCGGCCTTGTAATGAACTTTTCCTATATGTTTAGTGGGTC
7   D21   AX00002587   AAAGTGGATTTCATTTTTAGCAGTACCGACAGCTTCATGGTCAGCTGATAGCAAT
7   D23   AX00002588   ATGCACCTCTTGCTGCGCAAAGTAACATTCAGCATGCTCCAGATTTACAAAATAG
7   F01   AX00002589   CCACGCTGTATGGCGTTACATTATGAGACAAAATCATAGTTTCTTAAAAGACGTT
7   F03   AX00002590   TAATCACCACCCATTTATCCTTATCCAGTATAAAGCAGTCATTATTACTTTGTCAT
7   F05   AX00002591   TTGCAATTGTAGAAGAAGGGGATTCTTTCTCCTGGAATGCATGTGTTCCTCATAT
7   F07   AX00002592   TACATTACATAGCAAGAGAATTAGTAAGTGAGTTTATTAGACCAGTTTTTGCAGG
7   F09   AX00002593   TGGTCGCGAACATAGTAAATTTAGTTGTGAAATGTGAATATAGAGGGAAGGGAT
7   F11   AX00002594   ACGCTTCACTATGGGGAAATGAGAAGGTAATGCGTTATATTGGAAATGGGACGT
7   F13   AX00002595   AGCTATTTTAGTAGCACAACCAGAAGCATTACGTGCATCTGGTCCACATGGTAT
7   F15   AX00002596   ACGATGAAAAGTGCCGATGTAGCGAAGCAATTAGCGATGTTACCACAAATGCAT
7   F17   AX00002597   TTGGTGCAGCAACATCAGCATTAATGTTATTGCATAGTGACAAAGTACAGTCCG
7   F19   AX00002598   TAGTGTATGGAGCACCAGGTACATATTTAGCCGCATTACCAACCTCTTTATCAGG
7   F21   AX00002599   AAGAAAACGTACATGTAAATATCCGGAATTAGGAAGTAAGGCGCAGTTTGTTGC
7   F23   AX00002600   GTTGTTCTCAAAAGGTGACCACGTTATTTTAACAGATGATGTGTATGGTGGAACG
7   H01   AX00002601   AACCGACTGCTGGAAATACTGGTATTGGACTGGCACTTGCAGCGTTACAACATG
7   H03   AX00002602   AAGCAGCAGCTGTTGCACAAGTATGCCACCAATATGAAGTTCCGTTTGTTATCA
7   H05   AX00002603   TGGTAATTTAACAAATAAATTATTACTTGCTGGCCGCACAGTTTACGGTATAGAA
7   H07   AX00002604   GCTTCTTTAGAACGAAAAATTAGTGAACAAATCGATAATAATAAAGCACTTATGC
7   H09   AX00002605   AAAAGCTAAAGGCTGAAGAAGAACAGAAAAAAGCTGAAGAAGAAGCGAAAGCTA
7   H11   AX00002606   CAATTGCAAATATGATGGCGACGATTGCTAGAGGTGGAGAAAAGATGGAAGTGA
7   H13   AX00002607   CACGTAGCTTCGGAGATCTTTCTGAGAACTCTGAGTATGATGCAGCGAAAGATG
7   H15   AX00002608   ACAGATGCGGACCTTCGTATCCTGCGCCGCATGCAGCGTGATATTAAAGAACGC
7   H17   AX00002609   CAATGTGTATCGCATATTCAGGAAGATGTACGTTAAGTAACCATATGACAGCGC
7   H19   AX00002610   CTTGTATGTTCCAATCGAAGCGTTCATTAGTAGGAAACTACTTTGAGTATCAAGG
7   H21   AX00002611   TTGACGCAGCAAAAGGACAATATCGTCGCTTTTTTGACTTATATGAACCGTTATT
7   H23   AX00002612   TATTGAAGAAGAGGCAACAGGCTTTACAGATCGTCAAAAGATCTCTAGTGTCTTT
7   J01   AX00002613   TTTTCACTTTTGACGCTGAAAAATTTGGCAAAAAATCATACGTAGTCTTCTCTCC
7   J03   AX00002614   TGAAGCATGCCAACAATTTGCAGAAAACCTACGAGAGCTGTTACAATTAGACGT
7   J05   AX00002615   TTTATTAAGTGGAGACCCAGCATACATACCTCGCCATAAAGATGCACGAAGCAT
7   J07   AX00002616   GATTTTCTATGACCGCGGAGAAGCTTACGGTAATGACTTTAGTGACCCAGAATT
7   J09   AX00002617   GCGTATTTATTGCATCCTTTAATTGAAAAAATTCATAAGGAAGGGATGCCGCGTA
7   J11   AX00002618   TTTTATTGCTGGAATTGTTATATCGAATTATCGGTTTCAAAGGGGAAAATCCATA
7   J13   AX00002619   CCAACAGTAAAGCTTACTGAAATTTATCGTCAAGCGGAAGGTTCATCAGTGATTC
7   J15   AX00002620   CCAGTGCGGACTTTGTTTTGCACGATTAGAACATATTCAAGAGGCGAAACCTTA
7   J17   AX00002621   TTAGCGACAGCGGCGAAGAAAGATAGTACTGGTATTTGCTTCATTGGTGAGCGT
7   J19   AX00002622   TATACGCTGGTACAAATGTGAAATTTGAACCGTTATTAATAGGCGGAGAGCAGG
7   J21   AX00002623   TATCAGATCAGCCGGCTAACATTACAGCTGGGGATGTAATCCGTGTGTTAGAGG
7   J23   AX00002624   AGCCGTACTCACAAAAAAACAACAAGCAATCGAAGAAGATTACGCAATGCTTGT
7   L01   AX00002625   TCTCAAGTATGGGTGCAGCAAATAAAATGGATCCAACTCGTTTTCGTATTGCGG
7   L03   AX00002626   ACAGTCTCCACAGCTATTTAAACAGCTTCTTATGGTCGGTGGATTTGAGCGTTAC
7   L05   AX00002627   GGCATGGGCTTAAAAAATATTAAAGTTGTATTAAACAGCTTAGGTGATGCGGCG
7   L07   AX00002628   GTAGAAGGACAAGTTCTATCCATCTCGCAATTCACATTATACGGAGATTGCCGC
7   L09   AX00002629   CAAGCTGTTACAGAGACGAAAACGTACATTTCAGCAGTTTCTGGTAGAAGTGAC
7   L11   AX00002630   GTAGGATTTGCGCCAGTTCGTAAATTAGGAAAATTACCACGTGAAGTAATTACAG
7   L13   AX00002631   ATGCAGAGTTAGAAAGTATTCGTGCAATCGGATCAGACGGTTCTCATTTAAAAAT
7   L15   AX00002632   ATATTAGCGATTATAAAGGCGGTAATTGGTTATATTGGGAACAGTAAAGCGCTAT
7   L17   AX00002633   GTAATTGCACTGCTTATCTTCGGTAGTGAGTCACTACGTAACTTCTCGTTTGCGT
7   L19   AX00002634   CGGTTACGACCGAGTGACAGATGATGACATTTGGAAGTTTCTTAAAGTGAAAAA
7   L21   AX00002635   CAACCCAGCAATACGGTATATTAAACGGGTATGCATTCCCGCTCCTTTCACTGC
7   L23   AX00002636   TCATTTTGTCTGTCATTTCTTTAAAGTTTCAACGATTTCGGCATTTAATAGAAGGT
7   N01   AX00002637   GGTGATGCTATCGTAACAATCGGTGGTTTACACGGTACAATCGAATCAGTAGAT
7   N03   AX00002638   AATTCGTGGTATTGATATGTTTGACTGCGTACTGCCAACTCGTATCGCTCGAAAT
7   N05   AX00002639   GCGAAACAGGGGATATTGAGCATAAACATTTTACGGACATTCTTTCTTACTTACA
7   N07   AX00002640   GTTCATTGGAAGGCTTCCAGGCGATATTTTTGTGAAAAAAGGAAACGTTACCTTT
7   N09   AX00002641   TCGGTGTACTTTCAAGATTAGAGTATTACACAGTAGATCAGCTTTCTGCGATTGT
7   N11   AX00002642   AAGCGATTGAACATGAAGACGAGAAGTTTTTAGTGAAGTTCCCGGGCGTCGGAA
7   N13   AX00002643   TGTATACGGTAGCTTCGGGTACGGTGACATCATCTTTAACGACTTAAAACTTCCA
7   N15   AX00002644   AAGTGATAATGCGATTCATTCCTTCTTTCAAATTGATATGAAAAAGCTTGAGAGT
7   N17   AX00002645   GAAATCTCCATTGTGGCTATTATTTATGCTTACGAGTATTTTACTTGCTTATTTAC
7   N19   AX00002646   TGTAAATTACAACGGTCAAATTGCTAATCCGCATCCAACACGTAATATTACAATG
7   N21   AX00002647   AACAACAACATCCATATCAAATGCCATATCAGCAAGGAGCACCGTTTGGACCGC
7   N23   AX00002648   AGCGTCTCGTCTTTTTACCGGATCAACATTTAGGGAGAAATACAGCGTACGACT
7   P01   AX00002649   ATAGCGACGATGACGCGTAAAGCGGTTCTCGCTTTAGATAGCAGCCATACACGC
7   P03   AX00002650   CAAAGGAAACGAATCGTAATAATAATACACATTTAGCGCAAGGTGGAATTGCCG
7   P05   AX00002651   AAAGCAGCATCGCAATACTTCGGAAACGAACAAAGTTTACACGATATTGGAGGA
7   P07   AX00002652   AGTTGAGCATCCTGTATACGGTGACTTAACAGCATCCATCATGGTAAGTAATCG
7   P09   AX00002653   TGTAGCAACTGGCTTTACTGGCTATCTATGCCGCGTTCTTCAAGAAGGTACTGT
7   P11   AX00002654   GTCGTTTTTTTCCGGAAGCAGAGCATGTACCGTATCGAACGATTCCAGATTGTA
7   P13   AX00002655   TATGGAAGATTTCCCGCTGGCAATTATGTATGCTATTTTTTGCGCCAATTATAGT
7   P15   AX00002656   CAGGTCATGTGCTTGTAAATGGAGAAGAAATTAATCAAATGCGTGCTGCAAAAT
7   P17   AX00002657   GGATTGTTGTTATTCCCGTCTCAGCACGTTGTTGAGTGGCAAGGACAACAAACA
7   P19   AX00002658   TCCAAACCTTGGTGTTGTTGAAACTGGTGATAACCGCAGCTTCGTTATGGCTGA
7   P21   AX00002659   ATCGATCGTTTTGTCCAAGAAGCGAGACAAGAATCCAATCTGATGGGGCTATCT
7   P23   AX00002660   ATCCAGGTGTTAACGTTGGTCGTGGTGGCGATGACACTTTATACGCGAAAGTTG
8   A01   EMPTY        -
8   A03   AX00002661   TGGAACTACAGCGGTTGTGTTTGGTTCTATAAATGCAGTGGAAGAACTTTGTAA
8   A05   AX00002662   GCGAAAGTTGAAAAACAAGGTCGCGCTAAGAAAATTATCGTTTTCAAATACAAAG
8   A07   AX00002663   TTATCGTATACATGAAGGGCAAGCGGTACTCGTACAAGTTGTAAAAGAGGCAAT
8   A09   AX00002664   TGGCAGTTACTTTGGAATAGTAATAATATTATGATGTGGGTACTGCTCATATTTT
8   A11   AX00002665   AAAGATTATGCAATTCCTGCTTCCGGAAAGGTGATGCAAGGGTTTCAAAAAAATG
8   A13   AX00002666   GTCGTTGAAGGGCGTTGCCGTTTACCTCAGGCTCTTATTAAAGATAAACGTTTTG
8   A15   AX00002667   TAATCGCTGCATCTGTTATGAATCCGATGCAACTTCGAATTAGTGATGTGGCAAT
8   A17   AX00002668   GATTTTTAACTTTGTTAGGACGTACTCATATGTCGGCGTATGTCTTTTTCACAGA
8   A19   AX00002669   TATGGCTGTAGTAACTTCACAAGGTTTAGTTGGACGAGTGAAAAGTGTATCTCA
8   A21   AX00002670   CTCACGTAAACCATACGTAATGGTATGTGTACCATCTGGTATTACAGCTGTAGAA
8   A23   AX00002671   AGAAAATAACAGTGATCATATTGTGTTAGGTGCAGATACAATTGTTACATATGAA
8   C01   AX00002672   TGATTTCACTTGTCCTTTCGCCTCTTTTGAAGATGTGCGGATCGCAATGAAAGG
8   C03   AX00002673   AAATTACACCAGCACATGACCCGAATGACTTTGAAGTAGGTAACCGTCACGACT
8   C05   AX00002674   CCTTTTACGAAAGAAGAGCAACTACTCATGTTTGCGTATATGACGTATCCATCGC
8   C07   AX00002675   TAAGAGATCTATCGCCAGCGAAGTCAATAGATTATGTAGAAACAAGAGAAGATG
8   C09   AX00002676   CAGTTAACGCCAGAATCATATGTAGAATTCGAGCGTAAAGCTGAAATGTTAGAAG
8   C11   AX00002677   ACCAGTTATGTCGTACGCTGTGAAATATTCATCAGCATTTTATGGACCATTCCGT
8   C13   AX00002678   GCAGCATTGAAGTTAGGGAAAGTAGACATTATTACATTTACGAGCCCTTCAACTG
8   C15   AX00002679   TGCTCGCTGCAAGACCAGATTTACAAGTGAAGTGGATTCGCGGAAATATCGATA
8   C17   AX00002680   CAAAGTAACCGAAAGGCGAACCGATTTGCTTTTTGGTTACTTTCGATTGTATGGG
8   C19   AX00002681   TTAAAACGTGGTTAAGTACACTTGGTGTCGTTCCGTTAATATCAGCTCTTCGTGA
8   C21   AX00002682   AGAAATGGGCATTACGTATCCACAGTACATTACTTTACTCGTACTATGGGAGCAA
8   C23   AX00002683   GCAGGCGGAGAGGCAACAAATCCAGAACAACTATTTGCTGCTGGTTATGCTGCT
8   E01   AX00002684   AGCAGGTCGTTCAAATGTCGGGAAGTCTTCCTTTATTAATAAAATTTTAAATCGT
8   E03   AX00002685   ACGTACGTTGGAGCAATGCCAGGACGCATTATTCAAGGTATGAAAAAGGCAAAA
8   E05   AX00002686   ATCTCCATTTCGCACAAATGCAACATTTATTGAACTGGATGCGACGACAGCTCG
8   E07   AX00002687   TTGAAGGCTTAATGCTTGAGGTAATGTTCGAGCTACCATCTCGCAAAGATATCG
8   E09   AX00002688   ATCAACGTACCAGGTTTCCGTAAAGGAAAAATGCCTCGTCCGTTATTCGAACAA
8   E11   AX00002689   GGCATTTACAGGTCATAATGAGGAGCAATCCGATAACATTATACATACATTATCA
8   E13   AX00002690   AAGAAATTTCATACGACAACGACATTACATTGCAGTATGCACATAAAAGTTTAGA
8   E15   AX00002691   AAGTAGATATCATGATTCATTGCGGTGATTCAGAGCTAACGCCTGCTCATGAAG
8   E17   AX00002692   AGATGCTTTAAACGGAAAACCAGGTGTGTATTCAGCTCGTTTTGCTGGAGAGCC
8   E19   AX00002693   TAACAGGACGTACAATGGAAATCCAGCGCTTAATTGGACGAGCATTACGTGCGG
8   E21   AX00002694   AGGGTGTGGCTTTATAAATCAAGAGAAAGCAACGGAACAAATTGATCCGCCAAA
8   E23   AX00002695   TAATAACCGTGTTATGGTAGAAAGTTTAGCGTGTCCGCCTTTCGTTGAACTTGTA
8   G01   AX00002696   ATTAGTCAATCGAAAGTAAGTTGGGTTGTAGTAGGTTACTCCTTAGTTGTCGGTA
8   G03   AX00002697   AATGGCGGAGAGCATCGATTGGGAATGGTATCAAAAGAAAGAATTTATGAATCG
8   G05   AX00002698   ATCAAGATGAAAGTATGTCTTTTGCAGAACGTTTCCAAAAGACGTTTATTCACTC
8   G07   AX00002699   TTTCGGATTATGATGCGGTTTTATTTGGTGGTGGACACGGGGCGATTGTAGATT
8   G09   AX00002700   TTGCAGGTGAACTTTTTATCAGTGAAAAGACAGTTCGCAACCACATCTCAAACGC
8   G11   AX00002701   CGGCGTTATGTTTTTACCGTCTGGAGCGCTCCAGTCCTTGCCGTCTGTTATGCA
8   G13   AX00002702   GTGGTGGTTTAGGAGAATATTTTGATATTAGCTCTACTCTTATTCGCATACTTTG
8   G15   AX00002703   TAGATGTAGGACAAGCATGGCATCTAGAAACGATGTTCCGTTATACGAAAGAAA
8   G17   AX00002704   GAACAATTTCTGGATGTCACATTAACCCAGCAGTATCAGTAGCTATGTTCATCAA
8   G19   AX00002705   ATCCAGTTGTGATTCGTCGCATTACAGGAATGTTGAAGAGAGCAGGACTTGTTG
8   G21   AX00002706   ACAGAAGAGAATGAGAAGGGGTTACAAGCTATACATGTATCGTATGAAAAACAA
8   G23   AX00002707   AACTGTTTTAGATAATAGTCCTCATCAAGCAATGAGCGTAAAAACAGGCAAAGGC
8   I01   AX00002708   GTGCGTTTATTGCGACGATTTTTGGTATTTTTTCAGGTTATGTATTATGGCATCC
8   I03   AX00002709   TTATCGTTCATACAAACGCCAAAAATCATTACATGATACATACGTTAGACGTCAA
8   I05   AX00002710   GTGAAGTAGATATGTTTGGACATGTAAATAATGTCGTTGCCTTTACCTATTTTGA
8   I07   AX00002711   AAGACATTCCCGGTTGTTCGTGACTTACAAGTTGACCGTAGTCGCATGTTTAATG
8   I09   AX00002712   GCAGGTGAGTGTGATTATTCTATGCACGGTGGTAACCGTCTTGGTGCGAACTCA
8   I11   AX00002713   CAGAGGCTTTTAACAAAGCTGCAGGCTTTATGGAGCTCCTTCCATTCCGGTATG
8   I13   AX00002714   TTGAAAAAGCTGGCTGGGGCACTTTAAGCATTATTGAACATAAGCGTCGTGAAA
8   I15   AX00002715   TACATTTCATCGTCAATTACACGGGAAATCTGTCATTCAATCAGCACTGGATGAT
8   I17   AX00002716   GTAGACGTGGATGAAAACCAAGAAACTGCTCGTCAATTCGAAGTAATGAGCATT
8   I19   AX00002717   TCCGTACGTAACGACAATTACAAAACTTGAAATTGACGGTACAAACGTGAAGATT
8   I21   AX00002718   GCCACATGCGCTTTGCAACTGAAAGCGCAAAACTTGGTTTACCTGAATTAACAC
8   I23   AX00002719   AACGCACTTCTTGCTGTTGTCGCAAAATGATCCTCTTGCTATCGTTACGCAATTA
8   K01   AX00002720   ATCATCTCCAGTTACACATAGTAATTTTTTATGGGAAAAGCGAGTACCAGGTAGC
8   K03   AX00002721   GCATTTGCAAATAATACGTCAGGGACAGCGATATCGGTACTTCTTGGTGGAACA
8   K05   AX00002722   ACAAACAACTGTGGAATCATTACAAAGTGTACAAGATTCAAACTTCATTTACATTG
8   K07   AX00002723   TGTTAGGAAGAGTCGCTTGGCATATCGTGACGGCAATTCCTGTTATACTATCTG
8   K09   AX00002724   ATTATTGGAGTTATTAGTGTATCTCTTTATTTCACCTATTATGGTACCCCTTGGG
8   K11   AX00002725   TGGCATTAATGATCTTTGTGAGCATCATCGCTCAAGTAGAAGGTGATGCAGAAA
8   K13   AX00002726   ATATTGGCGTACGGTATAAAGGTGTCCCGGCATCATTGAAGCTTATGGCCAAAA
8   K15   AX00002727   TAATTCCTTTATTTTTTGGAATGAGAAAGAAATCGACACCGACAACGATTACTTC
8   K17   AX00002728   ATTGTGAATATATGGGCTATTACGATAAAAATGAAATTGACCATGCTTTACATTTA
8   K19   AX00002729   AGGGTATTGAACAATTTTATATCAAATGCGATTACATATGGAGACGATGGAAAGA
8   K21   AX00002730   GAAGAGTATTACGGTGACGATAACGTTATTAATGTTCATATGAGAAGATTGCGTG
8   K23   AX00002731   AGATCAACGCACCGGCAAATTAACACGTGGAATTGTAAAAGATATTTTAACGAAC
8   M01   AX00002732   ATTTATGAGAAGAAGCGTTTTGATACGAAAGGGAAATACATTGAAGGCGATGAT
8   M03   AX00002733   AAATACAGTTGATTATGATGAAGTAACAATTAGTACACGCTGGAATGCAAAAGAA
8   M05   AX00002734   CGAAAGACAATGATTACTATTTATTTCGTAATTATAAAGGTGAAGATATGAGAGC
8   M07   AX00002735   TTAAGCAAACGACGACTTCTAATATAACGATGAAGACGTGGGGCGATGTAGAAA
8   M09   AX00002736   ATACAGAGTACTTAAAGAAAGCTGATCCAGATATTATTTTACGAGCAGCTCATGG
8   M11   AX00002737   ATTACAACCACTTGCAGTTCAAGCAGCTACCAAGTTGGCTGACGGTGAATATTC
8   M13   AX00002738   TGCTTTTACTGTATGGAAAGGCGATAAAGATGAATCGTCTAGAATGAATAGGTAT
8   M15   AX00002739   CAAACCGGCAGCTGTAAAAATTCATGTTGTTGTACCAAATGCAAACTATGACCAC
8   M17   AX00002740   TGGAATGGGCGCAAACGGAGGAATTATTTTAACAAATGTCGTGAATCATTTATTT
8   M19   AX00002741   GATATAAGTTTATGGCGATTACGGATCACTCACAATACTTGAAAGTAGCGAACG
8   M21   AX00002742   CAGAGGGTTTATTCTGCAACTTGTAAAGTTAACAAGCTTTATTATCGCATACCTT
8   M23   AX00002743   TAAAATGCGCGAACTCAATGCCAAGAATCCTTCGCTTGACACGAGTAGACTAGC
8   O01   AX00002744   ACAACAATATAAACATTCGCTTAGCCCGAAAACTCCGCAAGGCGGGATCTTCAT
8   O03   AX00002745   TATTAAACTTTCGGATTCGAAGATTTATCGGGAAACACGATGCCCGCTTGTTAAT
8   O05   AX00002746   TTAGAAAATACGGCGGTACAAAACACGCTGGATTCGGTCTAGGTTTCGAGCGCT
8   O07   AX00002747   AGTAAACGTTCTAATTGAGTCTGCATACTTTGCAGGTCAAACTGTGCGCCGTAC
8   O09   AX00002748   CGTCTTCGTCCAAGTTTCTTCCCATTCACAGAGCCATCTGTAGAGATGGATATTT
8   O11   AX00002749   GTTGTGCTTGGAGAAGGTTGTGTTGATGCATATAATAGTAAAGTACTCCGCTCT
8   O13   AX00002750   TGTTGATGCAATTCAAAGCGGCGAAGAAAAAATGCTTCCAGGTCTTGGTGTTTT
8   O15   AX00002751   TCGCTTACCATGCGTTTCACTTAGCTAAAAAGCATCACGCCTCAGTCGATGCTG
8   O17   AX00002752   TGTTCCAAGACGCAACGAAGCAGCAATCTTCCGCACTAAACTTAGATGTCTTTAA
8   O19   AX00002753   TCGTTGTTCCTATCATTTGTATAGGTTCTGGAATAGATTTAGAGGGGATGGTTCC
8   O21   AX00002754   TACACTAGCTCAGCCAGTGTCTAACACGAAATTAGATATATTCGGTGTGGTTAGT
8   O23   AX00002755   TACAACGTTAACAGGAAAAGTAGAGCAAGTAGGCTTAACAACAGCGAACACATT
8   A02   EMPTY        -
8   A04   AX00002756   TAACATTAAGCCTCTCTATTTCACAACCTAACGATGAAAAACTAATGGTTCCGCG
8   A06   AX00002757   GTAACGAGCGTGAACCACGTGAAGTAATGAAGAAATATATTGAGCCGTTTGCGG
8   A08   AX00002758   AGTGTGCACAGACGAATAAAACACAAGTAGAAATTTTCTTAGACACATATGCGAA
8   A10   AX00002759   TCTTACAGCCGCTTAATGCACGGTCTTAAAAATGCTGGCATCGAAGTTAACCGC
8   A12   AX00002760   TGGATCAGGTAAACTGAAACGTTCTCACGCTTACACAAGCCATTTATTCGCTAAC
8   A14   AX00002761   GACAAGGTTAAAGCGTCAATTCGCTTTAAAGGACGTGCCATTACTCATAAAGAAA
8   A16   AX00002762   GTACTAGGAAGCAGAGAGCTTTATGAAACTTCTGGTCACTGGAATCACTACCGT
8   A18   AX00002763   ACTGGCTTTGTGATCCGCTTTCATTCTCGTTTTCATCATATGTTCGTTTTCGTCT
8   A20   AX00002764   GGTGTAGGGAAAACGTATTTATTAGGAGCAATTGCGAATGAGCTTGCTCGAAAG
8   A22   AX00002765   AAGATCGTGTATTTGGAAAAGAGAATACGCATCATTCCCTTATGGTGACTATGCA
8   A24   AX00002766   TGAAAAGTGATATGATTGGTGAAATTGTTATGGAAGAACTACGTGATATCGATGA
8   C02   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
8   C04   AX00002768   CCTCTCTTATTTGAAAGTAAATTAACAAGTCTCGTTGACCGCGTTTTAGTTGTAG
8   C06   AX00002769   TGCGTCTTTATTAGGGTATGCACCTGCTATGATGGCGATATTAGTTGCAGTGAT
8   C08   AX00002770   GCACGTCCGTTTCTTGTTTACAGATGGAACTGAATTACATTATAAAGATGTGAGA
8   C10   AX00002771   TTTTAAAGAGTGGCTTGCAGATGGAGAAATGAGAAAGTATACATTTGATGCGAA
8   C12   AX00002772   GGGAACCGTTGATATGAAGGGGCTTCTTGAAGATATTCATATGGTGCTTGATAA
8   C14   AX00002773   CAGATGAAGAGAGCATCACAATTGCTGAACTTAAAATTTTGCCGGAATTTTATGA
8   C16   AX00002774   GGGTTAACGAATGATGCCAATCCATTATATATTCAGCATGATTACGCATCCCAAA
8   C18   AX00002775   AGAAGCGAGCCCAGTACAAGGTTTTGATGCTAACATTATTGGAACATCTGATTAC
8   C20   AX00002776   CAAAAACTGGGGTTACGAAGTAGCGGAACAAGAATTCGGCGACAAAGTATTTAC
8   C22   AX00002777   GTATACCATTGTTTAGGAATTGACCATGACTTATTTACACCTATTTTTGCAATTAG
8   C24   AX00002778   ACGTATTTTTCACTGGCGACACTGCTTTCGCCATCGGTCTTCTCATTTTATACAT
8   E02   AX00002779   TGGCGAAAAGACAAGGGTTTAAAGTGCTTGGAGAGATTCAATCTAAGTTGAATA
8   E04   AX00002780   AACAGTTGGTATCTTACTTGATACAAAAGGTCCAGAAATCCGTACTCATGACTTC
8   E06   AX00002781   GAGTATGACATGGAAGATGTTATCGCTCGTCTGAAGCGCGGTAGTGAACGTGG
8   E08   AX00002782   GACCGTGTTCAAATTGCTCGTCATGCAGAACGACCGACAACGCTCGATTATATT
8   E10   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
8   E12   AX00002784   GACGTGGTGAAGGGACGTTTATTCGAAACTTTTACGATAACGGTCTTGTACAAT
8   E14   AX00002785   TATTAAACTTTTATATCGCTATGGCGTACGCGACATTATTATGTGTGACCGTAAA
8   E16   AX00002786   ATTCCATCTCTCGCTCAGGCGATGCGACATAAGAAAAAAGTACAAAGAGCTATT
8   E18   AX00002787   CTTATCGGAAAACCAACTCTAACTTACATTAATCAATTCGCCCAAAATTTAAGAAT
8   E20   AX00002788   TGCTGTTGGAGGTGTATTGAGCTGGTTTATTTTTTTGTACATATACGGTGTTTTT
8   E22   AX00002789   TTCACAGGGTGGTCTTAGTACCATTCTACAAGAATCGTTTCCAGAGAAAAATATT
8   E24   AX00002790   TTTCGTACAAACCGCCCAATGGAGAAAGGTTGGCTCTCAGGAAAATCCGCAATG
8   G02   AX00002791   AAAAGCTGACATATGCAGAAGTCGTTAACATTGTTGATGGTCAAGTACTTGGAG
8   G04   AX00002792   ATTTGAACTAGCGACATTTTTAAGTTGGCAAGGTGTAAATACACATCCGATGCAT
8   G06   AX00002793   TTGCTCTGACATTACACGTACAGTGGCATTTGGCGAGATTTCTGAAGAACAAAC
8   G08   AX00002794   TTTTCTAGCGAGAGCAAAAGTTGGACGGGACAATATAAAGGCCATATTAAGGAT
8   G10   AX00002795   TACGAGTTTCTATATGGGAACATAAAATCTTTCTTACGCAGCTTATTTTTCAGACT
8   G12   AX00002796   GCGATATCTTATGGATTAGGGCACGTGTATTCGCATCCTATACTAACTTTTTTAA
8   G14   AX00002797   TTGAGACAATTTTCCGGGAAATAAGAGATGGAGAAGAGTACTTATATTGGTATTC
8   G16   AX00002798   AAAAACGACGACGTTTGCTTATGCGGTATGTGATCAAGTGATAGATGGTGAGGT
8   G18   AX00002799   TAGTCATTGCTTACGAATCGCTGTATTTACTGGTGAATATGATTGGCACTATCAT
8   G20   AX00002800   CGGATTCCAAGGGGCAGATAGTGCACCGGGATGGATTTATCGTTCAGCTTTTGC
8   G22   AX00002801   CTTATAGCCGTGCAATTGCTGAACGTGCAAATCTATTTGCAGAAGACTTATTAGA
8   G24   AX00002802   TTTCATGCATTTTCTTCCTTATATGAAAGAAAAGCGAGGAGAAGAGGAAGATCCG
8   I02   AX00002803   TACGGTATGAATGTACAGTTTAAAGATGAACCAAACGAATCATATACATATAGAG
8   I04   AX00002804   TGGCTATACGCACTTACAGCGTGCCCAGCCAATTTCATTTGCTCATCATATTCTC
8   I06   AX00002805   TTGGACGTATCGATCACGTAGAAAATCGTCTTGTTGGTATTAAATCACGTGAAGT
8   I08   AX00002806   CGCTATATCACATTCACTTCCAAAACCACTTAACAGAAGGTGGCTTTGTAGGTAT
8   I10   AX00002807   AAGCAGATGGATGGCTCTTTCATTTGCATGCATTGATTCAAAGTTCACAATCACA
8   I12   AX00002808   GCTGGCCTGCTTGGGCGTTATATCAATTCGAATTATCACCCTTTTTTGGCGTTAT
8   I14   AX00002809   CGACCTCTTGGCGGTTCAATTGAACTTGGTGAAAAATCAGCACATACTGTTATTC
8   I16   AX00002810   AGCCGTATCCACAAATACATCGGTTCTTACACTGCTCGTATGAAAGGTGTAGAC
8   I18   AX00002811   CGGTGCAAGTGAATATAAGTTAAAAGCAGATGAAGGAATGTCGTATGCCCACCA
8   I20   AX00002812   CATACAAAGGCGAAGTAAAATTAATTAGTGTTGTACCTTCAATCGACACAGGTGT
8   I22   AX00002813   CGGATTTGCTGCTGGTGGAAGTGAATTTGGTAAAGTAGAACATTCAGGCCGCCA
8   I24   AX00002814   ACCGGATATGCATGGGGGACAAAAGGAATGGCTGCTGGAGTTGTAGGACAATA
8   K02   AX00002815   TCGTACACTTGGTTCACCGTTCATTTTAAATCACGAACGTACATTAACTTTAAAAC
8   K04   AX00002816   TGCGATTCATACTATCGGTGACTTATCGCTTGAATATGTCATTGATGTACTTGAA
8   K06   AX00002817   CATTCCCAGGTCAAGGGCATGCAATTGGTTCTCAAGTAACAATCGCAATTCAAA
8   K08   AX00002818   GTTACATAGCGCTGTATCCGCAGGTGAGCCGTTAAATAGAGAAGTCATTGAAAC
8   K10   AX00002819   CATATGATATTTCAATTCGTCCGTACGAAGATTGCTGTACAGTATTCACACCAGC
8   K12   AX00002820   TCTTCAAAAGCAAATGAAGTGAGCAGAGTGTTAGTGTCAATGGGAGTACCGCAT
8   K14   AX00002821   GGTAGAGTGTCAAGCGACGTTACCAGTTCAGCTGGAAGATTTATTACACGGACA
8   K16   AX00002822   TATGCGGCGTTACTTGCTGGGTCATTTATACAAACGGTGGTGCTAGTTTTCAAT
8   K18   AX00002823   AACGAAAACAACGCAGCTTGTAGCAGACGTTCACCAATTCCCAGGACACATCGC
8   K20   AX00002824   GTTCACCTTATTTACAAAGACCGCTTGAACTTGGCTGTGACGCCGTTGTTCATAG
8   K22   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
8   K24   AX00002826   ATGAGTTGGTATCAGGGAAGTAATTTAATAGATAATCCTGATGAATGGAAATATA
8   M02   AX00002827   GCGGCGCAATTTGGTTAGACCCAGAGAAAACAACTCCTTACGAGTTCTACCAAT
8   M04   AX00002828   GTTATTTTAGGCGGACGCTTTAGTCCAGAAGCGTGGTATGAAGCACTGCAAGAT
8   M06   AX00002829   AAATTGCCAGAAGCTCGTCTCATTATTGCTAGACATGACCAAACGATTGTTGGAT
8   M08   AX00002830   TATCGTGAGCGTTCTCGTCTACCCAGCAAAAGATGAGAATGATAAAGTACTCGT
8   M10   AX00002831   TATTCCCTGGAACTGGCGCTGTAAACGAACGCGGACAAGGTAATGGCTATAGTT
8   M12   AX00002832   TTAGCCCGAGTGAGCTAGTAGCAAGAGTAAAAGCCCATATTTCTCGTTATGAAA
8   M14   AX00002833   TTCTCAAAGCTCGATTTGAATCGAGTTCCCTTTCAGTTTGAAACGGTTGAATTAA
8   M16   AX00002834   ATCGATGTAAACCATGTAAATAACCTCGGATGGACAGCTTTAATGGAAGCCATC
8   M18   AX00002835   ACAAAGTGGTTCCCCCTCATGGGAAACGACGTTAAAACAACGCGGTTTTGAAGA
8   M20   AX00002836   TGCATTCGGTAAAATCGTTAGTTCTTTAGTAAAAGATATTATTACACCATTACTTG
8   M22   AX00002837   CACGTATGTAACTTCTATTTTTATTGAAAGTGTATCAGTGGATATGAGCACAAGT
8   M24   AX00002838   GATAATACACGCCTTGCATTAATGGTTCGTCCGCAACTTTCAACAGTTGTACAAC
8   O02   AX00002839   AATGGTACGTATATTGCTAGTGCTACTGTTCAAAAGAATGATACGAACATTGGAA
8   O04   AX00002840   AATCGTGTTGCAGAACAGTACAGCATTAAACATGAATCTCCGCAAGTGTTATACA
8   O06   AX00002841   TTGGAACGACAATCCATTCTTTAAATACGAAACTTCGTAATGTATCAGAGTCTGT
8   O08   AX00002842   ACTCTGCACCCGTTCGTGATTCTGTTAACGGTACAGTTTCTTACAACACGCCATC
8   O10   AX00002843   AAAGCTGTTTGAAGTCATGAAAATGGATAAGTGGGAAATGCAGTCAGCTCCTTT
8   O12   AX00002844   TGTAAATGTCCCGCTCGTTTGGGAAGTATTTATTAAAAAGCATAAAGTAGAAAAT
8   O14   AX00002845   GGATGGTAGGCATTCATCCGGTAAGCTGGGGGAAGAAAGCGGCGAGCCTTGG
8   O16   AX00002846   AAAAACATCCAGAGCGTGAAATTGTCGCTGTATTCCAGCCGCACACATTCTCAC
8   O18   AX00002847   AGATACGTCTCGCACGATGATTGATCAATACTTCATTCGCCACCCAGAAGTACT
8   O20   AX00002848   GAGAAATTACTTGGCCGTGGTGATATGTTATTCTTAGGGAACGGTACATCTAAG
8   O22   AX00002849   GATGTTGCTCGCGTATACGATCGTGAAAGCAACGAAACAGCAGGATTCAACATC
8   O24   AX00002850   TACCTGTTATTCGCTCTACTTCTTTCCCGAAACAAGCAGAAGAAGGAAATCCGTT
8   B02   EMPTY        -
8   B04   AX00002851   CGTGATGAGTTTATTGATCTATGCGTAAAATTAGACGTATTTGGCATTCCGAGCT
8   B06   AX00002852   AATTGGTATTGGACTAGAAGGCGGTGTAATGAAAACGGAGCACGGTTTATTTAT
8   B08   AX00002853   TTTCTATGCGCTTGATGCAAGTCCAGCAAACGATGCATCTGGTGACAAAACACA
8   B10   AX00002854   AGGTGAAATTACTGGCTCTTGGGTACATATGGTTCCAGAGACATTTGAAAAATAT
8   B12   AX00002855   TTATTTACGAACAGATCCGTTACTTTTGCAAACGAAAGACGGTAATATGCTCATT
8   B14   AX00002856   CAAAAGGTGAGATTGATCGCGTTTATTTAAACTTCTCAGATCCATGGCCAAAGAA
8   B16   AX00002857   TCTGAATGCGAGCAATTAGAGCGTCTCATTCAATCGTTACTCGCAAACGATAATA
8   B18   AX00002858   TTGCTGACCCAGCTTTAGACCTCGGTATGTTATTATATTGGTACATTCCGCGCCA
8   B20   AX00002859   TGCAGGAGGAATTACCATTTCGTTCGTGGGTACATAAAGAAGACTATCATATTAC
8   B22   AX00002860   TGTAGATGAGTTCGGGATCACACCGCGAACGATACAACGTGATCTAAATGTGTT
8   B24   AX00002861   TATCACAATGGATTCTGTCCTTCATGATTTCGCCTGATAGCCGAATTGGTGCTCT
8   D02   AX00002862   GAAATGTCTTCTAAATTCACGAACGGCTTATATTTCTGCGGGGAAGTTCTTGATA
8   D04   AX00002863   ATTTGGCTTAGGAATGGGACTTGTGACACCGATTTATATGGTAACAATTCAAGCA
8   D06   AX00002864   AATAACGGATCATTTTCCGATGAGTCGTACCGCGGTTGTAAAGCACCTTCATATT
8   D08   AX00002865   TTGAAAGACTTAGGGGATAATAAAACAGAATTTACGTTAATTCACGGCGGCTGG
8   D10   AX00002866   ATCGTTATCACCTTGGTATGTGTAAAGATGCCCAAAATCATGAGACAGGGGATC
8   D12   AX00002867   GTTGTTCGGGATTTACTTCGCCGCAATAAAGAGAGAGCTTTAAATGCGAGCGAA
8   D14   AX00002868   TGAAAGAGTTTGGTACGCTTGACGTTATGATTAATAATGCAGGGATAGAAAATGC
8   D16   AX00002869   TTTGGGCAGCTGGAAATATGTTTTTATTCATTTCACAGCCGCGTGTTGGAGTGG
8   D18   AX00002870   TACGAAAGGGCGTCGTACATTATACTTAGAATATGTCGCTTATAAAACGATGGCA
8   D20   AX00002871   TCGTAAGTAGTGTAGAAGGTGCTGGATTACTTTCGCTTTCTTCACTAAGAGAGG
8   D22   AX00002872   ATTATGGCTGCGAAACGCACTTCTGATATTATCCCAATGTGTCATCCTTTATTAT
8   D24   AX00002873   TATAATATTCCGTGGATATATGGTGGTTGTGTCGGAAGCTACGGAGTAACGTAT
8   F02   AX00002874   CGTATAACTGTAAATGGCAGTCCGCTTGCGGGAACGATAAACTCCCCGACAGTG
8   F04   AX00002875   GGGACGGAGACAAAACTTTGTTTACAGCCTGGAGATTCGGTGACGACAACATAT
8   F06   AX00002876   ATGTCGGCGATTGTTATGATATCTCACCTTTAGCTGTAGCAAAAGTATATGCAGG
8   F08   AX00002877   GAGAATGAATATATCTTTATTTGTCGCTCGGGAATGCGCAGTGAAAATGTATGC
8   F10   AX00002878   AAATATGGAGAAGAGCAGCCAATGAAGGGGCTTCAGTTAGCAAATAGAATGATG
8   F12   AX00002879   CTACTCTTTTAGAACGACCTAACGCATCACTAGAAGAGCTGAAGGAACATATTCC
8   F14   AX00002880   CGCTCAACTGTCAATCTACAGTATGACCGGTTTTGAGATTTACCTCATGGTGTAT
8   F16   AX00002881   ATAATATGGAGACCGGACCTTTACCAGCGGATAATCTACATATAGGAGCATTTC
8   F18   AX00002882   TCGGACATCCTGTGACAAATACTCCAACAAAATTAACAGAAGAACGTGCAAAAAT
8   F20   AX00002883   TCATCATCACCAAGGTCACCACGGTCATCATGGGCATCATCAACAACAAGTACA
8   F22   AX00002884   GCTTACCACCAAACAGTCAAGAAAGTAACAGAAGACTATGCAGAGCTTCGCTTC
8   F24   AX00002885   CACTTCTTATCGTATGTGTAGCATATGCTTTATGCTGGGTTACATACGTACAGTG
8   H02   AX00002886   TGATTTCTTTGGAGCCATATTCTTTTTCAGCTTCGGTTTAAGTATAGATCCGTTTT
8   H04   AX00002887   ATTAGATACGATTGAAATGGCTTTTGAAGGATTATCAATTGAATGGTTTAAGGTG
8   H06   AX00002888   TAAAAGAGCACTCGCAGCGAGATTATCTTTTATTTGTTATTGGAATTAACACAGG
8   H08   AX00002889   CTGGTAAAGGCTATAAAGCATTTTACCTGCCATCTATGACTGTTACGTGCATCTT
8   H10   AX00002890   TTAGGGGACGAGCCAACAGGAGCGCTTGATTCTAAAAACGCGACGAGTTTACTT
8   H12   AX00002891   AAGAACTATTACCACTCGGCTTAATTTTATTAGGGCTTGCTGCAGGGCAATATCG
8   H14   AX00002892   GGAGTATTCGGATGCGCAGTTACAATTAGAACAAGCGTATAACGATTTACAAAC
8   H16   AX00002893   GACTCGCCCAGATTGTTTACCGGACGATGTCGTTGCATATTTAGCGGACTTAAA
8   H18   AX00002894   TGCAAAGGGAAAAGTAACAGGCGCAATCTTCAACTTAGGTTACCTTCCAGGCGG
8   H20   AX00002895   AGAACTACAAAAACAATCCGGTTTTATACACGTTGCACACAATTCAAATCAAAAC
8   H22   AX00002896   TTGCGATGTACTTCATGAGCTTACTTTTTGTATATGCGTATAAACCGACTCCTAT
8   H24   AX00002897   AATATACGGAGCAAAGCATGACATGGACTTTCCTCATATGATGATCTATTCGTGC
8   J02   AX00002898   ATTACATAGTTCTCTTTTAGTTGGTGGCACTGTCATTAACTATACTGTAGAACTTG
8   J04   AX00002899   AGAAGAAGCAGAGAAGAGCATTGGTGATTTGCCTCACGCGAAGTTTCATCGTCT
8   J06   AX00002900   ATCATATCGGCTACCATGTCGTGATGGGGGACCTTCCGTCACATGGAACGACTT
8   J08   AX00002901   GTGATGTGTCACCAACAATTATTGGAGACCGCGTAAATGTACAAGATCAATGTA
8   J10   AX00002902   TCCCGTCTGGTCATACAACAGCCGTTTTCTCTGTCTTTATTCCATTTATTTGCTA
8   J12   AX00002903   AAATCGCCTATTCTGTTTTCGCCCCTCAGCATACAGCTGAAGATAATTTCGTAGC
8   J14   AX00002904   AATATATAGAAGCAGATTGGTATGCTATTATGCCTTGCGATGCGCCAAATGTTTC
8   J16   AX00002905   TTGGTGAGTTGTTCCGCATGATTAGTTATTTAGAAGATATCGGAAGCAGCGCAA
8   J18   AX00002906   AAAATGCTAGACTTACGTCGCCCAATTTACAAACAAACAGCAGCTTACGGTCACT
8   J20   AX00002907   CATACCCTATGCATGCGATCGACAATATCATACTGCCAAGTGTTGCTGGACACC
8   J22   AX00002908   ATCGTAAGTATGTATTGCGTTTGGCTTTTAGGGAGACGAATTGAGAAGCTTGGA
8   J24   AX00002909   AGAAGTCGGTTTATATGGAGCGAAAGGATATACCTAGATTAATTATCGTTAGCGT
8   L02   AX00002910   ATATAAAGTTATTTTACGATAATGAAGGTTGCGGTTGTGTAATGAGCGGCATTAT
8   L04   AX00002911   AAGGCCCAGAACAAGAGCCAGTTGGCCTTATTTGTGAAATAGATGAAACATCAA
8   L06   AX00002912   AAAATCCACTTGCTTCATTAAAAGGGTTTACGCAATTACAACGAGAGAAGCATGG
8   L08   AX00002913   TATGGACGAATATGCTGGCCATTACGTTTTTTCTGTACATGCTCATGATCTTAGC
8   L10   AX00002914   ACAAACTCAAAACATTCGCATCGGCGAAGTTACCCACTCTCTCTTCTATGCCCCG
8   L12   AX00002915   TTTCTTTGCACTATGGGAAATAGCTAGCAAAAAAGAATGGATTGATCCTTTACTC
8   L14   AX00002916   ATTTTTGAAGGGGAGCAAATTCGTAGTGCATTGGATAAAAAGTTTAATGATTATC
8   L16   AX00002917   GGGTGTCAATTGGAAATTAGGTGTTGCATATGCTCATTCTAAACAGGCGATTAC
8   L18   AX00002918   AAAGCATGTTTGGGTTGTATGCCGGTACGGGGATCAATGGTTATTAACGCATCA
8   L20   AX00002919   TTCACCAATGGGCTGCCAAACAGGATACTACCTTGTAGTAAGCGGAACACCGAC
8   L22   AX00002920   GAGGCGTTTCAAAAGCATGGCGCATTCAAAGGCTTTTGGCTTACTTGTAAGCGT
8   L24   AX00002921   ATTATGCGTAGTATTTTAGTCGCTGTATATGAACTTGGCGCTGATGAAGTATGTG
8   N02   AX00002922   AATTTCACCAAAGTTCCGTGCCTTCTGTATGTGGATGGTTGCACTTGGAACAAA
8   N04   AX00002923   TGTTCTTCACTGCTATATTCGTCGTATCCGGTGCCCTTTGGGTTATGATTAAAAC
8   N06   AX00002924   CTATACCAATTCAACAGACCAAGACGTAATCAAGATTTCATCATCGTTCTTGGTA
8   N08   AX00002925   GGCGGGGCATTAGATGGAATCGATATGCTAGCTGTATTACTTTCTCGCAAGTTA
8   N10   AX00002926   ATTCGGTTCACGAAAATCATCGTACGGTGATTATCGCGGATATAATGACAGACA
8   N12   AX00002927   GCTCCTGGCGATATGGTTGAAGTTTCATTAGTCATGTACGAATTAACTGGAAAAA
8   N14   AX00002928   GCAAGGGTACATTTTATCTCAATCGATTACGAAAGCAAATGACTTATGGCAAGCG
8   N16   AX00002929   TATTAATCAGGCGATGTCTGGATTTGATTCAAACTCAGCGAAAGCTGGTTTAAGC
8   N18   AX00002930   ACGACACGAAGCCACTTGATAAATTACCAGCTGTAACAACAGAACAAGGTGTAT
8   N20   AX00002931   TCTTTCTGAAGGAAGCGAACTTCGTATGAAGCAGAAAGCGATGTTCAAAGGTCC
8   N22   AX00002932   TATTATTGCATACCGCTGGGGCTTTAAATCAGCTTTCTTAGGTGGTTTAGTTTGG
8   N24   AX00002933   GTCGCAAATCAAGGCCGGATTGAACAAGTCATCGTGAACTTCATTACGAATGCG
8   P02   AX00002934   TAGCAAGAGCGAAACGGTTGTTAGAGAGTAGAAAAGTGACAAAGCAACTTTTAG
8   P04   AX00002935   TGGATTACCCATGCGGATGATCGTACTGTTATTATAAAAAAAGAAGAACCGATAC
8   P06   AX00002936   GTGGAGCGATAGTTGTAGGTTTGAAGAAGAGACCCCTAACGAAGAGCAAAAGA
8   P08   AX00002937   TTTAATTCGTCACATTAAAAACGATGTAACAATCGACTTTATTTCTGCATCTAGCT
8   P10   AX00002938   TACATACAAATTTAACGAAAATCGTACCACCTCTTGCCGCGGCTTTTCCTGACTT
8   P12   AX00002939   AGTAAGTGAAAATGAATTCTTCCAATCAGTAGCCGCTGCAATAGAGAAGAAAGA
8   P14   AX00002940   GAACGTATGAGTCAAGATTCCTCTTTCCGACAAGCCTATGACGCAAGGGAGAAA
8   P16   AX00002941   TTCCTATACGACAGGATTTGTTTGGACACTCATTTATTTCGTGCTCGGTTCTTTA
8   P18   AX00002942   GATGTAATTGATTTTAATAAAGCGAAATGCATTGTAGAGTTAGGGCCTGGTACAG
8   P20   AX00002943   TGAAAGAGCGGATCAAGTTCTGAACACACACTATAATGTTACGAAGCAGTACCA
8   P22   AX00002944   GGTAATAAATTTGCAGCGTTAAAAGGGATTAACCTACAAGTAAAAGAAGGTGAG
8   P24   AX00002945   TCAAACATTAAAGTCCCTTTCAAACATGGAACCTACTGGAATCATTAGTGCTTCT
8   B01   EMPTY        -
8   B03   AX00002946   AAAGGTCAATTACGCCGTATTTACGGTGATTATGCGCCAAATATTTCTGAACGTA
8   B05   AX00002947   GAATGTACCATAGATTAAGTGAGCAACCAGAAAAAATGGAAGATGCGTTTATTGA
8   B07   AX00002948   AATCCATAACGACAATGCAGCAATTCAAGCAGAGCACCCTCCTTTCCATGCAAG
8   B09   AX00002949   TTTACGAAATTAAATAAAGAAGAAGATGCAACGATTTTAATGGTTACCCACGATC
8   B11   AX00002950   TTACTTATCGCGTTACCAACAGCCATTATCGCAGGACCGATATTTGCAAAGTGG
8   B13   AX00002951   GCGGTAAAGGAACGAAAGTCATCCGCAATACTTCTGCGACAAAACTGTCAAAGG
8   B15   AX00002952   GTCGTTTTTGATTGTAACTATCGTCCATCTCTTTGGGGAGAAGACGGATATGAAC
8   B17   AX00002953   ATTCATTGAAGTACTTCCCAATGAAAGGGCTAGCTCACGAAGAAGAATATCGCG
8   B19   AX00002954   ATACGGTGCTCCTGTTGAAACGATGATTTACTTAGGCGGAGGAAAACTTGTAGA
8   B21   AX00002955   CAGGTACTTACGTATCGAGTGGTTGGATTGATTTGCACGTTCATGCTTTTCCAG
8   B23   AX00002956   TTATCACTGGACGTTGGTTCAACGCAAAAGAAAATGGAGAAAGCGCCTGAAGGA
8   D01   AX00002957   TACCGTATCTTTTTGATATGTTTTATACAGGTGATAAATCGAGAACTGAGAACCG
8   D03   AX00002958   ATTTATTAGCGAGTCATCCGAAGAAAGTGTACAATGTGGAAAATATTTTTCAGCA
8   D05   AX00002959   TATCCGCGGATTACATGTTAACGAAAGTAGGATCAGCCGGCAAACCACTATTTC
8   D07   AX00002960   GGATATGTAGGTGACGACCAAATCCCACGTCTAAACGTATTAGACCTACAACGT
8   D09   AX00002961   TACAAGAAGCAGTGCGAAAAGAACGACTTGCTAACAATTCAAACGGACTTGCAA
8   D11   AX00002962   TCTCTTGTAGGGCGCCTTTCACATATGGAAAAGGGGCTTATTATTTGTGGAGAT
8   D13   AX00002963   AGCACTCCGCATTGGGCAACCGGATTGTTACGTATTTTCTTTTGATTATAAAGGG
8   D15   AX00002964   GCTATCGTTCGCGATGGCATTCAGCCAAAAACAGTGCTTAACTTAGCATTTGGA
8   D17   AX00002965   TCTGGCGAAGAAATTCCATTTGAAAGATTAGAAGCAATGCCGACTGCTACAACA
8   D19   AX00002966   CTGGTAAACGTCTCGTTACAGGTGAAAGCATGTTTATGACTGTATTCACAAATAC
8   D21   AX00002967   GGTTATGAGACGAGTACTGTAAATACACTTAGACTTTGGAATGCGGAACCAGTT
8   D23   AX00002968   GTATATACGATTCATAACTTGCAGTTCCAAGGTGTATTTCCTCCTGAAGTGATGT
8   F01   AX00002969   TTACCTCCTTATGCGGAGTCTTCAGGTGTGAAGTGGTACACAGGTACGGCAAGT
8   F03   AX00002970   CATAGCATTGTATAAGCGCTCTAAACCACTTTGGCAGCTTGATCATTCGCGTGA
8   F05   AX00002971   CTACTTAGATGTAGATCCACGTAACGTTCATGCTTACATCGTTGGTGAACACGG
8   F07   AX00002972   AAAGCAGCTTATAACTTACCACATACCGATCATATGAATATGGATCCCCTTCGAC
8   F09   AX00002973   TTGGAACGCCGTATATTCTTTCGCACGTATATCAAGACGAACTAGATGATCATGT
8   F11   AX00002974   GACTTCTCTATTAACGTTATTTCCAAATCAGGTACAACGACAGAGCCTGCACTAG
8   F13   AX00002975   TAATCGGGTTCTTCCAGTTTGACTTAGTAGCAGCCATTTTCGGTGGACAAAACTC
8   F15   AX00002976   TGAGTTTATCGTTAAAAGCGGCGAAAAGAAAACAAGGACGGATTCTTATACCGA
8   F17   AX00002977   AATTAATGCTCAAAATTCACCAATATTCCATGATGTGTGCACCGACGATGTCTCA
8   F19   AX00002978   GGTGAAAGAACATACAGGTTTAACGGCAATGATCGATGTGAAAGTTACACCAAA
8   F21   AX00002979   AGACAATCCGCTCTTATCATTACAAAACGTTGTGACTTTACCACACATCGGATCT
8   F23   AX00002980   AACGCCCTACTTTTGTGCTCGTTCACGGCTTTTTATCTTCCTCATTCAGTTACCG
8   H01   AX00002981   GCGAGCGATGTTGTGAACGTCGCAAGTGTGTTTGATGATCCGAAATACATCGCA
8   H03   AX00002982   TCAAGCCTTTACATCCATCCAATATAGACAAGGCTTCCACGGATTAAATATATTC
8   H05   AX00002983   TTTTAATCCAGATGATAAAAAGCATGGACTACTTAATCCGAAGGGTGCAGAAAAC
8   H07   AX00002984   GTACCATTTTTCCACGAAAGACGTGCTTTAGCTTTCCGTGAACAGACGAACATTC
8   H09   AX00002985   CGTATGGAAAAGTAGGGACGGGTAAGCATCATTGTGCGCTAGATGATGCGATG
8   H11   AX00002986   TCGTTGATTTACACAACGCCTTTACGAAACATATTGAATGGGGGACGATTACACT
8   H13   AX00002987   CATCTACGCTATCTTAGACAGATATGGAACGAACTCTATATTATTTACGATTATTC
8   H15   AX00002988   TGGATCGCATCAGATAACATATGGTTACAACGCGCCGCTATTTTATTCCAGCTG
8   H17   AX00002989   ACCACCTTTGCTCAGCCTATATTTGAATTACTATCAATATACAGGCGGAGCACAC
8   H19   AX00002990   GGAGTAGCAGGTGCACCAATCTTCGCTAACTTCAAAGCTGGATTTGGAGCACTT
8   H21   AX00002991   AAATTCAACGTGTATTCGCTTACGATTTCGAAGGAAAGCGCTACGACGTAGGTG
8   H23   AX00002992   GTTCGTCATTTACATACAGTGAGTGGAATCGTTCTTACGGCAAGCCATAATCCG
8   J01   AX00002993   CATATGTTAGCAAATGTACAAACACTGGCAGCTACATACTATATTCAAGCGTATT
8   J03   AX00002994   CCGATTTTTGATCGTGATAAAGAGCGCGTGAGAAACAGTAAGTTTGCTGATTTA
8   J05   AX00002995   TTACATATTCAGGTGTTAAGGCGAAAAGGGATTTATATTCCACAATCGCAGCGG
8   J07   AX00002996   ATTGTCGCTCATGTGAAGGGGATCATTGGTGTTCGATCGGGCGTAATTCACAAT
8   J09   AX00002997   AGTAAACAACAACAGCTATCACTACCAAGCGACTTGGTTACATGAGAGCGCAGC
8   J11   AX00002998   TATCATCGATGTTGATGACGTAATCGTAAACTACGGCTTCGTTTCTTCCCTTGGC
8   J13   AX00002999   TCCTGAAACTATGACAACTTTAATAATACCTGCCGCTACGTATGCGGTATTTACA
8   J15   AX00003000   TCTTAGTGTTCCAAGGCTTATTTTTATGATTATCGGCGGCGCTGTAGCTGATAAA
8   J17   AX00003001   AGCTTGATGAGACGTATTGTCGTCACGATATACCGAAGCCTTTTATATACGCACT
8   J19   AX00003002   TGAAAGAACGTAGTCCCTCTTGTGGTAGTTCTACCATTTACACGGGAGAATTTAA
8   J21   AX00003003   TAGTTGGCTGTGATTTAAATCGTATGGGTAAAGATGAGTACTACGTTCAAATTAC
8   J23   AX00003004   AGATGCTGAAGATGGAGAGAAGTACGTGCGCCTTGCTGTACACGGCGGCGGAT
8   L01   AX00003005   TGCGCATGTTTAATAATGATGGATCAGAAGGAAAGAGCTGTGGTAACGGTCTAC
8   L03   AX00003006   TTTAGATGTAATGGAGTATGGTTGTTTAGGCTATTGTGGTATTTGTTTTGAAGGA
8   L05   AX00003007   CATTAGTTGCGGGTACTATTTCAGAAACGCATATTCGTATACCGTTCCCTGAACA
8   L07   AX00003008   CGTAGTCATGCTTGGGCAAACACCACCTATTTTTGATGGAACCATTAAAGACAAT
8   L09   AX00003009   AACAAATCGCGCTCGCAACATTCCGTATGACGATTCAGCTCGTACTCGTTGCCT
8   L11   AX00003010   GGAACTTCTTCAGTTGTGAAGATCGGTACGAAAGTAAAGAGTATCCGTCTAGTT
8   L13   AX00003011   ATCCAGCGCAAAGGAATACGTGGAATTGGGTAGCCTTTTTCTTCCCAACTTTTTG
8   L15   AX00003012   ATGGGAAATGCCTGAGAATCTCGTACTCTTATCTGGGGACGGACATACATGGAT
8   L17   AX00003013   CATGAAACTATCGACATTCCTAATTACCTTTCTACTATTTTCGACTGGTTTCAAAC
8   L19   AX00003014   AGATAGTCAAGGCGGAAGCGGGACAATTACGTTTCATCCGAATTACACGATTGT
8   L21   AX00003015   TACGTGTATTGTGCAGATGGTAAAGCGAATGTAGGTCATTGGGATATTAATGCG
8   L23   AX00003016   CGGCGATTGGTCGTAAATATGAAGGACAAGAAAATAAATTTAATTTCGAGTATAT
8   N01   AX00003017   TATCGTAAAATTACGCCTTATGGGTGCATGCGGAAGCTGCCCAAGTTCTACAAT
8   N03   AX00003018   TACCGACATGGAATGCGAGCTACCAATTTTTATTTAAAGAAATCCAGCAAGAATT
8   N05   AX00003019   ATGATACGCCGCAACTAACTGATGCAGCAACAATTTGCCAAGAACGATTCACAC
8   N07   AX00003020   GTGAGCCGTTACAAGATATCGTAAAACGTGATGAAGGCTTATACGGAATTGATG
8   N09   AX00003021   TACACAGCAGGCGGTATGTTTGACGCAATGAAGAAAACCGCGGATGTTGGTATT
8   N11   AX00003022   AATGAAGCCTTAATAGTTGGGGATAACTACGATACAGACATTTTAGCAGGAATAA
8   N13   AX00003023   TGGCGATTCGAAGACATTTAAGTAATCTTGAGAAAGATGGTTTCATCTATTCTAA
8   N15   AX00003024   ATTGATTCTGTATTAGATGTAGGGAATGCGATGATTGATGGATTTATTATGCGCG
8   N17   AX00003025   CAATCTTCTCAGCAACTGGTGTATCTGCTGGTGAGTTATTAGACGGCGTAAAAT
8   N19   AX00003026   AAAATGAGCGTCATGATTTAGCGCTATTATACTCCGATCGTCATTACGGTAAAAC
8   N21   AX00003027   TTACTGATCACGTTGAAACAGTCGATATGACGCAACAGGATCAAACGGAAACAA
8   N23   AX00003028   CTGGGGATATGAGCAACTTAGATTGCGCGGTTTCTTTGATGATAGTAACCAACG
8   P01   AX00003029   AATGATTACAAGCATGACAGTCAAACTTCCTGACGTTACAAACGCTGCTACGCTC
8   P03   AX00003030   AACTTCAGTCACTATTCATTAGATGCTTTTAAGGGGCTCGGTCAAATGTACGTCG
8   P05   AX00003031   GAGCTAAGCCGTCTACAGGACATGTTAATTCAGCAACCTGCCTACTTATACTTCC
8   P07   AX00003032   TAGAATCTACTTTTACAAATATAGATATTGCCTTTTCAGGCGGGGAGTCAACGAA
8   P09   AX00003033   TGCGAGACAAAACTGGTTGCACGCCGGGATGTGTCGCTCCTTTCGGGTATTCA
8   P11   AX00003034   CAGTATGTACACGTGCTTGTCGTTTCTGTGCGGTTAAAACAGGCTTACCAACAG
8   P13   AX00003035   ATTATTACGCTCACTTAGGCGGGTTCTCAAAAGAAATACAGCTTGGACAAATTGT
8   P15   AX00003036   TAGGTCTTTTAAATGAGAAGTTAGGAGATCGTGGTATTATTGCTGGCCGCGCGG
8   P17   AX00003037   TAACTCTGAAAATATGGGACAATTCGAGCGTACGCTTATCATCGTAGACGAAGG
8   P19   AX00003038   GAAGTTTGAAGGAGAAGGATGTTCTATCTCAATGTCTTCAGCTTCAATGATGACA
8   P21   AX00003039   TTAGCGCAATACGCTTTAGAAAGACTATCAGAAGTAGATGGCGTTACAATTTATG
8   P23   AX00003040   AAGTACTTAATGAAAGACGGCGTGAAGGTAGACGAGCATCGTCTAACTGCACTT
9   A01   EMPTY        -
9   A03   AX00003041   AACGAAATGCGTGGCGAAGAATTCGGTTGCCTAATGATTACGCATTACCAACGT
9   A05   AX00003042   CAAAGGATGCAATTGCGATTGAAGGATCAGACTCTCCATACGCAAATATTATTGC
9   A07   AX00003043   TATTGAGCCTGGTTTATTACCACAAGTGTATAACAATAAAGAAGGCGACGCTGTT
9   A09   AX00003044   GTTGGTGCTGGTGGTCTTGGAACACTTGCTTATTTAGAAGGATTCCAACGAGGA
9   A11   AX00003045   AAAAGTAATTCGCTTGCAGTTTATCGGTGAGGCTGTAGAAAGACCAGTGCTTCA
9   A13   AX00003046   TTGGGATGTTAGATTTAAATTATGCCCCGCATTTCGCGAAAGAGTATGGGATTG
9   A15   AX00003047   ACAATTGGTTTGTCGACAATGGATGAGCTCGTTGATCAGTTTTTTGATAAGGAAG
9   A17   AX00003048   GACCAACCAGAACTTGTTAACGAATCTCCATACGAGGGTGCATGGATGGTTAAA
9   A19   AX00003049   GTTACCGTGAACTTGGTCTGAAAGATAAGTTAAAAGATGCAAGTGAAGACGAAA
9   A21   AX00003050   ATGCCATGTATACGCAAGGGTTTGCAAATATCGGAAGTGGTGAAGGACAACAAT
9   A23   AX00003051   CCCTAGCATTCATGTTCTTACTACATTTGTCATTATGCTAGCTGCCTTTAAACGT
9   C01   AX00003052   TCAAGCTCTTTGTACTCCGAAAGTACAGCTGCCAAATATCACTAAAAATCCAATG
9   C03   AX00003053   TAGATACTTTAGGAGCGAGCGCGAAGATTATGGAAAGTGTTGTTGGCGGCGTAA
9   C05   AX00003054   TTAACAAGTTATGCAAATTATATTGCTCAGTCTGATAATGAACAGTTACACCAAAC
9   C07   AX00003055   ACACGCAACAATTATTAACAAGTTGGAGCAGTATGCACAAACGTGTACAGATCC
9   C09   AX00003056   TAACGTTAGCTTCATTAGCGCAAAGGTTAGGGATACGTTCTCCCTCACTATATAA
9   C11   AX00003057   GCGCATGATGATCACATCGGTGCATTAGACGCATTAAAGGAAGTACTTCCTCAT
9   C13   AX00003058   GAAAACGGCGACATGTTACGCATGATGTTATCATCATTACGTAAATTAACTCGCC
9   C15   AX00003059   GAGCAGAGACGACGCTAGATATTTTAGGTAAATTACGTCCAGCATTTAACGTTC
9   C17   AX00003060   GCATTTATCTGGTTACATTTCAGAGTACGACCTTCACATTGCGAAGAAACTTGCA
9   C19   AX00003061   GAATATATGAATTCAACGCGTACAACTCTACATACTTCAGAACGCTCTCCAAACA
9   C21   AX00003062   GAAGCAATCCGTGCAATTGGAAGAGAAGGTCTTGATTCGCAACTTTCTTTAAAG
9   C23   AX00003063   AACTATTACTTGGAGAGAGCAATGAAGAGAGAAAAGAACAGGTACAGAAGTGGG
9   E01   AX00003064   GAGAAAAATGCAGATCGCGTGAAGTATCAATTAACACCAATGAATACAGTTATTG
9   E03   AX00003065   AGGTACATAACATCGGTCACGAGCAAGGAGAAATTACAGCGGTAATGCATACAA
9   E05   AX00003066   TCACAACCTTTCGTGAAGTTCTTTACAGAATTCTTTTATCACGACGTTGCACTTG
9   E07   AX00003067   ATTTTCATGGGGATTAGTGGATCACTTGTACTTGGAGTACCGCTTGGCCTTGTA
9   E09   AX00003068   TAGTAGGAACGATTATTGGGTCTGGTGTGTTTATGAAACCAGGGAGCGTATTAG
9   E11   AX00003069   AAATGTTTGCGGGATTAGATGAACAGGCGAAAGAAAAAGCGAAGTCGATTTTAG
9   E13   AX00003070   ATCAGGCGGTTGGAATCCACTTGCTGGTTGCTGGCCACTATTAATACAAATGCC
9   E15   AX00003071   GTTTTCTTCCTTGCTAACGTTTCTCGCTTTGTGCGTCAGCAAGCATCGAGCGGT
9   E17   AX00003072   GCGGTGGATTCGCTGGCGTAGGGATGATTATCGGTTATTTAATGCACTACAATA
9   E19   AX00003073   ACCACTTCAATTAAGCTCAGCTTTCTTCCACGGTCTATGGACTTGGTTCATTGCA
9   E21   AX00003074   GGCGTTGCAACACTAGTACCACCTTCTATAGAGACACCGAATCTTTCGAAAAAA
9   E23   AX00003075   TGTATTTACGTATAGGTGATATAGTTACGCAGGCATGGTTTGTATATGCAGTTAT
9   G01   AX00003076   ACGATTAGTTTAATTGAGCGCGGGGATTATGCACCATCTATTGTATTGTCGTTAA
9   G03   AX00003077   ATTCTTCTTAATCGGTGGTTACTGGTTAGGTGGCAATTTACATGATATTTTTGGA
9   G05   AX00003078   ATCAAGAAAGCATGATTGGCAAAAGCTACATCATTCCAACGAAAGCTTTTCACTA
9   G07   AX00003079   TAAAAATCGTCCTTATTACACAGGCAAAATTAAAGGCGGCGATCCACGTAATCCA
9   G09   AX00003080   TATTAAGAAGGGCAGCAACGAAGGAAGCCGAGGCTGCAACTATACTACAATTCC
9   G11   AX00003081   CCAAATGGTTACGCACTAGAAGTTTTAAATACAGGTTCACAAATAGATGAAGATA
9   G13   AX00003082   CTTTTTAACAGACGGTGCTTTGCAAGCTGGCCTATGGAAATATGCTTTCTTCCTC
9   G15   AX00003083   TGAGCGATGTTTTCGTAACCTTGGTTTTACGTATGATTGCTATACACGTACAGAT
9   G17   AX00003084   TTCTTACAGAAGCGCAGAAAGAATCGTTACCGAAAACAACCATCCGTCGCTGGA
9   G19   AX00003085   CAACTGCTGAAGAAATGGCTGCAAGTGCTGAAGAAATGAACGCTTCACTGAATA
9   G21   AX00003086   GATGACTTCTATCGGCTGTCCAATGGCTGGGCAAATTGTATCAGACGTAAAAAA
9   G23   AX00003087   GGAACAGCTGATAATGGCGGCGTTCATATTAACAGTAGTATTAACAATAAAGCTG
9   I01   AX00003088   ACCAAACTATGGTGAGTTTAAATTTGATTGGAGTAAGCGTGAAAACGAATGGTTC
9   I03   AX00003089   GCTCAAGTTGGAGGGCATGATCGTTTAACGCAGCAAGAGCTTGGAAATAAGCTA
9   I05   AX00003090   AGCATAGTGACAGAATTGAACATCTCGTTGTTCCATTTAGAGACTTTTTCGGAGC
9   I07   AX00003091   AGTGGAGAAGGAAGCTCCAGCAATCGGAAAAACAATCGGCGATCTTGAAATAAG
9   I09   AX00003092   ATGGGTAGCTCTCCTAACGCAGCAGCAACCTCAGATGTATCTCACCCTGTAAAA
9   I11   AX00003093   TCACAAAACTACACAACTTCCATTGGTACGTAAAAGGACCTCAATTCTTCACATT
9   I13   AX00003094   GCTAATATTTTCAATATACGTATCGAGGTTAAAGACTATGCTTTCCTCATTGTCTT
9   I15   AX00003095   TAATTGAAGTAGAAACGATGCATGAACGTAAAGCGAAAATGGCAGAGCTTGCGG
9   I17   AX00003096   AAGCTGGTCACAGTATAATGCCTTTATTCGGTTAAATTTCTTAACAGAGGAAGTC
9   I19   AX00003097   GGCGATGGCTGCTTACTGTACAGCCGAAAGCTACGATGGATTCGCTAACTTTTT
9   I21   AX00003098   CTTCTTGGATATGCAGAAGCTGGAATCGTTTTCGTATTTGGTGGCCTTGTTAATA
9   I23   AX00003099   GCTTTTGATGGGGCATTCAAAACAGATAGTAGATTAGTAGGTCTTGTAATGGCT
9   K01   AX00003100   ACGTATTCGCTCTTACATCTAATGACTTACAAGCATTCGATGTAGTTGTAAATGC
9   K03   AX00003101   GGAGAAAAGTTCCGCATTTTAGTTCCGAAACAAACACCAGCTGGTGGATTTAGC
9   K05   AX00003102   GTGCTGACGAAAGCAACGAAGTTATCGGCCTATTCGGTCTGTTAAAATTACTAA
9   K07   AX00003103   AAGCACAAGTTACAGTGATTAACCAATACCCAACACACCAAATCATCACTGAACT
9   K09   AX00003104   GATTTCGCTATACTGCGGAGTTGATCCGACTGGTGATAGTATGCATATCGGACA
9   K11   AX00003105   GTCAAAACAACCTCTAGAATATCCTTCATGTGGTAGCGTATTTAAACGCCCACCA
9   K13   AX00003106   TAATCATACGGCAATCCTTTTAGGATACGGCATGTTATTCAATCATTCATATACA
9   K15   AX00003107   GAGGAATCGAATCGTTCTGCGGGAAGAATTCAAGGGATTTTGAAGGAGTTTAGT
9   K17   AX00003108   GTGAAGAAATATGTAGAAGGTGAAAACTTCGTCACGATTATTGATGGCTTTATCG
9   K19   AX00003109   ATCATTCTGAGTGGGGCATAGCCTTCTTATATGTATCATGCAGCATACTTGGTGG
9   K21   AX00003110   TAACGATACATGCTTCAAACAGTAAAGTAGGAGCGAATGGATTTCTTGAAGAACC
9   K23   AX00003111   AGTTAGTGGAAATCGATTATATTCACCGTAGAACGGAATTCCAAATTATTATTGA
9   M01   AX00003112   AATAAATACGAGTTTTTCAATAGCGAAACAGGTCAAAGCCGCGGTGACTATGGT
9   M03   AX00003113   CAAATGATGGAGCACTTGAGACGTGCGGCTAATGAATTTGGAAGAACAATTTTG
9   M05   AX00003114   GCCATAGCTTGTCGACAGTTGCTTTCCAATCCATTACGAATAATAAGATTATTAC
9   M07   AX00003115   TTAATGCTGACTGGAGCTGCAATGGCGATGGCAGGGCTCGTCATGCAACTCAT
9   M09   AX00003116   TGGTTTTGCTGCGCCGCACTCTGGTCGTGTTTGGGGACCAATGTATGAAATTTT
9   M11   AX00003117   TGCAGACAAATACGACTTGTTAAAATGACACCGATCATTATTGTGACCGACAATA
9   M13   AX00003118   CCTTCAAGGAACGGAAATTAAGTCGATTCGCGCTGGACGCGTGAACTTGAAAGA
9   M15   AX00003119   GTATTAGCACGCCTTAGTTCCCAATCGAGTGGTTCGCGTCAAGAAGGTTCTATT
9   M17   AX00003120   CTCAGCTGATGTACGTATGTTAGGGCGTTTCTTAGAAAAGAAAGGCTACACTTG
9   M19   AX00003121   TTTCAGGCGGTGCAGAGCAATTATTTGGTAAGCAAAAAGCACGTGGAATTGAAG
9   M21   AX00003122   CCTTCCATGACACAATGCCAATACTCGCTTTACTTGATAACTCTATGTTTACGTA
9   M23   AX00003123   AAATATGACCTTGCAGGTGAAGGCCGTACTGGCTTAACTTCTGCAGAAATGGTT
9   O01   AX00003124   ACTTTAGTGAAACAGTGGATGGTTACGTGGCATTCAAGCCAATGAACCTTGATA
9   O03   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
9   O05   AX00003126   CTTCAATACATTAGGCTCATGCAGCCGATTGGAAGAAGAAACTTATCAGCAAGT
9   O07   AX00003127   GAGCTAAGTGTGCATGAATCTACAATTAGTCGTGCAACGCGAAATAAATATGTG
9   O09   AX00003128   TGATACGGATAACCAACAAGCGAAGCAACTTTTCCAAACAGCTGCGCAGCAAAC
9   O11   AX00003129   AAAACCTCTTCGTAAGAAGCTTCAAAAACAGCTAAGTGATGAGCATCCTACTTTC
9   O13   AX00003130   GGATTTGGTATATACGATCGGTTTGGTCAGTTTGCCGGAGCAGGAACAGCTGTA
9   O15   AX00003131   CTCCTTATCTCGGACTATTCGGCGCTTGTTCTACTTCTATGGAAGGTTTAGCACT
9   O17   AX00003132   CAACTTATGTTTGATGTTGGAAAGCTAACACCAGCTCATACAATGGCAACACTCG
9   O19   AX00003133   CTTTCTCGGTCAAGTGGATTCATATGGACAACTTACTATCGACATTTATAATGAC
9   O21   AX00003134   CAGGTATGGCAATTTACGATACAATGCAGTTTATTAAACCGCAAGTATCAACAAT
9   O23   AX00003135   CCGGCTGCGTTGTTTGTACAAGAGGCCAATCGCTTTCATGCAGATATCTTCATC
9   A02   EMPTY        -
9   A04   AX00003136   ACTTTTGAGATTTGAAGACATTCGAATCGTACGTGATATGCGTAATTCTGTAAAT
9   A06   AX00003137   CAGGTGACATTCGTAACGTACTTGTTGCGTTATCAGATGTAGAGCCACTGGTGG
9   A08   AX00003138   GATTTAGGATATTTCTGTGTAGATAATTTGCCACCGATGTTATTGCCGAAGTTTA
9   A10   AX00003139   AAAGGGGGTCTTCACCTTTGTTATCCAAGAAGGTGATAAAGTTGTTTCTGAATGG
9   A12   AX00003140   TCTTTAGTCGTGAATGGAAAAAACATTTAGGATTTTTAATTCCACTTGCAGCTGG
9   A14   AX00003141   AGAAAGAAGTCAAAACTGACGGCGTATTCGTATACATCGGTATGTTACCACTATC
9   A16   AX00003142   AAACGTCAAGGATACGAAGGAGACGTTAGTTTTTATTATTGGTTTGCATATTCCG
9   A18   AX00003143   TTGTACCGCACATTTTTGCGGATGAAAGTAGGAAAGAAAACATCGTTTGCGCTT
9   A20   AX00003144   TCAAAGCTTGATGAGTTTTTTGATGTTGTCGTGACAATTGATGATGTAGAGCATG
9   A22   AX00003145   TTTTCGTAGAAGGGTTACGTACAGATAGTTTAATGCTAGGACCGCTTCGTATTGC
9   A24   AX00003146   CTATCAAGTCGTTTAACAAATTATTTAGAAGGTAAGTTAGCGCCAACAACTGCCG
9   C02   AX00003147   TAAAAGGGATTGCACCTGACGCGTTTTACGTAGCAAATATACAAACTGCAATTAT
9   C04   AX00003148   GAAGCGGAGAACGCGTTTCATAATGAAGTGAAAAAGGATTGCTACATCTTCTAT
9   C06   AX00003149   GTTTTTCAATTGGAGAATTAGAGCCGCGTATGTTCTCATTCAATAGTCCGTTCGG
9   C08   AX00003150   CGTCACTCAGCAACGTCCGCATTATTTGAACGGGATGATGTAATTATTGTTGCG
9   C10   AX00003151   CTATCGGTTTCTTTTTACTCCGTTACGGATTTCGTTTGAAAAAGGCGAGTTTTAT
9   C12   AX00003152   TTTATTCGGTAGATGTGGAAGGAGAACTCGATTGGAAAGTTATGTTTGAACTGA
9   C14   AX00003153   ACATGCTTATCGCAATGGCGATGGCGGGACTTGGTTTAAATGTAGAGTTTAAAA
9   C16   AX00003154   GGACACTCCAAGATCAAGTATGGGTATTAAGAGAAAGTGGTTCTGGTACACGCG
9   C18   AX00003155   AGAAAAGGGATTACTCCCTTCTAAGCGCCTCGCAAACGGCTACCGTGATTTTGA
9   C20   AX00003156   AAAAATGTATGTTGTCATCGTTGGCGGAGATAACCCAAAGCTAAAAGCATTACCG
9   C22   AX00003157   TTTCATTAGCCATGACCGTGCCTTCATTCGTTCTGTTGCAGACCATATTCTACAA
9   C24   AX00003158   TAGTTATATGCTTATGCGTCTCGTAACGCTCTTTGTCTTAATATGCGGTACATGG
9   E02   AX00003159   TAACGCAGTTTATTTCATGGTGGCCTGTCGTTTCAATCGGTTCTGATACATATTC
9   E04   AX00003160   ACAAGGCATGTTGTCTACGCTGAAGGACCCTTATTCCACGTATATGGATAAAGA
9   E06   AX00003161   GCGGAACAATTTTCGAACTTCTACCATATAGTCCGTTCGTATTCCAATTAGCTGG
9   E08   AX00003162   AAGAAGAGCCTGATGCAATTCGTGAGCGTGTAACAGAAGTTTTAGGTCTTGTAG
9   E10   AX00003163   TAAAGGCGTACGTCATAACATCTTAAATGCGAAAAACCATGCGCGTGAAGCGGA
9   E12   AX00003164   ACATTCCCAGAGATTAAAGTTAATTTAAAAGTATACTCTGACAAGCAACGTGTCG
9   E14   AX00003165   CAGCTTGTTTGCCTGTCGAAATTTCTTATCTATCATTAAGAAGAAGGGAAACAGA
9   E16   AX00003166   ACAACAATACTTAGGTTTACCATATGTTTGGGGAAGTGCATCTCCATCAAACGGT
9   E18   AX00003167   CGATCGTATGTTATCAGAGCGTTTAAAGGAATTGGAAAGCGAAGGCATTGTAGT
9   E20   AX00003168   AGCGCGCAAGCTTTCATCGGTAGTCTGTTACAAGTAAAGCCGGTTTTATATTTTA
9   E22   AX00003169   CGTGCATATGGAAAATGTACAAGCGAAGGCATTAATCATGTCGGTGTTGTCGAG
9   E24   AX00003170   TTCCTATTTCAGATGGCCTTGCTCTTTACAATAAACTCTCTGGATTTGATCCTTC
9   G02   AX00003171   AAAAACCTATTTCAGCACCAGATAAATCGCATTTACATCACCGTTTACTTGCAAT
9   G04   AX00003172   ACTGGAAAAGCTATGACAATCCTTCTGCCATACTAGAAAGAGTACGTAATCAGAG
9   G06   AX00003173   CAGCTACTACTCGGGCAGTTATTTGGGATTAAAAAAGGAGCTTATACAGGGGCA
9   G08   AX00003174   AAAAAGAAAATGGATGGATGAACGGAGCTATGGAGATTTAGTAGCACTAAGTCA
9   G10   AX00003175   ATTATGGTTCATCCAGCTTATATTGATCCAGAGCTTGTGAAGCGTTCTTCTTACG
9   G12   AX00003176   AGACTTTATTCGTGGCCTTCGTGCAATTCCATGTCCATATCACCGTTACTACTAC
9   G14   AX00003177   GCGATGGAGGCACTTCAATTTGCCAAACAGGGGAAAATGGCAGAGGCTGATGA
9   G16   AX00003178   ATTACTTGTAGCAAAAAGTGCACAATTACGCGGTGTATCTCGCTTATCAATTGGT
9   G18   AX00003179   GATTAACTGTGAAAAGTTATCATACAATCGTTCCTTCTTTCGGAACTGACTGGGG
9   G20   AX00003180   GTTGTTCAATGGAAGCAATTGATTGCGCGAAGCGTGGGGAGTTTACAGAAGCAG
9   G22   AX00003181   ACCACTTAGTGTACTTGGTGCTAGTCTTTGGGGCGCAATAATAGCAGTTATTCTC
9   G24   AX00003182   ATCTTTCATTATGTACTACGCTCCAATTGGACTTGCTGCTTACTTCGCAGCATTA
9   I02   AX00003183   ATGGTGCTTATTTAGCTCACTTTTTCTTCTTGCAACTATGTACAAAGTTTCTTTCT
9   I04   AX00003184   AAGAAGCAGGAACAAGCATCGTCCTTCACGATAAAGCGTTAATTGCAAAGATGC
9   I06   AX00003185   TTTACAATCAGGGGTTAGTGAATTAAGTGCTGGTACAAATGAATGGGTGAACGG
9   I08   AX00003186   TTTGGGAGCCACTTATTACAGAAGAAATTTTCTTAGTCGTCCCTTCAGGCCATCG
9   I10   AX00003187   AATTGTATGACCATATGTCCACATTCCGAAATGACAACGTATTTAGTAGATATTA
9   I12   AX00003188   GGAACAATTGTCGGTGTGCAAATCTCACTTCTTTGGCCTGGTTTTGCCAAAATTG
9   I14   AX00003189   GGAGGTAACAAATACGTTTCTCGTCTTTGTCGTTGTCGCATTTCTTGGCTTCTTT
9   I16   AX00003190   TCGTTCTTCTCATCTGGAGATGGTACTACTTACGAACAAATCCTGTCGACATTTT
9   I18   AX00003191   ATTCCGTTGGCGCGATCAATTTAATTTATCTTTAGATCCTGAACGCGCGATGGAG
9   I20   AX00003192   ATGGCAGCGACCGGATATGGTTTCTTATACGGATTATGGCCAATTGCTTGGATT
9   I22   AX00003193   TCGGTCATTTATGCAAGTTTATTATTGTTTTACGTTTTGCAGAAACCGGATGTTC
9   I24   AX00003194   ATTAATCGATGAATACAATTCTGGTGATGGCGTATTTGACCGTTACATGGTAACT
9   K02   AX00003195   TTAATTTTTCTTACGAGGGAATTAAGTTCGTTGCTGGGGATTTAGTCAACGCAAA
9   K04   AX00003196   AATGAAGCCGGTGCTGACATTGTAATGAACCGCCTAAAGCCAAAAATGGAGCAA
9   K06   AX00003197   CTATGTTATTTAGTGCTGGTATGGGTATCGGCTTAGTCTTCTGGGGCGTTGCGG
9   K08   AX00003198   AAAAATCACTTTAGATGGTAAAGACGCATTCGTAAGTGCAGAGTTCACAAAAAGC
9   K10   AX00003199   GAAAGTATTAAAATTGGAGACCAAAGCACGTATTACTTAAAATTCCCGAAAGAAA
9   K12   AX00003200   CCTGTTAACGTCGTTCGTATCTTTGTAGATAAAGTGGAATCCATCGTTCGGGAC
9   K14   AX00003201   TGGCACCGACATCTGTTCTTGGAAATTGGCAAAAAGAATTTGAACGGTTCGCAC
9   K16   AX00003202   AGGCGGATTTATTGAGTTTTTCCTTCGTAAAGGTGCTCATTTTATGGTATTCTTT
9   K18   AX00003203   TGCACAAGTCGTAAATCAAGTAATGGATACGATCCTTGCCTCATCTGTATTTTCA
9   K20   AX00003204   GTATTAGATGAGAAGGAGAAGTATATTATTTTTGAACGTTTTTTTGTAGGAAAGA
9   K22   AX00003205   ATCGTTTCCACATTCGCAAAATGGCCACCACTCGTTTCATGGGAAGTTGTCGTT
9   K24   AX00003206   CGTCCAACAGAAGGCGAATATATGCTGAATGATGTGAATATCTTAACAGCAGAC
9   M02   AX00003207   AATATACATATAAAGCAAGCCTTGATAGTCAAGATGGTTTATCTCCAGGTTATCA
9   M04   AX00003208   TCTTTCCCTATGTAGGTTCAGAAGAAATCTCTATTTCTTTATTTGATGTTGTGCTT
9   M06   AX00003209   CCACCTTGTAGTATTGTTATGACGAAATGGTTCTCGAAGAAAGAGCGCGGTACG
9   M08   AX00003210   GAGCAAACAGGGTTATCTGTTAATGCGATTTCGAAACTAAAACGTGCACCGAAT
9   M10   AX00003211   GAGCGTGAAGACATTCTTACTATTTCTGTGTATCCATCGTATTTTGTTGTGCAAT
9   M12   AX00003212   GTTACGGTTTGTATATTTGTCAGGAGATTATGGATAAGCAGGGCGGAAGTATGC
9   M14   AX00003213   TTTATGTCAGTTGTTTGTTTCTAATCCGCAGCGTGTATTTATGAGAGATGAGTTA
9   M16   AX00003214   CGATGACAAATCCAACGAATACGTATGGAGAAACGAAGTTAGCAATCGAGAAGA
9   M18   AX00003215   GCGTGGTTTAGAAGGTTTGGATAAAGTAATGAAAGAAGCAAAGCCGGATATCGT
9   M20   AX00003216   GGAGGTACAACGGATATCGCTGTACTATCTATGGGTGATATTGTTACCTCTTCC
9   M22   AX00003217   GGTAAGTATATCGTGGAGACAAGAAAGACAGTGCGTGTCATTGCAAAGGAATTT
9   M24   AX00003218   TTGCTTGTGCAGCGGTAATCTTAATGGTTGCGCTATGGTTCCAAGGAGCTAATC
9   O02   AX00003219   AACGACGATTTTCTTAACGACGCACAACATGGACGAAGCAGAAACGCTTTGTAA
9   O04   AX00003220   AATCATTACCTATGGAGGAGTATGTGACCGGTGTAGTAGCTTCTGAGATGAATG
9   O06   AX00003221   AATTGGTTCACGTCCAATTGACCAACATTTAAAAGGCTTCGAAGCAATGGGAGC
9   O08   AX00003222   AAGAGCATTTGTGTCAGTCTCCGCATACAATAAAAAGTGGGATGACGCTCTTTC
9   O10   AX00003223   CTCGGGGCTGCCATCCTTCTTTCCATATGTGATTTGTTTTTTAAGCTGAACCATA
9   O12   AX00003224   GGGAAGTGGGGGAAATTGTCGAGTGAAAAGGCTGCTTATAGTTATTTAATATAT
9   O14   AX00003225   GGAAGTGTCATTCATGCCGTGCATACGCAAAACATTAATAAAATGGGCGGCTTA
9   O16   AX00003226   ATGTTAACGAAACATAACGCGGAAAATGAATCACGTCTTACTCTTCGAAAATGGA
9   O18   AX00003227   TTTGTGATTTATGTACAGAAGTTTGTCCGACAGAGGCAATCGTTATGACAAATAA
9   O20   AX00003228   AGCAGAATCGGAACTTGTTTCTGGATATCATACGGAATACTCAGGGTTTCGCTG
9   O22   AX00003229   GGATGGACTATTTATCGGCTATGACGAATAATTACGTCATTTGCCATGCTGTAGA
9   O24   AX00003230   ATGAAGTAATGGAGTTACTGCGATTCCATGAGGGACTTGCATTTGATTATATGTC
9   B02   EMPTY        -
9   B04   AX00003231   TACATTGGAACAGTTGAAAGGATGGGCGCGAAGTAATTCTTTATGGCCGATGAC
9   B06   AX00003232   GATGCTGCGCCCAAATAAACCAAGTGCAGCGAAAGCGACGACGTATGAGAGCG
9   B08   AX00003233   GAAATTGAAAATCAACATTTACAAATCTCACCGAGCATCGGGATTGCCATATATC
9   B10   AX00003234   AGTCGTCGTATGATGGATGGGCATAAGATGGAGTATTTCATTTTATGTTTAAGCT
9   B12   AX00003235   AGAGAGTGGGGAAATGGGGATTTTACCAGGTCACATTCCAACTGTTGCACCATT
9   B14   AX00003236   CTTACATTAAGGGTGGTAAGATCGGTCTATTCGGTGGTGCCGGTGTAGGTAAAA
9   B16   AX00003237   AATTAATCATCCAATGCTAAATGCGCGCCCTGTAAAGCGTACAGGATACATCGT
9   B18   AX00003238   CACTTCGTCTTGACCTTGCATCTTACCGTGAGTTAGAAGCGTTCGCTCAGTTCG
9   B20   AX00003239   GAACATTTCAAAAGAGCAGAAGAAGACGTTTCTTGCAAACGTATTCGGATCTGT
9   B22   AX00003240   TCTTACTTCTATTAGTAATGCTACGCAAATTTGCGTGGGGTCCTTTAATGGGAAT
9   B24   AX00003241   TACAATCGAAGGTGTTGCTCGTCAACCAGAATTAAAAGGCGCACTTCAAACAAT
9   D02   AX00003242   GAACTCGCAGCTTAGCTCTTCGCCCAACAGGAATGCAAAACTTCATGGAATGGG
9   D04   AX00003243   TGCTAGGATGGGGATTCACCTCTTACAAGGATGTATTTCTTGGACTGATTATCG
9   D06   AX00003244   AGCTTATGCTTTAATGTCAGGTATTCTTGCTCAGTTAGTCGGTTCTATTCTTGTT
9   D08   AX00003245   AACTTCCAACGGATGTAGAAGAGCGTGACTTTATCGTACTAGATCCGATGCTAG
9   D10   AX00003246   TCTCATGGTGGTCACTTAACACACGGAAGCCCTGTTAACTTCAGTGGAGTACAA
9   D12   AX00003247   ACAGTTACGCCTGTTAGATCAGCAGGTGGTGCATTAGCAACATATGCTTATCAC
9   D14   AX00003248   TAGCAATGGGCGAGCGTGTAATTGGTGCTGGTCTAGCACGTGACATCGCAAAA
9   D16   AX00003249   ACCAGATCCAGTATTCGCTGGTCGTATGATGGGTGACGGTGTTGCAATCGATCC
9   D18   AX00003250   GGTGCTCAAAAATTATTTGGTTGGTTCGGCGGTTATGGTTTAAAAGGAACAGGC
9   D20   AX00003251   ATGGAGCACCATATAGTTATTTCAATATTGTCGCTGCTAATCCGCCACTTATCTC
9   D22   AX00003252   TGCTCGGTGTACAAATGTTTGCTGAGTTTTTAGATATTGAGTCATTGAAGTTTGT
9   D24   AX00003253   TTTCAGTAGGGCTTAGTCTTGGTATTTACGGGGCACAGACAATTATTACGATATT
9   F02   AX00003254   TTGTCCACATCGGGACAAAATCGCAGTTAGATGGGATTGTGAAGGAAATTCCAC
9   F04   AX00003255   AAAAAAGATGATAAAATAAATGAGTTGTACGCGCAATTTATGATTTTGGAAGAGG
9   F06   AX00003256   TACAATTGGGGAAGGAGAAGGGGCAAACTGGTGGTGTGTATTATTTCCACCGAT
9   F08   AX00003257   TGTTGGTGGTGAAGACGGATTAGATTTCTATCGCCGCTTTATGGAAGAATTGCC
9   F10   AX00003258   ACGGGTGATCGTTCAGAGCGTATTCGTACGTATAACTTCCCGCAAAACCGTGTT
9   F12   AX00003259   ACATGTAACAAAACTACAAGCTGTATGTTCTGCATGTGGATCTCCGGCAAGTCG
9   F14   AX00003260   AAACACAGGCTTCAAATTCTTAAGCGGATCTACTAAAGGATCTAACGAAACTGTT
9   F16   AX00003261   GGAAATATGGAACTTCACTTAGATCGTTCATTAGCTGAGCGTCGTATCTTCCCG
9   F18   AX00003262   TGAGGCAGACGGTGCAGCAACATCAGCTATGCGTGATGTATTTGATACAATTCC
9   F20   AX00003263   AAAAAAGCTGTTATTGGGCTTCCAGGTGGATGTCACTTAGGACCGAGGCCAATT
9   F22   AX00003264   AAGGCGTAATTTACGCTGACCCAGCTGAGTGTAAGCACCTTGTTGAAGCAACAG
9   F24   AX00003265   TAATGACTGCTTATGGTGAGCTTGATATGATCCAAGAAGCAAAAGATTTAGGTGC
9   H02   AX00003266   ATATACAGATGTACATATTGATACAAAGCTATTAAAAGGTCTTATTCCAGACGAT
9   H04   AX00003267   GCGCAGAAACTGACTTAGACCTTGGTCACTATGAGCGTTTCATCGACATTAACT
9   H06   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
9   H08   AX00003269   GGAAGAAGTATTAATCATGTATCAAGAGGTACGCTTTTTACCGAAAGAATCACTC
9   H10   AX00003270   TTGGTTTAACTGGTATTCCGTGGCCTGAAGAATACGGCGGAATTGGAAGCGATT
9   H12   AX00003271   TGTTCCTAGTATGGAACAAGGGGTGTTCCCAACAGAGATTTTGCAGAAGATGGG
9   H14   AX00003272   TCCAGAACACGCAATTTTAGCGACGAATACGTCATCCCTGCCAATTACAGAAATT
9   H16   AX00003273   TACAGCAATTGCAGTGGAGTCTAAAGATTTCCCGAGGACGCCAGGTTATGCAAT
9   H18   AX00003274   AATATGTGTCCGGCAACAGGAACAGGGAAAATGTTATCGCCGATGGATTTAATT
9   H20   AX00003275   TTTGCGAGGAACCGTTAGAAGAGTTGCTTCCTGCAATTTTTGAAACTTGGTCAC
9   H22   AX00003276   AGCGAATGAGCAAATTAAAGACTTAGTAAAACGTGAAGAACGGCAGCGGATTGC
9   H24   AX00003277   TCATGTGGAGTTAACGGTAGGGCAGTGGATTGGTGCTGGATTATGGTTATTGTT
9   J02   AX00003278   GCAGGAAATCCAGACTTGTTATTTTTAGATGAGCCGACAGTTGGAATGGATATT
9   J04   AX00003279   GCTTACATGAAGCACCAAACCATATTTTAAGTTACTTTGACCCAATGGATAATGC
9   J06   AX00003280   GAAACTACGGACAAACTTTCAATCCCCGCCTAACGAAAAAGCAATCTATCCCTG
9   J08   AX00003281   GTTTATGACTCAAATCATAATCTTATTGGACGTTATTCTGATGGTTACGGCCGCA
9   J10   AX00003282   CAAGGGGAGACAGGTTACGAGGCGAAATTCTCATCATGGGATATTGCCGGTAA
9   J12   AX00003283   TTTTCATCGCGGCACCAACTTTCTTACGTGGAGAATTATAAAAAGTGGATTACTA
9   J14   AX00003284   GACGGTTCTTACACATACTTAACGCCAGATATCGCATATCACCGTGATAAATTAG
9   J16   AX00003285   CTTATTATGCGTTCAGGTGCTGTTTCGATGCGTCAGACGCATGTGAAAGGTGAA
9   J18   AX00003286   ATGCTTAACTTCTAATAAGCCTATTGAAGTCCTGCCATCTGAAACATGGAGCGAT
9   J20   AX00003287   GAATGATGAACCGTGAATTGCATACGGGTGCTTTTATAAAAATTTATGCAAAAGG
9   J22   AX00003288   TTCCAGCTCGTTAATAACGCACCAGGAACAGCATCACCAATCCCAGGACTTCTT
9   J24   AX00003289   AATATGTATCAAAACTTTTAGATGCCGGTAAGTTTCCACTAGGTCTCGGCGGTG
9   L02   AX00003290   CAATTACTCGTTTATACACAGCGAACATTCCAACTTACCCAAGTGGTCTTTGGAC
9   L04   AX00003291   TAGGCGGGATATTAGGTGGACATTCTTGGCGGTATCCATTTTTCGCAACGAGTA
9   L06   AX00003292   TTAAAAGAAAGAATGGAACAGAGAAGAAATAGCGAGAATCCTCGTGATCGTGAA
9   L08   AX00003293   TCTTGCTCTCGGCACATCTCCTGTAAAACCAATTGAAATGGTTAACGCTTATAGC
9   L10   AX00003294   TATAAGTCACTTCCAGAGCACGTAAACAAAATGGATAAATCATTGAAGCGTCACA
9   L12   AX00003295   CCAACAAATATTCGTGCGAAAATGACACAGTATGAAAAATACGGGGCGATTGCG
9   L14   AX00003296   AAGCTCTTGCTGAGAAAGTAACAGCAGCAGTAAGCGAAACAACTGGTGCTCCTG
9   L16   AX00003297   ATTTCAACGCTTGCGCCGTATTAAGCAGCTTGGAACGACATTTTTTACATTTCAC
9   L18   AX00003298   AGACGTAAAACCAGTTGGTTCTGCTTGGGGCGATAAAATTAACATCGAAGCAGT
9   L20   AX00003299   TGTTATGGTTATCCATGACTTAAACCATGCTTCTCGTTTCTCAGATCATATGATTG
9   L22   AX00003300   CTTCGCGTTAGTTGGAGCGATATTAGCAGCGGTTATTATTTATTTACTAGCATGG
9   L24   AX00003301   GTTGATTCCAAAGTTAAAAAAAGTAGATTCATGTGCAACGATTGAAGTTGGATGT
9   N02   AX00003302   TACATCGGCTGCCTGTGGTTTCCGTTGGAATGCTGTTGTTCGCTATAGCTATGA
9   N04   AX00003303   GACCAACATTCCATGCACTTCAATCATTCGCAATGGATGATACATTATGCACAAG
9   N06   AX00003304   AAGGTAAAGCAACAGAAGAAGACGCTCGCAAAATCCTTAAAGACGAAAATTACT
9   N08   AX00003305   GCTTCTACCCAATGGACAAGCGTCGCCAAGGTGATGACAACTGGTACATGCTTC
9   N10   AX00003306   AAAAGGAAAACATCCTGAGGGTACTGATCCAAATGCAGAAAACTCTATGTCAGC
9   N12   AX00003307   TGCTGAAGCCGAAGGAGAAGGGCAACAAGGCATGTTAATGGTCGGAAATGTTG
9   N14   AX00003308   ACAAGCAGCTCAAGCTGCGCAAGCCCAATATGCAATTTCTCAAGGCATGTTACC
9   N16   AX00003309   ACTTTTAACTACTGCTGGTTGGCTTATGGTAGCTGGGATTATTATGTTCTCAGGT
9   N18   AX00003310   TTCAAGAAGGTCCTGCAGGCCTTTGGTGGGGAATTTTCTCCCTTTATGCAAGTT
9   N20   AX00003311   AAGGAACGAGCTTAAACCAATTAATCCAAAAGCTTGGCATTAAGCGTGAAGAAG
9   N22   AX00003312   AATTACAGGCATGGCTCACGGCATTCTATTTATTCTATTCATCTTCGCAGTAATT
9   N24   AX00003313   GGACAAGACCCATATCATGGGCCGAATCAAGCGCATGGTTTAAGCTTTTCTGTA
9   P02   AX00003314   CTGCTTCTTGTAGGTGTGTTTGCATACATATTATCAGGGCTTGTATTTGGATACT
9   P04   AX00003315   TTCAGGGAAGCGATGCGTCAAATTGGGAGTATCGTTGAAAACCCAGAACTGTAT
9   P06   AX00003316   ATAATCCTTTTGAAGATGTAGAAGATTTAAAGGGGTCTTCAAACATTGTTGTAGA
9   P08   AX00003317   TTGATGGGGTTATTATATGTTCCCGGACAAATAGTAAGGAAAAGCTTGAAGAATA
9   P10   AX00003318   ATATGATGACGACCATTACTTCCTTTGGACTTAGCCCTTATGATTCCTTCTTTATT
9   P12   AX00003319   ACCCTTGGTTTCTCTACAAATGTAGAGCTTGGAGATGTCAAGGTAAAAGGGATT
9   P14   AX00003320   GCAACATGTGAAATTGTTACAAGGGTTTGATGAATTGTTTTTCGCCCCGCATTCT
9   P16   AX00003321   GTGAAAATGCTCTCGCAGTTGCTAAATGGCTTGCTGATCATGAACGTATTGAAT
9   P18   AX00003322   GAAGAAGGGCTCATTATTGGGGATTCGTTAAGCGCTGATATGAGAGGTGGATAT
9   P20   AX00003323   TGTTAAATATGTAGCAAGCATGATGGGCTTCTTCGGCGCAACAAACATGGAAAC
9   P22   AX00003324   TATTGACTAGCTTTTCTGATCAGGCGCATGTGTTACCAGCATTAAGGGCTGGAG
9   P24   AX00003325   GTAACGATGGATCCACATAACGGTTGGGCACATAACGTATTCCCAATCCCAGCT
9   B01   EMPTY        -
9   B03   AX00003326   GCAACGATAGATGCATTGACAGGTTTAGGAAACGTAAGGCAGTTTGATTTAGAA
9   B05   AX00003327   ATTAATGCCGTATGGCTCTTAGTAGCTGCGGTATGTGTGTATGCAGTTGCTTAT
9   B07   AX00003328   AGATGTATGGGCTGGAGAGGTAAAACGTGCACCAAAATGGATTCAAGCGATCCA
9   B09   AX00003329   GTGTTTTTACAGCTATCGGTGCAAATGCGGCAATGTCACATCATGTTGACGCCT
9   B11   AX00003330   ACAGGTACATCATTAGCTACAACATCGGAAGAAAAAGCAAATAAAGGTAAAGAAC
9   B13   AX00003331   GCTGCAAGGCATAGTCGTAAACATTGCGTAACAGCATCTATCGATTCTGTTGAT
9   B15   AX00003332   TGAAGTTACAGAGAAAATGGGAACTGCTACACCAGAAGAATTGGAGGAACTTCT
9   B17   AX00003333   CTAAGGGTGTAAATGCGACATCAGTGCAGGAAATTGTGACAGCTTGTGGCATAT
9   B19   AX00003334   TAGTAAAAGGCATGATTGGCGAGATGTTCTTACCATTCGCCTTAACTATCGTCTT
9   B21   AX00003335   TTATACCGTAAGGGCTCAGGGCGAGATGCATTTATTAAGCAACATTGGCCAAAG
9   B23   AX00003336   GAAGTATGTAGGACAAGGCGTTGACATTTTGTATAAATCGATTACGAATGTTGG
9   D01   AX00003337   AGATACAGCAGTAATGAATTCAATGTTACCACAAGCAGCAACAACAGCAATTGCG
9   D03   AX00003338   ATTTACCAATTCCAATGCCCTCATCGGTAATCGGGTTAGTCATTTTATTTAGTCT
9   D05   AX00003339   ATGAAAAATCCACCTGCAATTGTATTTGCGACTGCCTATGATCAATACGCGTTGC
9   D07   AX00003340   TGAAGGCTGTCCTTTGCAAGCGGCGATTGTTATTCCGCTAACTTCACATGGAAA
9   D09   AX00003341   CTCATTTACTTCTTCTTATTCACAGATTCAACATTATTGTTATGGGGCAGCGCAT
9   D11   AX00003342   GTAGTGACAACAGGAGATTCAATGGCGTATTCGATTTCAATGGCAGTAACTGGA
9   D13   AX00003343   ATCATGATCGTTATAATTTACTGCCCGCCGTTGCGGAGATGATGGATCTAGATA
9   D15   AX00003344   ATTATTGTCATAGTCTTTTTTGGGAAGTAATGAGCCCACGGGGTGGCGGTGAGC
9   D17   AX00003345   TTGTGGGTGCACTGCAAATTATTATTCCGTTCTATTTGATCATGATTTCTGACCA
9   D19   AX00003346   AGGCATTCTTTATACAATTGGTGGATTTATTTACGGAACAAAGCCAAAGTGGTTA
9   D21   AX00003347   AACGTCGAAAGCTTTAAACAAGACATAAATAACCGTGTTTCAGAAGTAAGTGAGA
9   D23   AX00003348   CGGTATACCACTTTGTGAAATGGTAGAGTGGGAAGAGAATAAACCACAAGCGTT
9   F01   AX00003349   AAAGTTTGTATTACTAAAATTAAAACAGGATTTGGAACTGGCGGTTGGCAACTAG
9   F03   AX00003350   AGTATTAGGACTCGATCAAATGCTGTTCTGCGACTTACATGCACCTTTAGATCCC
9   F05   AX00003351   TTTGATGGACACCCAGGTTCGCAAGATAAAGAGGGCTATGTAAGAAGTATACTT
9   F07   AX00003352   TCACTTGGACTAAGTTCAGAAGTAATGAAGCGTTCAAATGAATCTCTTTCTTTTT
9   F09   AX00003353   GATGAGTGTGAAGTCGCGCCAGTTATTAACAATGTGGATAACTCAGAAAAAGAG
9   F11   AX00003354   AAGCAAGTGGAAGTAATATGGCCGAAGCTCAAGGAATTAAACAGATTAGCTTTG
9   F13   AX00003355   TTACCGCATCTACTTCTAATAACCAAGTACTTGCTTCAACGTGGAATTTAAAAAC
9   F15   AX00003356   GATGGGTTAGCTGAATTGAGACAAGTATGGGGATCAGAAGAAGTAATGGAATAT
9   F17   AX00003357   CGAATGCATTAAAGTATTCACCAGAAGGTGGAACAGTAACATATCGTTTACGTG
9   F19   AX00003358   CTTACACACCGTGAATTTGAGCTGCTGCATTATTTAGCAAAACATTTAGGACAAG
9   F21   AX00003359   GAAGAGTACTTCGAGTACGGACAGCAAATCGCACAATATGTATGTGATACGTCT
9   F23   AX00003360   AGAAGGTGGCCGTCTATTTGGTTCAATCACAAGTAAACAAATCGTAGATGCAAT
9   H01   AX00003361   GGAATTAGCGGCAGGTCTTTAGGTGAAGTGAATGTGCAGCTAATTATGGAAAAT
9   H03   AX00003362   CAAAGGTTTTACGAAAGGGGTTCCTATTATTAGTTTTATTGCCTGCATGTTTATT
9   H05   AX00003363   ACGTTTCGTTTCTGAGCGTGGTAAAATTTTACCTCGTCGTGTAACAGGAACAAG
9   H07   AX00003364   TGCGGAAAGCGTACAATTTTTAGAGCCGCGTAATGGCGGTGGGGAGCAACGTG
9   H09   AX00003365   ACACGAAAGAGTGGGGTAAGCGTCGTTTAGCTTACGAAATCAACGACTTACGTG
9   H11   AX00003366   AATTACACAAGCAGGAGCAGAATCTGCGAACTATCCATTCTGTACAATTGATCCA
9   H13   AX00003367   GAATCGTTGGAAGATTATTCGTATGGGAATGGATATCCGCATTAAGTGCGAGGG
9   H15   AX00003368   CGTATGGGAAGTCGTTCGCCAATTCAAATTTCAGAACGTCGTACAGTTACAGTA
9   H17   AX00003369   GTTTTATGGAGTTTTTCGTTCTACAAAACACAAGATTAAGTTTAGTCATGAAAATG
9   H19   AX00003370   CCTTCTTTTGTTCAAGATATGATTGCAAATGGTCAACTTTCAATGGCTCATGGGA
9   H21   AX00003371   AATCTAGCAATTCAAGGTGTATTGCTAACAATGTTGGATGCCCGTACAAATTTAG
9   H23   AX00003372   ACGTGAGGAACTAACAGCAATCGAGGAAGCTGTGGCGTATCAAAAGCTAATTGA
9   J01   AX00003373   TCAATTTGTGATGTTGGCGCAGGAGCTGGATTCCCAAGTATTCCTTTAAAAATTT
9   J03   AX00003374   TAGACAGAAATTGAAAGATGTTCGTCCGCTTTCAATGGGGCAAGCTTCACGTAT
9   J05   AX00003375   CTGATATTGCAGGAACAACTCGTGATGTTATTGAAGAGTACGTTAATGTGCGTG
9   J07   AX00003376   GGTTTATTTGGGAACCGACCTGCAGTAGTAGAAGTTGTATTGAAGAAAGATCCA
9   J09   AX00003377   TCCATTAGCAGGATGTTTACCAATCTTTGTTCAGATGCCTATTTTATTCGCGTTT
9   J11   AX00003378   TGGAAAAGATTTTGTTATAATAGCAAGGAAGCCTTGTGCAGAGATGACATATGAA
9   J13   AX00003379   GATCAACAAGAAGATGCGTTGCAACGTGTGTCGTATAGCTATGCGGATGTTTTA
9   J15   AX00003380   TATGATGTTGTTCAGAAAGAAGGATGGGGCGGAATTCGTGCGAAAGATGCTGG
9   J17   AX00003381   GCCTTTTGGCGTGGGGCTATTATATTAACAATCGCAAGTTTTGTTACAAAGGTAT
9   J19   AX00003382   GTAGTCGTTGGTCATAAACGTACATTGGAAGCAATCAAAAATGGTATAGTTAAAG
9   J21   AX00003383   TTCCTCGAGACAAACGCGTTGTTATTTCTTTAACTTACGTATTCGGCATTGGTCG
9   J23   AX00003384   ATGTTACGTGACTTAGCTACTGATTTAATTATCAACGAGCGCATCCAAACGACAG
9   L01   AX00003385   GTGGACAATACTATTTGCAGTTATGGCAACGATTGATTTTAATTTGGCACTTCGC
9   L03   AX00003386   AAGCGTATTAGATCCACAAGGAACAGCAGTAAAAGGAGCACTTCATAGCCTTTC
9    L05   AX00003387   TGATCCTGAATTACATGCAGTCATCGAAAAATGGGCGAATGATGAGTTTCGTAG
9    L07   AX00003388   GAATTTACCAAAGTCGTATATTGAAGAGCTAATTCAGCAAAAGAAAATTCGTGCA
9    L09   AX00003389   TTATAGTGATTGTGAGATTGAACTTGCGCAAAACGGTAATCGTGCAGGAATGAT
9    L11   AX00003390   AACGTTTAAATATGTTCATTGAAGTAATTGATACAATTGAACCTGAAGAAGTAGA
9    L13   AX00003391   TAACCATACGTGGACTCGTCCGAAACATGCAAAAGCGCAAGTTAACGGACAGAC
9    L15   AX00003392   ATCGACGGTCAACCGAAAGCGAAATCACGCTTCGCTTCGAAGCGACCTAACGG
9    L17   AX00003393   GAATTGAGCGCTCTACATTCCTGATTAATAAAGACGGTGAGCTTGTAAAAGAGT
9    L19   AX00003394   AGTTTAAGTATATTAGGGGGTGCCTCTCCTTCTGAAACATCAAAAGGAAAGACA
9    L21   AX00003395   GAAGAGGCGTGCGTATTAGCTGCTAGGCAAGGAAATCGTATGTGGTCTTTAGAA
9    L23   AX00003396   TTTATCTTCTTCAAGTAGAATCGACGTTACATATGAAGGCGTACCGGTATGGATT
9    N01   AX00003397   AGACAAAGCTGGAGAGCAACAATCACCAAAAAAACATCCACCAGGATTGTACTT
9    N03   AX00003398   TGTATGTCATGAACAATTTAAAGAGCATACAAAGAAAGCGAAAGCTATTATTCGT
9    N05   AX00003399   ATCATATTACAACTTTTGAAAGTGCGTGGTGTTTTCAAGAGGGAGAACAGATTTT
9    N07   AX00003400   GATTAGTTTAATTGAGAAGGGCAAATACAATCCGTCTTTAGATTTATGTTTGAAA
9    N09   AX00003401   ACTTTCACTCCTTCTCGGAACTGCTAGCATACTCGGACTTTTCGCCGCACCTGC
9    N11   AX00003402   CACTTTCCGAATTTAAGACTGGAGAGTTTGTACAAATTGAGAAGATACAATTAGA
9    N13   AX00003403   TGGGTTTATAGGATCGTTTATATCAGGAATGGTTGGAATTGGCGGTGCGATTAT
9    N15   AX00003404   GCAGGCATGTCAACGAGTATGGTTGTAAGAAAAATGCAAGAAGAGGCAAAGAAA
9    N17   AX00003405   TTTATGTGCAACATGTTTATCTGCAAAATATAGATTTACGAGCATGGCATTAATAC
9    N19   AX00003406   AGAGTTGTATTTCATGTTCGCCGATTTGTTCCATTCCTATTTGACTTTTTTACTTC
9    N21   AX00003407   CAATAGGAAATTGGGCATCGTTTACAGCTTGCATCGGCATATTTTTCATTTTACA
9    N23   AX00003408   GTTCCTGTTTGGTGAGTCGAAAAGTAAAGCGCGTATCATTAGTGTGGCTCTTAT
9    P01   AX00003409   ACATTGCACTCATTTGGTTTTTAGCATCATTACTTTGTTTACAAGTTTCTTATGCC
9    P03   AX00003410   AAGCAAGAAGAAATTGATAAAGCACTTTCGGCAGCTGGAATGCTTTTTAAGGGA
9    P05   AX00003411   GATTTCGTTCAATTTTCTTATCGACACGATCATGCTACAAAATTAGTTGGTTCCA
9    P07   AX00003412   TATCCGTACTTATGAAGGTAAAAAACTAGAATCGTATCGTACGCATGTGTTATCT
9    P09   AX00003413   GGTATCCTGACCGGAGCTGGCGTTGTCATCGGTAGAAGATACGTCGGTCCATG
9    P11   AX00003414   CTTTTCAAGCGGATGGAAATTGGATGAAGTTAATCGGTTTCATTTGGCTACTTTG
9    P13   AX00003415   TAAGGTGTACAAACGTATGGGATTTGTAGAAGAAGGCAGACAAAGAAAGCAAAT
9    P15   AX00003416   AGTTTTTCAGAAATTTACCGACGAAAACTTGTGCGCACTGCGGGAAAGAAATTG
9    P17   AX00003417   CTTTCAAATTGGAAATGTGGATTATGTTTTTAATAACTCTCGTATTATGCAAATCC
9    P19   AX00003418   CGCGAGTTCAAAGTCGGACAGATTAAAATGAACGGTGTATCATCGTCCGCACTC
9    P21   AX00003419   CTCATACAGTCGGTAATGTAGAATATATAAACAATGAATGGATATTCTTTGATGA
9    P23   AX00003420   CTGGACAAAAAGCGCCGAATGATGGCATTTACGTGGAAATTGGTGAAACGGGA
10   A01   EMPTY        -
10   A03   AX00003421   TTTTTACAAATCGTAATGAAGCATTTACCAGAAGCAAAGGCCATTTTAGATGATA
10   A05   AX00003422   ATCAAGAACAATTACAGCAACAAGGATTTGTGAAGAAAAAGGGATGTAATTGTGG
10   A07   AX00003423   ACAAAATGCGGCAATCAACAATAATAAAACTCCGAAAGAAAGCTTACCAGATGCA
10   A09   AX00003424   AACTCTGTTATTGTGGATATAACAATTATGGAGAATTTTAGAGAACTAGATATGG
10   A11   AX00003425   TCCCTCGAATTGGTGAAAAAGTTGAGATTTTAAAAACAGTCCGCACTGTTACAGA
10   A13   AX00003426   CACCTTCTGCGGAGGGGATTAAAAGATAAAAATAAAGATATTGATCAGCATATGG
10   A15   AX00003427   GCAATCATTCGACGAAGAATTCGCCCCTGAAATTTCACCTGGATATCGGCAAGA
10   A17   AX00003428   ACGAGACAAGAGGTAGTAGAGATGCTTCAACTATTTGATCTAATGGATACGAAA
10   A19   AX00003429   CATTATTTAAAGCGTTTGGTAGAGCGCTTAGAGAAGCAGTCGAAAGAAATGCCC
10   A21   AX00003430   AAACGAAATGGACGGTATTTGCTTGTTATATCGGATTAATGGCTATACTTGGTTA
10   A23   AX00003431   AAAATAAAGAATAAATTTTTGAAAGGGATTACAGCATTGGTAGCGTACACCCTTA
10   C01   AX00003432   TTAAATATTCGTCTGACTTGTATAAAATTGTTGATAGCTTGAATCGTACGTTAAAA
10   C03   AX00003433   TGGCGGATATGTACCCAGAAGCACATTGTGAATTAATTCATGATAATCCATTTGA
10   C05   AX00003434   GTTCTCTCGATTTGCTGGAAATGAATATAGGGATTAGAACGAATCATGCATTAAA
10   C07   AX00003435   TGCGAGACATTGGTATCTCGAAGGAAAAATATGCATTTCAGATTACCGAACAGT
10   C09   AX00003436   TGGATAGCCAAGGTGCGATTGTAGATGAAATACAAAAAGCGCAAGAAGAATATT
10   C11   AX00003437   TTTCATTCTTACATACGAAAGGATTTAAACTATCAGAGGAAGCGCAAGGGTTTAT
10   C13   AX00003438   GGAAGCACTGCAGTACATAAAAAGTTTCGATCTCTTTTTTATTAAGTGGATTCCA
10   C15   AX00003439   ACATTAGTCATTATGGTGATCCGGAACATCGGGAATGGAAACAATATTTCATAGG
10   C17   AX00003440   AGTGAGGTTGAGCAGCGGACTGTTATGGCGGCGAGTAGTTTGCCGGATTTAAT
10   C19   AX00003441   GACTAAATTCAAAATCTTGAACGAAGCTGGTATCAGCATGCTTTCTCAAGCAAAC
10   C21   AX00003442   TTCTTTCCACAATTATCGTTTTATTTTTCGTTGGGGTTTCACGTTATATTCATAAA
10   C23   AX00003443   GGCATTTAATTGATGTGTTAATTGGAGCAGGTGTATTTAAAATTCGTGACCGACA
10   E01   AX00003444   ATCGTAGCGAAAGATCGGGAATTGTTTGCACTTGGGCGTAATGAGAAATTTAGT
10   E03   AX00003445   ATTAATAAAATCGTGGTCGATTGAAACAAGTTCAAAGTGGACAATTGAGAATCCA
10   E05   AX00003446   ATGGAGAAAAATATTTAGCTGCTTATGCGGAGACGAAGCAGGAGGCGATTGAAA
10   E07   AX00003447   CTACTGTAGTTGGTTTTTTAAGTAGTACAGTAGCAAAAGCCATTCTCCAAATCAT
10   E09   AX00003448   ACTTTGGATTTAAGAATTGGAACTGTAACACATGCAGAGGAATTTAAAGAAGCGA
10   E11   AX00003449   CTACGACTGGGTTGATATTGCAAAATGCCCTGAATTAGCCGGGAAACAAGGTGA
10   E13   AX00003450   GCATAGGGATGAAGAAAATTATCCAGTGTTTCAAGAAATTACAGCGAAACATTGC
10   E15   AX00003451   CTATTGTTTGGGCTACTGTATTATTATCTTAAGAGAAACAAAAGAAAGAGAAAAG
10   E17   AX00003452   ATTGCAGATTTAGATGGACTAGCATCAGTTTTTAATAACTATCGTATGTTTTATAG
10   E19   AX00003453   TACGTGGTCCGATGGAAATGAATCATTATTCGGAAGGGTACTATACGATTGATT
10   E21   AX00003454   AATTGCCGGAAATCGGAAAGGCCTTAGGGGAAACGTTAAAAGAATTCAAAAAAT
10   E23   AX00003455   GTAACTACCGAAGGGCCTGGTATACCAAAAACAGTTGATATATCATTAGGTAAAG
10   G01   AX00003456   GTGAAGTAAGGAAAGTATTAGTGCAAGAATCTTTTTTTAATCATCATCCTGAACT
10   G03   AX00003457   CAAGTAGCGATTATAAACGACGTTCATCTGGTTATGGGCATCATCATTATAAAAG
10   G05   AX00003458   GCCCTCAGTTGTAGGGAATTTAGTTGTACAAAATAGTAACGGTTCATTTAACTTA
10   G07   AX00003459   ATACTGAATCAGTCTTAGTTGAAATTACAGATGTAAGCGGTGGTACTTTTGAATT
10   G09   AX00003460   TACACATATAAAGTATTAAAAAATGAGGAGGGCCAGTATTCTCTCTGGCCTGCCT
10   G11   AX00003461   GATGTGCCTTGGGATGGTTATCGTAATGACGTTTTACAATTTACTAATGAATGGA
10   G13   AX00003462   GTGAACATCCTACAGATTTTAATGGATTATTAGCCTTATACGAATCTTTAGGATG
10   G15   AX00003463   TTATAGCTGGTATGGCGGTAATCGGAGTAGGTGTAACATATGGCATGCTGTATT
10   G17   AX00003464   TAGAAGAACCGAAAAGAGAGCAGTTATTTCCTTTATTTGAAGAAGTGTTTGGGAT
10   G19   AX00003465   AAATTAATGATTACTATACCGATTATTACACGTATTTATGAAGAAGACGGGGAAA
10   G21   AX00003466   AAAACTTATCTGGACCGATGGCAAGACTTTCTGAACAGAGACATTTACAAGCAAT
10   G23   AX00003467   GCTTAATGCATATGTATTGGGATAAAGAAGAATTAACTGAGGAACAAGTACGGA
10   I01   AX00003468   GCAAATCCCACTAGAACAATCTTTATATATTGGAGGCCTCTTATTTTTTACTAGTT
10   I03   AX00003469   AGTTAGCATTGAAAATGTAATGATTAATCCTACTAATATATCTTCTGTAGTTGAAA
10   I05   AX00003470   GCCACCAACTTTTGGATACTCACATGTAGTGGAAGCTAGTAACGCTAAACGAAC
10   I07   AX00003471   CTATGCAAGGAGTTCCCACAAATAAAATTAACATACATCAATTACCTAAATGGAT
10   I09   AX00003472   AATGAACCAGTTTCAGAAGATACATACACCAGCTACAGTAAGAAATTGGAGGAC
10   I11   AX00003473   AAATATTCCAGCACAAAATTTATATGAAAAAGTTGGTTTCCAAGATAAAGGGCTT
10   I13   AX00003474   AAAGCGACAGAAGATTCACCAGATGGTTGGAATGCAACGTGTATGAGGCTTAAT
10   I15   AX00003475   ATAAGAATAGGCTATGTCTCTGTACCAGGGATAATTGGTTTTTCATGCTTTGTTA
10   I17   AX00003476   CACCAAGAGCTGAAAGATCAGTAGAGATTATACCGTTAAATACACCTGGATATAT
10   I19   AX00003477   CATTAAAACCGTCTGAACGATTAGTACTATTATTATTAGAGAAGCATAGAATGTT
10   I21   AX00003478   CGCGAAATAAAACTTCTCAATCATTCCAACAGCTTCGAACGAAAGTATTACAGCA
10   I23   AX00003479   ACGATGAGGCGGTAGAATTTTATAAAAGAATTGGTTTTCAGGTTAGAACTTTAGG
10   K01   AX00003480   TTGGTATTTCTTCAGGCACTATAAAGATTCATTTCACAAACTTTCACGACTCCGT
10   K03   AX00003481   CTTCAAAAAATCTGATGAGCTGAATGAATTAGCTTCAAAAATTGTACAAGCTGTA
10   K05   AX00003482   TGAGAAGAAGGGGATTGCTATTCTTTCGTTAATACTGTCCTCATCATTTTTTATA
10   K07   AX00003483   GAGGAAACGCAGAAAAACCTTTCAAAATTTGAAAATAGGTATTGGAAGGCAGAG
10   K09   AX00003484   ATGACATAGATTCAACCATCAAAGATAATATTAGCGGGAAAAAATTGAGGGACAT
10   K11   AX00003485   ATCTAAAGTATCGACATGGTTGCTAATTCCATATTTTTTATGGTCTACATTTGCTA
10   K13   AX00003486   TTGAGTCAGAGATAAGTAAAGCAATTACGCACTGGGAAAAGGACTACCTAGGAC
10   K15   AX00003487   CGTTGTAAAAGGCACGATTTCTACACTTTTAATCGTTACAGGTGCTAAATATTTT
10   K17   AX00003488   TCTTATTATATTGGTGAGGCAAATGTACAAAATGAATGGATGAAGGATGTTTTTG
10   K19   AX00003489   TTGGATTATCGTTTTTGGAATATGGGCAGCTATTATTTGGCTACGAGATGTTGAT
10   K21   AX00003490   GTACATTTTGTGCACCATGTACAGAAGAAAGACACAACGTTTGTCCAAACTGCG
10   K23   AX00003491   TGCAGCACGATTTATTCATTATGTTTATTACTACTCACTTAGTATAGGTACTTTAA
10   M01   AX00003492   CAAATCCTTTATCTAATAGACCTTGCATTATTAACAGGAGACGAAGAATGGTTTA
10   M03   AX00003493   AACGGATTACGGTTCGTCTTTAGGAGCTATACTCGATTCCCTCTGTTCCTGGGG
10   M05   AX00003494   CTACTATTATCTTAGGTTCTAATGCGTCTAATAATGAAAAAATTCTCGGCTTAGG
10   M07   AX00003495   TGACGAACTAGTGGCAAACGCTAAAACGTATGTCTCCAAATATCGTGAAGATTTG
10   M09   AX00003496   TTGAAGAAATGTTACATGAAGATTTCCAAGAAAGTATAACGGAGATTATCGCACC
10   M11   AX00003497   ACTTATAAGTGGGTGATGTTAATTGTTGCGACGATTGCTCAAACAACAGCGACA
10   M13   AX00003498   CAAACGCTATGATAAAACGAATTGAGGAACATACAAAAATGTTCCCTTCTACTTT
10   M15   AX00003499   GAAGAAACAGTGGAGAACGCCAGAAAGTACGTTGTTTTTATCAGCGGCAGCTGG
10   M17   AX00003500   ATGGCATTAACAGCATGTTCTACATCAGGTGGAGATAAGAAGACAAGCACAAAT
10   M19   AX00003501   AACAATTATTAAGCGATCGTGATGCAATCGATCGTATTGAAGAGCGTATTGAAAA
10   M21   AX00003502   TTTTTGGAAGATAAATTTGTATATGATTGCGCAGGGTATATTTTTGCTCATTCATC
10   M23   AX00003503   GACAAAAGACCTCATTTTAGCTACTGCTACAAAAGAACAAAATTGTTCACAAGAA
10   O01   AX00003504   ATTGATCGGCAAGATAATGTTATTACAGTTCGAGTAAATGATTGTTTTCATACGG
10   O03   AX00003505   GATGAACCAACTGTAGTCTTTCCTCTTAATTTAAGTGGAAGTCGCCAACAAATTA
10   O05   AX00003506   TGGGAATGGATCAAGGCAATTTTGATAGCTGTTGTATTAGCAGGTGTTATTAGAC
10   O07   AX00003507   CTATCGAGATATACTCGTGGGCACTTATTATTTACATTCTCCTATCATGGTTCCC
10   O09   AX00003508   ATTGTAATTCCTTGGAAGGGAATTGTGAAAATTGGGGAAGATGTCATACTTGTTA
10   O11   AX00003509   TGAGGAAGAATATAGAACATTGCTTGATTATATCGATCAAAAAAGAAGTGTAATG
10   O13   AX00003510   TAGAGTGCCCAAGCTGTGGTGAAGCGAAATTAGCTCACCGTGTATGTAAAGCAT
10   O15   AX00003511   ATGCAACAATAGAAGAGCATGGGAAAGGTATTCAGAAGATTAGGATAACTCATT
10   O17   AX00003512   AAGTTCCAACAGGAAATCCATTTTTTGATGCTGGTGGCTGTGGTGGCGGTTGTG
10   O19   AX00003513   CGACATGGACAAACTGATTGGAATTTTCAAGAGATTATTCAGGGACGTGAAGAT
10   O21   AX00003514   ACATATATGTGCATGGAATGTTCGGAACGAATTGCAGAACGTACGATGGAACGT
10   O23   AX00003515   ACAATTAAAACAGTTGCCGAAGCACGTCCGGATGATAGTGCTGCAAAAGAAACG
10   A02   EMPTY        -
10   A04   AX00003516   AAGCAAATGAATTTTGCCGTTTTCTAGCGAAGAAATTAGAAGGAGAGTTACAATT
10   A06   AX00003517   TTTGTCTTATATGCATATGTTATTATTGCGGCGGTTTATTTTGGGATAAGTTTTTA
10   A08   AX00003518   GTTTCAGAGAGACATTTAAATTTTGATATGGTCTTTACCCGTATTTGTAATTTCAT
10   A10   AX00003519   TCTCGGCTTGCTACTCGAAGGAGATAAACATCCATATGAAGTGCAGCACATCAT
10   A12   AX00003520   TGCTGATTATGCGATGTTTTTAGCGAGCGAAAAAGCGAAAGGTATAACTGGACA
10   A14   AX00003521   AATCAGAAAAACATACTGTACGATCCATCGTACCGCTACTCTTAGCTCTTCCTGT
10   A16   AX00003522   AAAGCGTCAAGAACAAAAAGAACGTGAAAAGAATAAATCATTTGAAGAACTGTTA
10   A18   AX00003523   TGCATAAACAAGAAAAGAAAGTGCAATCTAAGGAGAAGCGAGAGGCTGAAAAAC
10   A20   AX00003524   TCGCCCTTTAATTTTAGTTGGTGCTGTTGTACTCGTTATAAATGAACATGGATAT
10   A22   AX00003525   ATTTCATTAGCTGTGTTTGGTATTAAATTAATGAGAGATACTGTATTCGGGATTC
10   A24   AX00003526   AGTGACGGCAATTGATAAGCAAGGAACGATCATTTCAATAGCATGTGAGGACAT
10   C02   AX00003527   AGAAAAACAAACGTAACAACGCTGAGCGTATCGAGCTTAAAAAGTATTGCAAGC
10   C04   AX00003528   TATATTCGCCTAAAGATATGGCGCTATTCCGTTTTCAAAAAATCGGAAAAACCAT
10   C06   AX00003529   ATTCGTGCTTGTTCTTGGTTATATATTTTATTACGATATAAAAATCGGCACTTTAC
10   C08   AX00003530   ATTTGCTTTTGAAAGAAATGGAAAAAGACGTAAACGATGAGATGGATCAACATGA
10   C10   AX00003531   CGTTACATGGCTTTTTACATTTACTTGGTTATGACCACATGACAGAAGAGGATGA
10   C12   AX00003532   GCACTTCGCCGTTTTAAAAGATCGGTTTCTAAAACTGGTACACTTGCTGAAGCAA
10   C14   AX00003533   GAAATATCGTGAGGAACATGGTCCGTTTCAGAAAATAGAAGATTTGTTAGAGATT
10   C16   AX00003534   AAAAAATAAACGAAACAATCCAGAGCGCATCGAACTAAAAAAATATTGTCCACGA
10   C18   AX00003535   CGCTCCTTTCACCTCTTATGATAAAAAATGGTAGCCAACTTCCTGGAAATCGTAA
10   C20   AX00003536   GGGTAACATTCTTTATGCACGGTTTAACAAAATTCCAATCGGGAATTGACAATAT
10   C22   AX00003537   ATACTCGGTTCGGACAAATTCTTCTCGCTGTAAGTACATTGTTAATGGTTGGCTT
10   C24   AX00003538   GCAAAACAATACTTCAATGGAGCTTGCTTCTGAGTTTGGCATTTCTCTTCAAGAT
10   E02   AX00003539   CGAACTCCCAGTTACTTTATCAATTAGCATTAATGGGTGCGAGTACACTCGGTG
10   E04   AX00003540   AATGCGGTCGAATTATCGGAATTGAAGTGCTTGACCATATTATAATAGGTGACCA
10   E06   AX00003541   TACTTATTATAGGACTTATTGCGAAAAACCAATCGCTTACTGTAGCTATTGGTGT
10   E08   AX00003542   TGTCATCAACAGTACTCTTTTTTGGTAGTATCGCACTATTTTACTTTCTTATAATG
10   E10   AX00003543   TGCTGTATTGTTAGCTTTCGTAGACGGGAAAAAAGTTGCAATGGAATTGAATGA
10   E12   AX00003544   GTCACGAAAAAGACTTAGAAGACGCTGTAAATGTTTTTTTGAAAAAGATTGATGA
10   E14   AX00003545   ATATATATGAAGACGGAAAGTTTTATCGCATCATAGATACGCACCGTGGCAATAA
10   E16   AX00003546   GGTTATGCAGCATACACGTTAGTTAACTTTGTAAAGAAAAGTAAAAAAGGAAAAT
10   E18   AX00003547   AGAACGATACGTATATTGTCCAAAATGTGATGCGAAAATTAGAAAAGGGAATTCT
10   E20   AX00003548   AGATGACAGAAGATAAGGTAGTTGCTACGATGCCTGTTGATGAACGTACACATC
10   E22   AX00003549   CGCGGTTTCGAAGGGGACCTATTTCCTTTCGGCACATACTGCTTATGTCGTTTA
10   E24   AX00003550   ATGGACGTATACAATATTCGGGAACGTATCGAACGATGTTATTAATTGAATCGAT
10   G02   AX00003551   AAGAATTAAGAAAGCAACATCATATAACGCAAGTTGAAATGGCAAAGGCGATGC
10   G04   AX00003552   TAATGCAGAAAAGGGATTTGGGTTTATTGAGCGTGAAGATGGTGATGATGTGTT
10   G06   AX00003553   GCAGCGGGAATGTCTTCCAGCTTGATTGTTACAAAAATGGAGAAAGCAGCAGAG
10   G08   AX00003554   CGAAAATAAACTTAATATCCCTTCCGGTTGTTTTGTTTCTGCTCTTTTCGTATGG
10   G10   AX00003555   CTCTCGCAGCTAGAATTAGCTAAAAGAGTTAAAGTGGCGAGACAGACAATAAAC
10   G12   AX00003556   GCTATTTTTAGAAAAGAGGTACAAGATTTTAAGACAAATTCACAAGTGTTGCTAA
10   G14   AX00003557   CAAGCACTGATTGCCATTGTTTCGCATTTATTGTTTATTACCATCACGTGGTGGG
10   G16   AX00003558   CATTTGGCGGATCGCTTTCTATTTATAAAGAAACGTTAGAAGAGATGGAAAAACT
10   G18   AX00003559   AATAAAATGGCGAATGAAATTGCAAAGGCAAAAAGTAGTGAAGGACAAAAATCAA
10   G20   AX00003560   ATAAACGTAAGCGCAGCAAAGTACATGGTTTCCGCAGCCGTATGAGCACAGCAA
10   G22   AX00003561   AAACATATAAAGGTTTATTTGACGCTATGGTCATGACTCCTTACTTCCCTCATCC
10   G24   AX00003562   GGAATTATACATTGTATGTACCCCAGGACTGTATCGCCTCTAATCATGATCAAGA
10   I02   AX00003563   AAGTGAAGAATGAATGGTTACGTCAAAAGAGAATGGTTGAACAAAGCGTTGAAC
10   I04   AX00003564   CATATAGAGAAAAGGATTGGGACCCATAATAGCGGAAGAGGAGCTAAGTATACG
10   I06   AX00003565   TTTCCTAGCAGCGATTGCAATCTTACCAGTTATCTTTACGAAGCTGGGAAATCTT
10   I08   AX00003566   TTACCATGTGCACACGCATAGCGAAGATGCTCATCGGTTGCTAGCTAATCTGAC
10   I10   AX00003567   GTTGCGAGCGAATTGAGAATGCGCATTATTGCAGGTGTGATTGAAAGCGGTACC
10   I12   AX00003568   TGCGGATACTGCCATGTTGATATCCTTACTAGTTGCGATCTATACAATGGGATTG
10   I14   AX00003569   ATATGCTTGAAAACATCTCTGCAAAAGTGAATAACGAGCCTTGCTGTTCTTATAT
10   I16   AX00003570   TTAAATATCGTATGGCTATATATGGTCTCACCTATTAGAGATGAAAGCGGAGGTC
10   I18   AX00003571   CAAAATACTTTCTATAAAGTATATACGTTGCTAGATGACCTAACAGAGAATAACA
10   I20   AX00003572   AAGCTTGATAACAAAGATACTCAAGACGTTTCACTATCTCCTATAAGCTCTACAT
10   I22   AX00003573   ATACCGCTACTAGCTCCAGCGATTATTCTAAACTTATTTCCTACATGGAAAAAGA
10   I24   AX00003574   GAACATGTAACGATGACATATGGTGTAGGGGTAAAAGCTGAGGGAACAGAGATG
10   K02   AX00003575   CCGGAATGTTGGAAATAGCTTTTCGCAGTTTGGCTGGGCTTATGGTTTATTTGC
10   K04   AX00003576   TATTGGCAGCCTTTCAATTTATATTTAATGTATATGGTTGGTATCATTGGATTGCA
10   K06   AX00003577   TTTTATTACGGCCATTTCTAAGCCAGGGGGAGTTTTCCTTCCATATTTCCAAGAG
10   K08   AX00003578   GAACAGATTTTTAATTGGCCAGGGATTGGGAGTATTCAATTAGAAGCATTAAACT
10   K10   AX00003579   TAGGCGATTTTTTCCTCTTTCCTATGGCAGCTTATCATGAATATATCGCTAATGG
10   K12   AX00003580   ATAAGGCGATGTTTAATAGTAGATTGCGCACAACTGGTGGGCGTTATCTATTGA
10   K14   AX00003581   CGGGTGAACCAGATTTTCCATTTTGCCTTTCTTGGGCAAATGAACCGTGGACAA
10   K16   AX00003582   ATTCTTCGTCCAGGTGGCATCTTCATAGCCACAACACAAGCACGCTATTTTCTCG
10   K18   AX00003583   ATACAGGAAGCTATGCAGAACTTAGCATTACAGATGAAGCCTTTCCCCGATTTC
10   K20   AX00003584   GCAAGTATCCATCCAGAGGATCATATCTTTCAATTCCTGGTCACGAATCCAGTTT
10   K22   AX00003585   GAAAAGTTTAAAATAGCCAGTGATTGGTTTTTCTATGTTTCTATCCTTAAAGAGG
10   K24   AX00003586   CGCTATCCCAAAGATATACAGCACATTTTACATTAGTGGAGCCTACTCCAGATAT
10   M02   AX00003587   CGTATTTAAGTGTCGATGATATCCCTATGTTTGCGGTAGGATTCATCACTTCTTT
10   M04   AX00003588   GCTACTCTAGATATTGCAAATAACGAATTACAACCCACATATCCACCAGAGTATT
10   M06   AX00003589   TCATTTCTAGTCACATATTAGCAGAGGTAGAACAGTTAGTTGATCGTATCGGAAT
10   M08   AX00003590   TTATGCCAGAGTCTACTTGTCCTATCATTGCAGATCACCTAAGCCTTATGCGGAT
10   M10   AX00003591   CGAAGCCTTTCAGCATTCACGAAGTAGTTGCACGAGTCAAAGCTCTTATACGGC
10   M12   AX00003592   TTAGAAGAGTTACCTGCCCCAATCCAGCAATCTGCTAAGCAAATGCTAAATATTT
10   M14   AX00003593   AGTACGACGACAGGCGTTGTAAATCGCCTTGTAAAAAAGGGTTATATTGAACGC
10   M16   AX00003594   AGTTGAACTTCCTTTAACGCAAGGAGTTATTACATGGGATCCGTATGAATATAAC
10   M18   AX00003595   GCGGAACGATGGTACGGAGCTAACAAGGGGAGTAGCCAAATTAGTATTTCATAA
10   M20   AX00003596   TCACAAAATATAGTTTCGGAGACTAATCATACATCCCAATCTTCACAAGCTCAGT
10   M22   AX00003597   TATTTAGGAGTTGGCCCAATTTTTCCGACGAGTACGAAAAAGGATACGAAAGCG
10   M24   AX00003598   AAGTTCTATGGTTGAGTTAAGAGCTGGCGCTCAGTTACAAGAAACTTCAGTACC
10   O02   AX00003599   AGTCGTATATTGCAAGCTGAGAAACTAAGGATAGGTTATAGTGATCCGTTATGC
10   O04   AX00003600   TGCAGGGCGATATGCAGTATTTACTGGACCGACAATTTTATTATTTCATAATGGA
10   O06   AX00003601   TACGTACTTGTTGTATTCATTTTTGGTCTGTTTTTCGCATCGGTAGGCTTTAATA
10   O08   AX00003602   GATAGTGGTTCTGATGGCAATGGTTCCGATGGTAGCGGTTCTGGTGACAATGG
10   O10   AX00003603   GAAGCGTCACGGATTTACAAATACGAAATATGAAGCAGGTAAAGCTGAACAATG
10   O12   AX00003604   TAAAAACCCATTTCAACATGTGGAAATACCTCGACCACGAAAAGTGGTCAATTCT
10   O14   AX00003605   GATATAGATACGTTGGTTATCATCGCCTCCTTCTTCAATGTTTCGGTAGACGCGC
10   O16   AX00003606   AAATCCATCAACAAAGAGATTTGAATACCTTGGAGTTTGTACATCCAAGCGAAAA
10   O18   AX00003607   AAACAACCGAATTGAACCTAGTATGACTGTATTGAACTCTATTGCAGATTTGTTT
10   O20   AX00003608   GTTCGTAAAATTGAAAGTGGATATATACCGAGACCGGATATAATGGTTAAATATC
10   O22   AX00003609   TGGGGGCAGCTCAACTTTGAGCCTACCCAGTACCAGCATTATCAAAATAAACAA
10   O24   AX00003610   AAGATGCACGACAAACAGCAATAGAAAAACTAGATACTATCCCGGTTACTTACGA
10   B02   EMPTY        -
10   B04   AX00003611   CACCCTCTTACGATAAAAAGGAAGAGCCTCCTACATTTAAACGTAAGACAAATAC
10   B06   AX00003612   TAGTAGAAGAGTTCTTTACATGAGGATGTACAGATACGGTTGGGAATTGCAAGA
10   B08   AX00003613   AAGCGACTTTACGTACTTGGAATAACAAGACTGATTTTGGAGGACGTGTTTCAAA
10   B10   AX00003614   AAAATTGAGGTTAAACAAAACTGTGAAAAATGCTGTCATTGCGACGGAAAAGGT
10   B12   AX00003615   CATTTTTGGGTGGGTAACGTTTACCATAATAGCTCATTAGAGTCTGACACAATGG
10   B14   AX00003616   ATGCTTCTCAATTTATGAGTTGGGCAAATACGGTACTGGCACTCGTGGACGATG
10   B16   AX00003617   AAGTGCTGTCCGAACTTTGGAACAAGAATATGGTTATGAAGGCGAAGCTTGGGA
10   B18   AX00003618   AATCGCGCTTTTGCAATGATGATTATTGAGACATATACAGCAAGTCAACATAGAA
10   B20   AX00003619   GCATAACACTGGATGGGGATATCATTATCAAGCTTATCGGACCGAAAAGGAATA
10   B22   AX00003620   CATACTTCAAATTCAGGCATGGGTTATGTGAAAGATGTACAGACCCAGGAAAGA
10   B24   AX00003621   ATACGGATCCGACATTTTTACCGATTATTTATGAGTTAGACAGTCGTAAGGAATG
10   D02   AX00003622   AGAGAAGATGACAACGGAAACCGGACACTTATAGGTTATGCGGTAAAGTGGGA
10   D04   AX00003623   ACGTGCAAATGCTGTGACTAAAACAAGTGACATCGGTTCTGTTATCCCGCAAAC
10   D06   AX00003624   AGGCGATATGTACGAGTCAAATGATTCGGAACGTATTGCCTTTTTAATTGAAAAA
10   D08   AX00003625   AGAAGCAGCCCGACACGACTTAATGTTGTCGGGTGTTTCTTCCGTTAAAGCGAA
10   D10   AX00003626   TTCAAGCTGGTCAAAATGGTTTCAAACCAAAATGTGTATTAATCGTTTATTCGTTG
10   D12   AX00003627   CGAAGGGATGGCGTAAGAAGAAAGAAGGAAATGGTTTTATTGTCCATAACGCAT
10   D14   AX00003628   TAAGCCGCCTTTTATTTGTTATCTGGTGACTGGTTCACCAAACATGATTGCTGAT
10   D16   AX00003629   GCGACTCGTCATTTATTATACAACGTGTCTGTGTCACGCCCTGGTTTTGGTTCC
10   D18   AX00003630   TTAGACGTGATATGTTCGCGGATATCCTTAGTTTAGGGGTACTTTCTTCATACAT
10   D20   AX00003631   TTCTATGAAGGATGCGGTTCGTGATGCTGTAGACGATACTGAAAAAATGTCTGA
10   D22   AX00003632   GACTACACCGTTTCTATTCCTGGTCGTCCTGGTGCTTATTATTTCGGGTCAGATA
10   D24   AX00003633   AATTATTAAACCCTGGGACCTCTGAACACGCGAATGCTGGAGTTGAAATTCCTG
10   F02   AX00003634   CCAAGATAATTGCGACCCAGATCATCCAGCCATCATAAGGTTTCAAATACCTAAC
10   F04   AX00003635   GGTGATTTTATTATTCAACGTATTGATGTTAAACGTATCATTCCATTAAATATGAT
10   F06   AX00003636   AGAAGTTGCCATTGAAGCCCAACAATCAGCAAAAAGCGCTCATTTGCGTGTGGA
10   F08   AX00003637   AAGTCACTATCTTGGTTTACAGAATCGGCAACCCAGGAATCTGTACAAGCGCCT
10   F10   AX00003638   TTCCGACGATAGGTATCTCCCTTTTGTTTTTGGTCTTATATGGATTAATTAAGGA
10   F12   AX00003639   AGCGGTTCTATCCGTTGCGAATTCAGGATTATACGCAACTTCTCGTATGCTATG
10   F14   AX00003640   AATCGTTTCAGGTGTGCTTTTATCTGTGACAGATGGAGCAGTAAGCGTTCGTAC
10   F16   AX00003641   ATTACAAGCTCATCTAGAAAAGTATCAGCAAATTGAAATGAGCGAAAAGGATACG
10   F18   AX00003642   TATATTTTCTCGTTCCAAGGGATGAGAGAGATAGAACTATGTTTGAATACGAATA
10   F20   AX00003643   GTGAGCTTGAAAAGGTTGCAGTCGGCATCAGTGGAAATATAAGATTAGTAAATG
10   F22   AX00003644   GAGATAAAGCGAGAAGTGCGTCAGAGGGAGCGGGATTAGGCCTTTCAATCGCG
10   F24   AX00003645   CATTGCGTTGTACTTATTGGATATGATCAGGAATCTGTATATATTCGGGATCCAC
10   H02   AX00003646   ACATACAGCTCTTCGGTGTAACAAACGGAACCATTATTTCGATCGCAGGTGAGG
10   H04   AX00003647   TATTTTCATTTCCGAATCCGCCGAAGCGCCCGAGCTTCCCAGAAGCGGCTGGA
10   H06   AX00003648   GTTAAGAGCGTTAGCGCATCCGTTGCGTCTACGTCTAGTAATGGAATTAATGCA
10   H08   AX00003649   CTACCAAGGGCATTAATTGCAGCGAGTGTTGGTGCTAGTTTAGCCATTGCAGGT
10   H10   AX00003650   TAGAAAATAAAAATGGGATCGTCCATTTTTTAAACCTCAAAGACTACACATACCC
10   H12   AX00003651   CATTTTTTGGTGGAGGTTTCTTTCCAGGGTTTGTAGCAGGAGCATTACTCAGTC
10   H14   AX00003652   TCATAACGGCGGACATCACCACCATGGTGGACACAATCATCATGATCACCATCA
10   H16   AX00003653   ACAGTTTGTCAAAATGGTGGAATATTTAACGAGCTAACACATTATCATATGCATG
10   H18   AX00003654   AATCTATATGCATCCATCCATAAAGTTGCTTAAATCTGAAGGGAATGCATGGAAC
10   H20   AX00003655   TATATCACGGACTTCGTGTTCCAGCTAACTCTCCAATTCCACCATCTATGCCAAA
10   H22   AX00003656   ACAAGAAGATATCGTTCGAGTCGATCTGTTCGCCATTTATGATCCTCCTTCTGCT
10   H24   AX00003657   TTATACCCGATCTTCCCTACAAGTGGTAGCGTTGATCCACAAGTGGCAGCCGGA
10   J02   AX00003658   GATATTCGTCCAGAAAACCGCGAACAACAGCGTAAATTGCGTCGTGAAGTAAGC
10   J04   AX00003659   CGAATGTCCCTGTTATTACAGTAGACCGCGTTGCGAATTCAGGTAAAGTTGTTT
10   J06   AX00003660   CATTCAGGTGTCCACACTGTAAGGTGAAATTAAAAGAAATGAGGATCACACCAT
10   J08   AX00003661   GTCGTACTACATTTATGTCACTATGGTACGTGTTGCCTTGTGCGGTTGGTTTTTT
10   J10   AX00003662   ACATCAGTAGGTAGTGTGAAAGAGGCTGCTGGAAACTATGGACAAGCGCCTATG
10   J12   AX00003663   TTGTCACCGTTTCCGCAGTTTTTGAATACGGAAAGGCCAGATAATATTGTGGCC
10   J14   AX00003664   ATTACCTCTCTTAGGATTAACTAAACAAGGCGTACAAATGGAAGGAGCGGCATT
10   J16   AX00003665   GAGTTAATGGCCCAGCATCAAATTAGACGATTACCAGTCGTTGAGAGTGATCAA
10   J18   AX00003666   TGTATATAAGGGTCTTAGACACACTGGATATACCATGATGCTTATTTTTGGTGGT
10   J20   AX00003667   AGCCAGTGCGATTATCGTTCAGCCAGATGCCGATGAATCAGGTCAAACTGAAAA
10   J22   AX00003668   AACGATTTCCTTCTATCAAACCTCTTGCGTTCATTGTCAAAAGGTCTCTCCTATT
10   J24   AX00003669   TCAATCCACTCATGCAGGTACAATTGAAACAATCTCTTCCCTTCTAAACGCCAAA
10   L02   AX00003670   ATTTTAACAGACGGTTCACCATATGCATTAGCTGGACCAGCGACATTACTCGATT
10   L04   AX00003671   GGATTACGTCAGCTCACGGTATTAACAATCATCTCTCAAAAAAGTAATACTCCCC
10   L06   AX00003672   CAAACGCATCCTTCCTAATGGGGCAACTGGTATAGAGCTAGCTGAGTATTTAGG
10   L08   AX00003673   CGGGAAGATTGTTTGAATATGCTGGAGATGCACGTGAGTTTACACCATACGCGG
10   L10   AX00003674   CCAATTTGAAGGTGATTCACGTGAATTTACACCACATGCGGTAAATACGATGCG
10   L12   AX00003675   TTCGTACAGTAGGTGAATATAGAGGAAATCATATGAAAGGATTTCAAAATATCCC
10   L14   AX00003676   GAATGCGAGTGAAAAGATGACACTTGCTAGTGAAGAAATTTCAGCAGCTCATCG
10   L16   AX00003677   TTAGTTTTGTCATGAATCGCATGTTAGGTGGGCGGGAAAAAGGTGTTACAGATT
10   L18   AX00003678   CAATACGCTTGCACCAAAGCAAGATGCATTTGTTATCGTAGGTGATTTCACAGAT
10   L20   AX00003679   TATACTTACGCATACATGACAGTCGGAGAAGTCGTCGCCTTCATCGTTGGATGG
10   L22   AX00003680   CGTGAAGTGAGCTTACAAACGTTACGCGTCATCGGGCTTATTGTTCTAATTAGT
10   L24   AX00003681   TCAAACAGTGCACAACCTAAGGAAGAAAACGATGTACAATCTATTAAAGATGTTA
10   N02   AX00003682   AACCCTAAAACGATCGCGAAAGAACTTACTGTTTCCTATGCAATAACCAATGCTG
10   N04   AX00003683   TACTTATAACAAAGTTTTAGTAACAACAGATAACGACTATTATTCTTTCCGACTCG
10   N06   AX00003684   CGAAGAAAACGACCTTGAAATCTCGGGTGAATATCTTCTCCACTTATCAACAAAA
10   N08   AX00003685   GTACTTCTTCTAAAAAGCTTAGACTTTGCAAATAATCTTACTCATTCTTGGGTGC
10   N10   AX00003686   GGAAACAGTATTTATACACAAAATCAACTTGGATCAATAAAGTAGATGATAAGTT
10   N12   AX00003687   AAAATAAAACTGTAAAACCAACGCTTTACTTCCACCCTAGCTGGGGTGCAGTAG
10   N14   AX00003688   CAACAGTCGCTACGATATGTTGCCCTTCATTTCCTAGATCAGAACTGGGTCAATC
10   N16   AX00003689   GCTTGGTGGACAAGATACGAGACTCCCATTAATTGTCACTTCGTTTGCGTTATTA
10   N18   AX00003690   ATTTCAATTTTGTCGGAATGTTCGCTTCTAATCGGTATGAGACTTCATGCGCTCA
10   N20   AX00003691   AAGGTGCTGCAGTAGCTTCAATCTCTAACTGGACAGTTGCAGAACAAAATAAAG
10   N22   AX00003692   TCTTTGAAGGTGGAGAAGCTACTTCTACTACAGGTAAACTAGCTGTTGGCATTA
10   N24   AX00003693   CTTAGTCCTAAAAGACTCATTCGCAAACGCGATCGTGCCACACTTAGCACAAAG
10   P02   AX00003694   ATTACATATATATCCCGCTCGGCGGAAACCGCGTTTCAAAACTAGCGAATTATCG
10   P04   AX00003695   TTGTTCATCGATTGTGGAATAAAGCAGGAGGTCGCATGCCGGACTGGGCAGGA
10   P06   AX00003696   AGGCGCAAAGCTTACTATATCCAATTAAATCGTATGTGAGTATGGATGGGATTAC
10   P08   AX00003697   AACTATTTAGCGTAAAACATATGCTACTAGCTAGCACACTCGTCCTATCGCTCGG
10   P10   AX00003698   GTATTACTGATGTTCAACATAAGCCACAAATGGTTGAAGTGACAGAGCAAAGAG
10   P12   AX00003699   CACGTAATTGTCCTCGTCCTTTTGGGGGCAGACGTGTTTGTTCTTTTGCCTGCG
10   P14   AX00003700   TACGAGTGAGACACCGGAAATGGATAGTAGCATAACTTTAACGATTTTGTTTCTT
10   P16   AX00003701   ATCTGGTTGCGGCAATACATCCGACAAAACTTCTTCAGAATCTAAAGAAACTAAT
10   P18   AX00003702   AATCAAAGTGATTTGCCTCATTTTTGGGGAGAAGTTGGTACAACAATGGTTAGTG
10   P20   AX00003703   GGAGTTGACTCTTATTTGTTAGATACAGAAAGGGACGAATCAATTTGCGGGCTT
10   P22   AX00003704   TAAAAATCTAGGTTCGTCTAAAATATCGCCGTATATTGTATTGGACGGTGATTCG
10   P24   AX00003705   TATTCCGGTTCGACCTGATTGGAGTGATAGCTCTGATTTACTCGGTTATGTGAA
10   B01   EMPTY        -
10   B03   AX00003706   CGACGAATATATATATTTCGAACTAGAATCATGGAAAAAACTAGACCACCTCATC
10   B05   AX00003707   CTAACGGAAAAACACCCACAACAAAAATTCTCCCCAAAGACGAATACATAAAAGA
10   B07   AX00003708   GTTTGGAGAACCGGATAATAAAGCGGAGTCCCAAGCTGGGGATATTAAAATGAT
10   B09   AX00003709   GTTTAGGTTGGGCGGCAGTCGCTTTATCGATTTTAGGTATCGTTGGATCAGTTA
10   B11   AX00003710   CGTTTGGACAACTGCGAAATTGCCAATTCTCGTGTATGAATATTCTTCATTTGGA
10   B13   AX00003711   ATGGAACATGTTTCGCAACCTTCTCCCTGCGATGCTCTCCATCATGCTTTTCGTT
10   B15   AX00003712   AAGTGCGAGGAAGAACTTCCCGTCAATCCAATCGATAGTGCCATTTTATATCGT
10   B17   AX00003713   GTAGCAATCCTATGTTAAACACTAGTAATATGACCCAAGTTGGCGATCATACATT
10   B19   AX00003714   TCTTGCGGCAATACAATTGGAGAAAGGCTGTCTTCAAGAAGAAGTTCGTAACAA
10   B21   AX00003715   ATGATCAGAAATTACTCTTTAACCTTTGCGGCAGTTACATTAAGAATTTGGCTAC
10   B23   AX00003716   CAAGGTAATGGACAAGAGTTGACTCGTGAAGAACAAAAAGTAACGGAACGTATG
10   D01   AX00003717   TATCTAAAGTGGGCATTGTGAATTCTGTCCCAGGTGTAAAGGGAGGATATAGGT
10   D03   AX00003718   AAGAATTAGGGTGGCGGGGTTTTGCATTAATGGAGCTCCAGAAAAAATACTCGC
10   D05   AX00003719   ACGGTAAACTTGGAGGTGCTGAACTGAGTGTTGTAGCTAAAGATGGTTATTACC
10   D07   AX00003720   AGCAGATGCATTCGATGCCATGACTTCTTCAAGAGCATATCGTTCAGCTCTATCT
10   D09   AX00003721   GGCACGCCTAAAACAATTACACTAGATCAAAAAAAGCGAAAATCTGCACATTCTA
10   D11   AX00003722   TATTAGACAGTTTCATACCTATAGGAATGCTCATTGGCTGTATAATCGGTTTGAT
10   D13   AX00003723   TTTGCTCATGTTGCGGCGTGAAATACGAGCATTCCGTTCAACCAGAAGGACAGT
10   D15   AX00003724   TGGGAGAAAGGTTATGACGCTACATATATATCAGATCTTATTGAAACGATGGGTA
10   D17   AX00003725   ATCTATCGGAATAACTGAATGGTTCGGCTGGAGAATGGTATTTCTTTTTTCACTA
10   D19   AX00003726   GAGGTCGCGGAGGATGTAACGCAAGATATATTTGTGAAATGCTATAAATCTCTT
10   D21   AX00003727   ATCGTCTAGAGCAGAATCGCTTTATCCAATCTAGCTGGGACCACGAAGGAGCTA
10   D23   AX00003728   GTTGGTGGAGTGACTCTTTTTATAATCCATTGTATTTGTAACGTTGGCATGATCC
10   F01   AX00003729   ATCTCAATTGTCAGCCCTTGACACACCTTATCATCTAACAGGGCCAAGGCTACG
10   F03   AX00003730   CATTTAGGTTTACCTCAATGGTTTAGAATTGCGACAGGTTGGATCGCTTTAGCAG
10   F05   AX00003731   TTATTTTCGCTCTAGGTTCCTTGCTTGGCTTACTTGCTACTGAGTATTGGGTTAT
10   F07   AX00003732   TAAATTTGGTCCAAGAGCGCTTATTATTCCTGGGACGCTGTTATTAGCAAGTGTG
10   F09   AX00003733   ATGAAGTTTCGTTAAGACAAGCGCAGGAAAATTTCATTGTGTTTGGTGCCTGTG
10   F11   AX00003734   GTCGCCAAAAAGGTACTAGTACATAATCAAATAACAAGACAGTATTTTGAGCAAC
10   F13   AX00003735   TTCTCTTATGATTGTAGATATGCTAGGAAGATCAGCGGCTAGATTTAACATTTTG
10   F15   AX00003736   TATGATACGAGACAATCAGTTAGTCATGGTGTACCGAGGACTCGCGAAATATAC
10   F17   AX00003737   TATGTTTAGTTGTAGGTATTAAAGCGAAGGGGTCGTTATTTTATGGGGATTGGC
10   F19   AX00003738   GTCGCTTCTATTTCCATTTGCAGCTACCTCCATCCCTTACGTCCTGCTAAATACA
10   F21   AX00003739   ACGCCCTTTCACCTATCTTGTTTCATAAAGAAAAATATATAAATATGAAAGATGCA
10   F23   AX00003740   TTACTGGCTATATGATTACGTATAATGTTCCGTATCCAGGCATGCTACTTACTAC
10   H01   AX00003741   GATAAAGAAGCAGTGCACGGTAAACCAGATGGTACATTTGCTCCGGCTGAAAGT
10   H03   AX00003742   CGTTAACGAACCCTAAAGGACGTAAGACTGTTTATACGTATAACGATGCTGGGA
10   H05   AX00003743   GAGAGGTTTGTTGTTGGAGACATAGAGATAGAACAAAAGTTAGAAAGTATTATG
10   H07   AX00003744   CATTTAGCGTGGTTTATTCCAGTCGCTGTACACGAGGCGAGAATCGCTGCTCCG
10   H09   AX00003745   GAAAAGCAGCCTGAGCTATTGTGGATTGTAAATTGTAGGGACTTTAGTATATTAG
10   H11   AX00003746   AATTATTGTCGGTAGCAAGCAAGGCGCATTCGGTTCTTATAAAGATGGTCATGA
10   H13   AX00003747   GTGGCGGCGTAGTTGCTGAAAAAAAGAGTGAAGAAAGCGTTAATTATATGTGTG
10   H15   AX00003748   TCGCTTGAGAAACTGATGTCATCTGGCATGGTATGGGCACTTCTTGCAGCACTA
10   H17   AX00003749   GCGCATTACAGTCTAATAAAGTAGCGGTAGGAACGGGAGATGGCAAGTTCGAG
10   H19   AX00003750   ATTTTAGTATTAACAAAGCATGGTATTTTTGAAGGCGATGAAAAAGGAAATTTTA
10   H21   AX00003751   ATTTAGTGCTGAAGGGGCTACAGCAAAAGCTGAATTAGCTGCAAAGCCACAACA
10   H23   AX00003752   TACACAATACGATTGAAGAGATAAAAGCGTATGCGAAAATGTATGAACATGATAA
10   J01   AX00003753   AAATTTCATTTTGGGCTGCCGTTTTCCTTACAGCTATCGGGTTTGGTCGCGAAA
10   J03   AX00003754   TAGTATCGTATTAGCGCCGCATTATTCTACCTTTAGCATTAAGGCATATAACGAG
10   J05   AX00003755   TGAATTATCCGCCATCGCGTTTGAAACTAGCTCTTACATATTTATTGACATCACC
10   J07   AX00003756   GAAAATATTATGGACTCGCAACACTCTAAAGAAGACTTAATAGATGCGCTGATTG
10   J09   AX00003757   AGGCGGAGACCTCGGATACTTCCATTCAGGTGCAATGACACCTGAATTTGAAAC
10   J11   AX00003758   ATTAACACGTGACCTAGCAGAGCGTTTCAACAAACGCTTCCGTGAAGTATTCAC
10   J13   AX00003759   GACTTCGTTTATTCTTGGCGAAGAGCTGTAGATTCAAACACGGGTGCCAAGTTT
10   J15   AX00003760   TTAATGTTGTAAAAGATACAGGAGCAGCTGTTAATTTGTATAATACGAGTGCGAT
10   J17   AX00003761   TTCATCTTAGGAATATCTAGTGCTACCCCGGCCCTTATAGGAAATAGCGGTGCT
10   J19   AX00003762   TGCTGTAATGAGCCGCATCATTGATAATCGAAAAACAAAGAGGCAGCAAAAAAA
10   J21   AX00003763   GGTGATGCGATCTATATCACGGAACCTTTAAGTTCTTTCCGCCTTCATACGGGA
10   J23   AX00003764   TAGATGTAGGCTGTGGTATCGGCCGGATGGCGGTTCCATTAATGAACTATTTAA
10   L01   AX00003765   TTGAATTTAGAAAAGCTGGCTATACAGTTGGGGTTCCTGTACAGCGTGATGCTT
10   L03   AX00003766   GGGTTACGCATTCATTTGTACAGGATAATGTCTCGTATTCAGCGGAAGCGGGAA
10   L05   AX00003767   TTGGTGCTGGGCGTTTTCGCACCATTGATGGAATTGGAAAAATGGAACGCATTT
10   L07   AX00003768   AGGAAACTCGTCCGAATGAAACGGTAGAGAAAGCGAAGCGATTTGCGAGTGGG
10   L09   AX00003769   CATTCACTCCACATATAACGATTGGGGCAAATGGATTTTTTGAATTCGAAGATTT
10   L11   AX00003770   GGTTCACATCAGACTGTCGTGATAGATGTGAGAGGACCAGATGAAACGGGAGA
10   L13   AX00003771   CGATTTGGTGGAACGCTTGAGGGAGCAGTGGTGGAAGCAAAGAATAGTGTAGG
10   L15   AX00003772   ATTACTTGTAGTTGCTATTACGTCTCCTTATGAATTACCTAAAAAAGTTGGCTTTA
10   L17   AX00003773   TCGGAAGGCAATATTTATCAAAGAAAACCGTAAACGCTATGCCAGAACTTTTAAG
10   L19   AX00003774   AAGTTATTATGCTGCGATGATCGTGTATCCAATGGGCATTTTAACAACACATCTT
10   L21   AX00003775   TCTATGCCTCTATCCATATTTACCGAATCAGATGGCTGTACATTGGAACGAAAAT
10   L23   AX00003776   TGCCTTTTCTTCCTTCCACAAAGGAAGATGCGATAGCGGCTCATAAGAAAGGAC
10   N01   AX00003777   ATGATAAACCTCAACATCTGGAGAATATGAGATCTAAGATTACTAAACGATTTCA
10   N03   AX00003778   GCAGGCGATATCTGCGTTCGGGAAAATGACCGAAAGTACATTATTTCGATTAAC
10   N05   AX00003779   CGTCAGAATGTATCGTACCTAGCTCTTCCCGTACAATTACAGGTCAATTAGTTGG
10   N07   AX00003780   AAACGAGGAGATACGTGAAGTGACGGATGAAAGTTTTCTCTATCAAACTGTAGC
10   N09   AX00003781   TACGCTAGATTGGTTCGTCATTCATATTGCCGATGATTGGATAGAGAGCGTACA
10   N11   AX00003782   ACATAGTAACGGACAAGGACAGCATAAAGAGAAGAAGCAAAGTCATCCGTTTGG
10   N13   AX00003783   ATGAAGTTGTTACCCTTAATTCAGAACAGGATGCACAAGGTTGCGATTGTTGTG
10   N15   AX00003784   AAAGATATTCGCACTCTTTACTATCGTGTCAACCAGATTTCGTTGCTCTTGCGAA
10   N17   AX00003785   GATATGACAATTCCTTTAGCGAGAGTGGTGGGAACGCAGAGGTGTGATACGCC
10   N19   AX00003786   TTAGTTCGTGTGTTACAAGAAATTGGGCGTTCAAGAAAACCACTTCTAGGCATTT
10   N21   AX00003787   GAAGAAAAGGCATTTAAGATGGCGGAGATTGAGCTTGAAAAACATTTTTTACCG
10   N23   AX00003788   ATGGTCAACCACCTACTCGTAATTTCTCAACTAACGTTATCGGTAGTGCTGTATC
10   P01   AX00003789   AAGTGAACATAGATGTAAACTCGTCTATATTTGTGAAAGCGAATCGTAGTCGTAT
10   P03   AX00003790   CAAAAGCCAGTTTCCTAGACAAAGATCCGGTTCCAGTTTGGTCTAAGGATGATA
10   P05   AX00003791   TACGGGATATTGTAGCGATATGCTGTTTACTAAAAGAGAACGAGCTCCGTACGC
10   P07   AX00003792   CTGGTGGTGCCCCTCTATTTACTTGTGAATCGACAGAGGAATTAGAATTTGTTG
10   P09   AX00003793   TTTAAATTCCCTCAATGTATTTGCCTCAGTTAACGACTTGGCACAACCTATTGCG
10   P11   AX00003794   AGTGATGTACATAGTCCGGGCGGGATGCAAAGCAACTGGTTTAGTCGTTGTTTT
10   P13   AX00003795   TTGCTACTTTATTTCGAAACAGAAAGAAACAAGAAGCTGAAGGTCCGATGATTCT
10   P15   AX00003796   TCAAAACTTATGGGATCGTTGGCAAGCATGGCTAGCTGAAGATTCTTTTTGGCC
10   P17   AX00003797   GAACTATGAGGAGATTTTGCCATCTCTTCATTCAGATATTATATATATTCAGCAC
10   P19   AX00003798   AACATGTGCGTGATGGATTACAATGTGAGAAGATTACTGTGTCTCGAGTAGAAT
10   P21   AX00003799   GTTTTATACTGTGTATCACGAGTTGAAAAAAACAGGAAAACAAGTATTCACAGTT
10   P23   AX00003800   AGTGCAGGGAAATGCGATGGAGTGATCTTAGCAGTCAAAAAGCGAAAAGATTCC
11   A01   EMPTY        -
11   A03   AX00003801   ACTAGTAACGCTACCAATAATGTTGTTCTTTTGTATTATGATTGCTTTCGAAACG
11   A05   AX00003802   TCAAAGGTACTCAATACACCGGCATTTGGTGATGTTACGTGGGCGTGGGTATTT
11   A07   AX00003803   TGGATAGCGGGTATTTGTGCAGGAACATCTTTACTACATGCAGCAGGGGTGCTG
11   A09   AX00003804   TTGCTGGAATACTTCTCACCACGCACTCAGCAACCTTTGTTATTTACTGCAACTC
11   A11   AX00003805   ACAAAGCAAAATCTGCTCATTTCTATATTGAAGAAAGCGGCACAGAGGGAACGA
11   A13   AX00003806   AATGAAAGCTGGCTCGGCCTTTGGGAAGGCACAGAATACAAAGTGAATTATCAT
11   A15   AX00003807   TATGTGCGTCAAATGGTGAATTACGGATCGGCTGGAGCAAGTCAGGGCTATTCA
11   A17   AX00003808   GCTGGGGAAAATGGAGCTGTACAAGGAAGTAGTATTGCATTTTCGATTAGTAAC
11   A19   AX00003809   GAGTTTCGTAATTTAGAAGAACTGCTACATGCTTTTAAACTACAAGAAGGAGATG
11   A21   AX00003810   TTTACCTCCGCAAAAAGAAAAAGGGCTAGAAGTACAATCAAAAAGTGAAGATTCT
11   A23   AX00003811   ACTGGTACCGATTCAATAGGGAAATCTAATAGTGGCGCTGAGAAAGTTTCATTG
11   C01   AX00003812   TAACTTTGTTGAGGCTAGAAATTTTGCTGCTTCAAAGGTGAGTGGAACATGGAT
11   C03   AX00003813   TCGTGTAATACTCTTGAAGTCGAATATAATTACAGCATCTTATGTTGAAAATGAG
11   C05   AX00003814   ATTGGAAAGCCGACAACTAGGATTAGAGGAATGTGTAACGTTTTCAGATTATACA
11   C07   AX00003815   ATCAATTAGAAAGTCCACGTACGGCGAAGAAATATGATACGCAAGTATCACTGG
11   C09   AX00003816   GCGATGGATGGTGCCGGGAAGTTCATTAAAGGGGACGTTATTTTCGGCATTGTC
11   C11   AX00003817   AGAACAAATTGTGAAGGCGAACGGAATTCAATCGGTACTGCACAATTTAGAAAA
11   C13   AX00003818   AATGGCGTGGCAGTTTCACGGTAAGAAAAAAACGGTTGGTTTTATTACGACAGA
11   C15   AX00003819   TGCATTAATTGATGGATTGGCATTGCAAGCCTTATTCAATCCATCTTTTTCTAGC
11   C17   AX00003820   AGAATACACTTCAAATAGATTTTTTCTACAATTGACGTTTCTTGAATTAGCAACAG
11   C19   AX00003821   AATTGAAAATTGGAAACAGAACGTCTTACATAAAGAAGCGAAAAAAAGAGGTCG
11   C21   AX00003822   CCAACATTGCGGTTTCAATGGGGGTATAGTGGGCACGTATTAGGATCGGTTTGG
11   C23   AX00003823   AAAGGACATATGCGAGAACCACATTGGCATCCGAATGCGTGGGAATTGGATGTT
11   E01   AX00003824   GATACTGATGGTGGAGCGCATCCTGACTGGTTAGAAGATGCTAGAGCGAGAGA
11   E03   AX00003825   ACTTGAAATACATTCCTATGTTAAAAGCAATTTGTAATCAAGATATGGGAATAAAA
11   E05   AX00003826   GCTTTATTGCTGCCCTTCCTCTCGTAAGTTTACTGAGCCTATTTTGGATTTCTTT
11   E07   AX00003827   TGGGGGATTAGCTACAAAATGTTTTGCTGTAGATACTTGGACAGGAGATGGGCA
11   E09   AX00003828   CCACAAGTAGGATTTAAAGCACCAGACATAACATTAAAAGGATTAGATGGGAAG
11   E11   AX00003829   CTATGGATTACTATGCGGTTGTAATGACGACGATGATTGCACTATATGCTGCGA
11   E13   AX00003830   AAAAACTCAGCATCGGCAAATACGATGCAAAATCTGGTCATTGTACCAACATGTT
11   E15   AX00003831   CCAGTAGCGACGAAAAGCGGTGGGGCTCTTCTTGGGATTCAGTTAAAACTTGCG
11   E17   AX00003832   GAATGTTTTTCCCTGAGCGGGGGAAGAAAGTGCCATTTACAATACATAATACCG
11   E19   AX00003833   TTCAGCGGAAAAACGAAGTATTGTTAATACAGCGCCCTGATCATCTTGGCTTCC
11   E21   AX00003834   CACGTGAAGAGAACGGAAATCCAGGAAGTAACAAAAATGAATCTCTTGCGAATC
11   E23   AX00003835   GGCACTCGAAGCGATTAATGATTTAACGTCAAAAGGGGTTATTGCAGGTTACGA
11   G01   AX00003836   ACTCAAATGAGTAATCAAGGCATACGACTAATTGGACCGGCTCTTGGAGGCTTG
11   G03   AX00003837   AAAAATTTCACAGTCTATATCGCTACCTATAGAGAAAATAGGCTAGCTTATAACC
11   G05   AX00003838   TTTCCATTAGACCCTAATAGCCATAATTTCAAAGTCATCATTACTTGGGAAGAAA
11   G07   AX00003839   TACATCTGGTGATACCGCATTCCGTGCGGCACGTTCTATCATTGCGGACTATTT
11   G09   AX00003840   GAGATTAGATGAGGCAGAGATAGAGAGAAATACTTTAAGTCATATTGCTAAGGG
11   G11   AX00003841   TTTATGGTCAATGCCGCCAGAGGATGACGATCGTAAGGGACCTATTCATCGTAT
11   G13   AX00003842   CGATATGCAATCCCAATTGTATTTGTCGGCATCGCAATTCCACTCTACACGTTAG
11   G15   AX00003843   ACTTATCAAGTGAAGCTGGATCAAATCAACAGACAAATCAGTGTATTGGACGTTG
11   G17   AX00003844   TGCAAGCCCCCTGGTGATCATTTGTGTTCTGGACTATAATGTCGTCCATGAAGT
11   G19   AX00003845   ACAAAATCTTTTAGTTTTGGACAGACGTTAGTAATTTCAATTGCAATCGGAATCA
11   G21   AX00003846   AGTATGACGAAAGGCGCTATTAATACAATGACTTTCACACTAGCAAAACAGCTCG
11   G23   AX00003847   GGTCATAGTATGGGATCTTTCCTATCAAGACGAGCTGTGCAACTTAGAGGCGAA
11   I01   AX00003848   TTTTTGGAACAGTTTTACCTAATGCATTAGATCCAAATGAATCATTAGCAGGGAA
11   I03   AX00003849   AATAGCAGCTATGGCAATTGCTTTATGGGCGTATCGTGAGTCAGGGTGGTTAAG
11   I05   AX00003850   GGCATTGTAGGTACACTTGCTCCTTGCCAATTAACAGGAAACATTAGTGCTATTA
11   I07   AX00003851   CATTCCTTTTCCGTACATCCGGATCAATCTAGTGTAGTGGCGGTAAGTACTAAAG
11   I09   AX00003852   TCAGCGAAGACGAATGTAAGCATGAGTCGTAGTAAAACTGTAATCGCTAATGTA
11   I11   AX00003853   GGGTTTTCATTAGGTGCTCAAGTGTTAATTACGATGCTTAGCATGAAACCCAACT
11   I13   AX00003854   TCTCCCTATGATGACAGTGCATATAGAATGTCTATTCATAGTGATGATCCTGTAT
11   I15   AX00003855   GTTGGGGAGTTACTAATAAGAGGACCGAATGTAATGAAAGAGTATTGGAACCGG
11   I17   AX00003856   GAGTGGGGATTTTAACCCAATCCATATTGATCATGAGTATGCGAAACAAACTAG
11   I19   AX00003857   ATGTTCGTATCCCAGCTGGTGGATCAAAGCAGGTTGCGAGCTATGATACAGTTG
11   I21   AX00003858   ACACATTTAATTTCAAGGAAAGGAATAGGGTATGTACCAGAAAATCAAGGTATCT
11   I23   AX00003859   CAGGGAAGAACGATAAAACAGAAAAGTGATCTGTATCAATCGATATCCTCGAAG
11   K01   AX00003860   ATGTACAGTGTCGGTATTAATCAGTCTTGGTAATACAGAACAATTACCATTTCAT
11   K03   AX00003861   TTGCAATTCCTGACTATACGTACAACTGGTAAGTTAAGAGAACGTGCACGTATTG
11   K05   AX00003862   TGGCATTTTAGGAAGACATACTGAATCATTTGAGCATCTTAATTTAAATTGGTCA
11   K07   AX00003863   AACAATCCTACCGGTTCTTTACATGATGGGCTCAACAGAGCTGAAACGGGTAGT
11   K09   AX00003864   AACTTTATCTCACCATTTCAAAGTATTACGTGAATCTGGTGTTATGTATACACGC
11   K11   AX00003865   CATATTTCAACTGAGTTGTCAGGATGGATGGTGAGTTCATATGCTTTAGGATATG
11   K13   AX00003866   TAGAAATATGGGAAGACGCACTGTATTTAGGGGAATCGGGGAGAACGATTCGC
11   K15   AX00003867   ATTAGACGAAGAGGAAGAAGGGATTCAATTCGTTTTAGAACGTATGCCTAGTCG
11   K17   AX00003868   GAAGATCGCCTCATATGCGGAATGAAACTAGGTCCTTACTTAGATCGTATATTAA
11   K19   AX00003869   TTACCACAGTCTTCGCAAATTCAGTTTTCAGATGGGTTTGTTTGGGATGATATAC
11   K21   AX00003870   AGCTATGCAACAAGCTTAATAGTTTGCATCTATCTAAAAAAGAGCGTGAACAAAT
11   K23   AX00003871   TCAACGGGTGCTAAAGGGGCAATCGGTAACACTGAGCCTTATTGGCATACCGG
11   M01   AX00003872   AATTGGAATATCTATGGCAATATTCGGTGCATTAGATCATAACCACAAAATGTTT
11   M03   AX00003873   CTTTGTGGAGAACCTTGTGGTTGTGAGTGCAATGAATATGAATTAATTTGTAGTT
11   M05   AX00003874   AATCATGGGGGAGCACCAACTTATACCCATGGTGAGGGCTGGTCTCCGAGTTA
11   M07   AX00003875   TGGAAGTATTCCTGACCTTGTAAAGAAAGGTATTGTAGATCGAGAAGGAAATGG
11   M09   AX00003876   ATATGCGGGAAGTTCTTTAGACGAAGTCAGTTCTTATACTGGTCCATTCGGATC
11   M11   AX00003877   AGGGGAGCATATCTACACCGCCCATTCCTAGAATGGATTGCTTCATTAGCCATT
11   M13   AX00003878   AATGAGCTCGATGAATATTTTAAGGGGAATAGAAAAGAGTTCACAGTCCCGTTG
11   M15   AX00003879   CCAATAACATTGGTTGTCGCATGGATACACGCAAGTGCAAAAGATGCGTTATCA
11   M17   AX00003880   AATAATTGGACTTGTTCAGATGGTTGTACTTATCCCAGTTTCCGTTGCGACTGCT
11   M19   AX00003881   TACTCGTTGCATCAACGGAACCATAGACGCATTGTTACGATAGATGGAAAAGTA
11   M21   AX00003882   TATGACAAGTAGCGGGTTGATTGCCTTATTTCTATGTGTTCTAATGGGGCCATG
11   M23   AX00003883   AACGGAATAGCCGCGGATAATGGACGTGTAATGCAAGCGCTTAGCGAGACGTT
11   O01   AX00003884   AAACTCGTTTTACAATATGCACCACCACATTCTCATATTTCAGATCTTTGCTGTG
11   O03   AX00003885   GTTGCATATGTCACTCCATCTCACCAATTCCCACTCGGAATCATTATGCCGTTAT
11   O05   AX00003886   AATGAGAAACATGTTTTTGTGTATGACCTTGTAACCGCGGAAGCTCATAGATCAA
11   O07   AX00003887   GACAAGCTGTGTTTTGGGAAAAGGGTGAATTTCATGAAACGAGTACAGAAAAGG
11   O09   AX00003888   TCGCGAGTTTTATGGTGCCAGCAGACAATAAAACAAGATTAATAAATGTACTCGT
11   O11   AX00003889   GGTGGTTTTTCCCATTTAATTTATGGCAGAAACTATTTTTCAGTATTGGTATGATT
11   O13   AX00003890   GCTGGAATATGTTTTGTCATTATTACATATTACTTTAGCAGTAAAGGCGGATTTT
11   O15   AX00003891   TTATTATAGAGAACTCGCAGACCTTGGTGTAGAACTGTATCTACCATCAACGTCC
11   O17   AX00003892   ACTGAGTCCCCTCTATTCGAATCAGTCGTCACATTTACTGCCTCTATTGTCAGGG
11   O19   AX00003893   TAGTAAATGGCAACATTTGCGGTTTAGAAATTCAGAACGACACAACTACTATATT
11   O21   AX00003894   CAGAACCGGCATCATATGAAAACTATGTACCAAAAGATTGGAGTGGTACATATG
11   O23   AX00003895   AATGGAATCAAAGCGCCACATGGTAGAAGTCAAACTTGCAGAAGTCTGTCAAAT
11   A02   EMPTY        -
11   A04   AX00003896   AGGTGACAATCGGTTAATTAATGAGCAAACTAAATCTCTTTTTTTAAATTTGCACC
11   A06   AX00003897   TTTATGTTTCTTCACAAATACAGTTAAATGATGGCGGTCTTGTAGGGTTTCTTAT
11   A08   AX00003898   TTGGAAATAGGAGTAAACATCCATACAAATAAGCTATTTTATAAAATTCCTATTAG
11   A10   AX00003899   CAAACACAACCTGCTTCAGGAAATACTAGTAGTGCATATTACAAAAATTGTGCCG
11   A12   AX00003900   GGGAGACTCTTTTTCTCTAAGGGTGGTAAATTTGAAGCAGCTAAACTGAACATC
11   A14   AX00003901   ACTAGATGATGCTTTAACGTATCCATCGGGAGAAGTTATTACTTCAGCTATTGAA
11   A16   AX00003902   AAATGTAACGGTTCAAGATATTACTACTGCATGTGGGATAGCGAAGGGCACTTT
11   A18   AX00003903   AGATGGTGCGACGATTTACGCAACGCGTGACTTAACGGCAGCTCTATATCGTCA
11   A20   AX00003904   GATTTATTGGGTGGTGTGAAAACAATAGACGAGGTAGCAAGACTGCGCCCACTA
11   A22   AX00003905   AAGAAGTGAGTGCATTTCGATTGCCAGAAAAAACACCATGGTTACTTCGCGATG
11   A24   AX00003906   GATGTGTGGGATGGACAATATGTAATGCTATATAAAAAAGGATCGATTATCCCTT
11   C02   AX00003907   AAAAAGCAGTGGGATTGGATGAGGTGGCTTCCTCACGTATGGGATGAACAGAG
11   C04   AX00003908   GCGATATTAATAGTTTAGAAGGACAATGGGCTGGGGCAACACAAGCGAAGTTCC
11   C06   AX00003909   CAAAATTATTTAAGCAGGCATGGAGTAGTAACTCTTTCGCAGAATGCCCGAGCT
11   C08   AX00003910   ATTAGGAATTGTGTATTACGAAGCGGGCCAATTTTATGAAACGCGAGATGGCGC
11   C10   AX00003911   AGTAACGTATAAACCTGATGAAGTATCGGTGGAAAAGAAAGATCCACAAATCAAA
11   C12   AX00003912   GTGGATCCGAAGCCACCAGAACCAACACACCCAACAATTACAGTATCACCAAAA
11   C14   AX00003913   ACTTATCATTCTATGGAACTAGGATATCCGGAAGCAGATGCAAAAGAATGGATG
11   C16   AX00003914   TTTTATGAGATATTACAGAAATCAAATTTGTACGTTGTTGCTTCGGTAGAGGGAG
11   C18   AX00003915   AGGGTGTAAACTTTGTAGCCTCCACAGCAAAAGGATTTGCCGACAAAATCGGAA
11   C20   AX00003916   AGATTGCAATTGGACATGATAAAGTTTTTATTGGGCTTATTGAAGGTATAACAAG
11   C22   AX00003917   TGAGCTACGACACTTTTGTAAGCATTGGTCACTTACTCAATTGGCAGAAAGACTG
11   C24   AX00003918   GTTTTTCTCAGAGTTAGATGGAAAAACAGCATTAGCGTTTTGGCAGCAATATCCG
11   E02   AX00003919   TAAGACGATTTCCAAATGCCAACAAATTAGCACGATTTGCGGGGATTGCGCCTG
11   E04   AX00003920   GATTAAGTGAAGCAGCCAATAAATCTAAGGGGTCTAAATCTTATTCTGATTGGAC
11   E06   AX00003921   AACGTAGACAAGAGAGTTGAGAGTATTTTATCGATATGGAAAGAGCAAGTAGGA
11   E08   AX00003922   ATACCTTTAGATGATAAGCATGTGTTAGTTGAATTAGATTCTCCAGCTGTTGAGT
11   E10   AX00003923   AAACGGGGGATTTTACTCAAAAACCACTATTCGTTCAATTAATGAATCAGACTAA
11   E12   AX00003924   TTATTATCAATTTGGACTGGTAAAAGAGTACCTGCGGATTACAACACTATTATTA
11   E14   AX00003925   TTGGTTTAATCAATTATGCGGTGAGCATGGAGTAGCTAGAGTGTTTGGTCCGCA
11   E16   AX00003926   CTCACACTACGAGAGCAGTAATTTTTATTCCACCACTACTATACTTTGCAAGTAG
11   E18   AX00003927   CTGCTCGTGATTCAGTTGTTGACAAGGTTAGTGGTTTAGATCAAGGAGCAAGTG
11   E20   AX00003928   GTAGTGCTGATTGGAGTTTGGAGACTAACGAATCAGATTTAGTCCGATTATGTC
11   E22   AX00003929   CATACAATAACAGGAGAAATTATATCAACTACATCAGTAAATAACACTATTCAGCA
11   E24   AX00003930   ATTGATGTAGAACGTATGGACGATAAGGGTGTATATGAAATAGAGGTAGAAACA
11   G02   AX00003931   ATTGCATCAATCGGCGTTTTATATGGCTATGGTAGTGAAACAGAATTGACTGAAG
11   G04   AX00003932   TTTGATACCTCTGGGTTACCAAAAGAACTTCAATCATTAAAAATACACGGACGAA
11   G06   AX00003933   GTTCAAGGGGAGACTGCGGTTTTATCTCAGTTAATTATTCACTTTGATTATCAAA
11   G08   AX00003934   AATTTCAAGAAGATGGGAATGTATATTTGCAAATATCAAGAGGCGCCCAAGCAC
11   G10   AX00003935   TGATAGAGGAAGAGGTTGAAGATGTGAATCGGTGTATTCGTATCGTCTTGATGA
11   G12   AX00003936   TGAACAAGGACAAATACTACTACAACAAAGGCAGAATGGTATTTGGGGTGTCCC
11   G14   AX00003937   TGGTTTGGATTCCGATTTCGCCATCGTATCAAGAACCACATGATTTACTTGGTTA
11   G16   AX00003938   GCTGACGATTTTAGGGCAAATGTCAGCTAGTTTTGTACACGAATTTCGTAATCCG
11   G18   AX00003939   AGAATTACCGTATCGACTACGTAAGCAAGTTCCATTCGCGCAAGAATTTGAGTTT
11   G20   AX00003940   CTGATATTCGTTTCCACGATCTACGGCATACCCATGCAACATTAATGTTAAAACA
11   G22   AX00003941   AAGCATCAGATAGGTTCTTTTTTAATAGATTTATGGACCCATTTTCGGTTTCTGA
11   G24   AX00003942   AGACGTGGGAAAACATGGGGAATGCCGCCCTGCACCCTATTGATACCCTTAGTA
11   I02   AX00003943   TGATATATGCCTACTTGAAACCAGCAGATGAACATAATGCACCAAATCCTTTCAC
11   I04   AX00003944   TCACGCAAAATTAATTATGACTGATCACATCGCCTATATTGGTTCACAGAATTTT
11   I06   AX00003945   TTATTGATGGTGATGCAGTTGGAGGATATTTCGTTACACTGAGTAATTTCAATAA
11   I08   AX00003946   GGTATTACAGACCAAACACTTAGCTTAATAGCAAGAGGAAAAAGTGAACCAACA
11   I10   AX00003947   TATAAAGGCTATTACCGTTTATCGAACGATATTATGGATGATTTATATGAAGATG
11   I12   AX00003948   AAAATGCTGGAAGAGTGCCAATACATGCTAAGTCACATCGCACGTGTTGGAGGG
11   I14   AX00003949   GGAAAGAATACGTGTATTATCTCAATAAAGAAGGGCACGCGATGTTTGGTGATG
11   I16   AX00003950   TTGATCCAGGTAAATCACATTGGTTATCCGATAATTTAATCGTCCGCTCATCACC
11   I18   AX00003951   GTTATTTGTATCATCAGGACAGATTGGGATAAATCAGAATGGCCAATTCCCAAAG
11   I20   AX00003952   TTATGTGGTCACAAGTTCCAGTAATGCTTGCGATGTATTTTCTTCAAGGTGCGG
11   I22   AX00003953   ATTATAGGAAACTTATTGCAAGCTATAGGGAATTCCTTGCAGGCAATTGGAGGA
11   I24   AX00003954   AAACTAGCGTATTACAAGAGAACGTACAATGAAGATCTAGAACATAAATGGAATC
11   K02   AX00003955   AATGCAAATGCAGCAACAAGGTATCCAGCCGTATTATTCATCTATGGAGTATTTT
11   K04   AX00003956   GGTCCTTATAACGAGGTAATTACAAATGTTTCTATAATTAATCAACTTTCCACACC
11   K06   AX00003957   GAAGATGGGTACATACTTACAAGCTATATGACAGTTGTACATATAAACCCGCTAA
11   K08   AX00003958   ACCATTTCAAGCAATAATTAACTTCATATTAACATTAATATTTTGGGTTCCGGGGG
11   K10   AX00003959   GCATTGCAAGCCGCGATGCTTTCAATTGTTGACCCGAGTAAAAGAGGAGTTGCT
11   K12   AX00003960   ATAAAGCATGGTGAATCTATACGGTTTAATGTAAGATACGGAGGAGATAGCTCC
11   K14   AX00003961   CAGTACATCCCGAAAGAAGCGAAGAACTTCTTTGATAAAAACGGAACATTTCTTT
11   K16   AX00003962   GATACATACACTCCGCGGAATTATGTTGGGAAATATGGTGGAACATCAAGACTC
11   K18   AX00003963   AAGCGATTCCGTTTGCATTTATGGTGGGGCACGGATTCCAGCATTTCCTTACGA
11   K20   AX00003964   AAGGGGATTCAAGAGAAGAAGGTGACTCTGGTTGGTCAATATTAAGTGGTTATG
11   K22   AX00003965   AAGAGTACGAAGGGGATCTGATTGTTGTGTACAACGTACCTGGTGCTGAGTTGT
11   K24   AX00003966   GAAACGATTGTGGAAATGGTTAGACTACAAGAATATCCTAATTATCCGTCAAGAT
11   M02   AX00003967   ATATACTGAAATAGAAGATTTCAGTCATACGGATGGGGTTGTATTAGAGATGTCT
11   M04   AX00003968   GAAGCGCTTATGAAAAAAGAGTTTCCGAATAATGCGGGGAATCCTTTGTTAGTA
11   M06   AX00003969   CTAGTGTTCATGGTCTTTTAACGAAAGAAAATATTCCGCCTAATATATTTCCGAT
11   M08   AX00003970   TTGAAAGAGGACATGCGAATCCCTCGTTAAGTGTATTGGAATTAATAGCGAAAG
11   M10   AX00003971   GCTTGAATCGTGGCAAGTTAAAGATTGGTACCCTTTCGATGAAACTGGTGATGT
11   M12   AX00003972   CAGCATTTTAATCATCGCTACTCTTTCTCTTTCATATGGAATGTATCATGCAGCA
11   M14   AX00003973   GGAATTGTGGGTTCTTTAGTTGCTTTTTTAATACAAGGTGCAACAGAAGAAATTG
11   M16   AX00003974   TTCTCTAACCATTCATTCTAATGATTGTTCATACGTAGAAGTTTTTCCAATTGATA
11   M18   AX00003975   CTGATGAATGCAGGGGAGTCATTACAGATGATGGCACATTGTGTCAAATTATGC
11   M20   AX00003976   ATTCGGACCGTCAAAAAAATAACTGTTTTGTTGAGACTCATACAATTGGTGGTTC
11   M22   AX00003977   AGACAACGTAATTAAAATAACATGTGTTTGTGTGGGGATAGCAATTATCTACGCT
11   M24   AX00003978   TCTAAAGATAAGCATCATTGTGATGACGATTGGTGGAAATCTAAAGATAAGCACA
11   O02   AX00003979   AACTTCAATTTGTTTCTTTTCACTTGCAATTTTTAATTTGTTCGCATATTGGTTTC
11   O04   AX00003980   AAAAGTTTCTTTTTGGGGAGCTTCGCAATCCTAACATGCTTTATTTTATTATTAAC
11   O06   AX00003981   ATCGGAAAGAACACATTATGGATCGCCAAGTTAAGGATGCAGTTGTTGCTAAAT
11   O08   AX00003982   TTTGGAGTAGCTTTCGGGTTTTTCATCCTCACTTCCTTATGTAGCTTCTTTAATAT
11   O10   AX00003983   AAAAGGTTTCCCAATTAACAGGTGTGAGTAAAACGATGATTGGACAAATTGAACG
11   O12   AX00003984   GTTAATACGACAACTGCACTACTTGCTGGTACAAGGCTGCTATTAAACTCTTCGA
11   O14   AX00003985   CCATTGACACCTGTTCAAATTCAGATGCAAATATTTATCGCACCTGCTGCAAGTA
11   O16   AX00003986   AACGATTGGTGGCACAGGCGCGATTTGTCTAGGGAGAAAAGGAGAAGTATACG
11   O18   AX00003987   AAAGGGGCTCGTATTAACAAATGGGGAATTTGGTAATAGATTAGTCGGGCATGC
11   O20   AX00003988   ATGAAGTGTAAGGAACATATACTTACCCCTACAAAATTCCCATTCGAAATTCACG
11   O22   AX00003989   AACGATATGAAAACATCTTTTGCAAACAAAGAATTGGCCGATTTGGTGAAAGGAA
11   O24   AX00003990   TGAACTATTACTATCTTCAGCGCAAGTCATATTTGATGAGGGGTTATTCCAATGG
11   B02   EMPTY        -
11   B04   AX00003991   TTTTTCAGCAGAGCAACCTTCTTAGAAACTTGAACCTATTTGATAATATCATCTTG
11   B06   AX00003992   ACACCTAATATTTCAGAAATATGGGGAGCGAAATTTAGCGATATCGGCAAGACG
11   B08   AX00003993   AAAGAAGTACCCAATACAGATTTCTCTCTTTTGAAGGGTGCATTGATTCAAAATT
11   B10   AX00003994   AATACAATTGGTACGCTCCCACCTGCCTCTGCTGAATCGCAACCTACACAAAAA
11   B12   AX00003995   TGCGTTTACTTATCCCATCAAAGAATAATTCCTCATTTCCTAGTAAACATACAGTC
11   B14   AX00003996   TCACGACTCATGTTGTGACAACTGATGATATGAGGGGAGGCTACCTAGCTGGAA
11   B16   AX00003997   TTATTCTTTCCTAGTTTGGGTATCTTACAGTACGCCTCAGCAAATGCTTTCAAGA
11   B18   AX00003998   CCAAGTATAGAATATGTTCGCTCTTCAGGCGGATTGTTTATGGACATGATGATTC
11   B20   AX00003999   TAATTAAACATGGCGGGGATGGTTCAATCGCTTATACGAGAGACGGTCAGTCTC
11   B22   AX00004000   AGCAGCAAATGAAGCGTTCAAATCTTGGTCTAAAACTGCTGTACCAAGACGCGC
11   B24   AX00004001   GGAACAGAGTTTCGCTACCGAAACCAGGAAACACGTAAATTAGACGGAGCAATT
11   D02   AX00004002   AATGATGTAGTCCATATCCCACTCGTTTTACATGGCGGCTCTGGCATTAGTCCA
11   D04   AX00004003   ATTTCTTATCCAGGGCGATGGTCCAGTTATCCACCTCATCACCATGATCAACCG
11   D06   AX00004004   CAAGAACAAATGCTAGAAACATCATCTCAAGTGGAACATAATCCAAACAATAACA
11   D08   AX00004005   TATTATTACGAGTACGATCCAATTTAGGCTGGTTATATAATATTCAAGATTTATAT
11   D10   AX00004006   AAACAACGTGAAAAGAAAAGGACAAGAGCATACGGATCGCTTCTCGGCAAAGCC
11   D12   AX00004007   TTACTTTTGGATTAACACCGGCATTTGCAGATTCTAATAAGGCGTCTGTAAGCAC
11   D14   AX00004008   GCAGATACTCACAGATTCCCAGATGTTCCTGCATGGGCTGACAAATCCGTTACT
11   D16   AX00004009   TTAGGGAATTATGAGTATAGTGGAAAAATCCTTGCTTCGGTAGAATTCAATTACT
11   D18   AX00004010   CAGAGGCTTTAATACGTTGGCAACATCCAGAGCTTGGGCTAATTTCACCTTTTG
11   D20   AX00004011   GATATTCATGGTTGTGAGACAACAGCTGCAGATTCTTCCGTTGTTTACCACACC
11   D22   AX00004012   TTACCTACATATTCAGCCGGTTTATATGAAAAACAAAATACGTCTATGGTAGTAA
11   D24   AX00004013   TTTATCGTACCGACTACTAGTGAAGGGTTAACGATTTCAAGCCCTTACGATAAGA
11   F02   AX00004014   AACAGATCAGTGCGTATTACAACAGGAAGTAATAATTATGCAGGAACTGTTTCTT
11   F04   AX00004015   TAACTGTCCTACTGATATTTGTAAATGGATTGATGATGGAGCCAATTATGATGAA
11   F06   AX00004016   ACATATGATCGAGCGGGAGTAGGGAAAAGTGGCAAGAGTTCCAAGCGACGTAT
11   F08   AX00004017   ATATACATATGGTGAGGTCTTAAGGCACGTAATTGTACATGAAATTCACCATATC
11   F10   AX00004018   CCAGGTCTTTATCCTAGTTTAGGACGCAAAAAAGAAATTTCTTATCCAGATGTAT
11   F12   AX00004019   CCATTTGTTATAGAGGGAAATGGTATTGGAAGTATAAAAGAGAGTTTAGTTGATA
11   F14   AX00004020   AATATAAAAACAATGCGCTGCGGTACATTAGCGGTTCATCCGAATTATCGTGGT
11   F16   AX00004021   ATATAGTAGAAAAATCAGGGGTAGGGAACGCACGTAGGGATTGTTTGAAGTATG
11   F18   AX00004022   AAAGAATACATTCATGTATTAACCGACCATACACCAAAAGATATAGCTGGTTGGC
11   F20   AX00004023   ATTCTAACTAAGTTGAAAATTCAAGAGTGGGTTAATACTTATCAAGAAGTAACAG
11   F22   AX00004024   GAAAAGGACAAATTCAACACATTTATGTTACGTGGCATATTCATCGCAGTTATTA
11   F24   AX00004025   TGGTTTGGCATTCCAAGAAAAAGTGTAGTGTCCTATGATAATACCGGGGCACCG
11   H02   AX00004026   TTGCTTTCGGTGTTGCAATGACTTGCAATATTGCATGGAATACAATTGTAGCCAC
11   H04   AX00004027   CTATCATGTATATTGCCTATTCAAAGATGCTACCTAAACTATCTTCTGAAACGAAT
11   H06   AX00004028   AAAGATGCCTTATTATCTATTCTTTCGTGTGATGCTGCTAAAGGCATATTGAAAC
11   H08   AX00004029   AGTTATGGACTTGATGGATCACTTTGAAGGACAAAACAACTTGCAAGTACTTGAC
11   H10   AX00004030   TAAGATTTTGGATCTTTATGAGTTTGCCTATTATTGTATTATCGGTCGTTCCTGC
11   H12   AX00004031   TATTAAAATAGAAGGAAACGAGATTCCTGTTACATACGATAGTGACACTTGGATA
11   H14   AX00004032   ACATGCTGAGAAACATGGACATAAGCGTTTTGGCAGAACTTATAGTGGTTTTGC
11   H16   AX00004033   GCGAAAAAACGTGCACACCGGCTTGAAGTTACAAAGTCGATCACAAGCGCTCGT
11   H18   AX00004034   CTGTACCTTTCGGAGCCAAAATAGCCAAAACAATTGAGATAGGTATCAAAATTAA
11   H20   AX00004035   ACGTGAGCATAATTACGAAGAATCAGCTCCAGCTGCAACATATGAAATGAAAGA
11   H22   AX00004036   AACAAACTAATATTGTTCATTTTGCATTTCCTAATATTATTGTTCAAGTGGCATCC
11   H24   AX00004037   TGTATATTACCTGCTGTCGCTTTATTGTATATACTTGATGTTACCTTTGAACTACT
11   J02   AX00004038   ATGAGTGGGATAGTCTATCGAAAAGTACGGAATTTTTAAGAGTTTGGACCGACA
11   J04   AX00004039   TTCTGAAATGTTGCGCGAGTTTCCCGAAAAACTCGCGACAAACAATATAGAATTT
11   J06   AX00004040   TGGGAGAGAGTGTATGTGAATGATGGATTATTCCGATCCGTTCTTGGAAATGTT
11   J08   AX00004041   ATAACAAGGGAGATATTACTCTTGTGTACACAAGTCGTTACTTCCAACCTAATAG
11   J10   AX00004042   TAAGAGGATTTGGAAAGAAGAATACACGTACGTGGTTTTATACAAATAAAGCGAA
11   J12   AX00004043   TGTTAACAATAGTAGTGTATGGCACAATGTTTATCATTACAGCATTCGCATCCGC
11   J14   AX00004044   TCTGGATATGTATTAATTTTTGATTGGTTTGATGGTGAATGTCTTCATTCGCATTG
11   J16   AX00004045   TTCGGGGAAGATTGTATTGCTATTGAACATATAGGGAGCACATCTGTAAAAGGG
11   J18   AX00004046   CGTCATATCTTACTTGGGAAGAGTCTGGCGTTTTGGCTTTATCGGCACTGACTG
11   J20   AX00004047   TTGTATACTTGGCAATTAAACAACCAAAGTTAAAGGGAGACGAGTATGGAGCTC
11   J22   AX00004048   CAACTCATTACGTAGTTTAATAGGATCTGGGGCTTCTGTAATTGGTCCAGCGAT
11   J24   AX00004049   CGAAAGAACGTAAACTAAATCGATTGGAAGCATGGACTAGGGACAATTTATGGG
11   L02   AX00004050   TTGTACTGTTTATCGGGATAATTGGCCCTGATGCACTATTTATTTATTCAATTGG
11   L04   AX00004051   AGTTTGGAGAAGCGTTAGCTAGTCTATTTGGTACATCAGAGGAAGGGCAATATG
11   L06   AX00004052   CGAAAGCTATTAATCAATCAAATCATATAAAAAACATTGCACATAGAGGGGCTTC
11   L08   AX00004053   ATAGCCCCGTTCTTTGCGGGACAATTCCTATAAGAATGGATACGCTTCAATCTG
11   L10   AX00004054   TGCTGTTGTAAAAGAAACAACTGATATGTATTGGATAAACGGATTTATTATCGAT
11   L12   AX00004055   AGCGTTTCACTGGATAGATTATAATCGAGACGCTTTACATACTTATAAAATCATG
11   L14   AX00004056   GCGAAGCTTTTTTCGAAGAGAGAGGACACCATGCAATATTCTTTAATTTTTTAGG
11   L16   AX00004057   TTCAAACCGTCATTAACATAGATAGACAAAGAATGTTACAAGGGGTAGATCGATC
11   L18   AX00004058   TAAGTGACTATAATTACGGCGTAGGAGAGATGATACCTAAATTTTTAGTTGAAGT
11   L20   AX00004059   TTGTAGGGATGGAAACTGGTGTGAAATTAGTAGCAAAGAAACCACAATTTGGAC
11   L22   AX00004060   GGTGGCGCAGCGGCGAGTAAGGAATATGCATCTCATAAAGATAGTATATACTGT
11   L24   AX00004061   CAAATAGGAGGGAGGTACTATCCAACGTGTATGATTATAACAGCTTGTGAAGGA
11   N02   AX00004062   GGTCCTATACGTATGAGGATCATATTAGTTCTATCGTTAAAGAGGCAGAAAAGAA
11   N04   AX00004063   GTTTATGTAGTCGGTAGTTTTCCTGGTTGGGATCTGTCTGTAAATCAATTACAAC
11   N06   AX00004064   ACAGAAGATGATTGTATAAGTGCTGATTTAAATTACTATTGGATGCATACAGCAG
11   N08   AX00004065   TAAATTTTGGATCAGTCCAATGTTTATTCATCCAATCTATCAAGGGATAGGAATT
11   N10   AX00004066   ATTTATTAGCCCTTTTGCGACGTTACCAATTTTTTTGGCTATTTGCTACTCTAATC
11   N12   AX00004067   TACATCTGAAGAAGGCGTTTCTAGTAGTGGTTATGATGAACGAGGATTGCTTGG
11   N14   AX00004068   ATCGTAATACAGCTATTGGAAAAGCCGCTTTTCTTTTAGCAATCATTATTGGAAT
11   N16   AX00004069   AGAAATCTATTTTCAATAAGGGCCCAATTGCAGTCAAATTGACGGACTCTGGCC
11   N18   AX00004070   ATTTATCCGATCTGGGATACCCCTGTTAGCAACCAAGCTAAAAAGAGCCAAATG
11   N20   AX00004071   TTCATCGTGTTGATTCTTTGACATTAGATCCGCATAAATGGCTTTTTCAGCCTTA
11   N22   AX00004072   AATTATACGTGGCAGATGCACGTATATCTGTTCATTATAGAGTTGAAAAAGCCGA
11   N24   AX00004073   AGCGCAAGAGGTGTTTTTGCAACTGTATCATTCAGATTGGAAAGCAATAGAAAA
11   P02   AX00004074   AAGCACAGGTTCATCACATGAAAAATAATCAACGTACTTCCGGACAAGAGGAAT
11   P04   AX00004075   ATAATAATTAGCTACCTTATCAATCATATTACATGGGGAGATCCCCACGGTGTAT
11   P06   AX00004076   TTCGGGATGTACAGAGGAGCTATTTGTTAAAACGGCAAATATTATGGAGGAATG
11   P08   AX00004077   CAGCGTGTGAACAGAAGAAAGAAGTAAAAAAGCAAACAGCGACTTCTTCTACTG
11   P10   AX00004078   AAATGAATTATAACTCAGGCTCTTCGCATTTACTTAGTTACATTATCCAAAAAGCT
11   P12   AX00004079   CAGAAAGAGTTTTATTAGCGACGGGTATGCAGGAAGAATTCCCATCTATCCCTA
11   P14   AX00004080   TTTAAACTTCTCAGAAACAGTAGAAGAATGGGAAGAGATGTTGCGAGAGAGTGA
11   P16   AX00004081   CGCTAAAATGGCTTATGTCATGTTCACTTATTTAGGGATATCATGGACTTTAAGA
11   P18   AX00004082   TGATGTCCAAGAGCTAGCTGTTGTAAATGAGCATATTTTCGAGTGGAACAACGA
11   P20   AX00004083   AATTCAAGCTGTCCCGACATCAAAGGAAACGGAAGCATTGGCACAGCAGCTAAA
11   P22   AX00004084   AGAGTATTCGATTTATGCTATTGCTGTACGAGTATTTTGAGTGAGTTATATAGTG
11   P24   AX00004085   AGTTTGCTTTCGCGTTACCTGAGTTATTAAATGATTATTTAGGTGATGCTTTATG
11   B01   EMPTY        -
11   B03   AX00004086   ATAGGGTCGTTAAATTTTACAGACGGAATGCGAGCTAGGAAGAAATGGCTTAAA
11   B05   AX00004087   TTCGAGCGTACCTAGAAGATGTTGTTGTGCATGAAAGTGTAAGAAATAAAGGCA
11   B07   AX00004088   AAGAGTATTAGAACCAAGTTTCCGTCCAGGTCTTCCTAAGCCTAAAGGAGAGTT
11   B09   AX00004089   AATCCAAACTCCCTTCCACTGCAAAAGAGGGTGATGTTCTTATAATAGAGGATG
11   B11   AX00004090   ACAATGGATGACATGATAGCCGGTACACAAGCTTTTATTGATGAATTACGCCGA
11   B13   AX00004091   TCATCTGCATATAGATTTTTTATGGGTTGATGAATCAGTTCGTCATGATGGTTAT
11   B15   AX00004092   ATAGAAGAGAGATTTATCCACTGTTCATTTTTAGAACAAGCTTTAAACGTTGCTC
11   B17   AX00004093   TTGATTGGCGGGCACCTGTCGCAAGTATGTTTTATTCATTTACCGGCGGTGATG
11   B19   AX00004094   ATGAGATTAGTAATTTATGTGCAGAGGCTCGTTTCAGTATAGTTGGGATTTTCCC
11   B21   AX00004095   CACAAGATTGCATAGGTGAACCATTGACATATGTGAACGCAAACAATGGATATAT
11   B23   AX00004096   ACGGACCGATGGAGGCAAAGGATGTATATATTAGCCCATTCGGAAAAGCATGTC
11   D01   AX00004097   GAAAGCGACACATTACGAAAATATAGCGGCCTCATTTTAGATGTATATGATGCTA
11   D03   AX00004098   CATCATCCCAAGGCTATAATCATATTGGCTGGAAATTGTTTGTTGGACAAGCGTA
11   D05   AX00004099   ATGCAGGAAAGATATCTGCGCGAAGAGGTGGCTGAACTTTATTCCCTCAGTCTT
11   D07   AX00004100   AGTTATGGAATCTTATTTAGTTGGTGCGACGGGATGGGTTTCAGTAGCAGGAAA
11   D09   AX00004101   AAATGTCATTCCTACGTTTCACTACGTTAACAGCACTCGCAATCATCCCTTGGTC
11   D11   AX00004102   ATTACAGCGAGTACCTGATGATATATGGTTTCAGGCATTAAGAGAAGGTTCATG
11   D13   AX00004103   GTTCATCTGAATTTTTACGAATGGATGCATATCATCCATCTAATTACTTCAAGGTG
11   D15   AX00004104   AACTAATATCACATTGGGAACAGTATGATTTCGGGGTATGGTTGTTAGTTAATAG
11   D17   AX00004105   TAAGAAAAAACTAAGGCGATTTATATTCATGTTTATATTTATTGCGGCGGCTACT
11   D19   AX00004106   ATTGTAGCAGTCGCTCACCCACACCCTCATGAAGATATAGAAAAATGTTGGGTT
11   D21   AX00004107   TTCATTCTTGCTGCCCCCATTGTTTTCTTCGCCACTTTGCACATAATTGGCGAAA
11   D23   AX00004108   AATAAGATTGGCCGATTAAGGAGATTTTATATTGCGAAGGACTATCGTCGTATAG
11   F01   AX00004109   GCAATTGGACATGTTGCCTACATAAATGAAGTACCGTTTCTCGTAATACGATGTA
11   F03   AX00004110   AAAAGGGATGGGTGCACCGCGATCTATGGGTAGATAATCTCTTATTCCATAACG
11   F05   AX00004111   TAAAAAGTGAAGTGCAGCAAGTCATACAGCAAAGTGAAGTGGAAATTACCGATA
11   F07   AX00004112   ACAGTGTTCTATCGTAAAGGAAGATGAAGCACGAAACCTCATTGGAACAGGCCC
11   F09   AX00004113   AACCACGTTAAAAACTTGTTTGAACTAGCGAAAGAAGGAAAAGTACCTAATGTTC
11   F11   AX00004114   AAGAGTGGTTTCGGTTATCTGGTGGGCAGTATTTTGGATACAACCGACTCGGTT
11   F13   AX00004115   TATTATCGCTGGTATTATTGGTTCTTGGATTGGTGGGAAATTACTTGGTAGTTTC
11   F15   AX00004116   CAGCAAGACCGATGACAGCTGAAGAACCTTTATTCTTTCCTGAAATTCATGGGG
11   F17   AX00004117   GGTATTCAGCCAATAAATAAAACGGATGCAACGACTTTTACAATTCCCAACTCCC
11   F19   AX00004118   TATATACGGTTCTTGGGAAGTCGTTGACAACAAAAACGGTCTTTGTCCTATATCG
11   F21   AX00004119   AATAGCTTACATACCAGTTACACTACCAATTCTAATATCTTCCTTTCTATTTGCTA
11   F23   AX00004120   CTTATTCAACTTGATATTTTCCCTACGGTCGTCTCGTTCGGTGTCACTAGGTTGC
11   H01   AX00004121   AGGGGATTGCTGTTATATGGAAAGAACTTTCTAATGAAGATTATTACTCTCTTGA
11   H03   AX00004122   AATGACTGCACATCGTGCGAGTTTAACAATCCCAAAAGGAAGTTACACCATTGC
11   H05   AX00004123   ATTCATCAGGAGCTAGATGGATTCCTATCGAAAGCATTACAGAACGCAATTCATC
11   H07   AX00004124   TATTATATGCTCTTCCGATTGTACCAGCTGCTCCGAAAGAAGTTGTCCTTGGATC
11   H09   AX00004125   GAACAGGCGATTGCAAACGGTCTTGAAGGTGAGTCGCTTTGCGGCGCATATAT
11   H11   AX00004126   GATTGCAAATTCACCACATTCTTTATATTCGCGCGGAGCAATGCACTACGTAATT
11   H13   AX00004127   AGCACAAGAAGATCCAACGATGGTACATTACTCAAATAATAGTATTAGCGAAGGT
11   H15   AX00004128   GACTATACGATTGACACATGGGACGGTCCGTATACTGGTAAACTATTAATTGGT
11   H17   AX00004129   GAACTGGTGGTAGTGGTGGTGGAGGGTATTACGGCGGAACTAACAGTAACAAT
11   H19   AX00004130   GCAGTTGTCGATTTGCATTGGGTATACCGCTTAAAAGGAGAACCCGTTCCACTG
11   H21   AX00004131   AAGAGGCGATTCGTCAAGAAAATCCGATTAAGCGAGTGGAAAGTAATTTAACAG
11   H23   AX00004132   ATTGGGAATCGCGATTGGTAATAAAGAATACTGGGGTAAAGGGGATGGAATAGC
11   J01   AX00004133   TGGTTGTAACCCAGCTCCAAAAGATGAAAAGGAGCCAGATCCAACGGAGGAAC
11   J03   AX00004134   GAATTGATAACGTTCTCGCTGTTGCTGGAGCTGCGCATGGCAATTTTTCTTTAG
11   J05   AX00004135   AAAAACCGACTTTCCAGTCAACGCAAATATTCGTGAACAGTTTAGCCATACATAC
11   J07   AX00004136   AAAAAGGTGCTTAATAGAGTTTGATGATGTGCCAATTGGTTATATTCAAATGTAT
11   J09   AX00004137   ACTGCATGGACACCAAACTTTAGACCTGGCGGAGAATTCTTTAATAGAGTATTAA
11   J11   AX00004138   TCAATAATGGATAAAATTGTAGGGACACCAGAAAAAGCAAGACAAGATACGGGA
11   J13   AX00004139   TTTTTGGTTACATGGACTAGTTGTCAAGCAAGTACAGGATTGGCGTCGTAAATC
11   J15   AX00004140   AAATGATGAGTTAAAGGCTTCATACATAGTTCAAACTTCAACTTGGACATTGTTA
11   J17   AX00004141   GGAAACCTTGTGTACGGAAAAGGTAAATGGATTCATGCTTATCGGATCTGTCGC
11   J19   AX00004142   AAACTCAACAAAATGGAAGGCGCCTAAAAGAAATGGTATCCTAGATATAGGTGA
11   J21   AX00004143   ATTCACAGAGCGCTCAAACAAACAAGCTTACCTCAAGAAAGTGTACAGCTTATAG
11   J23   AX00004144   TATACGCATCAGTAATTAACGAAATTAAAGAAGAGATCAAAAGCGATGTTATTGT
11   L01   AX00004145   AAAGGGAATCCAGACTGGAATTTTTCTGGTCCGCATGGGCCAGGACGTATCATG
11   L03   AX00004146   CATTATTGTCTAAGCGTGCGAACATAGGCTTCACAACAGGAGGGCATACAGGTG
11   L05   AX00004147   GATAGTAAAATGACAGCTGCATTGTCAGAAGAAAAGATGAAAGATCTTACACCTA
11   L07   AX00004148   ATTTAAATGGAACTAGCACAGATTTTCAAATGTTTTCGGTTATGCAGCCTATACT
11   L09   AX00004149   AATTATCTCGCATACAAATTCCAGAAGTAAGAAGTGTATTAAGAGCAAAAGTCGG
11   L11   AX00004150   AATAAGCATATTATTCCGTCCGATGACTTTATCGTTGAAAATAGTAATGCCACTG
11   L13   AX00004151   TTTTTAAGCCCGATGGAATCAAGAGTGCCAATGTGGGCGAAAGTTATGACCGGT
11   L15   AX00004152   GAGAAAACTACATCCGAAAACTCAATCCCTATGCAATTAGACCTTAGCGTTCTCA
11   L17   AX00004153   CGATTAGTGCAATAACGTTATCACGAGGTGTTGTGCATGTGCAAAGCATAGTAA
11   L19   AX00004154   ACTAATTTATATCATCCTTGACATGAATTCGTGGATACCGAACTTCAAGGAAGGA
11   L21   AX00004155   AGACAGCATGGAATTTCAACTTTCCATAGAAAGTTACATACTAGGCTTCTTGGCA
11   L23   AX00004156   TCTAATAAACCCGGATAGTGGAAACGTCTCCTTATTTGGCATGAACTATTCGACT
11   N01   AX00004157   TTACAACGAAAAGAGCATATGAAGAACTGGAAAAAGACGGTTTTATTAATTCAAT
11   N03   AX00004158   TACGTTCGCGTTAAACGGTATAAATTTAACGATATATAAGGGCGAAATTATAGCG
11   N05   AX00004159   ATTATTGTAGCAATAACTGGCTTAGGAATGTCAATAGCTTACTTTTCATGGAGGT
11   N07   AX00004160   GGATATCGGCCACGTAATAATGAATGGTCTCCTTAATAAAAATTGGTCTCCACCT
11   N09   AX00004161   GATGCTAAAACGTCAGATTGTATAAACGTTAGCGTTGCATCCAAAGGACCGGTG
11   N11   AX00004162   CATCTGTCCTTGGGAACATGGGGAAAGGATCTGATGGAGTATTAATTTGTCAAT
11   N13   AX00004163   AATCATTTGCGGTTGGACAAGTTCACGGTTATTGCGGAGGCGAACCGTCACTTC
11   N15   AX00004164   GTAGGGCATGTAGAAAATGTAAAACAAAATAAGGATGTATTACCTTGGGGCGCG
11   N17   AX00004165   GGAGCATACCAATATTTCCGAATGGAGATTACTACTTTTTTATTCAGAAGGACTT
11   N19   AX00004166   CAAAGAGTAAAACGAAACAATTGGTAGCTGAGATTGAAGGGTATGATTTGTTAAC
11   N21   AX00004167   TAGTAGAAGATACCTCTATTAATGGAAATCCTGTTTCTCCTGATTGGGGACCTGG
11   N23   AX00004168   TTACTTTATGACGACTGTATATTCGTTAAAGAAAACATTTCTTCCTATTCTGCTAT
11   P01   AX00004169   TAGTTGGGAGTCGTTTATTCCTCTCATTCCAGGTGCTACTAAACCTGATGATGCC
11   P03   AX00004170   AAATCGCTCTTGGAATGATGAGATGTTCAAATGGTTTTGCGAAGAAGTGCGTAG
11   P05   AX00004171   AGCATTTTCATCAGTTTGTACAGATCTATACAAATTTAACTGGTCAGCAGCCAAA
11   P07   AX00004172   ACGCTCAATGTGAAAGCAGCACGAAGTCTTTCAAGGATACTAAAGAGTAGGCCT
11   P09   AX00004173   TTGTTTATGGTTGCTGATCTTCGTCGTAGAAATGCATTTTGGTTGAAAAGATGGT
11   P11   AX00004174   CAAAACAATCTACAAGAGTTAGTACAATTTTATCCTTATGCTCCTGGATTTCAAG
11   P13   AX00004175   CTTAATACGCCAACGTCTAGCCGCTTATGACAAAGCTCCTATTCACCCCTCCCT
11   P15   AX00004176   GTTTTTCACGCTTGGATTCTTGGCATAGGAGCCTTACTTGCAGATGTTATCTACA
11   P17   AX00004177   TTGCTCAATTATCTATGGTTGATGCATCTCAGCAAGTTGAGTATAAAACATCTAA
11   P19   AX00004178   GACACTTGGGGTTGAATGGGGCAAACTCTTCCCTGTGCCGAACTATGATATTAA
11   P21   AX00004179   TACATCCGGTGTTTGGTATTGTATTTGCGATCGTTCTCTATCTAGCGATTGGTCC
11   P23   AX00004180   GAATCAATACTTAGCGCTAGGAGCAAATACGTTATTAGCAGTTCTCATGGTCGG
12   A01   EMPTY        -
12   A03   AX00004181   AGAGCTTCATGTCAACTATGTCATTCCAAATCCGTTTGATCCTAGGGTGGTGCC
12   A05   AX00004182   AAAATAAACTCAGTGCACCATTAGTTATGTATTGGAATGGTAGCCCTTATGCAAT
12   A07   AX00004183   CATTTCATTTCATCCAGGATTAATTCCCACTAAGCTCGCTATTTCTATTCTCGGA
12   A09   AX00004184   TTAGACGATGGTTCAAGTATCATCAAATCTGGTTGGCAAGCTGCCGATTCAGCC
12   A11   AX00004185   ACGTAATCCAAGTAATCCATCGGAAGAGGACAAAGAAAATTACGTTGAAGGACA
12   A13   AX00004186   CTAACAATTATGGTCAAGCAGGTCACACGTATCGTAGTTTTGAGGAGTGGGAAA
12   A15   AX00004187   ACGGGCTTACAGCAGGTGGTCACCATTAATAGAACGTGCGGTTTATGACTTAAT
12   A17   AX00004188   TGTAGCAGAACTTCAAAAGTTACATGATGAGACAGTAAACAGAATTCATCAAATC
12   A19   AX00004189   GACAGTCGCATCCCTTCAAACTGTTGGAATTATTCTAGTTGTTGCCATGCTTATC
12   A21   AX00004190   AGGCCGAAGAAAGGGGAGCGGGATTGGGCATTTGAATGTCTAAAGAAAGTCGG
12   A23   AX00004191   TATTCCGCAAGATTTATAAATAGCAAGCGAACAATCAATCCAGCTTTTGGGGCG
12   C01   AX00004192   AACACTCCTTCTAGATCAAGAGGCCAAAAACTATATACATTCAAAAATGAAGGTT
12   C03   AX00004193   TGTACAATCAATTAACCCCTCTTTCAGAAGCACAGCGAAAGCTATTACTTCCAAG
12   C05   AX00004194   ATTCAGCATAATCTTGGGCAATTTCACGATGCTATCAAAGATTGTGAACATCTTC
12   C07   AX00004195   GAGATGGTAAGTCAGAGTCTGGGTACTTCTTCCCTATTATAGAGAGAAATACAC
12   C09   AX00004196   TGATTGTATTTTCTACATGGTTATCTCCAATCGTTGTGTTCGGAATTATACTACTT
12   C11   AX00004197   TGGTTTCGTACAACGAACCAGTAAATACCAAACAAAAGATTTAGTCGCTTTATGT
12   C13   AX00004198   AAAAATCCTGGATATCCTTGCAGGATAAGTTTGAAGGATGCAGAGGTAGGAGAA
12   C15   AX00004199   TATTTTAGGATCAGGTGTCCTATTTTTATCAGGGGTAACGGCCTCAATAGCGGG
12   C17   AX00004200   GCATGGATTATGCGAAACACTACTTTAAAAGCTGGGGACAACATGTGCTTGCTT
12   C19   AX00004201   ATAGAGGCGAAAGCTACGTTGTATCAAATTTGGGTAATTCCTAATAAGGATAAAA
12   C21   AX00004202   CTTTTTCTTTTCACACCTCTTTTAGACAGCGTTGGGATAGAATATGTCGTGCCTT
12   C23   AX00004203   AGTTGATGATCTCATCTTGCCAGTCACTCTTAATAACGCAGAGTTCGAAAATTCA
12   E01   AX00004204   GGTGCTTCCTTCTAGCATTCTACATAAACACACGATTGCTTTTTTCTTACGTGCA
12   E03   AX00004205   AAATTGCATACTCCAAGGGCAGTTGGAAACAAATCTGTTTTCCAGCAACAGTAG
12   E05   AX00004206   GAACAAAATGGAATCAAGTTTGTTCATTGTCCTCTTGAAGACAGGGAGCGTGTG
12   E07   AX00004207   CAATCTGGGGAAGTGTTAGCTCACTCTACGTACAAAACGGAATTCACGGCAGGC
12   E09   AX00004208   TAGACGTACCAGAAGGCTGGACATTAAAAAAAGCTGGGGTAAAAACACGATACT
12   E11   AX00004209   ATAGACCAGAGATACTAGGGGTGTTAACAGCATTCATAACGGGCATTGGTATTG
12   E13   AX00004210   TTCAAGAAAAGCTATCTGAGATGATAAAAGTAGATCGTACAACTGCAGCCCGGG
12   E15   AX00004211   TTTGAAACCTGTGAGAATGTTCTTGTAATGCTTCAGGGACCGCACTCTTATATCT
12   E17   AX00004212   AGGGGCAGTATTAACAGCACCTGTAGCGGTTCTGTTGCTATCTTTCACTAGTTG
12   E19   AX00004213   GAACGTCGCTCGGGAGTTACTCCTCCCAGGTGGAAAAACAATCCACTTAGCCAC
12   E21   AX00004214   TTACTACGACATTGCCAAAGGTTCATATTGCGATTATGGGGATGGAACGCCTTG
12   E23   AX00004215   TTATGAATCAATGTGGAGTGGAACTAGATTTCCCTGAAGGACAGACTTGTTGCG
12   G01   AX00004216   ATGACTGGCATCGGTGCCTCTATCTTGCCGAAAAGTGCTATATCTCATATCCCG
12   G03   AX00004217   ACAATAGCGAAAAATACTAATTTAGTCGCTTCAATGGGGTTTAATTATCGCTACT
12   G05   AX00004218   CTCATTTTGTGGCGAGTGGATTAGGTACAGAAATAACGTACTTTGATAGTAATGG
12   G07   AX00004219   AGCATTATTTAGCATATGGGCCCATAATACTTTGTAATGAGTATGAGGAAAATGC
12   G09   AX00004220   CAAGCTGCAAATTTACAATATGTTTCTGCTGAGCCATCGGGAAATGTGGTAGCA
12   G11   AX00004221   AGCAAAACACATACCTTAAGCCGTCCCACTAACTTAACCATGGACATTTATCAAG
12   G13   AX00004222   TGAAGATGGTTATTTACTCACCAACTATATGACCGTTATCGATATATATCCATTAC
12   G15   AX00004223   CCGCTTACCTTTAGAATTGGAATATTGGGTACTTTCATGTATGTGTGCTGCTTCA
12   G17   AX00004224   AGTGTTTTGTGGGCTTTTTGGCATCTTCCGCATTTCTTAACGGCTGCACAAAGG
12   G19   AX00004225   TCGGATGCGACTGCTGCATATGTGGTTGTAAATCAGGTTGCAAGTTATGTTCAG
12   G21   AX00004226   CAACAGTTTCCCAACACTTATCTAAAATGAGAGGGAAGGTTCTAAGAGGAAATC
12   G23   AX00004227   TCTCCAACCGGTTTAACCGGAGGTGATGCAGTTAAAATTAAAAACTATCGAGAAA
12   I01   AX00004228   CGGTGGTGGATTGATCGAAGTCAAACATGTTGAAATTGACGGATTTAGCTTAGA
12   I03   AX00004229   TGTTTGAAATACCCCCAACTTCAAGGAGAAGTACGAGGGAGAGGCTTTATGCAG
12   I05   AX00004230   GAAATCCATTTTCTTTCTTACACGTTGATAAAGCAGAAATTGATTTAGACCCAGC
12   I07   AX00004231   TTCAGTCGTAGGCATGATTACAAAAAGAAAAAGTCGAAAATATGCATTGTGGGC
12   I09   AX00004232   AGGGGATGTATGTTGCTCCGATTGGTTTTCCAGCAGATATGATTTCAAGTCTAAG
12   I11   AX00004233   TTATTTTCCCTTTCTCGTAGCCATCATGCAGCGGAGGACTTGATGCAGGAGACT
12   I13   AX00004234   GTACGTAGTGGTGCAGGACTGGAACATCAAACTGTGCGTAAAGCTTCAAATGGA
12   I15   AX00004235   AGAGATAAACAAATCTCATACTGACCAGCTTAGTATTGCACAAGGGGAACGTGG
12   I17   AX00004236   AGAATATGGGGTGCCTGATGTTTGGAAGAAAGCACCTTGTACAGAATGTGATGC
12   I19   AX00004237   AGATTATGGTTAGAAGAGCGTGGAATAGAGGTAGTAGGGAGTCAGGGGAAAGG
12   I21   AX00004238   AGAGACGGATTGGACTTTAAGCACTGGATACCAACAATCATACGATATAAATAAT
12   I23   AX00004239   GAAACTGCACCGCCTGGTTCTGTCTTTTCTTACAATAACGGATCAACAGAAACAC
12   K01   AX00004240   TAATCGTCGGTTTGAATCCAATAATGGATCGGCTTAATCCAGCCGGTATGAGTA
12   K03   AX00004241   TCCTAATTTTTTTCATTGGATGACAGCGAGAGAAACGCTTACGTTTATGGGCCAA
12   K05   AX00004242   GCCAGTTATTGCAGTGGGGGCACTTTTAGTTTTAATTGCATTCATTGATTTATAT
12   K07   AX00004243   ACCAGTTATCACTTATGACACAATATCAAAGTTACCTTAAGAAATTAGAGGAACA
12   K09   AX00004244   AAGATCCTATTTTAGTAGCATGGAATTGGTCTTTTTTGCCTCTAGATTTGTTAATC
12   K11   AX00004245   ATTAAAAGGGATGGAAATGTCCGTTGCATATGCGGTTTGGTCAGGTATGGGAAT
12   K13   AX00004246   AAAAATTCAAATTCCGTTTTTTATTGAAGTCTATTTGGGGGCACTGAATCGCATA
12   K15   AX00004247   TTTCAAACGAAACAACTTTCCCGCTCTTTACTTTTTTAAGTGCGGGCATCGTTAA
12   K17   AX00004248   AAGTGGATGAGGTAGTAAGAGGAAGTAAAGAATATGAAACGTATTTTCTTCCTAA
12   K19   AX00004249   ACGTCGCACTACTATATCGATCAGCCGATTGGATTATAATGAAGAGAGGTGTTT
12   K21   AX00004250   CTGGAAATGCAGGAGACTATGAAGTGATTATTGATCTTGAAGATTTTACAGAAAG
12   K23   AX00004251   AGATAAGCCAATATCATTGTTAGATATTCAAGAACATATCGTTTCGCATCATGAA
12   M01   AX00004252   AATGTTTAGAAGCAGCACTACAGACTGTTGAAAAAGATTTTAATCGTGCTCGTAT
12   M03   AX00004253   TACGTTTTATGTCAAAACGATGATACGTGAGAAAAATAATCCGAAGTATCGCTTT
12   M05   AX00004254   CGAGAGGCAACGTGGGAAACAGTCATTTCGTATTATATCGCAAGTTTTTATTTCG
12   M07   AX00004255   TCCGCTTGCAACGCGCGTTATTTGTATGAATAACGGTCGAATCGTGTATGATGG
12   M09   AX00004256   TCGTTATTCACGCATAGAGGCCGAACGACATTATTTTGGGTAGGTGATAGCCGT
12   M11   AX00004257   CCAGATCCAGTACCGCCAGTGCCAGATCCAGTAATACCAAAACCAAAACAAGTT
12   M13   AX00004258   TATTGTCATATCAACTTCCGAATGGTGAATTTAAATGGTTACCAGGCGATCAAAA
12   M15   AX00004259   TAGTTGTTGACGGGGGAGCCTCTACGAATTGTGCGTTACTTGGTGATAATTTGG
12   M17   AX00004260   TTTCGTAACCAGCAATTACTTTTTATATGCATTGTCGCCGCACTCTTTTCTATTCT
12   M19   AX00004261   GTTGATAATTGGAACCGAGAGCATGTTTGGGCAAAATCACACGGTGATTTTGGA
12   M21   AX00004262   AAATAAAGTTAGGGTGAAAATCCTTAACCGTACTGCGGGCCCGCTTACTGGAGT
12   M23   AX00004263   TTGATAAGCGCGGAGTAGGAAAGAGTGACGGAGAATTTCTGAAGACTGGAATG
12   O01   AX00004264   AGACGGGGCAGAGTTATCCGGATATTACATTTTTACCACTGCTAGCATCGTACT
12   O03   AX00004265   ATTTGCTTGTTTACTTCCACTAATACTTAGTTCTACGATTAACCCTATTGTATGTG
12   O05   AX00004266   ATTGGGCGAAAGGGTGATGCAAATTATAGTAAAGCGACAAAGGGGAATATTAGA
12   O07   AX00004267   TTAGTGTACGTCGTGAAACAATTAGCCATCTCGAAAAAGGTAAATACAATCCTTC
12   O09   AX00004268   GTACCGGCACATTATAACGCATATGGGACTGTAGATCGTTGGGGATCAAAGTGG
12   O11   AX00004269   AGCTGTGACATATAAAGTAGGTACATTTTACGTGATGCCAATGGTAACATTTCTT
12   O13   AX00004270   AGAAAATAGCTTATATCATAATCCGAAAAAGCAGTTTGAATCTTATTTCATAACTT
12   O15   AX00004271   ATGGAGACGTCGTACGAGGGAGTACGTTTTTCTCAGGAGAGATATCTTTCGTTC
12   O17   AX00004272   TATTGGCAATGACATTGGCTCGAATGTGCAGTAGTTATTTTCTAGATCGATTCGG
12   O19   AX00004273   GTGTGATTTTAGACGTTTGTGAAGTTCGAATCGGTGATCATTGTATGTTTGCACC
12   O21   AX00004274   TATAATAGATCGTACACCTTTATTTTTTGATTTCAAACTTATCTTAAGGGTAATAG
12   O23   AX00004275   AGTTAGCGTTATGTTGGCTGTTTCTCTAATTGTTACGATGATTGTATTTTCGAGT
12   A02   EMPTY        -
12   A04   AX00004276   AATTTAATCAAAGTATGATTCTTGTTACTCATGATCCCCACATTGCTACGTACGC
12   A06   AX00004277   AGCTATCCCTCGACTTTATGATACTATAGCCGATATTCAATCATGTGATGAAATT
12   A08   AX00004278   AGACAATGTCTCTGTTCGCATCGTTGCAATGCCAAGCTGGGAGTTATTCGATCG
12   A10   AX00004279   GGAGCCAGGAGTAAATCCCTCTTCTAATATAGACACATTTATTGCTGCTCGCTTG
12   A12   AX00004280   CAAAAGGATTGAACCGTCTTATTATAGAGAAGCCTTTTGGTCATCATGTAACGTC
12   A14   AX00004281   TTGGTAACGGAATTGCGGCTGTCGCAACAAGCTTCACTGTATTACTTATTGCGC
12   A16   AX00004282   ATGGAGAGCCAATTATCTTCCAAGAAGAAGACGGCTTGAAATCTGGATTTGGTA
12   A18   AX00004283   TTTCCTAATGAGAGTGGAACAGGTGGCCTACTTAACGGATGGACGCACTTTTGA
12   A20   AX00004284   ATGGTGTGATTACACGTAAAATCTATAACGAAATTCCACCTCGAGTAGAATACTC
12   A22   AX00004285   TGAGTATAATGGGCTTTGTTCTTTCTGAAAAACAAGTGGTGTGGGTATATTTAAT
12   A24   AX00004286   GTTTAGTAGTTATAACTCAAGTGTGAGAGTGTTACTTGATGCCGGTTTTTCTTTG
12   C02   AX00004287   ATAATAAATGTGTCCTCTCGGTTAGGTTCATTGCATAAAATGGCCAACAAAGAGT
12   C04   AX00004288   CATCATCAACAAAAGAATGGTTCACGGAATGGATTAGAGGTTTTGATGAAGCAG
12   C06   AX00004289   ATTCTTGCTTTATGCGCTGTATATGAAGATTGGGGACAGTTTATCTTTTTTGTTA
12   C08   AX00004290   TACAAAAGGAGTGCATTAAGTCTTGCTTGCGACCGCAATAAACCAGAGATGGCA
12   C10   AX00004291   CGTCTTTACTACGAACAAAAGTAGAACTTAATACGACGCAACGTCTGATCCAGG
12   C12   AX00004292   AAGGAAGAGTTTAAACCAAATACCGAAGCGAAGGATAATAAAAATTTGGTGAATT
12   C14   AX00004293   AACAGGATGGTGGCAGTTATTAAATTTGGTGCCATTTGGAGGAGCGGTTCTGCT
12   C16   AX00004294   AAATAGATTCAGACACTTCTCATGGTTCCTCTCCCGTCAGAATTAAATACGGCTT
12   C18   AX00004295   GAAGCAGTTCCTTCGAACGGTTTAATCCTTAATACTTCTAAAGGATTAGTACTTG
12   C20   AX00004296   GTATACAATGGCGGAATTAGGTGAATTAGCGGAAGTTATATTAAAGCGTGATAA
12   C22   AX00004297   ATGCACGTTTAAAGAGGATGGAAGATAGATTACAGCTGATTACGAAAGAAATGG
12   C24   AX00004298   TTATTTGATATCGTTGGCTGGCTTGTTTTCAATGCGCCAATTCAAAACAAAGTAA
12   E02   AX00004299   TTGTTAAGTCACCAATCTGGAATCATTGATCCTCCTAATAGCTTTGAACATTATC
12   E04   AX00004300   ATTCGCTTTCATCATTCTATTGTTTGGCGGTATGTTAATATCTAAGTTACTTGCCT
12   E06   AX00004301   TCATTTTCGTTTTCGGCGGTTCTCACCCCGGCAATTGGCAAGCTCCTCTAGAAA
12   E08   AX00004302   GTGATATGTAATCTATGGGGGATTTGGGTTTCCATTTATAAGCCTCGGCAGCCT
12   E10   AX00004303   ATAGGTACATTATCACAAAACGGTTTAGCGACGGTCTTAATTTTAGTCTTTTCTT
12   E12   AX00004304   GCAAGGAGATGCATTTGGTTTTTCTATGGTACTTCATCCGGAAGTTCTCGGTGC
12   E14   AX00004305   TGGTATTCATAGTTCATTTACATACCAAGCGGGTCATGCTGATCTTCCTGCACCA
12   E16   AX00004306   CGCATTTACCGTTGTTGCTAAATAGGGAAACACTCACGTTACATGGTCACTTCG
12   E18   AX00004307   GGCGTTCGGCAGAAAGGACGCTTTCGTTCCGTGGGACGGAGAAAGTACAGATT
12   E20   AX00004308   ATATTGACCTTCATACTACAGTATATCCAGGTGGAGGACTAGACCCTTATACTTC
12   E22   AX00004309   TATTCCAAACCTCATCCATTCTTCAGAAACACTACAAACAAATTATCATAACTGGA
12   E24   AX00004310   TGTAAGGATTGATGACTTTTGTATTTTAAGTGGCAAAGTAACGATTGGAAGTTAC
12   G02   AX00004311   TTAATTGGATTACCAGAAATTACGTTAGGTCTATTTCCTGGGGCTGGAGGAACT
12   G04   AX00004312   TTAGCTTTTGGGATAATATTTACCGCACTATTAGCGTTTATTACACTTCCTTTCAT
12   G06   AX00004313   CAAATGATCTCAGCGTTGACTTTACACAACTCTTATTTAGTAGCAGCCAGTGGAT
12   G08   AX00004314   TATTTTAACGCCCATATTATAGGTGGAGTTTTCGGAAGTGGTAAAGCTGAGGAA
12   G10   AX00004315   GGAGATGGAGTCTTTCGAGAAATAAATAGTGATGAGATACCATTAATAGAACAG
12   G12   AX00004316   ACAAAACAAAGCTACTGATGGCATTGATGTAGAGTTCTCTCGTGAACTTGCTGA
12   G14   AX00004317   TATATAGTCAAAAAAATGTTGCTCACTATACGGAGCTATTAAAATATATTTTATCC
12   G16   AX00004318   AAGTCAAAAGAGTTTTTTACCGGAAGTGATTTTTAAAGAGGTAAAGGGATTTTTG
12   G18   AX00004319   GGCTCAAAGCAAACTATTGTTTACAATCGCTTGATAGAGTGATCGTAGCTGTTAA
12   G20   AX00004320   CGGAATCCGTATTTACTATCTTGCCAACTAGATGAGTACCGCGTCGTTATTTTTC
12   G22   AX00004321   GTGCTAATAAACTACTCCACCATGATGATAACGTGCCGAAATGTGGTGCGTATA
12   G24   AX00004322   ATTACTAAAAGTAAGACAGAATGGATGGCTGATGCGAAAAAACGTTGGACAGAG
12   I02   AX00004323   GAAGAGTACGGCGAGTATTCGGAAGCAAGTACATTCTTCTTACGTTTAAATCAAA
12   I04   AX00004324   AAATGGTTGTAGAGAAAAATACAGGGATTATGCTAAAATTCCTTAGTTTCCACGA
12   I06   AX00004325   CTAATTATTGTTGTCGACCGCATTGAAGACGTATATGAACGTTGTAAAGAGAAGC
12   I08   AX00004326   TAGTAACGATCTTGAGAAAAAGAAAGTAGGGCGTATTTGTCTCTATGTTTCTCTA
12   I10   AX00004327   TCCCTGTCCGTTATGTGGGAGATTTATTAATGATGTCACAAGTTGCAGTTGCTTC
12   I12   AX00004328   AGGATGGGAACGTAATAAAGGCGGCATACGATTAACATTTATCGCTGGTTGGCG
12   I14   AX00004329   CAAAGAGTAATCATACTTTTAATGACGTTTCAACGAACTCATGGGCAAGCAATGC
12   I16   AX00004330   AGGTACTCTCGCCTTGTGGTGTATGCCAAGAACGTTTATTTTATTGGGGACCAG
12   I18   AX00004331   GTACGGGATGTGTATCAAACACATGAATTTCATCAAAAAGTAAGAGGGTGGAGC
12   I20   AX00004332   GGTGTGAAGAAGAAGCACGAGCGTTTTATGGTGAAACAATAGGTATGGAGGAAA
12   I22   AX00004333   GAAGGCGTGGAAATATTCGGTGCTGCCTTAATTGGAGCACCCCTTTCTAAACCG
12   I24   AX00004334   TAATTGAATGGAGACTAGGTGACGCTGGAAAACTTCCTTTTGAAGCTAATTACTA
12   K02   AX00004335   AATTTTTGATCGTGGACCAGAAGATATTGAGTTCTATACAATCTTTTATCCTACAA
12   K04   AX00004336   ATTTCTACATTGGGTGAGACAGCAACGATTTCAAATTTTATCACTCCAGCTGTAG
12   K06   AX00004337   AAAACGTTACATTTACAGACCCCCTACCCGCTGGCACTACTTTCGTTCCAAACAG
12   K08   AX00004338   TGTAACACTACCTGGTACAAAAGTAGTGCCAGCAGGAGGTATATCTGTAATGAT
12   K10   AX00004339   CCGATGTCAGCAACTTGTGGGCTAACAGTTTTTGTAGGATTTACAATTGCAGTTC
12   K12   AX00004340   CTAGACCACCTGTATCTGTTACTACGCCTACACCTACTACAAAGACGCAAGTAAG
12   K14   AX00004341   ACATACGGGGTGCCTGTTAATGTTCATTATTATGTCGTAAAAAAAATGGGTGGTA
12   K16   AX00004342   GTTCTTATTGGCCAGAGCGTCTTGTGACACGTGGTGAATTTGCGAACTTCATTT
12   K18   AX00004343   AAAAATGACGGGAACCCAGTATATAGAGCGAAGAAACTATCTCATATTCTATACA
12   K20   AX00004344   TTCAGAGCGCTGGAATAAACAACGCATTCGTGTAGCGAAATTGCATGAAAAGGT
12   K22   AX00004345   CGATAGCCTAGCGGTAGGTGGGAGATGGATTTCGGTTTGGCGTAACCAAACAT
12   K24   AX00004346   TTTTCAAGAACAAGAATTGTGGAAAGACATTCAAATTTATACCGAACTACTAGCA
12   M02   AX00004347   TGCAGGTCTTAACACCACTAAGTTTTGGAATTTAAGCGCAGGGACTGTACTTCA
12   M04   AX00004348   ATACCTACTTTGATGTAGCAAAGGACATAGCTACCTTAATGCAGGGTAAGAATCT
12   M06   AX00004349   GTTCAGCGACAATGACAGTATGGAATGCTGTTAAGAATTTCTTACAGTCATGCTG
12   M08   AX00004350   GAAGTGGAACGGCTACCAGTAAGCAGTTAGATCAAGCAATTGGAATTATCGGAC
12   M10   AX00004351   GTAGCAACTGTTAAGCGTTACAAAGCGCAATTCAGACGTGATTTGTTTGCTGAT
12   M12   AX00004352   ACGAGCTTAAATTCGTCGCAAGCCCAATTATTCTAGCAACTGGTGGTAGACCGA
12   M14   AX00004353   TATTCACATTTCACAGCAACGCCAACTAATCCAGTTCCAGTGCCACCTTATATTT
12   M16   AX00004354   AAAGGCTGGCGGAAAAAGAAGGATGGCAGTGCAATCATTGTTTATAATGCATTG
12   M18   AX00004355   TGTTCATGTCTGGGATTACCAAGATGAACGAAAAGTGAAGTATCGAGATAAAGA
12   M20   AX00004356   GAAGCATCTCGATATGATTTGAAGTTATCTGGTGTTTCTCATCTCAAGGCAAATG
12   M22   AX00004357   GTGTTGCAGATTCATATGAATCAAATGACGCAGAACGTGTAATGTATCTACAAGA
12   M24   AX00004358   ATATGGTCCTTTATCAAACTATCAACTTACTATTTTCTCAGATATGGACGTTCAAC
12   O02   AX00004359   CTTTCACAGAGTCCTTGACTCAAGATGATCAATTAGCTTTATGGAGCCACGACAC
12   O04   AX00004360   ATGGTGGAGGTTTTTTTGCGTGGAATGGGGATATCTATCAAAGTGACATTATAC
12   O06   AX00004361   TTCTTCACGAGAACAGCCAATGATATTTATGATTACAACAGCCGGAACTGTCCG
12   O08   AX00004362   ACTATTCCGCCCGCATCTAATCCAACTTCTATCCAAACTAAAGACAATCAAGTTA
12   O10   AX00004363   AATGTTAGTAGGGATGATTCAGGAGACTTCTAAGTTAGGGATAACGATAATAATA
12   O12   AX00004364   GGGTAAGTTTTTATGGTAGCTACACTGGTGGCATTATTGGAGGTATAGTGGCAT
12   O14   AX00004365   AGGATGCTAATAATTTATCTGCAATTTATAAGGGAAACTTAATCCGTGTTTGGGG
12   O16   AX00004366   ATTTTCAGTGGAAAAGTAGTGAAGATGCAATAGAACAAAATCTTGAAAACATCAA
12   O18   AX00004367   TGCACGTGAGATTGTAGCAATTATGACTATGTTTAATATAGACAGTTATGGACCA
12   O20   AX00004368   ATCAGAGAGAAAGAGCGTGCGATCCGTTGTTAATGCAAAGGTATTTTCGTAGCA
12   O22   AX00004369   TCGCAAGCAGAAACCTATTTTTTAACCTAACATCCTTTTTTATGTTAGCAATAGTA
12   O24   AX00004370   ATCAAAAAATCTCAAAAGTCATAACTATGGGAACGCCATGGGCTGGAGCTCCTA
12   B02   EMPTY        -
12   B04   AX00004371   CCCCGCAAATGTACAATACCAAATAGAACGTAATTTGGAGAGGTGTGTACAACA
12   B06   AX00004372   AGAGTATATGTTAAGAGAAAAGGTAAACAGGTTTCGTGTTATAAGAGAACTTAAT
12   B08   AX00004373   GCTCGTGTACCGCTCTCTGGTGCGATGGACGGGTATTCAAATGATGTGAAGGG
12   B10   AX00004374   CCAAACGCAGCCGCAACTAACCTAGTCTTAACAGTCAATTTACGTGGGCTTTTA
12   B12   AX00004375   CTGTCAGTGTCGGCGCGCCGCATCAAAGATACCGGACATTTATTGTTGGCCACT
12   B14   AX00004376   ATGCAAGATGTGTTGACTGCAAAAAGGGCATGGTGTCAGTACAGAGATTTAACC
12   B16   AX00004377   ATTATGAGAAGCCATTGAATTTAGAGTACGGCGAAATGTTTGTAATGGAAAGCTC
12   B18   AX00004378   AACTATTTGACTACATAAGTTCTACGTTCAATGGTCAATCTGAGGAATCTGAGCA
12   B20   AX00004379   CGTTTAACATCTAAGAAAACACAAACATTGATTAAAACTAGATTAGTAGAAGGAT
12   B22   AX00004380   CGGTATTTACGTGATAAAAGGTTATCTGAATTACTTAAGCGCTGTCGTCGTTTAG
12   B24   AX00004381   ATTCAAAGGTGTCTAGCAAAAGCCATTGCACTACACGGATTAGGTTTATACATCT
12   D02   AX00004382   ATATCATCAGATGGTTGCTGTGAATAAAAAGCGGATTAAAGGTGCATTGATAACA
12   D04   AX00004383   ACAATAGAAAATCAATTACTACAAAAGCAGGTTGAAAAAGCTGTAAGTAGCTTGA
12   D06   AX00004384   CAATTTTTGTTAACTCGTATTGCAAGTAAGAAAAACGTAGAGGGTAAAACGAAAG
12   D08   AX00004385   TGTAAAAGTATCTGATTATCTTAGACTACTAGCACAATATAAATTGCCAAATAAAA
12   D10   AX00004386   TCATGGAATACAATTCAGGATCAGTTCTTCTTTGACCCACGGTTCCCAAAATTTA
12   D12   AX00004387   GTTCAGATGGAAAAGTTGGAAAGTGCAGGAGAAGGGGAATTTACTGAGTCCAAC
12   D14   AX00004388   GTATTAGCTTCTGAGCTAAAAATATCAGTTTCATATTTATCCGACATTTTAAAAGG
12   D16   AX00004389   ACTTAGAATTCGGCAATGGGACCATAAGAAAATGGGATAAAGCATATCCCTCAG
12   D18   AX00004390   ATGCAAAGAACTGTTTGTGCACATGAATTAGGACATGCAATCCTACACACTCACG
12   D20   AX00004391   AGTCCATTAGTACGTATCCCTGCATCTCGTGGTATTAGTACACGCGTAGAAGTA
12   D22   AX00004392   CCTTTAGTAATGGGCGGTATGTCCGGAATATTGTTGAAAAATCGATTCGTACAC
12   D24   AX00004393   AAGAACAAAGAGTCTGTTAAGAATGTGGAATCAAGTAAACCTGTGGCAAAAGCA
12   F02   AX00004394   ATTGGTACGTGGAGTGTCATATGTGGATTATGTCTCGTTCTCATTTCTTTACTAG
12   F04   AX00004395   AGGCTACATACATTGGGATACGATGAAGTGGAACCAGAAAATCCATATTGGAAA
12   F06   AX00004396   TCCTGAAATACATTGGGCATTACTTGGACATATGGTTTCGCGTAACGGCGGTTG
12   F08   AX00004397   ATGAGGAGAATACCTCTATATCGATAGATGGAAAAAATATAGAGGGGGAAATGA
12   F10   AX00004398   TTTACTTAGCTTACATGATAACGGGAAAAAATGGGCGGATACGTTGTTGGAGGA
12   F12   AX00004399   GCGGTGGCTGAAGCGTTAGCTACTATTCCGGAAAATAAAAGGCCAACATTTTAT
12   F14   AX00004400   CTAGTTGCACGAAATGTGGAGGAGAATTACGGAAAGTCTACAAAGAGAAATGTG
12   F16   AX00004401   CCGTTCGTCAAAACGTCAAACCTGCAAACATTAGTGACCAAATTATATATCAAGT
12   F18   AX00004402   CAACAATCCCTCTAAAAAACCCCATCAATAAAAATTTCAAAAACGGCTCTGGTAC
12   F20   AX00004403   ACGCCACCACTACATTGGATTTTAGCGGATAAATGGGGAGATTGCATTGTACTG
12   F22   AX00004404   TGGAAACAAATAGAAGAGAGCAGATTGCTGCTTTGGCACATGACATTAAAACAC
12   F24   AX00004405   GATAGTCCAATTGTATTTCTAACAGCCAAAACAATGGAGAAGGATCTAATCACAG
12   H02   AX00004406   CTTGCTGGCAGCTTTAATGCTTACAGGGATGGGGGATGTGATTTGGAAATACAC
12   H04   AX00004407   TCAATTATCTAGTTACAACTGGTGGTACATTACGATGCTTCCGGGAATGGTTTCT
12   H06   AX00004408   CGCTGTATGAAAATTTAACAGCAAGAGAAAATCTGCAGGTTCGTACGACTGTTTT
12   H08   AX00004409   GAACAAGCGCAAGGAAAAGGTCTTGATGGTGGTGCTGTATCAGATATGGCATTT
12   H10   AX00004410   GTCGTAAATATAAATGGTGTTGAATTAATGGTTTCAGAAGAAGAACATGGGAGTT
12   H12   AX00004411   ATTATACCTGCTGGGAAATGGGGAGGGTTTAAAAAGGAACCACAAGAAATAAGA
12   H14   AX00004412   ATTGCTCCGTATAATAGGCAGTTTGGCTCTAAGAAATTAGGACAACGTGCGTTA
12   H16   AX00004413   TCTTGTACACCAGAATATTTATTAATTGATGCGATGAAACTTCCTGCACCAATTC
12   H18   AX00004414   TACTTGCTCAGCTTATTCATGTATTTGATTGCCGGAGTGAGCATTCTGTTTTCCA
12   H20   AX00004415   CATTATTTAAAATGGAAATAGATATGTATGGTATTTGTGAAGACACAGGGAGAGT
12   H22   AX00004416   AGGGGAAACGTGAAACGGTATTCCCGCAGGTATTCCCAATAGAAAGTATGCCAG
12   H24   AX00004417   TTCTTCCGATAGTTCTTCAGCATCAAAAAACACTACTAAGAATGAAGCGAAAGAA
12   J02   AX00004418   ACAATTCGATTAGCACACAGCCTTATGAGAAATGAAGCGTGGCTCTATCTGTTTT
12   J04   AX00004419   AAAGAATGCTTTCTTATATAGCTAGGATTGGCGGGGCGCTTGGGTTCAGACTAA
12   J06   AX00004420   TGAAGTTTATGACCGAAAAGAATATAAGGGATATTTCAGTTTGTCGCAGGTGTTA
12   J08   AX00004421   CCGGAATCAGCCAATCAACATTAAGTGCACTTGTAAACAATACAAAACTCCCAAC
12   J10   AX00004422   AAGATTTCGTCCCAGATATGGGAAAACAAATCTTTTCATTTATGAGTCATATGTT
12   J12   AX00004423   ACGGTAATGGTCCAGGGAATCGGGAGTCCATTTCTGTAGAAATCTGTTATTCAA
12   J14   AX00004424   ACAAATATTGTTCGAGGGAAACGTGGTAAGAAATTTAGATTATATTACAATCCCC
12   J16   AX00004425   GGTATTAAGCCAAATTCAAAGGTAGAAATATTCAGCGACAATTCTAACTTATTCA
12   J18   AX00004426   ATTTCAGCTCTGTAATTGAAGTACCAGCCATTAGATTCAACTCACTCGGTACTAC
12   J20   AX00004427   GAGACAGATCAGGAAGACATGACTCCACAACGTCTTATGACGCTTATGAAATTG
12   J22   AX00004428   TAGATGTATGGTTTGGAGAGTATCCGCATAATCGTGATTATTTCAGAATAGGCTA
12   J24   AX00004429   ACCATATACAAAACCAAAACCTGTTTACATTGAGATTCCAGTTATATTGGAAGGA
12   L02   AX00004430   GTAAGAGTGGTAGCGAACTAGGGCAAGGGATAATAAGTCAAGATGGCTATATTA
12   L04   AX00004431   TACTGGAGAACGAATGCGTGATACAGGGAATAAAATGCAAGATGTAGGCGGACA
12   L06   AX00004432   GCTACTGATGCTTTTATAGCTTCGGAATGGACAGAAAAATTGAGTGCTGATAGG
12   L08   AX00004433   ACAATGGGAAAAACCGTTTTTATTGCTACTACAAAACGAAATTTGAAATTCCTGA
12   L10   AX00004434   GGAAAAACATGGATTACTTATTCTGAGCTAGATAATGGTGCTGGGAGATACGCA
12   L12   AX00004435   AGGATGAGGTGCTTGTCGGAAAAATAAAAACCCGAAATGGAGTCAAATCAATTA
12   L14   AX00004436   TGAATTTTTTTATGCGATTTCGTAGGGGAATTGATTCGAAAATGCGAGTCTTGTA
12   L16   AX00004437   CAAAAGAAGCTTTATTAGGATCTGGTGTTCCTGAAAGTGAAAAGGCGCTTTACA
12   L18   AX00004438   AACAACATATAAAGATACAGGATTAACAGGTGATACAACATATTCTTATCAAGTG
12   L20   AX00004439   TATATAATGCTCAACCAGAACAAGTTTTAGGGAAACCAGTTAAGTTCTGTGATTC
12   L22   AX00004440   CTAACCCGTGCTGGTGACAAGTTAGATGAAGATACATTAAAACAATTACTAGATG
12   L24   AX00004441   TATGACACGGTTTTTAACCAAGTGTCTGATGTTGTGATGAATGAACCTAATCCAA
12   N02   AX00004442   ACGTAAACAACCAATGATTGTTTATATCACTACAGCAGGATATCAGCTTGAAGGA
12   N04   AX00004443   AAGAAGGCCTGACAATGGAGTATACAAATAAAGCAGGCGCTACAAATCTAACTA
12   N06   AX00004444   GAGTTAGCGCTGATACGAGATAACTATCGTTGCCAAGAGTGCATGAAGCATGAT
12   N08   AX00004445   AGCTATCAATGAATGTGTAAGTGCATTCGAACAGTTAGAAAAGGTTATGAGCAAG
12   N10   AX00004446   GAAAATGGAGAGCGGCAGGAAGATTGAAAGATGTAAGTGACGAGCTTCTTGAAG
12   N12   AX00004447   AAACCAAAGAATGAATTTCTCATCAAAAGTAGGAATGGTAAGAACAAGCCAATTA
12   N14   AX00004448   AAAAAGTATTTGAGGAGTATCGTATGTATTTATCTCAAATGCCAAGTGACATCTT
12   N16   AX00004449   AAATGGTCAGCAATGCTGTTCACGATAACAGCTATCGAGAATGGATTAGAGGTT
12   N18   AX00004450   GTAGCAACAATGGATGATCAGTTTGAAGTTGAGATAAGCGTTTCGTGTGGCGAG
12   N20   AX00004451   CGATCAAGAATCATTCCATCGTTTAATCAAATACAAATACTTTGCAAGAGGTTTC
12   N22   AX00004452   AATTTCAACGAAGGTTTAGATGATAAAGGAGAATTGTTTGATATTACGCTGTTTT
12   N24   AX00004453   GAATGCGCTCAACATATGGGCGTACTTCCTGAAACAATATACTTTTATACGACAC
12   P02   AX00004454   TGCCAATAGAAAAATTCGATGCAATCAATTACGCGGCAATTATCTTGGATCAGTT
12   P04   AX00004455   GTATTAATTCAAAATGATGTTAATATTTTACCTGGCCGAGAAAGAGATGAGAGAG
12   P06   AX00004456   TTCAAACAGTATTCTCCATGGATCAATGCAGATGTATTGTTGGATGAATTGTATG
12   P08   AX00004457   TGGATAATCGCAACGGATAGTTGGGGTTCGTTATTCTTATATCCTGTTTTTGCGG
12   P10   AX00004458   ATATGAATTGCAGGTGAGGCCGCGTAGTGGTATGACGCGTAATACAAAGTTGAG
12   P12   AX00004459   GAATCAGACAAAGCGTATGACAATGGAGATTTAGGTTTATCTGGTTACTATCGTG
12   P14   AX00004460   TCAGTCTGGAATGTTGGGGTTGGTCACAGCGAGAAGAGATTTTAAAACAGAACT
12   P16   AX00004461   TAGCACTTGAGGAATTGGATTTAGTTTTTGATGAAAGCGAAGTAATCCGATTCCA
12   P18   AX00004462   TGGGCTAGATAGCTTAAGAGCTGGAATGAAAGAACTAAAGGAATATGGGTATCT
12   P20   AX00004463   GATCAGCCGCATATGCACTTATGAAGAGAAAGGACTTCCCAACAATCGTAATTG
12   P22   AX00004464   TGATAAATAAACAGAAAACGGTAATCAGTAATTGGGAAACTGGCTACGCAACTCC
12   P24   AX00004465   AAACAGGCTATAGTTCGCCATCTAATGAAACTTTAGTTATCATTTCAGATGTATTA
12   B01   EMPTY        -
12   B03   AX00004466   GATTCCACGTTTATTGAAAGCTACAGCACTTAGTATTTTTGCTGAGAGTTATATT
12   B05   AX00004467   GGATTTGGATTCATTGGACCGTATCGCGTCATTCTTTAATATCTCTGTCGATACA
12   B07   AX00004468   ACGCAAGAGAAAGAATCATCATGTAGACCATCAACATTGTATCAATACAAACGTA
12   B09   AX00004469   TTTTATCCCAAAAGCGACTGCTTCTCTTTTAGCGAGTTATAAACAAAACTACGGG
12   B11   AX00004470   TGGTAGTAGACACGCTGAAATAAAGCTACTTCCTCCCTTATTAGGTAAACACTAT
12   B13   AX00004471   CGATTGGGTGTACAGTGTTAACTTTCTTTGCAGTTTTTTTACCTGTTGGAGAGGG
12   B15   AX00004472   AAATCTGGATATTCGGCGATACCTGTTTTGGACCCGATGTACAAATTGCACGGG
12   B17   AX00004473   TTCAACAAAATTATGCGAGTGAAATTTTAGCTGTGGAACTTACAGATATTGAGAA
12   B19   AX00004474   GTGAAATTTCCATTTTCGGTCTTGATGATATACTGCTAGGCAAACCTAAAATAGA
12   B21   AX00004475   TGCCTATATTCCAAATTCATTAAAGGCTGATAAGGGGATGAGCGAGTTTTTGTTT
12   B23   AX00004476   GAAAAGCAGCATCTATCATGAACGGCCCTTGGGCGTTCCAAGCCATGGAAAAG
12   D01   AX00004477   CTCCATCAATTAGGAAGATATTTAATTGGAGGAGTTATGCTATTGATAACAACGA
12   D03   AX00004478   GTTGGATGGGTGTTTTGGTACTAATTGTTCCTCTTGCGATTATGTTCTTATTTAA
12   D05   AX00004479   GAAACGAGACCGGTTTTACAAGGCGGACGTTTAACGACCTGGGAATTAAAACAG
12   D07   AX00004480   AAATGGAGTTTTATTTGGCATTAAAATATGATCGAGATGGAGTTGACCTTTATAT
12   D09   AX00004481   AAGAGGGCCAATACATACCGCTAGATCCGCATGTTTCCATACAAGTATTAAACAA
12   D11   AX00004482   AATCGTGATAATTATTTAGTCGGCCTCATTCAAATTGCAGTTTCTTTATACCATCA
12   D13   AX00004483   ATACATATTACTACTCCTACTATTTTCAGACATCTGATGGTACCGTCTTCTTTCAA
12   D15   AX00004484   AGTCTTCTCTTGTAAAAGTAAAACAACTGCCACTTCAGAAAGCATCACAGTACAT
12   D17   AX00004485   AAGGGACACCGCTTGGAGATTATGTAGCGAATAAAATAAATGATCCGAAGAAGC
12   D19   AX00004486   GATACGAGTAGGCAATATGAATTATATCGACAACAACAAGTACCGCAACTACTGC
12   D21   AX00004487   TAATTGCAAACCCGGGATGTTTTGCTACAGCTGCATTATTAGCGATATTACCGTT
12   D23   AX00004488   AATGTAGTCCTATGTCAAATGAGGATCAGGAAATGCTTGTTAAACATATTCAAGC
12   F01   AX00004489   ATGCAGCGACGAAACATGCAGTATTAGGATTTACCAATAGTTTACGCATGGAGT
12   F03   AX00004490   TTACTTCTTCCTATATTTGATATAAACATAGCTGGTTTCTTTCCTCGTCTAGTCCA
12   F05   AX00004491   GATTACTTCTATAGCATTTAACCCTGTTGTGGGGGATTATGCCATCCTTAAACAA
12   F07   AX00004492   GGAGGGGGCACCGGTAAGGCTTACAGCGGACGGTTATGATCATGTGGAATTTT
12   F09   AX00004493   TGGAGGCCTTTTTTCTTGGTAGTTTAGGGATATTCGGGGCGATTTGGCTCATTG
12   F11   AX00004494   GGGAGGGATATGGTATTTCCTTCATATATTTTCATTTACAGAAGCGGGACCGAA
12   F13   AX00004495   CTCATATTAGCAAATGCTTATTCAGATATATCACCGTTATTTCCTAGTTTGCATAA
12   F15   AX00004496   TAATTGTACTTCCGATTGAATTCTCAGTAGGATATAGCAGTGCCAAACAAATTGC
12   F17   AX00004497   AGCGATAGTAGCAACTTTGATTTATTGTGTAGTAACGATACCGACTAATTACATT
12   F19   AX00004498   TTTTTGGATGTTTATTAGTGATGGGCTGAATGAAACAGCACCTTCATTCATTGAG
12   F21   AX00004499   CCGGTAAGTCGAAAGGATATCGTCATTGCTAGATATATTTCCTGTGCAATATTTA
12   F23   AX00004500   ATGATTGGGAGTGGGATGTGTTTTTAGGGCAAGTACAATTAGAGTTTCGTGAAG
12   H01   AX00004501   CAGAAAGAAAAAGTTATAAACGGAAATGTATATTACACATATTGGGGAGGAAATG
12   H03   AX00004502   TTATTACTATTAATTATTCCTGATGTAGTTACGCAGCGTTCATCCGTCGAAGGAA
12   H05   AX00004503   TTAGGAGTACCGCTTCAAATAAGGTTTTGGGGAAGTAAGTTAAGTGGTGAACTG
12   H07   AX00004504   AACTGAGTACTGCATGGATGCTACGATTAAATTTGCCCATGGACTAGGGTACGA
12   H09   AX00004505   AACACCAATTACAAAAGAGGTTATCGCTTTCTTAGAGCAATATGACCCAATGAAT
12   H11   AX00004506   GATGTGCTAATGGATCTACCTCGGATCACGCTTGTTGGGCAAGTGCATATCTAT
12   H13   AX00004507   GTGGCACTTGCAAATCATGGGTTGAAAAGTATGAAAGGTTATCAGCAAATGTCG
12   H15   AX00004508   TTTAAAGGTTGCTCATCATGGAAGTAATACGTCATCTATAACGCCTTTTTTGAGC
12   H17   AX00004509   ACATTCTTTCTGGAAAGGGTTTATATAGCGATATTAATTATGTCGTCTTTTGCTTT
12   H19   AX00004510   ATCCACCGTTAACGGATGAGGGAAGGAATCAGGCTAAATTACTTCAATGCAATG
12   H21   AX00004511   TTTTGTACCATTAATCTCTTAAACAAATGGTTAGGTATAGAAACGAGTAATACATC
12   H23   AX00004512   AGGCTCTTCTTTTATGGTCCAGATGTAAGCAAGAATCCATTACTTGAGGAGTACT
12   J01   AX00004513   ATCGGGTTTGGTATTTGGAAAGGTTTTTTTGTTCGTTCCTCACGAAAAGAAAAAG
12   J03   AX00004514   GACCAGCTGTTTCGCATCATTTGAAAATTTTAAGACAAGCAGAACTAATTGTAGC
12   J05   AX00004515   TTTTACCGATTGTAGGGCTGACGATAGGCGGGACATATTTGCTGTTTACACAAG
12   J07   AX00004516   GAAAGCATAGACCCTGAATTTTTATATGAAGAAAATTGGTCTATTTTTGATGAGG
12   J09   AX00004517   GTCGCGATTAATCAATGGTCTTTTTATGAAGGGTTACAAACCGCAGATCCAACAA
12   J11   AX00004518   GAGTTAGAACAGCAGGAGTTACCGATTTTAGCTCAAACAACTGGAGAGAGAGCA
12   J13   AX00004519   AGATAAGTTATCAGCAAAAATTGTAGCATTCCCGCAACACGGTTTGTTACGAAGT
12   J15   AX00004520   CAATTGATGAAAAAGGGAAGGGCTTAGCGCAGCATCCAGTTGGGACAGGTCCA
12   J17   AX00004521   TCGGTATCATTTCTGGTTATTACGGTGGATGGTTTGACACGGTTATTATGCGAAT
12   J19   AX00004522   TTACACTAGGTGCATCTGGCGCAGCAATTGTAGCACGTATGACTCGCTCAAGTA
12   J21   AX00004523   TTACTAGTCCAAAACACCCTTATACAATCGGACTTCTTCAATCTCTTCCAAGTCT
12   J23   AX00004524   TCAGATCGCATCATTGTAATGTACCTTGGTACCATCGTGGAGATTGCCGATAAA
12   L01   AX00004525   CATTAGACATCATTCATGAGACTTTTTCTGACAAACTACACTTAGCAGACATCGC
12   L03   AX00004526   TTTCTTTCTGCCGGCATCCTAATCGAAACGGGAAGAGTATTAATCAGCCCTGCA
12   L05   AX00004527   TTATGCAGTTTACTTCTTAATCGACCCTTTAACAAGCATTTGGTCTAGTATAACTG
12   L07   AX00004528   ATTTTCTACTACGGGTATTCCAACATCGAGCCAAATGCTGCAAGGATTTTTGTTA
12   L09   AX00004529   GCAAGAGGCGGTAAAGGATCACGCATCTTCCTTTGGGATTGGCTATGTTTTCTC
12   L11   AX00004530   ATTTTATTTGCGACAGTGCGTCCAAATAACATCGCAACGCTTGAAAAAGATGAGT
12   L13   AX00004531   AGTTGCACCTCATTTAATGCGCCTGATAGGATACCGTCAACACTTTACTCTTCTT
12   L15   AX00004532   TCATCTGCTTTTGCATTGCACTGTAAAGAGATGGGTGTTCCGAGCTTAATTGTAG
12   L17   AX00004533   GAGAAGCGATCGAAAGGGCTTTAGCATGTACGAATTTGCTAAGTAAACGTGATA
12   L19   AX00004534   GTAAAACAGTTACGCTGAAAACAGTTGGTATTTGTGTGTTAATGGCGCAATCTG
12   L21   AX00004535   AAATATATCTGATAATCTTGGCGTTATGGCCATCTATTACGTGTTCATGAGTTTA
12   L23   AX00004536   AACTTTCAACACTAGAGCACTATCCTCTCCTCTTGATTCTATCTGGCGGAATTTT
12   N01   AX00004537   CCTTTGTCACACTACCTTTTGTTTTTTGGGGCATGGGAATGGAGGGCAATACAA
12   N03   AX00004538   TATCCCTACAACTGGAGAAAATAAGAGTGATTTTCTTTACTTTGGTATACCAGTT
12   N05   AX00004539   AAGGGTATATCATATTAAGAAATGAAACAGTGTTTTTGGCCGATGATAAAACGTT
12   N07   AX00004540   AAAAGTATAAGCGGAAAGATTGAAGTTTTATTCGTTGATGAAAAACACCGAGGAA
12   N09   AX00004541   GAAAGATAAGAAAAGAAAAAGGAATAAAAAATCTTCATCCGCTTCAAGTTCATCA
12   N11   AX00004542   AACAATTCCGCGTCGTTAGAGACATCACCCAAGAACAATTAGCTTCCTCTGTTCA
12   N13   AX00004543   ATCGAGAAGATGAGTTTAAAACTTATGGCACAAATTTTTGGTCTCTCTCATTTAA
12   N15   AX00004544   GCTAGTTGCTTTTGTAAAGTTACCGAAAGAAAGAAGTATATTAGTTGGCCCGTTT
12   N17   AX00004545   TGCAATGGTTGGTGCTGGACTTGGTATCACGTTACTTCCAGAAATGTCAGTAGA
12   N19   AX00004546   AGTGACCATGTAGAAGTACCGGACTTTCCAAAAACGGTAAGTCGATTCGATCGA
12   N21   AX00004547   TATCGACCTTGTCCAAGATACGTTTTTGACGCTAGAGCGTAAGAAACATATGTAT
12   N23   AX00004548   TCAATGATCACAGCTGGAGTTATGATGATTGTTATGTTTTCCATCATTATTCCGT
12   P01   AX00004549   AATAGGTGCAATACAAATGTTTTATGATGACGATTATACGAATGATCATTTCGGT
12   P03   AX00004550   AATATCACTTAACTTAGATAAAGATGAAACTATTATTGCTGGCAATGTGAAACAAT
12   P05   AX00004551   CACAAAACGAACTATATGACAACATGTCTTATGAAGAATCCCAAATACATTACCA
12   P07   AX00004552   TTGCTATACAGTCTGAGCATACGTACGATAATATGTACGGTGAGCAAATAACATG
12   P09   AX00004553   GCTGCACTAGAGTATATACGAAATGGAATCTGCCTTTATATGTTCCGATAGTAAT
12   P11   AX00004554   TTATATTACAACGCGCCAACGGGGTTTTATGCTACAAACCCATCTGACCCGTATA
12   P13   AX00004555   TCTCGGCAAGAATGGTGAGTTCGTTCCTAGATATGAAGTGACGCTACAATTTCT
12   P15   AX00004556   ACGGTTGCAGAGTTAAAAGATATTGTTGCAAGAGAATATAATGTACCAGTCACAG
12   P17   AX00004557   GTAAAGTCCGTTATTATGGTCAACTTGCCGACGAGTTAGATGCATGTTTTACAGC
12   P19   AX00004558   AAAAGCTATATGACAATATTGAAGTAACGTTACTCGTGCTACTTACCATTTCATTT
12   P21   AX00004559   TACGCTCTTACTGGAATCATCATTCACTCGTCACTCGTTTTAATCCCGATGGCAT
12   P23   AX00004560   GGCCCCAGTAGTAAAACTGCGTTCTTCGTCCATGGCTGGCCTTTAAATCATCAA
13   A01   EMPTY        -
13   A03   AX00004561   CACAGAATTTGAAGCATTAACGAGTTACTCAATGAGTCTTTTAATGCCAGGTTCT
13   A05   AX00004562   TCTTAGTGGAATGTGGTCGATCTGTTTAGAAACGCTATTCTTTGTTATATTAAGG
13   A07   AX00004563   ATACAAAAATAAAATGGATTCATATGTGGCTCGAGATGAATATGAAAAAGGGTCC
13   A09   AX00004564   ATGGTGAGCCCATTACAACGAAAACTTCATCTATGGGGTATATGTTGCAGCAAG
13   A11   AX00004565   AGTGATGAAAACATTAATTCATGAGACGGCTCACGTGTTGACGCTCGGGCATAA
13   A13   AX00004566   GGATATTTTACTGGTAATAGAGAAATGATGCCTTATATGTTCATTTTCTTAGGATT
13   A15   AX00004567   TGAAAAAACGCAAGCTTATAATGGATCGGGATCATCGAATACAGGGATTAAAGT
13   A17   AX00004568   GGATCATAATTTCCCGGATGTCGATAGAAATGGATGGGCGAATCCTGCGATTAC
13   A19   AX00004569   GTAGTAAGTATTCTATGGATACTATGTACATGTATGCTCTTTCTATATGTTCCGC
13   A21   AX00004570   TAGCGACAGTAGCCGTTATTAAACGTGAAACGGGTTCAGCGAAATGGACGATTT
13   A23   AX00004571   AAAGCCAGCTGTACAAGGTGAAAAATTACCAAACACTGCATCAAATAATGTAGCA
13   C01   AX00004572   ATAATTGATGTACCAGCGATTCGGATTTCACTAATTGGAATGACTTTAGTATTAG
13   C03   AX00004573   AGAACGTTACTACACATATTCAATTATGCAAGCACCATTCCCTGTGACGAATTAT
13   C05   AX00004574   AGTAAGCTATTAGATCAGATGAACCCATTTCTTGATATAGAGAATCATTACGCAA
13   C07   AX00004575   AAGAGTATTAGTTTCAAAAGTAGGTAGAACTGCTGCGGATAAAGCCTGGGCGGT
13   C09   AX00004576   GATTCCTGGCGATATATCCGCTTCTAGTAGACATTGGGAGAAGGATATTATTTCG
13   C11   AX00004577   CGCGCTTGCCACACTACATATACTTGATGCGCGTATCAACACCGCCTTCGCACA
13   C13   AX00004578   TAGTGTGGCAGTTTTTACAAGCCATAAAAACCGTTCACTAATGGATCACGTTGGT
13   C15   AX00004579   TTGTACTTACTGCTTTTTCCGGCTTTCTTATACATATATTAGAACCGTCGCACTTT
13   C17   AX00004580   AATGAGCGTTACGTACCGTACTGCATCGAGCCATCTTTAGGTGCTGACCGCGTA
13   C19   AX00004581   TACCTTTAATTATGCAGCGTCGTACGTATTATCCGAGTATTCAACTACATGGTCA
13   C21   AX00004582   TTCTTCATTTGGGACAAGTGTATCGCATTTAGGACAAGCAGATGTGTTTATTTTA
13   C23   AX00004583   TCGCTATCTTATCTACCATAAGGAGACGAACGATTTTGTTGGAACGGCTAGCCT
13   E01   AX00004584   ATGATCGCATAGAAGCGAAGAAGAAAGAATTGATCTATCTCGTTGAAAAGTACG
13   E03   AX00004585   AAATTGAATTGCCTCCATTTCTTATCGGAGAGATGATGGTATTGTCCTTAGGAGA
13   E05   AX00004586   TGAAATCCTTATATACGTAGTGGTGCTCACAGTTTTTGCACCAGTTTGGGAAGAA
13   E07   AX00004587   AGCTGGCATAGCGTTTGCTGTTAAAGAATTTAACCCGCAAACGTTTCGCCTTAG
13   E09   AX00004588   CGCAGGTTGCCGGAGTGAAGTGGTGCTTCAAGATTTTTTCGTTCACCCTGATCG
13   E11   AX00004589   GCTAAAAGAAAACAGCAATGATCTATACACGATGAGCCAAGGTACACTCTATCC
13   E13   AX00004590   TCGGGAGATCAGCCTTTTACTTTGGTAATCTGACGTACTTCTTTGAAACAGGTGA
13   E15   AX00004591   TTGGTTCTACGTTATGCGGCGGGCTATTTATTATGGGTAGGTAGCCAGGAACAG
13   E17   AX00004592   AAAGGTGAAAGCTGGACATTTACCTTTGAGGATAAAACTAAGCAAGGAACCATA
13   E19   AX00004593   ATGAAGCGGGTATAGATATACCTATACCATTTACAGATCATGATTTACATCTTGG
13   E21   AX00004594   TCTAATTACGGCAACGATTATGGGAATGGTATTTGCAATGTTATACAAAAAGACG
13   E23   AX00004595   GAAGCCAATGCAACAACCTAGTACTCATAATGAAGTGCGTTTACCAGCTACTGG
13   G01   AX00004596   TTATTAGCACGCTTCTCTTAACAACTAGTCAACCAACATTATATAGTTTCTTAGCT
13   G03   AX00004597   CTATTTTAAAATTTGCGGAAGCAGGGGTTAATTTCGTATTTGGTGGTCTAGCAAA
13   G05   AX00004598   AGATGTGTTTACGGAAATCTTTAAAGGTGCATTCGGTTTAGATTCAGCTGTAGGT
13   G07   AX00004599   ATGGTGTTAACGAAGTGTTCTTTAAAGTGACAGCGCACGGTTTTGAACAAATGG
13   G09   AX00004600   TATTTTGAGTTCACGCTGTACGATAAAGAAGGAAGAGAGAAGAAAAATGTAGCG
13   G11   AX00004601   CCAAAAGGTGATGTAGAAGGGATGCGTGAGTTGCATCAGCGTGGAATGAGTTT
13   G13   AX00004602   CATTAGGTGCGGCAGTAGGAGCTCCTGTTTTAACAGCGTTAACGGCTAGTATGT
13   G15   AX00004603   GGAGACCATTCATGCTATGAATCAAGTGATTCAAATGCAGCAACAAGCACAAGT
13   G17   AX00004604   ATTACAGCGTTAATCCGTTTAATTATCGTATCTCATGAGGAACCGATGGAGACGT
13   G19   AX00004605   GGCTATAAAGGAGAGCAGGCAATTGAATATCCGCTTAGTTTTCTATCCGAAACA
13   G21   AX00004606   ATCAACAAGGGAAGAAATGTTTAACGTGATGAAAGAGCAATACAATATCAGTCGA
13   G23   AX00004607   AAATTTATCAGAGTGGATAATTGAAATGGGAACGTATGCCGATGTTGATATTCAA
13   I01   AX00004608   ATGAATTGTCCCCAAAAGACAATAAGCTCGACAACCGAGTTATCAACCTTGAATG
13   I03   AX00004609   CATACATAGAAGGACGATACAGACATTTATTGGGAACTACACATGCACTAGGGT
13   I05   AX00004610   TCGATATAGTTGGCATGACTTGGGCTGGACATGATTTTTTAGATGCCGCTAGAA
13   I07   AX00004611   AAAAACAATTTGCAATGGAAGAAGCCGAGGAAGGCGATATTGAAACGTTGACAG
13   I09   AX00004612   CCATACGATGAGGAATCGTTCAAATGAAAAATACCAGATATTTGTCTTCGAGGAA
13   I11   AX00004613   TTCACGTTCAAGAATGTCAAGAATGATAAAAGATGGAAAAATAACGCCGATTAAG
13   I13   AX00004614   ATGGGGATTGCCACGTTAGAACGCTACATTGAATGGGGACTTTTAGAAAATGCT
13   I15   AX00004615   CATGGAGCTGAACTGTTAGAAGTTCGTACAGGGGAAGTGGAAAACGACCCAAAA
13   I17   AX00004616   AAGGAGTTTTTCATTCTTGAGCCAAAAGAAAATGGAGTGACGGTTTTAAAAGATG
13   I19   AX00004617   CTGTTAAACAATTACATGTGTATGGTGTACCATTTTCTGTTTGTAAGAAGCTTGA
13   I21   AX00004618   TCTATAATAGCTCATATGAAGGACTTGTGTATTCCATTATCTCAACGTTTACGATT
13   I23   AX00004619   CAAGCCAGCTTCTGATTGGGAATGGTGGAGAGGAAAACGTCAGGTGATTATTGG
13   K01   AX00004620   ACGGAAACGTGTCATTGACCGAGACGCTGGGCACTGTCAACGGTGTAGGATTA
13   K03   AX00004621   TTAGAGCTTCACCCATTGCTTTCAAAAGCTATTGTGGTTAACAAACGAATTAAGC
13   K05   AX00004622   CATCTTACGGGAAAGATTACCACCAATTAATTCAAGACGGTTTGCTTACCAATAT
13   K07   AX00004623   GATGCTTCAATGTCTGATTTCACATTCGACAAAGTAACTCTTGAACAACGTCGTG
13   K09   AX00004624   CTTGGTTTACCTGTTTATCGTAGAAATTTAGGCATTACAGGTTCAGGACAAAATG
13   K11   AX00004625   CACGGAATTTGCACCGAATAGGTGGATAAAGAAATCATGGAGTACACTGATTGA
13   K13   AX00004626   TACGACATTATGCCATTCAGTCGAACCTTAGGAACGGTTTAGACCTGTATTCATG
13   K15   AX00004627   TAGAGCGCCTGGTAGCAGCGACTGAAGGAACTGATTTACAAGTAGGTGCACAA
13   K17   AX00004628   TGCAACAACTAAAATCGTTGGTATCGACTCTATCCCTTCTAACTGGGAAGGCGT
13   K19   AX00004629   TCAAGCAAGCTTAAGCTCCCTTTCGCTAAATTCTACAGACGATGAAGCAAAACG
13   K21   AX00004630   TCTTCAAAGCTATGTTCATACTGTGGTCAAAAGAAAGTAGACTTAAAGCTATCCG
13   K23   AX00004631   AGCATGCTCACCACCTAACACTACAATTGATAAGAAGAATGATGTCGTTGTAAAG
13   M01   AX00004632   TGAGCGTGTTGTGAATAAGATGAAGTCATATTTTACGATTTGTATGACAAGCTTC
13   M03   AX00004633   AAAACAATCTGCAAGCACAGATAGCGCAGAGCAAATTTATCAAAAAAGTTGTATA
13   M05   AX00004634   ACGATACCATCGTCATCCGTTACCAGTTCCTCTATTTAGTTGGTGCGGAAATTGG
13   M07   AX00004635   AAAAATATCTTTGGGGAGACTATACAATATAGTGAATGTATAGATGAATCGATTA
13   M09   AX00004636   GAAGGAGTCGTGACTGGTGTAGTCAATGTGGAGGAGTTTGAAGGGCCTTTACA
13   M11   AX00004637   TCGCTACATGCTTTCTTCAATGAAAACGCTTGCTGACGAGAGAAACGTTGGAAT
13   M13   AX00004638   GGGTCTTGGATCTGATCAACCGGATGTAACACTGGGCATCGGTACAATGATTGT
13   M15   AX00004639   GAATGTTTCTTTACAGGAACGACGATTGAAATTTTGCCGATGACTCACCTTGATG
13   M17   AX00004640   TATGTTTATAGCGGGGTGGATTGGTAGCCTAATTGTCGATGCAGCGATTAACGA
13   M19   AX00004641   ATTTATAATACGCGTAAGCAAATAGCTAATTTACAGAATCAAGGACAGAAAGGGC
13   M21   AX00004642   TTAGGTGCTGGACCAACTGCGTATACAAGTTTAGGACCACTATTCGATCAAGGT
13   M23   AX00004643   ATTCACACGTATGCGTAAACAAGACCCACGTGGTGACTTTGGTCGTCAGATGCG
13   O01   AX00004644   AAAAAGAGGAGAATCGTGGTCGCTTAGCATTCTTCGCAGGCATTGATAATTGCC
13   O03   AX00004645   AAGAACAAATATCTCAATTTCAACATGGCTTACTACAAGAGGATCAAACCGGTAG
13   O05   AX00004646   GTTTGGCTAGTTTGTGGGTTAGTTACATGGTTTTTTGTAGGAACAACAATTACTC
13   O07   AX00004647   ACCTTGTTCATTGCCCAGAGCGAGTTCTTCCAGGACAAATTTTACATGAGTTAGT
13   O09   AX00004648   TGATATTTCGCCTAGCATAAACCTTATAGTGGGAACCAAAGATCATCACTATTTG
13   O11   AX00004649   TTTTGAAAGTTTCCATCTTGCTCCAGCTGAAGGAATGGCGTCGGGTGCCTTTCC
13   O13   AX00004650   ATTGATATTGATATACTTCAGAAGCGACCTATTATTAACAATAAGCTGGTCAAGC
13   O15   AX00004651   TTTTCGATTCCCTATCCAATATCAATCAGCAGTTAAGCCGTCGTTACCATATTCT
13   O17   AX00004652   AAGAGGATCTTCCTTTATGGGAAAAACGTCAAGAGGGCTTTACAGTAACTCGTG
13   O19   AX00004653   GAAATATGATTATATATTTGTTTCCACACCATCCATCTTTATACCTGTAGCAGGG
13   O21   AX00004654   CCCGAAGGATAAAGTAGAGCAACATAAAAAAAATACGCCTTTAAAAATCGATGAG
13   O23   AX00004655   TTTTAAGTTATGCCGCTTATGGCATTACCACATATGGTCATACGAATTTGTTTCT
13   A02   EMPTY        -
13   A04   AX00004656   AGTAAGACTTTTACTCGATAGATTGGGAAGCCATCATTTATCAAACGAGGCCATT
13   A06   AX00004657   ACAAGCCATTCTTCATTAAAGATGAAGAACTGTCTATTACACCAAGTATCGGAAT
13   A08   AX00004658   GGAAACGTTAAAGAAAGAAAAGTCAGCGTGCAAAGTAATGATTTTAACGACATTT
13   A10   AX00004659   AGATAACACGAAGCAGGGCGTGCGAAAAGCTCAGAAGTTAGAGAAGAGATGGA
13   A12   AX00004660   GATTGCACCGCAAGCAACAGGTATTGTTATGTACGGAGATGAAACAGGCGTTCA
13   A14   AX00004661   ATATTTGCTGGATCTAGTATCGGATATGCTATAGCTTCCATTATCCCGATAGATC
13   A16   AX00004662   TAATTGGCGTAGAATCCGTCACGAAAACGGTGGAAGTAATGGAAGATTGTATAT
13   A18   AX00004663   TTACTTGTTGGGGTACCAAGCTATGAAACATATGTAGAGCATATGAAAAAGCATC
13   A20   AX00004664   ATATAGAAGAATCCATTACGGCATTTCGTTTTCAAGCATTTTATTATTTACTACGC
13   A22   AX00004665   GGTACAGCATGCAGTGCTTACTTATTTGGAGTAGCAGAGTCATTAACAGTATTAA
13   A24   AX00004666   TATCTCTCCCTCTTGAAAAAAGGTATAAAAGCGAAATGGATAATGACTGTCCACA
13   C02   AX00004667   TTTATTCACTATTTGCAATTGGGACAAAGGTTGGCGTAGGAGCAATTTTTGGATC
13   C04   AX00004668   ATGAAAGCTATGTTTGAGTCTGCAAAGCAGATTGCAATTGGTAATAGCGTAGAG
13   C06   AX00004669   TCGTTCGATTAATCTATGTCGTACTTCTTTTCTCTTTCATTCATGGGGTTGACGA
13   C08   AX00004670   GTTTTGGTAGAATTATTCGCTTACACTATGGATTCCCTTATTTCTTGCGTGCTGT
13   C10   AX00004671   TTGGGTTCTCAACGTTCCAACCCCTATCGAATCAGATTTTTCAGTGATGTACAAT
13   C12   AX00004672   GTGATAAATTCACGATTATGTGGGCAGATTATGATTCCGCCCCAGTATGGAGCC
13   C14   AX00004673   AGGAACATGGAATCCAGGAGATTCAGCGTTACTATATCATTATAGTGGTCAACC
13   C16   AX00004674   GGGATGAACTACCTGATTGCGAATACCATTGCCTATTTAATTGGTGTTGCCAATA
13   C18   AX00004675   AATCAAATGACTGAGCGAAATCGCTTCATCCGCGGTATGATGTCTTGGGTTGGC
13   C20   AX00004676   TGAATTTTTGAAAGGCACAACGAACAAGTATATTATGACATCTTCAATGGCCGTC
13   C22   AX00004677   AAGATACAGTGGTAGAATTCCCCTACCTTTTACAAGGCAACAACCTAGCAGTGT
13   C24   AX00004678   TAGCAATCTGTTTTGCGGATGTATCTAAAGCGAAACGAGAATTAGGATGGGAAG
13   E02   AX00004679   ATCGATTTCACGTGCGAGTGTCCCGATTTTTGTAATGATTAGTGGAGCTTTACTA
13   E04   AX00004680   TTACAGATACGGGATACGTGAGTGACCGTATGAAAGGTGTTATTAAGGGGGCTA
13   E06   AX00004681   CCTAGGTGCTATATTGATTGATCAGGATGCATTAACTTCAGCATCGGAACTATTG
13   E08   AX00004682   TTATAAAGGCCAGGTAGCTGTCGCGAAGTTTCATGAAAAACAGACGCCTGTCAA
13   E10   AX00004683   CAAAATAAAGGAAATTATTAGAAGTGGTGAATCGCACATAGCGATTTGTGAAAGG
13   E12   AX00004684   CCAGCAACTGGATTTGGAGAACAAATAATTACTTGGCAAGGCGGGAAAGTTGAT
13   E14   AX00004685   AGCCATTATACAGATGAGGCTTACTTTGAAATTGAATGCGTTTGTCCAACAAAGG
13   E16   AX00004686   TATTAGAAAAATCGAGTGTATATCAAGCAGGTTAATTTTAGTTAGCGGGAATGCT
13   E18   AX00004687   GAAACCTAAGAAGAAACGAAAAGAGAAGTTAAGCACACGTGACATTGAAGGTTT
13   E20   AX00004688   GAATGATGCTGCTATCCTTCTTAAGGTGTCGCCTGGTCATATTAAGAATATGTGT
13   E22   AX00004689   ACAATAGGCGATTGTTTGGATTATATCGATGAGTATGTTGAATTAAGAAATCCGA
13   E24   AX00004690   CAACGATCTATTATTAGTTGTACCTAAAGAAGATTTAGCAAATGAAAAATTCCCG
13   G02   AX00004691   TTGCGATGTATTTCAGTTAAAGATGGAAGATGTGTTTGTTTTAAATAAGGAGGGG
13   G04   AX00004692   TATTCCAGTTTTTTGTTTAGTTGTTGGCCCCGTATTTGCTAATTCAGTTACTCCTT
13   G06   AX00004693   GCAAATTCATTCGTTACTCGCTCGCAATTTGGGTTTGGAGGAGGGGTCGATGGA
13   G08   AX00004694   CTATCATGAAGGACGAAAACTAGAAAGTTACCGCGGACACATCTTGCGCAATTT
13   G10   AX00004695   ATGTTCCACTTGGCGAAGCGTATGACCTATATGATCAAATTGATCGCCCGTTTTA
13   G12   AX00004696   TAAAAGAGTTTGTCAAAGCGACTGTGCGCGAAGTTTCAGCGTATTTTTTGCAGA
13   G14   AX00004697   AATTTAATTACTTACGACCCTGCAATCCAGATGGCATATCTGTATGTAATTCCAT
13   G16   AX00004698   CACGTATTCTATCGATTATTTGGAAAGGAAAGTTCATACAGCGCATTATTTACTT
13   G18   AX00004699   ATTTTGGGTAGTGGAATCAGAAGGACAAACGATTATCACTGCAACCTTCGCGGT
13   G20   AX00004700   ATTCAATTTGTTGCTTATTATAGCCGCGGATCTGTTATGTATTTTCAGATGGATG
13   G22   AX00004701   ATTTTGGAATCTTACGTGTTAGACGAAATTGATAGTGGCGTTGCGTTTGTTGCG
13   G24   AX00004702   AATATGTTGGGTTGTAAGTATATTTCTTATCCCAGATTATGAACCGAATAAAGTG
13   I02   AX00004703   AAGATGAAGTTTGTTAATAAAAGTTTGGATGTGCAATCCGGCTGGAACGAGGTC
13   I04   AX00004704   GAAACTAGAAGGTGTAGAACCTGTCATTATGATAATTGGAAGAATGATTGTATCA
13   I06   AX00004705   AGAATTCGGCGTAAGCTTAGGATCTAATACAGCATCTCGTTCTAACGGATCAGT
13   I08   AX00004706   GACTACATATTTTGATGGGATGGATGGGATATATGATGGGGTCACACATGAGAG
13   I10   AX00004707   ACATTTCATTGGTAACGCACAGCGCGGCGGACAGGTCATTTATACATATTCAGA
13   I12   AX00004708   AAGGGAGCGGAAACCAAGGCTCACCGAAATCAGGACAATTTCAGCAAGAGTTTA
13   I14   AX00004709   GTACAGCAACAATCGTATACTTCTGAAACAACGAATACTGCTCAGTCAGTTATTG
13   I16   AX00004710   ACGGGAACATTTTGAGGAAGTGTCTGAGAGAATTCAAGCGATGCTTGCTGATAT
13   I18   AX00004711   GTTGCAATAGACAAATTTACCGTTTTAATGTTAGTTGATGGAAAACAACAACTTA
13   I20   AX00004712   AGAAAAGTATGCCTGTTTAGAAGCCGAACGAAACTCACTAAAGGCGGAAAATGA
13   I22   AX00004713   TTGTTGATAGGGCGACACCTCAAATTTATTATACACCTTGTGAATCAGTGACAGT
13   I24   AX00004714   GCAAAGCAGTGCTGCAAAAAAACAACAAGTGATGCATATGAATCAGAAGCTAGA
13   K02   AX00004715   ATAGTAATATGCGCCACAGCAGTATTATTCATTACATTAGCTATGGTAAATGGAG
13   K04   AX00004716   CGAAAGTAGACGATGTTATTACATTGAAAGTACCAATTACAGCGGGAGTAGCAG
13   K06   AX00004717   AGTGGTAAAAACAGTATTGGGCCTAAGTATCATGCTAATAATGCAGTTTATACTA
13   K08   AX00004718   TTGGGATGGTTGACTATAAAGTATTAAAATACGAATTAGAGTATTTTCGGAATCC
13   K10   AX00004719   GAATCGGTAGTGCAATGATACAAAAGTTAGAATGGGAGAACGGAAAAACTACAA
13   K12   AX00004720   ATTAGAACCAGCTAAAGGTGAAGGGGCTATTATTTTCTTAAAGCAGTTGGTGCT
13   K14   AX00004721   ATTAGCAATTTCGGCTTTTAATGCTGTTGATTGTTTGGAAAATACGCTGCCTTCT
13   K16   AX00004722   GCTAGCAAAAGCTAACTGCTCCGTAAATAAGAAGAACACAATGGTCATTTGTATT
13   K18   AX00004723   ACTTATTGTTTATGAAACAAATAGTTGGTGCTGCTATTGGATTCATTTTTGCAGC
13   K20   AX00004724   ATTAGCATGTAGCATGATTAGTTTAAATGTATCACAACACTCTTCATTTAATGGTG
13   K22   AX00004725   TGATCTAGCATTAAGTGAAGATGATATTGCATCTCCACAAAAAGAATGTTACCCT
13   K24   AX00004726   TATTTCAACTGAAGATAAGAATCCTTCAGTATTACATAGTAGATTTGATCAGTTTC
13   M02   AX00004727   CTGTTATAGAGTTAACTTTACCGCCGGATATAGGCAGCATGTTAGACTCCAAATC
13   M04   AX00004728   AATTATTAAAGGAGCGTTAACAGGGGGTTCCAGAAGAGTTGTAGGTTTTGATAG
13   M06   AX00004729   ATGCGCGGCTAATGGAACTTATTGATGTGAGTACAATAGAAACCATGGCAGAAC
13   M08   AX00004730   TGTAGTGCTACAGCTTGCTCTAATTTAAAAATAAGCGAATCCACTTTTAAACGTT
13   M10   AX00004731   CTGTGGATAGGACCTATCCTTGTATTTGTAGGGTTATGTATGACAAACGTTATTT
13   M12   AX00004732   AACTGCTGGTTGCGCATCAACATTTATTTTAACAGTTTCATTTATTCAAAATATCT
13   M14   AX00004733   GGGGGATATATTAGAAATTGTGAATTTTTGGTTTGAAGATAAAGATGTCACAGCT
13   M16   AX00004734   AACAAGTGCAAATTAATAAGATGGTTGATTGGTCGTATGATTTAGTTCTGCAGTC
13   M18   AX00004735   AACATATCATTTCATATTGTGAAAAATTTGTTAGGTGTGGAGATTGCTGAAGAAA
13   M20   AX00004736   ATGAGCTGAAAAAGTTTAAGGAATTACTAGATATGGGCGTTATTACAGAAGATGA
13   M22   AX00004737   CCTCAAAAAAGTATATTCTCAATCGTTTTTTTATCAGTACTTCTCATTGGATCCTC
13   M24   AX00004738   TAAAAGAAATATCTGATATGGAACCAAGTGATTTTAAGAAATATGCTGGGACATA
13   O02   AX00004739   TGCTTTTCATATGGCTTATCAAGGACCTACTTATCGCGTCCAATGTGCTGTATGT
13   O04   AX00004740   AAAATAAAGGCTCATGATGTCGTTGATGTTGTTGAAAAGCTTGCTGAGAAGTACT
13   O06   AX00004741   GGAGAAGGATTTTTTGGGAGGAAAGGAATTACCTATTGAGGCATATTACGGAAT
13   O08   AX00004742   TGTCTATTTTATAAATGGAATGGTGTTAGGTAGAACCTTCCCTATGAAACAAAAT
13   O10   AX00004743   AAGAAGTTAGGTGGGGGATCAACTGCCCATAAAAGTCCGATTGGTTCAACTAAT
13   O12   AX00004744   GATATTATTCCTTTGCAATTTCTACCTGATTTGTTGTTATATTTTGCACTTTCATT
13   O14   AX00004745   TAACGGTGGGAATTTCTCCACTTTCTAAAGCGGATCAGTTTGCTACTCATGGAC
13   O16   AX00004746   AGATAGTGAGGAACATGCGCGAAAGATTGCTATGGAGCAACTAAAGGAATGTTC
13   O18   AX00004747   AACAGAAGAGATATCTGCCGGCACAGAAGAAGTAAGTGCATCTCTTTCGCTAGT
13   O20   AX00004748   CGATACAGAAAAACAACTCATTATGGCTAAAGTTACAGGTAATTTCAAAAGAGGC
13   O22   AX00004749   ATCGAAAAGTCATTATTGTTCTATGGAGAAGTAATTGGTTTAAAGCTGTATAAAA
13   O24   AX00004750   TGCAGAAATGGAGAACCCAGACAAAGAGAAAACCCGTAAAGCAAATCAAAAAGA
13   B02   EMPTY        -
13   B04   AX00004751   AGTGGTGAGAGAACTATATTCTCCAAGTGAGCAATATAAAGTTGAAATAATAAAA
13   B06   AX00004752   ATTTTGGATTACATTTGAATCTTTAATTCTGATTGGAGCAGCCTGGATGTTAATA
13   B08   AX00004753   GCGTTGGTAGTTGGGGAATGTTATTTACACCATCTCCGACAAACAACGCTGAAT
13   B10   AX00004754   GAAAGAAACGCACCATCAAACAAGAAGAATTTAAAAAGATTCCTATCGTTGAGAA
13   B12   AX00004755   TGATTTTGATGAACGAGCGATGTTAATTGGTGGTAAATTACTTTTAAGCCGTATA
13   B14   AX00004756   GTGATCGAAAAATAGAAGAGGTGTTTGAAGAACTTTACGAAAAGATTTATGGTTT
13   B16   AX00004757   AAGTTATACGATCCGGGAACAGGAATGGGTATTATTTTCGATCCAGGACCAGGC
13   B18   AX00004758   CTATCAGATATTATACGTTTACTAGCGGGCTTTCTATTATCCTTAAAATTACTATT
13   B20   AX00004759   TAGGAAACCAGAGCGGAAATGGTTGTTAATTCTACTAATGATAGGAATGTTAAGC
13   B22   AX00004760   GCGAACAACTTGCAAAGAAAAAGCAAGGTAACGGTAATGGTCAAAATGCCAAAA
13   B24   AX00004761   AAGTAGCGTACGCTCTATCTTTTTTCTTAGCGCAGGAGAGAGTGTGGATAGTTC
13   D02   AX00004762   TCTATTACTTAGTATTGCATTCTTCGGTATAGCAATTGCCACATATATTTTCCGCC
13   D04   AX00004763   CACGTTATTTACTTGTCGTTATACCAATGTTGCTCGTTGGTATGTTTGGCATCGA
13   D06   AX00004764   TGGAATTCCGCTTCTTTTCTTCAACGAATGAATCGAATGAAAGTATGCAGAAAGT
13   D08   AX00004765   TATATTCGCAACGCTTTTTTTACTAAGCAGTGCATTTTGCGCGGGTAAAGCACGT
13   D10   AX00004766   GATTCATATGCCACTTCCGGCAAATGGCATGACGAATATAAAAAAGTATATTGAA
13   D12   AX00004767   AAAAATTTTATTCAGTTATGGAGCGATCCAAATGTTTTGGGGACTTGTAATGCTT
13   D14   AX00004768   AACACAGACATGATGATTGTAACCGCAGACATGGGTGCGGCGGCGGTTTTGCG
13   D16   AX00004769   GAAATTCTCCATGTTCGTACAAAAGATCTAGATGAGTGTGAAGGAAATAAATTAT
13   D18   AX00004770   TCGGTATTCGGCATGATAATTGCGCTACTACCGATATTGATAGTTGTTTTTGTAT
13   D20   AX00004771   ATAATGATGATGTTGTTTATGTATCAAGTGTACAATAACCTATTCGTTAAAGATGA
13   D22   AX00004772   GCAATGGCATGGGGTATTTCATTAGGAGATACAGCTTTAGAGAAAAACCAAGTA
13   D24   AX00004773   GGCAGTATTCTTCATATGTAATCCCCTCTCTTTTTTCTTAGGGTGGATTGAATTT
13   F02   AX00004774   TGTTTTTGGTGTTTCTTCTAAGCCGTTACGTTTTATAGGAAAAGCGCTCTTTCAT
13   F04   AX00004775   GTGAAAAGGACATGGTGAATACGGAAACAGATGATCCGAAGTATATATATTATTT
13   F06   AX00004776   ATGAAAGATACGAGCTCAGTAGAGCGACTTGAAATAAAGAAATTTTGTAAAACAT
13   F08   AX00004777   TGCTGGAGCTGACTTCGTAGGCGATGCTGATTACATCGGTAAAATCCAACAAGG
13   F10   AX00004778   GTGGTCGTGTAAAAGACTTACCAGGGGTACGTTACCACATCGTTCGTGGTGCG
13   F12   AX00004779   AGATTCTCGTGAGCAATTCGAAATGCGTACGCACAAACGTCTAATCGACATCGT
13   F14   AX00004780   TTCCAAGGTGTTATCAAACGCCACGGACAATCTCGCGGACCTATGTCTCATGGT
13   F16   AX00004781   TAAAAACTCGCTCTGAAGTTCGCGGTGGTGGTCGTAAACCATGGCGTCAAAAAG
13   F18   AX00004782   TAGAGAATCCAACTCGCATTCGTGAAGTGCGTAAAGCGATTGCTCGTATGAAAA
13   F20   AX00004783   CGAACGTAACCAACGCAAAGTTTATACTGGTCGTGTAGTGTCTGACAAAATGGA
13   F22   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
13   F24   AX00004785   ACCAATCTGCGAAAAATGTAAAGTTATTCGTAGACGTGGAAAAGTAATGGTTATT
13   H02   AX00004786   AGTCAAATGGGGTTCTTTGCTTATTTAACAATCCACCGTTTTGGACTAGGGATGT
13   H04   AX00004787   GAAAGATATAAAATCATTTTTTGTTTGTTTCGAAGAGTCGCTAATGCAGAGGACT
13   H06   AX00004788   TAGTAATATCGTCTTGCATTATGGGAATTAATTATTTAGTTAGCTATATTTGGTCA
13   H08   AX00004789   AGGGAGAGTGATTCCTTATACTGGTGATAGGGAATTTATTACACATCTGGGGAG
13   H10   AX00004790   CACTTTATATCTCCATGAGGAGCGTGCTAACGCTCGTCCGATAATCGTCCCTAA
13   H12   AX00004791   TATCGGACTTGCAAGTGGAGCGACTCTTCTTACAGCTTTCATTTACTCACTTGCT
13   H14   AX00004792   AAATACAATGGGCATGGTGCTATCCGCACTTGTCGATGCAAAAGCAGTTGCAAC
13   H16   AX00004793   CGTCGGAGTTGCTTGTGAGCTTGCAGCAATTAATCGAAATGGTCGTAAGAAGAT
13   H18   AX00004794   AAACATCACTTTTAACAAATTAGATCTTTTAGGATTAGCTAGCGGCTCAATTCTTC
13   H20   AX00004795   CGTAAAGAAGAAGTAGTGAAGTTTCCAATTAAAGATTTCTGTAGCTACTTTACTG
13   H22   AX00004796   TGCGATGACAATAATGGCTTTCTTCATATTCGTTTACCCCTTTTTTATTGTTGGTT
13   H24   AX00004797   TGTCTGCACATCATGCGCGCATTCAAGGATTACAAGAAGATAACTATAACGGTA
13   J02   AX00004798   ATGCTCAATAACGGAGCATGCCTCTTTTATGGAATCGACATGTATAATAATACCA
13   J04   AX00004799   TGCCTACATGGCTTAAAAAACAAATGCAACGCGCATATTTTGAAAAAAACCGGTA
13   J06   AX00004800   ACAAGGGGCTATCTTCTTCAACTCTGTTCAACATATTATTTTGTTTTTTATTTATC
13   J08   AX00004801   CCTGATTATTTTTTTGAAAATGGAAGACTGGAAAGAAGAAATTCATAGAAAGGAG
13   J10   AX00004802   CTTTGCGGGATCTGATAATGATAGCTCGCATGGAGGTTCACATGATTGTGGAGG
13   J12   AX00004803   AGGGAATAGTATGGACTGGTTAGATGGGTTTGGTATATTTTACATCATTGGCGG
13   J14   AX00004804   AAAGGATAAACAAGAAGCATCTGAGCCTGTTGTTCAACGCATGATGACGGACCC
13   J16   AX00004805   TGAAAAAAGAGCAATTAGCAAGGGAACTAATGGTGAAGTGGGTTTTAGAGAACA
13   J18   AX00004806   GTATAAATGATAAGTGTATTGGCTGTGGTGCGGAGGTTGATGATCCAGAGTGCG
13   J20   AX00004807   TATTGTGTGAAGAATGCGATAAAGTAATCATCATTGGTGTAAAAACGGAATCCGG
13   J22   AX00004808   TTGATAAATATAGAAAGCGAGGTTAAGAGAATGAAACCTTTGAAGAAAAGAAAGG
13   J24   AX00004809   TAAAAATAAGTGGCAGAGTCGTGACCGCTTTTTGGCAGGAAATGTGCCGGTTGT
13   L02   AX00004810   TCTCCTTATTAACGGTAACATTCAATCAGTACCATCTGCTGGTTTCGGATTTTAT
13   L04   AX00004811   GAACAAATTCGGTTGCCGTAATTGGGTAAGTCCTGAAGCAAATTTAGCATATGA
13   L06   AX00004812   ATTTACAAAGTTTGGCGTTCCAGAAGCAAAAAGCTTTTTGGATGAATTAGCACCT
13   L08   AX00004813   TATTCATTAATACTGATACGAGCAGTTTTCCCTACGCAAAACTATTAGCAACAAT
13   L10   AX00004814   GTGTTTATTTTGTGCCAGCCTTTCTTGGGGCAAAAAAATACCGTAGGCTCTAAAG
13   L12   AX00004815   ACGCGGAAAAGCATTTGATCATAAGAAAAAAGGGCACGATCATCAACCACCTAA
13   L14   AX00004816   CCATGACCGTACAGAAACCGTACTGAAAGTTTCTCTATATCATGCATATTTGCTC
13   L16   AX00004817   ATGAAAAAGTGGAATGATAAAACGAAAGTTACATGTTCTATATTAGGCCTTTCGT
13   L18   AX00004818   AACGCGTTATCTAGTACACAAGAAGTTCTCTACCAACGAGAATTTCGTAAAGCAG
13   L20   AX00004819   ATCACTCACATTTCTTACAGCTATTTTTACATCTGGTTACAATGATAAACCCGGTA
13   L22   AX00004820   AAAAGCAAGATCGTAATACGGTTGTCATGTGCATTGCCGTATCTATGGTTATTAT
13   L24   AX00004821   TGAAAAAGATGGTATTTGGAGCATTAGCATTTATAGTGACTCTTACAGTTGCTGG
13   N02   AX00004822   TAGCCAAGGTGTCGGTCTTATTTGTTTAGGGGGATTTGCTGCATCTGTTACGTT
13   N04   AX00004823   CTTCTTACTAGTTTGCTAGAAAGATTCTGTGAATTATTGTTCACATTTGTTAGTTT
13   N06   AX00004824   ACTGGATTGGGAATTAGTTGCACAATATTAATAGCGATTCTTCCAGGAGCCATAT
13   N08   AX00004825   TTTTTTTGGTATACAAGGAAGCTATACGGCACAATCTCTCCTTTATGGAATGTTA
13   N10   AX00004826   CCGTATTTCCCGTATTCTTTATGGCTATTTTATTATTCATAGCTAGGTACATTCAT
13   N12   AX00004827   TTTTCTTTTCAAGCACCTATTACTGTTGTTACAAGGAATAAACGATATCCCGCGA
13   N14   AX00004828   GTGCAACAAGCGATGCACTTCATGTCATTCGCTCTTTTTATTTCGTATTTAAAAG
13   N16   AX00004829   TAATGATCGGGATTTTTGTTGTGTTAGTTGCATCAATGGTAAGTCTTGCAAGTTG
13   N18   AX00004830   ACGACCTGTTTATTTATCGTGTGTTTGTATGCGTTTCTCGTCTTTTCGTTTTATGT
13   N20   AX00004831   ACGATGGGTTGCTTCATTTGTAAAGAACTTGGGGATGTCTAAGTTCTTTTTTATT
13   N22   AX00004832   CTTCTTACTCGGTTATATCGGGGCTTCAAACGGCAACTTAGGACAATTCGAGAA
13   N24   AX00004833   TATAGTGAAGGATTATGTTGGATATTAGCAATACTAACTGACTGTAAGTCTTTTC
13   P02   AX00004834   AGTAACGTTCTTTGCACATGGTTTAGCGAAGTTTCAATCAGGTATCGATAACGTA
13   P04   AX00004835   TGAGGAGCACAACTTTTTATGGAGCCTTCAAGGTGGAGATACTGGTAAGGCAAC
13   P06   AX00004836   ATGTCATATTAACATGTATCTTTGAAGTTTTTTGGGTGTTTGGTTTTAATACGGCC
13   P08   AX00004837   TGTAATGGATTTAGCTCTGTTAAATGGCAGAAAACATTTATATCATTACGCAACC
13   P10   AX00004838   TGCAAAAAATTTAATTAAGCGAGTAAAACCAATTGTGACTGAAGCAGAAAGAAGC
13   P12   AX00004839   ATTTGTTTTAGAGTGGGGGAAAGCACTGGGGGGACCTGGTGCTTTTTTCTTTTG
13   P14   AX00004840   TGGAACTCCCAAAAGAACTGAAACGCTTTTATCAAGAAATAGGTTGTGGGTTTTT
13   P16   AX00004841   GGACTACTTATTGAATCCGCCACATTTTTAGAAGATGCTCGATCTAAAGTCTGTA
13   P18   AX00004842   TGGCAAGATCTTTCATTATAAAGAACAAATGTAGTTTGAATGGTGAAACAACAAC
13   P20   AX00004843   GTACTTGTGGTGGAGGCTGCGGATTCGGCGGCGGTTTCGCTTTACTTGTTGTA
13   P22   AX00004844   AATCGTTTTATTTGTAGGACTCGCATTTTTTGTTTTCGGTATGGTTTATCATTTAT
13   P24   AX00004845   TATTTTTTGGAGATTGCATGTATGGTATAACAAGAAACACAATGTTCCTAAGGTT
13   B01   EMPTY        -
13   B03   AX00004846   ATGGGATATGGTGGTAGTTGCGGCGAAGGCTGCGGTTTCGCTGGAGGATTTGC
13   B05   AX00004847   ATTCCTTGCTACTAGTAGCTTATTAGTTTACGGATTTGCCGCTTGTACTTTTTTAA
13   B07   AX00004848   TAAAACGATAAATAAGTTTATAAAAATAAGGAATATAGGAAAGGACCCGCTGGAG
13   B09   AX00004849   ATGAACGTTGGGTATACAGCTTTATTTCTCAAATCATGGCTGAAAACATGGGCAA
13   B11   AX00004850   ATTACGATGAACGCCATTCACTCTACTACTATTCTTTATAATGAAACACCTACAAT
13   B13   AX00004851   GTGACAATATGTTTTGGTTAGGATGCTTTTTAGGATACATTGTAGGTTCTGTTAT
13   B15   AX00004852   TTTACACTGACTTTAGGGGTGTATAGTTCAACAAATCATCAAAAAAGTCCAACAC
13   B17   AX00004853   GGAAACTTTACCATGGTGGGTGTATCTTGTAATCGTTGGGATCGTATTAAGTGG
13   B19   AX00004854   GAAATTATTATTCATTTAAGCGATCTGTTCGGTATTACGATTGATGAATTGTTAAG
13   B21   AX00004855   TAGCGAACATTGCAATTATAGCGGATGCACCGTATGTAATGAATTTTTTACCCCT
13   B23   AX00004856   TATTTATGTCAGGAGTTTAGACCGTACGGGTTACTTTCAACAAAGGCGAGCGTA
13   D01   AX00004857   TTTTTATTTAGCGGTTTTTGAAGAAGAATTTCAAAATGAAAGAGCGCCTTGGGAG
13   D03   AX00004858   GGTAAAGGTGGTAGTGGCGGTAACGGCGGTGGTGAAGTTGGACAAGCTGGTAA
13   D05   AX00004859   TGGCCCAAATGTTGGCCGCTACTTTAATAGTTGGAGTCCCTGTTGTTTTAGTTG
13   D07   AX00004860   GAATATGAAGGATGGAAATGCTACACTGATAAAGCAGGCCAAGAAAGAACGAAC
13   D09   AX00004861   ACAACTCAATACTTCTAATTTTACACAACCACTCCCCGCTAATTCATTTACACTCT
13   D11   AX00004862   TTATATTTGGGCTATTTTTCATTCTATTATTCTTTGCAAGGCCTTTTTGTAAATCG
13   D13   AX00004863   TGAAATCAACGTATGCGATTCGTTCGGATAATTGGTATAATATTCTTACAATTAAA
13   D15   AX00004864   AAGATTGAAAAAGGTGTGATTTATCCATCTAGCATATTGTTATATCAATTATCAGA
13   D17   AX00004865   CGTTTAGAAATGGAGTTGATACATATGCCACATACGAGTGATAACGACAAAAAAG
13   D19   AX00004866   TATCCAACAAGGAGCCGATGCTGTTATGAAGCATGATGCAAGATTCCCGTACAG
13   D21   AX00004867   CATATGAGTGGGGAATCCCTTCATAACAATTCTAAGCAGGAAGGGAGAGTTGTA
13   D23   AX00004868   TCTTTTATTCGGAGTCATTGTCATCGCCCTCTCGTATTTCAACCATAAAAAACGA
13   F01   AX00004869   ATGAGCTGCAATTGTAACGAAGACCATCATCACCATGATTGTGATTTCAACTGTG
13   F03   AX00004870   TATTACTATCCCAGAATTTTTGGAACATCGCTTCCAAGACAAATCCCATATGCTA
13   F05   AX00004871   GAATGGGCTTCGGAGCTTCCAAACCGAAACGAAAGAAGTAGGCTTTGGCGACA
13   F07   AX00004872   TATATGTGATAAAGGACCAGACGTTAATGCTGCCTCGGAATGGGGTGGTACGAC
13   F09   AX00004873   TGGTTCTTGCGGTTCATCTGGAAGATGGGCGAGAAGGCCGGCGCACATATATT
13   F11   AX00004874   TATATCGCTTTGGTTGTCACTTATGATTTTTGATCGGGGCGTGTGGCTGGTGTC
13   F13   AX00004875   TATTGAAAATGGAAATCGCTTATCCTACATACCTCTCATTCCATATACAAATGGTC
13   F15   AX00004876   CGGGTATGTGCTCGCAACTACAGTAGAATGTGCCCTGCAAATGGTTCGGGATTA
13   F17   AX00004877   TCGGTATGCATAAGATGAAACAGAGAATTAATAAGGGGAAGGAAGAAGGAGAGA
13   F19   AX00004878   TGGACACATTTTCGCATCTCTTTCATATAATTTACCAATACAAAAAAAGTTGGTCG
13   F21   AX00004879   CGAGCTTGGAAAGCACGTAAAGAAAATCAAAAACCACATGGCAAAGTGAAAGCT
13   F23   AX00004880   AAAGAGATATGGTCTCGACCACTCACACAATGGGTTGCAAAGACGGTTTATTAC
13   H01   AX00004881   ATCGTTCAAAAAGAACTGTGAAAACAGAAAAAGGGTATGCAGGTGATTCTGTTC
13   H03   AX00004882   AAACAACCGCTATATTATGAGCGGCTGTTTTGCGTTGTATATTTTCTCTGAACTT
13   H05   AX00004883   TGTGGAATAAGGGAGAGGAATTTATGATTAATATCAAAAACTTAGTAGTTGGCTT
13   H07   AX00004884   TTATTTTCCCCCTTTTTCAGCAAAAGTCGTTGTATATTCCCGAATTTATAAAAACG
13   H09   AX00004885   CAGAGAAAAAAACTACTCCATACAAACTTCTATATACGAAACAAAGCAACATCCC
13   H11   AX00004886   AATTGTGTGAGCGTCATCCGTGGAAGAGTTGGAATAAAGTGAAGATTGATCACT
13   H13   AX00004887   TGCTAAGTAGTATTGCATATTTACTAATGATGTTGGATTTCCCGTTCCCAGGGCT
13   H15   AX00004888   TTGTATTGCATGTGGTGCTTGTGGCGCTGCTGCACCAGACATTTATGACTATGA
13   H17   AX00004889   ACGTTTTCTAACAGGAAGGCCATATAAGAGAAGTGAGTTGGCGAGAAAACTATG
13   H19   AX00004890   GGTTGAATCTGACCGCGACCAATCACTACAATATCCGGGTGCAACTGGACTGGA
13   H21   AX00004891   TAGAGTAGAGTTGGAGGAAAGAATAAAAGGTGTTGGACATACAGTTTGGTTTAT
13   H23   AX00004892   ACAAAACAAACAAAATAAACCCAAAACTGGAAATCCAAAATTAGATGGTCCAAAC
13   J01   AX00004893   CTGTACCTGCTACTAATGCATATACCATACTCATGCACCAACCTTTTTTGATAAT
13   J03   AX00004894   AGAAAATATGAAAGAAATTGAGGAACGAATTGAGAAACGACATGTAGCATATAGT
13   J05   AX00004895   TTTATGTTGACTTGGTTAACATGTGCAGTCGGTGAATTTGTTGTCATGGCCATTG
13   J07   AX00004896   GGATAAAAAGCAACTCATTACAGAGGTAAATGACTTATTAGAAACGTATTGTGAA
13   J09   AX00004897   GGATATGAAAAAGAAGAAAATAATGAAGTATATGATAGGAATTATAATGGTTTGC
13   J11   AX00004898   AAAAGGAGGAACACATATGAGTTATGGTGGAAGTTGCGCTGGTTTCGGCGGTG
13   J13   AX00004899   TATTGTGCGTGATACAGAATCGTTGTGGCCAGATTCGTTAGATTTTACTGGTGA
13   J15   AX00004900   GGAGCAATTAATGGGGGATAGGTATGTTTTTAAGAATGATATTAATGCAAAGCTT
13   J17   AX00004901   AGAAATATGGGATTATCTGTCCCACTCGTAAAGCGAATCCTTACAAAAGAATGAC
13   J19   AX00004902   ACCCATACGTAAAATCTGTAAGCGAGAAAGGTATCACTTATACAGCGAAATTTAA
13   J21   AX00004903   GCTGCTAAATGTCGTAAATCTTTCTTCCTTCTATTTTTCTCACTACCATATAACTG
13   J23   AX00004904   GTCATAATTAGTTGTATGATGATTATGGGGAGTTGTGCTAATACATTTGTTGAAG
13   L01   AX00004905   GGCAGAAGAAACGAATTACACGATTAGTGAGTTAAATATTGAAAAAGTCCCTAAG
13   L03   AX00004906   GCAAGGGTTAAATCATTTCTTTGGACCGCTTGAAGCGAAAATTATGGAGATTGT
13   L05   AX00004907   TACAGGAAGTAAAGGGTGGAACCGTTGGCAATCAAGTGCAAAAAAGAAGAAAGC
13   L07   AX00004908   ATCGATTGGGGCTGTTTTCGAATAGAAACAGAACTGTCATATGTACAGACATGTA
13   L09   AX00004909   CAAAAAGCTGAATCATTGTATACAATAGAATTAGAACAACAATTTGTATGGAGTG
13   L11   AX00004910   CTAAGAAAAAGAGTAGAGTGAAAAATGAAATATTACTTTGGACATTAACAGCGGT
13   L13   AX00004911   AACAAAACCAGAACTGTTGGTTTTAGATGAACATATCAATGGTTTAGACGTTGTT
13   L15   AX00004912   GAAATAAGGTGGGACAAAATTTAGAGTTAGAATTACTTCCAATAGGTTCTGTTGT
13   L17   AX00004913   ATTTTTATTCGAAAAAGATGTAGATGGTAAAAAGCAAGTAGTAGTATTTAGGAGG
13   L19   AX00004914   ATCGATTGATTTGGCACAGTTAAGTAGAATGTTTTTCTTACTCGCATTTGCGATG
13   L21   AX00004915   TTTCTACTTCCCTTCTCACCGGATTATTTCTTATATTTCTTCCCTAAACGCGCATA
13   L23   AX00004916   TTACGAAGAGGCACAAAGGAGAGGTTTTCAGGCCTTCTTTCGATGGGTGAAAGA
13   N01   AX00004917   AGGGGACACCCTCTTTATACGTATTTCTTTCATACTTAAAGCTTGAAAGGGAGGG
13   N03   AX00004918   ATGGTATTTACATGAGTACGATTGAGAAATGGACGGCTGTTGATCAATATGTGA
13   N05   AX00004919   TGCGGCAATTATCCTTCAAAAAAATCCACCGACAGATATTAATGCGGCATATGGT
13   N07   AX00004920   CGGATATAGTTGCTGTGGTTACGGATATGGCGGCGGCGGTTGTGGTTATGGAG
13   N09   AX00004921   GAGCCATTCTCTGTACAAGATGAGGTATTGTACGAGACTGGACAATATATGGAC
13   N11   AX00004922   ACCATACTGCAAGTTCTGTATATTGACGACAAGGTCAAGTGGAAACATTTAAAAG
13   N13   AX00004923   GAAAAAGCCACAGAAAAACCAGTTCTTGATTTTAGTTGATTCTCTAATTTTGCTA
13   N15   AX00004924   AAATTACTGGCAGAATTGTGCCGGTTGTTTTGAAATCATCGTGATATATTTGTAT
13   N17   AX00004925   ATTAATAAGTAATTTAGGAGATGCATCAACAGTCACAAAATTACGAGAGAAAGAT
13   N19   AX00004926   ATGTGTAACAGCCTCTATGGATTGGGTGGATTTCTTACATCCAGTTCGCTCTTCA
13   N21   AX00004927   ACATGGTACTTCCGCTTTTATGTATTTCATATTGATTGTTTTAAACGACAGCAAG
13   N23   AX00004928   TTTGCTAAGTATCCTACATTTCGTATTGCGTTACATATTTCAGCGTACTTAACACT
13   P01   AX00004929   TACTATTCTTATTTTTTGTTGATATTGTCATTGCCCTTATCGCTCTTGGCTTTTCA
13   P03   AX00004930   AAATGGTTCTGCCATTTCTTCTAGTATATTAGCAGAATATAATGTAAAGAGAATG
13   P05   AX00004931   GCTGAGAAATACACACTATTAGGGGAGCGCCAATATATTGGAAAAATCCACGTT
13   P07   AX00004932   GACAAGTGCAACATTACGAGCACCTCTTTCTATTCAGTTTTTATATTGGATATTC
13   P09   AX00004933   AATCATCGCATTTGCGTCTATGTTCTTCCCACGTATTTCACCTTTTGGTGCACCA
13   P11   AX00004934   ACATTTTAACGGATGGACGTTATGCACACGTTATCCGCAAAAAACGGGTAAACG
13   P13   AX00004935   TTGTTGAAGGTACTGCTTCAAATGGATTGAAGTTCAGAGGTTATTTAAATGATAC
13   P15   AX00004936   GTACTTTTGTATTCATAGGAGTCTCCACTTTAAACAACGTGTTACAGCGTAAAGT
13   P17   AX00004937   AGTTCGGTTTGCTGTATAGTACCACTGGAATAGCCCTTTTATTCCTTTTATTTTG
13   P19   AX00004938   TAGTGAAGCGTTAATTTTATATAAGGGAGGGTTATTTGAGCGTATAGATAAGGG
13   P21   AX00004939   TTGATACGGAAGAGATTGCGGAGTTTTTTTATGAGCAACTAATTGAAAGAGGATA
13   P23   AX00004940   TGCACAATGGCTATTGTAAAGCTGATCCGCAAGAACAAGAGGGAATTATTACAA
14   A01   EMPTY        -
14   A03   AX00004941   ATAGAGTGTGCAACTCTTACGGGAATGATTACTCAAGAAGATTTGGTTGGGCCG
14   A05   AX00004942   GAGTATGGAAACAGTCAATCTATTACTATGCATTTCGAACAATTTAAAAAGTTGC
14   A07   AX00004943   TATCTCCCGTGATTTCAAAAACTATAGTTGCTGTTGGCTATAATCCTTTTTCTATG
14   A09   AX00004944   TTACTTGCGAATATGACTGAATTTGGGAAAACGCCGTATTATAGTGCAGAGGAA
14   A11   AX00004945   CAAAATGAACATAAAAAAACAAGACTTAGCGAAACGCATTGAAATAGAAAGAGGA
14   A13   AX00004946   GAAGTCTATGGGATATTAAGAATGTACAAAAGATCAAGTTGAAATTAGAAATTGC
14   A15   AX00004947   AGTACCACCAGAACAAACCCCTGTTTGGGAATGTGAAGCAGAGGATTGTTTAGG
14   A17   AX00004948   TTTAAACAGTTTACATGTGTGTAAAGACAGACGTTTTGATGTTTCGAGATTAGAT
14   A19   AX00004949   GATAGTTGCGTTGTGTTTGTAAACGGACAACCTTTTTTAGTTCTTTCAATAGCTG
14   A21   AX00004950   ATGAAAAAGCTCTTGTTGCTCGTCTACTTTCATTATATGCGAAACAAAAACCTTT
14   A23   AX00004951   AACAATCATTTATACGCCTCCCTATTATGTGGTTAACTATTATGATATCCGAGATG
14   C01   AX00004952   TGCAGACGCTGAAATTCGAGAAAAGAGCAAAGTAAAAATGGAGTCATTATTTACT
14   C03   AX00004953   GTGACTACTTTCAAGAAGATGGGAGAAAAGAGAGGAAAAATAATTCAAAACAAAG
14   C05   AX00004954   ACAAGCAGCTCTCTTTATGACAAAAGACGTGGACAAGCTTCTAAATTTAGCTACA
14   C07   AX00004955   AAGTAGCATTGTAGGAACTCTTCCAAACCATATCGTACAAAATATTGAAAAGTTT
14   C09   AX00004956   ATTAATTTCTCTAACCGATTTATATTTTCCGTTAATGCACCTTTCACAAGAGAGAA
14   C11   AX00004957   GACTTTAATCGGAGCAATTTCTGGAGCAGTCTTTGGTAAAATCTCCTATAGAAAT
14   C13   AX00004958   ATCTAGATTAAGTAGAGCAAGAAGTAAGGTTTCAAAACTAATAGGGGAGGGTGG
14   C15   AX00004959   TTTTCAAATGGATTTGACTCATCTGAAGATATAAAACGCCTTCCTAACGATTATAC
14   C17   AX00004960   TTATAGATTGGGTAGATGCTAGTTCAGGTGACATTCGTGCAGCTAGATTTTCTG
14   C19   AX00004961   GTGTACGGTATCATTATGAAAAAAATCCAAAAGTTATTACAAGAAGACGTCTTAA
14   C21   AX00004962   AAATAAGCTTGGTGCTTTTTCACATAAAATTAACATTTCAAGAGGAGCTTGTCTG
14   C23   AX00004963   GTTTCTTGAAGTGTTTGCAGTATACGAGGGATTCGCTAAAGCGGCAGATCAAGA
14   E01   AX00004964   AAAACTACATCATACGGAAAAGCTATATGAATTGACTCAAAAGAAATTTGAAAGG
14   E03   AX00004965   GATCAACTACCTATTAGTTTTCAAACCAAAAGGAGGAGAAAATATGAGTTACGGT
14   E05   AX00004966   AACAAACCTGTAACAAGAGTGTTTCAAGGAAAAGAAGTAATTTCTGGGGTTAACA
14   E07   AX00004967   TCAAGATGTTCGTACAATGGACTGTCATTTAGATGTAGAAGATACGGAAGAGAT
14   E09   AX00004968   AAATTGGCTTCATCACCATATTAGAGGTATGTTAGGTTCTTATATTGGTGCCGTT
14   E11   AX00004969   GGACAAACATTTGCTGATTTTTGCCCTAGCTTAATATCTAAAGGGGCCCGTATAT
14   E13   AX00004970   GAGCAAAATGCGATCTATAGCGATCCAAAAGATGCAGCTAATATGCAAACGGTA
14   E15   AX00004971   GAATAATATCGGGTATGAAAAAAACACGCTAAGCAAATTCGAAGGAAATAAGCAG
14   E17   AX00004972   TTATCAGCTCTAAGACAGGTTAGGGAAGAAAAAATATACTATCATTACGCAAGTG
14   E19   AX00004973   ATGTATAGTGATGGGCGATACTTATATTTTTCTATGTTTAAAAAAACGGACAATC
14   E21   AX00004974   GTGATAGAGAGGTGGGAGATAGTGGGAATGAAAACAAAATTATATTTTAGTGTA
14   E23   AX00004975   AGAAAGACTCGCGCAGCCGATGTATTACTTGAAGAGAGATAATTTTGCATGGAG
14   G01   AX00004976   ACGCTCATAAATGGGGGGCTAGGGCTCTTATCATTTCTTATATAATTGTTACGAT
14   G03   AX00004977   AAGGAATGATGCCTTGGCAATAGGTATTGGTATAGGGGTTGTAATCGGTGTGTT
14   G05   AX00004978   TCTAACAGATCAGCCTGAAGGAAACTCTTTAGGCATGGGACTGTGGCTAATATT
14   G07   AX00004979   TAGTGCAGCGCTAATTTTGGACTGTTTAGAAAAAGGGATACATCCAAACTGGGA
14   G09   AX00004980   GCAGGAATTTGTGAATTTGTGGTGGAAGTAACAGCAGATGCTATTGGGAATTTA
14   G11   AX00004981   GTCTGAAGAAGAAGAGGTTTCCGAGAAAGTTTATAATTACTTACGTCGTAATGAA
14   G13   AX00004982   TTTCATATTTTTACTGATAACTCCTATTGTTTTTTTTGGCTACCGTAGCGTTCGCT
14   G15   AX00004983   TTTAGCGTTAACTGCACCTGTGTTTTCTGGACAATTAAATATGAATTCGACCATC
14   G17   AX00004984   TTCCAAAGATGAAATTTTTCATAATGAGCAAATTGAAAAAGCTATGAATGATGTTA
14   G19   AX00004985   CTGAAGCTGAAATCAATCGTAAACAACAATTAAAACAACTGACTGATAAAATGAC
14   G21   AX00004986   AGAACAACAATACAAAAAGATTATGGACGAAATTCGAGATCGTAGAACCAAATAC
14   G23   AX00004987   GCAAGGTGGACTGTTTCTCGTTGCATTGTTAACGTTCGTCGTCGTTTTAATAGAC
14   I01   AX00004988   AACTATCCTATTTGGGTCTGGGAAGCAAATAATTACCCAAACCGAAATCATAAAG
14   I03   AX00004989   GTGTGAATCAGTACAAAGATAAGCATGAATTACAGCCTTGGAGCATCTTTTCCG
14   I05   AX00004990   AACGCCAGGATTTGTCATACTGTTAATAACGCAAATAATTGGTTGTTCTTTCTCC
14   I07   AX00004991   AATCGGCGTAAAGGTTGGGCTTGTAATAAAAAAGAAATATTTACTACAACAGATA
14   I09   AX00004992   TGATAGTGTGAAAAAGAAAGAGTTTGGAATAGAAGAAAAATTTGAGGAAGTTGAT
14   I11   AX00004993   CCTGTTATCCTCGTTACAAGCTTTTCTCATTATTCTAATGCTGAGCAGCCAAAAG
14   I13   AX00004994   GAACTTAAAAACATTCAACAAGCGGACTATCTCGTATCCTATTCAAATGCAATGA
14   I15   AX00004995   GTTAGAAAAGACGTTACAAAAAATAGATGATTATGAACGCGGCAAAAAAGACCTA
14   I17   AX00004996   GGGAAATGGGAGGATATAAAAATGCTAGATCAAATTACTTGGGGAACGCCAGGC
14   I19   AX00004997   GTTATGGACACCATTAAGAAGATATTGGAAGGGAAGTCCATACAATATGTTAAAT
14   I21   AX00004998   GTACAAGCTTTTATCTTGTTTTTAATTCCGTATACTATCTCAAGATTTTTTCATTG
14   I23   AX00004999   TGTCTCAGTTACCTTCTCTAATGTTTCCTTTATGTTTCCTTCTTGCAATTTGTCTT
14   K01   AX00005000   GGAATAGGCCTACCTATATACTTACTACCTTTCATATTACGAGGGGATTTTGATA
14   K03   AX00005001   ATGTCCATTATATTAAACTTTCCTCATTTTAAAGGTAATGGGATTTGGGAAGGTG
14   K05   AX00005002   GTCAGAGATGTGCGTGATGATTTGGCGCAGGGTTATGAATCCATCTTCTATGAA
14   K07   AX00005003   GGCTAAATTTTCACGAGAGGAAAAAGTAATGGTAGTAAGAAGATATTTAGATGG
14   K09   AX00005004   AACGCAAACTTTTCTAGAATAATGATTGGATATGCTCCTGAAAACCTTACAGCTA
14   K11   AX00005005   TACAAGCTATTTTGGACAACATGAAGCTGCACATTCTAATCATGCAAATAAGGGC
14   K13   AX00005006   AGAAATTCAAAGCTTTTTATCGCCAAATATCTTACGAAATCTTGCCAGAGAGTTT
14   K15   AX00005007   AAATAATCGTAATCCTGAAGAGGTTGCTACAGCGTATTTCGAATATGGAAACAGC
14   K17   AX00005008   AGTAATAATGCTGGTAAAAAGCAACCAAATTTCGATGATTCATCTAATTTCGCTA
14   K19   AX00005009   AATTTTAATTCAGGTTAATTTGGTGGAGGGAATAAAACTTAATCATGTTGAGGTG
14   K21   AX00005010   ATCTGATCACGCAATCAAAATGATGGAGCAAAGACTCCGACTCGAGCAACATCG
14   K23   AX00005011   TAAGAAAAATTCGGCTGTTATTTTTTATTTGTTGTAAAGGATGGAGCGATTTTGG
14   M01   AX00005012   ACACAACAACTTCGGCAACTTGAAGCTGATGGGATTATCCATCGTACCGTATAT
14   M03   AX00005013   TTAACGGTAAATTGGGATCCTTTACTTTCATTGTGCTACTTTTTATGCTTTCTATT
14   M05   AX00005014   TGACTGAAACTTTAAAAACACTTATAATGCTTGATGCTACTTACGTTGTTATTGCA
14   M07   AX00005015   CTCAAGGCGGAGCAAAAAGAAATGATGAGAGACATTCGAAATTTAGAAACGCGT
14   M09   AX00005016   CTCTCGTATGCTGGAGAGCACCTTGTTTGCTGTTACATAAACAAGGGATTCCTT
14   M11   AX00005017   TGGTTTGTATATTACTTATTTAGTAGGTGTAGTCACTTTAGCGGAATCGATCCCG
14   M13   AX00005018   CTACCTCCAGCTAGATACTATCATCAAGAAACGCGAGATGGGATGATATATTCTG
14   M15   AX00005019   AAAAGAAACTTACTATTTTATTTAGCATCGTGTGTATTTTAGTATTAGCAGCATGT
14   M17   AX00005020   TTTGAAGAGGTTTTTTGAAGCTGCTTTTTTATTTGGAGAAAATGGAGGAATTGGT
14   M19   AX00005021   ACAGGCTCTGCACTATTAACTTCTCGCGGAATTTATAAGATGTCTTTAAATCGCT
14   M21   AX00005022   CGTTTTTAGGAAGTGTATATCAAATATTTGGATTGTATCCAGAAATTTATTATGGG
14   M23   AX00005023   CAGTATGAAGATATAGATTTGTGTAATGCGATTCAATCGTTACATGAAGAGTTAA
14   O01   AX00005024   GGGATTGTTACTTGTAATCCCGTTTTGGATATTGATCATTTGGATCATAATAAAG
14   O03   AX00005025   AAGACTTTGCACCGAATCATATTGGAACACAATCAAAAAAAGCTGGTGGCAATAA
14   O05   AX00005026   TTTATCATAACATGCTGCTATCACTACGTGAAAAAGAAAAGGCAGAAATGGCTAC
14   O07   AX00005027   AGAGTTTGCAAATGAAAACTTAACTCCTGCAGAACGACAAAATAATAAGAAACGC
14   O09   AX00005028   GACGCTTGTTCATTCTCTTTTCTTATACGGGGCAATAAGCGCATTATATGTAGGA
14   O11   AX00005029   TGTGAATGAGTACGAGAAAGAAAAATTAGCCCTTCTTGGAATATTTCATATCGAA
14   O13   AX00005030   AGTTTTACTAAAGCGCAAGGGAATGAGAGGAATGGCATATGTAATTTCACTCCA
14   O15   AX00005031   AGGAATCGGATCAGTAATTGAAACATTCGTTGCTGAAGTGTTACCGTTATTTGGG
14   O17   AX00005032   ATTGATGGAAAGGGAAGGCGTTATATCTATTACAGTAAAGGAATTTGAAAAGATA
14   O19   AX00005033   AGCAGGCGTGGCGTTAGGATTTTTCATTGCCCGCAAATACATGATGAATTACTT
14   O21   AX00005034   GTATTGCAGTATTATCGTTTGGTTTAAATAGTCCTAGTATTGAAAAAAGTGCAGC
14   O23   AX00005035   CAATCAAAGAGATGGCACGAGATCGATTATATTTTAAAGAAGATATTCTGGAAAA
14   A02   EMPTY        -
14   A04   AX00005036   CTCCACATAGATTTCATAAGTCAATTATTGATAAAGTATTAGTGGATGGTTCACT
14   A06   AX00005037   AGCTGATTCAAAAGCAGAACTTATAATAACTGTTTCTGCAATAGTATTAACTCCTT
14   A08   AX00005038   ACCAAGTAGTTTTAACAGCAAATGAAACTGTAAATTTATTAGGTGTCACAACCCA
14   A10   AX00005039   GAGAAACATGGATTGGGACTTAACAGAAAAGGTTCTTAGAAATCTAGCTTACATA
14   A12   AX00005040   TAAAGGTGAGTCCTACGAAGTATGGGGACAATCAAATGGATGGTTAAACCTTGG
14   A14   AX00005041   GGTATTAAACCAAATACAAAAGTGGAACTATTCTCTGATACTTCTAATCTGTTCG
14   A16   AX00005042   AAATAAGCGTCCTCAACGCAAAGGTTCCAGCCGACCAAGCAGAAAACCTAAGCG
14   A18   AX00005043   CAAGTTTGAAGATAAAGAGCAACTGCTTTCTTTTTTACATGATGAGGTATTAACG
14   A20   AX00005044   GTTACACTGTTTTACTTTGCGTATTTTCGAGATTCAGTCGAAGCGAGTATTTTTA
14   A22   AX00005045   CAAAAGCATGGCGGGAAAATCTTCTGTGAAATTTGTGGTTTTGACTTTCATAAAA
14   A24   AX00005046   ATTGAAGATAAGCTTAATGAGATAGAAATATTAACTAGAGTTGATATGGAAGAGG
14   C02   AX00005047   GTTTCGATTTCTTATGATTGGTTTCTTTTCATTAACAGCAATTTCTTTAATGGGAT
14   C04   AX00005048   AAGAAGCTACTGTAGTTGTACAAACTGTAGTAGAATCAATCACTAACACTTTAGC
14   C06   AX00005049   TTGTTGCGAAACAAATATATTCCTTTCCGGTTAGACCATTCTCATCCATATTTTCA
14   C08   AX00005050   AAAGCACGTATGATTTATCCCACTCGTTGTATGCAGGAAGATCCCCACCTCAAA
14   C10   AX00005051   AAGATTTCTCCCTTCTTCTTTTACAAAATACGTTTACAAAGAAAGAGAAGGTACC
14   C12   AX00005052   GTTTTAGCTCGTCTTGGTCAAGAGTTCTTAGATGATGATTTAATTCTTGCTGAGT
14   C14   AX00005053   AGATTGCTACGGTATCGTAGGTATGGCATCAAAGAATCAGTTAAAAGATGGATT
14   C16   AX00005054   TCGTTCTGGTAACTCTCGTTCTCACGCAATGAACGCTACAAAACGTAAGTGGGG
14   C18   AX00005055   AATGCCATCTTATTCGGTGGCATTTTCTCATTTTCAATACCTCTCTTTAAACGGA
14   C20   AX00005056   CCACTTAACATCGATTGGGACGGGAATGAACTTTTATTATCAGATGTATTAGGGA
14   C22   AX00005057   AGCTTATAAGAAAAAGCAAGAAGATAAGAATGTAGTCAGAACAGCAAACCAAGC
14   C24   AX00005058   TAATCGATAATCGTATATACAAGCTTCCAGACGGGCGTGATCTATTCGAGGGAT
14   E02   AX00005059   TCCGCATTATGAAATTCAACGCATTCTTAAAAGTGGAAATGCATATGTAGCGGTT
14   E04   AX00005060   GTACTAGAGAGCACATTATGGGAAATGTTAAAATTAGGAGTATTAACTACAGATG
14   E06   AX00005061   GCTAGTGTAGTTATTATATGTGCGCTCGCATTATCAGTGTTATCGATTAGTTCGG
14   E08   AX00005062   TACTTGATCCAGGTAATGGGGGCGCGGGATTAAAAATAGAACCAGGTGGACATA
14   E10   AX00005063   AAATATGGAGGAATTGACAAAGGACCCTGGTGGTCACAGAGTAGCTGATCCTGG
14   E12   AX00005064   ATAGGAAATGGACAGCTGAAAGTTTTTAGGACCATAAACTTAGGGGGAAATAAA
14   E14   AX00005065   AGTAACAGTACTTTACGGGAAATGTGGATCTTGCGGATGTGATCACACAGAGCA
14   E16   AX00005066   TTTTTTATTATGGAGTGGTTTTTCGATTGTCTTATCATTGTCCAATGGTGATAAGT
14   E18   AX00005067   TATTGCTATCCAACTTGTTCATATCCTTCCTACGGTTATGGCGGTTCTTGTGGCG
14   E20   AX00005068   TGATTTGTCCTAACTGTCACAATTCTGCTGAGATTATTCATGTATTAACGGCTCA
14   E22   AX00005069   GTCGGAAGGTTATTAGTTTTCTACAGCATTAGTGAAAAGATGAAGAAAAATGAGA
14   E24   AX00005070   GAGGTAGCGTAATCTTTTGGGGGATTTTAATTTTCATCGGTTTAGTGTTCGATCA
14   G02   AX00005071   GATTTTTAGAGTAATTGTATTTATGTTTAGTTGTATATTTGCATCCGTTGCAGCCG
14   G04   AX00005072   ATCGTTATATTATTTGTAGAGTTTATGGTGTAACCTATTATTTAATTCCGCATTAC
14   G06   AX00005073   GAAACGTATATTTGACTTTCTTCTTTTCACTTTGTATGATTATCAAGTTGTTTTAA
14   G08   AX00005074   GATCAGCGATTATGATGATGGTTATTGGAATAGTAGTCATTTGGGGAGGGCTCG
14   G10   AX00005075   GCAGAAAAAACTTCCAATCATAATGAAAAGCGTACAAATACGTTTCATAATTTTTC
14   G12   AX00005076   ACCAAATCGCGTCACTTTAGTCGGAAAAGCATGGCAAATTCGCCATAAGCTAAA
14   G14   AX00005077   GGTTATAGACCGTTATGTCTAAAGAGTGGTGAAACGAAACTGTTTCACAATTTAG
14   G16   AX00005078   TTATTTCAGGATATATCGCTTCACTGTTATTCAAAAACGATCCAATTCGTACAGC
14   G18   AX00005079   TATGATTTATGTAATGCTAATTTCTATGCTTGTAACAACATTACTTGCTGGCGCA
14   G20   AX00005080   TTGGTGGTTTATTAGCATCTCTTAGCTCAGGAAAAGTTGATTTCGTAATGGCAGG
14   G22   AX00005081   TGGGTGTAGCGCCTTTTTTATTTGTTATTCAAAATGATAGGATATACAGTAGTCG
14   G24   AX00005082   ATTTCTCCAGACACTGCAGTCCGCCTATCAAAAGCATTAGGTGTTCCACTTGAAC
14   I02   AX00005083   AAAGGATCGTGCGTATCAAAAACGCATGGCAAAGCAAAAACAACAAGAGCGTAA
14   I04   AX00005084   TTTTTCTTTCCATATGAAAAGGGGGAAGCGAGAGGAAATTACGTTTTTGAAAACG
14   I06   AX00005085   TTCCGTGACTATCAATTGTTAGCAAGAATAGCGTTTAATTCTTTACTTAGCCTTG
14   I08   AX00005086   ATATACGTATTCGGGGCATATTTGACTGTTTTCTTCATAGGATTTACATACTACA
14   I10   AX00005087   TCGCTTATTCAGCATCTACATAGATCCAAATTCCCTTACCGCTTCCTTAAACGAT
14   I12   AX00005088   AGTGCCTGCTAATTTCGTAATAGATGATAGCGAAGTGGTTATACTTATATTCTTC
14   I14   AX00005089   TTTCATTTTCGTACGAGCTATTTTGCTAATTAAAGTGAAAAGTAGTGTGTCTACTT
14   I16   AX00005090   GTTCAAAGTAAACGCAATGACGCTATTGATTCAGGGGTAGGATTTATCGTCTCA
14   I18   AX00005091   CTTCATTTTACTTATAAAACAAGAAATTATTAGACGCTCATTAGAGGACAAGCTTG
14   I20   AX00005092   GGAGCTCAAATTATAATTGGAATGAAATTTTTTCATAACTATGGTTTCTCCTTTCA
14   I22   AX00005093   TGAACAAAATAGAAAACGTCAGGGAAACGGAAACCCAGCGAAAAAGAAGCCAAA
14   I24   AX00005094   ATTAATCGCATTAGGTGTTGGAGCGGCAGCATATCAATATGCTCGCAAACAAGA
14   K02   AX00005095   TGTTCATTTATCCCGCTATTTGGATTCTTATTTTTAGGATTAATAGCTGTTTCAGT
14   K04   AX00005096   TCCCGAGCGGTATACTTAGTTCGACAACGAGTTTGTTCTTCTTAAGTTTGTTTGC
14   K06   AX00005097   AGTGGATTCTCCGAAAAATAAACAAGAGAAAAAAGTCAATTTTGCAAGTGATTAT
14   K08   AX00005098   GGTGATGAAACTAATCCGAACTGGACTGTCGTAAAAAATGTGAGGAAGGGATCG
14   K10   AX00005099   AATAAATATTGTCGATAGGGCAACAGCGCTAACGAATGAAAATAAAATAACATAT
14   K12   AX00005100   CAATGGGAAATTGGCTGTGTACGAAAAACGGAATATGTAAGGTTAATAATCTGTG
14   K14   AX00005101   AGTATTGTTAGCTTGTTGTGGAATATTTTTGGTGATTGGGGTTATTTATTTAGTTG
14   K16   AX00005102   TCATTCAAGATCGGGCCTAGGTTCTCCAGAAGTAGAAGGACAAGGAACGACAAC
14   K18   AX00005103   TGGATACGATGGGTCGTCACGTGATCGCTGAACTTTGGGATTGCGATTTCGACA
14   K20   AX00005104   TGGACATACCACGAAACGTTGGGGTTACTGTATTTGTGAATCATTTATTTTTTTT
14   K22   AX00005105   GTATTCTTACTTTCAACGCTCCAAGCTGGGATACAATTAAAACAGGTTGTTCAGA
14   K24   AX00005106   TTTCGTTATTATCGCTTTAACTTTTTTAAGTGTGATTAGCTGGGATGCGTTTTTTA
14   M02   AX00005107   TATTTACGGGCATTTTGTTTTCATGTACCTTCGCTCCAGCAGCAGGGAGTTACG
14   M04   AX00005108   TCATTATTTTTTCTTTGCTAAATGCGGGTCAGCTTGCAGAGAATTCGAAGGTGGA
14   M06   AX00005109   TACTGTATAGGGCTTCGCTGATAAGAAAAGCCTTATCATTTGCAGCTCGTTTCAT
14   M08   AX00005110   TCCAATTGTTCAAGTGAAACAGCGTAACAGTAAAAAAGGACAACCGCAGAAATC
14   M10   AX00005111   ACCTCATTATCCCTGCACTTATTGGGCTTTCATTGTATTGGTACACGAAGAACCA
14   M12   AX00005112   CCTATCTTCTTAAGTCTACTCGGTAGCTTTTCTATTTCTAGCGGAATGCTATTAC
14   M14   AX00005113   TAGAGGATTTAGGTTCATTTGTACGCTCCCACGTTCCATTTGTTGAGTATCATCA
14   M16   AX00005114   ATCGGTATTATCATCGTCCTAGTCATATTAGTACTCTCTGTCATGACGATTAATA
14   M18   AX00005115   GAGTGCTTTTTTCTTATGGAAACATGCTATTTTGTTAGGCGCTTTTCATAGAATG
14   M20   AX00005116   TTCATACTTTGCGACAGGAGAATATGATGGAACAGGTATCATATATACTGCTATC
14   M22   AX00005117   TGCTGAAAAATCAAAAAGCGGTACACTGGCAGATATTTTAAAGAAATTGGGATTA
14   M24   AX00005118   CATTTCATTTTACTGCATGATATATTAATAACCGTCGCTGATGCAGAAACGCAGA
14   O02   AX00005119   CAACTAGGGTGGAACCGCGGGCAAACGCTCGTCCCTAGGCAATTAAGCCTTGG
14   O04   AX00005120   CATGTTTAGCATGGTTGCAATATCTAAAAACGAAGCTAGCAAATTGAGATTTGCC
14   O06   AX00005121   GAACAATCTAGCCGCTGGAGCTGGACAACGAAAAGCGCAAGCGGCTCGTTCAG
14   O08   AX00005122   TGAATTTTGAGAGGTGTTACATGTTTACAAACAAGAAATTAATTCGATTCGGTCT
14   O10   AX00005123   AGGAAACGCTGGACCAACTGATCGAGGCGTAGAAAAAGGACGTCAAGGTAATA
14   O12   AX00005124   AAAGATACTTGCGATTTTATTAGTTATCTTTTTAATCGTAGAGCTCGGCAGTAAA
14   O14   AX00005125   GTATCTTTTTAGGAGCCACTTATTATTACAATAAAAGATTTCCAAATCACAGGTAT
14   O16   AX00005126   GCTTTGGTTTATTTCGATACTATGTATCGGTGTTTCCGCGATCACGTTGTTTATG
14   O18   AX00005127   GGAGGGAAATGCGGTAGTAATAGATACAGGTGCGCGAGGTGTTCGTCTATTTAT
14   O20   AX00005128   TTCGTGTAGCTAATCACTACAAGATATGGAAAGGTCACCGTTCACTGAGTCGAT
14   O22   AX00005129   CTATTACGGAAAAAAGTTTAAGGAAGCTGTCGATATTACAGAGCAAGAAATGGA
14   O24   AX00005130   TTGTGGCCTTTGCGTGAAGGCGAAACAAGTTTTACAGGAAGTGCAATGTGAATA
14   B02   EMPTY        -
14   B04   AX00005131   AACGAGCGTTGTTGTTGGAGCACTTATTTTATTTTGTGGGCGTGCTGTACACAA
14   B06   AX00005132   GTTATTTGTACTAGGGCAGTTTGTTTATTTCTTTGTGAACTATTGGCCGAAATGG
14   B08   AX00005133   AAGGCCAACAAAATTGTTGGCGCATGTTGAGGACAATAGAGGATATACAGAGTT
14   B10   AX00005134   AGCTCTCTTTCGGAAGAGGGTTTTTTTACGGATATTTTACGTTCAGTTGACAAGT
14   B12   AX00005135   TACGCGTAGTGAGTATGATCGACTCGTAGAATCGCTATATAGACCTTCTAAAGA
14   B14   AX00005136   AAGCATATTTGTTTGAAACGTGTGGCACATCGTAGTGTCCAAGAAAGCACGGAA
14   B16   AX00005137   GAAGGTACAAGTCCTTAAGTAACTCGAAATTAGGAAGATTAACTTTATGGTACTG
14   B18   AX00005138   TTACATTGCCAGTAAGAAAGAGGTTCCCCACCATCAATTGTTAGAAGAAGAGTTT
14   B20   AX00005139   GTAGGGCTTTCAGTGACAAAAATACATCTATTCCGTGACGAAAATGTAAACTTTT
14   B22   AX00005140   GCAAGGGGGAAGCGAAGCATCACTACTTGCGGAAGTACACTTTATAGAAAAAAC
14   B24   AX00005141   CCTACCGATAAAGAAAATCAAACCGAATTTCATCTTGCACAATCTTACAAAAACT
14   D02   AX00005142   CTTAAATGAAGGTTCGCTTTCTACTTGGAAAGCTCCTACATTGCATGAATCTAGT
14   D04   AX00005143   CAGCATGATGGAAGATACAACATCGTTAGTAGCATTCGCAATGTTTATCGCATTT
14   D06   AX00005144   AAAAAATGAAGCCGCTAGCTATAGAAGAGAGATAGCGAAGCAACGTTTACAAAG
14   D08   AX00005145   ACGAACGGTTGTAATTGTGAAGTGGCAAAGCGACAGCAAGCGGAAAACGATAAG
14   D10   AX00005146   CATGGTAGTTGAGGGGTTAATTGTTGAAGCAGCAGATCTACGCGTTCGATTAGA
14   D12   AX00005147   CTGCAATCGAAACTGACGGTTTCAAATCTCTAGAAGAAGGTCAAAAAGTTAGCTT
14   D14   AX00005148   CCTTATTCCTCCAGCGTTGCTGTGGAGTGCACCTGATATTCCTCTAAATGTTAAA
14   D16   AX00005149   TTTATCGAAATGGAAGGCGCTGACGATGTATTCGTACATTTCTCTGCGATTCAAG
14   D18   AX00005150   TGTGAAGATGCAGTTTTGCAAGTACAAACCATCCTTTCCTCCCAAAAAGAACTTC
14   D20   AX00005151   TTCGAAGATCTTTTACTTACACAATCTTGATACATTTTCAACAAACAAACGCACAA
14   D22   AX00005152   ACCAAACTATGCGTACTACGGCGTACAAACAATGCGTGCAGTAGAAAACTTCCC
14   D24   AX00005153   TCGTAATTCTAATCAATTAGCATCACATGGAGCACAAGCGGCTTTAGATCAAATG
14   F02   AX00005154   TAATCATGATAAGATTGTAGAGGAAATGCATAGAGGATATATGACTGAGAGTGA
14   F04   AX00005155   ACTTATCCCTCCGGTACTACTGTGGAGTGCACCTGATGTTCCTTTAAATGATAAA
14   F06   AX00005156   GAATTCGATACTTTAGAAGCTTTTTTAAATGTGGAGGTATCCACATTCGGTGATT
14   F08   AX00005157   AATTCGATATTTTAGAAGCTTTTTTAAATATAGAGGTATCTGAATTCGGTGATTGG
14   F10   AX00005158   ATCGTTGGTGAAGCGGTAATAGTATGGACGGCAACAGGCTTGTCAGTGATTACA
14   F12   AX00005159   CGCAAGCGAGGAGCCAGTAGTTGTTAAGTTCTTTACTACATGGTGCCCAGATTG
14   F14   AX00005160   ACAGCGAAAAAGGTTTCGGTTTCATCGAAGTTGAAGGCGGTAACGACGTATTCG
14   F16   AX00005161   ACATAATAGAATTGTAGTTTGTCGAGCAGAAAAAGGTTGGACTCAAGAAGAATTG
14   F18   AX00005162   TATTCATTAGTCAGATGTACGTAATACAATTTCAGTCCAGTGATGAAGCAAAAGA
14   F20   AX00005163   TATCCAATCAAGAATGGAAAGATTTGCGGACACGACAATTATATTCTCGCGGAG
14   F22   AX00005164   TGGTGGTGAAATTACGAAACGTCTTGTATCATTAGCTGAGCAACAACTTGGCGG
14   F24   AX00005165   TGGTGGTGAAATTACAAAACGTTTAGTAGCAATGGCTGAACAACAACTTGGTGG
14   H02   AX00005166   GCATAATAAAATTGTAGTTTGTCGAGCAGAAAAAGGTTGGACCCAAGAAGAACT
14   H04   AX00005167   TTGTTATGTTCTTTGTTTGGAGCAGTACTTTAAGTTTGACTCCAGATGATCTTAA
14   H06   AX00005168   ATTAAATCAGCAATTAAGACAGGATACCGTAGCATCGATACTGCTGCGATTTATG
14   H08   AX00005169   TGGAGTAGCGCATTGAGCTTGACTCCAGATGATATAAAAATGGCAAAAGAACAA
14   H10   AX00005170   TATTGTAAGCAAAGATACGGTGTGGACAAAAATTAAACAATTGGCAGAAGAACAA
14   H12   AX00005171   GTTAACGGAATACGGTCATTCATTAGATGCTATACTTGATTCTCTTTGTAACTGG
14   H14   AX00005172   AATCAATTGAACTGATGCTTGATTTAGAAGAAGCGCAGCCAAATATATCCTTACT
14   H16   AX00005173   ACGGTAAAGTAAAATGGTTTAACTCAGAAAAAGGTTTCGGATTCATCGAAGTTGA
14   H18   AX00005174   TGGGTAATGAATTACTTTCACTTTTAGAAAATGCTGGTCGAATGGGCATCCCGTT
14   H20   AX00005175   CCTCTTGGTAGTAGAGGGTCTAATTGTTGAAGCGGCAGATTTGCGTGTAAGATT
14   H22   AX00005176   TGAGAAGAATAGTCCAGTTGTTGAAGGAGTAATGTTTGATGAGAATGGGGATTT
14   H24   AX00005177   ACTTGCAGGGGAAGCGGTAATTATTTGGACAGCAACAGGGTTGTCAGTAATTGC
14   J02   AX00005178   TAATGAATTACTGTCGCTCTTAGAAAATGCCGGGCGAATGGGTATTCCACTCCC
14   J04   AX00005179   GGACCAGCTACGCGAGTGGAAAAAGCAATCAAAACAAGCAAAGAAGAAAAATAA
14   J06   AX00005180   TGAGGTTACTCCACTGAATCCTCCAGTAACAGGGTTTGGGGAACAAGTAATCAC
14   J08   AX00005181   GAAACGAACGGCTGTAATTGTGAAGTAGCAATTCAGCAACAAGTAGAAAATGAT
14   J10   AX00005182   AAAAAATGAAGCGGCTAGTTATAGAAGAGAGATAGCGAAACAACGTTTACAAAG
14   J12   AX00005183   TAAAGGCTGGGGCCTTGGAGTAAATAAAGTAGAGGCTATTGAACTTATGCTGGA
14   J14   AX00005184   TCAAGAAGTTTCTTTCGAAATCGTTGAAGGTAACCGTGGACCACAAGCTGCTAA
14   J16   AX00005185   GAAGCTGTAAAATCAGCAATTAAAGCAGGATACCGCAGCATCGATACAGCTGCA
14   J18   AX00005186   TTGTTCTTGGGGCGAATGCCATCTTGAAAAAGAAGGTAAGACATCGATGCTAAT
14   J20   AX00005187   TGAACATGCGCATTACAGTTGATGATTGTGGGCAAGGATGGTTAGAAATTGCAA
14   J22   AX00005188   TGTGAAGATGCAGTTTTGCAAGCACAAACCATCCTTTCCACCCAAAAAGAACTTC
14   J24   AX00005189   AACGTCAATTTTTATTTTAGATGCTAGACAAACTAACTTTATTGGAGAGTTTGATC
14   L02   AX00005190   CGTAGGATCAGCAAGTGGAGCAGTAGTATTAACAGCATTAATCGTATTTTTATCA
14   L04   AX00005191   ATTAGGATCATTAGGTGGAGCGGTAGTATTAACATCATTTATTCTATTCCTTGCA
14   L06   AX00005192   AATTCAATTTTAAACGAGACATTACCAAACGGGACGAGTAAATCATACACATATG
14   L08   AX00005193   TCAGTTGCTGGGATTGAAATTGCTAGATTAGAACTTTCTCTTCAAGTAGCATTGA
14   L10   AX00005194   GATAATGAAGATACAACAGATTTCTCGTTAATAAAAGGAGATACATTACAGCAAG
14   L12   AX00005195   GAGAGAATTCCAGGTAGGAGTTAAAGGTAAAGGTACATCAGATTTCTCGTTAAT
14   L14   AX00005196   AAACGCAGTTAAAGAGTTCTTTAAGAAGCAAGAACTGGAACGAAATATAAAAGCA
14   L16   AX00005197   CTCAAAGTGAGATTTTACGTGAACAACACATTCAAACTATTATGGATGAAGTAAA
14   L18   AX00005198   GCAACACATTCAAACTATTATGGACGAAGTAAAAGAGCATCAAGCTTCTTATTAC
14   L20   AX00005199   CAAAGATACGATATGGACAAAAATTAAACAATTAGCAGAAGAACAAGTGAAGAAA
14   L22   AX00005200   AGATGTGGAGAAGTATCAGGTTAATAAAGCTTGGAGAAACATTTTTGTACAAGCT
14   L24   AX00005201   TTGGAGTGACGTAAAACAAAATAAAAAGACCCACGGCAATGGGTCCTTTAGAAA
14   N02   AX00005202   ATCAACAGTACTTTACGGAAAATGTGGATCTCATTGCGACTGTGACCATAAAGAA
14   N04   AX00005203   GTCACGTTGATTGCGGTTTTAGCGGTGGGTTCGCATTACTTGTTGTGTTGTTTA
14   N06   AX00005204   AGAGGCGCACTTTGCCTCGCAGGAAGAAGCGAAGCCACCGAACATTCTAGCCA
14   N08   AX00005205   AAACGTGGAAAGAATATCATAATTGGAAATTGTGGAGCATTCTTCACAAAACTGT
14   N10   AX00005206   CATAGAGGCGTTTTTTGCCTCGAAGGAAGAAGCGAAGCCACCGATCATTCTAGC
14   N12   AX00005207   GCTAAATGAAACTGAGCAAAAGCAAGTTGTTAAAACTTGGTCTCGTCGTTCAACG
14   N14   AX00005208   GAACTTCATCGCCAGTATGAAGATTACTGCATTGAATTAGGGATAGAATCGTATT
14   N16   AX00005209   AAAGAAAAGCATTACCTCTTTTTACACACCCTTTGATAATATTACCGGACAAACA
14   N18   AX00005210   TCATTAATTGATTTTCAAAAGCGTCCGTGGTTATGGATTCCACCTGGTTTCGCAA
14   N20   AX00005211   ACACATTGCGATGCCCCTGCCCATTTCATTTCAGGCGCAACTACCATTGATCAA
14   N22   AX00005212   GAACGCAAAAACATGATTGAGTTTATCGAAAAGAAAAAAGGGATTGAACGTGAC
14   N24   AX00005213   TTTTGAATAGGGTGGGTGAAAAGGAGATGAAGGTGTTGTTACTAGGAGATATAG
14   P02   AX00005214   GGTTTAGGCACGTTATTTATTAACTTCTTTTTTGATAGTTTAAATGCATGGAAGAA
14   P04   AX00005215   AGTACGATCATTAGTCGTTTCGCATATATATGCAGGAAAAGGTATCGGACGTATG
14   P06   AX00005216   AACCAAAATTCTTCAAATCAATTAGTAGTACCAGGAGCAACAGCTGCAATCGACC
14   P08   AX00005217   ATTCTTTGTAGGTTTGTTTCAATATTGTCGGCAGAATGAGATGAGCTTTTCTCAT
14   P10   AX00005218   AACCAGCTGTTGCTGCTGCAAAGCAAAGAGCTCATTCTGGACGCCCAACATCTT
14   P12   AX00005219   CATTCTATATAGCGCATTTGAAGCACAAGAAATGCCGCCAACTCCTTTATGGTAC
14   P14   AX00005220   TGGTATGGGACCGGCATCTTTGCCAAAGCTTAGAAAGGCTTTGGAGGAGAGCG
14   P16   AX00005221   AATGGATCCGGAGCCTCTAATGTTGGATTTGTCGTGAATACGTTTAACGGTGTT
14   P18   AX00005222   TCTCAAATACTGGCGGATTTACAGAGCCCCTTCGCCCATTACAGGCGAAAGGAC
14   P20   AX00005223   AGAGGAAGAGAAATTTGATGCCGTTTACTTTTGTCTGTATGAGCCTAACCAACAA
14   P22   AX00005224   AACGAAAATAAACACCATGGCTCTTCTCATTGTGTAGTTGACGTTGTAAAATTCA
14   P24   AX00005225   TGTGTTTGTTGTGTTAGACAAAATAGTCGGCCAGCAGACAGTTTTTCAGGATAAT
14   B01   EMPTY        -
14   B03   AX00005226   CGCTGGGATCGCCTTGCAAGATATCGAACATTTTTTCAAACGTATGAAGCCATC
14   B05   AX00005227   CAAAGGTAGGCGTAAAAGGGAATTATCGAATAGCAGCATTCTCCCGTATTCAGC
14   B07   AX00005228   TGGTTAAAAGAACAAAATGCTCCTTTTGGGATTCAACTGCAAATTTTACAAGCAT
14   B09   AX00005229   CTTTATTAAACCAGCAGCCGGATCAAAAACTTCTGGGTTTGGCGTGCGTTCTAT
14   B11   AX00005230   GACGAAAGCCAAAAAGACAAGTATTGTTCGGGTGTTCGGGGAAGGGCTACTGT
14   B13   AX00005231   AGTAGTGCTCTTGTGTATGCCGCCGTTTTATTACATGAGGATCGCATACTACGA
14   B15   AX00005232   GAAGAAATGGATTCGGAGCTAAGAATAAGAGTAGAAACGGAGCTTTCGAAAAGG
14   B17   AX00005233   ACAATTGGGATTTACTCACCTTCTTCACCAGTAACCTACACTTCTCCCAAAAGAT
14   B19   AX00005234   TACAGCAACAATTCGCTTCTAAGCCAGAGAAGGTAGAAGTACGCTATAAGCAAT
14   B21   AX00005235   GGGAGTGTATTGGGGGACAAAAAGACATTCTTGGCTTAGTTATGTCTCATTTTG
14   B23   AX00005236   CGCAAATGAGGATGACATCATTCAAACTGGCGATGTCGTAGCAATGATTCCGCC
14   D01   AX00005237   TTAAAGGTATCTTCAAAATCAAGCCCCAATTCAGTCGCAGGTGCAATAGCAGGT
14   D03   AX00005238   CGTGTCGATGAGTTGCTACAGATGGTCGGACTAGATCCAGACGTATATCGTAAT
14   D05   AX00005239   CTAGCTGAGGATGGAGCAGTACTTATGCCTTTAGGTGCCTATCCGTTTAGTAAA
14   D07   AX00005240   CGGAGATTACCATTCCATTACGTGATGTAATTGAGGTTACTGAAGATGCTACCTA
14   D09   AX00005241   TTTTGTCACTCAGTTTGCGACATTAATTTGGGCAATGACTTATTTTATTAAACACT
14   D11   AX00005242   TGGGCTAACGGTAATAAATGTAGCGCAGACGCAATTTATGTAGTAAGTCATAAA
14   D13   AX00005243   TTCGTGATTTAATTGTATTCACAAATCGTCGTCTTATTTTAGTGGATAAACAAGG
14   D15   AX00005244   CGGGAACGCTTTATAAACAGTATTACGCAAGATATTACATACTCTCAAGAAAGTG
14   D17   AX00005245   ATGTAAACATATTTTAGTTTATTATAACAATCTTCCTGTTGGTACAGGTCGCATAC
14   D19   AX00005246   AATGCTTGAATTTATGGAGAAAATGCCGGATATTCCTGGATTTGAAAAAACACAT
14   D21   AX00005247   ACACGTAGATTAAACCGCTTAAACCAACGTTTACGTACAATAGAAAACAGACTAA
14   D23   AX00005248   CACAGTTCCTGCTACTACTCAGCTATTAGCTATTGAAAAAGTGCGTGCAGAATG
14   F01   AX00005249   GTTAGAACTATGTGTACTGGCACTTGTGAAACGTAAGGATTGTTACGGCTATGA
14   F03   AX00005250   TGGTATAGAAAACTAACGCGAAACCCTGAAGAAAAAGAGGCATTTGAGTTAGCG
14   F05   AX00005251   TATCCATATTATCAACCAATCCCAGTCCGTTCAGCACCTATTGGTCCAGTAAGCG
14   F07   AX00005252   AAACAGGAGAGGCAAATTGCACATGTGCTGTGAATGAATCGGTTGTTCACCTTG
14   F09   AX00005253   AGTGGATCAAGATGATAGGTAATGTAGGGTTTCCAATTGTTGTAACATTATATTT
14   F11   AX00005254   ACAAGAGAAAAATATTGAACCGAACGCATTGATTGTGATTCGGTTTTTTGATGTG
14   F13   AX00005255   CAAATTCACGCTATTTTACAAATGATTGAGAGAGTAGCGAGTGAAGCGAAAGTT
14   F15   AX00005256   GTATTTGCTACGCTTAGAACACTTCGGGAAAAGAATTTTCTCGCGGGTGGCTTT
14   F17   AX00005257   AACGACTAGAGCTCTTAAAACAAATAGCAAAAGTAACCTCCCCTGCTACTGCCC
14   F19   AX00005258   AAAGGAAGGGGCGTTTCTTTTGAGAAAAATTGGCATCATTGGCGGTACATTCGA
14   F21   AX00005259   TAAAAGATAGTCATTATAAAGGCGCAGAGGCACTTGGAAGAGGCATTGGATACT
14   F23   AX00005260   TATATGTACACGTCAGTAGCTGTGCAAACAGTGAAGGACGGAAAAAGTGATAAG
14   H01   AX00005261   TGCAGAAGCTCACGGTTTACAATACGCTGATGCAAAAGAGCTTCTTGAAAAAGC
14   H03   AX00005262   ATTCTGAACGTATTATTTTAGATGTGAATGGGAAAGAAATCGAAATGTTAGATAC
14   H05   AX00005263   GGCACGTAGCACAAATAAATTAGCGGTTCCTGGTGCTGAATCAGCATTAGACCA
14   H07   AX00005264   TGCGTATCCAGTGTATACGGCAGAGCGTGGTACAGAAGTGTGGCAACCCGTTC
14   H09   AX00005265   CAGGGATTGTTTGTGTTCTATTTATCATCGGTGCGATTGCTACGTGGCGTATGT
14   H11   AX00005266   AGGTGGAGAATTGGTATGTGTTGGATTCGGAGCTTCCTTGGGATGTCAAAAGGC
14   H13   AX00005267   AAACTTTAGCACATTCCTTTTATACTTAAGCGCTACTTACATAGTTGGTATCCTCT
14   H15   AX00005268   TGTTATCAGACAAAGAAGCTCATGATAAAATGTCAAAAGCATCTAACCCGTACGG
14   H17   AX00005269   TGATCCGCATGGCGTTACTGTTTTAGTTTTACTATCAGAAAGCCACCTCTCTATT
14   H19   AX00005270   CACATTACAAATTTGTCCAATATGGAGTCAAACCCGGCTCACAAAAGCCATTCCC
14   H21   AX00005271   AGTCGAAACAATCGTAATGGATTTAACTTTACGTCTTGTCTTAAACAATGGCTTA
14   H23   AX00005272   GGCAAATTTTCTCTCTGTTTACGATGGCTGTAGCAGCAGCGGAAGCCGCGGTAG
14   J01   AX00005273   TATGTTGGATTATGGCGTAGATGTCATTATTACCGATTGGCCAGCACGCGCCTT
14   J03   AX00005274   GCAATATGATACCTTCTTAACACCAAGTGTACAAGTAAGAGAAGACATCTTAATG
14   J05   AX00005275   GCCCGAACCGTGGATAGAAGCGGTTCGGGCCTTTTTATATTTCGAAAGAAACAG
14   J07   AX00005276   GCGAGCTGTACTATACAGCTCGCTTTTGTTTATGATGTGAAATATGATAAATTTT
14   J09   AX00005277   AGCGCCCCAAAACAAAAATGTAGAATTATTGTTTTGGGGTATTTTCTTTTCTTAG
14   J11   AX00005278   ACAATAGAAGTAGGTGTTATTTCTATAAAATATGGAAAACGTAAAGAGTATGTAA
14   J13   AX00005279   TTATCTAAAATTGTTTATTATGAAGGTGTTATGGTAAAAAACAAAACGAAAATCTT
14   J15   AX00005280   TGAAGAAACGATTTACCATTTTGATTGCATATCATTTTTATCAAATGAGTGTTTAG
14   J17   AX00005281   ATTTGAAATGGAGGAGCAACAAAATATGAATAAATTTAAGAGTTATAAATTTGGG
14   J19   AX00005282   GAATCATGAAGATATCTCTAGTGTGTTACATCTTGGTTTTATTAATGAAACAGAA
14   J21   AX00005283   TGTATCCATATTCATACGCAACATTAGAAGAAATTGAAATAGGTATAAAAAAACTT
14   J23   AX00005284   GTGCAGAATTAAAAGAAGTTTTAACAAGACGTATTAAAAATGCTTTCATTATGATG
14   L01   AX00005285   GAAAGAAGAACTTTTATATTTAGTATCGGATTACGGAATTCAACATGAAAAAGTA
14   L03   AX00005286   GCATTAGCAAAGTATATAAAGTACTATAATCATGAAAGAATCAAGAAAAAATCAAA
14   L05   AX00005287   GAAGAACTGGTTAATGATCTTATAAAAACACATATAGGTAAGATAAGAAAAGAGA
14   L07   AX00005288   TACATTATTTATATAATTGTGTTATACTATTGTTGGGGATTACGAGAAATATTTCA
14   L09   AX00005289   AAGAAGCGAAGCCGCCGAACATTCTAGCCACTGTAGCTGGATTCCAATAA
14   L11   AX00005290   GCTTTATCTTTTTTTATTCTATTTATAAATTATAAAATAGATGGACAAACTGCTTTT
14      L13   AX00005291   GGGAAATGAAAAAGAAATTTTTGAACTGATTCAAGCTGAAGTAATGGTGAAATTT
14      L15   AX00005292   GATAACGGATATTACATTTGATTTCATTTACTTGTTAAGTAGTTCTCTTGTAATCC
14      L17   AX00005293   CTGTACTATTAAATCAGATTGAGATAGTAATTGAAATTTTTAAAAATATACAAAAA
14      L19   AX00005294   ATTATTTTACTTAAATGTAACATATGTAATTCATACTTCGACGATTAATTTCGTGG
14      L21   AX00005295   GTGTTGAAAGACACGATTAAAGGTACATATGATAAATTAGCGAGTACATATAAAG
14      L23   AX00005296   TGAAAGATTTCATTGTTACTTGGAAAAGGAGCAATGAAAATATACATATTGAGTA
14      N01   AX00005297   GGAATGGCATTTTTGAAGAAACGTCATAAAAAATTGGATAAATTGAATTATAAGT
14      N03   AX00005298   GGTGGAGTGTATAGTTTTCTATATGTTTTAGTAATTGTAAGAAAACTATTAAGTAT
14      N05   AX00005299   GGGGATTTTTAAGGAAGAAAAAATTAAATTTATAGATTGTAAAGGCGAAGAAGTC
14      N07   AX00005300   AAAACAGCAAGTGAAATTTCTATTTATGAAGATAACACTTCTAAATATCCAATTTC
14      N09   AX00005301   AAGATCGTAATTCTTCATGTGACAATATACTCTTTTTCTTTTACTACAGAGAAGAA
14      N11   AX00005302   ATGAGGGGATATTATGTAAGGAGCAGTTTTTATATGTAGTTTTATTTGTTATAAAG
14      N13   AX00005303   GTGTATCTTGTAAATGGAACAATTTTCGAGTTATCTCAATCGATGTTTCATTATGA
14      N15   AX00005304   ACAATTTGTACAAGTATTATAAACAATATGAATGATTTTCGTAAAAAAGGTGCGAG
14      N17   AX00005305   GGATATTTTTCATGATAAAATTAAATATAAGGATTTTCGTATATGAAGAACTGAAA
14      N19   AX00005306   GTTCTTTTTGTGATTTGTTTTTTGGGTACTATTATTTTTACAATGTTTGATGCTAC
14      N21   AX00005307   GTGTATTTTAGTGAAGAAAATACATATATAGCATGGGCAAATAAAAGAAAAATAT
14      N23   AX00005308   AGACAATTATAAGAAAGTAGAAATAAACGATTCACATATTTCTTTAAGGGATCTTA
14      P01   AX00005309   AACAGGATACATTTCCAGCACACAAAAAGGAAGTTGGAATCATTCCAACT
14      P03   EMPTY        -
14      P05   EMPTY        -
14      P07   EMPTY        -
14      P09   EMPTY        -
14      P11   EMPTY        -
14      P13   EMPTY        -
14      P15   EMPTY        -
14      P17   EMPTY        -
14      P19   EMPTY        -
14      P21   EMPTY        -
14      P23   EMPTY        -
AXCON   A01   EMPTY        -
AXCON   A03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   A05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   A07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   A09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   A11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   A13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   A15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   A17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   A19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   A21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   A23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   C01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   C03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   C05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   C07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   C09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   C11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   C13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   C15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   C17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   C19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   C21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   C23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   E01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   E03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   E05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   E07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   E09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   E11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   E13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   E15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   E17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   E19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   E21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   E23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   G01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   G03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   G05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   G07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   G09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   G11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   G13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   G15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   G17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   G19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   G21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   G23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   I01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   I03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   I05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   I07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   I09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   I11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   I13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   I15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   I17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   I19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   I21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   I23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   K01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   K03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   K05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   K07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   K09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   K11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   K13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   K15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   K17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   K19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   K21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   K23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   M01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   M03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   M05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   M07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   M09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   M11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   M13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   M15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   M17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   M19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   M21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   M23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   O01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   O03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   O05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   O07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   O09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   O11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   O13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   O15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   O17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   O19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   O21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   O23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   A02   EMPTY        -
AXCON   A04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   A06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   A08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   A10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   A12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   A14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   A16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   A18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   A20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   A22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   A24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   C02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   C04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   C06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   C08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   C10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   C12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   C14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   C16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   C18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   C20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   C22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   C24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   E02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   E04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   E06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   E08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   E10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   E12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   E14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   E16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   E18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   E20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   E22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   E24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   G02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   G04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   G06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   G08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   G10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   G12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   G14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   G16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   G18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   G20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   G22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   G24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   I02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   I04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   I06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   I08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   I10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   I12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   I14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   I16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   I18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   I20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   I22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   I24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   K02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   K04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   K06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   K08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   K10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   K12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   K14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   K16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   K18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   K20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   K22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   K24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   M02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   M04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   M06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   M08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   M10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   M12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   M14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   M16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   M18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   M20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   M22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   M24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   O02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   O04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   O06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   O08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   O10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   O12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   O14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   O16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   O18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   O20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   O22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   O24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   B02   EMPTY        -
AXCON   B04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   B06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   B08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   B10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   B12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   B14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   B16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   B18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   B20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   B22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   B24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   D02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   D04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   D06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   D08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   D10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   D12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   D14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   D16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   D18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   D20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   D22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   D24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   F02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   F04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   F06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   F08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   F10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   F12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   F14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   F16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   F18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   F20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   F22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   F24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   H02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   H04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   H06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   H08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   H10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   H12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   H14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   H16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   H18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   H20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   H22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   H24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   J02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   J04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   J06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   J08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   J10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   J12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   J14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   J16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   J18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   J20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   J22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   J24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   L02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   L04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   L06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   L08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   L10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   L12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   L14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   L16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   L18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   L20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   L22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   L24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   N02   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   N04   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   N06   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   N08   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   N10   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   N12   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   N14   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   N16   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   N18   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   N20   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   N22   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   N24   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   P02   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   P04   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   P06   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   P08   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   P10   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   P12   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   P14   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   P16   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   P18   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   P20   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   P22   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   P24   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   B01   EMPTY        -
AXCON   B03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   B05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   B07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   B09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   B11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   B13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   B15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   B17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   B19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   B21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   B23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   D01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   D03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   D05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   D07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   D09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   D11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   D13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   D15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   D17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   D19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   D21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   D23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   F01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   F03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   F05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   F07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   F09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   F11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   F13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   F15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   F17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   F19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   F21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   F23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   H01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   H03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   H05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   H07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   H09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   H11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   H13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   H15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   H17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   H19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   H21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   H23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   J01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   J03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   J05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   J07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   J09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   J11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   J13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   J15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   J17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   J19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   J21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   J23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   L01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   L03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   L05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   L07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   L09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   L11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   L13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   L15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   L17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   L19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   L21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   L23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
AXCON   N01   AXNC000012   AGACACATTCAGGCGACTCGCGTGGGCATCATGTAATGATAAATGGCGTGTTGC
AXCON   N03   AX00002767   CTTCGTGTACCAACACCAAACGTGTCTCTTGTTGACTTAGTAGTAGATGTAAAAC
AXCON   N05   AX00003125   TTATCATCTCAGCTCCAGCTTCTGACGAAGATATCACTGTAGTTATGGGTGTTAA
AXCON   N07   AX00002558   ATGGGTGGCGTGTTCACGAAATTAATCGAGCGTAACACTACAATTCCAACAAGT
AXCON   N09   AX00002262   GCTAAAGCGAAGATTACAAGAATCGAAAAACTGTTGTATGTAGCGTTTATTGGCT
AXCON   N11   AX00002185   GCAACTCGTGCTGGTATGTACTTCGTTAACCAACGTTGGTTAGGTGGAACTTTA
AXCON   N13   AX00002461   TTTTACGTGTAGCTGTGTATGAAATGAAATACATGGAAGAAATTCCACACAACGT
AXCON   N15   AX00004784   AACGTTGCCAAATGCTATGTTCAAAGTAGAATTAGAGAATGGGCATGTCGTATTG
AXCON   N17   AX00002783   AGTAATGCAGGAGGATTATTTATTTCTGTTATGACTCACCCAACGACGGGCGGG
AXCON   N19   AX00003268   GGGCTACGCAGCTGGTACCCATACGAGCAAATTGATGAAGAAATCTTGCCTCAA
AXCON   N21   AX00002031   CACGTTGCTAATATCGTTTCACTCGATCGGGATGAAACCATCATTTGGGCAACT
AXCON   N23   AX00000186   GCTGGTGACGGAACAACAACTGCAACTGTATTAGCACAAGCTATGATTCGTGAA
AXCON   P01   AX00002825   ACCACGGTCACATCATGGTTGATGGTGCTCGCGTAGATATCCCATCTTACCGTG
AXCON   P03   AXNC000001   TTGTGGGCAAGTGTCCTCCGTTTCCATAGGGCGTAGTACACCCTATATCAAGAG
AXCON   P05   AXNC000002   CTGACAGTCGAGGCACCCGTACATAAGCGACGCCGGGGCTTGCCTAGAGATCT
AXCON   P07   AXNC000003   CCGAACAAACCACCTTGCCTGCGGCTATTCGAGCAATATTTGAGTTACGCAGGT
AXCON   P09   AXNC000004   GTTTAACAGTGACGCTCACCTAATGTAATTCTCGCGATATTCTCATTAAGCCATG
AXCON   P11   AXNC000005   CTTTTGTACGTTCTTGGCCACGCGAATACGCCTTTAGATCATAGGGAGGTGGTA
AXCON   P13   AXNC000006   GGCCCTTGGTCTCCTCGATCTAAGCTGATAAGTGACGAAGATTGACGAACCTAA
AXCON   P15   AXNC000007   AATAGTGCGAGGCGTCAGGATACTTAGGGGGGAGAGATAATGGCGCACTGGTT
AXCON   P17   AXNC000008   TCTATTGACGAACAGGAGGCTGTCGCTTGGCTTGGATGGTTCACCAGTATCAAG
AXCON   P19   AXNC000009   AGAGGATAGCCTCACTTCTCCAATAGCTCAGAGTGACTGAGTCTGAAATCAGCG
AXCON   P21   AXNC000010   ATCGGCTAAAGGATCCCTAAGCTATAGTCCTTTGTCCGGCATAGTGGCTTGGTG
AXCON   P23   AXNC000011   TTCCTCAGAGCTCCCTTTTCGTAAAGTGTGGCTTTTCCCCGCCAAGATGGGTGT
Ext1    A01   EMPTY        -
Ext1    A03   AX00005310   AAAGAATTGCGTCCAGGTCATGCGATGACATTTTCAAAGAACGGTTTGTGTATAT
Ext1   A05   AX00005311   TGACGTATGCCATTATTAAAGCAATCAACTTCTTCCTCCCTGTCCGGGTAGATGA
Ext1   A07   AX00005312   AAAACGTGAAGAATCAAACGTGTATAAAGTTAACGGAGAAACAGGTGTGAATTG
Ext1   A09   AX00005313   AAAGATGAACCGCAAGCGAACGCAAAAGGGGATAGCGGGAAAAGCGGTGCGAA
Ext1   A11   AX00005314   CAACGATTCCGTCTAGAGAACATCCGGCAGGAAGTGTTGCCAATGCGCTGTTAT
Ext1   A13   AX00005315   TTTCAGCGATGCTTGCAGCAATGATACTAGTTTCTGGCATACGATGGCGTTTTAT
Ext1   A15   AX00005316   TGCGCTCAAAATAGTCGTACCACCCCATTCCGAGGCTGCTCTAACGTCTGGTCC
Ext1   A17   AX00005317   TTAGATAAAGATACGACAGGTGGTGTCGTGTTTGCTAAGCATAGAATTGCTGGT
Ext1   A19   AX00005318   GTAATGAATCATGCGGAAATTATGCAGATTGGAACACCAGAGGAGATTTATCAA
Ext1   A21   AX00005319   TACAGCAATTCCATTTTCATAAAGCGTTTGTTTCGATTGATGGGTTATTACCTAG
Ext1   A23   AX00005320   AAATGTTATCACTTCCCATTCCACTCACTGTTGCTGTTATGCCTTTTCTTCCTTCC
Ext1   C01   AX00005321   TTCAAGCACTTCAAAAGTTGAAGGTGCAATCTTTTACAATTGAGATTGGGCAAGT
Ext1   C03   AX00005322   ATGCTAGCTTATATGAATGAAGAAGCATATAAAAAAACGTTAGAGACGAAAAGAA
Ext1   C05   AX00005323   GATTCAGAGATTGAAGGATTAGAAGAATCCAAGGGCATTTTAGAAAATCAACGTC
Ext1   C07   AX00005324   AGGAAAAGTATTTTATGGTAATGATTGTTGCGAAGTAAGAGCATGTAGCCATATT
Ext1   C09   AX00005325   TTCAAGACTATATCTTTGATCCATTCTTCTCAACAAAAGATTCCGGCACAGGTTT
Ext1   C11   AX00005326   AAGACTGCGGATGTATTCCGTAGAAATTACGTATATCAATATCCATATCCGCTCG
Ext1   C13   AX00005327   CGTAAAGAGATGGCTATTGTACAATTAACAATTCATGAAGGACGTAATCGTCAAG
Ext1   C15   AX00005328   AAAGATTTAACGCTTTGGATTCTCGGCATTGGAGGATTTATATTTATGGTTGGTG
Ext1   C17   AX00005329   GTGATCGTCTAGATTTGGCATTGGCGGATTGTAAAGAAGATGGTTTTCGTATCC
Ext1   C19   AX00005330   ATAGGTTGTCTACTTCTTGGTATCGTTGGTCTTGTAGCCGGCGTTTCCGCTTTC
Ext1   C21   AX00005331   ATGAGTTTATAGGGAATATGGATGCTTTACTTTTATTATCTTTTCGTGAAGTGTTT
Ext1   C23   AX00005332   CGTATGGTGCCGATTGAAACTGTGTTCAATCGTTTCCCGCGTATGGTACGTATG
Ext1   E01   AX00005333   CAAGTAACCTCAGGGAAGAAAAACCTTCTTATGAGTGAAGATCCACTTGCAGCA
Ext1   E03   AX00005334   GTGTGCAAAAGAATGATGCTCCATGGGTTCGAAAAGAAATGAATGGGATGGGCT
Ext1   E05   AX00005335   ATTATGGCTGGTATGCTTTCTTCACATACGTTTTCACCTGAAAGAATAGAAGAAT
Ext1   E07   AX00005336   TGCCAAAAATGGATGGACATCATTTAACGAAAGTGGTTAAGGATAGTGAAGTAA
Ext1   E09   AX00005337   ATCTGCTTCATATTACGAAAGGTACATTGTATCGTCTTGAAAATTCAACGAAAAA
Ext1   E11   AX00005338   TCAGACAAGCGCAAAAAGTATACGTCTGAAGTGGAAGTGAAAGTAAATCAAGTG
Ext1   E13   AX00005339   TGAATATGACTTCGGGGCAATTTCAAGGTCCTATGGTAGGAGAACTAGCGTATG
Ext1   E15   AX00005340   CGAACAGAAATCAAAAATTATTCATGATTTTAACGAAGGTTTATTTTTAGATCGCT
Ext1   E17   AX00005341   AACCTTTCCCACCAAGCAATTCGTATTTTACAAATCGTTTCTCGTGAGAAAGATA
Ext1   E19   AX00005342   TGCTGGCTTGGTGGGATCCTGAATTACAATTTGAATTTGTTATGATTTTTGATAC
Ext1   E21   AX00005343   ATCTTATTACCGATTCTTATTTTTGGATGGTTAGGAGCTCCGAAATTAGATGTGT
Ext1   E23   AX00005344   TGCAAAAGAGAGTGATGTATCTTTAACAGCAGTAACAAATCAAAAAGAAACACAC
Ext1   G01   AX00005345   CGTACAACTAGCTTCTATTTTTGGCGGGGCATACTTCGTAGTAGAAGAAAATTTC
Ext1   G03   AX00005346   ATTAGGTTGGGCGACTGCTTGGAGTTTTGATGCTTTAAAATTATGGTTAGAAAAG
Ext1   G05   AX00005347   ATGTTCGATATATGGTATTTAACTATTGGACAGACTCATTTGAAGGTGAACTTCT
Ext1   G07   AX00005348   ATATGGGACACCACGGTCACGGTTTAAGTGCAGTAGGACTTGTGATAGGTTTTC
Ext1   G09   AX00005349   GAAAGAGGGAATTAAATTAGAGATTAGTAACTTTTTAACAGAGACAGTAGAGAAA
Ext1   G11   AX00005350   TAATAATCAAGTTGATAAATATATTGCGGATCCGTTATGTGGTTTCATTTGTACG
Ext1   G13   AX00005351   GAACAGCCAGTTCCGTATTTTTTACAGTTGTTAGCACTACCTATATACTTACCAC
Ext1   G15   AX00005352   TTTTTGCTTATCCGCATGGCGGGGGAGCGTATGTTGTATCAAAAGAAAATTTAG
Ext1   G17   AX00005353   TGGACCAGCAGGATTCCAAGATGTAATGGCACAAACGACATCAAGCATATTTGC
Ext1   G19   AX00005354   CCAAGTGTTCACTAAATTCCTTCCGATGCAGGAAGTAGGATTAGGCTGGATCTT
Ext1   G21   AX00005355   CAAAAATTCGAATTTATATGGTATTCCTGTCGTTGTAAAAGATAATGTACAGACG
Ext1   G23   AX00005356   AAAAGAAGAAGAGATGGTTGGGCTTTCTTTATGACGAGTTTAACGATCATTTTAC
Ext1   I01   AX00005357   ATTGGAAGTTATTCGCACATATCAGCGTATACAGCGTTATATGGAGGGGAAGTT
Ext1   I03   AX00005358   CCAATCCACTATCCTTTAGGTGTTATAAAGGAATCTAAACATAAGAAAGAGGCGA
Ext1   I05   AX00005359   TCGTTTGTTTTAATGGCACTACTTGTTATTATCGTAGGATATGGCGGGATGCGAG
Ext1   I07   AX00005360   CGAGTAGGGAATTATCGAAGGTAGTTACAATTCGATTGGCGCTTTTATTCTTCGT
Ext1   I09   AX00005361   AGAAGAAGCTATTCAGCAAGGGATTACATTTTTTGATACAGCAGATTCATATGGT
Ext1   I11   AX00005362   ACCAATACGTAACAGAAAAAGAAATGTTCCCAATTGTTGAAGGTAGCGAAGATCG
Ext1   I13   AX00005363   GTTAGCTTTACCACAGTCTTCACAAATTCAGTTTTCAGATGGATTTGTTTGGGAT
Ext1   I15   AX00005364   TTTACGTTATATATGCTAGCTCCGCATTTAGCTAAACTTGTCATCGATGGGAATG
Ext1   I17   AX00005365   TATATGTTACAAGCATATAATGAACAAGTAAATTTTCAAGAAGGAGAGAATGTGC
Ext1   I19   AX00005366   GATTTTGATCTACATGGAGATATTCTTGTAACAGATCGAAAAGATATGATGGATC
Ext1   I21   AX00005367   TACAAGAAGATGCTGATATTATGGTTACAGCATCGGCTCCTACTAACTTAGAAAT
Ext1   I23   AX00005368   CAGCAGTAGATGCTTATAATAAAGGGTTTAAAATTGTTGTTTATGAAAAGGCGGT
Ext1   K01   AX00005369   AACGTTATATACATCAACACGTGAGACTGAATTCCGCACAGAAGCAAGTTCATCA
Ext1   K03   AX00005370   CAGAACGAGCACCGAGAACATCAAATGGATTTTCACGAGAAACAGCTTATTTATC
Ext1   K05   AX00005371   TAGATCTACTGTTATACCAGACTGGTTTGATCCTATTTCTCCAAATACGTGGCTA
Ext1   K07   AX00005372   GGAGATACATCATCCATTCATGCTTTAGAAAAGCTTTTAAATGATACAGTTCAGT
Ext1   K09   AX00005373   TGACGTTATTTTCCCATTACTACATGGACCAAACGGTGAAGATGGAACGGTTCA
Ext1   K11   AX00005374   TGACCAAGTGAACCCAGGTGATGATGTACGAGTAAATGGAGAGCAGCTTCGAAT
Ext1   K13   AX00005375   GACCAAGCGACAGGTGGTAGTGTGACGATAGCTGGTACAAATATTACTTCTATG
Ext1   K15   AX00005376   TACAACGGTCTCAATCAAAGCAACGAATGTGGAATGGGATTTTTGTTGTACTTGA
Ext1   K17   AX00005377   GAGGCTGCTCCATTTTCACCGTCGAATAAATTTTGGTTCGGTAGTGATGAGAAA
Ext1   K19   AX00005378   GATGCTTTAAAATGGAAAGCATTATTTGATTCTTACAATCGAGAAGTTTTACAGA
Ext1   K21   AX00005379   ATAAGAAAGGGTCAATAGTTTTATGTGATTCAGTATCTCGTTTCAGTGCGAATTC
Ext1   K23   AX00005380   ATACTATCGAATGCGATTAAATATTCATCAGGTAGTAGAGAGAAAATTAAAGTGA
Ext1   M01   AX00005381   AAATGGGGCGTGCCAACGAACGATTTTCATACTTTAAGTGGTGGTGAAAAGCTG
Ext1   M03   AX00005382   TGATAAAAGTAACGGAACTTGTGGAACTTATTCGAGCAGAGGAAAAGCCAAAAC
Ext1   M05   AX00005383   AAATACACCATGGATTGTATCGAAAGAACCTATTAGACCAGAGCAGCTCGATTAT
Ext1   M07   AX00005384   GTAGCATCTTCTCTTTCTACGAAAATAATTTCGGTATTTTAAATTCATTCATAGCC
Ext1   M09   AX00005385   GGGAGGATGGGATGCAACATTGAAAATCTTAGTGACGATGGCAGTTATTGATTA
Ext1   M11   AX00005386   ATTTTGTACAAGAAGATTATTTTGATCAATTTATAATTGAATGCGCGAAAAGTGTG
Ext1   M13   AX00005387   GGCACAAGACGTTTTATGTGAAGTAAATAACTGTAAATTTTGGGCGAACGGTAA
Ext1   M15   AX00005388   ATAGCCGAAATGATAGGGTCGGCAAAAGTTATATCGAACAGCAATACGAAGATG
Ext1   M17   AX00005389   ATATTTCAATGGGAACACTGCTTGAAGGACTCGAACCATTCTTTAATACTTGTAT
Ext1   M19   AX00005390   GTTTTTGGAGCATTATTTGGTCCAGTGGCAGGACTGTTAATCGGACTTATCGGT
Ext1   M21   AX00005391   GATCATTTTCCAGTTCAATCTGGATATGTATTAATTTTCGATTGGTTTGATGGTG
Ext1   M23   AX00005392   GATATGAGTATGTTCCAAAAGATGCAACGAATTGGCGTTTTTTTAGAAAGGGAAA
Ext1   O01   AX00005393   GTCAAGGTTCTACAGTAACTCCAATTCAATTAATCCAAGCGGCTACTGCTATAGC
Ext1   O03   AX00005394   TTGTTTTATTTTCACAAGTAAGAACAGAAGTAATTAGGAAAGAAGGAAGAGCTGT
Ext1   O05   AX00005395   AATGAACAGTTTGTCATAGGGACGACTGATTGCGAATCAGGGCAAGCCATTTAT
Ext1   O07   AX00005396   TCACGATCGGTTGGGAGTTTTTAGTGAGCGGATTCTTTCTCTACATGGCAGATA
Ext1   O09   AX00005397   AAAAAATCAGTGATGCATCCAGCTCTTGGAGAATTATCCCTTGATCAGTGGATAG
Ext1   O11   AX00005398   TTTCCATTACCTATTGAAATCATCCCTTTTTCATGGAAACAAACCGAAAATAAAAT
Ext1   O13   AX00005399   GCTTTTATTAGTTTAATGTTTTGCTACGGGATTGAAGCGAGCCAATTGTATCATG
Ext1   O15   AX00005400   AATTGCAAAGGAAAGAGAGTATATGACCTTAATTGCTGGAATTGATGCAGAGAA
Ext1   O17   AX00005401   GAGATTGTTAGGACAGTTGCATCAAGAGCCTACTGGAGAATGGTGGAACGGAA
Ext1   O19   AX00005402   AAAGTGAAAGCGAAGATGAATTAGCAGCGCTTCAAAGTGGGGCAGATGAGTACG
Ext1   O21   AX00005403   ATATTTTGGCGTCGTTATCGCTCCATGCATAAGTCAATAAAGGGATCGGGAAAA
Ext1   O23   AX00005404   TTTTAAAAGACATATTGCTTGAAGAAGAACAAGTTCCATCGACAAATCAATTTGC
Ext1   A02   EMPTY        -
Ext1   A04   AX00005405   CGTACCTGTCGGTTCACATGGCATTATCCCTACTTTTTCAAACGTTATGAACTAC
Ext1   A06   AX00005406   TATTAGAAGGTGCAAAACGTACTGGTCGTGCAACTGGAATTGTTGCTACATCTG
Ext1   A08   AX00005407   ATGTGGAATGGTGTTGGAGGAAAAATAGAAGAGAATGAAACGCCATACGAAGGA
Ext1   A10   AX00005408   TGACGCCGCAAATCGTTAAAAAAGATGTAAGTCAAAATGAATATGCTGTCGTTAG
Ext1   A12   AX00005409   AACAAGGATTGTACCTCCTGTATCGCTCGCTAAATTGGAAGGAAAGATGCGGTC
Ext1   A14   AX00005410   CATTGCTATGACTTCGAAAAATATAAATGACTTGCTTAAATTGGGGGATATGCTC
Ext1   A16   AX00005411   ATTATATGTCTGTGCATGAACTAGTAAATATCATTATACGGGCAAATACGAAATA
Ext1   A18   AX00005412   TTCAAAACTCATTTGGTACAGATCGTCTAACAGTTGGGATAATCATGGCCATTGC
Ext1   A20   AX00005413   TTTCTTCTCATCGTGGGAATGAAATTATGAAAGCTCTTACTGTATTAACTGCTGT
Ext1   A22   AX00005414   CTGCAGCTAATGTTGCAAAACAAACATTACCACAACTGCTTACAGCCACACCAG
Ext1   A24   AX00005415   ACTCTATTGAGGAGTCTCTGTCTGGAAAAGGATGGCTTAATGAACCAGTGGAAG
Ext1   C02   AX00005416   GAAGTGTTTGAAGAAACTGGACTTATTATTAAAAATCCAGAACTATTCCGTACAT
Ext1   C04   AX00005417   GAGAGTAAACAGGGGTGGTCCAGAATCTCAAAAAGGAACAATAATATCAGTATG
Ext1   C06   AX00005418   AGAGTCTAGTGAAGAAAGTGAAAGAAAGTAAATGTGGCGATTGCTATAGTTCAT
Ext1   C08   AX00005419   TGGAAGCATGGTCACCACTTATGCAAGGTCAATTATTAGATAACGAAACATTACA
Ext1   C10   AX00005420   CTGGGATTGCTCTTGGTGCTTATTTAGGCGGTATTGTAACGAACTCGTTAGGGT
Ext1   C12   AX00005421   GTGACATACGATATTCGTAATAATGAAGTGGAAGGTGCGGTTGATAACTATTTCG
Ext1   C14   AX00005422   CATATAGCTCAGGTATTCTTGCTGGAGGCGCTCACTTCGAATATCAAAAAGCAT
Ext1   C16   AX00005423   AGAGCAAAAGTTATTAGTAGAACATGACAGATATATATTTCAATTTCCGCTTTACT
Ext1   C18   AX00005424   CAATATCTCAGTTAAACAAGAATGTATGGGTTCATACGGAGTTAGGTTATTTTAA
Ext1   C20   AX00005425   ATACGATGGCGGAATTAGGTGAATTAGCGGAAGTCATATTAAAGCGTGATACAA
Ext1   C22   AX00005426   TTTATATGATCTGGGGGAATTCAATCAAAAGGGCACAGTGCGGACGAAATATGG
Ext1   C24   AX00005427   TGGATCAATCTGCTGCTGATGATTGGACGTTAGGCTATGCATTTTATATAGAAGA
Ext1   E02   AX00005428   ACCTTTAATTGTTCAAATTGCCATTCTCTATTTTGGGATTACATCCGTTGTTGTTT
Ext1   E04   AX00005429   GCCGGAAAACCATTAAATCTTGATGAAATGGGAATTGCTATTCGCAAAGATGATA
Ext1   E06   AX00005430   TGGAAGTGTTAAAGTAGGAGTAAATGATAAAGGGCCAAATGCCGATGCAAGTAT
Ext1   E08   AX00005431   AACATCGAACCCTCTTGTCAATCCAATTCCAAACCGTGCAAGTGCAACATTTACC
Ext1   E10   AX00005432   CGCCGAAAGAAGCAAGGAAAAAGGGATACGCATCTAAGTGTGTAGCGGCACTT
Ext1   E12   AX00005433   AAATAATGATATGATAGAGTTGTTACATTATGGGGATGTTTTAGTCGATGGAAGG
Ext1   E14   AX00005434   ACGTTAGCTGCCGGTGTGCCGACAATTTGGCTCGGTGTATTACAAGAGTTAGAA
Ext1   E16   AX00005435   CTGGAATGATGGCTGGTTCATTTGGGATTGGTTCTGCACCGTTTATTCAGCTTG
Ext1   E18   AX00005436   AATAAACAGTTAGAATCAGAGAGTCAGCAAGTAGAATTTGAAAAGAAACAAGCG
Ext1   E20   AX00005437   GGGTACCGACTGAAGTTTTAACAGGAGAAAACCAAGGATATGCAATGTGCCATG
Ext1   E22   AX00005438   TCAGGCGTTACGTCAATTTTGGACTTCAATTGAGGCGCCAGTAACATTATCTGA
Ext1   E24   AX00005439   TATTACATCGAGTACGAAATTCCCAGCAGAAACAGCTGAAAAGTTTACGAAAGTA
Ext1   G02   AX00005440   TCGATAGATGGAAAAAATATAGAGGGAGAAATGAAACTACAAGTTATTCATGAAT
Ext1   G04   AX00005441   TGCAAGAGCAGGACAAGAGGTGGAACGTCCAGTTCGTACAATTACAATTCATGA
Ext1   G06   AX00005442   TATTAATTGATGCGATGAAGCTTCCTACACCAATTCCGCAAACATCAATTATTAA
Ext1   G08   AX00005443   TGAATCAGCTTGTAGCAAAAACAGTAACGAGACGTTACAAAGCGATTGTACACG
Ext1   G10   AX00005444   CGGCAGAACAACTCGGAAAAAAAGTGGCTACCTTTACTGTAAAACCATCTACAA
Ext1   G12   AX00005445   AAAAAAGATGTTAGAAGAAATGGAGTTTTATTTGGCATTGAAATATGATCGTGAT
Ext1   G14   AX00005446   TAGAGAGTATTTCAACAGGGGCAGCAGGTAGCTGGTCATTAAGTAATTTAGCTC
Ext1   G16   AX00005447   CCAATTGTAGAGCAAATGCCGGTATCGCTTATACTAGATAGCGGAAAAACATATA
Ext1   G18   AX00005448   TAACAGAGGACTTTGGACCAATTACAGTTCCCGAAAATAAGATTTTTGTTATGGG
Ext1   G20   AX00005449   ATACGCATCATTGGGAATGGGCACGTGTAGATGTAAGTGTAGATCGGAATGGG
Ext1   G22   AX00005450   TTTTGAAAGACGAGTCGTTATTGACGACGAGGACACTTAAATATTCTTGTAATAG
Ext1   G24   AX00005451   TTATTTATATCCCGCTTTGTATAGACGAGGAACAGGTTGTTGTTCGCTTACAAGG
Ext1   I02   AX00005452   GTCAAATCCGGAAAAAGTAATCATCAGTACCATGAACCACTAATCTTTTACTCAC
Ext1   I04   AX00005453   AGTAGAACAGACGCTGGTGTACATGCTTTGAATCAAGTTGCTAACTTTCAAAGTG
Ext1   I06   AX00005454   GTTCAACATTGTGATGATGATTTAGTACCCGAGAAAGAACTTTGGGCTATTCATA
Ext1   I08   AX00005455   TCCATGTAGCTGATTTAGAGGAAGCGAAATGTTTCTATGTTGATGGTCTTGGTTT
Ext1   I10   AX00005456   GGCCAGGGATAGGGGGACACTGTATTCCCGTAGACCCTTTATATTTTCAATGGA
Ext1   I12   AX00005457   AAGTTGTCGTACAAGAAGCGAAGATGCATCGACACCTCGTTTTAATTTTAGATGA
Ext1   I14   AX00005458   TCGGTTATTGAAAGAATTTCGAACAGATAAAAAAGAGAAGAAAACATCAAAGTGG
Ext1   I16   AX00005459   GAGCAATTACAATGTTCATCGGTTTCTTCGTAGCGGTACTGTTCTTCTTCTTCGC
Ext1   I18   AX00005460   TTGTTAGCCTTTGTTTATTTGGGCTCGTTTTACAGTTGCAAAGTCTTTTAGAAAA
Ext1   I20   AX00005461   TTGTTATTTGCATTGTTTATCGTTTTATTCGCAATGAGTAGTATAGATGCTGCGA
Ext1   I22   AX00005462   TATTATTGATTATATCAATTACCCAGAGCGAATCTTTCCAGTTGGGCGATTAGAT
Ext1   I24   AX00005463   CGTTTGAACAGAGAGAGTATTTGTCGGCTAAAGATGTAATGGTGCAAATGGTGC
Ext1   K02   AX00005464   CCCAACGATGGCAGCATATTATGCGATGAAAATTGTGAAAGAATTAGGCTTACC
Ext1   K04   AX00005465   GTAGTCTACCTAAAGAGAACAGAGATGGGTCCGTTAGTATTAGATGAAGAACTA
Ext1   K06   AX00005466   TCTTTTTATTTGCTCATACATACTTAAAAAATGTTTCCTTCACACGTTACTTGCTT
Ext1   K08   AX00005467   ACAAAAGTGCTGAGCTTACGCAACAACGAATTAAAAATTCTCAGTTACATGCTCT
Ext1   K10   AX00005468   TTGAACTCGATAATAATGGCTATACGTGGAAGGATAAAGTATATGCTACTCTCCT
Ext1   K12   AX00005469   CGAAATAAATCCCAGTATGAAGGACCTCTTATTCGTTCCTTTGAATCAGCAGGAT
Ext1   K14   AX00005470   AACGATTCAATTAGGAATTTTATTTTTCGTTCCTTATGTCGTTGCTGGTGTTCAC
Ext1   K16   AX00005471   AAACAGATGTAGTGAGGCACGCCCTGCGGGGCGGAGTAACAGATTATATCGTA
Ext1   K18   AX00005472   TGCCAGGTGGAAGAGATGCTAATTTATATGGTGGAGAAGATGTGATTGATATCG
Ext1   K20   AX00005473   AATCTTGAGGTGAAAGGATTCGGATTTCGTGGGAAAGTGATGGGGAAAATGATT
Ext1   K22   AX00005474   CTAACATACATGGCGAACATGGGGAAAATGTCCGTTAGTAATTACTTAGCGCAA
Ext1   K24   AX00005475   CGGAGGGATCGCTTTAGGTTCTTATATAGGTGGCCTTGTAACGAATTCATTAGG
Ext1   M02   AX00005476   TTTCTGAATCGGGATATGGTGTATATCATGGGCCACTTTTTCAGTTAGCGGAAAA
Ext1   M04   AX00005477   GGAACGGATAAAAGCTTAATCTTATCGTCATTACCAAAATCGGTGACAATGCCAG
Ext1   M06   AX00005478   TCCGCCAACGCTTGGCCTAATGAATTACGGTGCTTTTTTTATGAGTAAAGGAATT
Ext1   M08   AX00005479   AAATTCGCGGAGAGCAAAAAGAAATCGGATGGGGTAGCCAAATCCGTTCTTACG
Ext1   M10   AX00005480   CGGCGCAAGGAGTTATAGAGGCTATTAAGCAAAAAGAATCATTTTTTATTTGGGC
Ext1   M12   AX00005481   TAGAATCATAGGCGCACTTCCACAAGGTCAGAAGGTTCAAGTAATCTCTGAAAA
Ext1   M14   AX00005482   AGATGCGGCAATTAGTTTACTTGCTGCGAAGGAAGATGTTTCAAAAATCGCTGT
Ext1   M16   AX00005483   CTTAGTATTTCAGATGGTGAATACTTCTGTGTTTACGATGCAGATAACCAGCCTG
Ext1   M18   AX00005484   CCGCAAATGAAGTTAGAAAGAATACCTGCGAAAGTGAACGATAAAATCATTTTAC
Ext1   M20   AX00005485   GTCAGGGCATTTGTTCTGTCTCATACTTAAGTAAGATCGAAAATGGAAAGATCGA
Ext1   M22   AX00005486   ATTGTTAATAAGGATGGACACGATGTTCGTACCGATTTAACTACTGATAAAAACG
Ext1   M24   AX00005487   ATTGAACTCGATGTCCACTTATCAAAAGATGGTGAACTTGTCGTAATTCACGATG
Ext1   O02   AX00005488   CAGTTGGATTTGTTGGTCTTGTAATTCCGCATATGACTCGTTTCCTCGTAGGCTC
Ext1   O04   AX00005489   GTACGGAGGAAGAAGATGGATAAACAAATAGCGCAGTTGAAAAATCATATTATAG
Ext1   O06   AX00005490   GGCGCTACTTTAAGTGTCATTTTTAACGCACCATTATTCGGTTATTTAGCACCAA
Ext1   O08   AX00005491   ACCAGAGGCACTTACATATGAAAATAAACGCCCGATGTGCGAAGGTGAATGTTG
Ext1   O10   AX00005492   GATCATCCTTATATGTGGGTGTTTTCAGCGGTTTTATTTGCATTTAGTAATATGA
Ext1   O12   AX00005493   AGTCGACAGAAGAAATCTATATGCATCCATCCATAAAACAGCTTAAATTTGAAGG
Ext1   O14   AX00005494   AAGGATGTTGATAAGGAGTATGCCGATATAACAGGAAGCTACCCAAATAGTGTT
Ext1   O16   AX00005495   TGGAGATATGTTCACGGGAAAAGAACGTGCGAAATGGCAAGGTATTTTTGGTGC
Ext1   O18   AX00005496   TTGCAAATGCATTACGTGCAAAGGGTATTGAAGATGATAAAGGTTTAGCGAAATA
Ext1   O20   AX00005497   ATCGGAACACAAGTCGTTTCGCAACTTCAGCAAATTGTATCTCGCCTCACGAAT
Ext1   O22   AX00005498   AAAGGGGTTCCAACTCACTACACACTTGAGTTACCTCCGTACCGCAAGCCAAAA
Ext1   O24   AX00005499   TACGTATCCAGCACGTTGGATTGCGTTACGTATATTAGATGGAGATAAAAATTTC
Ext1   B02   EMPTY        -
Ext1   B04   AX00005500   ATGCCACGCGGTGCTGATAAGATGGGGTTATCCAAAATGAATTTTGCTGGTATG
Ext1   B06   AX00005501   GTACTATTTGCTAAGGCGAAAGGGCTGGGGCGCTTTCATATTTTAAATCGTCAT
Ext1   B08   AX00005502   AAAATCCACAAGTGCCACCGTTTTCACCTTCATTACAATTTTTACTCGGGACAGA
Ext1   B10   AX00005503   GCTTACGATTGATGGTCACGATGTAAAAGAGATGCCGAAACAAGCAACCCGTGA
Ext1   B12   AX00005504   CTTATTAAATCCACCACAAGGTTGCCCATTCGCAGAGCGTTGCCCGCATGCGAT
Ext1   B14   AX00005505   ATTTTTAGAAGATGAGGTGAAGGTACAAAAAAACGGATTGTTTACTCATGTTGCA
Ext1   B16   AX00005506   ACCAAAAAGAAAGTATGAGTACTTTTATGATGGTATTAGCGAGTATGAAAATCGT
Ext1   B18   AX00005507   CAACATTATGTTAAACAATGATTCACGTTGCCATACTAGTAATGTAACGGTAACT
Ext1   B20   AX00005508   AAATATACAGGACTTATTAGAAGAAGACACGTCCAATCAATGGAGAAGACACAAT
Ext1   B22   AX00005509   TGTATATATCGGAATTAATTTTTTATTTGCAGGTTTGATGGCTCTTTTAGGACTTG
Ext1   B24   AX00005510   TGCACATACCGAAAAAGGTAGAGGGGCGTAAAAGTTTACGCATTGCGATGGCTT
Ext1   D02   AX00005511   ATTTTGGCGTTAACAAAACGTGGTGTTTTTTCAGGGGATGGCCAAGGGAATTTT
Ext1   D04   AX00005512   GAAAATTCAACAAGCTTTATCGAGGAGATATTGGCTTTAACGGAAATGGGAATTT
Ext1   D06   AX00005513   AATGGCTGGACGTTACTGGTATCTAGAAGAGCATAAAACAGATATTATGCATGA
Ext1   D08   AX00005514   GCTCTGAATACCCCTAGTAAGGAACAAGAACAACTGTTAGAAACATCTTCTCAAA
Ext1   D10   AX00005515   TATCGTGAAAAACTCAGCTAGTATTATATTCGGTTTATTTTTCATTCTGCTATTCT
Ext1   D12   AX00005516   AAAACCAAAAGAAAGTTTTCTCTCTCTTCTTTCAGCGCCAGCAAGAAGGGCATTA
Ext1   D14   AX00005517   TTCCAAATTGGTACTGCCGGAAGTATTAAAGCCCTATCTAAATTTTCAAATACGG
Ext1   D16   AX00005518   TGAACGCTATGGAATGACTTCTCAAAAAACAGTGGATTGTAGCCAAGAACTGGA
Ext1   D18   AX00005519   TGGCTTCATTACTCAACTCCTACTACACTCACACTACTGAAAGCATCATTTTGGA
Ext1   D20   AX00005520   GCGTAATGGGATTGAGCAAACGATTAGTATCGTATTAGCGCCGCATTATTCTAC
Ext1   D22   AX00005521   TTCAATTCAGGTACAATGGCCCCTGAATTCGAAACCGCTGCCTACAAACTAAATG
Ext1   D24   AX00005522   TGGGAAAATGGAACGAACGGGGCGCATCTTGGTATATACAATTTACTTAGTGGT
Ext1   F02   AX00005523   GGAAAGAGAACGCTACGAGTAGTAGTAACGGAAAACAGATTCTTAATTTAACAG
Ext1   F04   AX00005524   GTCATTACAAATAGCATCGGCGAAAAGCTCTTTGGTGGAAAAGAAAAAATGAAG
Ext1   F06   AX00005525   TTAGTTGCATCTGAGCAAAAACAAGTTGTTAAAACTTGGTCTCGCCGTTCAACAA
Ext1   F08   AX00005526   CTTTTGGCACCCTTAAAGAGCGACAATATTCTTGTAGTGTTGATATGGCCTCATG
Ext1   F10   AX00005527   CGAATTTCGCAGTTGCTTATCCTGAGACAGATATTTGCAATCTATTGAATAAGTA
Ext1   F12   AX00005528   TTAGTACCGCCAGGGTATATTGTCCAATTTATGCCGATTCGAAATGCGAAAAGTA
Ext1   F14   AX00005529   AGTGCAGATAACCATCGGCAATTACTAGTGCCAAAAGGGTTTGCGCATGGATTT
Ext1   F16   AX00005530   ACTTCAACACACGTTGTTATATATGACAACGATGTTCCAGTTGGTGCTGGACGT
Ext1   F18   AX00005531   TCGCTCCTCGCTTACGTACCTACTCAGAAATTGCAAATAACTCTATTACTATCCC
Ext1   F20   AX00005532   ATTATCCGTAGCTGCAACTTATATAGGGATTAGTATAACTGTAGCCGTATTAAAG
Ext1   F22   AX00005533   ACGTCCTGTAGTAAAGAAGAACATGAGCGGTGGTACAAAAGTTGGCATTACACT
Ext1   F24   AX00005534   CTGGCAGTTATGCTTGATGGTAGCATTGCTGCGCAAATTTTGTGGGGCGGAGC
Ext1   H02   AX00005535   AAAATTACATCTGCTGATCTATCCGTTGCTGTAACAAAAGCAGTGGGAGAAGTTA
Ext1   H04   AX00005536   ACGAAATGATTTCAGAAGAGGTACTTCGGATGTATCTTAAAGTTTTGAGAAAATC
Ext1   H06   AX00005537   TAGCCCTAATAAATGCTTGGTATTCAATACAGATAAACAAAAAGATAGAGGACTT
Ext1   H08   AX00005538   ACATGGCTTAGTCATGCTGATACGGCAAACATTAAGCGTTTGAAGCAAAACTTAT
Ext1   H10   AX00005539   GTATGTAACAATAAATCGTGCTAAGATGTACCCTATAAATAATGCTCCTTCTCTT
Ext1   H12   AX00005540   CTATATACATAAATGGCGATACTCTAATTTAAGAAAACCGGCTAGAATATCACTT
Ext1   H14   AX00005541   TGGCAATAAAATTGCATTCAATTGAAACTCCTATTATATGTAATATCTCAGATGGA
Ext1   H16   AX00005542   CCTACTCCAAATTGTCAAGCTAGGCTTATTTTCAACTCAGGTTTACGGAGTTATC
Ext1   H18   AX00005543   GAATCTGCTATAAAATTTTTACTGCACAATTATAACACACGGTTGCCGATACATT
Ext1   H20   AX00005544   TGCCTTAACAAATCTGCTCTCAGAAGTTCATACTGGAACATATGTAGAACCTAGC
Ext1   H22   AX00005545   TGAAAAAGATTGTCCGTATTGTTTTGGGAGGCAATATCTATCAAAGAAAACAGTG
Ext1   H24   AX00005546   ATAAAGATGAGTCGATGCAGCAAGTGTCCATATATGTAAATGAAGGATTTCGCA
Ext1   J02   AX00005547   CATTGCTGCTAATTTGAAAAGCGTAGCTGGGAAATGTGTCACAACGATTTTGATG
Ext1   J04   AX00005548   GATTTTTCAAGTGATGGCATGTGGCATATTGTTTTCATTGTTTTTGAACTTAGAG
Ext1   J06   AX00005549   TATGGATGATCAAAGAAGTTGCCCGTTCGGGTATGTGTCCGCAACTACGGTAGA
Ext1   J08   AX00005550   AACAAGTGGGCTAAATAGTAGGGAGACAATTCAAGTTAGTCAAGAATTGGACAA
Ext1   J10   AX00005551   TGTTGTTACGAAAGATGTATTTTATACGTTCAGAGAAGTTGTTGTAAATAGAGAA
Ext1   J12   AX00005552   ACTTTATTGACATGAGTTTTAGAATGTTGTTTCATAGTCATTGTATTGAAAAAAAA
Ext1   J14   AX00005553   TTGCAATTCTTTTAACAGGTATATCGTCTTTTCGGAAAATGTTAAAAAACTCTATG
Ext1   J16   AX00005554   TGCATCAGAATGTATCGTACCTAGCTCTCACAGTACAGTTACAGGTACGTTAGTT
Ext1   J18   AX00005555   AACGAGGAGATACGTGAAGAGACCAATGAGAGTTTTCTTTATCAAGCTGTAGCG
Ext1   J20   AX00005556   ACACTAGATTGGTTCGTCATTCATACTGCTGATGATTGGATAGAAAGCGTACAAA
Ext1   J22   AX00005557   AAAGGGGATTTCATTACTGAAAAACATAACGGTGGGCAAAATCAGCATAAAGAG
Ext1   J24   AX00005558   GAACAGGATGCACAAGGGTGTGATTGTTGCGTTGTAACTGGGCAAGATTCTAAT
Ext1   L02   AX00005559   AGTGTGTGTACTAAAAGAGGTTTGTGATATAGGAAAACCACTCCTCGGTATATG
Ext1   L04   AX00005560   TTGATGTATTTTATCACTGTTTCGTTTTATTAGCTGAAAAAAATATTGCATTGGAA
Ext1   L06   AX00005561   GTGAAGAACAGGCATTTAAGCTTGCGGAGATTGAGCTTGAAAAGCATTTTTTAC
Ext1   L08   AX00005562   GCGCGATATTGTAGCGATATGTTGTTTAATGAAAGATAAGGAGCTTCGTGCGCA
Ext1   L10   AX00005563   TAGAGGGAGAACTTGCAAGAACGATGAAAGCTCGAAAAATAAGTACCGTTCGGA
Ext1   L12   AX00005564   ATTGCGTTCAAATATTCGTGATGCCTTTCAAATGCAAGAGCTTCATCGTCAGTAT
Ext1   L14   AX00005565   ACAAGGAGGTGTTATTCATTATGGGTAAAGATCGCCAAGAACGAAAACTACGAG
Ext1   L16   AX00005566   GGTGGATAGAGTGTTTCTGCTAAGTAGTGCTCTTGTGTATGCATCGGTGTTATT
Ext1   L18   AX00005567   ATTTGCAGGTGGTGCTCCTTTATTCGTTTGCGAATCGACGGAGGAACTAGAATT
Ext1   L20   AX00005568   GATTCAGCAGTTTGCTTGTAATGATTGTATGGTGGATGTCTTTAGGATCCTCCCA
Ext1   L22   AX00005569   ATTTGTGCCAGCTCTGTTCTTTATGGTTGTTGTAACGATCCTTGAATGGGTACCG
Ext1   L24   AX00005570   ATAGAAATAAGCAAGAGGCTGAGGGACCAATGATTCTTTTTGCAGCTCACTTGT
Ext1   N02   AX00005571   GAGGAACTTTTATTTGATTTTGAAGATGAGCGTATTCATGAAGTTGTAAAAAAAG
Ext1   N04   AX00005572   TTAGGAGTAAGGTTTATAAATGGTAAGGGTGAAGTAATAGATCCATCTGGAGGC
Ext1   N06   AX00005573   TCTCTTCATTCAGATATTATATATATTCAGCGAGACGGCATGTCTATGGAGTTCT
Ext1   N08   AX00005574   ATGAGTCTGTGTTAACGGGAAACGAAGCGAATATAGAGAAGTTTGAGAGCTGCT
Ext1   N10   AX00005575   GTAATTTGTCTAATTACTTATATTGTATTCCTGCAAAAAAAACAGTACATACAGGG
Ext1   N12   AX00005576   AGCTCTTAAACATTTTAAGAGGAGATATGTCTTTTGTAGGCCCTAGACCAGAGAG
Ext1   N14   AX00005577   GAATCTCTTGTTCTCACCTATGATCGCTTATGATTTAGTATTTGGAGTAGGTCAA
Ext1   N16   AX00005578   ACCTGCATTTGGAGACGTTACATGGGCGTGGGTATTTGCTTTTTCCCAATTTATC
Ext1   N18   AX00005579   TACAATTTTCTTAAAGAGTGGCGTTAGAATAATAGGAGAAGTTGTTGGAGTGGA
Ext1   N20   AX00005580   ACTACGATACATTAATTGCTGAAACGGGGAAGTTCACAAGTCAAGTAAGTCGTC
Ext1   N22   AX00005581   AACTATTTTTCACATCGACTACTGCAGGAGAAGCTGGAGAGCTGAAATTAACGG
Ext1   N24   AX00005582   TTTATACGATAGTTTATTTGGTTTATATGATTGGATTAGCATTCAAATTCAAACGA
Ext1   P02   AX00005583   AAGCAAAACGCATTTGGAAACCTGTATTTAATAAGTTAAAAGCGGAAGCTAAGGG
Ext1   P04   AX00005584   GATATCAGTCATACGGTACATATGACGAAACATATTCCCCCTTCCCCTACACAAC
Ext1   P06   AX00005585   CGGTAATTCTTTCTTAGATACAACTGCCACTCCTCCCGGAAAAGATATCGAGATT
Ext1   P08   AX00005586   ACAGAGGAACTGCTGAGACTGAAATAAAAGCTCTTGACACTGCTATCCAAGAAC
Ext1   P10   AX00005587   AACTTTTTATGCGTTACTTCCCGAAAAGATTAGTGAGTTCCTATTCCTACCCATT
Ext1   P12   AX00005588   GTGCAAGAGGTAATTCTGGACTCGGAATAACAATTTCTTATTGGGAATCACTTGA
Ext1   P14   AX00005589   GCGAGATATCTTTAAAAGCCGATATGGACTTTCAGCGTATTTGGTCAGATCGGT
Ext1   P16   AX00005590   CTGCCCTTCCTCTCGTGAGTTTACTTAGTTTATTTTGGATTTCATTCGAAGGCGG
Ext1   P18   AX00005591   TTTTTGTCAAGGAGTAAAAGATGGAGGGTTATCGACTAAATGCTTTGCAGTAGA
Ext1   P20   AX00005592   ATCTACCATCCTTCAAAGGTTAGCATTAATGAAACAACAGGAGACCAATGTCTTA
Ext1   P22   AX00005593   TATTAAAGAATTCAAGCAACAGTAAAATAATAAATGTAACAACTGACATGGCCTC
Ext1   P24   AX00005594   TCTTCATTCTATTTCTCTCACTACAACATAACGGAATCATCTCTTGTTGTAAAACA
Ext1   B01   EMPTY        -
Ext1   B03   AX00005595   AAACCGTATATTATTAATTTTTGGGCATCATGGTGTGGGCCGTGTGAAATGGAG
Ext1   B05   AX00005596   TGGGTGGCAAAATTGCTGGTCAGTTGAAAAATCCTAATACGGGTGAAGTTATGT
Ext1   B07   AX00005597   TGACCATTATCAACTTTGGAGATCTGATATCGACCAACTTATTACCCATTGCACA
Ext1   B09   AX00005598   TTGTTATTTCCCATATGACATTATGCCAAGTGCAGTACAAAAAGTAGCTAATTTTC
Ext1   B11   AX00005599   TGATCAATTGACAAGTGGTATGTTTCAGCTGTTTGCAGACAAACCACTGAGGCC
Ext1   B13   AX00005600   AGCTGAGCGAGATGAATATGCACGAGAATTAGTAAGGTGGAACCGTACTTTTTA
Ext1   B15   AX00005601   GTGGGGCTGTAATTGCCGCATTAATATTTGGTGGGAAAGAGCTGTGGCATAAGA
Ext1   B17   AX00005602   TATACGCTTGGTCCATGGCAATCTTAATGCTTTGCTTTCCGATTGCCACGGAAG
Ext1   B19   AX00005603   TTTAAACCTTCTACACCTAATGAAAACATTTCTAAAAGTCATACAAGCTTTGACTA
Ext1   B21   AX00005604   CAATACATGCAGACACCTGTAGAGAAGGATGTTTTACGTTCGGATTTTTTAATGA
Ext1   B23   AX00005605   ATGTTTATACAATGACGATTGCAGTACTTGCCATTCCGTTAGGGCGGATAGCTG
Ext1   D01   AX00005606   CACCTCTTTCTCACGCTGCAGCTTATTGTTTACCATTTGAAGAAGCCTTTCCTTT
Ext1   D03   AX00005607   GAATGGGAAACGAAAGCCTGGTTCTCACATATAATTTGGGAAGATAGCCTTGCT
Ext1   D05   AX00005608   ACAAATTCTTTTAGTTTTGGACAGATGCTAGTAATTTCCATTGCAATCGGAATTAT
Ext1   D07   AX00005609   CTATAGCAATCCTGCTTTTATGTTCCTTTTATTCTGTGAGACTATTTAAAAAAATA
Ext1   D09   AX00005610   TTTTACTAGAATTACCTCAAAATAATAAACATTACGGTTTATATACTCCCGATGGG
Ext1   D11   AX00005611   CGGCTTCTACAAACTCTTCATCAAAAAGAAAAGTATCACTTCTTTTTATACCCCTT
Ext1   D13   AX00005612   ACGTAGTTCTCATACTGGTGGGAAAGGAATGGGGCTTGCAATTTCGAAAAGTAT
Ext1   D15   AX00005613   CTTATTAATGTGGATGAAGGCTCTTGCTATTTAGGTGAAGTAGCACTTGTACCAC
Ext1   D17   AX00005614   CATACAAGCTTTACCGATTTACATTTGTTCTCACCTCTGTTGCAGAGCCCAGGTG
Ext1   D19   AX00005615   CTTTATGCTCTGCTTTTCCATACCTGGGAACAGGTACATGAAGGAAATGTGGCT
Ext1   D21   AX00005616   CAATTGCCTTACTGCCCGAAAGTCGAGGACTAGGGATAGGTACCAGATTAATTG
Ext1   D23   AX00005617   TATGAAACCGTCAAAAGCATTCATATTTATTTTAGTAGGCTTATTAGCTGTACGC
Ext1   F01   AX00005618   GCTAATTTTGATCAGACATCACTGAAGGGGATAGATATTAGTTCTTCTACCTTTG
Ext1   F03   AX00005619   AGAAAACCACTTTAATGAACCCGACTTAGATTCGTTAGATCGAATCGCATCCTTC
Ext1   F05   AX00005620   GAGGTACTGGGGGTACAAGAAGCCCCACGTTTGTTAAAAGCTACAGCATATAGT
Ext1   F07   AX00005621   TGATTCTACGTATAGTGGATATGAGACAAATAAAAGAAAACCAAACGCTGAGGTT
Ext1   F09   AX00005622   GGTAAAAAACGTATGTCACAGGTGGCTCTAGCAGATAAGGTTGGTGTGACTCCT
Ext1   F11   AX00005623   TGCTTTAAACTTTGCATTTCAGCTCGAAGCCCCGTTCTTAATAAGTGAGACACCG
Ext1   F13   AX00005624   AAGTATAGGAGAAAAGAGTATTGATTTTGCTACCCGACCAACTGTGTTGGCCTG
Ext1   F15   AX00005625   AAGTCTTCAGCTGAAAAGCAATTAACGGAAATCGCTGAACAAATGGCGCAGTAC
Ext1   F17   AX00005626   GATTGGCCGTAGGGGAGATTAGTGGTGTAAGAGGACCATTATTCTTAGATGAGG
Ext1   F19   AX00005627   ACCGATTCGTGAAAAGTATCTAAAACGAACTGAGGAACTATTAAAGCCGGTTTTT
Ext1   F21   AX00005628   TGATAGACCTGAGGTTACAACAAGCGTATTACTGGAGTTTGCGAAGGTACTGAA
Ext1   F23   AX00005629   ACAAGTGGTAACCCGTTTGGACGCCCTAACTATAGTAATAATAAACATGATTGGA
Ext1   H01   AX00005630   GAAAACCGCTGTAGAGCTAAAAGAAGCTGAAGCATTTATGCAAATTCAAGGTGA
Ext1   H03   AX00005631   TGAAACGTACAGAGAGTCGTAGATTTTCACTAGATTATATGAGACCGAATCAGAT
Ext1   H05   AX00005632   TTACGGAATCTGTCCGGTACTGTTTTGTCTTGCAGAAACTCGTACAAAAGCTATT
Ext1   H07   AX00005633   TCAACGTTAAGACCAGACGACTTCCCTCGTATCTACTTAATGAGCTTTAGCCCG
Ext1   H09   AX00005634   CTGGAAAGCTTGTAAAAACGCGTGTCATGGTTGCGGGTAAAAAGCATACGCCTT
Ext1   H11   AX00005635   AAGTACTTGAACTTTATGAGTGGACGGATCCATGCAGGGTACAGTCCATTCACA
Ext1   H13   AX00005636   GGTGAAGTGCAGCAAGTATCCCTTTTATCGTATAAAGATGGCCGAACATTAGCA
Ext1   H15   AX00005637   GTGTATTTGGACAATTCGGAGCAACAGTTAAAAGATGTAATGCAAGAAAATCGTG
Ext1   H17   AX00005638   GAATACCTGAAAAGGACTCTTTAAAATTCGCAGAAACTGCACCCTTTGTTAATTC
Ext1   H19   AX00005639   TTAAGTGAGTTACTTCATGTGTGGCGTGGTCATAAGTTTTGGAGCGAAAATAAC
Ext1   H21   AX00005640   CTAAAAGCAAATCGTATAGGGTTAAGCGATCCACGGTTACATTTCAATGGGCTT
Ext1   H23   AX00005641   ATCTGAAAATCAGATGAATATCATAATTGCCCGTGTAGAAAGTCGTTCGGATTGT
Ext1   J01   AX00005642   TTGGTTAGTCTCTATCTTAGCAATTAAGACTGAAGAATTTTCTAGATTATTGCCG
Ext1   J03   AX00005643   CTTGGTATTCCTTTATACAGCCAAAATATAGAGTCTGCATGGCAAGTAGTCGAGA
Ext1   J05   AX00005644   TGCAAAGAGTGTTTTGAAAAGATACTTGTTAAAAACGGAGACAACAAACCAAAAA
Ext1   J07   AX00005645   ATCGGTAGAGCACGTGCAGTTACCGATGTAGCGTCGCAAATTATTGAAAATGGC
Ext1   J09   AX00005646   CCTAAGGGATACGTAATTATCTTTGGTGATGGTAATCGGCGTAACTTTCAACAAG
Ext1   J11   AX00005647   ATGAATCGCTCAGACGTATAAAATACGGTGAATATAATGGCCATCATCAATGGG
Ext1   J13   AX00005648   AATTTTACAGCATTCCTGCACGTTACATGGATTACGGATTAGCAAAGGCACAGTA
Ext1   J15   AX00005649   AGCACTGGGATTTATCCCAGATAATCTTAAAATGAACTCACATATGCCTAAAGGA
Ext1   J17   AX00005650   AGATGCTCACAGCACGATTATCGAACCGTGTGGACAAGCACTATTTCATTTGTC
Ext1   J19   AX00005651   CGGCTGTTAAGATGACCACGGATAAGCAGACGCGTAAACTGCCAATCGTAGACG
Ext1   J21   AX00005652   TGAAGGATACAAAAAGCTAGAAGGGGCGCTATTTACGGAAGGAAATGCGATAGA
Ext1   J23   AX00005653   CAAGTTTATGGTGATGGAGATACGTTCGCGTTACTTTGCAAAGCGAGTTCTCAA
Ext1   L01   AX00005654   ACGCCGTACATTAGGTATTCAGGAAAAGGATCCAATGGAGATTTTCGTAGATGG
Ext1   L03   AX00005655   CATTACCAATGCAAATGCGTATGCAGCGTGAGATGTCTAAAGTATATAAGGCGC
Ext1   L05   AX00005656   TAGTAGAAATCACAGAGGAAAACGGAAGTATACGCCAGGGACGTGCCATATTTA
Ext1   L07   AX00005657   TACGATGGGTATGTAACGGTACAAGAAGGAGTTGTTACGGGTAAGCTCAGCTGG
Ext1   L09   AX00005658   TGTGCTGGATCAGGCGATTAAACAATTACCGAAGAACATGAAATATATAGTGCTT
Ext1   L11   AX00005659   AGCAGAAACTTACGGCTAAACAAATTCAAGCGGCGTACCTGCTTGTAGAAAACG
Ext1   L13   AX00005660   TTATTGGAGCAATTTGAAATGTATCCGATGCACCCACACGATGACGGTCCGGAT
Ext1   L15   AX00005661   ATTCTGAGTGGACACGCATTATGTCCGAGGTTCGTTTGTATGAGCGTTATGAAG
Ext1   L17   AX00005662   AACACCTAAGTTCCCACTTCGATTAGACCTACAGTTTTTCTCTGATGGTGGTCCT
Ext1   L19   AX00005663   CACGTTACTTAACTCCAATTTATGATCAAGATGCTACACCAAATGGTGCTGACTA
Ext1   L21   AX00005664   AAAAAGTAGCTCTAATACCCAAAAAGGTTGATAAACAACCAGATAGTACAGCGAC
Ext1   L23   AX00005665   TGCGGCAGACGCGGCGCGCTATTTTTCTTATACAGATGGCGAAGAATCGGTTG
Ext1   N01   AX00005666   CATCGCCACAGATACCACTCAAAGCATATGTGTTACAAGCTAGCTAGACGTGAT
Ext1   N03   AX00005667   GAGCAAGGACGTAGGGAACCGGTGACATTATACATTAAAGGTGTTTCTGAAAAG
Ext1   N05   AX00005668   ACATACACGCTTACAAGCTAATCAAGCCTCTAATCGAGCACCGATATTACACGG
Ext1   N07   AX00005669   GTAGTGCAACCGCTTCTGAGTTTAAAGTTAAATCAGGAACATACATGTTGAATAG
Ext1   N09   AX00005670   TGGTAGGGATGGATTGTAAGGTTGGGGTTTCATTAGATGGAAGAGTTGTAGCG
Ext1   N11   AX00005671   CAAGACCTTGTAAATGAACGCATCGATAAACAGAAATTAGAAAGTGTACTTCCTA
Ext1   N13   AX00005672   ACCGATGCAATTCGTTTCTCAAACCATGCAGGGCGGAATTACTAATTTCACGGA
Ext1   N15   AX00005673   GCTTTGTTTAATCGAAATGCTCAAAGTGACAAAATCAAGTCATTAGCGGATATAT
Ext1   N17   AX00005674   TATGAACGCAGCAGGTAGCATCATTTCTTCAATTTGGAATGCGGCTAAGTCAGC
Ext1   N19   AX00005675   AGCGCATGAACTAATTAATGAGGGCGATACAATCCGAATCAAGGATACAGGCTT
Ext1   N21   AX00005676   TTTAGAGATTAAAGGGTTAGAAATACGAACAACTGGTAACGAGAAAGATATTGAT
Ext1   N23   AX00005677   TTTATTTTCCCAACCTTTTGAAGTCAATGAGCTCTATAAGATACATGGGTGTAGT
Ext1   P01   AX00005678   TTTTGGCATCCTACTTTCTGTTATCTTAGGTATCACAATAGTTGGGTTATTTTTTG
Ext1   P03   AX00005679   CTAGTTAATGGTGAGGTTGGTCTTGTACGTTTTGACACATTAAAGTCAATCCTGG
Ext1   P05   AX00005680   ACGTATTGGAGTTGATGATTCTACTCTTAGTGCAATTGTTCGTAATCGTACTAAA
Ext1   P07   AX00005681   CACTTTACAACATGTACGCAGAGGCTGATGATCATGATGAAGTGCAATGTGTGT
Ext1   P09   AX00005682   AAGGTGAAGTAAACTCTATTCTAAAACATATGGAAAGACACGAGGTATCTAACAA
Ext1   P11   AX00005683   TAGTGGTGATGAAGGTAGCTGAGAAAATGGGGATGAGTGTTCCACATTGGCTTC
Ext1   P13   AX00005684   AGTCGACTAGCACACAGCTTAATGAGAAATGAAGCATGGCTCTATCTGTTTTGTC
Ext1   P15   AX00005685   AAACGAATTAAGAGGGCTAGCCTGTTGTGCTCATTGTAGGACACCGTTAGCCTT
Ext1   P17   AX00005686   GGATGCTGGAACTATTTCCGGATTTAAAGCAGTTTTGGAATAAGAAAAGTGGGC
Ext1   P19   AX00005687   AAGCACTTTTTACCCATTTGTTCTATAAACTTACAATGTATTGAACCGGAATTGG
Ext1   P21   AX00005688   AATCCATTAGATTTTTACCTTGAAAGAGGAGATGGAAGTATCGTGGACCATACAT
Ext1   P23   AX00005689   AAAGATGAATCATTGACGCTGCCTTGGATAAATGCTGAGTGGAATACCACTCCT
Ext2   A01   EMPTY        -
Ext2   A03   AX00005690   AATGTTATCGCCATGAAGGGCATGGCATTAAAACAAGCATCAGCATTAGAATCC
Ext2   A05   AX00005691   CAACAAGTAATTAAACATTTCGAAATTTCAAAAGCATATTCACATCGCGGGATTA
Ext2   A07   AX00005692   ATTATTGGCGGGAATTTAAACACGATACAAGGAATTTGGGGTAGCCCCTATATG
Ext2   A09   AX00005693   CATGACGGACTCAATAGAGCGGAAACAGGTAGTCCAGTTGATATAGCAGGCGG
Ext2   A11   AX00005694   TAGTTGTTGCCCTGCTTATGTCTTAATTATAGGGAATATGGATACTTCCAACTAT
Ext2   A13   AX00005695   ATTTGATGGTGGAGATGTAGATATCGTTGAAGTCGGTGATTTTACAGGGAACGG
Ext2   A15   AX00005696   CAATTCAAGCGCTGCAACTTATCTCTATGGGGCTTCTTCCAAAAGGGGCATCCA
Ext2   A17   AX00005697   TTAATACTGTATTTCCTTGTATAAAAGTTGTGCCAAAGCAGCAGGGAACTGTTGC
Ext2   A19   AX00005698   AGCAACAGTTTGCAGCCAAACCAGAAAAAGTAGAAGTACGATATAAGCAGTCCA
Ext2   A21   AX00005699   TTTGTTTTTCATATCATTTACTTTGTTTATTAGAAGAGTATTACAAAGCAGCGTTG
Ext2   A23   AX00005700   ACTTTATCTCACCATTTCAAAGTTTTACGTGAGTCAGGTGTTATGTACACGCGCC
Ext2   C01   AX00005701   GCTATTATTGCGTTGCTATTTATGTTAGTAATGATTATACCAAGTTTTTCGGTTGG
Ext2   C03   AX00005702   CTCTGAAGTATTTAAGTGAACAAAGTGATGAGTGGCTCATGTCAGAAAGAAAGT
Ext2   C05   AX00005703   TTAGACGAAGATGAAGAAGGTATTCAATTTGTTTTAGAGCGCATGCCTAGTCGA
Ext2   C07   AX00005704   CTTATGTAAAAAACTTAGCAATATGACACTATCTGAAAAAGAACGTGAACAACTA
Ext2   C09   AX00005705   TGGGATGCACTTTATACTATTCCATACGGCGTAAGTGCTTCATATTTAGATATTG
Ext2   C11   AX00005706   TATTTTAGGTAGTAAAGCATCACGTATGCCTGCACAAAAAATAGGGAGTACGCG
Ext2   C13   AX00005707   AGATATTATCGGAGATGGATATGGTTGCTTCTATTTCAGCATCCAGACATTCGAG
Ext2   C15   AX00005708   GAAACTGAAAAATGTGTTCTATTCTTTGCATCAACGGAATCATAGACGTATTGTT
Ext2   C17   AX00005709   AATCGAAACTTTCGCAGGGACAATATGGATTGGTGCTATTACGATGGCATACGT
Ext2   C19   AX00005710   TAGCTGGGAATCCTTCTTTCCATTATTACCAGGGGCAACTGATCCATCTAGCCC
Ext2   C21   AX00005711   AGTTGTTACAACTGGAAGACCATATAGTTTATGCTCACAATTTAAGGAACTAGGT
Ext2   C23   AX00005712   AGCAGGGCTGTTTGGTATGTTGCTCTCACCACTTGCAGGTCGTTTAACAAAGAG
Ext2   E01   AX00005713   TTGGCACACGTCTACCCTCACACAGAAATTTAGCATCACAACTTAATATTAGCCG
Ext2   E03   AX00005714   GGGAAAGTATTACTTTCGTATATAGAGAACTGGGGAAAGGAAAACGAATGTGAG
Ext2   E05   AX00005715   GTGCGCAAATAAGCGTTAGGAAGGGAGATATCGTTTCTCTCATTGATGATAGCT
Ext2   E07   AX00005716   AGAAAAGATAAAGATAGAGGCGGGACAAGCTGTGTTTTGGGAAAAGGGAGAGC
Ext2   E09   AX00005717   TTATATATGAATTGTACGTTTTCCCAAAATATCGCGGGAGAGGATTATCGCGAGA
Ext2   E11   AX00005718   AATATAGATGTTTTCTCTCCTGTAACATGGCAGTGGGAATTGAGTGGGACTCAT
Ext2   E13   AX00005719   CTGTTTGTCGCGCTACCGATAAGGAGCGCGGCTGACAGTTATCTTGGTGATGA
Ext2   E15   AX00005720   TGAACAGACCGTTGCTCAAATGGAAAGCTTAGATGCATTACTGCAGTTTCTTGAT
Ext2   E17   AX00005721   TGACGTTGGTGGATACAGCAGAGTATAGTTTCGTTCAATATAAAGACGATGTGA
Ext2   E19   AX00005722   GATAAAGGCAGCAGACTTCACACTTCCGGGAAGAATGTATAAAATTCCGAATCA
Ext2   E21   AX00005723   AAACACATTCTATGATTATGGCGGAGTGTTGCATCCAGTGGGTTTAACCGAAGA
Ext2   E23   AX00005724   TGCTAAGGATACAAAGGAAAATCCGATGGAAATAACAGAGATAACAATTTCGATA
Ext2   G01   AX00005725   ATTGTATACGTTGGAAACCAACCGAGCCAAATAGGCTATTTAGCAACCGATGGA
Ext2   G03   AX00005726   TTGAGGTAGATGGTAAAAAGCATAATGTATGGGTAAGTGAAGAGACATATAAGG
Ext2   G05   AX00005727   TCTGATTCTTCCTGGAATGTCTGATTATACAATCGACGGAATTACATTAGTATAT
Ext2   G07   AX00005728   CAATGGAATTCACTACAATAAGCATCACAATGGGATATGAAAAAAAGAATAAAGA
Ext2   G09   AX00005729   ATGAACTTAGTAAATTGAAACCGAGTGAAGATACAAAAAGATCTAGTGAACCGAG
Ext2   G11   AX00005730   ATTAGACTCTCATACTCTATTTTGATTTACCAGAACTATACGCGCTCAGTAAAAC
Ext2   G13   AX00005731   GGAGTTATTACCCGACTCTCTTTGATAAAATAATTGTTAGCCTTGAGTTAGTGCT
Ext2   G15   AX00005732   ATCATCGCATCCGCCTCTACTTCCGCTGAAAATTCATTATCCGCTATGGTAGTTG
Ext2   G17   AX00005733   CATCCAGGTAATGTGTATATTCTTCGTGATGGCACTCCTGCATTACTTGATTTCG
Ext2   G19   AX00005734   TGATAGGAACTGGAAGCAGTTCCACAATCCTAAAGATTTAGCTATTTCTCTTTCT
Ext2   G21   AX00005735   AGTAACTAAACTTAAAGATAATGAATTACATGAGAATGTATGTATGTGGGGAGCA
Ext2   G23   AX00005736   AACATTTGTATCGGAAGCCAGCCGAAAAAATTATATGGAGGCCCATCATCTAATA
Ext2   I01   AX00005737   ATCTTTTCACGAGGAAGAAGAAATACATATCTCATACTATCGTGATGGAATGGTG
Ext2   I03   AX00005738   TGCTAATTCGGGATATGGATAGTACAAAAGATATTCTGGACAAAATCGAGCCTTT
Ext2   I05   AX00005739   TGAGGTTCTTGAACAGGCTAAGGCTTTAGAATTCGCCAATATCCAAATCGAAACA
Ext2   I07   AX00005740   AACTAGATGAAGCTTTAACGTATCCATCATCAAAAGTTATTACTTCAGCGATTGA
Ext2   I09   AX00005741   TTAGGTAATGCATTGCAAGGGGACTTTGGCTTCTCGCTTCAATATCAAGAGCCT
Ext2   I11   AX00005742   ATGCTTTCGAAGGTTGGGGAGGCCCTACTCCATTTATAAACTATGTAGACTTCTG
Ext2   I13   AX00005743   CATTAATCGAATGTATTTTCACAGAATTATGTGCTGCGATGCAGTTTTCTTCCTT
Ext2   I15   AX00005744   ACTTAGGTCTTGGAGTCGTTCCACCTACACCATCATGGGGGAACATGATTAGCG
Ext2   I17   AX00005745   ATATGAGTGAAGGAGAGGTTGAACGTGCAGTTTTTTACTTCCGTGAGTATTTAAA
Ext2   I19   AX00005746   ATCCTCCTATTGGGTTAGTGGGACTCATTATCGCTGTTGCTTCGCTCGTTATCG
Ext2   I21   AX00005747   CTACGATTCTAGTCCGAACAGGCGCTGGGTATGATGCTTTGCATACGTACCGAG
Ext2   I23   AX00005748   TAATAGATTATAGTGTACAAGAGGAACGGGCTGTTTTATCACAGCTAATTATTCA
Ext2   K01   AX00005749   TTATGTCATATAATCATTCGGAAAAGAATGATTAAGAAAAAAAAGCCGTATGAAT
Ext2   K03   AX00005750   AGTAGCTCCAAATCCACAACCTCCTAACCCACAACCGGTACCTCAAACGAAGGG
Ext2   K05   AX00005751   TTGCTTCAATGGAGGCAGGGATTAAGGTGACAGTAGAAGAGGACATCAGGTGG
Ext2   K07   AX00005752   GGCAATAATTTGGTTTACGATACAAGAGTTTATGCAAATAACGCTCAATTATCAA
Ext2   K09   AX00005753   GATGGAAGGTGTTTGTATGAGTGTATATTCAGTAGCACTCGCAATCAGGGATTG
Ext2   K11   AX00005754   GGACTTCCAACTGCAATTATTTCAGGTCCACTTTACGGGAAATGGATTGGTGCT
Ext2   K13   AX00005755   TATCGGTACATCAGGCGGTGTAGAAGGAGCTAGATACGGTGCTTGCTTAATGGT
Ext2   K15   AX00005756   TCATTTATAATGGGAAATCCGTTTCTTGGAAGGAAATGATGTCTTGTAGTGGATT
Ext2   K17   AX00005757   AAATCGCGGACGAACTTGGTATCAGGGGAAAAGTATAGCAGATGTATTGCCGCT
Ext2   K19   AX00005758   AAAGTGAAGAATGAGTGGTTACGTCAGAAGAGAATGGTCGAACAAAGTGTAGAA
Ext2   K21   AX00005759   GGTTTGGATTCATACAGGTCTTGATATTAAACGTAGTATAGACCCAAGTGACCG
Ext2   K23   AX00005760   GGTCTGATCCTGATGTTACTAAATTCATGAATATAAGTAATTTCACTGATGAGAA
Ext2   M01   AX00005761   TTCATGTGGTCGCAAGTACCGGTTACGATTTCGGTATATTTCCTTCAAGGAGCG
Ext2   M03   AX00005762   AACAATTGCAAATGCAGCAGCAAGGTGTACAACCGTATTATTCATCCGTAGAGT
Ext2   M05   AX00005763   ATGAATATAATCCAGTAACGTCGATTTTTACTCCGAAAACTAGAGGGGTATATAG
Ext2   M07   AX00005764   CGGTCCTTGTAACGAAGTAATTACAAATGTGTCTATAATTAATCAACTATGCACC
Ext2   M09   AX00005765   TTGTGGTACAGCCTCAGTTCCCTGGCGGACCGAATGTTGTTTTTCCGGTTTTCG
Ext2   M11   AX00005766   CTTAACAGGTTATTGGGGAGGCGGTGAGCAAGATATGATTTGTTTAGAGAACGA
Ext2   M13   AX00005767   AGAAACGAAAGGGATTAAAATTGGGATGGTTGAGTATAAAGTGTTAAAGTACGA
Ext2   M15   AX00005768   TGAAGATGGTTACATATTAACAAGCTACATGACTGTTGTACATATCAATCCGGTA
Ext2   M17   AX00005769   GCTTTTTCATGATACGGGTGTTATATTAGTGAAACAAAATGTTGATTATGGTAGT
Ext2   M19   AX00005770   AGCTTGCGCCATATTGTGCCTCGAAATTTGCTATTGAAGGTATCACTAAATCTAT
Ext2   M21   AX00005771   GAATCGGATCTTGTTATTGTAGGAAGCTCATTACAAGCCCTCGGATATATATTAC
Ext2   M23   AX00005772   ATTAACATTAATATTTTGGGTTCCAGGAGTTATACATGCAATTCTTGTAGTGCAT
Ext2   O01   AX00005773   TCGGCATTGAACTTCCAGCAATTTGGCAACAATACCAATCACCAGGTCAAGCTA
Ext2   O03   AX00005774   GCTTTGCAAGCGGCAATGCTTACAATTGTCGATCCGAGTAAAAGAGGAGTTGCA
Ext2   O05   AX00005775   GGATAGTTCAATTCAGCCCGGATATTCTTTAGGGGTTGTTGCTGAGAAACCCGA
Ext2   O07   AX00005776   TTAGGTATCGTGACGTCTACTGAAGTGGCTGAGAGAGCAAGAGATTTAGTAAGA
Ext2   O09   AX00005777   TCCAGACTTACCAAGGGCATTTAAGGCTCCGCTTGTACCATTTTTACCAGCATTA
Ext2   O11   AX00005778   AGCAATGAAGCATGCAGATACTTTAATTATGGTCGGTACTTCTTATCCGTTCACC
Ext2   O13   AX00005779   GCATTTGGTGGATTCATTATTTGCGCAGAAACTATGGCGATATATTCACTAGGAG
Ext2   O15   AX00005780   GAGGCTTGTTCAGATGTTGTAGCAATCTCTATTTCTAATACGGTTATTAGAAACA
Ext2   O17   AX00005781   GGACAGTGGTTAACAACTACATGTGTCCTTGGAATAGGTCTCATTAGTTCTATTC
Ext2   O19   AX00005782   AAGAGGTTGCGGACGAAGTGAGGCACCACAAGATGACGGTGAGTACTCAATCA
Ext2   O21   AX00005783   TGTTTTTGGTGTTGCCTCTAAGCCATTACGTTTTATAGGTAAGGTGATTTTTCAT
Ext2   O23   AX00005784   AAGCCATTATTCCCATGAAGATAAGGAAGAGATTGCTGTTATTATGAAAGGGGA
Ext2   A02   EMPTY        -
Ext2   A04   AX00005785   TTAAAAAATCCGGTAATACTTATAGAATATCCTTCAGGAAAACAAGAAACATGGA
Ext2   A06   AX00005786   TTCTTTCTAATAGTATTTTTTTGTTTGCTCTTGGTTCTTCTATCGAAAAGCAACTC
Ext2   A08   AX00005787   GATGACCATATATTCAACTCCGCTATTTAAACCTGCAACAAATGGCCCTGAATTC
Ext2   A10   AX00005788   TTGAGCGCTGGAATATAGCTGTTCAGAAGTCAGAGCAATATGAATTAGTAATATT
Ext2   A12   AX00005789   AAAAATTCCCTATGATGTGTGAAATTGATATTGAAGGTGACGAGGCCGTAATTCG
Ext2   A14   AX00005790   GCAACACTTCAAAAAGTTTCTTTTGGGGTAGTTTTATCATTCTTACAAGCTTCATG
Ext2   A16   AX00005791   TCACAATAATTCGCACGGGAACTATAGAGTCGGGAGACATGGTTCGCATTATCC
Ext2   A18   AX00005792   AGGTGTCGCGTATATGCTATATTTAGCCTTTAAAATAATTACTAGTAAAGGCGGT
Ext2   A20   AX00005793   ACATAAACGATTGTCAATATACGTTAAATAATGGAGACTCAATTCGCTTTAAGGC
Ext2   A22   AX00005794   CATTCCACTTTCAAATAACCAAAGTCTTGGTAATTTTACAGTTAACGCTTCAAATG
Ext2   A24   AX00005795   AGAGAAGCTTATATATACAGATGCTGACGGGATACCCCAATATGGTACAACGAA
Ext2   C02   AX00005796   GCTTCAGGTACAACACCAGCAGCGTTAGTTAATGCGTTAGTAGCTAATACAGGA
Ext2   C04   AX00005797   AAGATTCCTGCCCCAAGTCCTCAAATTGTCTCCGGGGATGGGCATTATTTATGT
Ext2   C06   AX00005798   AATGTTTATAACAAGTTGAACTTTAAGCACTCAACGCCAATTGCAGCAAGTGGCA
Ext2   C08   AX00005799   CGTTCGAAAGGCATTTTCTACGCGACCTATTTCCCATCGCTCTAAGTCATTTCAA
Ext2   C10   AX00005800   CGTGACACAACTCGCAGAGGCTTTTTATGTGACTCGCGGTGCTATAAGTAGAAT
Ext2   C12   AX00005801   GAACAAGCATTGGTTGTTACACTACTAACTTCCGTATATGCGGCCTGCGTGTTT
Ext2   C14   AX00005802   TAGCCGCTTTATCTTATTACGTATTAGCAATCGATTTCATTCCAGATATAGCTGC
Ext2   C16   AX00005803   ATCTTCTTAATTACGGATTTAACAGATGCATCTTTAAATACATTAGGCTGGAGAG
Ext2   C18   AX00005804   AAAGAGGATGTCACTAAGGCGAAAAGGATTGTCTCCAATCCCGATATCCACGTT
Ext2   C20   AX00005805   TACATGGAATACAAATAACGATTTTGGTAGAGTTGTTTTAAATGCAGCATTAGGG
Ext2   C22   AX00005806   CATTTACAGCCCCTATAAATGGTATCTATTTATTCAGTGCCAATATAGGATTTAAT
Ext2   C24   AX00005807   TGTCAAACAGCGTTATCATGGGAGAATAATCCCTCCTAATCCACCTGCTCCATAC
Ext2   E02   AX00005808   CTGGTATTAAAGGATTCTCTAAAGTAGATAATTGGATATCAATGCTTAGAAGCAT
Ext2   E04   AX00005809   GAATGGATTAAGCAAACATCATTTCGTATTGACCAGTTTCTTAGTCGTTTGGGTA
Ext2   E06   AX00005810   AGGTGCAACTTATAACCTCTCCAAATTCAGCTACTTGCCAAGGCAAGACGGCCA
Ext2   E08   AX00005811   ATAGTGTCAGTGTAGTGATAAGCAAGTACAACATGACTGCAATGAAAAATTATTT
Ext2   E10   AX00005812   TATAAAAATAACTTCGACAGAGATATTAGGTGTTGCTAAATCCGTATTTATGCAA
Ext2   E12   AX00005813   GAGAAGTCTGTTAGATCACATGTATGCCCAAGTTATGGGCAGTCTAGCTGGAAA
Ext2   E14   AX00005814   TTCTTCTTCGGACACTACTTCTCATTTTATAAATCCTAAAAACGGTGATTTACCAC
Ext2   E16   AX00005815   ACGGGGACAGGGATTTTCGTGAGTTGTTAAAGAAAGTTGATGCACCACGTTTTT
Ext2   E18   AX00005816   AAAGAAGGTAAAGCGTCTGGATCACAAATAGGGCCTTTAATACGCTCACTGGTG
Ext2   E20   AX00005817   GTTTAGTGAATGCCTTGAATCCCTAGGAAACGAAACTCTCATTTTCTCCCAAGAA
Ext2   E22   AX00005818   AAATGGACCTGGTAAAGAGGGAACTGTAATTCATGCAACTTTTACGCTAAATGG
Ext2   E24   AX00005819   AATTTAGCGATATTGGCAAGACAGTTCAATCAATAAAACGATCATTAATTGCATC
Ext2   G02   AX00005820   ACTATTGGCTGTGAGAGAGCGTCACTAAATAGAATTGGTAAAGATGTATATTACA
Ext2   G04   AX00005821   TAATCAGCCGATGATTGCACTCATTATGTGGCAAAATGGCGCTAACATCGGACA
Ext2   G06   AX00005822   TGGTTTATTATAAAGGGTGAGCAGCCAGAAGGACTGATTGTTGCGAATGATACT
Ext2   G08   AX00005823   AATGTTTATAGAAGAGGACCAGATTATTTTACGAAAATATCAATCTCCAAGAGCT
Ext2   G10   AX00005824   GAAATTTGACATGTTTTTAGAACTCTTACGAACAACGCCTACTTATAAGGTTCCA
Ext2   G12   AX00005825   TGTCTCCTTCTGTAGCGATAGCGACTAATAAACTACAAGGGAGTAGCGGAACTC
Ext2   G14   AX00005826   ACCAAAGGGCGATACAGTCATTCAAAGTGATGCTTGGATTGGAATGAATGCTAT
Ext2   G16   AX00005827   GCGCCTATTAAAGAGGGGGGAACTATTAGTAAAATGATTATCTCTCCTAAAGATA
Ext2   G18   AX00005828   AAAGATAGTAGGCCCCCTTATAGGGGGCATGTTGTTGAGCTGGTTTCAACCAGA
Ext2   G20   AX00005829   TTTTTTGATTTCAGTAATGTGGAGAATACAAATTTGCTTGAGGAATGGATTGAGC
Ext2   G22   AX00005830   CACGAAGTTCTAGTCACTCATAAGACAAGGATTGATGAGGTACTATTAACGGCA
Ext2   G24   AX00005831   GTATCAAAGCTTCCTTTCTCGTTATACAGGACAGGACGACATTATAGTTGGAAGC
Ext2   I02   AX00005832   TGCAACAAATTGTCGAATTCCTTCCTAGCGCATTACCTGTAAGGGATTACTCTCA
Ext2   I04   AX00005833   AACATCATTCCGTTATCAACCGCCTACAGTGGATGCAGAAAAAATACCCATTGTC
Ext2   I06   AX00005834   TTACTAGGATGGATACCTAAAGACATCAAGACAGTTTGCCTAGATAGGGACCAA
Ext2   I08   AX00005835   TTATTAAATTCATGCGACATTAATAGGACCCTGATAGGGGATTTACTAATCCGAT
Ext2   I10   AX00005836   AAATAGTTATGCAGATAGATGATTCGCCCTACATTCTATTCGGGCATAGCATGGG
Ext2   I12   AX00005837   TATCCCTATGATCGGTTTAAAATGGAGATACAGCCTGTAATTAACAAGTTTGAAA
Ext2   I14   AX00005838   ATTTTATTAGGAATTATGTATCAAGAGAGTAGAGGTGAGGGAAACGATCCTATGC
Ext2   I16   AX00005839   ATTCGGTCTACGTGCATATGATGGAGATCCGTTTAAATATGCGAAATATTTACCA
Ext2   I18   AX00005840   AGATTCCCCTGGTAGTACGATGCACGATTTTTGGGAAGTATTTTTGTTTATTCAG
Ext2   I20   AX00005841   GTTCATGCAACAGTCGAAGACCTGGTAAAGTGGGGAGAAAATTTAACTACAGGT
Ext2   I22   AX00005842   CCAAATATAATAGTTAGAGGAGCATCGAAAGCCCAACGAGAAGCATGGAGTAAC
Ext2   I24   AX00005843   GTTCTAATCCAGAAGTGGCTAAATTTCAGTCATGGGTTAATTATCAATATCATGA
Ext2   K02   AX00005844   ATATACGAATGAGCGGTTGGATTTGGTTTTATCGGGACATGCTCATGGAGGGCA
Ext2   K04   AX00005845   ACATTGTAATGATGATTGGTGGAAATCTAAAGAAAAGTGTCATCGTGATGATAAT
Ext2   K06   AX00005846   TCTGTCAGTTGTGATGTAGTTAGGCTTGCGGCTATTCCTGGATCGGTTGGAGTA
Ext2   K08   AX00005847   ATAAAGACATCTCTTGGTTTGATCCAGGTAAATCACATTGGAAATCAGATGATTT
Ext2   K10   AX00005848   TTCCAGGAGTTACATTAGGACCCTACTTATATTCTCAGTGGGAAAATCATTTACA
Ext2   K12   AX00005849   AAGGCAAACCTGCTGGCGTAATACTAGGTGGTATAAAGGATTATGAAAGTATTA
Ext2   K14   AX00005850   ACCAGGTACATACATTGTGGAATACATGGTTGTTGATTCTCAAGGGCGGAATGC
Ext2   K16   AX00005851   TAAGCACCTTTTCAAATAACAGTGACTCACTTCATATAAGTCATAGCAGCATCTT
Ext2   K18   AX00005852   GAAGTGGCAGGACCTCCACATGTGAATCTAAATCCCAATACGTATACAGTGGAT
Ext2   K20   AX00005853   TATAAAACTGCCAATCTATCAAGGGACCTCTGAGGAAGTATTGAGTCGCGGGAT
Ext2   K22   AX00005854   ATAGTTCCTACATCACAACCATATTCTCCTAATTCCCCGTTTACTGAGCTATATG
Ext2   K24   AX00005855   AAAAATGGATGCCCAATTTACAGATTGAAAGCCTTAAAACTGCTGGAATAATAAA
Ext2   M02   AX00005856   ACATTTGCTTTATGGAGTACATATTGGCTTGCTCCTGGAATTGCTTTCGGAATCG
Ext2   M04   AX00005857   TAATGTCTGGTGCATTTAGTCAAAGACCACTTAAAGGCGCTCCTGCTTATGGAG
Ext2   M06   AX00005858   AATGGAAGTCACTCATTTTGTTTATTTTGCTAACAGATGGAATGAAACGTTTTGG
Ext2   M08   AX00005859   TCAAGTTGTCATGCCCCGTTTCTGGCATCTGAGTTAGCGAAAGTAATGAAAAAG
Ext2   M10   AX00005860   ATGAGAAGCTACCGGCTAATATTGTATTACTTCGAGCTACAGTCCCACAAGTTTG
Ext2   M12   AX00005861   GGGTAGATGCTAGTTCAGGGGATATTCGCGCAGATGTATTTCGAACATATTTGT
Ext2   M14   AX00005862   TATCGTGGGTATGGGTTCCAGTTTAATATTCAGTTACATTTTTGAACCTGCAACT
Ext2   M16   AX00005863   TATCGTTAAAACAATCGCAGGATCGATAAGCATTGGGGCCGAGTTACCACAGTA
Ext2   M18   AX00005864   AAGCTGTTACTGAGTTACCTGAATCGGTTATACTTCGTTACGGCACATTATACGG
Ext2   M20   AX00005865   TGTTTTGAAAATGACAGGTAGTACATCTGTGAGCCAAATGACAAGAGCTGAAAT
Ext2   M22   AX00005866   CCACTTTGACGGACAAAACAACTTGCAAGTACTTGACCTTGGCTCTGGCGTTGG
Ext2   M24   AX00005867   GAATCCCTTTACTGGAGAACAAATATTAAGCATTCCAATTCCCGCGTTATATGTA
Ext2   O02   AX00005868   TATATTGGTATGCCATACTGTGATATTCCAGATCCGTATGGATGTCATAACTCGT
Ext2   O04   AX00005869   GAATCTACTGCACAAGCGATGATGAATGCAAAGCTTTTTCGTAAACGTGATCAAG
Ext2   O06   AX00005870   GATATTAAATGGGTAATTCCAGAAATTTGGAAAACTATTTTGCTAGATGTTCCTC
Ext2   O08   AX00005871   ATATCCATATTACTATATTGAAGATGCTGCTCGTCGCTGTGGCGGTTGTGGTCG
Ext2   O10   AX00005872   AAACAATATGGTTCGAGTACAAGTAGGTCATTTGTTCCATTATCGCAGTCTTCTA
Ext2   O12   AX00005873   GCTCATTCACAAGAATCACGATATCACATTGGATATCTACTTGCAATAACTACAG
Ext2   O14   AX00005874   TATCTTAGTAGTTTTCAATTGTACTATATGGGGCTTGCGGTCGGAGGAGAAGAA
Ext2   O16   AX00005875   GCATTCCCAAGTCGTGAAACCATAGAAAAGATAGCGAAGAGATTTAATGTACCT
Ext2   O18   AX00005876   AATATCGCTGTTTGTAGAATGTATGAATTAGCAAGTCATCCACAGTTTCCAGTGA
Ext2   O20   AX00005877   TTGGTGGTATTAGATGATCTTGGGGCAGAAAGCGGGTCAACTGATTCGAATAGA
Ext2   O22   AX00005878   ACGAGTGGTTGTAATTGCGAAGTAGCAATCCAGCAGCAAGAAGAAAACGATAAG
Ext2   O24   AX00005879   AAAGGAATCAGACAAAGCGTATGAAAATGGCGATTTAGGTTTATCAGGATACTTA
Ext2   B02   EMPTY        -
Ext2   B04   AX00005880   TTCCAATTGACCCCCTAAATTTAACCAGCTTTGCTATTACAGAAAACATCTTCAAT
Ext2   B06   AX00005881   ACTGGCATTACTGGACCGACTGGTGTTACTGGTCCTGCTGGTGTAGGTTTAACA
Ext2   B08   AX00005882   TGTGACCTTTAGTAATGCGAAAAGCTTCATACAAGCTGGAATTATTATGGTACTT
Ext2   B10   AX00005883   AAATCTGGAGTAAAAATCTATCATTCGTAATGCTCGGTTTAGGGATAAATATAAT
Ext2   B12   AX00005884   AAGCTACTACATTAGATGAGATAGTACTGCAAGAAAATGAGTTATATTGTGTAGG
Ext2   B14   AX00005885   ACTTGCAAACAGAAGTGATGAATTGGTCAAGAACTACATGTGTGAGGATGATTT
Ext2   B16   AX00005886   ATTCGGAGTAACTGTTAATCCTGAGAGTATGATCTTGGGCATGGACTTATCAAG
Ext2   B18   AX00005887   GGTAGAGCATCAGAAATGACGAAATATGTTCGTAACTTTTATGAACAAGGCTATA
Ext2   B20   AX00005888   GAGAGAATGGATGCTGTCAACGATGTGGAAGGTTCGTCTTTGGTAGACGTGCT
Ext2   B22   AX00005889   GGTTTTGCTCCTACAAAAACGCATAAAAACAAGGCTGGAGCAGTAAATGAAATG
Ext2   B24   AX00005890   CGTGAACAACCAATGATGCTTAATATTTCAACGGCTGGTAAGGGTGCTTCATCT
Ext2   D02   AX00005891   TGTTTGGTTGACCCAGAAAGGGAATAGGACAACTCAAAAAAATTTATTAGAGCAG
Ext2   D04   AX00005892   TAACATTCTTGCTAAACTTGGATGCTCATATCAATCCACAGAATGGCGCGCAGTC
Ext2   D06   AX00005893   GTGGACAGAGAAAGTCGAATGTTACCTTCTCCAAGGGGATATTTCAAAGAGAGA
Ext2   D08   AX00005894   CAACGTTCCGCTATTTCAGCATCTATTGCAGCGGCTCTTTCTACTAAAGGTCATC
Ext2   D10   AX00005895   AGGTCAACGATATGTAAAAAAAGCATGTGGAAGAGAAGTGGAATACCTGGTCAT
Ext2   D12   AX00005896   TAGGAGAGACGATTGATCCAGTAACAGACCGTGTTGTGATGGGATATCCATTAG
Ext2   D14   AX00005897   ACCCTTATATTGTGTATGAATTTGTGAATGAGCAACATAAGAGGGCTTCTAATAA
Ext2   D16   AX00005898   AGAAGCTAAGCGTAATAACGTACAGTTAGGAAATCATGCAGCTAGTATGGGTTT
Ext2   D18   AX00005899   GTTTGGATGCGTTAGATGAAGCAGCCAAGTATTTTGCTAGTAAATTAAAACCAAA
Ext2   D20   AX00005900   ACAAAAATATTACGTTGGTACCCAAAATGTACAGTTGCTCCAGTAGAGGAATCTT
Ext2   D22   AX00005901   CGTAGTGGTGGTACAGAATGTACATTAGATGAATTGAAAGGTGCTATTCCTATG
Ext2   D24   AX00005902   CATTTGGTGCGTTGAATCTGGCGTTTTTACCTGTGATAGCTACCATTGCGGCAG
Ext2   F02   AX00005903   AAAACCTTGGTTGTTACAAGGGAGAACACTCTTTTTCACAGATGACGAGGTGTA
Ext2   F04   AX00005904   GTACATTAAGTGGGAACTTTGTTCGAGGGGGAGAAATAACAGGTTCAACATTAC
Ext2   F06   AX00005905   AAAGGACTTGATGGCAATGGATACTTGAATGCAGCTTCTTTATACTTTTCACAAA
Ext2   F08   AX00005906   CTTTTCCAGCACTGGCATATGGATATACACCCGCAGTTTGTGAAGTTACAATAAA
Ext2   F10   AX00005907   TTAAATGCCATGAATGAGCGGGGAATTAAAGGAAAGGTTATATCTGATCCTTTAA
Ext2   F12   AX00005908   GATGAAGGAACCTGACTTCCCTTTTTGTCTTTCTTGGGCAAATGAACCATGGAC
Ext2   F14   AX00005909   AGAGTAAGTGGGAGAGCTAATAGACTAGCAAGTATAGAACCTCCTAAGGAGTAT
Ext2   F16   AX00005910   CACATGTATATTGGGCTTTCGGAGGTAATTGGGGGACAAATAGTGTTATTCCAA
Ext2   F18   AX00005911   TTTGCATACTACCTGCTATTGCCTTATTCGTTACTTTCGATGTCATCTTTGAACTA
Ext2   F20   AX00005912   TCTTCGCCCTGGTGGAATCTTCATCGCAACAACACAAGCGCGCTATTTTCTTGA
Ext2   F22   AX00005913   AAGAAAAGAACCTAACTTAATTTTAAAAGCGATTGAGGAAGTATTACGCTATCGC
Ext2   F24   AX00005914   TGGATTATCGGGGGATAACATACAACTAAAAGAGGATGAGGTATTTATTAACGG
Ext2   H02   AX00005915   AAATGCATACGTCTTTCTTAGTAAAAATTACACACCAATAGCTGGCGGAGCTTGG
Ext2   H04   AX00005916   TTCACTAGACCAGCTGCACTTTATTCCGGAAGGTCAAATGATAACGAGAGATAA
Ext2   H06   AX00005917   CAGCTCGATAAAATTATCGATTACGATGTAAGTCAATTCTCTGTGACGCGAAAGA
Ext2   H08   AX00005918   CAAATAGAATTCAATAATTTGAAAGTACATAATGGATACTTGCAAGCTGAGGTTC
Ext2   H10   AX00005919   AGGATATAGAATCCATACTCCGCACTATTCGCGCTGGGTATCCACAAGGAGCTT
Ext2   H12   AX00005920   CTACAATGACTCCAGAGGTTATTAAAAGACTTATGGAACGCCTTATCCCTGAAAT
Ext2   H14   AX00005921   AGTTACAAAATGGTCTTCTAGAGGGTAAAAAGGATGTTTGTAAACTTGTGCGAAA
Ext2   H16   AX00005922   GAGTTCCACCCACGCTACTTCCTGGAATCTACAAATCTGTATTCACAATTGAAGA
Ext2   H18   AX00005923   GCATGGAAACGCTTGTACTCCGAGTGGGTCCCAACCTCTAAGTATGAACTTGCA
Ext2   H20   AX00005924   AACCCTTCCCTTATTCCTTCCGCTGTTGACGAACTATTACGCCATTCCGGCCCA
Ext2   H22   AX00005925   TCCAACAGGCTCAACTGAAAGTTGCCTTTGTGATTGCTGCGTTTTACCTATGCAG
Ext2   H24   AX00005926   TGTGGTCACATCAAAAAAGTATGATGTGAATATGTTAGGTTTGTTAAATGGAATG
Ext2   J02   AX00005927   GGACCTGAAGGTAGCTGTTTTAAGATGGGTGGTGAATTCGAACTTTTATTACAA
Ext2   J04   AX00005928   TCGTGGGAAGGATAACAAGTGTGTTGGAATGTTAAACGGCGAACAGACAGTGG
Ext2   J06   AX00005929   GGCGTTCAGTCTGAAATATGTATAGACGCGACGTGTCGACGTGCATATAGCTTA
Ext2   J08   AX00005930   ATACAACTAGCACAATTAAATCAATTGAAATCTTGCGTATACAATATAGGGAGTG
Ext2   J10   AX00005931   TCCAAATACCACTAGAACCGGAGCGAATCAAAGGATCTCACGGTTTACCAGCAA
Ext2   J12   AX00005932   AAGGCATATTATTAGGCATGATTACAAATGGATTCACTGATTTTCAACTCCTAAA
Ext2   J14   AX00005933   AGAAAGCTATAGATCAGTTAACAGAGCGAGATTTACATTGGCGTCCTAACAGTG
Ext2   J16   AX00005934   GTGTACGTCGAAAAGTTTATAGATCATTGGAATCAATATGGCTTTGGTGTATGGG
Ext2   J18   AX00005935   GGTACAATGGATAGCTATATCTATTGGAGAATCGGCAAACATCTTCGACAGCTC
Ext2   J20   AX00005936   AAATTGCTGAGAAATCATGGCTTGTACGTTTAGACTTCCCAAAAGCACCTGGAG
Ext2   J22   AX00005937   GCTGCCCCTCTAATAATTGATCTGTCCCGTTTTATGGAGCATGCACTTAGAGAA
Ext2   J24   AX00005938   TGAACGTGGAGAAAGGAATATTTCCATGCTTACTCTGCAAAAAATTGCTGTTGGC
Ext2   L02   AX00005939   GTGGGCTGCATGGGGACAATAGACTTCAAAATTTACGTACACTTTGCAGACGTT
Ext2   L04   AX00005940   TAACAGGTTTCTTCCACCTATTAGCGAAATAACAAGGGATGATAAAAGAGATGTG
Ext2   L06   AX00005941   CGTTGGCTGCAAACATTGTATAACGCTGTTTCACCTGGTGGTTTATTCATTTTCA
Ext2   L08   AX00005942   CTATTGGACTAGGATGACGATCATCAGCATAGCTTTTGGTTTACCAGATATAGAC
Ext2   L10   AX00005943   ATAGTTTTTGGATCTATTATGAGCCACAACCTAAGTACGGTCTATGTTTTAGGAC
Ext2   L12   AX00005944   GGAGAAGCAAGTTTATGGGTTCGTATGAAGAACCGTGTTTTAATTTTCTGGCCA
Ext2   L14   AX00005945   TTAATTCCGGGAATAGGAGGTGGTGTAGCTACATTTGCCATGTTATTCGCGAAA
Ext2   L16   AX00005946   TGTTCTTATACACGCGGTATATTACCATCCGCGTCCGTTCGTATCACATGATGTA
Ext2   L18   AX00005947   CCAAACCTACCCTCTTTACGAACTAATTTTCTTAGACGATGCCTCCACTGATCAT
Ext2   L20   AX00005948   CCAATCGGTTTTCCTTCTAATGTTGAAAATCTGAATCGCTCGGTCAATATAATAC
Ext2   L22   AX00005949   TGCGCCAACAAAATGGGCGTTAGAATCTATTCAGCCGTTTACTTTGTTATTTATT
Ext2   L24   AX00005950   CCAATGAGTGTTTGGTTATGGGATGAGGAGCAAGAGCGGGATATAAAAAGCGA
Ext2   N02   AX00005951   AATATCGCACATAGAGGTGCTTCTGCGTTCGCGCCTGAACATACAATAGCAGCA
Ext2   N04   AX00005952   AACGTGAATATGTTCGTAAAGGAGCATCACAAACGATGCGCTCATATCACTTAG
Ext2   N06   AX00005953   AAAAATTGGCTCCATCACCACATTAGAGGCATGTTAGGTTCTTATATTGGTGCAG
Ext2   N08   AX00005954   TGCTCAACCGAAGCCAGTGCGTAATCAAAATGCATATAGACACATGATAGTGGA
Ext2   N10   AX00005955   GAGGATGATATATACCGAGAGTTATGGCTTGATGAATCACCTCCAGCTCCTTTA
Ext2   N12   AX00005956   AACTTAATCCATCTATGGAAGGACCTTTGCTACATGATGTGGTTGCAATAAGCGG
Ext2   N14   AX00005957   AAAAACCGCACCAATAAATGAGTTCTCAACATCATGGCATCATCAAACTCCCGCC
Ext2   N16   AX00005958   CGCTATATACGATGGTGACCTTATGGTTGGTTTTGTTATGCATGCTGTTGTAATA
Ext2   N18   AX00005959   ATAAAATTGGAGCATGTAAAACGGGCGAATATGACCATTGTCTTTCCTATAGTTC
Ext2   N20   AX00005960   ACCGAAATCTAGCGAGTCTCATTTAGCATTTCACTGGATAGATTATAATAAAGAA
Ext2   N22   AX00005961   AAAATTGTAGGTGGAATAACTGCAATTACATTTTGGCACCACGTACATGTTGATT
Ext2   N24   AX00005962   CTTATTTTTTTAACCGGAACCAATTCGTTTCACTCAATCTTCATAAAAATATTATC
Ext2   P02   AX00005963   CCTGTTCTTACTGGGGTGCATATAGAGTTATCTAATAATAAGTTAATTTGTGCTG
Ext2   P04   AX00005964   TAGTAGCAAAAAAACCGAGCACCGGACAAGCTTGGATAAATGCCAATCGTTTTA
Ext2   P06   AX00005965   AGGGAAGAGCACCTCAGAAATCGCCATGCTTGCTAATGTGTCTGCAAGGTATAT
Ext2   P08   AX00005966   AGAAGAAAGAAGTACATATAATAGAATGCTACAGGGGAGGAGAGAGGAATAGCT
Ext2   P10   AX00005967   GTTTCAACAAATAAAGTGGTTAAGAAAATCGTTTTTCGAGTGGTTTCCGCAATAT
Ext2   P12   AX00005968   GCAAAAAAACAGAATACCATTCTATTCCTTATAAAAGTATTACACAATATAGCATC
Ext2   P14   AX00005969   AAGACTATGAAACAAATCCAGCAAATGAAACTATCGAAAAAACTATTTGTAGAAT
Ext2   P16   AX00005970   TTTCAAGCAGCTGGGAACTTAGTTCCTGGTATAGGTTTGCTCATTAGTCCATTTT
Ext2   P18   AX00005971   AGCGGTTATGATGAACGCGGATTGCTTGGACTTGCGTTCCATCCACAATTTTAT
Ext2   P20   AX00005972   AGAGAATATTTTTCAATATGCTAGTCTAACAGATCATGCTATTTATCCATATTGGG
Ext2   P22   AX00005973   CGTAGCAATTGTGATTTCCAGTCATCAACTGTCTGAGATTGAGCAGATGGCACG
Ext2   P24   AX00005974   CTGATGATACGGTGGCTCAAATAGTAAATGCTTTGCTTGGCCTATCGGGAATGC
Ext2   B01   EMPTY        -
Ext2   B03   AX00005975   TTGATATAGGTATAGCTTCGTTAGTACCTCTTGTTCCTGTACCTTTTACTGGCGA
Ext2   B05   AX00005976   AACGCAGAATATGCCGGATGTTTATTCCACTTAAATAACAAAACCATTCGTTTTA
Ext2   B07   AX00005977   CCTGGAATGTCACTCTCAATACTTGCTGATGGTGAAGTGTTCTACTTTTCTTCTG
Ext2   B09   AX00005978   AAAATGAATACATGCTTGGACAATTCAACTATAAAAGCTCGATTCAATCCGGTGA
Ext2   B11   AX00005979   AACAGCATTCTTTTGGATTGAGGAAGGGAAAAGTTGGCTAGGATTATGGGCGGG
Ext2   B13   AX00005980   CAAGTTGGAGATATTGACGTTTCAAAAGCTTTACCAAGCAGCCATGTTTTCTCAT
Ext2   B15   AX00005981   GTACGATTTTTGCTATTTCGTTAATACTTAGTAATTTAATTAATCACATTACTTGG
Ext2   B17   AX00005982   CTTATTCGCTTTCCGGCCTCAACAATTGGATCGGCATATGCCATGACTTTCACAT
Ext2   B19   AX00005983   AAAAACCAAACAGCAACTTCTTCTACTGTGATGGAAAGGCAACAGAAAGAGTCT
Ext2   B21   AX00005984   ATTAAGAAAATCACTTGGAAACAAGCTGCAAGTTGGCTTTTATTCCCATTTTTTTA
Ext2   B23   AX00005985   AAGAGTCAAGTAGGGCGCAATTTGAAACATATGAACATGTGGGCGCATATGGAT
Ext2   D01   AX00005986   ACGTATAATGATCCAAAATCAAGTTAGAGCATTCCTGCAATTAGCAAATGAAGAA
Ext2   D03   AX00005987   AGAAAAAACTTCCGTCAAATGTCGTTCAGTTACACAAGGCATCATTACACGACAG
Ext2   D05   AX00005988   TTTACTTATTTAGGTGGGACGTTAATCTTAAGAGCATTGATGGAATGGAAGTATG
Ext2   D07   AX00005989   AGTACGATTTGAAAGTTGATGTTCAAGAGTTAGCAATTGTAAATGAACAGATTTT
Ext2   D09   AX00005990   ACTTTATACTGCCTTCAATCATTTATGGAGTGGAAATTTGATAAAGAATCGAGGG
Ext2   D11   AX00005991   CTGCTTTACGTTGGACATGTCCACTGGGATAGTGAAGAAACATACTTGGGTTAT
Ext2   D13   AX00005992   CGATGAAATCGGAGAGCAATGTAAACATATTTTAGTTTATTATCATGAGCTTCCT
Ext2   D15   AX00005993   TCGTTTATTTTTCAATAGAAGCTTTCAGGGAGCGGATTGAGAAGACAGGTGCTA
Ext2   D17   AX00005994   AGAGATTCATGACGTTGGCCAAAAAGAACCGAATGCATGGGGACTTTATGATAT
Ext2   D19   AX00005995   TCTAGATTTCGCAAATCCATATAACAGTTATTATGAAAGACCGGCGATGATGGAG
Ext2   D21   AX00005996   CATCTTCATATCGACTTTTTATGGGTTGACGAATCAGTTCGTCATGACGGTTATG
Ext2   D23   AX00005997   TAGACTTACAAAATCCGTCTGGCCATGCGTTATCATGCATGCGATTGAGGATGC
Ext2   F01   AX00005998   TTATACCGGACAAGTATTTCCTTTCTTAAGTGCAAAAATAGGAAAAGGTCTTCTA
Ext2   F03   AX00005999   ATCCAAGTGAACTATCCCTAATTGAACTGGTCAACAAATCCTGCTCGCGAGATTG
Ext2   F05   AX00006000   GCCCCTTCAACGATTTCTGTTTGGAAAAAACAGCTCGAAACACAAGGAATTGATG
Ext2   F07   AX00006001   GGCTACCGTCGCATTCGTGATGAGTTAACGAATCGTGATCAGAAAGTGAATCAC
Ext2   F09   AX00006002   GTGTGATTTAAATAAGCTGATTGGAAATAAGCCGTTAGCTTGGTTTACAAATCCA
Ext2   F11   AX00006003   ACGTTTTAGATAGGCAAGTTAAAGATGCTGTGGCGGCTAAGTTAAGATCCCTAG
Ext2   F13   AX00006004   GTGTATATTAGTCCGTTCGGAAAAGCATGTCAGGCGTACGCAACTATGTTTTTC
Ext2   F15   AX00006005   ATCATCCCAGCATCTGAAGGCTATAATTATGTCGGCTGGAAGTTATTTGTTGGG
Ext2   F17   AX00006006   TAATTACTCTTTGTGACGCTCTTGCTGATGCGGGTGGCTTTACTACGCTGGAAA
Ext2   F19   AX00006007   AAGTCTTCTGTGGTTCTGAAGATTTAGTTATGGAATCATATTTAGTTGGTGCCTC
Ext2   F21   AX00006008   GACATTAAGAGTTCATGAAGATAGCGGAACACCGCGAGGTATTTATTGTAATATC
Ext2   F23   AX00006009   CATTCTAATCCCATCGAAAAGTTTAGTATCGCTTATTAGTGATAAGAAGGTAGAA
Ext2   H01   AX00006010   TATCTCCTTGACCCAGAACATTGGAGGAATGGGTATGCATTAGAAGCAGCAGAG
Ext2   H03   AX00006011   TTCGTAGCATTTATCCTTGTTAAGGATACAGGGGAAATTGTAGATGCAGACTGC
Ext2   H05   AX00006012   TAAAAAGAAGTTAAGGCGTCTTATTTTAATGGTCCTTTTTATTGCAGCAACTACTC
Ext2   H07   AX00006013   TCAACGAAAGGTGGTTTAATCGGACACCACTACGACCCTAATGGAGTTCCTGTA
Ext2   H09   AX00006014   CTATTACTGGCGAAAGCAGGTTTACTGGAAGGTTTAAAAGCAACAACACATTGG
Ext2   H11   AX00006015   AAAGGCGAGTCCAAGTATTGTTAACGAATGTAGTGAAGATGGATGGACACCACT
Ext2   H13   AX00006016   TGATTTTTACGTATATATGGGCATTTGACCTCCAAGAGGATTGGGATTATATACA
Ext2   H15   AX00006017   ATGGGCGATAATTTTAATACATATATGGAATCCAATGGTGTGAAAAATGAAGATC
Ext2   H17   AX00006018   AGGATCCGTACACAAAAGACAATAAGATTGGGCGGTTAAGGAGATTTTATATTTC
Ext2   H19   AX00006019   CCTCGAATCCTCATCCATCTTTTAAAAATGCTAGCGTTTCAGAAGCAGCTGCGC
Ext2   H21   AX00006020   CGAGTTCCTGAGCCAAAAAAAGAGGATTGTGAGCCAAAAAAAGAGGATTGTGAG
Ext2   H23   AX00006021   ATCATAGAAGAGAGGGCTTGGCAACTGTAGTAAGTGCAGCTCTTATATTGGATT
Ext2   J01   AX00006022   GTTCAAGTACCTGAACTGGTAGGTTTTCGATTACTTTTATCACATCTAGCTGGAG
Ext2   J03   AX00006023   GTAAAGGGAGAATATCACTCCTGGGTGGATTCAATATTTGGTCATAAGGTTGAA
Ext2   J05   AX00006024   AATTGAAAAAGCGTGGGGGAAAGCAAATAAAACCGAATATACAGGGAATGGAAT
Ext2   J07   AX00006025   TTGGGTTGGTTCGAAATTACTTGGTAGTTTTGGTCCAGTCATTGGCGGATATGC
Ext2   J09   AX00006026   CCCTGAAATCCACGGGGATCACGGTTTAGGTCCTATTATTCCACCTGAGATGAG
Ext2   J11   AX00006027   TGCCGGACATTCCTGGATTTGAAAAGATACATTTGAGAGAGCCGAGAAAAGGAA
Ext2   J13   AX00006028   CAAAACGTTAGCAGTGGAACACACGAATATTCATTAACTGTAGAAAACCTTACTA
Ext2   J15   AX00006029   ATATACGGTTCTTGGGAAGTCGTTGACAATAAAAATGGTGAATGCCCTGTATATT
Ext2   J17   AX00006030   GAAAAGAAAGTGCCGAATTAGCTGCTGAAGTAGTGAAGGAGATTCCTAGTTTTC
Ext2   J19   AX00006031   AGATTTCAATGGATTGGTCTCATGATTGGTGGGTCGCTTTTCCTTTCAACAAATA
Ext2   J21   AX00006032   AAGAAAAAAGGCATATTGATCTTCAAAGTCTATTACATTTGGTTGAGCATACAAG
Ext2   J23   AX00006033   ACGTTGGTAATAATTCAGATGTGGTTGCAATTGTTAATCATTTACCCGGTGGTGG
Ext2   L01   AX00006034   ACTGCAAATGATACTAAGTTAACAATCCCAAAAGGGAGTTATACAATCGCATATT
Ext2   L03   AX00006035   TGTATGCCCTTCCAATTGTACCAGTTGCGCCGAAAGAAGTTGTGCTTGGGTCAT
Ext2   L05   AX00006036   AGCAGTTCCGTATTATGAGCAGGCAATCGCAAATGGACTTGATGGCGAATCGCT
Ext2   L07   AX00006037   TTTGCGGAGAAACCGAGTGATGTACATAGAGGGTTAGAATTACATCCATTTGAA
Ext2   L09   AX00006038   GAAGCAGTACGTCAAGAAAACCCTCTTGAACGAGTTGCTAGTAATCTTTCATCC
Ext2   L11   AX00006039   ATGTAACAAAGCATTTAGTTTTACCAGATCAATATCCTCCGTTCACTCGTGGAGA
Ext2   L13   AX00006040   AAGATAGTGAATCGATTAAGTAATATGGGCTATCATGAGGTAGAACCTGAAAACC
Ext2   L15   AX00006041   TTTCGGATCGGAAATGGGTAAGTTTTATGTATAGTTATCCCAATCTCATTCCATT
Ext2   L17   AX00006042   TATGGGGAACTATCGGGGCAATCGCGATTAGAGCCCTCGCTACCTTAGTTGTTG
Ext2   L19   AX00006043   AATATTCGTGAACAGTTTAGTCATACGTACAACCGTTTATTTGAATTTGCGAGAA
Ext2   L21   AX00006044   ATACCATTCCGATTGGTTACATACAAATGTACCCAGTGGATTCAGAGTGGAAAG
Ext2   L23   AX00006045   ACTGAATGGTTCACACTCTATACAATCCCGCAATTTAACGTATTTACAGCATTTT
Ext2   N01   AX00006046   ATGATGATCTTCCAAAGGATTTGGCGTGTCCAACTTGTGCGAAAGAGATGAAAT
Ext2   N03   AX00006047   TATAATTGATTGGCTAATTTTTTGCTGGATTACTCCAAGGTTTGTTGTGATTCCTA
Ext2   N05   AX00006048   CCTAATTTAAACATAACCGGCTATACTCATATGGCTTTTTCTGTCGGTAGTGAAG
Ext2   N07   AX00006049   CGCTTTCAGGTATGCTAATTGGGATTTATACGTTAGATGAAACGCTTAGTGTAAA
Ext2   N09   AX00006050   TGGTGCTAAGCGACCCCAAAGCATTTAAGGGGAATAAGGAAGTGATGTATCCAG
Ext2   N11   AX00006051   AAACGATGCTATCATCGTTACGATCGCTGCTGGGAAAAGTATTGAAAGTACTGA
Ext2   N13   AX00006052   GGAAAAGGAAATCAAGAGCCAATTGTCCAAAGGTGGATGCCTGCTGCAAGTGTA
Ext2   N15   AX00006053   TCGTTCAAAACTAGGTTCAAAACCATATGCAATTGATGGCACGAAATCTTCTGTT
Ext2   N17   AX00006054   CGAACGATATCGTCATAGCTTTGATGTCTTTCCTGATTCTAGGCGAACTCAACCG
Ext2   N19   AX00006055   TATGGTTACAATTGACGATGGCTTTCCCCGAAAGCCCAACTCTTTAGCTTATAAT
Ext2   N21   AX00006056   GAATACACAAATGAAACGATGAATGCTTTTCATATGGCTTACCAAGGACCTACAT
Ext2   N23   AX00006057   TTTCTTGGACCATCAGAATCTAGAATTCCTTATATATTTAAAGGCATGATAGGAT
Ext2   P01   AX00006058   GTTAAGAGGAACCTTGAGCAATCAAGATCAGGGGGATAAATTTGTTATTGATGT
Ext2   P03   AX00006059   GCCGATTGGGCAAGCTTCATAGCACGCCCACAAAAGGACAACAAGTTGTTACAG
Ext2   P05   AX00006060   TAATCATACTTTTCTTTGCGATTAGTGCGATAACGTTATCACAAGGTGTTGTGTA
Ext2   P07   AX00006061   AGGCTGTTGGATTGAGTTAAGCACCTCATTGTCAATATACGACAATAGGTGCTT
Ext2   P09   AX00006062   ACCTGGATATGTGGGGTATTGGAGCTTTGAGACAGCTGCAATAGTAAAGATACT
Ext2   P11   AX00006063   AAACTAGAGCATTTATATGAATTCAATCATTCATCCAGCAACAACTACAGCACCG
Ext2   P13   AX00006064   AATGCTTCAGATAGAATGAAAAGTGCTACTAGTCGCTCTATAAATAAGGCAACGC
Ext2   P15   AX00006065   ATACGCATATGCATAGCCTTTTGAAAGACTCCTATACCTCCCGTTTATGGGCAGC
Ext2   P17   AX00006066   ATACATGCCTTTTGACTGTTTATTATTTTTTGCTGATGGGGGAAATGGTGATTTG
Ext2   P19   AX00006067   TGGAAATAATAATGTCATTGCAAGAGGAAGGAATAGAGTGCATCCAGAAAAAGA
Ext2   P21   AX00006068   GCAGCCGAAAGGTGTGGAAACAATATATGTTGATTCCGGAGCAGATGCTGCTG
Ext2   P23   AX00006069   TTTTTACATGACGATTTTCATCCGGCTAATATAATGATTGACCAAAATGAGTTTCG
Ext3   A01   EMPTY        -
Ext3   A03   AX00006070   CCGCATATTGTAGGGCATGTAGAGAATGTGAAACAAGATGAGGCTTTATTACCA
Ext3   A05   AX00006071   ATATTACTTGTCCACACCCGAAAGACGGCAATTGTCTAGAGTATGAATTGACATT
Ext3   A07   AX00006072   TTGCTAGACGTGAAGATGGAAGATTAAAATTCATATCACTTATCTCTTTCTTTGTT
Ext3   A09   AX00006073   TGATTGTAGAAGATACCTCCATTAATGGAAATCCGCTTCTTCCCGATTGGGGTC
Ext3   A11   AX00006074   AAGATAAAGTGTATAAAATAGGGGAGACAGTAGACGTAGATGGTTTGCAAGTAA
Ext3   A13   AX00006075   GATATTGAAACATACGAAGAGTTTAAGGAAAGCAAGTGTGAGGTAGTTGTATTAG
Ext3   A15   AX00006076   AAAGCATTTCCACAACTTTGTACAAATTTATACGAACTTAACTGGCAGGCAGCCG
Ext3   A17   AX00006077   AAGAGTATATTCCATCGCATCTTATGAATGCGGAAGTGACGGCGGATATTATGA
Ext3   A19   AX00006078   CCAGACTGGTAGAGAAGTTCTTGCAAGAGCATCCGAAAAGTCTTCTGGACCTCT
Ext3   A21   AX00006079   AGTTGCTGGAATCGGCTTCTTTGGAATCGTTATCCCAAGCATTCTAATCTTCACA
Ext3   A23   AX00006080   CAGCATTATCCGTTTGCCGATCTCAGCGATGTTTCGACGTCCTATTTTTTCAAGA
Ext3   C01   AX00006081   ACAGGAGAATCGGTGGTTACTAGATTAGAAACTGTTAGACAACGGAGTGATGGG
Ext3   C03   AX00006082   CAACCTTGATTGCTGGTGGCATAATGATAGGTGATGCAAGAGGTAAGTTAGGTT
Ext3   C05   AX00006083   GTAATGAAGGGTGCTATTTTGGGTCTACCAATAATTGGCGGTATTATAGTCGGA
Ext3   C07   AX00006084   TCACCTTAATCAAGAGCTGTCACGAATCAATGCGAATTACTGGTTAGATACAGCG
Ext3   C09   AX00006085   CAGCCGCAGCCGCAGCAAAAACACAAGAGTATGACCTGATGAAGGTCATTGATA
Ext3   C11   AX00006086   TAATAGAGGATCCGCTCAGGAATCAAAAAAACCTTGGAATTATTGCGATTACCTT
Ext3   C13   AX00006087   TTTGAACTAGGAGTCACACTGGGACCTGATACATCACATCATCTGCAAATGGTT
Ext3   C15   AX00006088   CGAAAACCATGTCCTAAAGACCGCCGTGTCACGTATGCGTCAATTACTTCAGAA
Ext3   C17   AX00006089   AAAATAGACGATTTTCAACTCAGCATGTCGTTTAGTCCTGTTGCAGAGCGTCCAT
Ext3   C19   AX00006090   AAGGATTTACTTATTGAACAAACCGGATTAGCCCCATTTTTATTTCAAGCAACGC
Ext3   C21   AX00006091   ATGGCATTCATGCAATGGTTACCAAAAGAAGCCTACTTTTGAGACTGCAAGGGA
Ext3   C23   AX00006092   TCTTATCCTCGTTTGGACGAAGATATAAAATGTGACGTACTCATAATAGGAGCAG
Ext3   E01   AX00006093   TTTCGTTTATGTATTACGTTACAAGAGTTTTCTTATTTTCTCCGGAATGTCCTTTT
Ext3   E03   AX00006094   TAATAGGGAAATGGAACTCTATCCCAGCAAAAGGGGTAGCTAATGAAAGTATTA
Ext3   E05   AX00006095   TCTAATTACAAGGTTCATTGGGGCACCTCCACATAATAATATTTCTTCTAGTTCTT
Ext3   E07   AX00006096   AGTTGGAGATAGAGCAAAATTAAAAGTTACGATAGATATCTCTCCAAAACCTTTA
Ext3   E09   AX00006097   CAGACGCCTCTGACCGGTTTCGATCAGGAATTATTCATACCTCCTTTCGGAAGC
Ext3   E11   AX00006098   AAAGTGAAGCGCTTCTACTAGGGCGAGTAACCTATCAAGGTTTTGCAGCTGCCT
Ext3   E13   AX00006099   GTTGAAAGGGTTCATATTCTTTCTTGTGAAAAATCATGTCTGGGTCAATCTTACT
Ext3   E15   AX00006100   GAGGGATTATGCACACCGCTACGGTTTCCAGAAGCGGATAGGCATGTTGTCGG
Ext3   E17   AX00006101   GAGCATTTATAGAACATTGGGCATTTCAGTGTGGGTACTGTACGCCGGGGTTTA
Ext3   E19   AX00006102   CAGCACGGAACAAAATTACTTTAGGTGGAAACATTGCAGGGGAAATCTGTTATA
Ext3   E21   AX00006103   AGTAGAATTTATAGAAACTCCTCATGACGATTCTCCGTTTGGTTCCCGTGCTCTT
Ext3   E23   AX00006104   ATAAGGGGCACACAATGCTGGAGCACTCTGCTAATTCATCATTAGAAGAACGTT
Ext3   G01   AX00006105   AGCTAGTTTATCAAAAGTTTTTGGCTATGCCAAACCGAAATTCATCGCCCACCTA
Ext3   G03   AX00006106   TGAAGTGCGTGGAGAGGTATTAAAGATAACGCATTCTGAATTAGGAGAATTGTT
Ext3   G05   AX00006107   AGAACGCTTAGTAACAGCTATGAACAAGAAGAACGTAAAGCTAGAACAGGCTAT
Ext3   G07   AX00006108   GGGAAGCTCTTGTAAGCACTCTTGTGGTCATTCAACCTAAACAAGGAAATTGGG
Ext3   G09   AX00006109   ATCGCTTTAATACCTGCTGTGATTGTTCTCTTTATGTTAAGTTTCGGCTTAGTTG
Ext3   G11   AX00006110   TTGCATTTACTTTGGTATTAGTGACAGTTGGTATAGTGACATACCAATTGTTTAC
Ext3   G13   AX00006111   TCCAGGGATACTTGCTAAAACTTCTGAGAGTGGAAAAACATGGAGTTATGCGGC
Ext3   G15   AX00006112   TTTATTGTGAATCAATTACATATGAAAGAGCCCTCAAGAGCCATTTTATCGCTTG
Ext3   G17   AX00006113   CTATAATTCAGTACGATCAGCTCGAGAAAGAGCCTTTTATTATGCCTGCTTCTTC
Ext3   G19   AX00006114   TGCCCTGATTTTCGAAGAGCCGCAACTTCCATCCACTAAAGAAAGTTGGATCGC
Ext3   G21   AX00006115   TCGCCGGCGGGAAATGCGTGGCAACAATAAACAGGGATGAAATACGAGCAACA
Ext3   G23   AX00006116   ATAGACAAACACAATAAACCAAGAATCATAGAGTCTCAAGTTAGAATAGGTGGCG
Ext3   I01   AX00006117   GGGTTTGTTGTAGGCTCAGCAGCAGTGGGATTTTTAATAGGCAATACGGTTCTC
Ext3   I03   AX00006118   CGGACTTGCGAGGTTTCAGCCCCCGCAAGGTGGTATGCTAGAACCTATTTACAA
Ext3   I05   AX00006119   AACAAGCCAACACAGAAATAATTCCATCCGAGTACATCTGGGCGAAAGCAACGG
Ext3   I07   AX00006120   AGATCGTCGCACTTGGTGTGCTGTCTATTGGCTAATGCAGAAATTTACGATTGG
Ext3   I09   AX00006121   GTTGCGCCAAGTAATAGCTATTGGATTATGGTCACCTATTATGGATTCGCATATG
Ext3   I11   AX00006122   AATATCTCATCAAGACTTATTTTCATAATGCAGGATCATTAAGTGCGGATGCTGT
Ext3   I13   AX00006123   GATGTTCTTCGCCTTGCAGTTGCTTTATCTGAAGGTGATGTGAGTTTAGCATCC
Ext3   I15   AX00006124   GCTTTACTGGTTGGATGGTTCGTCAATATCCTGGTTCAGGTGAAGTATTTGAAC
Ext3   I17   AX00006125   AAGACTGAGCAAACTAGTAAAGCAATAACAATACTTTCCGAACAACAGTATCCGT
Ext3   I19   AX00006126   CTGCAAACTTGGAAGGACGTGAATGGACACATAATCTTGACGGTAATGACACCT
Ext3   I21   AX00006127   AAAACTTTAAAACTTATAGTTTACCTGTAGGTACCAAAGAATTGAAATGGGTTATT
Ext3   I23   AX00006128   AGTGATGTATTGGATGTAACAACAAAGGCAGAGGATTCCACATATGAAAAATGG
Ext3   K01   AX00006129   AAAAGGTGAGTTTATTAGAGGTAATTCGTTATTTATTCGGGAAGAAACAAACTGG
Ext3   K03   AX00006130   TTTATCAGTTTCAACAGATATCGACATGAACCTTGAAACAGGGGGAATTACTGTA
Ext3   K05   AX00006131   AAAGGTGACTATTCATATTATAGTGGTACCTCTTTTGCTACTGCGTATGTTACGG
Ext3   K07   AX00006132   ACAATTGACGGGAAGAGTTATGAACTTTCATCTGGCACTGTTATTGGTTTCGTTC
Ext3   K09   AX00006133   GGGCTGGTTTCGTACAAGGAATTCAGTGGTATGCAAATATAAATGCGCAGATTG
Ext3   K11   AX00006134   TGAAGCACAAAAGCCGAAAGCAGTACAAACGGAGAAAAAGGACTATATGGATTA
Ext3   K13   AX00006135   GTGTATAAATTAGGGGTAGAGTTTGATAAGTTGTTTGCGGAGCATAACAATATTA
Ext3   K15   AX00006136   TTTGGATCTATAACGGGGGACGCTACATATTTTCAAGACCATAGTTGGCCAATG
Ext3   K17   AX00006137   GTTGTAGCGTTTAATATTATGGAAGGTGTTGATTACGAACTTTTAGCTTATTACT
Ext3   K19   AX00006138   TTTTATTGAAAAGGAAGTGTTAGAAGAAGCGAGTGATGACATTTCTATGTTATTA
Ext3   K21   AX00006139   GAAATGTTTTCAAAGATAACCACCAAGAACTTTGGTATTCCTTTACAATGTCTCT
Ext3   K23   AX00006140   ATGCCTATAACTTTTATAGGCAATGTAACTGAGATTGATTTGATGATAGATGGTG
Ext3   M01   AX00006141   GTCTAATACATTTAGAGAGTTTTATTATCGATTTGCAGGACCATTTTGGGAAGTG
Ext3   M03   AX00006142   ATGTCGATATAGATTACACGATAGATGGTGATTCAGTTCATTCAAAGTTTGGGAC
Ext3   M05   AX00006143   TTTACTGATTTGGATGGGTTTATCGATGACCATTATATTAGTTTAGAGGCTGTAT
Ext3   M07   AX00006144   CACAGGGGCATTAGGAATCGGTGCATCAAAAGGCGGTGACAACATTTTGTGGA
Ext3   M09   AX00006145   GGGAAATTGCGTGGTGTGTGAGGAAACAGGAAGTAATATCATTATATTCCGTTC
Ext3   M11   AX00006146   TGTCGTCTTTTGGGAACATGAGGGGGCATGGGAAAAGGAAACATTGATGGAAA
Ext3   M13   AX00006147   GGGGACCTTATGGGTTAGGAATAGTAGAGTGTGCGGATGATGGTAAAGAAAAA
Ext3   M15   AX00006148   TTTAGCAGATCAGGTTGTTGAGGAGTTACAAGCTGCTAAAAAACAGATTGAAAG
Ext3   M17   AX00006149   TTATGTTGCTTCGGAACGGAATTTTTATGCAACTACATGGGCTGCACCAAATCCT
Ext3   M19   AX00006150   CCAATGGGAATTCCGTCTATAGAAGGATATATAAATGATGATAAAGATCTATGGT
Ext3   M21   AX00006151   TACATTTACAGAACGTGAAACTAGTCCTATGGGCATTCCTAGACTAAAAGGGTAT
Ext3   M23   AX00006152   ATAGTTTTTGTTGGGCGTATTGAAGGTATAACAAAGAGGCTAAGTATGTTTAACC
Ext3   O01   AX00006153   TTATAGTATAGGTAATGGGGATTACTTTTGCCTTCATTCAAAAGAGGGGCAGAG
Ext3   O03   AX00006154   AAATGATATAATTCCTGATCTTTGTATAATTTTTGAGGATCATATTGCTGAGCCAT
Ext3   O05   AX00006155   GGTACTGATAAGTGGGTTTGTATAGGGAAAATTGAAAGATATCCATTGTTTATTA
Ext3   O07   AX00006156   TATCTCCAGAACGAATGTTTCAGGTTCTACAAATTATAAGTGAAGATATCGAAAG
Ext3   O09   AX00006157   TCAATTACTTAAGAGGATCACTTTAGTTGGAATTGTAGTCCCATATGGAGATATT
Ext3   O11   AX00006158   TTGCTAAAGGGTTCAAAAAATCTTCCTTATATATTAGTAGAGAGATTTCCATACG
Ext3   O13   AX00006159   TTAGAACTTATGAACCTAGAGCATAAAAAACTTAGAGAGTATGTGAATTTTGATG
Ext3   O15   AX00006160   TAAAATATGATAATGAGGGGAACAGGATTCCTTCGCGTTTTATGACTGATTTTCA
Ext3   O17   AX00006161   GGTTGGGGAAGGTGCTCAAGAGGCATATTTTTATTACTACACTGAAGAGAATAG
Ext3   O19   AX00006162   GAAAATAACGCCGAATTATAGCGGGAATTCAAAACGTCCAGACAGTGTTGTTAT
Ext3   O21   AX00006163   ATGGAGAACAATATGCTAGGGAAAAACGTAAAAAGATATTAAAGCAAAATGTTGA
Ext3   O23   AX00006164   CCGTATGATTTCCTTCGTGATGGACGTGATGTAGGGATCTCGTTTGATTGTTCA
Ext3   A02   EMPTY        -
Ext3   A04   AX00006165   TTGAAGGGGTTAGAGGTGAGTCTTTATGTACCCTAAAACCACCACCAGATCCTA
Ext3   A06   AX00006166   GATATGTTACCGACCAGTTTAATCATAGGAGATGATCCGAGTTCAGGGTTAATTG
Ext3   A08   AX00006167   TTGGGAGATTCCTCCAAATCGAGTTTCTTATCCTGGAGGTTTTCCCGACTTTAAA
Ext3   A10   AX00006168   CAGAGGTGATGGCAGAGGGTATCATGGCAAAACAAGTCCATTTAAGAGCTTCTT
Ext3   A12   AX00006169   CTATACCGGTAAGGTTTCTTCCTAACGGTCCTTTGGGGGTAGGCGCTAAAACAT
Ext3   A14   AX00006170   ACAATATCAAGCGATAAACCCGATTTGAATGGGATTCCTCCTCATCCAAGACCAA
Ext3   A16   AX00006171   ACTGAAGGAGAAGATTTCGTTCAAATAGATGTAGATCGTAATCAATATGACTGGG
Ext3   A18   AX00006172   AAGCATATGTCACAGGTGCGAAATGGAATGGAAAAACGAGAGATGCATTTTTAA
Ext3   A20   AX00006173   CGGATAAAGAGGCTAGTGCTAAGGCATTGGAATATCTTCAGTATCCTGGTGCAA
Ext3   A22   AX00006174   TTTAGTGCTTTTAACCGCTTGTGGTAATACTGATGTTAAGACATCTAAAGCTTCA
Ext3   A24   AX00006175   TGTATATGCAAGTTTCACCAGCTGTAGTTCCTTTACAAATGCAGCAGCCACTAAC
Ext3   C02   AX00006176   TCCTGACCAAATTGCTCACTTCCCTTCCGCATTGCAAAACTTAGACGATTTTGCT
Ext3   C04   AX00006177   TGCAGTTGCACCTAAGAATGACTCTAACATTAGCGTATATACTCCCTTTTTTGGT
Ext3   C06   AX00006178   ACTAAGGTTGCACCTGAAACGAGGCAAATCTTTAATTTCACATTGCCTTCAGTGG
Ext3   C08   AX00006179   TTGGGCGGAATGGTGATGCAAATTATAGCAAAGCGACAAAGGGGAATATTAAAC
Ext3   C10   AX00006180   AGCGTTGGTGTGCGACGTGAAACAATTAGTCATCTCGAAAAAGGTAAATACAAT
Ext3   C12   AX00006181   CATGGACAATGAACTATGGCCCAAAACAAATTATAAACGGGTTAGAGTTTTATTC
Ext3   C14   AX00006182   GAATCGCAACGAAACTCCTAATTTATATATTTAACATGTTTCCCTCTTCAATGGC
Ext3   C16   AX00006183   AAAACGTAACGACATCAACTGTAGTAATCGAACCAGCCATTTCAAATACACTTCT
Ext3   C18   AX00006184   TCTACAGTTTTTGGTTCTGATGTCAGTTTAACAAATGCAACAACTGTAACGTTAA
Ext3   C20   AX00006185   ATTCTATCCCCTTAGTAGAACAGCGATACCACGGTGTCTTCCCTTATAACCCAAA
Ext3   C22   AX00006186   TGTTACTGCCGTACAACCTCCTGGTAGATTTGGTTCTCTCATATTAGATAAACAG
Ext3   C24   AX00006187   AGCTTGCGCTGAAATAGTGGCAACATCCTATCAAAAATCATTCTTCCGCACTAAT
Ext3   E02   AX00006188   CCCCACAAAATATTTTTCATAACTATTTATACTTCAGCTCTTACTCCTCAAGTTGG
Ext3   E04   AX00006189   CGTATGCACAACAAACAGGCCTCAGCATGTGTTGGGGCCGCATTTTTCATATGT
Ext3   E06   AX00006190   AATTGGTCCGACTCTTTCTGAAGCTAGTAAGCATGGGGGAATGGGGACGCACC
Ext3   E08   AX00006191   TCCGGAAAACTGGGAAAACTGGATGTTTTGTCACGAAGAGAAGTATAACCGGAA
Ext3   E10   AX00006192   CAGTTTTATATTTGTGAGGAGTATGCTCCACTTGAAGAAGAGGATGATGATTGG
Ext3   E12   AX00006193   CCGGATTTTCTACTATAAGAAAAATTCGGCTGTTCTTTTTTACTTGTTGTAAAGG
Ext3   E14   AX00006194   GAGGTAGCAGTAACGACTACAGAACGAATAAATATCGGTAGTGAAGTGATAAAT
Ext3   E16   AX00006195   ACTTCGGAGGAAGGCAGTCATATGTGGAATAGTTTGCTGGATGAGATTTATTAT
Ext3   E18   AX00006196   AGGAATTAAGAAGGTAGTAGTTGCTACACTTGATCCAAACCCGCTTGTTTCTGG
Ext3   E20   AX00006197   GATGCCCTAATTCGTATGCATAGTATTTGTCACACCGGTGATATCTTTGGTAGTA
Ext3   E22   AX00006198   AACTTTTTTCTGGATCTCAGCGCTTTTGTACGCTTGAATCTTCTCTTCCTGTTAG
Ext3   E24   AX00006199   CATCTGTTGTCAGGGTTAAAGGGATTCGCCCAGATGATAGGGAAAAGCAGTTTA
Ext3   G02   AX00006200   AGGGACGAAGCGAACGAGTGAGTTGCAACGTTTGATTCCTGAAATTTCTGTGAG
Ext3   G04   AX00006201   GCTCGAGATTGCCTGTATTATCAGTCAATCCTTATGATGAACCTAGATTTTCAAG
Ext3   G06   AX00006202   TTCGTCAGGTAAAGTGCTGCTTATTAGCCCTGCGCCAGTTGATGAAGAGAGGCA
Ext3   G08   AX00006203   TATCCTGCTATGAATATTAGTGGAACAGCGGTAGGTTGGCCAGAAGGTAGTCTT
Ext3   G10   AX00006204   CCGTTAGATTTTGTAAAGTTTGGCACATGTACATCGTTATTTAACGGAATTGGGA
Ext3   G12   AX00006205   TCCAGAGAAGGGATCGTTGCTTTTTCAAGGTGCAGTTTTGGGACTTGCGCAAAT
Ext3   G14   AX00006206   GGGAGCGCCTTTTATTCATTAAGCAAGACTAGTGATGAAGGGAAAACATGGGAG
Ext3   G16   AX00006207   GAAGCAACTTTAGTATTCACTCAAAAATCCATTGTCTATGAAACAACTAGATTTG
Ext3   G18   AX00006208   TCATTTCTCCTGATGAAGTCACAACAGAAACATCACCGATTCATCACATATTACT
Ext3   G20   AX00006209   AGAAATGGGAATTGTAGAAAGAGAACCTGAAATTAATAAAGAACTACGCCAGCT
Ext3   G22   AX00006210   ACTCTAAACTATAAACTCTTTAACAAGAAAGGCAATTTCAGCACTTATATATCGGA
Ext3   G24   AX00006211   GTGTCATCGTTAACGCTGGTTCGATTCATAGTTTTGTTTCATTACCTACACCAAC
Ext3   I02   AX00006212   GAGAGTTGTCGATTTTAGATATCGATGAGGAGAACAAAAGAGCAGGATTCAGAA
Ext3   I04   AX00006213   GAACATGACAAGTTAGGGCTGCAAATTATTGAAGGTCAGTTTCCAGGAAGAAGA
Ext3   I06   AX00006214   AACAACTAAGTCCACATCATATCGTTACTACTATGCATTATGGAAGTTACGACTA
Ext3   I08   AX00006215   GGATTTAGATGTGAGCCGAGTTATTATTATTCCTGCTGAAGAAGGGGATGTACT
Ext3   I10   AX00006216   CTATTGTGCGTCTCATCATTATAGATCACGATAGTCCGTTAGATTTATTGTTATAT
Ext3   I12   AX00006217   GAGAAGATTGATTTCTTTATCGCGCCTACTGATGATGTATGGGCAAGGGACAGT
Ext3   I14   AX00006218   TAATTTAGGTTTATTGTATGCGAGTCAAAATCTTTCAGTTTTAGCAATTAGACACT
Ext3   I16   AX00006219   AAAGGATATGGCTACGAGTCAGCTTCTGCGATAATCGAATACGGTGTACAAAAG
Ext3   I18   AX00006220   TCATTTGTATCGTATATGGAATGTTGTACAATACCGTATTAAATTTAAATATGCCT
Ext3   I20   AX00006221   AGTACATATCAACCTGATTGGAAGATTGGAAATTTAATAACTGGTGATACATTTT
Ext3   I22   AX00006222   GCGTAGAATTGGATTCCTTAGCTGATATTGTTAGTTTCGGCGTCGCTCCTGCGC
Ext3   I24   AX00006223   ATCAAGAGAGCTCCTGTTCTTATTTCTTCTTCTTTTCTGTCGGTTGGCTTTGTTT
Ext3   K02   AX00006224   TATTGTTAATTTCAAGGAGGGTATATCTAATATTGTTGAACAAAATTGGGGAATA
Ext3   K04   AX00006225   GAGGACATTCCCAAACCATTAGTTCGAGTTCAAGGAAAGCCTCTCCTCTTGCAT
Ext3   K06   AX00006226   GAGTATTGTTGGACATTAAAAGCGCCCCTATGTCTACATGTCCTTAGTCTTTATC
Ext3   K08   AX00006227   ACTCCTGTGGATATCTATGGAAGTACCAAAGCTGCTGCTACTATACTCGCCCAT
Ext3   K10   AX00006228   CCCTATGGGCGGCCATGACATATATAGCTCAAGCAAAGGATGCTGCGAACTTTT
Ext3   K12   AX00006229   GGCTTTAGGATTTACATTAGTTGTAATAGAGAAAGGTATTAAAGCGGGATATGAC
Ext3   K14   AX00006230   AGATCCTGGGAAATCCACAAAGGGATTACCTGAAAGTAAGATTGTACTAGACAC
Ext3   K16   AX00006231   AAGGCTTCTCCAAATGGTTACGTTCTTGTTAAAGAACCGATTATGTTCGAAATAA
Ext3   K18   AX00006232   ACTATGCTAGAGGCACCTACTGCTCAAGCAGCTTCTTATAACTCAACGTCATCCT
Ext3   K20   AX00006233   AACGAATTGCTTTGCCATTCTATTCAACAACAGAAAAAGGAACTGGGCTTGGTAC
Ext3   K22   AX00006234   CATATGACCAAAATAGACAATTCCAACTTCCAATCTCTTTTCCTGGCACTGGAAA
Ext3   K24   AX00006235   GTAACACAAGCTACGGTTTCTCGCGATATTCGTGAGTTAAACTTAACGAAGGTA
Ext3   M02   AX00006236   ATTTCGGTTTGACATGGGAAACTATTCATCCGTTTCTTGAGTATGGCAGTGCGG
Ext3   M04   AX00006237   ACAGCTGAGGAATTTCAGCTGGAAGGTAGGGGAAATTATATTCCGTTATGGTTA
Ext3   M06   AX00006238   GAGAGAACCAGCGCGTAGACGTGAATCATTATTCATGGAGTACATCATTAAATA
Ext3   M08   AX00006239   AAATTCTGGTGTGCCAGTTTGGAATGGATTAACAGATATGTGGCATCCAACACA
Ext3   M10   AX00006240   AAATATTTTGGTGTACGTCCCATTGTTGCTGCAGACGAGCGTATGCAATTTCAAG
Ext3   M12   AX00006241   TTTCAGAAAAGCAAGAAATGACAGTGCAGCAATTAAAAGAATGGCTCAAAGCCA
Ext3   M14   AX00006242   TAGTGCATGGGGATACTGGCTATCTGCTTGGCTTGGGAATGTAGCTTACGGTAC
Ext3   M16   AX00006243   TACTGGTTCCGCGCTATTAACTTCTCGCGGAATTTATAAAATGTCATTAAATCGT
Ext3   M18   AX00006244   ACGGAAAAGACACCTGCAATGCCATTAGATACTTGTGGGGCAATGAGCCAAGGG
Ext3   M20   AX00006245   GGAGAAGATAGAATTGCTGGGTTGTTATCGGTCGGAGCGATAGCAGGGCTAAC
Ext3   M22   AX00006246   AAAGTATTTTGGCTTAACTTGTAGTGGAACAAGGGGGAATGCCTTTGCAGTTAT
Ext3   M24   AX00006247   ATTGTAGAAAAAGGTAAAGGCGAGCTATTAACGAAAACGAAAGAACGTTGGGAT
Ext3   O02   AX00006248   CATGTTCTGGGTCAGGTGGGGAAAAGAAAACGACTACTACATCAAATAATGGGG
Ext3   O04   AX00006249   ATATTCCAACGGTAATCTTTGAAGATATGGTAAAGTCCAGCAGAACACAATTGAT
Ext3   O06   AX00006250   ATTCTAGCTCATCAAGAATTGCTACAACATATAAGTATGCGATTGATACGGAGAA
Ext3   O08   AX00006251   ATAAAGGAGCAATGGCATACTTGCTAGCAACACCTGTATCTAGAGTGCAAATTG
Ext3   O10   AX00006252   AAAAGGTGAGGAGAAAGCATTGGTTGCCCAATTTATTCGAATAGAATCTAAATTT
Ext3   O12   AX00006253   TGGGAATACAAAGCTAATGATAGCAGAAGATACAATGAAGCATAATGAACGTTAT
Ext3   O14   AX00006254   TGGGGAAAAACTATTCAATGTCTATAAGATTCCGATACATACGTATGTTTATATG
Ext3   O16   AX00006255   ACACATTCCAAACCTTTATTATGATCCAAATGATCAAGATCCAAAACGGGATTAC
Ext3   O18   AX00006256   CCTCTGAACTCCATTCCCTATTATCCCCTCTTCTTGAAACTGGTAGCCCCTCTCT
Ext3   O20   AX00006257   TAGTAAAGATCCTGAAAAAAAACAAGTTGGACGTATTTGTCTCTATATCGCATTA
Ext3   O22   AX00006258   AAAAAACTTATAGGCACGTGTGGATTTATAAAATACGATTTGGTCACACATACAG
Ext3   O24   AX00006259   GATGGATGGGACGTGTATAAAACGCATGAATTTCATCAAACTGTAAGGGGGTGG
Ext3   B02   EMPTY        -
Ext3   B04   AX00006260   GAAATCAAGAAATCCATATTGGTGTCGAGCGGAACTTTACACCAGCTAAAAAGG
Ext3   B06   AX00006261   TAGATCCAAAGTCAATCGGCATTCTTTTCTACACTCTTGCGGTTTGTTATATAGT
Ext3   B08   AX00006262   AAATGTGTAACAACATGCTTGACGCATTTGATCTAGCGAAAACATCACCAGCAG
Ext3   B10   AX00006263   ACAGAAGTACATTTGAGGAGCAATTTAAATTAGCAGAAACTGAAAAAGACTGGTA
Ext3   B12   AX00006264   AAGCTTGCATATGCAGAAGGATTTTCACTTGGAGAGGTAATTGGCAGCCAATAT
Ext3   B14   AX00006265   CAACAGGAAATACCAGGTTCATTCGTCTTTATGGGAACGAGCGGTACACATGAA
Ext3   B16   AX00006266   TTAACGATACGACCAGCGAGTCGCTTTAAAATTTTAACAGCAAAATTTTTAGCAA
Ext3   B18   AX00006267   GTGACAGAGTTATCATTATTCAGCACGGGGAATATGTGGCTACGCAAAATATTC
Ext3   B20   AX00006268   GTCTGTCCCAAGTGGAGGACTTGAAAAGGGAGAGACACTAGAAGAATGTTGTAT
Ext3   B22   AX00006269   CCCGCGACTACTCAGCTACTAGCCATTGAAAAAGTGCGTGCGGAATGCAAACG
Ext3   B24   AX00006270   GACAACGTGGACAGCGTGGCAGTACACAGATTCCGGACAAATTTCAGGCGTAG
Ext3   D02   AX00006271   TGGTGGAGTGACAATTTTTCAGTTTCGCGAGAAGGGGGAAGGTTCTTTAATCGG
Ext3   D04   AX00006272   TTAATATCGGAAGGGTCAGTATACCCTTTATTACGTCGTTTGACGAAAGAAGGG
Ext3   D06   AX00006273   TTATCTTCGTAGTCATGGTGTATCTGAGGCTAAATTTCGAGCGGATGTGTTAAAT
Ext3   D08   AX00006274   TGAATTGCATAAAGGACGCTGGAATGTTAGTAAGAGTGATGCTGTGAACCCGTT
Ext3   D10   AX00006275   TATCGCTGTTGCCTACAATGGTGGTTATCGATATAAAAACGGGGGGAATTTCTT
Ext3   D12   AX00006276   AAGCGTTGGATTAGCGGTGATTTGCAAAATGTACGATTAACGGCTGAATCGGAA
Ext3   D14   AX00006277   TTGTAACTTTATTAAGGGGATGGGCATTCCGTTAAGTGAAATTGCAATTGCAGAG
Ext3   D16   AX00006278   ATTCTTATCAGGATATCGGCCTTAGAAGGAAGTTATATAGAGATATTTATAGTCA
Ext3   D18   AX00006279   TTTCTTCGCATCTGAAACTTCGCCACGCAACAGTGAGCGACAAAATAAATGGTA
Ext3   D20   AX00006280   TATGAAACCATCCAAAACGATCAATCAAACATTATTTACATTCCTATCATTGGTTC
Ext3   D22   AX00006281   TTAACAAATGCGTTTCCTATAAAGCCGGGAGATTATTATGAACAACCCGCTCATT
Ext3   D24   AX00006282   CAGGCTACTTTAATGATATATGTGAAGAATGGTTACAGCGTATACAGGCCGTAG
Ext3   F02   AX00006283   AGTTAGAAAAAAAAGCAGTGAACTTGGGACATAGGGAGATATATACAGAGGCGA
Ext3   F04   AX00006284   AAACCGATGTTGCTGATCCCGTTAACTAACAGTTCCAGTAGGGGAGATCAAGTT
Ext3   F06   AX00006285   CCGCCATGCTTGCCACTATTTTTTAGAGCAGGGCTTTCATGTAATTCCTATGTTT
Ext3   F08   AX00006286   TTAAAGCCGTATATCAAGGTAGAGGCGGGGAAATCTTTGTTATGAAAATGCCGG
Ext3   F10   AX00006287   TACGAAATGGCGCTTATCGCATATACAGCCCTGCACTCATCTATGCATGGCGAG
Ext3   F12   AX00006288   ACTAGTTGCAAGAAACGTGGAGGAGAATTACGGTAAGTCTACAAAAAGAAATGT
Ext3   F14   AX00006289   TGGATATAAAGAGTGAGGAACATTCTCGAGAAAACTCAACGCTTGCTCCAGGTA
Ext3   F16   AX00006290   CAGTTCCTCTAAAGAACCCCATTGATAAAAAATTCAAGAACGGCACAGGTACACA
Ext3   F18   AX00006291   TTTAGAGCAAGCGCAAGACAAAGGTTTAGATGGCGGTGCGGTATCAGATATGG
Ext3   F20   AX00006292   AGCATTCGTTGTTTGGTATGTTATTTATAAAACACCGTTCGGTCTTCGTCTACGT
Ext3   F22   AX00006293   TTCACAATGTGAAAGTCAAAAAGTTGTAAATATAAATGGTGTGGAATTAATGGTT
Ext3   F24   AX00006294   CGGGCAAATACAAACACTTATAATACCTGTAGGGAAGTGGGGAGGTTTTAAAAA
Ext3   H02   AX00006295   ACGTAGAGAAAATAGAAATATTACTACAAGACATGCAAGAGATTGCGGGGCGAT
Ext3   H04   AX00006296   CAGCAGTTCGATCGAACAAAAAGAAGGTGAACTTGGCGAAACAAAATAACATAC
Ext3   H06   AX00006297   AGTAAGGCATCATTGCCCGACTATTGCGATATTAGGGCATGGATTGTCTTTTATG
Ext3   H08   AX00006298   TGAAATAGGTCATGCGGCCCAAGATTGGGAATTTCATTTGGTGTATAAAGAAGG
Ext3   H10   AX00006299   ACAAGAAGTACGTTCCAAAACAATCGAGACTTTTCAATCGTTACCTGATGAATGG
Ext3   H12   AX00006300   CTTCTTTGCTTAGCGTCCTTTCCCGTTACAATGATTGTTATTGGTGGGTGGGAA
Ext3   H14   AX00006301   AGAGTTGCAAGAGAGACTAGCTAAAGAAGTAATGCACAAATATGATGTCGAGTT
Ext3   H16   AX00006302   GCAATCGTGTTAAAGGCGATAGCAATTCTCAGGAGGGCACCGGTTCTCAAGGG
Ext3   H18   AX00006303   GGCTTGCTGGAGGAGAGGAAAAGACGCAAAAAGATGTGGCTGATATGCTTGGG
Ext3   H20   AX00006304   AAATGGTACGAAATGTGTGTGAAGGAACGTCTCGTAATACATCCTCTATGTTAGC
Ext3   H22   AX00006305   TTTGAGTTAGCGGCGATGCAACATTTCAAAAAAACAATACCAGATAAAGTGGAAA
Ext3   H24   AX00006306   TTTATTATTTACGAGTGCAAGGAGTTGCTGTTGAAGGTGACATTGGCAGTAGAC
Ext3   J02   AX00006307   GTGGTTACTTTATGGGACGATTATTATATTAAGTGCTCTCGTTTATAATTTAGGG
Ext3   J04   AX00006308   CTGTCTTAGATCCAATGTATAAACTACATGGTTTGATTAGTACTGCCATGATATT
Ext3   J06   AX00006309   GACTATATTGAAGGCTTCTATACGATGCAGGATTTAACTCTCTATGTCAATCGAG
Ext3   J08   AX00006310   TTCCTCAAGTAGCCGTTACATTACAAATTGGTAGTATGTATACAGAACAATTTTC
Ext3   J10   AX00006311   CCCGTTTTCACAGTGGCACCAAAAAGAAATCTCAGCATTTACAGTGGCGGGACC
Ext3   J12   AX00006312   TATATGAAGAGTTACAGCATAAAGCGGGAGATGAAAACTGCACATGTGCTGTGA
Ext3   J14   AX00006313   TAAATTTATTGGCTTTTACGATGATGAAGAGCGTATTCTTTAGTGAAACCGACCA
Ext3   J16   AX00006314   CGCAATTATTGTGGGGGCGGATCGAATTGTCGCAAATGGAGATACAGCCAATAA
Ext3   J18   AX00006315   GCTTCCCGCTTACAATTAATTAATTGGATTGGACGTCAAAATTTAGAATTTCCTG
Ext3   J20   AX00006316   TTATCAGATTCATCGTTAGAGAAGCAGTGCATAGAGTTATGTCAAAAACAAAACC
Ext3   J22   AX00006317   AACTATTGTTAGATTTCGTAAAGTTAACACCAGCTCATTTAATGGCAACTTTTGTA
Ext3   J24   AX00006318   TTACCACCCTACTGTCCAATCAGATAAAGATCATGGAAAAGTAATACAAAGGGGA
Ext3   L02   AX00006319   TTGGATTCCCTTTTATTTTGCCGACTCTAATTGCCGGAGCTATTTCTATTCATAC
Ext3   L04   AX00006320   AGCACTTTATATACCGAGACTATCGCAATACGTATCAAAAATAGGGAAAGAAAAC
Ext3   L06   AX00006321   GCAGTCCAATATCAAAAGAAGATCAGGAAATGCTAGTGAAACATATTCAAACGG
Ext3   L08   AX00006322   TATGCTATGCTTGCAATGGCTTCTGTGTTAAACTTTGGATTGCTACCAGACTTTA
Ext3   L10   AX00006323   GATAACGTTGTCCTTGTTCGTCACTTAGATCCCAAGGGAAATGAATGCAATCGC
Ext3   L12   AX00006324   TAGAGGGCTAAATACAGCAGCTACTTTATGGTGTGCAGCTGCTGTCGGTACTCT
Ext3   L14   AX00006325   TGGGATAGATGGAGACGTTTTTTAGAGCCAGCACCTATCATTCTTATACATAATG
Ext3   L16   AX00006326   GAGAGGTGGATGGGGTCTTTGTTGATGTGTATGTTACTGAAAATTCTACTGAAA
Ext3   L18   AX00006327   ACCCTTTCCTTTTATTTTACAACAAAAAACACCTCTTGCGGAGCTTTTACAAAATT
Ext3   L20   AX00006328   TACAAAAGATGCTGGTCAAGGTGCCATCGCTTCGAAAATTGAACTTGCTGGGAA
Ext3   L22   AX00006329   CAATGAACCTAAGTACATGCATCATGGTGTGAAATTCTCAGCCCAATCTGTAAGA
Ext3   L24   AX00006330   CATTAACTGGCGTTGAGACTGGCGAAATAAAACCATTTCAAATTGTTTTGACTCC
Ext3   N02   AX00006331   TGGGGCAATGTGTTCGGAATAGTGTGTATGGGACTTCTTTCAATTTTGATCGCC
Ext3   N04   AX00006332   GAAGAAGTGTACGGATATGAACTGAGCACAAAATTAAATAAACACGGATTTACAT
Ext3   N06   AX00006333   CTCATCGAAGCACAAGCAGAAAATAAAAACGCTTATGACATCTTTGGAGATAATT
Ext3   N08   AX00006334   CCATGCTCTGTATGATGTTATTCATTAATGCCGATGTAAGCAGCTCTCCTTATGC
Ext3   N10   AX00006335   AACTGGATTTACGCTGTGGGGAGAGATTCTTGGCGGAATAACGGGAGGATTGG
Ext3   N12   AX00006336   CTATTTGATCTTACCAATATACGGAGCATTCCAAAACTCTATAGAACCATTTCAAA
Ext3   N14   AX00006337   GGTATGCCGTAGTTAGAGTGGCGATATGCTCTTTAGTTTATATAGCGGTGCTGT
Ext3   N16   AX00006338   GTGGAAATTATGTCTTTGAAAATGATTTAATTCTCGTTACGTTGCAGTGCACACT
Ext3   N18   AX00006339   AATAAACAGTCGAAAGGGTTAAATGATTGGGAGTGGGATGTGTATTTAGGGCAA
Ext3   N20   AX00006340   GTAGTTACACAGCGCTCATCGGTCCAAGGAAAAGGTTGTGCAGCTTACGTGAAA
Ext3   N22   AX00006341   GTACACAATTGTCCATTTAAAGAAGTTGCTGTTCATCATCCAACTGAAATTTGTA
Ext3   N24   AX00006342   TATGGGATTTGCAAGGGAAAAAGAGAATCCCTTTGAGGTGGGTTATTATTCATC
Ext3   P02   AX00006343   CCGCTCTCAATAAGAGTTGTCTTTATTATTTTATTTATGTAGCTAAAAGGAAATGC
Ext3   P04   AX00006344   AATATAGCAAAGAATATGAAGTTCCCATTACAGCCGCACAAGCTGATCAAATCGT
Ext3   P06   AX00006345   TATGGTCCTATTATGCGTAGTCTACCAAGCATTGTTAAAATCCTCACCTCTGGAA
Ext3   P08   AX00006346   AGAAACAATACATATACACCTTTTTACAAGAAGAGTAGCAAGCCACATATACTGT
Ext3   P10   AX00006347   TGTATTAATGGATCTACCTCGGATTACTCTTGTTGGGCAAATACATATTTATATAG
Ext3   P12   AX00006348   AATGACCAATTTGATATCCTTACAATCCAACAAACAAATGGCGTTAATTACGAAG
Ext3   P14   AX00006349   GAATCAGAAATTTTGGGTAGCTCGTTTTCGGCCTCAGAAAAACAACAACAGTTAG
Ext3   P16   AX00006350   TTACCATTTACCCAGCTTATCTTCGGGGAAACGCCCCTCAATCTTGTAGCTGTAT
Ext3   P18   AX00006351   AAATCATTGCAGGCGTTCTTTTATCTGTGACGGATGGGGCAGTAATTGTTCGTA
Ext3   P20   AX00006352   ATCCGAGCATCTCTTGAATATTTTGGTGCAAGGGTTGTGACATATTGGATTGGT
Ext3   P22   AX00006353   TGCTTCATCCGCCATTGACGGATGAAGGAAGGAATCAGGCTAAATTACTTCAAT
Ext3   P24   AX00006354   GTACCATTAGCCTCTTAAATAAATGGTTAGGTTTAAGCACAAACGATAAATCACC
Ext3   B01   EMPTY        -
Ext3   B03   AX00006355   GATGTAACGATTAAGTACGATTATGCGATTGGGAATCCAGATTATTTATTGCGAG
Ext3   B05   AX00006356   GCAGCATGTTCATTAGACATATTTATTTATCGTTCCGTCGCAAGGCCAGGATTGC
Ext3   B07   AX00006357   ATCGGGTTCGGTATTTGGAAGGGGTTCTTTATTCATTCCTCACGTAAAGAAAAAG
Ext3   B09   AX00006358   TTTGTTCTGTTATAAAAACTATAACAGATTAGGAGATAAGAGTATTACAGCTCTAC
Ext3   B11   AX00006359   CACGAAAAGTAGCACCTGACATTGCCTTTGGTGTTTGCTTACAGTTCTATGGCG
Ext3   B13   AX00006360   ATTCGTTCATACTCCTCAGCTTTCACTTAGCAACACCGAACCCAGGGCGCCCTT
Ext3   B15   AX00006361   CCCTCTTTTAATCTGGTGGAAGCTTACCAATGTTATACCTATAAGAAGCGTAGAA
Ext3   B17   AX00006362   AATCTTTTTGGAGAAAACAAGGTCGCCTAGGTAGAGAATTAGTAGATGAAGCAA
Ext3   B19   AX00006363   ATCATTAACAGTCTATGACAAAAAGAACGACAAAGACGAGTTTTATGGTGTTAAA
Ext3   B21   AX00006364   AGACACGATTCAGAAATACCTATACGACAAACTGAAACAAACCTCTGTTACAATT
Ext3   B23   AX00006365   ATCATACAAGAGTAGGCTCCCAGCTGGTAATAAGACCTTTCCCGACACAACAAA
Ext3   D01   AX00006366   TTTCTCGAACCAATCGTACCTATCCAGGAAAGACAAAAGGATTGATTGTGACATT
Ext3   D03   AX00006367   TTGCGAAACAAAAGGTAAACGTTGATGGGCGTGATCGCCGATTTGACGTGACAC
Ext3   D05   AX00006368   AAGGTGCACGTAATCATGGTCTTCTAAACATAAGTGTGAGCGATTTTTTTGAGAC
Ext3   D07   AX00006369   ACCTTTGATTCTGTCCTTATGAATCCACCATACTCTGCAAAATGGTCTTCAGACG
Ext3   D09   AX00006370   TTTGAGCAGTGCCGGAGATGTTGTTTTCAGCTTTGTTAGTTCAAAAGCTGGGAT
Ext3   D11   AX00006371   AAATCAAGTTATACATAGGCAAACGATCTTTATTGGAAGTTTAAACACGTCAATT
Ext3   D13   AX00006372   CTTACTGGACAAGGAACGACAGGAGGAAGTGAAGTGACAGCTTCAAGGCCGAC
Ext3   D15   AX00006373   TTCGGACACTATAGCGTCTCTTGTGGGTGGTTTATTAGGTGTAATTAATGAATTG
Ext3   D17   AX00006374   TACATAAGGAAACGATTGAATCAGGTGAATATAGTGATGATACTCAATTGCTTAT
Ext3   D19   AX00006375   AATGCGGCTGCGGGGGAGGGTAAATACTTAAAGAGCGGTAATGAAGGGTTGAG
Ext3   D21   AX00006376   ATGACAAGAAAAGCGTTGGGCGCCAAACCTGCCTTGGTAAAATTTGAAGGTATG
Ext3   D23   AX00006377   ATAAATTGCCAAGCGAGAGCGCTGGCTTTATATGTTTCTTTGCATAAGGCTGATA
Ext3   F01   AX00006378   AATCGAGTATCTAGTAGAATTGTTGCGTTTCCGCAACATGGATTATTGCGCAGTA
Ext3   F03   AX00006379   TTTAGATGGTCTATTCCATGTGACGGAAAAGGGTGGGGCTCCATCGATTACATA
Ext3   F05   AX00006380   GAAAGTTAAAGGGGTCTTGGATGTCATCAGAAAGTACAGACAGGCCAGTTGGG
Ext3   F07   AX00006381   TCAACATTACTTAGTGTCATGTCTAGAAACCACGCTCCTAGCAGTGGAGAAGTA
Ext3   F09   AX00006382   AACTGCATTTTATCCGCCAGGAAATATATAGAACAGAAGTAGCGTTGAAGATGTT
Ext3   F11   AX00006383   TATCGGAAATTACTCGTTGGTTTAATGGGGCTACTTAGCCTATCCTTTGTCACAC
Ext3   F13   AX00006384   ACTACCAAGAAATTATTCAAGAACATGCTAGAGATGGCTGGAGGTTCGTACAGA
Ext3   F15   AX00006385   GGGAGAGTATTTGATGGATATGAAACACCAGATTATAAAATAGCGTATGCTCTTT
Ext3   F17   AX00006386   AATGTCTCCCCGAATCCTCACGCTCAAAACAACAAGTTAGTGAGGAAAATTAATT
Ext3   F19   AX00006387   AAGAGCATCCAGCACATATAGTCTTGAGCTTTAAGGACAAAGACGCATATAAACA
Ext3   F21   AX00006388   TTTGGAGTGTTTTACAGTTTTGGGATAACTCCCAATATTATTGAGAGCATTCTAG
Ext3   F23   AX00006389   GAAATGCTAGATACGATTCGCACTCATTTTAAAGAGAAGCACGGCGTTGAACTA
Ext3   H01   AX00006390   ATAACGAAGAAGACTTCGAAGTTTCTTGTAAACTAAATTCAGAAATTGCCGATCT
Ext3   H03   AX00006391   TGTTGCTTTTGTAAAGTTGCCGAAAGAAAGAAGTATATTAGTTGGTCCATTCGAT
Ext3   H05   AX00006392   GGGGTATCAAGAGAACCGGAAGTTTTCAATTGGTATACTACCGAGTTTAGCGGA
Ext3   H07   AX00006393   TTTACGCGAACTTTGACTGTACGATTTTAGACGTATGCCCGGTAACAATCGGAG
Ext3   H09   AX00006394   GTGATTACTTTGCGGATGTTTTTACTGCTACGCATCGTGTATTTCTCATTAATTTA
Ext3   H11   AX00006395   CTACGAATGATCATTTCGGTTGGTTCTTTTTTGCGATCTTTTGGGTAATTAAAAG
Ext3   H13   AX00006396   TTTACCTGTCGTTGTCGATGTAACGCATTCTACAGGGCGACGTGACCTTCTCTT
Ext3   H15   AX00006397   TTGCACTAGAGTATATATGAAATGGGATTTGCCCTTATATATACCAATATTAATAA
Ext3   H17   AX00006398   ATAAGTTGCTCCAAACAGCAATTTCATGGGCTGAGAATAAAAAGCTGAAAGATAT
Ext3   H19   AX00006399   AAATGGGAATACTCCAGATAAAGCATTCATTGGTTTGTTTGCGTCGCAAGGTAAA
Ext3   H21   AX00006400   GGCGAATTTATTTTTACGTCTTCATGCAGATGGTTCTGAAAATCCAAACGAAAGT
Ext3   H23   AX00006401   AACGGAAAGTGGCAAGAAGGATGGATTACAATTGGATATGAAACGGATATGGGC
Ext3   J01   AX00006402   AACATGAAACTCCATCATTCATCTTGAAAGAAGCGCCTTACTTATATCATGCGTA
Ext3   J03   AX00006403   ATTTCAAGGAGCGCATAATCCCCCGAACGATAGAGTTACGCTTACTTTGGAAGA
Ext3   J05   AX00006404   TGTTGCGAACGAATATAATGTACCAGTTTCAGAGCCAATTATGGTTGCGATTAAT
Ext3   J07   AX00006405   ACTCTTTAATAAGATAGCCATGAGGCCCGGAAGTGTAACGACAGTAGCTGAAGT
Ext3   J09   AX00006406   TTGCGACAGAGGGTTTGGATGTAAGAGAACTTCTTAGAGGAAATCTTTCGGATG
Ext3   J11   AX00006407   TGCTATACCGAAGAATGCGATACTAAGCAATAGAAATAAGAATGACATTTCTTGG
Ext3   J13   AX00006408   AATCTACGCATCTTTCAATTGGTATTACTTCTTTAATTCATATTGATTCGTATAAC
Ext3   J15   AX00006409   GTACACGAAAAATCATAGCATTTTTTACGCTGTCCTCGGTGTTCTTCTTCCAGGT
Ext3   J17   AX00006410   TGCAGAAATGTCCCAACAAACCTCACAACCCCTTCTTCTAGCTACATCCTATCTA
Ext3   J19   AX00006411   GTTAGTTCCAGCGATACTTATCGGAAAGTATGCTCTTACAGGAATCATTATTCAA
Ext3   J21   AX00006412   AGAAAACTTTCCTGGTGGACAAACTATTTCTCCTACATTTGGGGGAAATACGGC
Ext3   J23   AX00006413   GATTGCGATGAGTGATCGTATTTATTTACTTCAAGCGAATCCTGGAAAAATCGCG
Ext3   L01   AX00006414   GTCAGCGACAAGATAGAGAGTATCATGAAACCTTATGGGACATGTATCGCACTC
Ext3   L03   AX00006415   TCTATGGATTTTTTACTGGTAATAGAGAAATAATCCCTTATATGTTCATCTTTTTA
Ext3   L05   AX00006416   AAAAGACGAAGGCTTATAATGGATCGGGATCATCAAATACAGGAATGAAAGTAC
Ext3   L07   AX00006417   TTGTAGTAGGTATTCTATGGATACTATGTACATGTACTCTTTTTCTGTATGTTCCG
Ext3   L09   AX00006418   AAAAGCCGAGCAAAAGAATGAAGTAGCTAAAAAAGAAGTAGCAAAGCCAGTTGT
Ext3   L11   AX00006419   TCTTGGCCTGTTGGCTTACGTAATTGATGTACCTGCGATTCGTATTTCATTAATT
Ext3   L13   AX00006420   TACTTTATTAGAGGTTGTTTAGAGATTCCTATCATTGACTACCACGAAAACTTCA
Ext3   L15   AX00006421   ATAAAGAAGTATTTAGGGTTACCACCTGGTTGGAGATTTTTAATTGCTGGAGATT
Ext3   L17   AX00006422   TTCATGTGGAATGCAAGCATTTAATCTACCAGACGTTGTTTTAGACGGAGGGAT
Ext3   L19   AX00006423   ATGTCAGCATGAAGTGGCTTATGCTGACGTGTACTTAGAAATAAGAGAGTATAG
Ext3   L21   AX00006424   GAAGGAAGAGAGCAATTCAGTGACTTCTATACAATATTCCGCAGCGGTATTGAA
Ext3   L23   AX00006425   TATTTTAAATCAGTATCCGTATGAAGCTTCAGGCGGACAAAAACAACGCTGCGC
Ext3   N01   AX00006426   TTTCGCCGTAATCATTTAGGATTTATTTTTCAAGATTATAACCTTATTAGATACGT
Ext3   N03   AX00006427   TCGTTATGCGGTAATTGATAACGATGGAAAAGATTTAGGTGGAAATAAAGGCCG
Ext3   N05   AX00006428   GCGTTTGCTTGGCCACATTTACCGGATACAATTGCAACGCATTGGAGCGGCGG
Ext3   N07   AX00006429   GTATTTCACACCACTTAAATGCACTTAAAAATGCTGAACTTATTCAAGATGAAAAG
Ext3   N09   AX00006430   CATTCTGAACGAGCTGCTTTCGCTTTTGGTCTCATCCAGCTACAGCGGCTAGAA
Ext3   N11   AX00006431   TAGCTAGTAGCTTTCGTTTCGTCAACTTGTTCGATGTCGTCCCACTTCTCCCTCC
Ext3   N13   AX00006432   CTTATCCCTTACATTCGGCGGTGTATTCGCCTATTTCAGTGATTCAGAAACATCA
Ext3   N15   AX00006433   TTGGATTTTTACTCAACATGATTTTGCGAGCTACTTGGGTAATGGTTATTGTGTA
Ext3   N17   AX00006434   GATTGTAAACAAGGCGATTGTTGATGATAATAATCCGACGCCGCCGCCAGTTGA
Ext3   N19   AX00006435   AAAAAAACGATCGTGTACCGTGGTATAAAGATGTAAACAACAATTCGGCAGCAG
Ext3   N21   AX00006436   TTGTAGGAGGCATTACATTCCACTTATGAACTTATCGAAACTAAACAATCGAATA
Ext3   N23   AX00006437   TAAGTACGGGTTTACACACGAAAAAGATTGATGCTAACATACGTTACTTGCAGCA
Ext3   P01   AX00006438   AAGTGCACACAACTCAATACCTTCTATATGGGTGGTGGAATAAATACAGCGATG
Ext3   P03   AX00006439   GCTACACTTCTTGATTAGAGAAAAGGCGTTAAAACGGAAATTAGCGTCTTATCAA
Ext3   P05   AX00006440   TATGAATGGGAAAAATTACTGATGATCCGAAAAAATGACGGTGAGCTTAAAAAAA
Ext3   P07   AX00006441   ATCTATTTGGATAGAAAGGACGTTATCTACGTATGCCAACAACTACTTTGTAATG
Ext3   P09   AX00006442   GTTGTCGAGGTAGAGTGGTACTTCAAGATTTTTTTGTTCACTCTGATCGCCAAG
Ext3   P11   AX00006443   TTAGGGAGCTTAGGACTTCAAAATAGTCTACAAAGTATTATATATGTGTTAAGTG
Ext3   P13   AX00006444   AGAGAAAGAGAAGCATGAAGACATCTTTGCTGGATTAGATGAAGCAACAAAAAC
Ext3   P15   AX00006445   GCACGTAATACAGCTTCACAAAAATTGTGTGAACGAATAGGTATGAGAAAGGAA
Ext3   P17   AX00006446   AAAGAAGTTACCCTCACGGCAACTTCTTTTCCACATACCCCACTTCGTATTCACT
Ext3   P19   AX00006447   TCTCAAAACGCTACTGCATGAATTCCGCCATGCGATGCAGCATAAGAGAGATAT
Ext3   P21   AX00006448   TTGTCTTATGCAGGTTATTTAGTATCAACAGGAAGCATTACATTTTGGGGCGCTG
Ext3   P23   AX00006449   GATCGATTTGGAAATAAGAAGGTGACGGAAGTTCCTGTAGAAGTGACATATGGG
Ext4   A01   EMPTY        -
Ext4   A03   AX00006450   GCATAGGAAGCCTCTGTGCGATAGGTATTGGCTTTTTCCTAGCTGGTAGAGCAC
Ext4   A05   AX00006451   ATTAATATAACAGGGGCGTTTTTACTTGGATATATAATCGGCAACGGAGTTACTA
Ext4   A07   AX00006452   CAAGCATATTTTGCACAAATGATGCAAAGTCAGTATATGCCGTATTCACAGCTTC
Ext4   A09   AX00006453   CCTTTAATGGTAACTCGTTCTTTCGGGGCCGAAATGTGGAGACTTACTGCTAGT
Ext4   A11   AX00006454   CAGTTTCCTAAACTGAATATGAAGGAAATACGCCATCATTTAGCTGCGTGTGGA
Ext4   A13   AX00006455   CTTATTATGTCAACAATTGATAGGGTTGTCTTTAACGTTAGAGGGGTTATTGGAA
Ext4   A15   AX00006456   GTCGTCCCGAAATAAGACTAAACTGGAGAGTGTAAGAAAAAAAATACATACTATG
Ext4   A17   AX00006457   GACTATTTAGTAGATTTTAATGGTAAGATTCGACCCATAAGTGAAGAAATGAGTG
Ext4   A19   AX00006458   ATATTGGATCGCAACATGGGGTAGTTGCCAATGGTCTAAGAGCCCCCTATTGTA
Ext4   A21   AX00006459   GACGCACATCAATTAAACTTTAAGTCAGGTATGTTTGATGGTGCATACGCTCTAG
Ext4   A23   AX00006460   AAGAAGTGTAGCCTCAGGTGGCGGCTTATATCCTGGGGAAATTTACTTATATGT
Ext4   C01   AX00006461   GAGTACCTAGAATCGAAAGTTTCAGAAATAATAGATAATAACAACAGAAGTAGCT
Ext4   C03   AX00006462   TTGCTTTTATAGTTACAAGTTATGTTCATATGACAAACAATAGGCTTGGTATCATG
Ext4   C05   AX00006463   TGAGGAATATTGAACAGTCTCTAATTAATTACCTAAGTCGTATGATATTTAAGCC
Ext4   C07   AX00006464   ATTGACAAAAAGACATTGAGATTCAATGGTCATAATTTTTTACCTAATCCACATTG
Ext4   C09   AX00006465   TTGGTGATACCCACCAGGAAGCGAGGTTTAATACTTATTATAAAACCATAGAACA
Ext4   C11   AX00006466   AGCTGGGAGTATAGTTATTCATCATTCTTTAACTTTGCATTATGCATACTCTAACA
Ext4   C13   AX00006467   AGTTACGACTGCAAATAATCTGGGAGTATGATAATTATGTAGGATTTCATAACGG
Ext4   C15   AX00006468   ACAGATGTTTGCTTGGGGCACACCTAGATTCAATATTGGAATAACTCTAACTACA
Ext4   C17   AX00006469   AGGATTCATATTAGAGGTATCTCAATTTAAAAATCGAAGAAAAGGGGTTCGTCAA
Ext4   C19   AX00006470   TAGGGCGAAGCTAGAAGGTTCTATTATGACCTTTGTTACACTATTTTTACATGCA
Ext4   C21   AX00006471   AGGATTAATTTTAAAATAAGGGCGTTTGCTAATAAACCAGCTTGGGGTGGCTTC
Ext4   C23   AX00006472   TGTTTACGATGAGAAGGTGTACGATAAAAAAGGGGAAGAAAGAGAACTGAAAAT
Ext4   E01   AX00006473   ATGTCATAGGGAAAATCCCGTATTATCGCCGAAACTTAGGATAGATTACTGTCAT
Ext4   E03   AX00006474   AACAAGGTTTAGTAAGTAAGTTAATCCCTTTCTCTGGAAATACTTCACATCGTAT
Ext4   E05   AX00006475   CATCAGCAAAATCCTCAAATAATCAAATGAATATGATAAAATCTTTGGCTTCTACA
Ext4   E07   AX00006476   AAAAACGCCGTGTTATGATCGAGTTAAGAAGAGAAAAGGTCCTAAAGCAGCTTA
Ext4   E09   AX00006477   AACTAGAAAAGGTGAGTATCCAAGTAGGAGGGAAATGGAAAAAATTCTTGGTGA
Ext4   E11   AX00006478   CAAAGAGCTTGGTGCCCTTCTTGTTATGAGGAGGATCTTTCAAATCAAGGGACA
Ext4   E13   AX00006479   TACAAAAGCAGATTAAGGACGCCAAAGCTAATGAAGATCTGGATAATAAAAAACT
Ext4   E15   AX00006480   GCGATTCAAGAATTAAAAGAAGAAAAAAGCATGCCTTTTGGCAAGCAAATAAGAC
Ext4   E17   AX00006481   GGAACAAGTTGATGCAACTGAATTTGCAGGTTTTACAACAGCCGGTAGCGTAGC
Ext4   E19   AX00006482   CGTTATTGTGCCTGTATCCATTGAGTTATATCGTTTCATCAGTATTTCGCAACGG
Ext4   E21   AX00006483   AGGATTCTGGTACAATGCATCTTTCAGATAAACAAACATTATTATTGGAAGTTGC
Ext4   E23   AX00006484   AGCGGGCTACTGGGGCATCAACTTAGTCTAAAAGCAACTGAATTAGATCTGAAT
Ext4   G01   AX00006485   AACTTCTTCATCACAGGAGTTGACACTCTATGATTATGAGGTTGCAGTCCAGTTT
Ext4   G03   AX00006486   AAAGGCGGTTAACTGCAATGTAATTCCAATATTTTTTGATGTAGATACAGTAATT
Ext4   G05   AX00006487   CTCTATACGATGCATCGACCATTAACGGAGTTTATACTTTTTGCCTGAGGGCAG
Ext4   G07   AX00006488   AAGGAGCAAAGAGTATTAAAAAAAATCTATGACCCGGAATATAATTTATTTGGTT
Ext4   G09   AX00006489   AAAAGATTCTCTTAATAGAGCCCGATATGGATATATACAACGCGCAACTGTAAAG
Ext4   G11   AX00006490   TGCTAGTTTTTTTAAGCGGTATTCTGTTTATCCATGAAATGTTACATGTTGTCATT
Ext4   G13   AX00006491   AGTTTTCGTGATTTAGTCGAAATGATGGAAGAACGTGGATTATCGATGGCTTAC
Ext4   G15   AX00006492   CAAGCAAGTTTAAGCTCCCTTTCATTAAATTCACAAGACGAAGAATCAAAACGCG
Ext4   G17   AX00006493   GATGTCATTGTAAAGGGAGTAGGAACTTCCAATCTAGATAAATTCGAACAGTTCG
Ext4   G19   AX00006494   GCAAAACTTTTCTCGTAATCCAGTGCCGAGTATTTGTATTATGATTGGTACTGTA
Ext4   G21   AX00006495   CGCAATGGAAGAGATGAAAACTCTTGCAAGACAAAAAAATGCGAATGCCATCGT
Ext4   G23   AX00006496   AAAGAAGTTGTGCGGGATGTCACGCAACAGATTTATCAGGGGCAACTGGACCTG
Ext4   I01   AX00006497   GTGCATCTTTTTTAAATGCGGGCATTGGCTACGGAGGGTCGTGTTTTCCGAAAG
Ext4   I03   AX00006498   TTATATTTGTATGGTCCACTGGAGCAAGGGATTAGTTTGAACGAGGGAAGTATT
Ext4   I05   AX00006499   CGGAACAAAATTTTGCGGCTATTGACTGTTATACTTGCGGTACAACCGTTGAAC
Ext4   I07   AX00006500   AAGCCACATGCAAAACGTGCTCTATGGACACACATCATTCCAAGTATTGCTACAT
Ext4   I09   AX00006501   TATTTGCAAGTATCTCGTGGTGTACAAGCTCGCACACATGTATTTTCATATGACA
Ext4   I11   AX00006502   AATACACATTACAAAATTGTGCAATATGGAATAAAACCAGGCTCTCAAAAGCCAT
Ext4   I13   AX00006503   AATGCACATGAGAGCACACTATCGTTTTCATTTATATCAGGCGTCTCTGTAAATG
Ext4   I15   AX00006504   ATGTGGTGGACCTTTATCAATAAATGATAAGTTTTGTGGTTCGTGTGGAAAGCCT
Ext4   I17   AX00006505   AAACAATTTAAACGTGTTAAAACAAATGCGAGCTTAGATCAAGTACACAACGTAG
Ext4   I19   AX00006506   TATATATTCTTCTCAACATATACGACTGAGTTTGATATAGGTGAAGAACATTATAA
Ext4   I21   AX00006507   ATCGTACAAAACTTATCGACAGTAGCGGAAACCATCTTTACTCCTGTCAAACTGC
Ext4   I23   AX00006508   TTTAGGTGGATCGGGTCAAGAAATGTACACTGGCCTAGGACCAATTTTCGCCTC
Ext4   K01   AX00006509   AAGGTGCTTGGGCAGCTAAGCTAACGGCTAATTTAGAAACTGCTTATGGTAAAG
Ext4   K03   AX00006510   GATGAGGCACTATCATTCACACGTATGCGCTATGAAGACCCACGTGGTGACTTC
Ext4   K05   AX00006511   AGGTTGGGAATATAGCGACTTGCGTAAGCCCGTTTTTGTTTCACAGTATTGGTT
Ext4   K07   AX00006512   AATTTAGAAATTGTATTGGTAAATGACGGATCTACAGATCAGAGTGGATTGATTT
Ext4   K09   AX00006513   TTGTTTAGGGCTGGTATCTTAGGAGCCTGGATGTGTCTATCTATGACTCGCTTA
Ext4   K11   AX00006514   GGAACAATCTCAACTAATGTACTTAGTAATACTATGAACGATCAGTTATATATTGT
Ext4   K13   AX00006515   AGATAAGGGACCTGTTTTCTATAATGCGCCTAGATTAGGAAAAGGAATGAGAGA
Ext4   K15   AX00006516   TACTCTGATGAAACGTCCCTACCGTGGAATGAGAAGGAGTTACCGTTACCTGAT
Ext4   K17   AX00006517   AAAACCAAATTTCTGTTGTTTACTCTACAGGTTCAGACTTAGCTATGCCGATAGC
Ext4   K19   AX00006518   AACGAAAGGGAAAGAGATGTGGACAAGTTGCTGATTTTACTTGCTATTCTTTCCA
Ext4   K21   AX00006519   GATATTACCCGTTACTTTATGACCATTCCAGAGGCATCACGACTTGTAATCCAAG
Ext4   K23   AX00006520   ACGCGTTACGATGTTGGGGAGAAGTTTGGATTTATTAAGACGACGATTGAGATG
Ext4   M01   AX00006521   CAATTATTATACGAATTACGTGTAAAAGGAATGATTCCAATAATCGTTCATCCAG
Ext4   M03   AX00006522   ATTCATTACTGGTAACATCTGCGAATCCGAGTGAAGGGAAAACGACAACGACAG
Ext4   M05   AX00006523   GCAGCTATTGTAAGTGCTATCATTAGCTTTTTCTTCATGACACCAATCTATCAATC
Ext4   M07   AX00006524   GGGCGATGGACGAGGCGTTGCTAGAAGCATATAACATGTTTGATATTATATTAA
Ext4   M09   AX00006525   GGAAGACTTGCTTTCTTTGCAGGTATCGACAATTGCCGTTTCAAAAAACAAGTAC
Ext4   M11   AX00006526   TGCTGAATGCTGCCAATTTAAACTTAGTGGCGTTTAGTAAATTAGGCTTATTTCC
Ext4   M13   AX00006527   ATCGGTGAAGAGTATCTAGGGCATAATGAATATTTAGGATTATGGCGAGACTAC
Ext4   M15   AX00006528   TGGACAGCTATATTATCAAAGAGGTGAATGCCTAGGGAAGTTGGAGTACGATGG
Ext4   M17   AX00006529   AAGAGAATAAGACTATAAATCAAGTAACATCACCTAGATTATCCCCTGCAAGTGA
Ext4   M19   AX00006530   TTTTGAAAGAGCAATGAAAGCTGGTGTGCACGGCTATTTATTAAAGGATAGCCC
Ext4   M21   AX00006531   CTGGCATAAAAGCCGTCCCACTCACTTTCCCTCTAGGTACAGTAGCTAAGACTA
Ext4   M23   AX00006532   AAGAGCTAATAAATAACACGAAGCAGGGCGTGCGAAAGGCTCAGAAGTTAGAG
Ext4   O01   AX00006533   TTCTTTATGTAGAAGGTAGAGAGGCCTTTCTACTCGTTCTATCGTTTCGCTTGAT
Ext4   O03   AX00006534   CTGAGGCCTCGGAATATTTAAATGTCAGCTACCGTCATCTTTTATATGTATTAAA
Ext4   O05   AX00006535   TGCTCGTTGGGGTACCAAGTTATGAAGTATATGTGGAGCATATGAAAAAGCATC
Ext4   O07   AX00006536   AACAAGGTGAGAAAGCAAAGAGTTATTTGCGAAAACTACCGATAGAAAGTCAAG
Ext4   O09   AX00006537   TAGCCTTGCAAAAGGATTGGGGATTAAGTACGCAAGAAATGGGCTGGATAGGC
Ext4   O11   AX00006538   GCGTACCATCAATTGTGACTAGGGCTGGAGAAATTGAGCCATTAATCGTAGATG
Ext4   O13   AX00006539   AACAAAAAATCTCTTGCACTTAACGCAGTAATTGCTATTATCCTATTAGCCGGTG
Ext4   O15   AX00006540   AATTCAGTTCGATGCTGATGGACAACATAATCCGGATGATTTATACAAAATTATA
Ext4   O17   AX00006541   TTTCATTTCCAAATCCGCCTGAGCGCAAAAGTTTTCCAGAAGCAGCCGGTCTTA
Ext4   O19   AX00006542   GCAAGCGATTATAAGTATAGGAATAGGACTTATTGTACTTGGACCATGGTGGGC
Ext4   O21   AX00006543   GGATTGAAAATGCTAGCGGAGAATACGTGGCTTTCCTTGATAGTGACGACTTAT
Ext4   O23   AX00006544   TGTATGGGATATCTAGTCTTGTAACAGGAGTCATCGCCTTCATAATGGTACTCCG
Ext4   A02   EMPTY        -
Ext4   A04   AX00006545   TACAGAGGATTATCAGCTTGCATTCCCTGTTTTCATCCTCTTCCTTATTACTAGC
Ext4   A06   AX00006546   AACTGGTGATTCACCTGTTCGCTCTTTCGTCTCTCGTCTTTACTATAAGGTGATG
Ext4   A08   AX00006547   AACGGGAGTAGATGCTTATAACCTGGGAACAGGTATGGGCTATAGTGTACTAGA
Ext4   A10   AX00006548   TTAACCGTGCCAATTCTATTATTACTGAATTTCTCTCAATGGGTAATACAAGGAA
Ext4   A12   AX00006549   GTTAAGAGCGTTAGCTCACCCACTTCGTCTACGTCTAGTAATGGAACTTATGCA
Ext4   A14   AX00006550   TAAGTTTGGCGCGGAATTATTAGAGAAGGGATGCTACTCTTACACCGGCATTGA
Ext4   A16   AX00006551   TTTCCCTGGAAGCTTTGCAGGAGGAGTGTTAGGCGGACTGACAGCTGGTGCAT
Ext4   A18   AX00006552   GATTCGTCTGTTATGGAAAACACAACAAGATTACCATACATGGCTTTCTCAAAGA
Ext4   A20   AX00006553   GACAAACAATTGCTGCAATTGAAAAAGGGGATTACGTTCCTTCTTTGTTATTAGC
Ext4   A22   AX00006554   GATTACGGATAAAGCTTGTCGAACAACATTTGTATCGTTATGGTTTGTGTTACCT
Ext4   A24   AX00006555   GGGAATATCATTATCACAATAAACCAGCTTCTAGTAGTGGCGCAACGAGCCCAG
Ext4   C02   AX00006556   GTCTTAGCGATATCAGTTGTTGTAGGTTTACTCCCATGGCAAGAGGCTAATCTA
Ext4   C04   AX00006557   CCTATCAGATGGTACTCCCTAGTAAATTGTCTCAACAGGGTGGACAAGGGGGTG
Ext4   C06   AX00006558   AGAGCTAATGGCACAGCATCAAATTAGACGATTACCAGTAGTTGATAGTGGTCA
Ext4   C08   AX00006559   AAGGATTATTCCTCTCTCAGCAAGTCAAGCACCCCTAGTGGTTTCAATATGAAAT
Ext4   C10   AX00006560   TTATTTTTTGAATAGGGCGGGGGAAGAAATGATGAAGGTACTATTACTTGGAGA
Ext4   C12   AX00006561   GAAAGCGCTTCAGACAAATTAGGGTCCCATGAATCTGGAAGAGCATTAAACGCA
Ext4   C14   AX00006562   AGAAGTGCTTTCGGGAGATGTTCAAATACTGAATGAACGAGATCTTCAGGAACT
Ext4   C16   AX00006563   CTTCAGCAATAGAATTTGTTAGTAATCTTTCGGGATATCGAAAAATGATGACGGT
Ext4   C18   AX00006564   AATGGGAGAATAGCGGAGTAATTGAAATTCAGAAAGGGCTAGAAAATAGTATAG
Ext4   C20   AX00006565   CATTATGGGCCCCTCTGGTTCGGGGAAGTCTACTCTCCTTAACATTATTGGCTT
Ext4   C22   AX00006566   TTTTGGAGGGGTATTTCTACTTCGCTGGCTCATACATGATGAGATGCTACTGGA
Ext4   C24   AX00006567   GCCTATATCGGTTACGCAATGTTCGGTGCCAAGAAACCAAATATAGTCGGAACA
Ext4   E02   AX00006568   CATTCACTTAGCGGTGGAAACCAACAAAAAGTCTCAATTGCAAAGTGGAGTGGA
Ext4   E04   AX00006569   ATAAACGGTATCCAAATATAAAAGAAGTCGCAAGATTCGGTACTGCTAGTAATAA
Ext4   E06   AX00006570   AGCAAGTGCGATCATCGTTCAGCCTGATGCAGATGAAACTGGTCAAACTGAAAA
Ext4   E08   AX00006571   AAGAAACAGTATACTTTTATCAAACATCTTGCGTTCATTGCCAAAAATTATCTCCT
Ext4   E10   AX00006572   ACTTACTACATTATAAAAGGTGGCTTCCGTTCTGTGACAGGGATATGTTTTTGGG
Ext4   E12   AX00006573   GGAACTATTCTCTTCCCAGAGTACACACATGGTGTAAAGTCTAAACCAGAAACTC
Ext4   E14   AX00006574   AAAGATGTCTTCTACTATCCGGTTGTTACGCTTTCCGCTTATTCTTTTAGCCGGT
Ext4   E16   AX00006575   TGGTTAGGATATAGAACTACTAATGTAGAGTCTCCAAAGGGATTACTCGCAGTA
Ext4   E18   AX00006576   ATACTTATGAAAGACGAATCACCTGAACCCAGTAAAGAAATTGGGATCTCAATAG
Ext4   E20   AX00006577   TCCGTACAGTAGGTGAATATAGAGGGAATCATATGAAAGGCTTTCAAAATATCCC
Ext4   E22   AX00006578   CCAGAAGCATGTAATATTCCACTAGGACTATTAGAGTTTCGTATGCATGAATTAA
Ext4   E24   AX00006579   GACAAGGAGATTTCGGGAATGCCGGTGAAAAGATGAAACTTGCTAGTGAGGAA
Ext4   G02   AX00006580   ATCGATTCTGCCGTTAACAAAGCTTTTATATAGTAATAGTGCCTATGTTCGTTCA
Ext4   G04   AX00006581   AATCGTAGTTTGGGTGGGCGTGAGAAGAGTGTTACGGATTCGGTTGATGTACTA
Ext4   G06   AX00006582   GAGCGAAACAGCCGATATTTTTTTTATTCTTCAATACAACCCCTCCTTTTAAGTTG
Ext4   G08   AX00006583   GCACCAAAAGGTAAAATCCTCTGAAAAATGGGGATTTGTAGAGATGACAAAAAA
Ext4   G10   AX00006584   TTCGCATACATATGCAGGGAAAGGGATAGGGCGTATGCTCGTAAATCATGTAAT
Ext4   G12   AX00006585   TGCTGATGCTGTTACGTATTGCGCTACGAAATTCTATGTAAGTGCATTTACAGAA
Ext4   G14   AX00006586   AAAATAAGAGAATACGCTAGATTATATACAGAAGGGGAGTATACAACAGAAGCTC
Ext4   G16   AX00006587   ATTACGGGTCATTGGACTCATCGTTCTTATTAGTGGTTATATCCTCGTTGCTCTC
Ext4   G18   AX00006588   AAAGATGCCCTATATATCCGTACGGGTTGCGTAATGATATGAATGTTTTCTGCCA
Ext4   G20   AX00006589   TGTAAGTCTAATAATAGGAGAGGTTTGAACATTCAAGAAATTGGATGGTTAGAGA
Ext4   G22   AX00006590   AATAGATAACGGAGTACTTGGTGTATTAAGTAAAACTTCTTCTGAGAAAGAAGTG
Ext4   G24   AX00006591   ATTAAATGGAAAACGCTTCGAGATATCAACATATAAACAACGAATATATAATGCA
Ext4   I02   AX00006592   CTAGAATGCCGTTGCTTATTACTTCATTAGCGTTACTCATTGCGCCATACATGGC
Ext4   I04   AX00006593   AAAGCTGTTTATCATGCGATAAAAAACAGTGATGGAGTTATTAGCGGTGGCGGG
Ext4   I06   AX00006594   TAAAGGGTATCCAGAAGATAATACATTTAGACCACATTTATCAGCTACAAGAGGG
Ext4   I08   AX00006595   ATCATGACCGTAAAGTATATGCTATTAGCGAGCACACTCATTCTATCACTTGGCA
Ext4   I10   AX00006596   TCATGCAAACGGGTTTAATGAACAAGTAGAAGGAACAGAAACGTTCTACTACAG
Ext4   I12   AX00006597   TACTTCGCTCCCCAACATATACTGTTCAAAAGCAAAAAGGAAGTGATCCAATGTA
Ext4   I14   AX00006598   TATGAGGGCCAAAGTCTGAGTGATCCTGAAACATATCGTAAAATTGCAATCGAG
Ext4   I16   AX00006599   CAAAAGCGGCGATGGAGGCGTGGATTGAGAACTTGAAAGTGTTACAAGCATTAC
Ext4   I18   AX00006600   CTGTGTTTCCATATGCAGGTACTTATATAGGTCCAGATGAAGTAGTGAAAAACGT
Ext4   I20   AX00006601   TTTCGACTTTGGTATATCAAGCTTCCACCGGTAATAACAAAGGAAACTCAATAAA
Ext4   I22   AX00006602   AGCTTCGAATATAATCCAAAGTGCAACAAATCGTTCTATAACAAAGGCGACGCG
Ext4   I24   AX00006603   GAAAGCAAGTATGGAAGCCATCAGTCAAGCTATGCCAATCCCAGGTATGGACGC
Ext4   K02   AX00006604   GGCTTCCTCAAGAAATTAAACTTATGGAGACTTTTTTAGGCGTTGAAGTTTCTGC
Ext4   K04   AX00006605   TGTGATCCATTTAGTGGATTAAGAATTCGTTTACAGGAAGAGATTGCTATTGTAT
Ext4   K06   AX00006606   GTACTTTGGTATTAAATTTCCTAATGATTTTATTGAGTGTGTAAAGAAATATGATG
Ext4   K08   AX00006607   CATAAGTTTGGAGAAGGTGGAATTGGAGATCAGCCACCGCATCATAATATAAGA
Ext4   K10   AX00006608   GGAAAATACCAAAGTTTGAAGAATCAGAGTTATTAGATGTGCGTCTTAAAAGAGA
Ext4   K12   AX00006609   GATTGTACATGATACATGGAAGGATAGGATTTATTTTTCTTTAGCTGTACTTTTTG
Ext4   K14   AX00006610   AATTACTCTTGTGATTGGGATAGCAGATATATTTGTGCTTTTGCCTGCTTTTGCG
Ext4   K16   AX00006611   AAATCGATTGGAGCATGGGGGAAAAGATGCAGGGGTTGAACCACCCCCATATT
Ext4   K18   AX00006612   AAATACGTCATCCAACCAAGCAAATCAAATAGAAATTACGGGAATTTCTTATGGA
Ext4   K20   AX00006613   TGGGCTACTATGAACAGTGCTGATCAGGGAGTAACCCCTTTAGATACCGCCTTT
Ext4   K22   AX00006614   CGAGAAACCTAAATGGACTGACTTTAATGCTATGCAGCTTATAACGAAAAAGACA
Ext4   K24   AX00006615   GAAATCCCTTCATGTGATGTTTTAACCGCCGGATTCCCCTGTCAACCATTTTCTA
Ext4   M02   AX00006616   AGCATAAGAGTGTATGGACAACCATCGAGAAGCTTGCAGATATTAAAAAGCTAG
Ext4   M04   AX00006617   GGGGATATGGGCGCATTACAGATATAGAATTATCAATTGATGATTCTGTAGCTTT
Ext4   M06   AX00006618   AAGGGCTTAGGTACTAATCAGATTAACGTTATCTGTAATTTCTGCTTCTTGCCAG
Ext4   M08   AX00006619   CTCTATCGGATTTAAACTGTCGAAGAACTTATGAACCTTTTGTAGAGTACCAACC
Ext4   M10   AX00006620   ACGCAGACGAGCTCGAAGATTGGTTGGTTTCTAAAAACCTTCGAAACAGAGGAA
Ext4   M12   AX00006621   TATTTTGTTCATCTTAATAGCAGAGTTAGAACAACCATATGATACAGAGTCTGCT
Ext4   M14   AX00006622   ATCACTTATGACGACCAGTCCAGAAAACTGGAAACCTTGGGATGAAGTTTCTAA
Ext4   M16   AX00006623   AAAGTCCTTCAAGTAATGGAAGGAAAAGGCGAGACGCAATTAAGAGTAGCGGTT
Ext4   M18   AX00006624   AAAAGAATTTGTAAAAGCGACTGTACGTGAAGTTTCAGCGTATTTTTTGCGGAAG
Ext4   M20   AX00006625   AACTGGAATGTTACAGTTTGCTGAAGTCCCGCTTGGGAGTGAGGACCATGTTTT
Ext4   M22   AX00006626   AGGGGAGACCTCCAAAGCTGTTATACGGGTTTTACTTTGGATAAGGAGCATAAT
Ext4   M24   AX00006627   AGAGTCCTAATGATACAAAAAACTGTGGCCATTTTAAAAGTCAACAAGATGCTCA
Ext4   O02   AX00006628   GCTAGACAATCAGCAGAGTCGTTAACAACTAGCGAGGCTAAACAATATGAGATC
Ext4   O04   AX00006629   GGGGTTCATAAAAACTATCGTCACTTATGGTAGTATACCAGCTCTTATAGCTTGT
Ext4   O06   AX00006630   ATGGCTAATTCTGAGATGATTTTACGTTTACTTACGGATTTAAAGATTGAACAAC
Ext4   O08   AX00006631   CTGTGGAAATTACTGATCACGGTAGCGACCCTATCTTAAACACCAGCAATATGA
Ext4   O10   AX00006632   CTCAGTTGACTATTTGGTAGTTCCCAAACCGTGTCCACCTTTTGATAATGAAAAT
Ext4   O12   AX00006633   TAAAAGATCGTAAGGAACGTGAAGAAAGAATAGAAAAAAGGCTAGAATTAAGAG
Ext4   O14   AX00006634   TAAATTGGAAAGCTTCAATTATTGACACACTCTTTTTTGGTAGTATTATTTTGTTC
Ext4   O16   AX00006635   TTGAAAGGCATGCTGGATATGAGGTGAAAGTTGCTTCTTGTGAAAACACACTAG
Ext4   O18   AX00006636   AGTTAGCGAAAAAAGAGCAACAAGTAGCGCAGCAGCCGGTTCAACAAGAACAAC
Ext4   O20   AX00006637   AGCTTTATTTCTCAAATCATGGATGAAAACATGGGGAATTGCTTTCGTACTTGCA
Ext4   O22   AX00006638   TGAAATGTTTGATTGGTCATCGGGTTCTCCGGTATTGTTACCATTAATAGACCCT
Ext4   O24   AX00006639   CTACAGATAAAGCTTCACAAGTTAAGCAAGAACATGCACAATATACCTTTCAATT
Ext4   B02   EMPTY        -
Ext4   B04   AX00006640   TCAAAAAACGCTCAAGTTTTATTAGATAGTTTAATACCAATAGGAATGCTTTTAGG
Ext4   B06   AX00006641   GTATGACATGTGCAACTCTCTATTTCCCAGGATTCGCTACTTATAGTAGTCATGT
Ext4   B08   AX00006642   GTGAAATGGTTCGAGCGTGGACAGGAAATTCGTAATCGATTTGCCAAGGCCATT
Ext4   B10   AX00006643   TATACTTCGAAAAAAGAGCAAGATATGGATAATGAGTTTATCGAAAAAGAAGGCG
Ext4   B12   AX00006644   CAAGTTCTTCTTCAAATAATTCAACTTCTTCACCTGGTAAGGTAACTGGTTCAGA
Ext4   B14   AX00006645   GCTTGTTGAGGTTGAGCCTGGTGGAATGAGAGAACTTCATTGGCACCCGAATAA
Ext4   B16   AX00006646   AACTTCATGTGAGCAGGCAATCTGTTTCGAAATGGGAGACGGGAAAGAACTATC
Ext4   B18   AX00006647   GATTAGAGAAAAAGGAGTTTCTTGAATCTTATTGGAATGAATCTGAGAATGGGAT
Ext4   B20   AX00006648   CTTCTACATTTGACTCTGTTCGCAGTTTGACAGGTGGTGGGACTGTCTATCATC
Ext4   B22   AX00006649   AAATTACAGAGTGGTGGGATGATGATAACACAGCAGTTTGTCCGTATTGTGGGA
Ext4   B24   AX00006650   GCACACTTTCAAAATCTGACACGTGCTGGTTAATTTTTCTTTATCAATATGAAAAC
Ext4   D02   AX00006651   TCCTTACATTGTATTTCGGAGTACCTATTATTTTAGGTGGCTGTCTACTTGGTGA
Ext4   D04   AX00006652   GATGATGAGGTACAGTTTAACGATCCTGACTTTGAAGGCGGTGCAAATGAAGTC
Ext4   D06   AX00006653   GGAAGACTCAGAGAGGAAAGGGAGATGGGTTCGCTCTTTTGTAGAGGAAAGAT
Ext4   D08   AX00006654   CAGAGAGACCGAAGCCACAGCCCAATACAGATAATCTATTGAAATGGGGTTCTT
Ext4   D10   AX00006655   GAAGATGATGCGTACGGTGAATGCCGTGCTAGATCTTATTCAAGGTATATAAAG
Ext4   D12   AX00006656   CTTTAGTAATAAAGCCTTGATGTCTATGATAAAAAGTAATCAATCTTTAGATACTT
Ext4   D14   AX00006657   TGCTTTTAGTGGCCTCACTCAAAGTAATTGGACATATATTATAGCTACTGGTTTT
Ext4   D16   AX00006658   CGGCTGGATATGTGTTGAAATATGCAAACTTTAAAATTGAGCGAAAAGGGGAAG
Ext4   D18   AX00006659   ATCGTCATGCTTCAGTTTGTAGCTGATATAACAGGACTTACAAGCAATCTAGATA
Ext4   D20   AX00006660   ACGCATAAAGTCCCGTATCCTGGCATGTTACTTGCTACTAATCAAAGACTTCTCT
Ext4   D22   AX00006661   ATAGAACAGAAGGGATTAACGCTTACGGCGAGTGCAATATCTTATTTGTGAAATT
Ext4   D24   AX00006662   GGGATCTGGAAGTCAAGCGCGCTCTGTTATTGATGGCTTAGAAGCAGACGTTG
Ext4   F02   AX00006663   TTTGTTAGCCAAATTTATAAAAACGTAGAAGTATTAGATTCAGGAGCGCGCGGAG
Ext4   F04   AX00006664   ATAGCTTGGGTGCTCGTACGCTACAAATTTCCAGGGAAACGACTATTAGACGGA
Ext4   F06   AX00006665   CGCAGGATTAGTATTCGTTTTACTTTTCACACCGAGGGGTGCTCTTGGCGAATG
Ext4   F08   AX00006666   GCACGTTTCCAACGTAGACGGAATAGCCTACGTAAGGCCGCATGACTTATCAAT
Ext4   F10   AX00006667   CTAATACCAATTCATGCTTTTGCCTATGACGCATGGGATGATATTGTAATGCCAT
Ext4   F12   AX00006668   AAAAAGGACCTTCTTTTGCCCTTAAATCAATAATTTTCCTAGCCGTAAGCATTTTG
Ext4   F14   AX00006669   CATGGAGATTGTCGCACAGCAGGAAGAGAAACTTATCCGAGATTATCCTAAAAT
Ext4   F16   AX00006670   GATGAAGTGTTTAATGGGAGAATGTGTTGTACCACAAATCGAATTAGTTCCATCA
Ext4   F18   AX00006671   TAATCCCTATAGTAGTTAACATAACTCCGGAATATGAAGATGCGGGTTTTCATAA
Ext4   F20   AX00006672   CAAACGCAGTTTGATAAAATTATGGAGTATGTTAATCCAGAGATACTCTATATCG
Ext4   F22   AX00006673   TTACTTAGAATCAATGGAAGCATGGGTAAATGATTGTGAGGGATCCTACCAAAA
Ext4   F24   AX00006674   AAGACTGTCTCATTATAGGAGAATCTTTGCTACGGTCATGGCTATACGTTCATTG
Ext4   H02   AX00006675   ACAATATACTGAAACACGTATTGGGGCGATTATTTTTTGTATTCGGATGTTGTTC
Ext4   H04   AX00006676   TTGAATTTAGTGTTGTTTTTATAGGGTCTTGGTCTGGAAAGAGTAACAGTTGGAT
Ext4   H06   AX00006677   AGTTGGGAAGACACCTAAGAAAAGCCCAAGCCGTAAGAAGATAGCGATATTAAA
Ext4   H08   AX00006678   GAAGATAGGCCAGTATGGACATATGTGACATTAGGGATGTCAGCTGAATATATG
Ext4   H10   AX00006679   AGATATTGATGTCGAATCAGTGTTATGTATGCAACGAATCGGCGAGAAATGGTT
Ext4   H12   AX00006680   TACAAAACACGCCGATGACTACCAACTTCGTCCAGGCTTCACATTCGGAACTGC
Ext4   H14   AX00006681   ACCGCTTTTATATAGCATATTCGAGGCACAAGAACTCCCTCCAACTCCTTTATGG
Ext4   H16   AX00006682   TTTTTCATGTATTTAGCGCTCCATTTGTTGGGGATTTTATGTATAAGTGGTGGAG
Ext4   H18   AX00006683   TGAACTCGTGTTTAACCAAGCTGACACGCCTTACAATATCGACCCGTTAGCGTT
Ext4   H20   AX00006684   TTACCAGACGATCAAAAGATTGCTACAGATATGAAAGCGTCACATAGCCCTGTA
Ext4   H22   AX00006685   AGTAGCTGATGTTCTATATAAACCGCCTTTCAAAGTATCTAACAAAACAAAAGAG
Ext4   H24   AX00006686   GTTATATACGCCCTCCACTTCATTAGAAATCGGGTGTGACCATTACATGGGACA
Ext4   J02   AX00006687   AAATGGATGGGCGGGTGATCGCACATATTATGCTGTAAAGGGATACACCGCTG
Ext4   J04   AX00006688   TTTATGCTTTGTGGCTTGTGTTCTCTTTTTTGCCAAGGCATTCCCACAAGTCGAA
Ext4   J06   AX00006689   TACGGAAGTGTTATGGCAAACTGCGGGTCACTATGATCACGTACATGTTGGGTG
Ext4   J08   AX00006690   AGAACTTCCCTGCACCTGTTAAGACAGTATCAGTGGATAACTTCCCTACACCTG
Ext4   J10   AX00006691   TAATCGCTGCAAGGTTCCCTTTTTCTAGCGTGGATAGTCAAGTACAGTCTTCAAA
Ext4   J12   AX00006692   CGAACTGTAAGAAGATGGATAGCTGACGGTAAGTTAGAATCTATCAAAATTGGC
Ext4   J14   AX00006693   ACCAAAAGGGGAATGTAATTAACAGACTGCAATACGGGTTTAAACCATCTATTTT
Ext4   J16   AX00006694   AATGTAACAGGGTGTAAAGCGTACGGTGTGCCTTTTGGGAACTACGCATTCTGC
Ext4   J18   AX00006695   GTACCACGCTATTTCACAGGGCGTTGTGTCATCTATTCAAAAGATTATTAGTATC
Ext4   J20   AX00006696   GTGATTAAACAGTCTCTTGACGGGGAGACATCATCAGTAGTCGTTACACAAGAC
Ext4   J22   AX00006697   AATCGTTTCTATCAGAATTTAACTCTAAGTATTTGCTAGTTGTTTATAAGGATGTC
Ext4   J24   AX00006698   GTGACATTACATGCTGACTCTATGATACTACATGACAGCCTTAGATTGCTACCCG
Ext4   L02   AX00006699   CCCCGTCTGTGCGTGACATGGCAAGTCGTATGTATGTGAGCCACAAAACCGCA
Ext4   L04   AX00006700   ACGATCATGGCGTCACGTCCGGGAATGGAAATGTGGATGCTATCACCTGATGA
Ext4   L06   AX00006701   GGGAATGAAAGCTACCGCATGGACGAATCATTCTTTACAGAGCATGTCCTCCCT
Ext4   L08   AX00006702   CTGAAGTGTACTTATCAGGTGTGACAGACGTCGACGTCGTGAAACTCGATACAA
Ext4   L10   AX00006703   ATGCCTTCTGTTGTTGGAAATCTCGTCGTTCAAAACAGTAACGGTTCTTTCAATT
Ext4   L12   AX00006704   AAATGAGCAAGAGCAAAAAAATATTCAGCAAGGTAAACGTGCATACTCTAAAAAG
Ext4   L14   AX00006705   TTACGTCTCAAAGTGCTGTGGTGTCTACTATTTATCGTTGGAAATTAAGAAAAGT
Ext4   L16   AX00006706   GTGAAATGCACGGAAGAGTTTTCTCAACTAGCAGGAAATTTACTGTATATTTCTT
Ext4   L18   AX00006707   CTCTTTTTGTTTTATAGAAATACGGGTGTAGAAGGGGGAGGAAAATGGAATTTC
Ext4   L20   AX00006708   AATATATCGCTTTGGTTATCGTTTATGATTTTTGATTGGAGTATGTGGATGGTAG
Ext4   L22   AX00006709   GGATTATCATTACTAATCGATATTTACAGTCCATACAAGATGAAGAAGTTATAGG
Ext4   L24   AX00006710   GTTGAAGAAGGTAGTAGAGCGAGTTGCGAAGAAGCAGCAATACAGATATAATCC
Ext4   N02   AX00006711   GGAGCATTTCACAACAGAAGAACCACGACTCAAATTGTGGAGCATACCCCTGAA
Ext4   N04   AX00006712   TGCTGGTATCGCCATGCAAGACATCGAGCAATTTTTCCAACGTATGAAGCCATC
Ext4   N06   AX00006713   TCTAATACAGCATCTCGTTCTAACGGTTCAGTTGGCGGTGAAGTAACAAAACGT
Ext4   N08   AX00006714   TCCATTTTCTACTTCTCCAGAAAAGGATGAAACGGATTCTTCATCTTCACCTGGT
Ext4   N10   AX00006715   AAAAGATTCGTCAATATGATACGAGTACATATTTTGATGGGATGGATGGTATCCA
Ext4   N12   AX00006716   AATGCTCCTTTTGAAATTCAACTGCAAATTTTACAGGCGTTTCAATTGTATAAAGT
Ext4   N14   AX00006717   CCAATCGTTCAAAAAGAACTGTTAAAACACAAAAAGGATATGCAGGAGATTCTGT
Ext4   N16   AX00006718   GGGAGCGGTAGTCAAGGATCACCAAAGTCCGGCCAGTTTAATCAGGAATTTAGC
Ext4   N18   AX00006719   GATAAAATTACCCGATCTTTCGCAAACTTTTCGTATTGCATTCATAAGAGATATTT
Ext4   N20   AX00006720   CTGAAACGAATGCTGCATCTCAATCGGTTATTGAGGAGCAAATTAGCGATACGG
Ext4   N22   AX00006721   TTGCTGATATGAAATATGGTTCAATTACAATTGTTGTGCAAGATGGGAAAGTAAT
Ext4   N24   AX00006722   CTTGTACAAGTACAGGAATAATTCCGATACTCTATCCTTTTAACGGCGGAACCCG
Ext4   P02   AX00006723   CATCCCTCTGTCCCAGTCCGTTATTGGATCAAGGCAGAATCCAAGTTATTATTTT
Ext4   P04   AX00006724   GTCTCTACTAAAACCTTACTTGCTTGTACAAATGTATGCTTTCGATTTCTATCTTC
Ext4   P06   AX00006725   CTGTAAGGTCATTTAAACACAGCTGTTTATATAACGTAAAGAAGTATTTTCATTCC
Ext4   P08   AX00006726   CAGTGGTAGGTACTGATGTTGAGGAAGTAAAGCGTTTAAATAAAAATTCAGGAT
Ext4   P10   AX00006727   ATTATCTGATGGGGGAACTTTATAAGCAAGGACAGATTACACAAGAGCAGTACA
Ext4   P12   AX00006728   TCACAACGGTGCAAGTAAGTCCCCATGAAAAGATTGAAGTAGCCGGTATTACGG
Ext4   P14   AX00006729   GTTCGATACGTGGCTGGGGCAACTCTCTCAGTTAGGACTACTGGAGCAAGTCA
Ext4   P16   AX00006730   TTTATGGGCGGAGATATCAAAACAAATGTATTCCAGGGAATCATCATTGGACTAT
Ext4   P18   AX00006731   TTTGTCCCCCAATACACTCCCATAATACTCTCCTTTTATTTGTATTCTATACGTTA
Ext4   P20   AX00006732   GCAGTAAGAAGAAGAGAGCCGCTAGCTAATCCTAAAAAATCTAATTTGTTAAAAG
Ext4   P22   AX00006733   CCAAGGTAATAATCAGGATGCGAAACAGGAATATATTGATTTTAAAGCACAGTAT
Ext4   P24   AX00006734   CTATTTTTGTCGTGCGATTTTTCATGATGTAGTTGTTAACGGGATACGTATGCCC
Ext4   B01   EMPTY        -
Ext4   B03   AX00006735   AAGCGACAAGTATGGGATTGATGTAAGTATTCTTCGCATAGTAACTGCAGTATCA
Ext4   B05   AX00006736   GGAATTTCAATTGTTGGTAACTTGTATATTACAAGAAGGTAATGCTTACTTTTTAG
Ext4   B07   AX00006737   TCTTATTAATGATGATGTTATCCGCTGTTTTTACTTTTGGTCTTACTAATGCAAAA
Ext4   B09   AX00006738   GATATGTAAAGCTTTGGAGTGTCAGCCAGGGGATATTTTGGAGTATAAAAACGA
Ext4   B11   AX00006739   CATATTTGACCTCCTTGAGTATATAAAGAATTTTAATATATTGTTGGTCAATTTAG
Ext4   B13   AX00006740   GAAACTAGAGTGGGAGAACGGAAAAACTACAATAAACTATCAACTCGTTTCACTA
Ext4   B15   AX00006741   AAGAAGTCGAAGAAGCACGGGAAACATATGTCAGTCGTATCATCTTAGTTGGAG
Ext4   B17   AX00006742   CACTTGCAATCTTAAATATGTTTGCATATTGGTTTCATTTTGGCGGTGCTTTTAC
Ext4   B19   AX00006743   TTATTCACATGTTTTTCCTAGAATACAAGGGGATGCTGTTAAAATATGTAGTGAA
Ext4   B21   AX00006744   GGTTCGAACCAAAGTAACACCTGAAATGCTAGATGAAGTGGCTAATCTTGCAAT
Ext4   B23   AX00006745   GTTCAATCATGTCTCACGAAAGGGAATATACCCTAGGAGATATTGCTCAAATGAA
Ext4   D01   AX00006746   AGTGAAATACAACTAGGCAAGTTTAGGAATGATGATTTAAAAGCGCGAGAAGAG
Ext4   D03   AX00006747   AAAAGAAGAATCCAATACAGATTTCTCTCTTGTGAAAGGTGCATTAACGGAGAAT
Ext4   D05   AX00006748   GTAGCTATTTATGTAGCAAAAGGATATACAGATGCAGAAATTTCCAAAAAAATAT
Ext4   D07   AX00006749   GAAAAGGATATGGTGAATACAGAGACAGATGATCCGAAATATATATATTATTTAA
Ext4   D09   AX00006750   TGCCTTTGTCAATGTATATGATGTTGCGGAAGTACAAGGCGGAAACTTTAAAAAG
Ext4   D11   AX00006751   GCGAAGAATAAAGAAATAATACGAGATTCATATAAGAAATACAAAGAATGGATTC
Ext4   D13   AX00006752   TTATTTCAACTGAAGATAAAAATCCTTCATTGTTACATAGCAGACTTGATCAGTTT
Ext4   D15   AX00006753   CTTTTGAAGATTCTGGTCTTAAATATCATGAATTAGCTAATATGGTTGGTATATCA
Ext4   D17   AX00006754   GCGTCTAACTGAATATCAAGTGCTATTACCTAATAAGTTTTGGAACTTAGCAAAG
Ext4   D19   AX00006755   AAATTTATGTGGTCAAGAATGGTGAGGTTACGCTACTGAATCCTCCAGTAACAG
Ext4   D21   AX00006756   AGAAATGAAAAAAAGTATATTTGGTGTACCGGTGGAATTAACAGATGCAGTCGA
Ext4   D23   AX00006757   CACACATTTCCCTTCTCAAATTACTGTTTATTCCGATTATCTTTATCGTTGCTCAT
Ext4   F01   AX00006758   AGCAACGAGCTGGGAACTTGCTACTATTTTAGAAGAAGAGAAAAATTGCTTTTTA
Ext4   F03   AX00006759   TTGGGTGGGCCCTATCCTTGTATTTTTAGGACTATGTATGACAAATGTTATTTCA
Ext4   F05   AX00006760   AAACCTTCAAAAGAACAGAATGGACGAAAAATAGTAACTTTAGTAACTGCTGGTT
Ext4   F07   AX00006761   TGTTTGGGATACCACTGTTAGTAATCAAGCTAAAAAGAGCCAAACGTGGCAACT
Ext4   F09   AX00006762   TGGTAATCCACAAAAGTGGTTTTGGTTATGTATTTTCTTTGCATCCATTATACAAA
Ext4   F11   AX00006763   GAAATGATGCTTTGGCAATAGGTATTGGTATAGGAGTTGTAATCGGTGTATTCC
Ext4   F13   AX00006764   GAGGATACATTTGAATTGTTCCTCCTTCAATAAATTACGAAGCTTTCTTATAGTAA
Ext4   F15   AX00006765   GGGGTTACTATATGAAGCACCGTAATATTAGTTCCATCAAACAGAAAACGGTATC
Ext4   F17   AX00006766   GGGCAACTTGCACTTCGCTATGTACTCTCTCATCCGGCAGTAAGTGTTGTAATT
Ext4   F19   AX00006767   TAAAGTGACGAACTCAGGTTATAAGGAAGGAACAATTATATTGTATGAAATCTAT
Ext4   F21   AX00006768   ACTAGAAATATCAAAAGATGAATTGATGGATATGATTCAAAAGATTACGAAGGAG
Ext4   F23   AX00006769   CTGCGACAATAAGATGGGGAATATGGCATATAGCAGATCATAATCGGTATCATC
Ext4   H01   AX00006770   GACTTTAAGCTTGGGAAACAAGATTTTTATAATGAATCAATTCAGCATCCAGTTG
Ext4   H03   AX00006771   TCAGTTGCAACTTTGACCGATTAATGGAAGTAAAAGCGGAATACTTTGCGAAAAA
Ext4   H05   AX00006772   GTTGCAAAAAGGAATATATTCTCTTAGAATGTTTCTTTATATTGCACAGGGATGT
Ext4   H07   AX00006773   AAACACTTACTACCTCAGTGGGATTTATCACATTCCAATTTCAATATAATAGTAAA
Ext4   H09   AX00006774   AGTCAATCCAAATGGTGGGGCAGAAATATTCGTAAGGTGCAATGATGAATGTTT
Ext4   H11   AX00006775   TATAAGTTCGCGTACAGGTGAGCGAGTAATGATTTTTAAATTGTTTCATAATCTT
Ext4   H13   AX00006776   AAGGTCAAAGGACTTTAAGATTAGCTTGATAAATATAGGAAGCCCCCACAATTTT
Ext4   H15   AX00006777   CTCGCTTCAAGAAGAACTACAACCATTTGCGGAAGAATTACAACGATATATTACA
Ext4   H17   AX00006778   AAGATGAATACTATGTTCAAATTACAACTGATGCGAAAATAAAGTCAGGGGTATC
Ext4   H19   AX00006779   ACTTTGATGATGGGGTATTATGACAGTAAGTATGATTTGAATTTTTTACTACAGA
Ext4   H21   AX00006780   GCGTTTACTATAATGAAGGTATAAAGTTTAATCACATCCCAGTATTAACAAAAGA
Ext4   H23   AX00006781   GGTACTCGGCATTTCTATTCTATTAATCTTATTTGTGGCTTATGGGGTGTATTCT
Ext4   J01   AX00006782   ATTAATCATAGATTCCCGTATTATGGAAAATAATATTGATCAAGTGACTAGTCTAT
Ext4   J03   AX00006783   TTGCATAGGTAGTTTAATTCCTTCATTCATACAATATTATGGAAGAACCCCTGAT
Ext4   J05   AX00006784   TTAATGAAATTATTGCTGATAACCCTAAAAGATTTGAGAGGACTGCCAATGAGGT
Ext4   J07   AX00006785   ATAATTTTTATGAAAAGGTATTTGAGGTGTATAAAATGGGAGGATGGCCTTGTGG
Ext4   J09   AX00006786   CTCGTACAAGCTCGTAAGTTTTAATCTACTTGTCACGATGCATACAAGGTGTCAT
Ext4   J11   AX00006787   TTGTAAATTTTGCGGAAACAGGTTATATTTTATTGAGAATGATAATCAACGATTAA
Ext4   J13   AX00006788   TTTGCTTACACAGAACATGGCTAAATTACGCTGTCCCTTTAGCGCGTTTATTAGG
Ext4   J15   AX00006789   TTTGCGTTCTTCTCCACTGATATTTACGAACATTTCCTTCATAAAATGTTCCTTTT
Ext4   J17   AX00006790   TAAAGATACGATTTGGACAAAAATTGAACAGTTGGCAGAAGAACAAGTGAAGAA
Ext4   J19   AX00006791   CGGTCATAATAACCGATGTAAGAGAGAAATAAGCAGAACGGCACTTAAAAATGC
Ext4   J21   AX00006792   CGTTACTTCAATTTGTAGTTCTTTCAATCGTGCTACATTTGTTATTTGATATAGTT
Ext4   J23   AX00006793   ATCAATGATTCGTCAAGCTATATCGATTTATCGACAAATAGCAACAATAAGAAAA
Ext4   L01   AX00006794   GTCTCAAGGCGGAGCAAAAAGAAATTATGAGAGACATTCGTGCTTTAGAAACGC
Ext4   L03   AX00006795   AATTAGCTCAAAGTGGATATGGTGGAACGTTTATAATTATAAAACCTAATGAAAA
Ext4   L05   AX00006796   TTAACGGTGGGAATTTTTCAGTTTTCTAAAACAGATCAGCTTGCTACTCATGGGC
Ext4   L07   AX00006797   TGAGGAAGAACGAGAGACGAGAAACGCACAATTGTTGTACATTTTTGAATTAAG
Ext4   L09   AX00006798   AGAATTTGCAAACGAGCCTTTTACTCCAGCAGAGCGACAAAATAATAAGAAACG
Ext4   L11   AX00006799   AAAGGACAACCTGAACCATTAAGCGGATCTCATAAAGTAAAAAACCGTAACCATT
Ext4   L13   AX00006800   TACACAAAATTTCCAGACGTGCTATAGTCTCACTAACAGATGCAAAGGGGCGAA
Ext4   L15   AX00006801   GTAAAACGTCAATATAACGTTAGCAACCATTTACAAACACGCATCGACACACATA
Ext4   L17   AX00006802   ATGTGCTTTTACACTCTCCCTACGCTGGCATTATCCAACAGGTTCAAATGGTCAA
Ext4   L19   AX00006803   TGATTGAAATTACGGCAATGATTGGGGTTGTTGTAGGAATTTCACAAATTGCAAA
Ext4   L21   AX00006804   TAAGGCAAGATATTAAGGATATACGATTAGAGATTAGAAGTTTAGAAATGCGGAC
Ext4   L23   AX00006805   AAAAGTTGATGGTGCGGGCTCTATTGAGGGACATATAGATGAGACAGATAAAAA
Ext4   N01   AX00006806   AAAACGTAAGAAGAAACTTTCGTTTCATTGGTATAAACGTGTGGTCGAAACGAG
Ext4   N03   AX00006807   AACAATACAAAGGAACGGTTTTAATTGTCTCACATGAACCTTCTTTCTATGAATC
Ext4   N05   AX00006808   CAAGGGATATGGTTAAATCGAGATAACTCACAACTCAAGTACGATATTCCTACTA
Ext4   N07   AX00006809   TACTACTATGGAGTGGCTTTTCCACTGTATTAACATTATCGAATGGTGATAAGTT
Ext4   N09   AX00006810   CGCAAGTGAAATTTTAGCTGTGGAACTTACAGATATTGAGAATGGTTTGAAACAG
Ext4   N11   AX00006811   TCTATCAGATGCTATGCGTTTGCTAGCTGGTTTTCTATTATCATTAAAATTATTAT
Ext4   N13   AX00006812   ATTATTGGTAAGACCACTTTTAAAAGTTGGCACGGTATTTGCTTTATAAATAGAC
Ext4   N15   AX00006813   AATCTCTCCAGATACTGCAGTCCGCTTATCAAAAGCACTAGGTGTTCCACTTGAA
Ext4   N17   AX00006814   TCTCATATTAGCAAATGTTTACTCGGATATACCACCGTTATTTCCAAGTTTACTAA
Ext4   N19   AX00006815   AACTGTACTCGTTTTCGGATGGTTTACGATCATGACTGTTCTATATAACGGGTAT
Ext4   N21   AX00006816   GCAAGTTGGAGCGGAATTTCATGTCGGAATTTTGTTTGTCGCATCATATGCTCA
Ext4   N23   AX00006817   AGAAGTTCTCTATCAACGCGAATTTCAAAAAGCAGATCGTGCAGCAGGATATCG
Ext4   P01   AX00006818   AATGTAAAATTCCTTATATCTGTTGTATCGGAAACATTTTGGACAGGAGTATCTG
Ext4   P03   AX00006819   TAGAAAACCAGGGCGGAAATGGTTGTTCAGTGTACTAGTGATAGGAATGTTAAG
Ext4   P05   AX00006820   CCATCTATTACGTGTTCATGAGTTTACTGTGGTTTTTCTATTTAGATCGATTAGG
Ext4   P07   AX00006821   GAATATACTACTACATATAAATTAGAGCTATCCGAACGATTCGATTATGTTACGA
Ext4   P09   AX00006822   ATACGAAAATACGAGAAAAGAAGCGAATTTTTTCGAAACTTTTGCGGGAAAATAT
Ext4   P11   AX00006823   CGCTTCAATCACTGTCGGCTTTTCCTTAAAAGGCGCAATTCCATACGCTACATTA
Ext4   P13   AX00006824   AATGCTATTACAGCATGTACTTCCCTATTCTCCTTCTATTAGCTGGATTCTAGGT
Ext4   P15   AX00006825   AAAAAAGGCCCGAGATTAGATTTTTTTGATTTTGTAGTTACAGTACTCGTATGTA
Ext4   P17   AX00006826   CTATCGCTCTTTCTCTCGCCCTATTTAGCTTCTTTGCAAACTTCACTATTCTTTTA
Ext4   P19   AX00006827   TTTGCAACATATTGTATTGTGTTGGCTTTTTTCGTATGAATGGTTGGTTACTCTA
Ext4   P21   AX00006828   ATTGTATGAAAAACGTTATAAATGTTTATGGGATGATTTTCTGTGGGCAGTTACC
Ext4   P23   AX00006829   ATTCCAAAAGTCAGGTAGCTGATGCAAAGTTCCATGAAAAACAGAAACCTGCCA
Ext5   A01   EMPTY        -
Ext5   A03   AX00006830   TTATTATCGGTGCTATTGCCACATGGCGTATGTTTATTCGTGTATCAAAAAGAGA
Ext5   A05   AX00006831   CGACCCGCATTTACAATCTGTACTCGTTCCAATTGGTGATGGAATGACGATTTC
Ext5   A07   AX00006832   CAAAAAAGCGCCCTGCACAGCAGGACGCTTTCTTCATACATATATTATCCAGTTC
Ext5   A09   AX00006833   AGAGCAAAATGAGAAAATCATTGAGCTGTTGATGGAGATAAAGGAACAAAATAAA
Ext5   A11   AX00006834   TGTTGATGCTATGCCAGAAAACGAAGCGCTTGAAATTATGGGAGCGTCATGTAC
Ext5   A13   AX00006835   TCGTTCTATTATTGAAAAATACAACCTCAAAAACATGGTGAGATATTTGTGTGGA
Ext5   A15   AX00006836   TGGTGCATTTGACCTAAGAGATACACGTAAAGAAAAGTTGGGAAGGAAAGTTAG
Ext5   A17   AX00006837   ATGCTTCACCTTTTCAAGTATGTACCAAGTGGAAAAAATATCTCTGTATAATTTTT
Ext5   A19   AX00006838   TATTGGTAGTTTATTAACGTTAGCGATGGCATGGGGTATTTCATTAGGCGATACG
Ext5   A21   AX00006839   CTCACATTCTGAGCGAGCCGCTTCCGCTTTTATTTCTATCCAGTTACGCCTCTTA
Ext5   A23   AX00006840   GTTAGCGTTAGGTATTGCTTATATTGCAGGACATATTTTAACAGCACCAGGAGTT
Ext5   C01   AX00006841   TAGCGCTTATCCCAGTTCTTTGTTTAGTAGTTGGGCCAATATTTGCGAATTCAGT
Ext5   C03   AX00006842   GCCACGCAATATACCTCTTATAATTGAATACGTAGCCTTTTTAGGTTTAATCTGT
Ext5   C05   AX00006843   TTCTTATATAATAACAACACAATAAAATTAAGATGGTTCAAGTGGGAGGAAGGCA
Ext5   C07   AX00006844   TGGCTGTTTTTATCCAGAAGGATATATTAATCCTGAGTATACATTTGTATTTAATC
Ext5   C09   AX00006845   TTTAATTATTAAATCGGATGAGTTACCAGAGGAAATGTGGTTGGCAAGTGACAAA
Ext5   C11   AX00006846   TATGGTATCATGAAGAATCAGAAGAGTTGAATCAGGTAACTAGTGAAGTTGCAG
Ext5   C13   AX00006847   GTTTATTTTGTTTCATTTCATTATGGAACTCCATAGGTACTATTATTTAAGGAAGC
Ext5   C15   AX00006848   GGTGTTCTTATTATTGGCGCAATTTCACTTGGTGCAAATAAATTCTTTGAACTGA
Ext5   C17   AX00006849   CTGAACGATATAGGAAAGCAATTAGGATTATCAGAAGCAGATGTATGTAGAATG
Ext5   C19   AX00006850   TTGATGCGTTTAGACTTCTCCCTTAGTGTACCCATATTATTAGAACATCCTGTAA
Ext5   C21   AX00006851   AAATTATGACGACGAGGGAAGCATGTGATCGTTGGGAGATTACGCTGGATAATC
Ext5   C23   AX00006852   AGATCTTGTATTATTTATTTTTGAAGGAATAGATGCAAAAAGAGCTTTAAGAACAC
Ext5   E01   AX00006853   ACAAGTATGAAAGATGCATTTGGAATACTTACGTTCTATTATGTGTTAATGGGTG
Ext5   E03   AX00006854   ATATTATAGTACATGAATTAATGGAGAAAGGTTTTGATGAACGAGACAATATAAA
Ext5   E05   AX00006855   TGGATGCTCAAGCAATACAAATGCTTATCGGTAGTGTAGGTTTTCCTATTTTCGC
Ext5   E07   AX00006856   AAAAATTTTTCTTAACACAAAAGTAGAAGAACGTTTCAAAGAGTTGGTTCAAGAA
Ext5   E09   AX00006857   AAAGTAGCTATGAGTATATCAAAGTCATTAATACACTTGTATCTGAAATGGCTGA
Ext5   E11   AX00006858   AAAGGCACAATTTCAATACTGGTTACGCTTATACGAACTCCATGGAGAAGAAGG
Ext5   E13   AX00006859   AAAAAAGAGGTATCGTACAAAGTATGTCTCGTAAAGGCAACTGTTATGACAACG
Ext5   E15   AX00006860   ACTTGTTTAATGTAGAAGCAACAGCTTTTGCGTCGATAAGAGCGGAAAATACCA
Ext5   E17   AX00006861   GCTTAATAAAACTGCAGAAGCTGTTGCTAGACATGACGAAGATCTTTCTCGTAAT
Ext5   E19   AX00006862   AAGTACAACACAAGCGGTTACTTCAGCAGTAGACAGCAAAGATAATAAAAAAGAA
Ext5   E21   AX00006863   AAGGTATGAAAGAGCAAGTATTACAAGTAACAAAAGGTGATTTCGTAGGATCAG
Ext5   E23   AX00006864   AAAAGAGGTATCGTACAAAGTATGTCTCGTAAAGGCAACTGTTATGACAACGCA
Ext5   G01   AX00006865   CTTGAACCAAAGAAAAAGGGGCGTCCATTCATGAAAAATAAAAACACAAAACATG
Ext5   G03   AX00006866   ATAGAAGAACAAAAACAACTGTGTCATTAATTAACTACCATTTTGTGTTTTGCCCG
Ext5   G05   AX00006867   TCGTGATAGTGTTGGGGCGATGAATATTCGCACCGCAACTGTGATTAATGGTAC
Ext5   G07   AX00006868   GCAATCCAAGCAAGGAAAGAAGAAAAATAAGAAAAAACAAAAAGAGAAATTAAGT
Ext5   G09   AX00006869   GTTCAGCTAATACGTGATCCAGAACAAATACAGCAGCTTAAAGAGTATTTTAAGG
Ext5   G11   AX00006870   TTTCTATTATGGCATGAAGCGATTGCTATATATTATGTAAATGGAGCAACAAGTA
Ext5   G13   AX00006871   GAGAATAATATGGAAATCGCAATGGCAGTTTTAAAATTTATAGGTGGAGCAATCC
Ext5   G15   AX00006872   AGTATAGAACAGACAAAAGTTACTGTAAAACAAGATCCGCAAACAGGCGGGTCC
Ext5   G17   AX00006873   AAAGAAAAAGGGGCGTCCATCCATGAAAAATAAAAACACAAAACATGATACTAAA
Ext5   G19   AX00006874   AAAAAGAGGTATCGTACAAAGTATGTCTCGTAAAGGCAACTGTTATGACAACGC
Ext5   G21   AX00006875   TAAAAAATCGGAGAAAAAAGCACTTTGGATTACGATTGAATTTTTAGTTCTTTTCT
Ext5   G23   AX00006876   GAGAAATTTAGCACTCGTGAAATTGAAGATTTAATGGGAATGCATAGGCCTTGTT
Ext5   I01   AX00006877   CGGCAGATTTTGGGCTAGATGAAATAGGAACACATACACTGAGAAAGACGTACG
Ext5   I03   AX00006878   AAAGAGTTGGTTCAAGAAATATGCGGAGAAATGGATGTTGCTATTGTCGCAATG
Ext5   I05   AX00006879   AAAGCGAATTTAGTTGGTATTAAGGTAGAATATGTGAACCCTGCTTATACAAGTC
Ext5   I07   AX00006880   GAAGACTTAGTAGATGCCACGCAAAATACGGATGCTTATACTGAAGTATCTGCA
Ext5   I09   AX00006881   CAACGAAACAAATTCCCGATACCACATAATTATAAGAGGACAATAAAGCATCAAG
Ext5   I11   AX00006882   AATGGATTTAAAGAGCTTCGTAAAGAAGCATTCTTACGCGTGTTCCACTCCGATA
Ext5   I13   AX00006883   ATGTATCCGACTGTAGCATTTAACGAGGAAGAGATATTGAATCGTCTTCTAGATG
Ext5   I15   AX00006884   ATTTCATGGCAATTCTCTAAAATTCATATTGCATTATGTGAAATCACTGAGGTAAC
Ext5   I17   AX00006885   CTATTTAAAAATACATGAACTTAAAGCACTTGATTGTCTCCGAAAGGCAACGAGT
Ext5   I19   AX00006886   TAACTGATTACGGTCATTCTTTAGATTCTATACTCGATACTCTTTGTAACTGGGG
Ext5   I21   AX00006887   TGTAGTGGTTTTAGTAGCTCTATGGATAGGTACTCTTAGATCCTTACTTAAGAGA
Ext5   I23   AX00006888   TCGAAATATTACATGTTGCTTTGCTTTATTTGTAGTGGTTTTAGTAGCTCTATGG
Ext5   K01   AX00006889   ATTTCATGGCAATTGGCGGAGATTACAATTCCATTACGTGATGTGATTGAGGTTA
Ext5   K03   AX00006890   TGGCAAAGAAAGTTTTAAAGGTTGTAAAAATACAGCTACCAGCAGGTAAAGCAAA
Ext5   K05   AX00006891   TTTAAAAGTTGTAAAAATACAGCTACCAGCAGGTAAAGCAAACCCAGCTCCACCG
Ext5   K07   AX00006892   CGAAGCGCTTGAAATTATGGGAGCGTCATGTACGACATGCGTATGTACATGCAG
Ext5   K09   AX00006893   ACACTTGAAATTGAAGATTTTGATGCAATTGAAATGGTTGATGTTGATGCTATGC
Ext5   K11   AX00006894   AATACGCTTGAAATTGAAGATTTTGATGCAATTGAAATGGTTGATGTTGATGCTA
Ext5   K13   AX00006895   TTTTTTACGGGAGAGGTCTGTCCAAAATCAGAAACAATATATATATAAATTGTTTG
Ext5   K15   AX00006896   AAAACATGATACTAAAAAGATTCCGGCAGAAGGTTCAGTTGAAGCGTTACAAGC
Ext5   K17   AX00006897   AAAGATGGATGCAAGACCAAGACCACAAAGTAAGTCGTGAAATCATTGACTTTG
Ext5   K19   AX00006898   AATTAAAGGAGTGACATCGAAGCGTTTGAGAGAAGAGGTTCCTCATCTTCAACA
Ext5   K21   AX00006899   AAAGGAGTGACATCGAAGCGTTTGAGAGGAGAGTTTCCTCATCTTCAACACTTG
Ext5   K23   AX00006900   AAAAGATGTTGAAGCGAATCTTCCAAGCGCAGTGAAGAACCAAGCAATTAAAGA
Ext5   M01   AX00006901   GCTTAATAAAACTGCAGAGGCTGTTGCTTCTCATGATGAAGAATTATCACGTAAT
Ext5   M03   AX00006902   CCCAAAAGTTTGCATATGGAATGTTAGGATTACAAACCCCTATCTATTTTATTTTT
Ext5   M05   AX00006903   GGAATGAGACAGGGGGAATTACTAGGTCTGCGTTGGAAAGATGTTGATTTAGAA
Ext5   M07   AX00006904   TCAAAAAACTAGGAAACGAACACTTGGAATTTCACTAGAATTTTTAGTTCTTTTCT
Ext5   M09   AX00006905   CATGGATTTTCTACATATTTTCTTACAAAAAGTGAATATTTTTCGAATTTTTACTTT
Ext5   M11   AX00006906   TGCAGTTACAGAGTGCTAACAATGCAAAATCAATTATTACAAATTTTATCCTTATA
Ext5   M13   AX00006907   ATTATATTCCAAATGGGTATTCCACTCACTTTTACATCTATAAAAATCACAAAAGT
Ext5   M15   AX00006908   GTTTGTAGTGACAAATGTTTATAGATTTAAAAAGGAAAACATAAAAACTTCACAGA
Ext5   M17   AX00006909   TGGTTGATATTGTACTAGAAACTGTTCAGCCAGTAGGAAAAGGTTTATAT
Ext5   M19   AX00006910   AAAGGAACTTCAAAATTAAATCCTCTAGTTTAAAAAATATGGAAGAGGTAATTCC
Ext5   M21   AX00006911   TGATAAGGATCAAAAGAATATAATTATAGACCTTTTACTCTCAGATATTTTTAATA
Ext5   M23   AX00006912   TAACCTTTTCAAAAATGAAAAACTATGGTTCTTTTTACAACTTAATAGTTACAATA
Ext5   O01   AX00006913   CAAATAACGATAAAGAAAAACAGCTAATTATGGCTAAAATTACAGGTAATTTCAAA
Ext5   O03   AX00006914   GCATTAACTACACTTTCTTTCATAGTAAAGAAGAATTGGAAAAAACTTAATATCTC
Ext5   O05   AX00006915   CGAGCACAAGAACTTTTTTCCAGAAAAAATTACAGTGTTACTTTTTTGTTACAAAA
Ext5   O07   AX00006916   AAAACACTTATATAGAATAACTCTCTTTTTCATACAATACAATATATTATACTACAG
Ext5   O09   AX00006917   CATTGACACATATGAGTAGGCGCTCATATAATAAGAGTATAATATATATGAATGA
Ext5   O11   AX00006918   AATAGAGGAATTGAGAGAGCAGAAGTTTAGTCAGCGAAAAGCTGAATATATAGT
Ext5   O13   AX00006919   CATATCGAAATGATTGGTATGTGGATCTACTAGAATACCTCGATGTTGGAGTTGG
Ext5   O15   AX00006920   TACTCAATATTATAACCGGTCAAGAAGTAAGATCATCCTCAATAGTTGTAGCAGC
Ext5   O17   AX00006921   GTACATGCAAACGAAAAACATAGCATTACTCATGGAGATATTCAATCATTCGTCA
Ext5   O19   AX00006922   TTTTTCACGCCGTGAACGTGGTTTCGGTAACAAAATCATTTTTGAAGCAGCGAG
Ext5   O21   AX00006923   TCCTTTAGCGGTCCATCTTGCAGAAAGGGGCCATACTGTACTTGGACTAGACAA
Ext5   O23   AX00006924   GGAACAAGTTCGCTTAGCTGATTTTCGTGGGAAAAATGTAGTTCTATATTTTTAT
Ext5   A02   EMPTY        -
Ext5   A04   AX00006925   AGTAGCGAGCGAAGCGAAAGCACATACCTTTTGTGATGTAGTTAGTTTACCAAA
Ext5   A06   AX00006926   GTAATCGAAGAAGAGGACGTGTATTTAAGTGCGTCAATTGGAATCTTTGGCCCC
Ext5   A08   AX00006927   AACTAACTGGCTTACAATCACTTAACTTGGAAGAAAACTATGTTTCGGATGTATC
Ext5   A10   AX00006928   TCATTAGGCCCTTCATTACGTGGAAAAGTTCCAATCCGTAATCAGGAAAATGAAA
Ext5   A12   AX00006929   AATAAAAAAGCATATGTTAACAGTGAATGAAGAAGGTATTACTGCGGAAGTGCTA
Ext5   A14   AX00006930   AATCGCTTTCGCTATTGCTGTTATGCTTAACTATCCGAACTTAGAACAACAGAAA
Ext5   A16   AX00006931   AAACGGAAAGGTAAGAGGTATTGGGTTATTTCGAGTTCTGTTTTCTTCGACAATG
Ext5   A18   AX00006932   GGCTTGTTGCAGACTATAATAAGTCACAAAATAAATATGAGATAAAGGCAGAATT
Ext5   A20   AX00006933   ATGGTGTAAGCATAAATGACTCATCTTGTGTGAGTTGTGGGCAGTGTGTAACAG
Ext5   A22   AX00006934   AAAGTAGGATATATACTGTATGCAAGTAGAGCTCACTTAAAGAATGTGAAGGCTG
Ext5   A24   AX00006935   ACCTGCACAATTAACTGGAATAGATGCATTAACTGTCGGCCGTCAAGCAGTTTA
Ext5   C02   AX00006936   ACGTATTGCGTTTAACCCATTCTTCTCATCGCTCTAAACAAGGGGTAGAGGCTG
Ext5   C04   AX00006937   AGAAAAAGCGTAAAAGACATCGTATGTTAATCGCTGCTGCTTGCTTATTGATTGG
Ext5   C06   AX00006938   TTCCGTTCGTACTGTCCATAGATACATAGTAGATTTAAGTGATATGGGATTACCC
Ext5   C08   AX00006939   AGAAAGAAACAGAGCAGAAGGAAATGAAAATGAATCAGGAAGTAACTGCGCCGA
Ext5   C10   AX00006940   ACCTCGCACAGGTTGTCGCTTCCAAGCACGAATTCCATGGATTAGACCTGATCA
Ext5   C12   AX00006941   GATATGTTCATGAAGATACGTTAAAGAAAGTAGAACGAGCGATTGAGATGCTAG
Ext5   C14   AX00006942   CTTAGCTTTGGGATTGGTTTAGGAGTTTTATACGGAGGATCCTCAGCTCAAGCA
Ext5   C16   AX00006943   GTTGCAGAAATCATCGCAGGAATCTTTGTAGGTAAAAGTGGGTTTAATATTATTG
Ext5   C18   AX00006944   TATTCCGGCTCTAAATTACCTATGGAATTTTTACCTAGCATCGATAATCCCGCAG
Ext5   C20   AX00006945   TCAAGAATTGGTGATGCTCGACCCCATTTTTCCAAAGCCCTATATCATACTGCCA
Ext5   C22   AX00006946   CTTTTTTTGAAAATGGAAATTATACAAAAACATTCCCCGTAACAACTGGAAGAGA
Ext5   C24   AX00006947   TAATACTAGCCATCGTTTCCCTTATGTACTATAGCCCAGGGCAACTCCATCATAC
Ext5   E02   AX00006948   GGAGTAGGAGTGTTGGGATACCAAAGAATAATTGCGCAATTTGCCGGTTATGAT
Ext5   E04   AX00006949   TTCCACTAGGGCTGTTAGAATTTCGTATGCATGAGTTGGATAAAAAGAAAGAGTA
Ext5   E06   AX00006950   CGGGATTAAATACATGGGCGATGGACTGCAACAAGCAGCTGGAGATCGTCTTC
Ext5   E08   AX00006951   TGACCTTGGCATTGGTGCTGGCGCGATTATTTTTGGATTCATTGCACATTTTACA
Ext5   E10   AX00006952   AATCGAGCTTTTTTAGCGAGCCGTTTACATGTATCAACGAAGACGATTCAAAAAG
Ext5   E12   AX00006953   CAATAGTACTAGCAGCACAGAAGCAATTACAATTGAAATCGTTGGAGCAGTAAC
Ext5   E14   AX00006954   TTCTCATATCCAAACGTTGCCGATTCGGTATTTTGATCATTTACCGGCGGGGAA
Ext5   E16   AX00006955   ATGTCTTGTAACTTCAGGGCCAGGGACATCAAATTTAGCGACAGGTCTTGTTAC
Ext5   E18   AX00006956   TTAGTGACACACGGTGGTGCTTTCATTTCAGCAACGTTAGATAAGCCGTACGTT
Ext5   E20   AX00006957   GCCACATTCGAAGGTACGAAAGCAACACTATTCGAAAAAAAGTTTCTATGGAAAA
Ext5   E22   AX00006958   GTTGCCGTGCTTGGTGAGCCAGATGAATTATGGGGAGAGCGTGTTGTGGCAGT
Ext5   E24   AX00006959   TTCCATCAAGATATGGAAACACAAGAAAAAGCCTTACACGAATTTATAGAAGAAG
Ext5   G02   AX00006960   GAGTCTGGAAGCGGAAAGAGTGTAATGGCGAAGTCCGTTATGTCTCTCGTTACG
Ext5   G04   AX00006961   TCAATTCGGTTTCTTTGCTCATGAAAAACCAACCTATATATTTGGAGAACTCGAT
Ext5   G06   AX00006962   AGTTCCTGTCGGTTTTGCGGTAATCACGATTGTTTCAGCTATCGTAGGCTGGTA
Ext5   G08   AX00006963   AATTTACCGTATTGCGGTAGTGGGAATGGTATTATTCGGTTCTGTTGCGACGCT
Ext5   G10   AX00006964   GGCGGAATGAACAAGTAAATCCCTGGGAAGATTCATTTGTTCGTTGGTTATTATT
Ext5   G12   AX00006965   TTTACATTGGCTGGAACGGCTGGGTTTGGCTTCATGCGGTATTTGGCTGGGAG
Ext5   G14   AX00006966   ACTATTATCCGGTCACACGCACCGCGGACAAATGGCACCAAACCATATTGTAAC
Ext5   G16   AX00006967   ATAAACGTTATGAGTATGTAAAAGATAACGGTGTGAAAGTATACGGGATCGTCA
Ext5   G18   AX00006968   AAATAGAAAGAGAGATTGGTAAAGAAGCCTTTAAGAAAGGGAGATTCCAAGAGG
Ext5   G20   AX00006969   CAAACCTGTCTGGACATATGTATCCAGACCAAAGTTTATATCCAGCGAACAGCG
Ext5   G22   AX00006970   CAAAAGGTTCTTTCTCTCATGCCGAAGGATCAAAAACGAAAGCAACTGGACATA
Ext5   G24   AX00006971   TATCACCTAATACTACACTTAATACACGCAATACAGCGCAATCATCATCATCTATA
Ext5   I02   AX00006972   GCTGGATTAGATAAGGATCAAGATTTCTTTATGGATGGGGGAAAGGGATCTGGT
Ext5   I04   AX00006973   CAGTTGAAACGGATAAAGGTACGTATAAAGCGGATCTTGTTTTAGTATCTGTCG
Ext5   I06   AX00006974   TTAGATCCACTCAGGAGATAGAACAGGCGCTTGTTATATGGAAGCAAGGACGTG
Ext5   I08   AX00006975   AGAAAGTGCTGGGGCAAAAGTAAAAGATGATAAATTATCTGGATCATTAACTGTT
Ext5   I10   AX00006976   CATTATTTCCGAATTTAACAGCACTTGAAAACATTGAATACGGCTTAAAGGCAAA
Ext5   I12   AX00006977   AACCAATCGGTAGCAGCGAGTGATCGCACGTATGATACTGAGATTAAAATATAT
Ext5   I14   AX00006978   CACTAATTCAGGCAATACGGAAACGGATAAACCAGTTGATAATCAAAATATGATA
Ext5   I16   AX00006979   AGAAGGGTATGTGAAAGCGTTAGTGGATAATAACATATCAAAAGGTGATGGAAA
Ext5   I18   AX00006980   ATCAGAGTTGTACGGAGAAGAAGGGGAAGTAACATTCGATAAACGTAGCGTGG
Ext5   I20   AX00006981   TTAACGAGTGGGTTAAATAGTATGGAGACGATTCAAGTTAGTCAAGAATTGGAC
Ext5   I22   AX00006982   AATACTGCAATGCAATTATCAAAAATCGGCGGAGGAGTAGCTTTAAACTTATCTA
Ext5   I24   AX00006983   CACCTCTAAACATGGAAACAATATTTGGAACAATTAACCCTAAGAAAGGTAAGTT
Ext5   K02   AX00006984   GATGTATTGTATCACTGCTTCGTGTTATTAGCCGAAAAAAATATACCATTAGAAG
Ext5   K04   AX00006985   ATTCTTTGATTTCGTCGATTTTGTGGTAAGTAATGTATTATTGCCACTCGGAGTA
Ext5   K06   AX00006986   TGGTTGGAAGTTTGGGGTAGCGCTCATTTATTTGTTGTTTATTCATGAAATGGGT
Ext5   K08   AX00006987   GGAATTATTATTGTTCCGTTATTAATCGGATTACATAGCCTGTCACCACAACTTG
Ext5   K10   AX00006988   AGCTGTTCCGCAACCGACTTTAATTTATGATGCAAATAATGAAGTTGCGACTAAA
Ext5   K12   AX00006989   CAAAGCTTGTGGATGGAGTAAAGGTTGGAAAGACAGACGTTTATGTTGGCAATG
Ext5   K14   AX00006990   ATGTAGTCCGTTGGATCATGATTTACCAATTTCAATCATTGAGGATGAACTGCCA
Ext5   K16   AX00006991   TAAAAGGTGGCGTATATAAGCATTCAAATATAACTCTTTTTGTTAGTAATGGGTA
Ext5   K18   AX00006992   CAGGTGATGGAGAGCTATATGAATCTCTTACTAGAAAAGAAAATTTTATGTTACT
Ext5   K20   AX00006993   TCCCATTTGTCGGCGTATGGACACCAGGCGAGAACGCACCTTTCCTATGTATCG
Ext5   K22   AX00006994   TATGGATGTTGTGGGAGAAATATTCCGCTCAGCCCATACGTTTAAAGGTATGTC
Ext5   K24   AX00006995   TAAAAGCAGTACGTGCCATTATGTGTATTGAAGCGCTACAAAATTTAGGTAATGT
Ext5   M02   AX00006996   CAACCGTACGACGGAAGTTGGTTCAACGATGAACACTATTGATACGTTTAAGAC
Ext5   M04   AX00006997   TATTAACGTAATGAAAGTACGTGAAATCATTAATCCATTCCCTGTTACAACTGTG
Ext5   M06   AX00006998   ACTTTGAGTGGATGAATGATTTTTCTGAGGCGCGTAATTTCGCAGCATCTAAAG
Ext5   M08   AX00006999   AGCTCCAGATTTTACCTTTTGGAAAGGGGAAATTTATTTTTTACAAAAACGTTATA
Ext5   M10   AX00007000   AGAACATCGAAAGATACCGAATCAATTAAATCGGGAATTTAAACAAAATACGCCA
Ext5   M12   AX00007001   GTGAGTATGTGGAGAAAATGCCGAAAGATTACTATTTATATTGCGTTATTGATCT
Ext5   M14   AX00007002   GCAGTTAGTCTTGGTATTACGGTCTCCATTTTTGCTGCACAATCAATTGGTGCG
Ext5   M16   AX00007003   GGAGAATGATAAAAGTTGCCCTGATATTGATAATTTAATTTTACTAAGCGAAATG
Ext5   M18   AX00007004   AGAAGGAGAACCACAGAAATTTTTATATAAAACAAAGATCGGATTTGGGCTTGAA
Ext5   M20   AX00007005   TGCCAGAAGAAGCCTTTGGGAGGGTAGCAAGCCTTGATATGTTAGGATCTTTTG
Ext5   M22   AX00007006   GATCTGCGGTAGCAGCTTTCTTTGTTGGGAAGTTATCGCAAAAGTATGGTCGCC
Ext5   M24   AX00007007   CTTGAAGATGATGCAGCTATCGCTCCAATCTTCCAATCAGGACTTGTATATTTAG
Ext5   O02   AX00007008   GATTATATATGCCTGGTCCTGACAATAAACCTGTTCCTGCAGCTGCTGAATCATA
Ext5   O04   AX00007009   GTGGAATTTTTGCTCGGCGTGGTTATTATATTTCTTCATTAAATTTAAATGAAAGT
Ext5   O06   AX00007010   AGCAGGAGCCGACGCGATTGTCGGAAGTCATCCACATTGGTTACAAGGGTTTG
Ext5   O08   AX00007011   ATCCATCTAATAAGCCTCATTTACAACCAGCGGATGAAGTGTTATCACACCTTGT
Ext5   O10   AX00007012   AGTAATGGCAATTTGGAAATACATATACCTATTTCAAAAAATGACGAGATTGGTG
Ext5   O12   AX00007013   AGATGATGCCGATATGAGCTTTTGCATTAAAGGTGATAAGGGGTTACATGTGGA
Ext5   O14   AX00007014   AAACTGGATATGAACAAAATATGTTCCCTTTCTTACAGAAAAATGATTTCCGTCC
Ext5   O16   AX00007015   TTAAACTATGCGAAGTCTCTTTCTGCAGATCAAGTTATCGCTGTATATGTTGCTT
Ext5   O18   AX00007016   ACGAAAGAGCAGTTCATTGATATTGTAAACCGTGACAAAGTAGCTGTTATTGGAC
Ext5   O20   AX00007017   TATATATCGCAAAATCCTCAAAATGCAGCTGAAATCGTATTTGCTACAATGAAAG
Ext5   O22   AX00007018   GTCGTGCTCACCCAGTGTTCGGGATTGTGTTTACAACAGTTTTATACTTGGCGA
Ext5   O24   AX00007019   TTCATTTAAAGTTTCGGCCGTTTCACCGGGAGAATATGAAGCAGAAGGTATGTA
Ext5   B02   EMPTY        -
Ext5   B04   AX00007020   TTGGAAAATGACACTTTTACTTTTAACGGTTATTCCATTATCAGTACTGATTTTAG
Ext5   B06   AX00007021   AGTTGGTGATTTTACAGGAAACGGGAAACGAGAGTTGTTAATCGGGATCTCTGT
Ext5   B08   AX00007022   GGTTTCGAAGCCAACATGTTAAAAAAAGAAAACTGTTGTTTAATTGCGCTTGCAT
Ext5   B10   AX00007023   TTTGTCAACTATATTGGAATCAAAGTATGACATTCATGGTATATGGAAAGGGTGT
Ext5   B12   AX00007024   TAAAAGGGATTTATTTACTACTTCTTTGTCTCGTTATTATGGGGATAGGAATTGG
Ext5   B14   AX00007025   CGGCATTAAGCGCTGGAGAATTGGGACGATATGTGTTCGTAAGTATGTCTTTTG
Ext5   B16   AX00007026   ATGTATATTGGTCAAATGATTGGAGCGGCAATAGCAGGAATGTTATTTGCAGCA
Ext5   B18   AX00007027   AGCCATTTAGCGATCTTATCAGTCGACCAATTTTATCAATATAATATCCCAATGG
Ext5   B20   AX00007028   ATGGTGATCTTTGTGAGAAAGGAAGAAATAGTATTGGCGTCGTAAACTATGTGA
Ext5   B22   AX00007029   AGCAGATTTTCATGCCGATGCAACAATGCAGGGCGGGGTTACCTATCCACATTA
Ext5   B24   AX00007030   AAGAAGAAGTAGCACAAATATTACATATTCCAATTGGTACTGTGAAATCTAGAAT
Ext5   D02   AX00007031   TACGCAACTTAGAAAATGAATTTGGAACTACACTTATTCAGCGCTCACCGAAGCA
Ext5   D04   AX00007032   AAGGATAGTGTTATAACTACTGGTGAAGATGAATCTTTCTTTGGTGGCGCGACA
Ext5   D06   AX00007033   AAGTTCCTGATTTTGCGGTGCTGCATATGGATTTTGAGGATATTCATAACTTGGA
Ext5   D08   AX00007034   CACTTCTACTGTTATGAGCACTTATTTTTATACACTAATGTCGCATTCGCTACTAC
Ext5   D10   AX00007035   CACTGCATGGAAAGTTGGAAAAATAGCGCAAATAGAAAGTAAACCTTTAACTCTA
Ext5   D12   AX00007036   TGCCCCAAACGCAATGCAAGCACTTGAACTATACGGCATTTCTAAGAAAATCAAA
Ext5   D14   AX00007037   GCAGAGGAGTACAGTGAACGTGCCGTATTTGATAAATGGGGCTACGTCTATATG
Ext5   D16   AX00007038   AGGCAATGGATAATGGAGCTATCGCTTCCTTATGGAAAAAGTCTTACGGTTCTC
Ext5   D18   AX00007039   ATGCCATTAATGATGTTTTCAAGTATTCCAATGTTGGGATCATATGTAATTACAAC
Ext5   D20   AX00007040   TGTTCACTACTACATACCAATACTCGCCAGAAAAGGTTGAGTTATACTTAGTAGA
Ext5   D22   AX00007041   GTATTGGATATTTACTGGGAACGACACAAAATAACGATGTGTATTTCTTTAATAT
Ext5   D24   AX00007042   GGTCTTAAAGTATGTTCACGCTATATCGTTACTAAAGAAGAACATATATCTGCTA
Ext5   F02   AX00007043   ATAGGTGGTTCAACGTTATTTTATTTCTATACAACAAACGCGAAATATCAAAAGTT
Ext5   F04   AX00007044   AATGAGAGAGCACTATTCTATTTACGTAATCAAATGAATGTACTAAATGAATCGG
Ext5   F06   AX00007045   AGAGCGTTTATAGTTACGGATACAATTATGGAGGATTTAGGATATGTTGAGAGG
Ext5   F08   AX00007046   CAACAATTTTAGTACGAACAGGCGCTGGATACGACGCTTTACATACGTACCGAG
Ext5   F10   AX00007047   ATATTTACGTATGTCCTCACAAACACAGTGATGGTTGTGAATGCCGGAAACCAA
Ext5   F12   AX00007048   TCCAAAGAAACCGATGACGAATCGATTTACACAATTATCAGTTCCAGGTTCTGTG
Ext5   F14   AX00007049   CTCGGATGGAGATATGATTTCTACTGCTGACGACTTAAACAAATTCTTCTCTTAC
Ext5   F16   AX00007050   GAGTATGGGATTTATCAATTATTTTCACGCTACGTAGTTGATGATTCTATTGCTT
Ext5   F18   AX00007051   AGGCGTTGGTGCAATATCGCTTGGCTCAGCTGCAATTACGATTGGAACTTCACC
Ext5   F20   AX00007052   ATTAAAGCAAATGTTTGACACGCTTTTTGTGAATTTGAACATTTCTACTCAACTGG
Ext5   F22   AX00007053   TTGTTATGTGTTATATGGTGAGGCAAGCGGAGAAGAACGAAGTGATACGAGCAT
Ext5   F24   AX00007054   AGGTTAAGAAGCGAGGCTACCAATCGGAAGAATTAGTTGAAACATATAGTGCGC
Ext5   H02   AX00007055   GAATTACTTTAGAAGAAATTGCTGGATCCATTAGCAGTAGCTTAAAAAAGAAAGC
Ext5   H04   AX00007056   GTGAGCGAATATTATTTATCCAAGACGGTCTTTTATATAAAGAATTAAAGCGTCA
Ext5   H06   AX00007057   GTTTACTTAGTCCATTAACGACAGGATTCCAGCTTTTATCTCTCGGTGCGATAGC
Ext5   H08   AX00007058   ATCTGCCTAGGTGCACTACCGTGTTTATTTAAGGGATTGCAAATTGATTTAATCG
Ext5   H10   AX00007059   TTAGAAGGCAAAGAGTATTTCTTAGAAGAAGGAGATGTTGTACGTATCCCACCA
Ext5   H12   AX00007060   AATCCTTGTAGAAAAAGAAGAGTACTTAGGTGGTAAAATCCATAGTGTAGAAGAA
Ext5   H14   AX00007061   AAAAATACGACTGTGATTGTCATTGTGAACCTCGCTACCAAGCGTATACATCTGG
Ext5   H16   AX00007062   TTATCAGAAGACAGTGGGAGATATAAAGTGTATCCTTCTTTTCCTTTCCAAGATG
Ext5   H18   AX00007063   CGATCCAGAGTCTAGTGATGTTCAGGCTTTAATTGTTGCACCAACAAGGGAACT
Ext5   H20   AX00007064   CATTTTGATAGGGACATGTATAGCTGCTACATTTGGTGAAATGTTAGTAAGTTGG
Ext5   H22   AX00007065   TCAATTACTATCGCAACTTCTTCAGCCGAAAGAGGAAAAATCTTTGATCAAAATG
Ext5   H24   AX00007066   AGGCTTATAAGAATCAAGTGGAAAACAGTCAAAATGCAACAACTAGCATACCAG
Ext5   J02   AX00007067   GAGAGCTTTTAAGAGTTCAGAGCCGCTACTCGATCGAGCTTTTGTCGTCATGAC
Ext5   J04   AX00007068   AGAAAAGTGGGCTCAAGATAAAGGAATTTCCACTCTGACTACAAACTATCAGGA
Ext5   J06   AX00007069   GCCGGAGCTAGGGGCAGAAAATACGTTTGAACAATGTATTAGTGAGATGGCACT
Ext5   J08   AX00007070   TCGGTAAATTAGCTCAGGAAAAGGGGCTACATATTGTATACCATCATCATATGGG
Ext5   J10   AX00007071   ATACTCAATTTAATAGGAAACCAGATAAGGATAAGTGGAGTATAGCACAAGTTTG
Ext5   J12   AX00007072   TTCAAGGAAACTCAGTAGAGTTATTCAATGATCAGCCACAATCGCCAATGATGG
Ext5   J14   AX00007073   ATATAGAATGGAGGCTCTTCAGGCAAAAGGTGGAGCTTTAGAGGGGCGTAAGT
Ext5   J16   AX00007074   AATGTCTGGATCACTTGGTTTACAAGCAACATCTGCATTTGCAGATTCTAAAGGA
Ext5   J18   AX00007075   CCAGTCTGGAAGTATATTATTAGGGAAGGACAGTGCTGCATTAATAGGAAAAGA
Ext5   J20   AX00007076   AAACATTACTTTCAACCACTATGGAGTTTAGTGGGGGGAGGAATTGTGTCAAAG
Ext5   J22   AX00007077   CGCGAACGCTAACATATTTCAGGTTCCACGATATGCTAATACATTAGAACAAGTA
Ext5   J24   AX00007078   GATGTTCAATTGGGCATTTCAGTGTAATGAAGAAAGTGATTTTATATCGACTTTA
Ext5   L02   AX00007079   TTGATTGCAGGTATTAACGAAGCAACGGAAGGTGAAGTGCTTGTTTACAACACG
Ext5   L04   AX00007080   TTATTGTCACTAGTGTTTACACAAAAGGACTATGTACCGCATATTGCTGTTGTTG
Ext5   L06   AX00007081   ATTGAAATGCCCCCAGCTACTGTTTTACGACTTACTTTATCAGCTGTATTTGGTT
Ext5   L08   AX00007082   ATAAACCTTTCGGTAAAGAAGCGGCTATGGCAAAACTTTTCGCATCTGAGGCTG
Ext5   L10   AX00007083   AACAACGGTTCGTGATTTACTTCATGCATTGTTATTGACAGGGAATAATCGTTCC
Ext5   L12   AX00007084   AACGCCAGAGAGTGTAGTGAAAGATGCACTTAAGGAAAAAACGGAGCATGTTTT
Ext5   L14   AX00007085   AAAGAAGACGAAAAAACTGAGGTAAACCAAGTCCCAGAGTTAACTGTACCACTT
Ext5   L16   AX00007086   TAGATACCTCTAGAACTGGTACTTTTGAAATAAAATATAGTGTCAGAGATTCTGT
Ext5   L18   AX00007087   ATTTCTTCCAATCCACGTTCAACGATAGGTACACATACTGGTGTTTTCACTGAAA
Ext5   L20   AX00007088   GTTTCTTTATTGCCAAGAAAAGCACAAGTTGCACTAAAAATGTTTGAGTTAGAAC
Ext5   L22   AX00007089   TATGGATATCACACGGGGCTCATGGGGAATAACGGAGTGAAAGTGGGTTCAAA
Ext5   L24   AX00007090   TAAACATGGCATCTTCTAATGATATTGTTTTGATTGCAGGGAAAGGGCATGAAAC
Ext5   N02   AX00007091   TATTTCTCGTATATTGGTTTGATGGACATAACCATATTGCAACGGCATTATATGC
Ext5   N04   AX00007092   CACTCGTTATCGTTTCTCACGATCGATATTTTCTGGAGAAAACAACTAATACAAA
Ext5   N06   AX00007093   CGATAAAGATCTTAGGGACAGTGATTTCTACTTTGTAGCTTTAACATTAAACTTG
Ext5   N08   AX00007094   AGCTGTTGGGATGTGTAACGAGTACATTCCGTTTCAAAGAATGACCGGTGACGG
Ext5   N10   AX00007095   CCTGAGGTTGTCAGGAACTTAAATATACAAGGAATACCGGATAAGGATTATGAT
Ext5   N12   AX00007096   AAGATGATTTTCATATAGGTGGAGAAGTTGAATTGGAGCATATTCTGAAATCCGA
Ext5   N14   AX00007097   CATCGATATATACTCAAATATTCCCGCTAGGCGTAAAAGCTGTTGAAAGGAACTA
Ext5   N16   AX00007098   CAGGAAAAGAACGCAAGAGAAAGTATACACATTCATATCGCTTTTGATGATTCAA
Ext5   N18   AX00007099   AATATTAACTCTACAGATCCACCAGAACATCGCAACGTACGTTCTATCGTTTCTA
Ext5   N20   AX00007100   TGGAGACTTTGTTTTGTGGAATCGCGAATGTGAAATTGTAACAGGATATACTGC
Ext5   N22   AX00007101   ATATAAGTATTATGAGTGAGGTTGGTGTCGGGACAACAGTAACGATTTACTTGC
Ext5   N24   AX00007102   ACTACAGTTCCTACAGGAATTGCTGAAATCGGCAGATATGTTCTTGGAATCTATG
Ext5   P02   AX00007103   TTACATAAGTATTGTGCAGATATTGCCACCTGGGATATACCTAGTGGTGGATTTT
Ext5   P04   AX00007104   GGACAATTGGAAGTAAGATCCCTAGTCAAAGGCAGTTAGCAAAATTATTTCAAGT
Ext5   P06   AX00007105   ATCGCTACGAGTTTGCAGAGTCCAACATATGCAAATAAAGAGCTACCACAAAATG
Ext5   P08   AX00007106   AAAATTAGGGCTTCGAAAACTCATCGCTACTGCAGGGATTGTGCTGGGACTCGG
Ext5   P10   AX00007107   GGAAGCAAATATCGTTACATTAATTATCTTTTTTTGCATGATAGCAATATGGTGTT
Ext5   P12   AX00007108   TCGAATATTTTCATCGAAAAATTTATACCTAGTGCTATAGATGACGAACAAATTAC
Ext5   P14   AX00007109   TAGTAAAATTAAAACAGTATTGCTTGATGATAAGAAGTATAAAATCACGTCACCA
Ext5   P16   AX00007110   TGCTGGTTTCAGCCTTGGTGGCTTAGCCGCTTTTTATGTAGCACTTCAAAATCC
Ext5   P18   AX00007111   CGGTAAACGCTAGCGTATTACATGTTCGTGCAGGATCAAGTACTTCTCACGACA
Ext5   P20   AX00007112   GAAGTTAGACCGCGAAACTGCGGCTTACTTTTCTTTTTTATTATCAACTCCAGCC
Ext5   P22   AX00007113   AAGAAGCTAGCTGTGTGGTCGTGTCTGTAGACTACCGCTTAGCACCTGAACACC
Ext5   P24   AX00007114   TTGGCAAATTCAACGGAACGAGAGAAGTCGTATTGCCTAATCTAGTATCAGTCA
Ext5   B01   EMPTY        -
Ext5   B03   AX00007115   CGCCTTCCGCTCTACTTTGTACAATATATGGTGATGTGTTGGCATATTGGAGTAA
Ext5   B05   AX00007116   GAAATGATGTATCATACAGGTGATCTCGTTCGTTGGTTGCCTAATGGAGAACTT
Ext5   B07   AX00007117   TTTCTTGCTAGTGTATCTTTTGATATTTCCTTGTTAGAAATATGTCTTCCTTTAAC
Ext5   B09   AX00007118   ACAATCAAACCCAACCAATTTCTTTTTCTTTGCAGCGCAGCAACTCTTTAAACAA
Ext5   B11   AX00007119   GATAAACATCCTAGAAATGCATTATTAGTTGAGGAATCACAACCAGCTTTATTAG
Ext5   B13   AX00007120   CATGTACTTTACGTACGCACAGCTCTTTACGTACTTATTCATTCGTAGCTTAATC
Ext5   B15   AX00007121   TGTGGAAGTAAGGTAGATGTAATTGCTGATCAGGCTGCTTCTTCTCGTTCAGAA
Ext5   B17   AX00007122   CGGTAATCGGAAGAACAGACGATGAATGCCGCGATATGTATGAGAAATTAACGA
Ext5   B19   AX00007123   AGAAACCGAAATGTGATTGTGAAAAATGTCATTGTAAAGAGAAACCGAAATGCCA
Ext5   B21   AX00007124   ACGGAAAAAGCATAATCGCTCAGTTCCATCAACCTCGGCCTGATCTGTTCGTAT
Ext5   B23   AX00007125   GAACATTAAGAGTGCACGAAGATAACGGGACGCCGCGAGGTATTTACTGTAATA
Ext5   D01   AX00007126   CAAATATATGAGGCAGACTTCGTTTGTATTGCAGGTGGCTTATATCCTCTTGCTG
Ext5   D03   AX00007127   ATTGCAGTACATGGAAATATGTCAAATAAGGAGGATACAGTTATTCAAAAATTAG
Ext5   D05   AX00007128   TATATATTCTTCTCAACATATAAGACGGAATTTGATATCGGCGGAGAACATTATA
Ext5   D07   AX00007129   CTTTACTCCTGTCAAACCGCTCTCCAGCTCATAAAGAAATCTTGTCTAACCAATG
Ext5   D09   AX00007130   TATACAGGCGTGTTACTTCCAACTGGTCAAGGTTGTGAAGATCCATGGGTGTTA
Ext5   D11   AX00007131   TTTCACGGAACACATTTTCAACTGGAACAGAAATTATTTACGCGAATGCAGCCAT
Ext5   D13   AX00007132   TTCATAATGATTGTCGCTTTAGGAGTGGATTATAGTATTTTTGTAATGATGAGAT
Ext5   D15   AX00007133   CTGGTTTTTCTTCACCAAGTACGTTAGTCATTCAATCGAATAATAAGTTAGATGA
Ext5   D17   AX00007134   GAAGAGACTGCCGAACAGTTTGTACAGTGGGAGCAAACATTCGAACCAGTTACT
Ext5   D19   AX00007135   AAGACCAATTACCGAGTAGTCTTGAGTTTGTGAAAGACAGTTTGAAAGCTGAAG
Ext5   D21   AX00007136   AAAACCCGCATCATTTGCAAAAAAATCCGACGGGGGACGGAAGGTATTTTGTTA
Ext5   D23   AX00007137   GAGAGCGATCGTCTACAATGATTTACATTGGCTTGCAGAAGAATGATCTCTCCC
Ext5   F01   AX00007138   GATAATAGTGGCTTGCAACTTGTACTTACATTCGGTACATTTGCAGCGGCCTTC
Ext5   F03   AX00007139   TATTTAACCGCGGAACAAACCAGGAGATTTTTCTAGAAGTGGAGCAGCTTATCG
Ext5   F05   AX00007140   CTATCCATCACCTTGCCTTCACCTAGTGCTTTTGCAGAGATACATAAGAAGAGCT
Ext5   F07   AX00007141   CAGTTCAATTTGCGGGATCATACAAGCCGAATAGTTTAAACCATTCTATTAGTTT
Ext5   F09   AX00007142   AGCACAACGAGCAATTGAAAGGTTAGGTGCAGTAAAAGAGGGCGTGCTTAGAA
Ext5   F11   AX00007143   TGATCCGCATGTAGAATCTGATTTCTTTGAATTACATTCTGCAGAAGAAGCTGTT
Ext5   F13   AX00007144   CAAAATACATATATGCTCATCCGCCTGCTGGTGTAGTTACTGAACAAGCTGAAAT
Ext5   F15   AX00007145   CTCATTCTTCTTTCATTTTGGAGATTAATGAATCCAAAAGGTTGGATGCAGATAA
Ext5   F17   AX00007146   CCAGTTAAGTGCGTTAGGAATCTTTTCACGCTACTGGTTTCCTAAAATACCGTTA
Ext5   F19   AX00007147   CTTTACTTTTCAAATCATTTGCTGAGATCGATGCTTTTCCTATTTGTTTAAACACT
Ext5   F21   AX00007148   AAGTAGGTTTCCACGGAATACATGGAAAGAAGATAGCGATAGAGAGCTATCTAA
Ext5   F23   AX00007149   GGGATATTTAAGATTAATACACGGTCATACGTTTTTAGGATGCTTAATAGCCGCG
Ext5   H01   AX00007150   AAGGGAAGACAAAAAAGTTGATGGGCTTTTTAAATGAACAGGAATTGGAAGGAG
Ext5   H03   AX00007151   TTAAGTGTGATATTAGGTGGGATACTCGCAATGGTTTCAGGAGTAATTATGGTC
Ext5   H05   AX00007152   ATCGATCACATCCGAGGCAATAAATGAGATCATTGTTATCGCATGTTCCCATAGT
Ext5   H07   AX00007153   TCCGTGTATTAATGGAGGGGAAAAGTGGTTCTAAAGATCAAATCTCCCCTTTTCA
Ext5   H09   AX00007154   TGTATCCTTTAAAAACGGTAAAGATGCTGAAACAGGACCAACTGATTTTGAAGCA
Ext5   H11   AX00007155   GAATTGTCTACAAAAGCATTAGAGTATGGGGCGTTGGGAAAACCGGTTATTTTA
Ext5   H13   AX00007156   TGGTACAGGAGTACTTGTTGATGGCATGGACTTCTCAGATGATAAAATGCTACA
Ext5   H15   AX00007157   CCAGTTTCAAATGTATCGAATCCTCAGCGGATGTTTGACTTTGTTTCTCGTACCC
Ext5   H17   AX00007158   CACACTATTCTTTCTCACGATTCCCATGATAACAAGTTACATAGTTGCAGTAACC
Ext5   H19   AX00007159   TATGAACACACATGTGTTCCGCTTAATACAAGAAGTATTACAAGGCCTGAAAGAA
Ext5   H21   AX00007160   ATCCCTCGTGATGTAACATCTTATTTCTCTCAATTTGTAAAGAAAATAAGTTCTCC
Ext5   H23   AX00007161   AAATGCAAGGTGAAATTTCTTCTTTCCGTATGGTAGACGCTTCGAAAGAGGCTG
Ext5   J01   AX00007162   AATGGTTGCACACTGACATGTATCAAAGTGTTCAACCTTCAGCTCCAGCCGTTA
Ext5   J03   AX00007163   GGGGGGATAAAAGTAACCCTCAAATCATTTGTTTTCATGGTTTAGGAAGTACAAA
Ext5   J05   AX00007164   TGATAGAGGAGTCTATATTCTTCACAATAATGAAGGAGAGGGATTCTCATCTGCT
Ext5   J07   AX00007165   GGATGACACTTATTATTGGAGTAGTTATTATTGGCCTTGTCATGCTGTTTTACAA
Ext5   J09   AX00007166   TTGTAATGTTTTTTGTTTCTTTCTTTATGGGAAGAAAGATTGGTGCAAACTATCCG
Ext5   J11   AX00007167   GATATTCTTTTACGCGGTCAAGACAACTGGGGTTTTCTGCCGGCCTTCTTGCAA
Ext5   J13   AX00007168   CAGCACAACATAAAGAACAGTACCTCAAGATTTTGGTTCGTTGGTATGAAGGCG
Ext5   J15   AX00007169   GTATGGTCCCATTTTTCGGATGCAAACTTTAAGTGATACCATCATTGTCGTTTCT
Ext5   J17   AX00007170   GGCCACACTTAGTATATATTTGCTACTATTTGTGATTAGATTGTACAAAGGTAGA
Ext5   J19   AX00007171   ATTTGCATATTGATTACGAATGGAGCATGGTTTACAAATGTGGTGAGGGCAGAA
Ext5   J21   AX00007172   GCAGCTAAATTAGGGCTAGCCAAAAGAGTTACGTCAGGCTTGTTAGAGTTGCTA
Ext5   J23   AX00007173   GGTGACGAATTCCAATCATACGCTTTAGCAGGGACTAAAGCATTGACATATTATG
Ext5   L01   AX00007174   GGCGATAGTGGGAATGATTTAAGAATGCTACAAGCTGTAAGACATGGTTATTTA
Ext5   L03   AX00007175   ATTTAGAGGATAGAGAATTAATAAAGCTACCTATGATGACAGAAGATAATGTCTG
Ext5   L05   AX00007176   TTAATCGGTTGATTTCTCAAGATGAGGTTGAAAAAATTATTGGAGCTTTAAAAGA
Ext5   L07   AX00007177   AAACATGTAGATGTAACTCATTTTGCAAAGATACTTACACAAGGTGATTATAACG
Ext5   L09   AX00007178   TTAAAAATGAACTTCATCAGGTGGTCGACTGGAATAAAATTGATAAAGAAGATTA
Ext5   L11   AX00007179   TTGTGTATTTGGGGCTTTCAGCTTATTCTGGACCACTGTTCCATTATTATTATCT
Ext5   L13   AX00007180   AACCTATAAGTCACTTAAGGCTTGTAAATTCGAGGTTTACATGCACAAACAAGTA
Ext5   L15   AX00007181   TCAATTACTGCAAATAGCGCTGGACCAGCTTCAATTTTATCTTGGGTTATCATGT
Ext5   L17   AX00007182   GTTGAGAAGGGACAATGTGTTGTTTTGCAGTGTAATAACCATACAGCAAAAATTT
Ext5   L19   AX00007183   AAGCAGCGAGTTACGGCGATAACGGTATTGTCAATCATGGAGCGTCTTGGAGA
Ext5   L21   AX00007184   TCATCCAGAGTTGGAAGAAATAATTGTGAATTGGCTGGATACACATTTTATCTCG
Ext5   L23   AX00007185   ACCGATTGGTAAGGTAGAAGTTGGATTAATTGTTAACGAACTACCAAATTCGCCT
Ext5   N01   AX00007186   GTGACGGTCTGTACGCCAGCACATACGCATTACGAATTAGCGAAAAAAGTTATA
Ext5   N03   AX00007187   GAAGCACTTGTAGGGGGAGAGAAAAGATATTCGTTTCAGCAGTATAATGAACGA
Ext5   N05   AX00007188   CGATGGATGAGTTGACGAAACCATTCCAAGCTACATGCCTATATACAGGTATGG
Ext5   N07   AX00007189   CAACATCCTATATCGACATATTTGTTCAACTTACCTATCCAATGGCAGACTTACT
Ext5   N09   AX00007190   GAGGATCCCAAAAAGAAAATGTTGGAAACGAGCAAGGCAACAATGGTAGGGGG
Ext5   N11   AX00007191   GAAGTAGCGAAAATACTTGGCTGGGATGCGAGTGGTGTTGTTGTACAAACCGG
Ext5   N13   AX00007192   GCATGAACATGACGTATCATTCAATCCTTTACCAAATAGCTTCAATAAAGTTCCT
Ext5   N15   AX00007193   AATCTCATCCAACCATCCACTGGCTTACTACTATCACTTCTTTAAAGGCATTTATG
Ext5   N17   AX00007194   ACTGGGCTATTTCAGTTTAACAAGGATAGTCTTGCCTTCTATCAAAATGATAGTA
Ext5   N19   AX00007195   GTAGAAGAGCCAGAATGGAATGTATCACAATTTATTCCGAATGAGTTATATGAGG
Ext5   N21   AX00007196   ATGCAGAAGCGGTTAATAAAGGGGAAAAACCTGTAACAGAACTAGGAGTTAAAG
Ext5   N23   AX00007197   TGAATGTTATCCCACTAGAAGGGTTAGCGCTATTACTTGGTGTAGATCGTTTCAT
Ext5   P01   AX00007198   GGAGCAATTTGGCCGAGTGTTGGACAAGAGATGAAGCCAATTGGTGAAACATTC
Ext5   P03   AX00007199   AGCGTTCGAAGATTGAGTTAATTGCTTCGGAAAACTTCGTAAGTGAAGCGGTAA
Ext5   P05   AX00007200   AGTTCTCATAGTGGGACTACTGATCATTGTAGTTGTTACGTATGTAGCGGGCAT
Ext5   P07   AX00007201   TTTGAGTTACGCAACTGGTGCAGCTCTATATTTATGGTTGTTAATTTGGATATTC
Ext5   P09   AX00007202   TCGTGTTTTTTGCGGGCTGTCCGCATCGTTGTTTCGGTTGCCATAATCCGAAAT
Ext5   P11   AX00007203   TATATTGATTTAGGTTGTGAATGTGAAGCTGGTTCTGTTGATTACCCTGATTTTG
Ext5   P13   AX00007204   GTACAGGATGCGTATTCACTTCGCTGTATTCCGCAAGTACACGGTGCTTCTTGG
Ext5   P15   AX00007205   AAAGAAATAGTATGAAGTTCATGAAAATCGGGGGATACGTTATGATTGTCATGG
Ext5   P17   AX00007206   TGGATATTGCTAATGTTTCTATTTCTTGTACAAGCTTATTCCATAATACATCTCCA
Ext5   P19   AX00007207   TGGTATCATGAAATGCTTGCTCAGCATATAGAGAAGGCAAGTATTTTAAAAATTG
Ext5   P21   AX00007208   TTTCTTGTATTCCAATTTATCAACGGATCATGGACAGAAAATCTACAAACTGAATT
Ext5   P23   AX00007209   TGAGATGGGGCGTGTTGAAGTTCTTCTGTTAGATGAAGCGAGCAATGTGGTAGC
Ext6   A01   EMPTY        -
Ext6   A03   AX00007210   TAAGTTAGGGCAAGTACAAACTTACACATTCACTCAAAATTGGTCTACCGAGACT
Ext6   A05   AX00007211   AAATTTTCTTTATAGAAATAGTAAGGGATTCCAGTCACGCAGTATCTTTCCAAAA
Ext6   A07   AX00007212   AGTGGGAGTGTTAGAAAGAATCGAGCGCCATTTTGGTGATGAGAAACTACATGT
Ext6   A09   AX00007213   TACTCGCAAGCTATTCGGATTACTAGGGCGTAATTTGAAAGATGCATTCAATGTG
Ext6   A11   AX00007214   TCTTGCATGAACGTAACATCGAAAAGCATATCATCCCCTACTTTCAAAACATGAA
Ext6   A13   AX00007215   CAAGAGTCGATGGAAAGTTCTTACCGAAGTCAACATTGTTCAATGCATTCTCACG
Ext6   A15   AX00007216   CAGTAGACCGTAACATCTACGTAATGACAAAAGAAGAGCGCGAAGAAGCAGGTA
Ext6   A17   AX00007217   CAATTAACAAAAGCTCTTGATAACAAAATGATGTTTGATGGATCTTCTATTGAAG
Ext6   A19   AX00007218   CAGTTAAAAACTGAAATTCCACAGTTCGGTAAAAAAGTTCTTCTCGTATACGGGG
Ext6   A21   AX00007219   ATGAATTAGAAGGGAAGAACAAGCCATTATATTTATATGTAAATCGAGGGATTGG
Ext6   A23   AX00007220   TGGATTCCTACGTCCTATCAACTACTCTCCAAGCTCAGAAGATATTTATATCTCA
Ext6   C01   AX00007221   AAGCTGAAATTGAAGGAGACATGGGTGACTCACACGTAGGTTTACAAGCTCGTC
Ext6   C03   AX00007222   AAATGGAATCCACTTGGTGCTCTTGGAGCCGCTCTGTTCTTCGGGTTTGCTCAA
Ext6   C05   AX00007223   CAAGTGCTTCGTTAGCTTCTGAGTGGTTATCTTCATTGACAGATGGATCGCGTT
Ext6   C07   AX00007224   GCTGCGCTTTGGGAAGGAATGGTTGGAAATCCACAAGCTATCGGTGAGACGTT
Ext6   C09   AX00007225   GGTGGTGCAGAGAAACTGCTAGGTCGTGGGGATATGCTATTTATACCAATTGGT
Ext6   C11   AX00007226   TTAGGTGGTGGCATGTTTGGTGCGCTTATGTTTGCGACATGTTACTTCTTATTTG
Ext6   C13   AX00007227   AGGTATGATGGACTGCAAAAAAGCTTTAACAGAAACTAACGGCGACATGGAGAA
Ext6   C15   AX00007228   GGCTTATTGTCAGTGGATTTGCAAGAGGGATAGATACGATGTCTCATGAAATTA
Ext6   C17   AX00007229   AAAAGGGCGGAGCGGATTACATTCATGTCGATGTAATGGATGGACATTTCGTAC
Ext6   C19   AX00007230   CTTTTCAAGAACAACAAGTAATGCGAATGTATCATTTATTTAAAACATATGGAGTA
Ext6   C21   AX00007231   TGGGTGTTTCTAACGAAGCGATTACGGCGGTGTTAAAACGTTTTACAGGTGTAA
Ext6   C23   AX00007232   TTATCCGAGAATATATGTCACCAATCGGAAGTGAGCCGAATTGAATCGGGCGCG
Ext6   E01   AX00007233   TTCAATAAGATGTTTAGTCAGTTAATGGGAGCTGTCCCGGAGAGTGCCAAACAA
Ext6   E03   AX00007234   TAGAGAATGAACTTTCTCAGAAGGCAATTGATCCATCCGCAACCATGGAAAGTC
Ext6   E05   AX00007235   AATAAAACAGGTGTGAATATTCTTGTGAATACCTTAAGCGTATATGGTTATTTTG
Ext6   E07   AX00007236   GGCGGATATAAGAACTGCAATGTATTATTTATATCAGTCAGGTTATACGGAATTA
Ext6   E09   AX00007237   AGCTGAGACTTTAAAGGAAACTTCATTATTTGACACTGTTGAGATGAAAGATGCA
Ext6   E11   AX00007238   AAAAGGTGCGGAGAAATCGAATTATAAAGATGCACTTGAGGCTGCGAAAGATAT
Ext6   E13   AX00007239   AGCAAGCTCTACTGTAACAGTCTCTCGTGGTACACATTTAAACAAAACAAGTAAA
Ext6   E15   AX00007240   TGGGCGCGGAAACCTTGAAATTATAAAGGTAGATAACGACAATAAGAAAGTACC
Ext6   E17   AX00007241   ATTAGAATGGACAATGCCAGCGCCTACACCGGAATATAACTTTAAACAATTGCCA
Ext6   E19   AX00007242   ACACTTGTTGACCAGTTATTACGTCAAGCGGGGACTTTCCGTGCGAACGAACAC
Ext6   E21   AX00007243   TACTTTGTTCCCTCCTGAACTAGCTAAATTAGCTCCAAAGGGCGAAGACACAAG
Ext6   E23   AX00007244   AAATTGGTGTGATACACCGAAAGACTTAGTAAAGCAAGTGGATGTTGTAATGAC
Ext6   G01   AX00007245   CAAAAAGGTATATGATGTCTATTCATACTGCGTCTCCTTTACATATGCAGCGGCA
Ext6   G03   AX00007246   ACATTCCCTATTACACGGGGCCATGCATGCGGCAGAAAAACACGGATATATAGG
Ext6   G05   AX00007247   CATTCGAATTTGCTCTTGGGCACCGTCACCGTGGTTCAGCACCACTTACGTTCT
Ext6   G07   AX00007248   ATCTGGTCGTCGCCCGACGGATAAAGAGGTGAATCACGTAATTGGAGCAGTTAA
Ext6   G09   AX00007249   ATTTCACCTGTATTCGTCGATGTACTAGAGAAGACAGCATTCGTTGATATCGGTG
Ext6   G11   AX00007250   TAATTGATACAGGGACGAATACAGAAGAGGCAAGAAATGCGTTAGAAAGTCAAT
Ext6   G13   AX00007251   GGTGATAATCCGCGTGCCGGTGATCCTTTCATTATTGTAAATAAAGCGACGAAT
Ext6   G15   AX00007252   ATTGTAAAACGTCCAGTAATTATGGAAAATGGTATGTTCGGTGCTCGCGACATG
Ext6   G17   AX00007253   TTGATGGGTCGTTGACGCATCATAACGTAATTCAAGAACTTCGCATGCCTAGAG
Ext6   G19   AX00007254   AAGGAAATAAAACAAAATATCGGCTTTGTATACGATGAAAATCATTATTACGAAG
Ext6   G21   AX00007255   CGAACCTTTCATGCAAATGGTTCCGCCTTATCGACAAATGGAAGGACCACCGCC
Ext6   G23   AX00007256   GTTACAAAGCCATTTGGAGACGCTTAGACGTCATCAAGAAAAACTTGAAAAGATG
Ext6   I01   AX00007257   GGTATCGCGGATAGTGTTGAGGCGGCGGTACGTTCTATGAATCACCCAACGCC
Ext6   I03   AX00007258   GTGATTAATCCATCTAGTATGGCCGGCATTCATATTGCAAAAGGCATTGCGAATC
Ext6   I05   AX00007259   GTATATCCACTGCACGGCGGAGCTGACCATTACTTTAGTGAGGCTCTTTATTTA
Ext6   I07   AX00007260   AATAACGGTCGGAAGGCTTTACAAGCATTAGAAAGTTTTACACAAGAGCAAATTG
Ext6   I09   AX00007261   TAATCCCATACTTCGGCCCTATTTTAGGGGCGATTCCAGCGTTGATGATTGCAG
Ext6   I11   AX00007262   AGAGAAGTGAGTATAGAAGGTGATCGATTACTATGCCGGATGCATATTTCATCT
Ext6   I13   AX00007263   TGTAGCTACTTGCATATCAGTTGTCTTATATGGAGCAGCTGTTACGTGGAAACAA
Ext6   I15   AX00007264   TTTAATCTGTGGGGTGTTATATAGCTTAACAGGCAAAAAAGTTATGAGAGGTGTC
Ext6   I17   AX00007265   CAGATATGTTAACAACAGATGAACAAGTTGTCATCTTACCAGATATGCGTGCAGG
Ext6   I19   AX00007266   GAAGGAAATTTGCGATAATTTACATCACGGTATCTATGTACAATCGGCTGAAGG
Ext6   I21   AX00007267   TTTTAAGCTTAGCCCGTTTGCAAAGAACAGATGAAGTTGTCCGATCGCTCGAGA
Ext6   I23   AX00007268   ATATGGTGAAAGTTTGGGGCTGAAAATTCGGGAACAAGTTACAGGTGTCCGAGA
Ext6   K01   AX00007269   AAATCTCACCAAAGCAACTATTGAAAGAAATCTCTGGTGGTGCAGAGGCGACGA
Ext6   K03   AX00007270   TTAAATAACGAGGAAGACTTTGAAATTTCTTGCAAACTGAATTCAGAAATTGCCG
Ext6   K05   AX00007271   AGAAGTGTTGCATTCTTTTCCATCTGAGACTTTTTTCTTAGAAATGTACACGAAA
Ext6   K07   AX00007272   ATTAGCAATCGGCGGCGGTACTTACGCTCGTTCATTAAAAGCTGGTGTTGCATT
Ext6   K09   AX00007273   GTAGCAAAACTATTTGTTAGCATCGGTGTACGAAAAATTAGACTTACTGGTGGCG
Ext6   K11   AX00007274   TTTTGATTTGTCATTATTTTAGTGCAACTAGTCACGCGGCAGGAAAATATACAGC
Ext6   K13   AX00007275   GTATGTAGGCGTTCAAAAAATTGGGGCGTCACATACGATGGTATATATGTATATA
Ext6   K15   AX00007276   AGGTTTAGTAAGCCCAATTTATTTCTCTAGTCTTGTTTTTGATTATGCAGGATTAA
Ext6   K17   AX00007277   GCTAGATGTGAAGGCAGAAGAATGTCTTTACGTTGGGGATCATCCTGAAAATGA
Ext6   K19   AX00007278   CACTTATATCCAGATTACCGATCATTTCTCACTTCTCCCATACGTACAATTTATTC
Ext6   K21   AX00007279   GACTGGAGCAAGACTTTTTAAGAGAAAATAATACGTGGATTACGACATTAGATCA
Ext6   K23   AX00007280   CCGTTTTCTTTTCATTTGCTGTTTACTTATTCCATCCGAAATTACAAAATTTTGGC
Ext6   M01   AX00007281   TGCTTGCTATCTTTGCAGGTATTCAAGGCGGTCTCGTGTTCTCTAACTTTTTCTT
Ext6   M03   AX00007282   TTCTTCGCAACGTTAGAAGGCCCTGGAACAGTTTGGATCCAGTCCTTAACACTT
Ext6   M05   AX00007283   TCGTGATCAATATAACACGCTTGGGTACATGGTACGTGAGTATATGAATAGTCAA
Ext6   M07   AX00007284   GTCAGCTTGGAGGAGTAAAGTGGACGAGTAAGTTGCGAATGAAGTTTGAGCAA
Ext6   M09   AX00007285   AAGAACTAGGAACAGGTAACGGTCCCGAAGTAGACATCGCCGTTGACCCATTAG
Ext6   M11   AX00007286   CACAGGACGTATTCACAAAATCGGTGAAACTCACGAAGGTGCATCTCAGATGGA
Ext6   M13   AX00007287   TTTGAAGCAATTTTCCCTAAAGCAGAGTATGTAAAAATACCAATTGGAGATGGAG
Ext6   M15   AX00007288   CGGAGCGTGCAAAGCATTTTCACATTCCTGTCATTGCTATTGGAGGATCTGTAT
Ext6   M17   AX00007289   CCGAGAATATTGGTTATCCACTTCGCACACCGGATATATCCACAGCGGAACAAG
Ext6   M19   AX00007290   GCAAGGTCTGACGTTTGGCGACAGATGATGTCCGATATTTTCGCATCTGAAGTC
Ext6   M21   AX00007291   AAAAAATCGCACTTGGCACACCTGAATCTGTACCTGCGGGAAAATACGCAAAAG
Ext6   M23   AX00007292   TTCACCGTATGCAGATGGGAAAGTACAAGTAACACAAATTAATAAACCGCCTAGC
Ext6   O01   AX00007293   AACATTGCGGGAGCAAGCCTTTATGCAAGCGGCAGATGTATTAGGATTAAAGGA
Ext6   O03   AX00007294   AAGAGAACTTACAAGCTATCCAAACTGCAAAAGAGGCTGGTCATATTGTCATGA
Ext6   O05   AX00007295   AGATGGAGAAGTATATATTAACGAAGTGAATACGATGCCAGGATTTACGCCGTT
Ext6   O07   AX00007296   CCAGCAAAAATCTCCTATGTGTTCACATATGGTAAATTAGGGGCTCAAATTGCTG
Ext6   O09   AX00007297   GGTTGTTAAAAATGGAACGGAAATTATTGCGAATGTCGTTGCATCACAAATTGAA
Ext6   O11   AX00007298   ACTGGTATCGTAGATCCAGCCAAAGTAACTCGCTCTGCACTTCAAAACGCAGCA
Ext6   O13   AX00007299   CCCCCAACCCAACAAGGACAGCATCATTTTTCACGATAATTCCGGCATTTTGGA
Ext6   O15   AX00007300   TACCGGGGTGGGTTTCCAACTAAATATATCAGCGATTTTTCAAATATATCGAACA
Ext6   O17   AX00007301   GCACAGCGCAGCTTTACGTATTTAAATTTGTACGATTATAACGTAGATGCTATTA
Ext6   O19   AX00007302   TTTATGAAATGGAAAAAGGCTGGGGAAAGTTACAGAAATATATTACACTACTCTT
Ext6   O21   AX00007303   AAGAAAAAGTCGGTGCGTCTTTTTGTAGATTCTTACGGAAATGTGGAAGTACAG
Ext6   O23   AX00007304   GCAATTGCCGGGGCTTCCTTTATGCTACTTGCAGATACAATCGGACGTACGATT
Ext6   A02   EMPTY        -
Ext6   A04   AX00007305   TCAACAAAGCAGAATGGTACGGGACTTAGATTAGCGATTACATATAAAATTATTG
Ext6   A06   AX00007306   ATGCCAGGAGTTGTCGAGGAGTATATCAATTTAGGGGGTGCTTGGGACTCAGA
Ext6   A08   AX00007307   CGCTCGTTGCCCTCAGTGTAAGAAGAAGTTAGAATTACGTGGTGAAGGTGCAGG
Ext6   A10   AX00007308   AACGTTTCTTAGCTGTTTTATTCCCAGCATTCGAATACGAACAACTAACGTTACG
Ext6   A12   AX00007309   CCGCGATTATGGGTCCAGTATTAGTCGGTGTTACAACGCAATTAACAGGAAAAA
Ext6   A14   AX00007310   TGGTTATTCACAAAGAACGATGTAATGAATGTAGGCATTACTTGCTATATCCTTG
Ext6   A16   AX00007311   TGGTGTTTTTGGCAAAAATTTTCGTGTTTTTTCCTACGACTGTAAAAGGAGCGTC
Ext6   A18   AX00007312   AAAAAGGACATGATTGAGCGATCTTTGTTCTACTGGGCTGGCATGTATTATTCCC
Ext6   A20   AX00007313   GAAAAAAGAGACGTGGTTTAAAGAGATTGAACAAAGATACGGTAGATTAATGGT
Ext6   A22   AX00007314   AGTACTAAATCAATAAAAATAAAACCATCGCGCTCATTGAAAGAGGAAATGAATG
Ext6   A24   AX00007315   CAAAAGATAGTTTTACGGGAGGGCTTGGTAAGAACAGTAGTGGTTCGAATGCTG
Ext6   C02   AX00007316   TATGTACCATTTTTATGGCGGCTATTTGCACCCTTTGATGCGGTAGTAGCGTTTT
Ext6   C04   AX00007317   ACCAGAGACAGTACTATATGGGCAAGAAGTTATCGATAACTTAGAGTACTGGCA
Ext6   C06   AX00007318   GGTACAAGCCTCTACAGAGTCCTTTAAACAGGGGTATGCAGCAGAACAACAGGC
Ext6   C08   AX00007319   AAGACAGTAGTATTAAGCCACGAGAAGAAATTTTAGTCACACATACACAGGACG
Ext6   C10   AX00007320   AAAATGCTAAAAGCAGGTATATTAAAAATTGTGGGTGCTGTTGTGGCAGCAGTT
Ext6   C12   AX00007321   ATATGTATTAGGAGACCGTAATCCACCAGGCGGTACGTCAGATTGCTCAGGATT
Ext6   C14   AX00007322   AGACACTGTCGTATTGGCCAAACTAAGCAATGTAGGACCTTCTATCTTGGATAC
Ext6   C16   AX00007323   GTAGTAGGTGTTGCTACCTATAATACTATTCATCGTTACATGATGAAATCTCAAG
Ext6   C18   AX00007324   ATGAAGACATGAGCAATGGTTTTGTTTTCATCTGTTTGGTAGTAAGTGGCTTTAT
Ext6   C20   AX00007325   CACGGTGGCGTAAAGAAAACGTTTCGAAGTGTGATAAAAAAATGCGATGTTATT
Ext6   C22   AX00007326   GACGGAAAAGTATGGACTTGTAGGACAAATCAGTTTACAGCAGAGAGTGGCACG
Ext6   C24   AX00007327   TGTTTTTCGTTATGCGGCCATAAACATTTTAATGTCTAAGTTTAAGCAAACTTGG
Ext6   E02   AX00007328   GCAAAAGGATATCCTATGTATAAGCTATTTACCCGGAGACTGTATATCTTACTAG
Ext6   E04   AX00007329   ATTACTATCAACCAACCTGTCATTATTGTAAAAAGGCTGCACCAGATATCAATCG
Ext6   E06   AX00007330   TAAATTTGTAGAAACAGCCGTATTGGAGAAAAATATTCAGGAAAATTCACGTATT
Ext6   E08   AX00007331   CCTCAATGGGAATGTCGCTTTGAGTCTATGTCTTATGGATTTAGACCCAAACGA
Ext6   E10   AX00007332   ATATTCAGTAAAATCCTTAAGTCCCATGAACGGTGGATCCCTTGATATTGATAGA
Ext6   E12   AX00007333   AACGTAAGGATCTTGAAAGAATGCTGGAAGAATTGAATCAAAAGTTGTCACAGC
Ext6   E14   AX00007334   AGTCTGCTTCAGGTTATTCTTTCCCGAGCACACATGTACAGTTAACGACAACATT
Ext6   E16   AX00007335   CCAGATTTTAAAATAAGAGCGGTAAAAGAAAATCAACAAGGAAAAGGTCCTAGC
Ext6   E18   AX00007336   GTTAGCTCTACGTATCCATGTCTCAAGCAATTGATAGATGTTTATGAGGAACATC
Ext6   E20   AX00007337   ATGGAGGCTCTTACTGAAGCAGACATTGCCTTAGTTCTAACAGAGTGGGATGAA
Ext6   E22   AX00007338   AAATAGAGAAACTCAAAATGATGATTGGATCCTTAATAGAGCCTATCAATTAGCT
Ext6   E24   AX00007339   TGAAGGATATAATAGATATGAGAAAGGATTCAAACGTAGGACGTATCCCTTTAAG
Ext6   G02   AX00007340   TCCTTCCATGAATCAACGAAGGTAGAACAGGTTGTTGATGCCTTTAACAAACTAC
Ext6   G04   AX00007341   CTTATCCAGTATCAGAAGATCTTCAAATGTAGGAGTTTATAAAGATAGTGGCGAC
Ext6   G06   AX00007342   CAGTAGCGTCTATAACCTCAGAGCTACAAAACTCTTTCGGCGTTACATTACATGA
Ext6   G08   AX00007343   CTTTTGAATCCAACTGGTCAAGAATGCAAAGTGGTAATTGAACAGATAAATTTGT
Ext6   G10   AX00007344   ACTGTAGACCTACTTAAGGGTTCTAATACTGGACGTATATTATTACGGAGAGCCG
Ext6   G12   AX00007345   TACGGAAATATCGAGAGAACATATTACCATGATGGTGAGGTCACATCTAATATAG
Ext6   G14   AX00007346   ATGACGCAAGAGACAAAAGGTATTTTTATACAAAAAATTCATGAGATTATTAGCG
Ext6   G16   AX00007347   TCATCTTCAGATGGACAATTTTTTCGTGCCGGTGGGACTTCCAGTCCCCTAGCA
Ext6   G18   AX00007348   TGATTTACTTTCTCAATTACTAAAAGGAGATACGCTCGTGGTAACAAGAATGGAC
Ext6   G20   AX00007349   AGGTCCTACCATAGCAGCTATTGTGGAGTTTGGTCCATTTGTGGCCGCAAATCA
Ext6   G22   AX00007350   TTCCCCTCCCGTGTTTAGTAGTATGTTACCATCCACATTTCGGATTCCTTTCACA
Ext6   G24   AX00007351   GATCCTTTGCGACTGTATACGTTTCGATCCAATTATTATGAGCCCGGAATGACAA
Ext6   I02   AX00007352   AATCGTATGTTTCGTATTGCTATTGTACTTACAGTCATTTGTTTATGTGCTTCTCA
Ext6   I04   AX00007353   TCAAGCACTATCTGGATATATGCTTCAAATAAAAAAACCTTCAAACCACCTAACA
Ext6   I06   AX00007354   TGTATCACCAGAGGCAAGACACCCCCTTGTGGCAGCTTATCCGATTGTACATGT
Ext6   I08   AX00007355   CTTCCACCCTTACAACATGCTCAATGATTTTCTTTAAATACTCTTCTCGTGTTTTT
Ext6   I10   AX00007356   TATCACCCGCATGAAGAGACAGAGTGGTTTGAATCATATTTAACGAAAGATGGA
Ext6   I12   AX00007357   CTTTATTTACAAGAAGGTGGGATCATGGTGTATGTCATTCCATACGACAGATTCG
Ext6   I14   AX00007358   ATCCTTTAGAACTTTCCAAAAGGATGATTGAAGAGAACCTTCTACTAAGTAATTG
Ext6   I16   AX00007359   AGCAAGTTCATTCAAAAGGGTTATATGTTCCAGAATCCCGTTCTATATTACTCCA
Ext6   I18   AX00007360   ATAAAGAGATCTTATCAGACAGTGAGAGCAAGCCACTGTCCAATCAAAAATTGG
Ext6   I20   AX00007361   TCGTCATCTTTAAAGACTACGAAACATTTCATACAACGGGGCAACTGTGGAACG
Ext6   I22   AX00007362   TTCGTTTCCAGGATGTCTATTACTTTCTATTATTACTGGTGTGATTCTTTGGAGC
Ext6   I24   AX00007363   ATCATACGATGCTTGTACAATAACTGCTGATATTTCAGAAAAAATCATACCGTTA
Ext6   K02   AX00007364   GATAGTACACTGGAAAGAAAATTGGAATGCATTAAGGTAGCACTTGCAGATTTAT
Ext6   K04   AX00007365   AATTAGATGCCTCTAGTTCATCTGCCTTTCTACCTAAAGCGGACGGTTCTCATTA
Ext6   K06   AX00007366   AAAACAGAGAAACTACAAACATTGTAAAGGTTGTCCCATTTTCGATTCCATCCGT
Ext6   K08   AX00007367   TAATTAAGTATAAACACATCAAACCTATCAATCTGGCTACCTGGAAAGCAGATGG
Ext6   K10   AX00007368   ACAGTTCGTAATGATTAATCTAAAGAATTCAGGATCAGAGTTTGACTTCGAAAGT
Ext6   K12   AX00007369   CGCGTCTCCAAATACAGACAATCCGGACATTCAAAAATTCCAATATATTATGAGC
Ext6   K14   AX00007370   CTTGATATTGACGGCCTCGAAGAAATTGAAACTGAGATTTGCTATTTGATCGCAA
Ext6   K16   AX00007371   AGGTAGGCTATGTCATCTTATGGCGCTTTGTTGGGCAACAAAGTTTTTATAGTG
Ext6   K18   AX00007372   TTCTAGGTGATAAGGGTCTTAGTAAAGCAGGACAAGTAGGGAAGGGAGCTGCC
Ext6   K20   AX00007373   GGTAAGGATTCATTTGGGAATCATCTGTGCTTTGACTACCGTAGCAATCCTGAA
Ext6   K22   AX00007374   GTACGCTACAAAAGGCTAGTGAAGAAGGTATAACTGAAATCGAGAAGCTTCAGA
Ext6   K24   AX00007375   ATGTTTCCCAAATTAAGACATGGATGAAATGGTATCGTACAGATCAAACGTATCG
Ext6   M02   AX00007376   TATGAAGGGTATTTCGAAGACAACCAAGTGAAGGATCGATCACTCTCCGATTGG
Ext6   M04   AX00007377   GTTGGAGTGAAATTGACCATCAGCTAAGATATCCTAATAATATGAACGACGTCCA
Ext6   M06   AX00007378   TTAGCTACTCGCTCTTGCTTAGATGATGTTCAGGAGTACATTAAGGTTCGTCCTA
Ext6   M08   AX00007379   AATTGGCAGATGATGAGACTCTTCAGCCGGTAGATTTTGGTGTTTTCGAAAAAC
Ext6   M10   AX00007380   CAGCTGGAAAAAGGGAATTTAATTTCTGCTCAGAATCCGGATTATCCTTTGTGG
Ext6   M12   AX00007381   ATTATCCCCATAAATATGGTGGCAGAAAAACTCATTGATGATTATGCTAGCTTAC
Ext6   M14   AX00007382   GAGGCTTATATAGAGAAGATTAAGGTTCATAACCGTAGATTGAAACCGAGAGAA
Ext6   M16   AX00007383   TTGATTGGGGAGACCTTAACCTATTGGATAACGAAATTATGAGTAGTACGGATG
Ext6   M18   AX00007384   TAGAGATACGTGCCAGACATGTAGGAAAGGCACATAATTTAAAACTTGAGATTG
Ext6   M20   AX00007385   AACGATATTTTTAATAAACGGCGTAAGAGTACCTGGAATCATTATCGCTGTTGAT
Ext6   M22   AX00007386   CTCAATCTACCGTATCTCAGCATTTATCTAAGATGCGTGGCAAGATTCTACGCTC
Ext6   M24   AX00007387   GTGAAATGAAGATATGTTCAGTAGGCGTTTCTTGTACAGAAAATTATTTGAATTT
Ext6   O02   AX00007388   CGTGATGATTTTGAGAATCTTTTCCCTTTAGAATTGAAAGAGAGGGGTTATGACT
Ext6   O04   AX00007389   TTACCATTTAGTAATAATGAATATGTGTATGTTATCTCAAAAATCGGTGCAGCAG
Ext6   O06   AX00007390   TATAAAAGACGGAGATACGATAGACGTGAACGTAAAGGGGCAGAAACAGACGG
Ext6   O08   AX00007391   GCGTCAATATGCCCGAATTGTAAGAAACATTCATTCAAAGAACTATATAATGATT
Ext6   O10   AX00007392   TGCTAGGATTGCCCTCATGGAAAGGGTATGCACAAGAGATACTAGAAGATGCAA
Ext6   O12   AX00007393   AGGGAGAGTTAATCTATAGGGAAGTGTACGAATACGCAGGGGTGAATAAAAAGC
Ext6   O14   AX00007394   TTAAAGTGGTGAAAATTGACCCATCCTATACAAGTCAACGATGTAGTGAATGTGG
Ext6   O16   AX00007395   ATTTGGAGTGGTGAGATGTCCATTCCTTCATTCCGAAACAATTTACCAATTGATA
Ext6   O18   AX00007396   CTAAGTTGGCGTTGGCGTATTCAACAATCTTATCAACATTTGACTCATTCATATA
Ext6   O20   AX00007397   CCCGCCCAAAAGCAGTGATACTATTAAGTTTAGTGTTACCCCAGGATATGGTCA
Ext6   O22   AX00007398   AAACTCACTTCGGTGGGATGTATCGTTTCTTACATAAAAAATATCCGCATCAGAT
Ext6   O24   AX00007399   ATGATTCGACTTGAAGTGAAACGAGCAGAATTAGATAGGAGAATTTCTGCACAG
Ext6   B02   EMPTY        -
Ext6   B04   AX00007400   CTGATCCGGTTTCGTTTACTATACATAAAGCATGCCTTAAAAAAGGAAATCCTGG
Ext6   B06   AX00007401   AGCGGGTATTCGATTCAAAGAAAACAGGGTCTATTGGAATGGATTACACCTTCC
Ext6   B08   AX00007402   AACAGAAGCAAGAAACGCTGAACGAATTGTCCGTCATTGGTTAGGAATGGATAT
Ext6   B10   AX00007403   CAGTTAATAAGTGAGGGGTATACAGATTATGCTTACCTACAATCATGGAAAAGCT
Ext6   B12   AX00007404   TATGTTGACCTTACTATGGGATGCAATTGCAGAATTGCCAATAGAGGAGCGTAC
Ext6   B14   AX00007405   GTGGGTGTTTATAGCAAAATCCGATTTAGATTCTGCTAGTTACTTAACTCACATG
Ext6   B16   AX00007406   GCGGTATTCTTAGTCCTATACTTGCCAACGTCAATCTTAATGAATTCGACTGGTG
Ext6   B18   AX00007407   TAGTGGCACGACCGTTGAAGGTTCTGTAATGGAACTGGAGGAACAGCCACAAG
Ext6   B20   AX00007408   GGCTCTCATGCATATGGCACACCAAATGAAGACAGTGATTTTGATCTCTGTATTG
Ext6   B22   AX00007409   TGTGGAGACGAAGAACTATGAGGGCTGGATCTATGGAAGTGAGAAAGCGGCAA
Ext6   B24   AX00007410   ATTACGAGGCTGCTACAGAAACTAAATTAGGGAGTAAGATGGATAGATTATCTTA
Ext6   D02   AX00007411   CTAGCGCTATTTTGCAAAAAATCCAGGAAAACGAAAATATGTCCTACATGGAAAG
Ext6   D04   AX00007412   TTATTTGGCGCCTTATTGATACCGTTAGTAGGTGAAAAAGTGGTGCGGAAACAT
Ext6   D06   AX00007413   AGAAGAATATCGATATATGGAGTTTAAGGAGGTTAAAGGCGATCATTCTATAAGA
Ext6   D08   AX00007414   ATGGTAAATATGTTCACCTACGATATTGGCACGATCTAGATTTAATCTGCCATCT
Ext6   D10   AX00007415   TCTTAGTTGAAATTCATGGCGTAACAGTAGGAGTACGATACTCGCAATGGTCCC
Ext6   D12   AX00007416   ATGTGAGTACTTATCCTTGGATGAGCAGAATCAATTACATTTACATAAATCTTTCC
Ext6   D14   AX00007417   AAGATCCATCAAACCTACGAATTTTACAATATCTGTTTTCCCAATCTGGTAGGTT
Ext6   D16   AX00007418   CGACGGGAGAGATGTCTATGAAAAATTTATCTAGTCTTCTAAATGTAAAATTATT
Ext6   D18   AX00007419   GAAAAACCAGTCAATCGAAGAGTAACCAGACCCTTTCAGTTTCGAGGTGGGCTC
Ext6   D20   AX00007420   CGTAAAGAACGAAAGAAAGAAATGAAATCTGTTTTTCGAAGAGCAAAGAGAGAG
Ext6   D22   AX00007421   ACATGCAAGTGATGTGATGCACTTTTCGAAAAATATACGTGATTCAGCAGCACAT
Ext6   D24   AX00007422   GGACAGTATTGTCTCTTAATCGTGAGGGAGGTTATTATAGATATAGAGAAAAAAC
Ext6   F02   AX00007423   GCTCGTCAAGGGATAGGAGAAAGTTTATTGAAGGCTGCTGAAAAACGAGCAATT
Ext6   F04   AX00007424   CCACGGGCACCATTTCTTATCTTTGTGTGTATGGCTAAATCAACAAGTCGCTACT
Ext6   F06   AX00007425   GTTTCTGGATTAGTCAACATGTCGCGAGTGATTCTTTAGTTCGACTGTGTAGTCA
Ext6   F08   AX00007426   CAAAGGACTTACAAGTTACAAGACAAACGATTGTAGCCATTGAAAACAATCACTA
Ext6   F10   AX00007427   TGTGGCAACTTTGAGGAAACCTATGAAATCGGAACGGAAGATCCATTGAATTCA
Ext6   F12   AX00007428   ACTTTAGAAATGGTCATTTAGGAAATGCTTTTTTGATTTTATCAATAGGGAATGC
Ext6   F14   AX00007429   TACTATCAATACTATCAGTTGTTTTAGCTGTAAAAGGAAGCGACTATTGGTTAGT
Ext6   F16   AX00007430   CAAGATTGGAATACGGATTCCATCATTCATTCCAGGATTCCTGATGAGACTGAAC
Ext6   F18   AX00007431   TGACAGAAGAGGGGGCAACATTTAGTGTTTCTCTACAAGATATCCAAATCCCAG
Ext6   F20   AX00007432   GGCATCTTACTACACGACAAATTACTCAGCTTTATAGTGCATTTGAAGGTAGGGA
Ext6   F22   AX00007433   AACTAGAACTAAAATCAAATCAATTAGACACTGAAAACCCACTAGGTTACTTGAC
Ext6   F24   AX00007434   CCTTCGCGATATGCTTTGGATATTATGACTGCACGACTTGAGGGAGCAGGGCTG
Ext6   H02   AX00007435   AAAAGCACGAAATAGTAGTGCTTTTAGATATGGATCCGGCTGTTATTCGTAACGT
Ext6   H04   AX00007436   ATTCTTCTCTGGCATAATGTTCGGCCAAGAGTTTCGTTGGCTCAAATTATTATGC
Ext6   H06   AX00007437   GGTACTCATACAATTAAAACAAGGGATGAGCAATACTTTTTATATACCGCTGTGT
Ext6   H08   AX00007438   ATTTATACAGGGTTTCAAATTTGTTTGGAGCGTAGACTCATAAAAGAAACACCTG
Ext6   H10   AX00007439   CGAAATCATTCGAACAGATGAAACACAGGAGTTTAGTGTGTTTGCTATACGAAC
Ext6   H12   AX00007440   CTACATCAATTGCTAAAGATAGCGCATCCTCTTACACAAAGGGAGAGAAAGCTT
Ext6   H14   AX00007441   ATATGATTATTGGAGATACAACACACACAGATAATAAGTCTGCACTAGAACGTGC
Ext6   H16   AX00007442   ACTCTTATACCAGAGGGTGTACTGTATGGAATGCAGTTAATAAAGGCACATGAT
Ext6   H18   AX00007443   AGCCAGAGACTAAGCCAGAAACAAAGCCAGAAACAAAGCCAGACGTTTTAGATG
Ext6   H20   AX00007444   TTGAGTGGGAGTGTTGATAGCTTATCACCATCTAAGCTCCATGCGGGGTATGGC
Ext6   H22   AX00007445   TCTCATTTATCAGCATGATGTCGATGAGACTAAGTGTATACTTTTTGTTTAGTTCC
Ext6   H24   AX00007446   TCTAAAAGTAATTGCTAGAGAAGTCGCTGTATTTGTGGCAAAACGAGTAGGGAA
Ext6   J02   AX00007447   AAAGATGGCGAAGTTGCATTCCCGTTACTCGTTGATTCGGAAACAAGTTCAGGG
Ext6   J04   AX00007448   TAGAAGCGGACCAAGTAAGACCAAGTTTTGCGGTTGGAACTGGTCTTAGCCATG
Ext6   J06   AX00007449   AACAATAACGATTCGTAAGAATGCGGATCACCTCCGTGCTTCTGAAGAGCGTAT
Ext6   J08   AX00007450   TATACCTGGCAAGATTGCGTTCTAGTTTGTCGCAAGCACAGCGTGCCTTTGTAC
Ext6   J10   AX00007451   CAGTAAAAAAGGCGCAGATATATGCTGGGAGACATCTTCGACCGTATGTATCTA
Ext6   J12   AX00007452   ATACCGAACTGGATGAATATATAGAAAACCTGTCAACAAGCGTGAAGTATGTCAT
Ext6   J14   AX00007453   TAAGTGGAGATACAAAGTCAAATCGGACACTTCCAAAGGGTTCCTTAGTTTTGAA
Ext6   J16   AX00007454   CGGTCAATAAAGCGCCTCTTAAACTAAATGGCACAACTGTTGAATCTTATCCAAC
Ext6   J18   AX00007455   AATATCTCTTTGTTTCCAGAGAGGGAACCCGGTACCAACATACCAAGGGATAGA
Ext6   J20   AX00007456   TGGAGAATATCAACTCGATTTTGGTCAAAATGGATTACAACTGCAGTTAGATCCA
Ext6   J22   AX00007457   TATTTGGGGCAAAACTACCAAAGAAAGAAATACAGCTGATACAGAGCTTCCCGG
Ext6   J24   AX00007458   GAATCAAACATTTTAGGAGATGAAGAAGGAACTGTATATGAAGTGCATCAAATGC
Ext6   L02   AX00007459   TTTGGGAACGAGATTGTTATCAGTTTTCCATTAAACCATCAAACTTGTCACAGCG
Ext6   L04   AX00007460   ATTTGTCATGATACAGGTAATTGCATGCTGCATGTGTCACAAGAGAAGGTAGCA
Ext6   L06   AX00007461   AAATGGAAAATAAACCGTTGGAACGCCCCGTTTATTGGTGCCCACGAGAAAATA
Ext6   L08   AX00007462   TTACGAATGGAATGTGCATCCTTGCCGGATACTTTCTACATCTAGTGGAAGACA
Ext6   L10   AX00007463   TGGTACAAGAATCAAAAACTACCCCTGAAGTTGCAAGGCGATATGTTGGGAAGG
Ext6   L12   AX00007464   TACAAGGAACACTGAGACGAAAGAGTTGTCAGTTGCAATCCATGAATTAGCTCA
Ext6   L14   AX00007465   ATCTAAGTAAATACTTATTCAATAAACAAGTTATCGTAAAAGTTTCAGAAAAAGAA
Ext6   L16   AX00007466   AAAGAAAGGAGAAAATCATTTTCTAATCAGAAATGATGATTATGGTGAGTGCTTT
Ext6   L18   AX00007467   AGCAAGTTATATGCCGAAGGTAGTTCCAGTTGGTGGGTTTGGAAGGATTATGTT
Ext6   L20   AX00007468   ACAGATTTTTACGATTTTTAAAAGAAGAAAGAAAAAAGAGCCTGTGTGGGTAACG
Ext6   L22   AX00007469   ATGACGGTAGCAGGATTCATTATTGCCTTTGCTATACTGGTTTTTCAAATAAGTT
Ext6   L24   AX00007470   GCAGGTTCAACAACAGTGCAGCGTGATGTAAATGTACAAAACAATGTAAGGGGA
Ext6   N02   AX00007471   CAGATAACAAGATAACAAAGAATGCAGATCAGCAGCGCATTATTTCTCCTGAACG
Ext6   N04   AX00007472   AAACCTGAGTATCAACGTCAAGTTACGCTCACTTTGAAGGCTAATACTTTTCCTT
Ext6   N06   AX00007473   AGAAAGGTATGATTCACGCTTTACTATCAAGCACTTATTAAATCGGTTTGGTATG
Ext6   N08   AX00007474   CTGTGTATGTATTATTGCCTTCATGTTCATGTTCGGCGAAGGACCGAGCCGAAC
Ext6   N10   AX00007475   GCAACTGCCTGTCCCTGTTACAAGGAGAAAATCCTAAGTGGCGAAACAAAATGT
Ext6   N12   AX00007476   ATTTTCAAAGACAGTATCCGGAGTATCCGAGAGAAGCAGACGTGTTGCGACATG
Ext6   N14   AX00007477   GTGGCAGTATCTCTTTTTTGTATTCAATTAAGCGATGTGAACTTGTATAAACAAC
Ext6   N16   AX00007478   TATCTGTTAGCTTTGGGGTTGCCTTTCTTCTTTTATCGCTCTAAGTATACGCATG
Ext6   N18   AX00007479   GGGTTCGGTATATGGGCTAAAAGTGCTCATGCCTAAAGTCATTAAAAGGGCATA
Ext6   N20   AX00007480   GTTAAGTCCTTGTTTCCTGACAAAGATGTATTTAGTTGGTTAACTGGGAACGGAG
Ext6   N22   AX00007481   CAAGGCGTTACAGAGACAGTTCGAGCGAGTGTAATCTCAAATGCAGATAATAGC
Ext6   N24   AX00007482   ACATGTTAGATCAAAATACGGATCGTAGTTGGTGGATGATTGGTGCAGTTGTTG
Ext6   P02   AX00007483   ATACTTCGTCATTACGGGGATTGTAATTCGTTTAATTGGATATTCGTTGCAAGGC
Ext6   P04   AX00007484   GAACCTCGTTTACGGTACGCATAAGAATGGATTTGGCGATCAATATGTCAGTAA
Ext6   P06   AX00007485   ACAGAACCCTTTGACAAAAGTAATGAAGCTGGCAATGACTCTAGCCCGAATAAC
Ext6   P08   AX00007486   TGATAAAGGTTATAGTACGCAACCTTATGGAGATATAGGAACAGTAAAGTTAACT
Ext6   P10   AX00007487   AAAAGATGCAAGGAAATTGGAAAGAAGTTAGGCAGACGTTACTATCGTTGGGAG
Ext6   P12   AX00007488   ACCAAAAATGGAGTTCCATTTAAACATAGATATGATTTTTGCGATATTCTTGAAG
Ext6   P14   AX00007489   CGGTACATCACATCCTAATAGTGCTCAATGGAAAGAATTCCAAGAGGGATTCAA
Ext6   P16   AX00007490   AAAACAAAGCATACGACAGGCTGCCTAATTGAAGGCGAAAGCGATGTGTGCTTA
Ext6   P18   AX00007491   AAAGTTAGTACCTTTGATGGCAAGAATTTAATTGTTCTCGATAATGGCAATCTGT
Ext6   P20   AX00007492   TGAAAGCTACGAAAGAGCATCTTGGTATATAAATAAGTCACTAGAAACGCTTGAA
Ext6   P22   AX00007493   AAAGGAAATGGGTGTTGCTGGCGGTACACTTTCTAAAAATTTAACAGGCAAAAC
Ext6   P24   AX00007494   ACACATACACAGAACATCCTGATAAAATCAGCGGTCGCTGTGATAATTGCGGAA
Ext6   B01   EMPTY        -
Ext6   B03   AX00007495   GGTAAGAATGTATCAGGTGTTGTGTTGGATGAAAGTAAATATTGGGTATTGTTG
Ext6   B05   AX00007496   AACAAACCTGTGCTATACTTTACACAATCAGAACTGTGCGAAGCGCTTAACGTTC
Ext6   B07   AX00007497   TTGCTTTTCAGACACAAAGTGATAGCCTAGATGGTGCTAATGATTACATCACACG
Ext6   B09   AX00007498   TGATAAACGTGGCACACTGCGTATTCCCTTAGAAACAAAACACGAGTTTGATGC
Ext6   B11   AX00007499   ATTAGCTGCCATAATCGGAGTTATAATAGCAATTGCGCTTGGTGCTTATTTTTTA
Ext6   B13   AX00007500   AGACATTTCATTACATACCATCAGCCATCCCTATCATCAGGGGTTACCTCAAATC
Ext6   B15   AX00007501   ACAGTGTGACATATGTACGAGAAATTGCGGATGCTTTGTATAATATTCCGCATTC
Ext6   B17   AX00007502   GAGTATCAAAGTTTGTCCTCCACGGTGAAGATTGCAGTTGCGAAAAAAGAATAC
Ext6   B19   AX00007503   TAACACAAAATTTCGTCCTGGAGGTACTAAAAAATTTTGCCTGATAGTGATGGAA
Ext6   B21   AX00007504   ACCTGTTTGCCCGGAGTTATTAGGTGGTTTTGTTACACCGAGAGAACCAGCTGA
Ext6   B23   AX00007505   ATGAAAAAGATATGGAAAAAACAGAAGTAGCAGTAAAAACAGAAAAGACAGCTAT
Ext6   D01   AX00007506   AAGCTTCGTAAGAAACCTCTTAGACTTGAGGGGGATGAAGTTCGAATCATGATA
Ext6   D03   AX00007507   TTTTACGTCTTTATATTAAACAAGAGGATAAAGAGAAAGCAGACATACCTGATAC
Ext6   D05   AX00007508   TTTTAAGTCTTCGGAAAAAGAAGGGGGTTCGAAAAGATAAGTTCATTGAAATACC
Ext6   D07   AX00007509   CGATTAGACCTTGCGAAGCCACGTATTTATTCTGATAAGCTAAGTATCTTCTATC
Ext6   D09   AX00007510   TCGTAGTAAATACGCACTGGGGGGAAGAATACGATAATAAACCGAGTCCTAGAC
Ext6   D11   AX00007511   AGGTTTAGTTGTACCTGGTTATTTAGCACTCGTTTTTAATCAGCCCGTATTTATG
Ext6   D13   AX00007512   GGTATGTTGAATGCTCATCCGGATCCAGGAGCAATGAGAATTACACGTTTTGCT
Ext6   D15   AX00007513   AACAATTAACAGAAACCTATATTAAAGAAGCGATGTATACTGCTATGGATCAAAA
Ext6   D17   AX00007514   ATGGGTTCTTGATAGTAGAGGGAAGGTAACAACAACTTTTGTTGACGTTTTAAAC
Ext6   D19   AX00007515   ATCCAAATTTCAAATCACATGTAAATAAGGCGGCAATATACATTAATTCAGAAGG
Ext6   D21   AX00007516   TGCTATAATCAAAAACAATGAATCTACTACATGGAAGGCATTTCGTTCAGGATTT
Ext6   D23   AX00007517   TTACAAAGAGGGGGAAAGCACAACTTATACATATGTAAAGAATTTCATCAGCATC
Ext6   F01   AX00007518   AGAGTGATTTTGGAGAATGATTTTTTGAGTATGCAATCAAATAAGGTGCTTAATT
Ext6   F03   AX00007519   AATCATTGCCTTAACATTACTAGTTACTTTTTTACATCATCGAAGCCTCAGACCTC
Ext6   F05   AX00007520   TGAAGTACAACGGTAATCCTTATGTGTGGGGTGGAAAGAGTTCTTCGCAAGGAT
Ext6   F07   AX00007521   CAAGGATATCACCCTTTGGGTATCAGCTGTCCTTCTTATGATTTTGAGTATCCTC
Ext6   F09   AX00007522   TTAGAAGATGGGGCAGTTGCACCGTTCTATCAGCAGGGAAGATCATATTTACAA
Ext6   F11   AX00007523   ACTCGGATGTTCTTGAACGGGAAGGGTATGAGGTACGGAAGAATAGTCGGGGA
Ext6   F13   AX00007524   ACGAATTCCTGTTAGATATTACTGACAGCATTCACTTATTTGCTAGCGATCCATA
Ext6   F15   AX00007525   TTCCCAATTTGACGGGATACGTGAGATTATTAAGGAACAAAACAAAGTAACACGT
Ext6   F17   AX00007526   CATTCTAATGATGCAATAGCAATGGTAACAACGGACGGTTTTTCTACAACAAGGG
Ext6   F19   AX00007527   ATACACGGTAGGGATGGAAATACCAATATTTATCGTTATGCTTGGGGATATAGG
Ext6   F21   AX00007528   TTTTAGACCCGTTCTTCTCTACAGGTACTCGAACATCATTTAGTGGTTTTATTTTT
Ext6   F23   AX00007529   GGGTAAAGATAGTGAATTAGTTGATAAATTGATTAGAGAAGGGAAATTGAAATAC
Ext6   H01   AX00007530   AAGATTGGAAATAAGTTTTCATTTGTGCGTGAAAAATGGACAAGGATTGGTCTGA
Ext6   H03   AX00007531   AAGAAATGCAGTCTAACCATGAAATTTCTGCTAGCAAGGAATTAAGTGAGCATGG
Ext6   H05   AX00007532   CAAAACGATTCCTAAACCTGTACGTCCTAGATATCACAGTGATGATCCACTCTTT
Ext6   H07   AX00007533   TTAACTCCATCGGGTTCGGAGTATTTAAAACACAACCCAGAATTAGCTTTAAAAT
Ext6   H09   AX00007534   TTGCAGCCGTGCATTTTGATTGGTTCTTCTTCCCGTACTTTGTAAATGGTTGTTT
Ext6   H11   AX00007535   GTTGTAAAGTCGGATAAATACAAACGTGGGGCGTGGAAAAGTATCCAAAAAAAT
Ext6   H13   AX00007536   TCAAGATTTTGTCTCTTACGTACTCTACAGAAACAACAGAACAACAGGTGTACTG
Ext6   H15   AX00007537   CTTATGCAAATAAGTTCGCTAACAATTTGTTTAAGAAAAGTAAAAGAGCCACCCC
Ext6   H17   AX00007538   CGAAAAGAGACTTATGGCAGATGTTCCCCTTGTGAGTCGGGCGAACGGTGTAA
Ext6   H19   AX00007539   TTGAAATGATAAACGACAATGGAGGAGGCTTTTTTCATGGAATGGAGATATCTAT
Ext6   H21   AX00007540   GGAAGAGGCAGGATTTGTACAAATTAGAGTAAGTGGCAACGGATTTCTTCATAA
Ext6   H23   AX00007541   CTTAACTTACCGAGTCCGGTATTTGCGGGAATCTCAGCTATCTTCGCTGTTCAA
Ext6   J01   AX00007542   GATGCGTGTGAATCGTTTCCGTTATGGAGAAACGAAAAATTCCTACAAAAGAAAA
Ext6   J03   AX00007543   AAGCAGGGGGTCGGCGGTTCGATCCCGTCATCCTCCACCATATAAACTATATGA
Ext6   J05   AX00007544   CAAGGAACTGAAGTTATTATTGAGGGAGTCCAAGATGGTGTTTTGCTTGTACAA
Ext6   J07   AX00007545   ACAGCTCGTAATCAAAATTACGATATGGTGAAAGGTCTTACTATGGGCGCAGAT
Ext6   J09   AX00007546   ATTACTGATGGTAGCCATCCTTATTGGATTAACAGCATTTTTTGTAGCTGTTGAG
Ext6   J11   AX00007547   AAGTAAATGTTTTATAGTCGGCTCACCTAACCACCCAAGCCCTAAAGCGGTAATT
Ext6   J13   AX00007548   AACAGGATTAGTATTCATTGTAGTGGGTGCTATCTTTACGATTTTCTTACAGAAG
Ext6   J15   AX00007549   TGGTCAAGTGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCGAATC
Ext6   J17   AX00007550   AATGAGCAATATGGCCAATATAAAGGTGAATTGCAAATTGCATTAAACATATCTG
Ext6   J19   AX00007551   TAGGGGAAACTACTTGCAGGAATGGACGGGGATTACCAATCTATTCGGATGGAG
Ext6   J21   AX00007552   TATTATCGACATAGTTTTACAAACAGTTCCACTTTTGGCGGTAAGTGAAATTATA
Ext6   J23   AX00007553   TGATACAGCAGCACAAATAGCTGGCTTAGAGTCTGAGGAAGATATAACAGAAAA
Ext6   L01   AX00007554   TAGCTGCTTGTTCAGGGGAAAAAGATTCGAAGCAAGCAGGAACTAGTAAATCAG
Ext6   L03   AX00007555   TTTAAATGCTGACGGTACTCCGTTTATAGGTTATGAGAAAGGGTATTTTTTGCAC
Ext6   L05   AX00007556   AGATGTTTGTTTTGAGAACTGTGATTTATCAAATGTTAATTTAAGCAATTCTTCTG
Ext6   L07   AX00007557   TTTTTTAAACGCAATGTTACGAGATTCTTTAAAATCGCCAATTGTATCCACATTTG
Ext6   L09   AX00007558   TCATATGTCGTGGAATGAAATAAAGGTAACTATGGAAATATGGTCGGAAAGTTTT
Ext6   L11   AX00007559   GGCAAAAGATAGTTCTTTTGACATCGTTTCGAAAGTAGAATTACCTGAAGTAACA
Ext6   L13   AX00007560   CCATTAAAACGATATGTACAGCGTCAAGTTGAAACGAAATTAGCGAGAGAATTAA
Ext6   L15   AX00007561   GCACCAGTATTCCAACGTGGTAGATCTATATTAGAAAGAGAAACAATTAAAGATG
Ext6   L17   AX00007562   TGAGCGAATATTTATCAATTCAACACATTCAAAAACAGTTTGATGCATTTACAGC
Ext6   L19   AX00007563   TAATGTGCCGAATTTTATTGAAGGTGGAGGAGTAGTTCTCGTTCATAATTATGGC
Ext6   L21   AX00007564   TGATGTACAAAAGGCGTTTCAATTACCATACTGGGGTGAGAGAAATAATCTTTTT
Ext6   L23   AX00007565   ACTTGTCGGGGCTTGTAGTACACGCCAGATTCATCTGAGTGGTGGCTTCTTTCA
Ext6   N01   AX00007566   TGAGTATGGTATATGCATTAGTAGCAGGTACAGTCGCTGTATATGCAGTTATTGC
Ext6   N03   AX00007567   GACGAAGACAGGAATAACGCCAGTTATTCCAATATATTTAATGGTGGATGGTCT
Ext6   N05   AX00007568   AGAACCAGAAGAACCGAAAGAACCGACGTTAGATGAACAAGTGCAGGATGCTAC
Ext6   N07   AX00007569   AAAGAATAACTTGAATCAACTTAATCAAGTGTATTACCGGATCAATATATATTCTG
Ext6   N09   AX00007570   AGAACAACAATTAATTGAAAAAGCTTTTTCATTATTAGCAAAGGAGGCAAAGTAT
Ext6   N11   AX00007571   GATTCCAGTTGTAGAAATAGACGAAAAACAAGTAGAATATGGTAACATTCACAAA
Ext6   N13   AX00007572   AAACTACGAGAGTCAAAGGGATTTTCACAAGAGGATGTTGCTAAAAAGATTGGT
Ext6   N15   AX00007573   TTGCAAACTTCTCTTCATTTGGATTATGCCAGGGGCAGTGAAGAGTTTAAATGAA
Ext6   N17   AX00007574   AGATGAAATAAAGAAAAAAGGGAATTGGAGGCAGTTTTTACGCCTTATTCAAGAT
Ext6   N19   AX00007575   AAAGTCGCTGCTACTTATATTGGAACAGTCGTTGGAGCTGGATTTGCTACTGGA
Ext6   N21   AX00007576   ATACTAATAAGAGCATCTCCATTGGTGAGCTCAATATTTTTATTCACTGTCATTGC
Ext6   N23   AX00007577   AGGAAAGAGCGGGAAACTTGTTGGTATGCGGGCGGTTTATGGAGGAAAGAGTG
Ext6   P01   AX00007578   TACGATAACAAAAGTGCCTTTATCCATTGTTGATGTAGGCGTTCCATTGAAGTCC
Ext6   P03   AX00007579   ATTTTATCATCATTAATGCCCTATATTAAAGTGGATATCCCATTAACTGCGGGAC
Ext6   P05   AX00007580   TCGTATTGATGTGCAATGTGCATACAATAAATTCTAATGTAGAAGTTTCAGTTCC
Ext6   P07   AX00007581   TTCAACGCTCTCCGCGTGTGAAAGTAGATATACCAACAGGGGATGTTATTATTC
Ext6   P09   AX00007582   TATCGACTTTCCGGCAAAAAACGACAACTATCGCAAACCTTATTTTCAGTTTTAT
Ext6   P11   AX00007583   CAGAAGAATGTCCGTATGTCTCTATGAATGCAGTTGAATTATTAAAGACAATAGA
Ext6   P13   AX00007584   TGGTGAGAAATATAGCACTAAAAAGGGGGTAGTGGTGGGACATACATGGATGAA
Ext6   P15   AX00007585   ATGAATAACTGTGTCACATTGCATTTGTTAAATGATACAGCGCTAGAGCAAGCTG
Ext6   P17   AX00007586   TATGATGCATTCACATGGTGGGCTACAAGGGGACTCATTTGTTTCAATATATTTT
Ext6   P19   AX00007587   ATAGTGAGTGATGTTTTCATTGTTATGATGGGGAAGAAAAATAACCTGCAAGATC
Ext6   P21   AX00007588   AGATGGCGAGTGTCCTGTTGTCTTTTGGAGTCGTTTTTCAAAGGAACTGTATGC
Ext6   P23   AX00007589   GTATTGTAGAGTTGCATAAAGGAACAATTGAAGTGTATAGTGATGACAAAAAAAC
Ext7   A01   EMPTY        -
Ext7   A03   AX00007590   AAATTAGTGCGCGTTTTCAAATCTATTATTAACGCTATCGCTTACGGTAACGATG
Ext7   A05   AX00007591   TACAAATACAGAGAAAATAAATAAAAATATAGAGGTATTATGGGGACGCACGTTC
Ext7   A07   AX00007592   GAGCGTTCGATTGAAGATATTATTGATGAACTTCCAAATGAAGATATTGCTTATA
Ext7   A09   AX00007593   ACAAGCAAGTTTACTACCAAAAAGTGCAGATGCAGCGGGAATTCATTATAGTAAA
Ext7   A11   AX00007594   AACACCATATTAAAATTAAATATGCCTAAATGGACTGCCCATGCGGTAGCTACGG
Ext7   A13   AX00007595   GTTTAATTACTTGCTGCAAGAAGCAAAGGAATTAAACGTTGCTCAATGCGTATTA
Ext7   A15   AX00007596   AATTCGCTTAGTGTATATTTTCGTTAAAATGTGGGCAGGCCCACTTTTAGCAAAA
Ext7   A17   AX00007597   TTCGCATATCCGAAAAAGGGTAATTCTCGCTACAGTACTTTTATTCACCGTGATG
Ext7   A19   AX00007598   AGTGTGGTTACCAAATAGTGAATATAGTGCAGATTATGATAGGGATAATTTAGAG
Ext7   A21   AX00007599   AAGAGAAATGTTTAATACGTCGTTTGAAATTCAGTTTGATCTATGTAATGGCGAA
Ext7   A23   AX00007600   AATAGGGTTGAAACAAGTGAAAACATATATTCAAAGTGGGAATATCGTATTCAAT
Ext7   C01   AX00007601   TCCACAAATGTGGTTTTGGTTATGTATTTTTTTTGCGTCCATTATACAAAACATAG
Ext7   C03   AX00007602   TATACGTATAAACCCGTAACCCTTGAAAATAGAATAGATTGGTATGAACAAAAAA
Ext7   C05   AX00007603   CAATAAAACGATAGATGGTACTTTGAAGGGGACAGAATTAAATAATGCAAAAAAG
Ext7   C07   AX00007604   ACCAATAGAAATTATTATTGTAGCTGATGATAGAATGAGTGCTATACAATCTATAC
Ext7   C09   AX00007605   GGGGCAATCCATTCTATTTGCTATAACTTTCAGCAGATTCATTCTAGGAAATTTT
Ext7   C11   AX00007606   ATCATCCTGCAGACAATTGCGGCAAACATCGGTAGTAGCTTGATGCCTATGGGA
Ext7   C13   AX00007607   TATCAAAGGAATTACAGCCAATCACTAAGTGTATTGAAGAGGATATAAAAAGTTA
Ext7   C15   AX00007608   GCTATCAAAGTGTATCTAGCTTTTATAATGCATTTAAAAGAAATACAGGATTTTCA
Ext7   C17   AX00007609   GTTTGCGCGAGATATCGGAATTGACCTAGGTACGGCTAACGTATTAATCCATGT
Ext7   C19   AX00007610   AACTAGAAACGAGATTAACAGGTTTTGGTTTCTTTAGATGCCACCGCTCTTATCT
Ext7   C21   AX00007611   TATTGTGCGAAATATCGTTCATAATAACCGATGTAGAACTGCACTAGAAAGTTTA
Ext7   C23   AX00007612   GAAGTTAGCAAGTTACAAAATTCCAGAAGTGGTATTCGTAGAAGAGTTACCGAA
Ext7   E01   AX00007613   TGTTGGAATAAAAAAAGAAAAGGAAGACTTTTGGTCAACTGTTAAAGAGGATGG
Ext7   E03   AX00007614   AAGGGAATAAGTCCAGTAAGAGGATTATATTATATCGGCTTGCCATGGCAATCT
Ext7   E05   AX00007615   TCACACCAATTAACGCTCAAAATGTAAAAAAAGCACATGCTCTGCTTGAAAGCGG
Ext7   E07   AX00007616   TGCAGCTACACCTAGTTTGGCTCCCGCAAAGGCACTTACAGCAGTTGTACCAAC
Ext7   E09   AX00007617   TTAGCGTCTGCGTTATTTCTTGCAAAACATAATATTGAGTACTTACTTATTGAAAG
Ext7   E11   AX00007618   TTGCAAGCAAGAGAACACTCTAAACTAGATGAAACTAGTATTGCTGAAGGGTTAA
Ext7   E13   AX00007619   AATTCATTACAGTTCACAATACTTACAACGATGCTACAGCAGAAAATGAAGTAGC
Ext7   E15   AX00007620   CTTGCTGAAATGACACACATGAGAGAGGCAACAATAAGTGATATTGTAAGAGGA
Ext7   E17   AX00007621   CTGTCGTCGTGATATCGTTCTTGAACTTGAAGAAATGGGCTTTGAAATAAAGCG
Ext7   E19   AX00007622   GGGCTGTCAATTGCCGCAAGATGATGATGAAAAGTTTATGCATTCCATGAAAGA
Ext7   E21   AX00007623   AGCACAAAATGCTGAGATTTCTCAAAAAGAAGCTACTGTAGTGTACAACTGTAGT
Ext7   E23   AX00007624   CAAAAAGATGGGCATAGAAGACATCAACCGCATCCTTCGCATGGAGGACTTAGT
Ext7   G01   AX00007625   AATCGTCGTTTTAGTAAAGACAGCCGTTCAATTGGTACAATTTCAATGGACCAAG
Ext7   G03   AX00007626   GATTATGCGGTTCGGATATGTCTCACATGCAATGGCACTCTGGGACTGCTCTCC
Ext7   G05   AX00007627   GTAGTACAACGGCTGGAATGCATGGGATATGGTTAAACCGAAACAGCTCGCAG
Ext7   G07   AX00007628   CTTATTGGTTTCGCTACACTCTTTTCTTGCTATTGCCTATATAAGCAAATTAAGAA
Ext7   G09   AX00007629   AAAAGGGACTTATGTATAGTATGCAAATGAGTTCCTTGTATGAAAATGAAAATTG
Ext7   G11   AX00007630   TATAGAACTCGGAGAGGGCTACTCTGATTTATATGAATTACTTGAAATTGCCAAA
Ext7   G13   AX00007631   GTGCAAACGAAGATCAATTAGAGTTCCCAGTTGTATTTGCATCAGCAATGTCGG
Ext7   G15   AX00007632   CATTTGTAAAAGAAAATGCACCATCTATCATTACACCAATTGTCTTTACAAATTTA
Ext7   G17   AX00007633   TTCTAAGTCCGTGACCCGTTTTCAACTCGAAAACGGTGGATCTAGTGAAACTCT
Ext7   G19   AX00007634   TCAAAATTTTGTTTGTCACATCGTATGCTCATCGTTTAAGGAAGCGGTAAGGGAA
Ext7   G21   AX00007635   ATTAGAAAATGTACTATTTGATTCTGGGAAAGCCGACGTGAAATTAGAATCACTA
Ext7   G23   AX00007636   TATTAGCATATTCCGGAGGTCTTGATACTTCCGTTGCAATTAAATGGTTACCAGA
Ext7   I01   AX00007637   TTTGCGACAGAAGGTCTCGACATAAGGGAACTTCTTAGAGCAAAGCTTTCAGAT
Ext7   I03   AX00007638   CACCGCATCACAGGTGACGGTCCACCTGATTTAATGATCGGTCCAATGTGGAGC
Ext7   I05   AX00007639   AGGAGTTCAATCCTTAGTTAGTAGTTGCTTAATATATTTTTCTAACTTTTTGGGTT
Ext7   I07   AX00007640   AACGCGTTTATTTTAACGACAATCGTCTTCCTTAGTCTTTTTATCGTTGTATCTAC
Ext7   I09   AX00007641   CGATAGCTCTACCACTGAGCTACTGCGGAACAATTATGGTGGGCCTAAATGGAC
Ext7   I11   AX00007642   CTTATTATTCCTATTGCTGAAGCTCCCACTTGAATCCCCGCAACTTTTCCAAGTT
Ext7   I13   AX00007643   GTTAGGTGAATTCGCACCAACTCGTACGTATAAAGGTCATGATGCTGACGATAA
Ext7   I15   AX00007644   CGTGGTTTACCAGTTCGTGGTCAAAACTCTAAAAACAATGCTCGTACACGTAAAG
Ext7   I17   AX00007645   GATCACTTTAGGTAAACGCGGAGATCTTCATGCTCGTCGTCAAGCAGCAGCTTT
Ext7   I19   AX00007646   TGTTACAGGTGTAAGTCGTTTAGATGGTATAGGCGCAGCAATTTGTAAAGAATTA
Ext7   I21   AX00007647   GTTTTTCTGGTACGCAATCTATTTTGTATCATCATTATATGCCAACGGAAGTAGG
Ext7   I23   AX00007648   CATTACGAACATTGGTGAAGCACATTTAATGGACTTAGGCTCTCGTGAGGCAAT
Ext7   K01   AX00007649   TAGCGCGGAGCAAATTTATGAAAAGGTGTGGAACGAAAGATCTTTCCAGTCGGA
Ext7   K03   AX00007650   AATAGTAGGTGGAAATAGTTTCATTGGTATTAACCTCGCATTAGGTTTATTGAAA
Ext7   K05   AX00007651   CTTTTTAAGTTTTCTAAGTGCTCTAAGTGCTCCCAAACAATTCTTATAATAGGAAC
Ext7   K07   AX00007652   GTTTTATACCCAAAACAAAAAAAGAAGATGCAGAACAGAAATTGCTCCAGAATGG
Ext7   K09   AX00007653   ATGGTGGGGGGAATTGATCAAAGATTAAAGTTAGATTGTTTAATAGGATATGCC
Ext7   K11   AX00007654   AACAAACTGTAGGAAAACAATACTTTTATGGGAAAAGCCAAAAGAGCTAAGTGAA
Ext7   K13   AX00007655   AGTCATGAAAGGTGTTCCCGCTCGAAGCTGCTATCTGAGTAATCGGATTGTTGG
Ext7   K15   AX00007656   AACCACCGCACTTTCATTCGGCTTAATTGCTTTAGGAGGGGTAGGGACAACCTT
Ext7   K17   AX00007657   TTCCGCAAAAATGAGAAGAGTATATTATGGGTGAATATGGTGAACCTTATAAGTA
Ext7   K19   AX00007658   GATTTTTATAAGAAGGGCAGCTGCTATTTTCGAAAGTAACTTTGTAGAAGGGGA
Ext7   K21   AX00007659   CTGGAAAAAGGGATTGATGTTTATCAATTATCCCATCTACTATATCGTGATCAGC
Ext7   K23   AX00007660   TTCAATAAATATATCCACCAATGGGAAATCGAAAGTCACACCTATAAAAAATGTT
Ext7   M01   AX00007661   ACTCATCGCGCAAGCGCTGTATTTTTTGCACCAGAACCACAATTTCTGCTCTATT
Ext7   M03   AX00007662   TTAACCAGGCTAAAACAAGAGCATTTACTTGAAGAAAAATACCCAATTAAGAGGA
Ext7   M05   AX00007663   ATAAGGACCACAAGAGCGTGGCAAATATATTGAAAGAGAAAGCAACTGCCAAAA
Ext7   M07   AX00007664   TTCTTAGCAAATGAGGGAACGTATAATGTAGTGAACATAAACGGTGAACGGAAA
Ext7   M09   AX00007665   TAGGAATATTAGTAAAAGTGCCGAAAAGATCCTGTTGCAAAGCTTTTAAAGAACA
Ext7   M11   AX00007666   ATCGATTCTAGATGTATCTGCTACATTAGACACAGGAACCAAAATTAATATTGAA
Ext7   M13   AX00007667   ACACAGGAAAACAAATTGGTGAGATTCGAAAACAATATCTACTAAGTGATTCTAC
Ext7   M15   AX00007668   ACTATAACGTTTGGACAATATTAGACGATCCAAAAGAGCAGGAAACAAACGAGC
Ext7   M17   AX00007669   AGGGTACACCCAATCCGATATATCACATCGTCTAAATATTGCCCGCACTAATTAT
Ext7   M19   AX00007670   GAAAGAGAAGGATTTAAAGTTCTATGAGCAAAAAAATAGGAAGAAACCGATGCA
Ext7   M21   AX00007671   GCCGGCAAGTGCTGGTTCAGGGTTAATATGGGTTAGAGACAAATACCCTAATGC
Ext7   M23   AX00007672   ATGGAATTTTTGTTTGAACTTTTAAAAGAAATTGCTTTCTCAGTGCGTGAGCTTTC
Ext7   O01   AX00007673   GTAGCTCGTATACATCTTATTAAATTTAAAGTGGTTATCAAGTCGAAGAAAAGGC
Ext7   O03   AX00007674   ACCTACGCATAACCATAGCGTAGGTGTGTCCTTTTTTTGTTTAAGGAGGAAAAAG
Ext7   O05   AX00007675   AACGCTTGGCACATCGCAAAATCATGGCGAAGTTTAAACAAACCAATAGATATTT
Ext7   O07   AX00007676   AAAGGTACGCAAGATGGGAAAGATGTTGCCTGTTTTACAGAAAGAGTACGCAAC
Ext7   O09   AX00007677   TCGATTCTAGCAATATATAGCTCTCCACATAACACCAGGGAGTATTCTTCTAATG
Ext7   O11   AX00007678   GAAAATACAACTGATATAACTGTGAGTACAAATAACGAAGTTAGATTTTTCAAAG
Ext7   O13   AX00007679   ACAGTTTGTAGAAGAAAATAAGCAAGAGCATTTTCAAGATATAATCAGTCAGAAC
Ext7   O15   AX00007680   TTATATGTACTAGGGTTCTTAGTAATCTCCATAGTAGCTATTCGTCTTAACATGA
Ext7   O17   AX00007681   TAAACATTATGAAGAACAAGTACCATTTTACGTTAGAGAGATACATCCGACTGAC
Ext7   O19   AX00007682   AATTATAAGCCTTTTTAAATTAAATGTTGAAATATTTGCTGCAAATCCGGATGTTG
Ext7   O21   AX00007683   AGCACTTGAAGGCCAGAGGAATGATACTTATATGGATTCAAATGCTCATCCATTA
Ext7   O23   AX00007684   ACACTAATCGGCTCAAAGAAGCCCTTTCTAAAATGAAACAAGACGTAACTTGCTT
Ext7   A02   EMPTY        -
Ext7   A04   AX00007685   TGTTAACTTTTCATAAGATCACATCCATTGAAAAGAAAAAGAAAAACCTTAAGCTT
Ext7   A06   AX00007686   AGTACCCCATGCCCATCAACTTAATATTTTGAAGTATCCCCCAAATGAAAAAATT
Ext7   A08   AX00007687   TATAGCTCCATAGAACAAAAAAGAAGGTTCCCTTGTGAGAGTAGGGTTCCCTCC
Ext7   A10   AX00007688   CTGTTCAGATGGACAGCTTATTTACATAATTATCGTTATTGGAAGTTATCGGAAA
Ext7   A12   AX00007689   GGCTTTGTTTACCGCAGTCCTTGACACATTTCTTTTGGGATTTTTGTGCGGTGAA
Ext7   A14   AX00007690   AAGCAAGGGTTATTTGGCATGTTCTTTACTTTGAAGACATGCTTTTTTATTTAGG
Ext7   A16   AX00007691   AGATCGAAATGGGAAAAGTTATGCTCCTGCAAAGTATTTTGAAACAGGAACGAA
Ext7   A18   AX00007692   TGGATGTATTGTGATGTATCCAATGGTTATTGTTATTCAATCCTTAATGCAAGGA
Ext7   A20   AX00007693   GATGATTGCTTCATTCTGTACGACTGGTCGTATCAAGTATGATAAAAAACCAAAA
Ext7   A22   AX00007694   TATGGGTGGCGTGATTGCGCTCATAGCGATCATAACGATTTGTTCAGACGGAAT
Ext7   A24   AX00007695   CAATATAGTGAAAAAAGATTCAGAAAAATTAGTTGCTAAAATGGTTGGACCCGGC
Ext7   C02   AX00007696   AAGCGCATACAGGCACATACAAAACGCATACGAAGTGCTAAAAAACGCATACAA
Ext7   C04   AX00007697   TACGGAGGATTTGCCTGTTCAGCATTTTATCGAATTTAAATTAACATCATCCTATT
Ext7   C06   AX00007698   GTTTTATACTCAAAACAAAGTAAAAGAATCCAACTATAAAAGAAGGATTCTTTCAC
Ext7   C08   AX00007699   CAACCTTTTTTACGGGATTTTCAATTGGGTGTGTTGGAAAACAATGCATATATGA
Ext7   C10   AX00007700   TTTTTGTACGGGGGCATGCCTCTATATTTCACATCATTTTTACAGAGAAATATGT
Ext7   C12   AX00007701   AGTTTCAAATCAATACAGGAATTAAAAGACCATAGAGAAAGGAATGAGGGGAGT
Ext7   C14   AX00007702   GGTACGATGTCCATTATTAGACGTGTGAATTCTTATAAATTCCAAAATAGGCTAG
Ext7   C16   AX00007703   CTTGTAACAATGGGGACCTTTAAACGTTCGGAAACATTAACGACTGATGAGCAG
Ext7   C18   AX00007704   TAAAGGGGGTGAATTTAAGTTTAGAAACAAACAGAATTTTATATAATAAGTGGAA
Ext7   C20   AX00007705   GCAATAGAACCACATTTCTTCATATTTTTATACTCCTACTTCTTTCTTAAAAAACT
Ext7   C22   AX00007706   CGATATTTGAAAGAGCGTCAAGAAAAATTTATATCTGATTGGAAAAAAAAGGTCA
Ext7   C24   AX00007707   TCTTAATCAAATGCATATTCGAGCATTGAACGGACAAAGTAGTGTCTATTTCCCT
Ext7   E02   AX00007708   ATTTCATACTTATCTAAATCAAGTAACAGGAAAAAGTTTGACATATGGTATATGCT
Ext7   E04   AX00007709   CGATTCAGTTGTCTGTTCACAGCCCTGCAGTTGCTTATACACATTAAAAAACAAA
Ext7   E06   AX00007710   ATGGACAAGTACATAATTGGCATTCCTTGTGTTGGTAAGTTGAGCCTTTATTTAA
Ext7   E08   AX00007711   ACCAATTATAAATGTGAGGTTGTTAGCTATTCCATGTAATGTTTTTATACATGTTG
Ext7   E10   AX00007712   TGCAAATGTATTAATGGTAGTTGTAAAAAGCGTTAAAAACGAAAATAAAGAGCCG
Ext7   E12   AX00007713   AAAAGGAAGGGGAATACCCCCCTCCTTTACTTGTACTTTTGTCGTCGGAGTTCA
Ext7   E14   AX00007714   GGTAAATCACAATGAGGTGTACCGCTGCAATAAATGTGGGGGCGCTGCATGGC
Ext7   E16   AX00007715   TTTTTAGTGAAAGACAAAAAGAGCAACATATCGCTATGTCGCTCTTCAAAAAATC
Ext7   E18   AX00007716   TATCTTTCCATCCCTCGTTGTTGCAAGTATGCAGCCCTTCTTCCTTGCTCTCTTT
Ext7   E20   AX00007717   TCTTCTTTTGTTGTTCCATGAAAATTCCTCCATTAAAAAAAGACCATGCTTTTTCA
Ext7   E22   AX00007718   AAGAGGAAAATGAATTAAGTCAATGTCCTATTTACTCTGAGGATGAGAAAATAGC
Ext7   E24   AX00007719   ATGAAAAATATCGGTTTAGTATTAGAAGGCGGAGGAATGAAAGGTTTATATACGG
Ext7   G02   AX00007720   AGCCATCATTTCAGCTATGCAACGTTGTACACAAAAGTCTGTCGAACTATCTGGT
Ext7   G04   AX00007721   TGTAACAGCGCAACATCGTCAAATGTTAGGCACTATTAAGTATCTTCGAAAACAC
Ext7   G06   AX00007722   TTGGGATAGTTATGAGGAAACTTCAAAAAAGAAAAGTGTGTAATAAGAAAGATAT
Ext7   G08   AX00007723   AAAAACTTGGTTAAGCGAACAACATCTAATTTTCGCTGAGATAACTACCGAAGTG
Ext7   G10   AX00007724   TTCGTGGTGCTGAAAGTGCAATCAATCAAATGAAATATGAAAAATCGCACAAGAG
Ext7   G12   AX00007725   TGAAACAATATAATATACCGGTAGAAGCAACTTTAGAAATTATCGGGGAAAAGTG
Ext7   G14   AX00007726   ATGCAAATCGCGGCTTCTAAAGTACCTGCTTTCAAAGCTGGTAAAGAACT
Ext7   G16   AX00007727   CATAACCCGAAGGTCGCAGGTTCAAATCCTGTCCCCGCAACCAAATGGTCCCG
Ext7   G18   AX00007728   AAATTCGTGGGTCAGTTCACTTAGTATGTGGATTTAATGGAGGTGTTTTTCGTTT
Ext7   G20   AX00007729   GAAGCGGAAAGCCTGGTACAAGAAATATGGGGCGCGTATATGGAAAAGGGTAT
Ext7   G22   AX00007730   AAAATTGAATACATGAGTTTAGAAGATGATGCTGAACTTTTAAAAACAATGGCAC
Ext7   G24   AX00007731   TTATGATACGATTCTGGCAAGATTCACAAAAGCATCAAGCAATGCAGACGTAAAT
Ext7   I02   AX00007732   TGATACAATTCTAGCTCGATTCACAAAAGCATCAAGTAATGCGGATGTAGATTCT
Ext7   I04   AX00007733   TGAACGCTATCGTTGGCATTGACGTAGATTACGCAATTATTCGTGCTGGAATGT
Ext7   I06   AX00007734   AAGGGAAATCGAAAGGGTCTAGAAATCTACTCCAGTATTAATAATCCAAAGGTTG
Ext7   I08   AX00007735   GTTTTATCTGGTGATGTATTAAAGGTAGATGCATTTTTAATCACCAATTG
Ext7   I10   AX00007736   GACATTAACAGGTAAAGTAAAATGGTTTAACAGCGAAAAAGGTTTCGGTT
Ext7   I12   AX00007737   GGTTTTATCCGTTACGTGAAGCAATAAGTAAATACGTAAAATCATTTGGA
Ext7   I14   AX00007738   CTGAAGGTATTGATGAAAATAAAGTGACTTTATTTATGTTGCGAATAAAAAAGTA
Ext7   I16   AX00007739   TTATGCGTATGATGCTTTAGAGCCCTCACTTGACAAA
Ext7   I18   AX00007740   GGTGATGAATATAACATGTTAAAACACTTAAAAAATCATTGTTGCATTTACTATAT
Ext7   I20   AX00007741   GCTATTTCAATAGAAGAAACAAAAAACCAATTTTTCCCTTAAAAAAATCATTCCCA
Ext7   I22   AX00007742   AATGAAAAAGATTTGATACATAATTGGAAAATAGATTTGCAAATTATTAAAGAGGA
Ext7   I24   AX00007743   GCGGAAGAAATTCGTTTAATTACTAATATCAACAAAAAAATAAAACAAGTGGTAA
Ext7   K02   AX00007744   GTAGGATTTTTAGCAGCAAAATCAATTTTCAAACAAAAAGCGAACTATACAGTTA
Ext7   K04   AX00007745   TTCTATCTTTTTCTTATATCCAATTAACTAAAAGAAGGGTAGAAGAGAATATGAAT
Ext7   K06   AX00007746   GAGACACAATTTAATTTAGAAACAATTCACTCGCTATATTTAACAAGAGAAAAAAT
Ext7   K08   AX00007747   CGGAACCCGTTTTTCCTGTTCAACAAAGAGTAGCTGATGTTAAAGATATGGATTT
Ext7   K10   AX00007748   GTTCGAGTGAAGCAGAATGTACTTGAAGTAGATGGAGAGATAGAGGATATCATT
Ext7   K12   AX00007749   ATTTAGTAGTGGCGGTAAAGCAGCATACCTTGACTGGGCTTACAAATCAGCAGA
Ext7   K14   AX00007750   TAGAAACAGAGGAAATGCTATCCGAAGAGACAAACCATCTCTTTGCAAAAGTAC
Ext7   K16   AX00007751   ACGCGATGAGTTAAGGAGAAGTATTGTGGAACGCCTTGATCAAATTCAGCCACC
Ext7   K18   AX00007752   CAAGAGCTTCGCGATAAAACGTGGGCTTATTTATCTTTCCTAAGTGGATTTACGA
Ext7   K20   AX00007753   GAGTAGCGAGTGATTCTTTAGTGCGGCTATGTAGCCAACTTCATGCTATTACAG
Ext7   K22   AX00007754   TAAACCAGTAGCAAAGTGCAGAAAAGAAGCGGTGTCTCGCTTAAAGCATATGGG
Ext7   K24   AX00007755   GCAAGAAGATCGAATGGATCCATGGGAGGATATATTATGCACGCTGGCTATTAT
Ext7   M02   AX00007756   AGAAGAAAAGGCCGCGGAAAAAGCAGCAAAAGAAGCAGCAGAAGAAGCTAGAA
Ext7   M04   AX00007757   TAATACGTTCTTCCGTCCGTTTTATATTCCTCGTGATGGGTACCCACGTATGATG
Ext7   M06   AX00007758   ATTCGTCCATTCTTACGCGATGGTTCAAAACCATTATTTGATGGACAAAGTCATT
Ext7   M08   AX00007759   TATGGAAGTCTCAATGGCTCTGAATGTGGATTGGAAAGAAGTTGTCGCTTTTGA
Ext7   M10   AX00007760   AAAGGTATTGGAAGAAGCGAAAAAATGGCTAGGGCAAGGAAAAGGTCAGATATG
Ext7   M12   AX00007761   AACTTTACCATTCGTGGAAGTTTTAGTTTGTTTTTAGGGATATATGGAACGCTGA
Ext7   M14   AX00007762   TTATGGAAGTCAGATGTTCCTTGGTGAGGAGGTGCAGTTTGGAGATGATAGATG
Ext7   M16   AX00007763   TAATACGGAACGTATTCAAGAAAAGTTAAACTACCTGTCTCCTATAGAATACAAG
Ext7   M18   AX00007764   CAGTATAAGGAGTACTCAATCACAGATGTAGTAAAAGAAACAGGTTTAACAAAGT
Ext7   M20   AX00007765   GAGCATCGGATGGTAGGAGGACGTGCGTTGATGACAGATTCTACTCACATTAAG
Ext7   M22   AX00007766   TGAGGAGGCTGGTGGAATTATATCGGGAATCGTATTTCTAGTAGAACTAACAGA
Ext7   M24   AX00007767   AGTTCGAGATGTGAAGGCCTCTATTGACAAGTTAAAGTTACGAGGACAACGTTT
Ext7   O02   AX00007768   ATCAGCGAATCACAAACACTGACATTGGCGATGAAGACATTAAAACAAGCAATG
Ext7   O04   AX00007769   TTTGGTAAGAGAGGCAATTAGTGGTGAAGAAATTGAGGCTTTTCGAAAAAAATTG
Ext7   O06   AX00007770   TTTCATATTAGTAGTAGGGTTTGCAGCAGCGGTGCTAGTCCATCACTTATCATCC
Ext7   O08   AX00007771   TTTTCTTTTGGCTTTAAAACGTATATAACGGCATTCGCAAGGCATCCGATTGGCT
Ext7   O10   AX00007772   TTGGAACTGCGAAATATGGTGACCAATACATTGAGCCAAAGATTGAACAGCAAA
Ext7   O12   AX00007773   CATCACCAGCATGTCACGGAAAGGAAATTGCCATGATAATGCCTTCATGGAAAG
Ext7   O14   AX00007774   TGAAACGATGGAAATCCCCGAGGCATACATTGGTCAAAATCAGAAACTTCCAGC
Ext7   O16   AX00007775   CATCGCCTTTATCAGCTGCTCAAAAAGAACGGTCGTAAATGTCATAGGTATAAG
Ext7   O18   AX00007776   GCTTTTCGAGTTATCAATGATTTAGGTAAACAATATTCGTTTCTAAACTCATTCAT
Ext7   O20   AX00007777   AGAGTTGCTGGATTCTGGGACCCGGATACAGGTACCCAGAGGAGGAGTGAAAA
Ext7   O22   AX00007778   ATGTTAAGTTGGAAATAAAAGATATACCTGTTGTGCAAATCTCAGATATGCCAAC
Ext7   O24   AX00007779   GGTAGTTGTAAAAAGCGTTAAAAACGAAAATAAAGAGCCGTTTTTTAGAAGAGGG
Ext7   B02   EMPTY        -
Ext7   B04   AX00007780   CGAATCGCAAAACGTTTTACGGTTGTACAGGCTATAAGGAAGGTTGCAAGTTTT
Ext7   B06   AX00007781   GCGATTCCAAACGAAAAATGATGTGGCATTGCTACTGAAGAAACATCAGCTGTC
Ext7   B08   AX00007782   GTTGAACGATGATTTAACGAAATGGCGAGCAGAACAAGAATATGAACGAGTACA
Ext7   B10   AX00007783   TTATGTTACCAATACACCTTTGGAATGGGTTCCGATGGAACAAATACATGATTTT
Ext7   B12   AX00007784   ACATAGTGATCAAGGGGCCGTGTATACCTCCTACGCTTTCCAAACGTTATCTAA
Ext7   B14   AX00007785   GCATCAAGTAGTTCCTACGAGATTAGGAACAGGCTATCAAGAAATAGAGTGGGA
Ext7   B16   AX00007786   TGTCTCCTGAAGAAATGAAAGAGGGCAAGAAGGAAGGGATAAAAGCAGAAGAAA
Ext7   B18   AX00007787   CAACGTCACCGTGATTTAGAAGCAATAAAATTGCAGGTAGAGGACATGATTACG
Ames_sequence_name                              entrez_geneid
                                genbank_accession                gene_symbollocus_tag gene_start_coordinate
-                               -               -                -          -         -
ref|NC_003997.3|:407-1747       NC_003997.3     GeneID:1083812   dnaA       BA0001         407
ref|NC_003997.3|:1926-3065      NC_003997.3     GeneID:1083862   dnaN-1     BA0002        1926
ref|NC_003997.3|:3193-3405      NC_003997.3     GeneID:1083875   -          BA0003        3193
ref|NC_003997.3|:3418-4545      NC_003997.3     GeneID:1083876   recF       BA0004        3418
ref|NC_003997.3|:4584-6506      NC_003997.3     GeneID:1083919   gyrB       BA0005        4584
ref|NC_003997.3|:6595-9066      NC_003997.3     GeneID:1083944   gyrA       BA0006        6595
ref|NC_003997.3|:15468-16931    NC_003997.3     GeneID:1083772   guaB       BA0008       15468
ref|NC_003997.3|:17045-18352    NC_003997.3     GeneID:1083767   dacA       BA0009       17045
ref|NC_003997.3|:18514-19401    NC_003997.3     GeneID:1083765   -          BA0010       18514
ref|NC_003997.3|:19420-20010    NC_003997.3     GeneID:1083754   -          BA0011       19420
ref|NC_003997.3|:20338-21612    NC_003997.3     GeneID:1083752   serS       BA0012       20338
ref|NC_003997.3|:21869-22420    NC_003997.3     GeneID:1084023   -          BA0013       21869
ref|NC_003997.3|:c23762-23127   NC_003997.3     GeneID:1086224   -          BA0015       23127
ref|NC_003997.3|:24535-25035    NC_003997.3     GeneID:1086637   -          BA0018       24535
ref|NC_003997.3|:25512-27200    NC_003997.3     GeneID:1089003   dnaX       BA0019       25512
ref|NC_003997.3|:27223-27552    NC_003997.3     GeneID:1088875   -          BA0020       27223
ref|NC_003997.3|:27567-28163    NC_003997.3     GeneID:1088835   recR       BA0021       27567
ref|NC_003997.3|:34554-35975    NC_003997.3     GeneID:1086913   cad-1      BA0026       34554
ref|NC_003997.3|:35977-36603    NC_003997.3     GeneID:1087006   tdk        BA0027       35977
ref|NC_003997.3|:36639-37622    NC_003997.3     GeneID:1085794   holB       BA0028       36639
ref|NC_003997.3|:37619-38455    NC_003997.3     GeneID:1087373   -          BA0029       37619
ref|NC_003997.3|:38470-38820    NC_003997.3     GeneID:1086683   -          BA0030       38470
ref|NC_003997.3|:38941-39681    NC_003997.3     GeneID:1083746   -          BA0031       38941
ref|NC_003997.3|:39927-40802    NC_003997.3     GeneID:1088327   -          BA0033       39927
ref|NC_003997.3|:c41107-40823   NC_003997.3     GeneID:1086671   abrB       BA0034       40823
ref|NC_003997.3|:41598-43580    NC_003997.3     GeneID:1084885   metG       BA0036       41598
ref|NC_003997.3|:43746-44513    NC_003997.3     GeneID:1084677   -          BA0037       43746
ref|NC_003997.3|:44728-45285    NC_003997.3     GeneID:1083787   -          BA0038       44728
ref|NC_003997.3|:45282-46160    NC_003997.3     GeneID:1087001   ksgA       BA0039       45282
ref|NC_003997.3|:46271-47134    NC_003997.3     GeneID:1086198   -          BA0040       46271
ref|NC_003997.3|:48101-48970    NC_003997.3     GeneID:1088040   ispE       BA0043       48101
ref|NC_003997.3|:49025-49873    NC_003997.3     GeneID:1088028   purR       BA0044       49025
ref|NC_003997.3|:49996-50370    NC_003997.3     GeneID:1086283   -          BA0046       49996
ref|NC_003997.3|:50523-50816    NC_003997.3     GeneID:1087291   spoVG      BA0047       50523
ref|NC_003997.3|:51139-52518    NC_003997.3     GeneID:1085656   gcaD       BA0048       51139
ref|NC_003997.3|:52537-53490    NC_003997.3     GeneID:1084386   prs        BA0049       52537
ref|NC_003997.3|:53563-54123    NC_003997.3     GeneID:1087397   spoVC      BA0050       53563
ref|NC_003997.3|:54194-54418    NC_003997.3     GeneID:1083896   -          BA0051       54194
ref|NC_003997.3|:54524-58054    NC_003997.3     GeneID:1084914   mfd        BA0052       54524
ref|NC_003997.3|:58190-58726    NC_003997.3     GeneID:1084878   spoVT      BA0053       58190
ref|NC_003997.3|:60571-62031    NC_003997.3     GeneID:1083796   -          BA0055       60571
ref|NC_003997.3|:62046-62321     NC_003997.3   GeneID:1083636   -         BA0056    62046
ref|NC_003997.3|:62380-62688     NC_003997.3   GeneID:1086691   -         BA0057    62380
ref|NC_003997.3|:62685-63338     NC_003997.3   GeneID:1086663   -         BA0058    62685
ref|NC_003997.3|:63335-63694     NC_003997.3   GeneID:1086646   divIC-1   BA0059    63335
ref|NC_003997.3|:63782-64264     NC_003997.3   GeneID:1086747   -         BA0060    63782
ref|NC_003997.3|:64936-67314     NC_003997.3   GeneID:1084170   spoIIE    BA0061    64936
ref|NC_003997.3|:67548-68978     NC_003997.3   GeneID:1086418   -         BA0062    67548
ref|NC_003997.3|:68975-69517     NC_003997.3   GeneID:1086462   hpt-1     BA0063    68975
ref|NC_003997.3|:69603-71504     NC_003997.3   GeneID:1086600   ftsH      BA0064    69603
ref|NC_003997.3|:71729-72517     NC_003997.3   GeneID:1086632   -         BA0065    71729
ref|NC_003997.3|:72524-73399     NC_003997.3   GeneID:1084237   hslO      BA0066    72524
ref|NC_003997.3|:73504-74427     NC_003997.3   GeneID:1084865   cysK-1    BA0067    73504
ref|NC_003997.3|:74648-76045     NC_003997.3   GeneID:1083914   pabB      BA0068    74648
ref|NC_003997.3|:76051-76638     NC_003997.3   GeneID:1083680   pabA-1    BA0069    76051
ref|NC_003997.3|:76632-77504     NC_003997.3   GeneID:1087828   pabC      BA0070    76632
ref|NC_003997.3|:77497-78339     NC_003997.3   GeneID:1083704   folP      BA0071    77497
ref|NC_003997.3|:78340-78702     NC_003997.3   GeneID:1083963   folB      BA0072    78340
ref|NC_003997.3|:78699-79214     NC_003997.3   GeneID:1084906   folK      BA0073    78699
ref|NC_003997.3|:79166-79369     NC_003997.3   GeneID:1083770   -         BA0074    79166
ref|NC_003997.3|:79417-80391     NC_003997.3   GeneID:1087319   -         BA0075    79417
ref|NC_003997.3|:80551-82050     NC_003997.3   GeneID:1086603   lysS      BA0076    80551
ref|NC_003997.3|:87415-87876     NC_003997.3   GeneID:1085666   ctsR      BA0077    87415
ref|NC_003997.3|:88050-88598     NC_003997.3   GeneID:1086619   -         BA0078    88050
ref|NC_003997.3|:88603-89667     NC_003997.3   GeneID:1087194   -         BA0079    88603
ref|NC_003997.3|:89690-92125     NC_003997.3   GeneID:1085707   -         BA0080    89690
ref|NC_003997.3|:92222-93598     NC_003997.3   GeneID:1086967   radA      BA0081    92222
ref|NC_003997.3|:93602-94675     NC_003997.3   GeneID:1085924   -         BA0082    93602
ref|NC_003997.3|:94836-95945     NC_003997.3   GeneID:1085716   -         BA0083    94836
ref|NC_003997.3|:95962-96642     NC_003997.3   GeneID:1088223   ispD      BA0084    95962
ref|NC_003997.3|:96757-97233     NC_003997.3   GeneID:1088079   ispF      BA0085    96757
ref|NC_003997.3|:97323-98780     NC_003997.3   GeneID:1085804   gltX      BA0086    97323
ref|NC_003997.3|:99213-99878     NC_003997.3   GeneID:1085922   cysE      BA0088    99213
ref|NC_003997.3|:99859-101256    NC_003997.3   GeneID:1085927   cysS      BA0089    99859
ref|NC_003997.3|:101259-101666   NC_003997.3   GeneID:1088081   -         BA0090   101259
ref|NC_003997.3|:101663-102406   NC_003997.3   GeneID:1088222   -         BA0091   101663
ref|NC_003997.3|:102410-102922   NC_003997.3   GeneID:1086427   -         BA0092   102410
ref|NC_003997.3|:102990-103646   NC_003997.3   GeneID:1086147   sigH      BA0093   102990
ref|NC_003997.3|:103957-104136   NC_003997.3   GeneID:1085982   -         BA0095   103957
ref|NC_003997.3|:104268-104801   NC_003997.3   GeneID:1084095   nusG      BA0096   104268
ref|NC_003997.3|:104969-105394   NC_003997.3   GeneID:1086044   rplK      BA0097   104969
ref|NC_003997.3|:106497-106997   NC_003997.3   GeneID:1086413   rplJ      BA0099   106497
ref|NC_003997.3|:107065-107424   NC_003997.3   GeneID:1085015   rplL      BA0100   107065
ref|NC_003997.3|:107499-108098   NC_003997.3   GeneID:1086058   -         BA0101   107499
ref|NC_003997.3|:108391-111924   NC_003997.3   GeneID:1086075   rpoB      BA0102   108391
ref|NC_003997.3|:111989-115573   NC_003997.3   GeneID:1086436   rpoC      BA0103   111989
ref|NC_003997.3|:116502-116972   NC_003997.3   GeneID:1084609   rpsG      BA0106   116502
ref|NC_003997.3|:117180-119258   NC_003997.3   GeneID:1086334   fusA      BA0107   117180
ref|NC_003997.3|:119376-120563   NC_003997.3   GeneID:1087644   tuf       BA0108   119376
ref|NC_003997.3|:122586-122876   NC_003997.3   GeneID:1086274   rplW      BA0112   122586
ref|NC_003997.3|:122905-123735   NC_003997.3   GeneID:1087436   rplB      BA0113   122905
ref|NC_003997.3|:124092-124433   NC_003997.3   GeneID:1086393   rplV      BA0115   124092
ref|NC_003997.3|:124437-125096   NC_003997.3   GeneID:1086384   rpsC      BA0116   124437
ref|NC_003997.3|:125098-125532 NC_003997.3    GeneID:1086422   rplP    BA0117       125098
ref|NC_003997.3|:126050-126418 NC_003997.3    GeneID:1087270   rplN    BA0120       126050
-                               -             -                -       -        -
ref|NC_003997.3|:126457-126768 NC_003997.3    GeneID:1086419   rplX    BA0121       126457
ref|NC_003997.3|:126795-127334 NC_003997.3    GeneID:1087325   rplE    BA0122       126795
ref|NC_003997.3|:127368-127553 NC_003997.3    GeneID:1087005   rpsN    BA0123       127368
ref|NC_003997.3|:127583-127981 NC_003997.3    GeneID:1087012   rpsH    BA0124       127583
ref|NC_003997.3|:128014-128553 NC_003997.3    GeneID:1087011   rplF    BA0125       128014
ref|NC_003997.3|:128585-128947 NC_003997.3    GeneID:1087013   rplR    BA0126       128585
ref|NC_003997.3|:128969-129469 NC_003997.3    GeneID:1083790   rpsE    BA0127       128969
ref|NC_003997.3|:129483-129665 NC_003997.3    GeneID:1084559   rpmD    BA0128       129483
ref|NC_003997.3|:129699-130139 NC_003997.3    GeneID:1086033   rplO    BA0129       129699
ref|NC_003997.3|:131497-132147 NC_003997.3    GeneID:1087031   adk     BA0131       131497
ref|NC_003997.3|:132147-132893 NC_003997.3    GeneID:1086458   maP-1   BA0132       132147
ref|NC_003997.3|:133741-134130 NC_003997.3    GeneID:1087053   rpsK    BA0136       133741
ref|NC_003997.3|:134311-135255 NC_003997.3    GeneID:1086425   rpoA    BA0137       134311
ref|NC_003997.3|:135757-136599 NC_003997.3    GeneID:1086432   -       BA0139       135757
ref|NC_003997.3|:136575-137456 NC_003997.3    GeneID:1087290   -       BA0140       136575
ref|NC_003997.3|:137444-138238 NC_003997.3    GeneID:1087049   -       BA0141       137444
ref|NC_003997.3|:139149-139586 NC_003997.3    GeneID:1086446   rplM    BA0143       139149
ref|NC_003997.3|:139608-140000 NC_003997.3    GeneID:1086438   rpsI    BA0144       139608
ref|NC_003997.3|:140658-141371 NC_003997.3    GeneID:1086710   cwlD    BA0146       140658
ref|NC_003997.3|:141516-142580 NC_003997.3    GeneID:1086449   -       BA0147       141516
ref|NC_003997.3|:c143254-142637 NC_003997.3   GeneID:1087071   gerD    BA0148       142637
ref|NC_003997.3|:c144874-144110 NC_003997.3   GeneID:1086778   -       BA0150       144110
ref|NC_003997.3|:152603-153496 NC_003997.3    GeneID:1087589   rocF    BA0154       152603
ref|NC_003997.3|:153745-154566 NC_003997.3    GeneID:1087571   -       BA0155       153745
ref|NC_003997.3|:154559-156049 NC_003997.3    GeneID:1087567   -       BA0156       154559
ref|NC_003997.3|:156042-157388 NC_003997.3    GeneID:1084111   glmM    BA0157       156042
ref|NC_003997.3|:157676-157861 NC_003997.3    GeneID:1088245   -       BA0158       157676
ref|NC_003997.3|:157874-159676 NC_003997.3    GeneID:1087656   glmS    BA0159       157874
ref|NC_003997.3|:166998-168962 NC_003997.3    GeneID:1087597   -       BA0165       166998
ref|NC_003997.3|:169081-169647 NC_003997.3    GeneID:1088734   -       BA0166       169081
ref|NC_003997.3|:c170225-169719 NC_003997.3   GeneID:1088432   -       BA0167       169719
ref|NC_003997.3|:c175234-174566 NC_003997.3   GeneID:1087570   -       BA0173       174566
ref|NC_003997.3|:c176249-175209 NC_003997.3   GeneID:1087271   -       BA0174       175209
ref|NC_003997.3|:c177074-176262 NC_003997.3   GeneID:1087471   -       BA0175       176262
ref|NC_003997.3|:c178262-177354 NC_003997.3   GeneID:1087438   -       BA0176       177354
ref|NC_003997.3|:179305-180720 NC_003997.3    GeneID:1085133   -       BA0178       179305
ref|NC_003997.3|:181329-183050 NC_003997.3    GeneID:1087199   -       BA0180       181329
ref|NC_003997.3|:183178-184428 NC_003997.3    GeneID:1087485   -       BA0181       183178
ref|NC_003997.3|:184679-185179 NC_003997.3    GeneID:1087259   -       BA0183       184679
ref|NC_003997.3|:185820-186743 NC_003997.3    GeneID:1087454   -       BA0185       185820
ref|NC_003997.3|:186760-187764 NC_003997.3    GeneID:1086235   -       BA0186       186760
ref|NC_003997.3|:187721-188731 NC_003997.3    GeneID:1087161   -       BA0187       187721
ref|NC_003997.3|:188728-189501 NC_003997.3    GeneID:1087211   -       BA0188       188728
ref|NC_003997.3|:189515-191125 NC_003997.3    GeneID:1087493   -       BA0189       189515
ref|NC_003997.3|:c191609-191142 NC_003997.3   GeneID:1087455   -       BA0190       191142
ref|NC_003997.3|:191781-192680 NC_003997.3    GeneID:1086755   -       BA0191       191781
ref|NC_003997.3|:192939-193235 NC_003997.3    GeneID:1086417   -       BA0193       192939
ref|NC_003997.3|:c194920-193280 NC_003997.3   GeneID:1087151   -       BA0194       193280
ref|NC_003997.3|:c196948-195308 NC_003997.3   GeneID:1087159   -       BA0195       195308
ref|NC_003997.3|:c198173-197340 NC_003997.3   GeneID:1086448   -       BA0196       197340
ref|NC_003997.3|:c198978-198241 NC_003997.3   GeneID:1084028   -       BA0197       198241
ref|NC_003997.3|:c200735-199884 NC_003997.3   GeneID:1086378   -       BA0200       199884
ref|NC_003997.3|:c201552-201022 NC_003997.3   GeneID:1087189   modB    BA0202       201022
ref|NC_003997.3|:202684-203604 NC_003997.3    GeneID:1085078   -       BA0205       202684
ref|NC_003997.3|:c205043-204177 NC_003997.3   GeneID:1086828   -       BA0208       204177
ref|NC_003997.3|:205171-206139 NC_003997.3    GeneID:1087074   -       BA0210       205171
ref|NC_003997.3|:206669-207274 NC_003997.3    GeneID:1087080   -       BA0213       206669
ref|NC_003997.3|:207749-208726 NC_003997.3    GeneID:1086921   -       BA0216       207749
ref|NC_003997.3|:208875-209204 NC_003997.3    GeneID:1086730   -       BA0217       208875
ref|NC_003997.3|:209323-210159 NC_003997.3    GeneID:1087082   -       BA0218       209323
ref|NC_003997.3|:210297-210653 NC_003997.3    GeneID:1087073   -       BA0219       210297
ref|NC_003997.3|:211397-212161 NC_003997.3    GeneID:1086800   -       BA0222       211397
ref|NC_003997.3|:c213913-212264 NC_003997.3   GeneID:1086820   -       BA0223       212264
ref|NC_003997.3|:214164-214697 NC_003997.3    GeneID:1086994   -       BA0224       214164
ref|NC_003997.3|:c215495-214713 NC_003997.3   GeneID:1086443   -       BA0225       214713
ref|NC_003997.3|:216438-218318 NC_003997.3    GeneID:1086696   -       BA0228       216438
ref|NC_003997.3|:c218805-218560 NC_003997.3   GeneID:1086431   -       BA0229       218560
ref|NC_003997.3|:222954-223934 NC_003997.3    GeneID:1087075   -       BA0234       222954
ref|NC_003997.3|:223931-224941 NC_003997.3    GeneID:1086302   -       BA0235       223931
ref|NC_003997.3|:226826-227944 NC_003997.3    GeneID:1086140   hppD    BA0240       226826
ref|NC_003997.3|:228011-228967 NC_003997.3    GeneID:1085981   -       BA0241       228011
ref|NC_003997.3|:228933-230105 NC_003997.3    GeneID:1085179   -       BA0242       228933
ref|NC_003997.3|:230339-231610 NC_003997.3    GeneID:1083980   -       BA0244       230339
ref|NC_003997.3|:233140-234516 NC_003997.3    GeneID:1086792   murF    BA0246       233140
ref|NC_003997.3|:234821-236407 NC_003997.3    GeneID:1087008   -       BA0247       234821
ref|NC_003997.3|:236504-237466 NC_003997.3    GeneID:1084346   uvsE    BA0248       236504
ref|NC_003997.3|:238124-238483 NC_003997.3    GeneID:1087043   acpS    BA0250       238124
ref|NC_003997.3|:238577-239590 NC_003997.3    GeneID:1087024   -       BA0251       238577
ref|NC_003997.3|:239709-240878 NC_003997.3    GeneID:1087014   dal-1   BA0252       239709
ref|NC_003997.3|:241188-241475 NC_003997.3    GeneID:1084215   -       BA0253       241188
ref|NC_003997.3|:241480-241830 NC_003997.3    GeneID:1086042   -       BA0254       241480
ref|NC_003997.3|:241898-244066 NC_003997.3    GeneID:1087362   -       BA0255       241898
ref|NC_003997.3|:251335-251808 NC_003997.3    GeneID:1086138   -       BA0258       251335
ref|NC_003997.3|:251789-252481 NC_003997.3    GeneID:1086253   -       BA0259       251789
ref|NC_003997.3|:252501-252938 NC_003997.3    GeneID:1086247   rimI    BA0260       252501
ref|NC_003997.3|:252938-253954 NC_003997.3    GeneID:1084587   gcP     BA0261       252938
ref|NC_003997.3|:c256358-254436 NC_003997.3   GeneID:1086840   -       BA0262       254436
ref|NC_003997.3|:256546-257175 NC_003997.3    GeneID:1086169   -       BA0263       256546
ref|NC_003997.3|:c258100-257393 NC_003997.3   GeneID:1088082   -       BA0265       257393
ref|NC_003997.3|:258543-258827 NC_003997.3    GeneID:1084579   groES   BA0266       258543
ref|NC_003997.3|:258866-260500 NC_003997.3    GeneID:1086282   groEL   BA0267       258866
ref|NC_003997.3|:260908-262446 NC_003997.3    GeneID:1084286   guaA    BA0268       260908
ref|NC_003997.3|:262831-264156 NC_003997.3    GeneID:1086064   -       BA0270       262831
ref|NC_003997.3|:264301-265002 NC_003997.3    GeneID:1085970   -       BA0271       264301
ref|NC_003997.3|:264986-266491 NC_003997.3    GeneID:1086032   -       BA0272       264986
-                               -             -                -       -        -
ref|NC_003997.3|:c274516-273794 NC_003997.3   GeneID:1086897   -       BA0275       273794
ref|NC_003997.3|:295542-296027 NC_003997.3    GeneID:1085644   purE    BA0288       295542
ref|NC_003997.3|:296024-297175 NC_003997.3    GeneID:1085688   purK    BA0289       296024
ref|NC_003997.3|:297172-298479 NC_003997.3    GeneID:1085703   purB    BA0290       297172
ref|NC_003997.3|:298568-299287 NC_003997.3    GeneID:1088229   purC    BA0291       298568
ref|NC_003997.3|:299531-300214 NC_003997.3    GeneID:1085624   purQ     BA0293   299531
ref|NC_003997.3|:300198-302417 NC_003997.3    GeneID:1085313   purL     BA0294   300198
ref|NC_003997.3|:302402-303817 NC_003997.3    GeneID:1085685   purF     BA0295   302402
ref|NC_003997.3|:303924-304964 NC_003997.3    GeneID:1085673   purM     BA0296   303924
ref|NC_003997.3|:304961-305548 NC_003997.3    GeneID:1086381   purN     BA0297   304961
ref|NC_003997.3|:305573-307108 NC_003997.3    GeneID:1085697   purH     BA0298   305573
ref|NC_003997.3|:307230-308501 NC_003997.3    GeneID:1086452   purD     BA0299   307230
ref|NC_003997.3|:c309563-308718 NC_003997.3   GeneID:1085410   -        BA0301   308718
ref|NC_003997.3|:c310150-309773 NC_003997.3   GeneID:1087484   -        BA0302   309773
ref|NC_003997.3|:310422-311174 NC_003997.3    GeneID:1086581   -        BA0304   310422
ref|NC_003997.3|:311187-313430 NC_003997.3    GeneID:1086929   pcrA     BA0305   311187
ref|NC_003997.3|:313446-315455 NC_003997.3    GeneID:1084819   ligA     BA0306   313446
ref|NC_003997.3|:315472-316665 NC_003997.3    GeneID:1087456   -        BA0307   315472
ref|NC_003997.3|:316761-317531 NC_003997.3    GeneID:1084750   -        BA0308   316761
ref|NC_003997.3|:317685-319232 NC_003997.3    GeneID:1087266   -        BA0309   317685
ref|NC_003997.3|:c320362-319799 NC_003997.3   GeneID:1084334   -        BA0311   319799
ref|NC_003997.3|:320835-321854 NC_003997.3    GeneID:1084795   -        BA0312   320835
ref|NC_003997.3|:321844-322509 NC_003997.3    GeneID:1084732   -        BA0313   321844
ref|NC_003997.3|:322531-323385 NC_003997.3    GeneID:1084064   -        BA0314   322531
ref|NC_003997.3|:326615-326905 NC_003997.3    GeneID:1083989   gatC     BA0320   326615
ref|NC_003997.3|:326921-328378 NC_003997.3    GeneID:1088221   gatA     BA0321   326921
ref|NC_003997.3|:328393-329820 NC_003997.3    GeneID:1087223   gatB     BA0322   328393
ref|NC_003997.3|:330291-331196 NC_003997.3    GeneID:1085979   -        BA0323   330291
ref|NC_003997.3|:331336-332079 NC_003997.3    GeneID:1086928   -        BA0324   331336
ref|NC_003997.3|:332234-333598 NC_003997.3    GeneID:1086502   gabT     BA0325   332234
ref|NC_003997.3|:333711-335078 NC_003997.3    GeneID:1083782   -        BA0326   333711
ref|NC_003997.3|:335071-336522 NC_003997.3    GeneID:1085923   gabD     BA0327   335071
ref|NC_003997.3|:336570-336893 NC_003997.3    GeneID:1085945   -        BA0328   336570
ref|NC_003997.3|:c338162-336933 NC_003997.3   GeneID:1087171   ampS     BA0329   336933
ref|NC_003997.3|:c339361-338279 NC_003997.3   GeneID:1085388   -        BA0330   338279
ref|NC_003997.3|:c342052-340856 NC_003997.3   GeneID:1086842   -        BA0332   340856
ref|NC_003997.3|:342478-343854 NC_003997.3    GeneID:1086870   -        BA0333   342478
ref|NC_003997.3|:343951-344940 NC_003997.3    GeneID:1086580   -        BA0334   343951
ref|NC_003997.3|:346049-346561 NC_003997.3    GeneID:1087057   -        BA0336   346049
ref|NC_003997.3|:346656-347363 NC_003997.3    GeneID:1086241   -        BA0337   346656
ref|NC_003997.3|:c348258-347563 NC_003997.3   GeneID:1085602   -        BA0338   347563
ref|NC_003997.3|:c349382-348273 NC_003997.3   GeneID:1083897   -        BA0339   348273
ref|NC_003997.3|:349475-350746 NC_003997.3    GeneID:1085480   -        BA0340   349475
ref|NC_003997.3|:c352156-350735 NC_003997.3   GeneID:1088030   nhaC-1   BA0341   350735
ref|NC_003997.3|:352436-353551 NC_003997.3    GeneID:1085074   amhX     BA0342   352436
ref|NC_003997.3|:353703-354311 NC_003997.3    GeneID:1087240   -        BA0343   353703
ref|NC_003997.3|:c355882-354356 NC_003997.3   GeneID:1084774   ahpF     BA0344   354356
ref|NC_003997.3|:c356460-355897 NC_003997.3   GeneID:1085137   ahpC     BA0345   355897
ref|NC_003997.3|:357051-358280 NC_003997.3    GeneID:1083930   -        BA0346   357051
ref|NC_003997.3|:358293-359336 NC_003997.3    GeneID:1087308   -        BA0347   358293
ref|NC_003997.3|:359391-360032 NC_003997.3    GeneID:1087393   fucA     BA0348   359391
ref|NC_003997.3|:c361080-360073 NC_003997.3   GeneID:1086501   -        BA0349   360073
ref|NC_003997.3|:c362093-361077 NC_003997.3   GeneID:1085592   -        BA0350   361077
ref|NC_003997.3|:c363083-362166 NC_003997.3   GeneID:1084630   -        BA0351   362166
ref|NC_003997.3|:363416-364465 NC_003997.3    GeneID:1084697   -        BA0352   363416
ref|NC_003997.3|:c365030-364662 NC_003997.3   GeneID:1085650   -        BA0353   364662
ref|NC_003997.3|:366841-367509 NC_003997.3    GeneID:1086382   -        BA0357   366841
ref|NC_003997.3|:367746-369011 NC_003997.3    GeneID:1087379   -        BA0358       367746
ref|NC_003997.3|:369889-370269 NC_003997.3    GeneID:1087284   -        BA0360       369889
ref|NC_003997.3|:371279-372388 NC_003997.3    GeneID:1085652   -        BA0362       371279
ref|NC_003997.3|:372511-373293 NC_003997.3    GeneID:1084548   -        BA0363       372511
ref|NC_003997.3|:c374609-373308 NC_003997.3   GeneID:1084295   -        BA0364       373308
ref|NC_003997.3|:c376279-374753 NC_003997.3   GeneID:1087233   -        BA0365       374753
ref|NC_003997.3|:376862-377947 NC_003997.3    GeneID:1087346   -        BA0366       376862
ref|NC_003997.3|:c380425-379703 NC_003997.3   GeneID:1084509   -        BA0368       379703
ref|NC_003997.3|:382527-383819 NC_003997.3    GeneID:1084716   -        BA0370       382527
ref|NC_003997.3|:384056-385720 NC_003997.3    GeneID:1087007   -        BA0371       384056
ref|NC_003997.3|:385893-387530 NC_003997.3    GeneID:1085587   -        BA0372       385893
ref|NC_003997.3|:387535-388326 NC_003997.3    GeneID:1087341   -        BA0373       387535
ref|NC_003997.3|:388632-391457 NC_003997.3    GeneID:1083906   -        BA0374       388632
ref|NC_003997.3|:c393687-391498 NC_003997.3   GeneID:1084121   topB-1   BA0375       391498
ref|NC_003997.3|:394096-394902 NC_003997.3    GeneID:1087357   thiM     BA0376       394096
ref|NC_003997.3|:c397007-395694 NC_003997.3   GeneID:1087358   -        BA0378       395694
ref|NC_003997.3|:399521-399841 NC_003997.3    GeneID:1084935   -        BA0380       399521
ref|NC_003997.3|:399813-400586 NC_003997.3    GeneID:1085021   -        BA0381       399813
ref|NC_003997.3|:400583-401581 NC_003997.3    GeneID:1088331   -        BA0382       400583
ref|NC_003997.3|:401578-402327 NC_003997.3    GeneID:1084366   -        BA0383       401578
ref|NC_003997.3|:c406648-404624 NC_003997.3   GeneID:1084251   -        BA0385       404624
ref|NC_003997.3|:407020-407391 NC_003997.3    GeneID:1086639   -        BA0386       407020
ref|NC_003997.3|:408264-408845 NC_003997.3    GeneID:1086118   -        BA0389       408264
ref|NC_003997.3|:408912-410144 NC_003997.3    GeneID:1085085   -        BA0390       408912
ref|NC_003997.3|:410258-410452 NC_003997.3    GeneID:1087295   -        BA0391       410258
ref|NC_003997.3|:c412167-410884 NC_003997.3   GeneID:1085960   -        BA0393       410884
ref|NC_003997.3|:c413589-412276 NC_003997.3   GeneID:1086126   -        BA0394       412276
ref|NC_003997.3|:414384-415910 NC_003997.3    GeneID:1086703   proS-1   BA0396       414384
ref|NC_003997.3|:417898-418494 NC_003997.3    GeneID:1086690   -        BA0399       417898
ref|NC_003997.3|:418518-419102 NC_003997.3    GeneID:1088307   -        BA0400       418518
ref|NC_003997.3|:419183-419767 NC_003997.3    GeneID:1084375   -        BA0401       419183
ref|NC_003997.3|:419841-420632 NC_003997.3    GeneID:1086290   -        BA0402       419841
ref|NC_003997.3|:420742-422373 NC_003997.3    GeneID:1086441   -        BA0403       420742
ref|NC_003997.3|:422392-423474 NC_003997.3    GeneID:1086261   -        BA0404       422392
ref|NC_003997.3|:c426176-423510 NC_003997.3   GeneID:1086599   -        BA0405       423510
ref|NC_003997.3|:c426592-426368 NC_003997.3   GeneID:1086645   -        BA0406       426368
ref|NC_003997.3|:426767-427231 NC_003997.3    GeneID:1086743   -        BA0407       426767
ref|NC_003997.3|:427285-427767 NC_003997.3    GeneID:1083708   -        BA0408       427285
-                               -             -                -        -        -
ref|NC_003997.3|:427806-428675 NC_003997.3    GeneID:1085965   -        BA0409       427806
ref|NC_003997.3|:c430785-428860 NC_003997.3   GeneID:1088738   -        BA0410       428860
ref|NC_003997.3|:431056-432006 NC_003997.3    GeneID:1086104   -        BA0411       431056
ref|NC_003997.3|:432129-432809 NC_003997.3    GeneID:1086222   -        BA0412       432129
ref|NC_003997.3|:c436380-433618 NC_003997.3   GeneID:1088613   -        BA0414       433618
ref|NC_003997.3|:436855-437445 NC_003997.3    GeneID:1087559   -        BA0415       436855
ref|NC_003997.3|:c437882-437454 NC_003997.3   GeneID:1084939   -        BA0416       437454
ref|NC_003997.3|:c438705-438289 NC_003997.3   GeneID:1083773   -        BA0418       438289
ref|NC_003997.3|:438876-439940 NC_003997.3    GeneID:1088856   cax      BA0419       438876
ref|NC_003997.3|:440022-440819 NC_003997.3    GeneID:1087489   -        BA0420       440022
ref|NC_003997.3|:c441981-440854 NC_003997.3   GeneID:1088874   -        BA0421       440854
ref|NC_003997.3|:442584-444104 NC_003997.3    GeneID:1087739   fumA     BA0423       442584
ref|NC_003997.3|:444231-445013 NC_003997.3    GeneID:1087807   -        BA0424       444231
ref|NC_003997.3|:461821-462303 NC_003997.3    GeneID:1089131   -        BA0457   461821
ref|NC_003997.3|:c487230-485827 NC_003997.3   GeneID:1088718   rocR-1   BA0489   485827
ref|NC_003997.3|:487504-487758 NC_003997.3    GeneID:1088882   -        BA0490   487504
ref|NC_003997.3|:489380-490660 NC_003997.3    GeneID:1087713   -        BA0493   489380
ref|NC_003997.3|:c491408-490755 NC_003997.3   GeneID:1087716   -        BA0494   490755
ref|NC_003997.3|:c492786-492445 NC_003997.3   GeneID:1088468   -        BA0497   492445
ref|NC_003997.3|:c493891-492962 NC_003997.3   GeneID:1086143   glsA-1   BA0499   492962
ref|NC_003997.3|:494216-495709 NC_003997.3    GeneID:1088197   -        BA0501   494216
ref|NC_003997.3|:495964-497202 NC_003997.3    GeneID:1088880   -        BA0502   495964
ref|NC_003997.3|:497356-497757 NC_003997.3    GeneID:1087722   -        BA0503   497356
ref|NC_003997.3|:497943-499529 NC_003997.3    GeneID:1087744   -        BA0505   497943
ref|NC_003997.3|:500759-501724 NC_003997.3    GeneID:1087740   -        BA0507   500759
ref|NC_003997.3|:501717-503261 NC_003997.3    GeneID:1087762   -        BA0508   501717
ref|NC_003997.3|:503601-505850 NC_003997.3    GeneID:1088702   pfl      BA0509   503601
ref|NC_003997.3|:505920-506651 NC_003997.3    GeneID:1087733   pflA     BA0510   505920
ref|NC_003997.3|:507064-508230 NC_003997.3    GeneID:1087727   -        BA0511   507064
ref|NC_003997.3|:c509382-508825 NC_003997.3   GeneID:1087767   -        BA0513   508825
ref|NC_003997.3|:c510754-509624 NC_003997.3   GeneID:1087764   -        BA0514   509624
ref|NC_003997.3|:c511800-510895 NC_003997.3   GeneID:1087760   -        BA0515   510895
ref|NC_003997.3|:511882-512694 NC_003997.3    GeneID:1087763   recX     BA0516   511882
ref|NC_003997.3|:512710-513021 NC_003997.3    GeneID:1087771   -        BA0517   512710
ref|NC_003997.3|:513562-513828 NC_003997.3    GeneID:1087750   -        BA0520   513562
ref|NC_003997.3|:c514833-513853 NC_003997.3   GeneID:1087772   -        BA0521   513853
ref|NC_003997.3|:514983-516080 NC_003997.3    GeneID:1087779   mutY     BA0522   514983
ref|NC_003997.3|:c516402-516115 NC_003997.3   GeneID:1087780   -        BA0523   516115
ref|NC_003997.3|:516465-516752 NC_003997.3    GeneID:1087778   -        BA0524   516465
ref|NC_003997.3|:517434-517964 NC_003997.3    GeneID:1087786   -        BA0527   517434
ref|NC_003997.3|:518019-519779 NC_003997.3    GeneID:1087774   -        BA0528   518019
ref|NC_003997.3|:c520881-519793 NC_003997.3   GeneID:1087773   -        BA0529   519793
ref|NC_003997.3|:c525578-521142 NC_003997.3   GeneID:1087770   -        BA0530   521142
ref|NC_003997.3|:c527082-525778 NC_003997.3   GeneID:1087796   hemL-1   BA0531   525778
ref|NC_003997.3|:527204-528217 NC_003997.3    GeneID:1087792   -        BA0532   527204
ref|NC_003997.3|:528210-529001 NC_003997.3    GeneID:1087787   -        BA0533   528210
ref|NC_003997.3|:529006-529791 NC_003997.3    GeneID:1087790   -        BA0534   529006
ref|NC_003997.3|:529864-530268 NC_003997.3    GeneID:1087791   -        BA0535   529864
ref|NC_003997.3|:531060-531494 NC_003997.3    GeneID:1087782   -        BA0537   531060
ref|NC_003997.3|:c532049-531693 NC_003997.3   GeneID:1087802   -        BA0538   531693
ref|NC_003997.3|:c539168-538848 NC_003997.3   GeneID:1087844   -        BA0540   538848
ref|NC_003997.3|:539521-540240 NC_003997.3    GeneID:1087851   -        BA0541   539521
ref|NC_003997.3|:540358-540852 NC_003997.3    GeneID:1087839   -        BA0542   540358
ref|NC_003997.3|:541339-542115 NC_003997.3    GeneID:1087838   -        BA0543   541339
ref|NC_003997.3|:542303-542956 NC_003997.3    GeneID:1087837   -        BA0544   542303
ref|NC_003997.3|:543343-544485 NC_003997.3    GeneID:1087855   -        BA0545   543343
ref|NC_003997.3|:544530-545417 NC_003997.3    GeneID:1084979   -        BA0546   544530
ref|NC_003997.3|:545476-545964 NC_003997.3    GeneID:1087852   -        BA0547   545476
ref|NC_003997.3|:546092-548161 NC_003997.3    GeneID:1087859   -        BA0548   546092
ref|NC_003997.3|:548553-550448 NC_003997.3    GeneID:1087848   -        BA0550   548553
ref|NC_003997.3|:550894-552069 NC_003997.3    GeneID:1087847   -        BA0551   550894
ref|NC_003997.3|:552231-555443 NC_003997.3    GeneID:1087882   -        BA0552   552231
ref|NC_003997.3|:c558118-556568 NC_003997.3   GeneID:1087869   opuD-1   BA0554   556568
ref|NC_003997.3|:558387-561284 NC_003997.3    GeneID:1087871   -        BA0555   558387
ref|NC_003997.3|:561531-562079 NC_003997.3    GeneID:1087874   -        BA0556   561531
ref|NC_003997.3|:562092-563672 NC_003997.3         GeneID:1087885   -        BA0557       562092
ref|NC_003997.3|:563909-565885 NC_003997.3         GeneID:1087867   -        BA0558       563909
ref|NC_003997.3|:566037-567647 NC_003997.3         GeneID:1087860   -        BA0559       566037
ref|NC_003997.3|:c569686-568382 NC_003997.3        GeneID:1087891   -        BA0561       568382
ref|NC_003997.3|:570327-570830 NC_003997.3         GeneID:1087896   -        BA0563       570327
ref|NC_003997.3|:571366-571989 NC_003997.3         GeneID:1087887   -        BA0564       571366
ref|NC_003997.3|:572548-573114 NC_003997.3         GeneID:1087888   -        BA0565       572548
ref|NC_003997.3|:573078-574208 NC_003997.3         GeneID:1087900   -        BA0566       573078
ref|NC_003997.3|:574208-575140 NC_003997.3         GeneID:1087200   -        BA0567       574208
ref|NC_003997.3|:575137-575958 NC_003997.3         GeneID:1087884   -        BA0568       575137
ref|NC_003997.3|:575980-577356 NC_003997.3         GeneID:1087883   -        BA0569       575980
ref|NC_003997.3|:577772-578476 NC_003997.3         GeneID:1087911   -        BA0570       577772
ref|NC_003997.3|:578626-579297 NC_003997.3         GeneID:1087909   -        BA0571       578626
ref|NC_003997.3|:582586-584568 NC_003997.3         GeneID:1087917   -        BA0575       582586
ref|NC_003997.3|:584647-586251 NC_003997.3         GeneID:1087898   -        BA0576       584647
ref|NC_003997.3|:586281-586955 NC_003997.3         GeneID:1087932   -        BA0577       586281
ref|NC_003997.3|:587078-588424 NC_003997.3         GeneID:1087930   -        BA0578       587078
ref|NC_003997.3|:588484-589683 NC_003997.3         GeneID:1087926   -        BA0579       588484
ref|NC_003997.3|:c590503-589979 NC_003997.3        GeneID:1087928   -        BA0580       589979
ref|NC_003997.3|:c591545-590619 NC_003997.3        GeneID:1087943   -        BA0581       590619
ref|NC_003997.3|:591666-593066 NC_003997.3         GeneID:1087924   -        BA0582       591666
ref|NC_003997.3|:c593612-593100 NC_003997.3        GeneID:1087920   -        BA0583       593100
ref|NC_003997.3|:c595222-593759 NC_003997.3        GeneID:1087919   -        BA0584       593759
ref|NC_003997.3|:c595959-595288 NC_003997.3        GeneID:1087912   -        BA0585       595288
ref|NC_003997.3|:c597299-596793 NC_003997.3        GeneID:1087951   -        BA0587       596793
ref|NC_003997.3|:c598334-597528 NC_003997.3        GeneID:1087949   fdhD-1   BA0588       597528
ref|NC_003997.3|:598638-601574 NC_003997.3         GeneID:1087950   -        BA0589       598638
ref|NC_003997.3|:602262-604097 NC_003997.3         GeneID:1087942   -        BA0591       602262
                                NC_003997.3        GeneID:1087940
ref|NC_003997.3|:604465-605598, ref|NC_003997.3|:c4430350-4429217   ald-1    BA0592       604465
ref|NC_003997.3|:605702-607117 NC_003997.3         GeneID:1087937   -        BA0593       605702
-                               -                  -                -        -        -
ref|NC_003997.3|:607384-607761 NC_003997.3         GeneID:1087971   -        BA0594       607384
ref|NC_003997.3|:607786-610152 NC_003997.3         GeneID:1087968   -        BA0595       607786
ref|NC_003997.3|:c611819-610356 NC_003997.3        GeneID:1087966   -        BA0596       610356
ref|NC_003997.3|:612020-613288 NC_003997.3         GeneID:1087967   -        BA0597       612020
ref|NC_003997.3|:613589-615289 NC_003997.3         GeneID:1087962   -        BA0599       613589
ref|NC_003997.3|:616279-616797 NC_003997.3         GeneID:1087958   -        BA0602       616279
ref|NC_003997.3|:c618396-617134 NC_003997.3        GeneID:1087993   -        BA0604       617134
ref|NC_003997.3|:c619632-618631 NC_003997.3        GeneID:1087992   -        BA0605       618631
ref|NC_003997.3|:c621086-619908 NC_003997.3        GeneID:1087996   -        BA0606       619908
ref|NC_003997.3|:621672-622757 NC_003997.3         GeneID:1087990   -        BA0608       621672
ref|NC_003997.3|:622841-624274 NC_003997.3         GeneID:1087999   aspA-1   BA0609       622841
ref|NC_003997.3|:c625933-624314 NC_003997.3        GeneID:1087984   lldP-1   BA0610       624314
ref|NC_003997.3|:c630097-629132 NC_003997.3        GeneID:1088008   -        BA0615       629132
ref|NC_003997.3|:631271-632329 NC_003997.3         GeneID:1088005   -        BA0617       631271
ref|NC_003997.3|:632342-633163 NC_003997.3         GeneID:1088006   -        BA0618       632342
ref|NC_003997.3|:634139-635329 NC_003997.3         GeneID:1087998   -        BA0620       634139
ref|NC_003997.3|:635374-636327 NC_003997.3         GeneID:1087994   -        BA0621       635374
ref|NC_003997.3|:636393-636815 NC_003997.3         GeneID:1088029   -        BA0622       636393
ref|NC_003997.3|:c638735-636855 NC_003997.3        GeneID:1088027   -        BA0623       636855
ref|NC_003997.3|:c639632-638739 NC_003997.3        GeneID:1088021   -        BA0624       638739
ref|NC_003997.3|:c641289-639760 NC_003997.3        GeneID:1088023   cls      BA0625       639760
ref|NC_003997.3|:642437-644140 NC_003997.3    GeneID:1088020   -       BA0628   642437
ref|NC_003997.3|:c645568-644171 NC_003997.3   GeneID:1088019   -       BA0629   644171
ref|NC_003997.3|:646020-646730 NC_003997.3    GeneID:1088039   treR    BA0630   646020
ref|NC_003997.3|:646868-648295 NC_003997.3    GeneID:1088038   treB    BA0631   646868
ref|NC_003997.3|:648309-649970 NC_003997.3    GeneID:1088035   treC    BA0632   648309
ref|NC_003997.3|:c651126-650002 NC_003997.3   GeneID:1088036   gerKC   BA0633   650002
ref|NC_003997.3|:c652213-651107 NC_003997.3   GeneID:1088045   gerKB   BA0634   651107
ref|NC_003997.3|:c653696-652194 NC_003997.3   GeneID:1088033   gerKA   BA0635   652194
ref|NC_003997.3|:653846-654532 NC_003997.3    GeneID:1088032   -       BA0636   653846
ref|NC_003997.3|:654556-655527 NC_003997.3    GeneID:1088031   -       BA0637   654556
ref|NC_003997.3|:655655-657115 NC_003997.3    GeneID:1088677   -       BA0638   655655
ref|NC_003997.3|:657249-657980 NC_003997.3    GeneID:1088047   -       BA0639   657249
ref|NC_003997.3|:657993-658823 NC_003997.3    GeneID:1086045   -       BA0640   657993
ref|NC_003997.3|:658886-659542 NC_003997.3    GeneID:1088668   -       BA0641   658886
ref|NC_003997.3|:659543-660187 NC_003997.3    GeneID:1088046   -       BA0642   659543
ref|NC_003997.3|:660392-661819 NC_003997.3    GeneID:1088666   -       BA0643   660392
ref|NC_003997.3|:661794-662171 NC_003997.3    GeneID:1085988   -       BA0644   661794
ref|NC_003997.3|:662844-663401 NC_003997.3    GeneID:1088042   -       BA0646   662844
ref|NC_003997.3|:c665787-664834 NC_003997.3   GeneID:1086099   -       BA0648   664834
ref|NC_003997.3|:665894-666415 NC_003997.3    GeneID:1088054   -       BA0649   665894
ref|NC_003997.3|:c667820-666429 NC_003997.3   GeneID:1088051   -       BA0650   666429
ref|NC_003997.3|:c668509-667832 NC_003997.3   GeneID:1088070   -       BA0651   667832
ref|NC_003997.3|:670092-671543 NC_003997.3    GeneID:1088058   -       BA0653   670092
ref|NC_003997.3|:671609-672031 NC_003997.3    GeneID:1088050   -       BA0654   671609
ref|NC_003997.3|:c679737-678388 NC_003997.3   GeneID:1088056   glpT    BA0661   678388
ref|NC_003997.3|:680010-680468 NC_003997.3    GeneID:1086111   -       BA0662   680010
ref|NC_003997.3|:682226-683197 NC_003997.3    GeneID:1088068   rbsR    BA0664   682226
ref|NC_003997.3|:683211-684107 NC_003997.3    GeneID:1088980   rbsK    BA0665   683211
ref|NC_003997.3|:684617-686002 NC_003997.3    GeneID:1088171   rbsA    BA0667   684617
ref|NC_003997.3|:686005-686940 NC_003997.3    GeneID:1088067   rbsC    BA0668   686005
ref|NC_003997.3|:687916-688563 NC_003997.3    GeneID:1083931   -       BA0670   687916
ref|NC_003997.3|:688880-691279 NC_003997.3    GeneID:1088063   -       BA0672   688880
ref|NC_003997.3|:c693149-691977 NC_003997.3   GeneID:1088092   -       BA0674   691977
ref|NC_003997.3|:693375-694427 NC_003997.3    GeneID:1088128   -       BA0675   693375
ref|NC_003997.3|:694546-694890 NC_003997.3    GeneID:1088094   -       BA0676   694546
ref|NC_003997.3|:695144-695995 NC_003997.3    GeneID:1088080   plC     BA0677   695144
ref|NC_003997.3|:696054-697070 NC_003997.3    GeneID:1085901   spH     BA0678   696054
ref|NC_003997.3|:697178-698350 NC_003997.3    GeneID:1088087   -       BA0679   697178
ref|NC_003997.3|:698338-699651 NC_003997.3    GeneID:1087472   -       BA0680   698338
ref|NC_003997.3|:c700810-699659 NC_003997.3   GeneID:1086977   -       BA0681   699659
ref|NC_003997.3|:c702056-701244 NC_003997.3   GeneID:1088072   uppP    BA0683   701244
ref|NC_003997.3|:c703133-702189 NC_003997.3   GeneID:1088120   -       BA0684   702189
ref|NC_003997.3|:703354-704616 NC_003997.3    GeneID:1088109   -       BA0685   703354
ref|NC_003997.3|:705461-706162 NC_003997.3    GeneID:1088124   -       BA0688   705461
ref|NC_003997.3|:c707576-706191 NC_003997.3   GeneID:1088095   -       BA0689   706191
ref|NC_003997.3|:709266-710987 NC_003997.3    GeneID:1088135   -       BA0691   709266
ref|NC_003997.3|:c712570-711023 NC_003997.3   GeneID:1088125   -       BA0692   711023
ref|NC_003997.3|:c714143-712752 NC_003997.3   GeneID:1089224   -       BA0693   712752
ref|NC_003997.3|:714424-715716 NC_003997.3    GeneID:1089118   -       BA0694   714424
ref|NC_003997.3|:716053-716481 NC_003997.3    GeneID:1086001   -       BA0696   716053
ref|NC_003997.3|:c716956-716519 NC_003997.3   GeneID:1084560   -       BA0697   716519
ref|NC_003997.3|:c719111-717282 NC_003997.3   GeneID:1088888   -       BA0699   717282
ref|NC_003997.3|:c719644-719333 NC_003997.3   GeneID:1088155   qoxD     BA0700       719333
ref|NC_003997.3|:c720247-719645 NC_003997.3   GeneID:1088156   qoxC     BA0701       719645
ref|NC_003997.3|:c722195-720261 NC_003997.3   GeneID:1088153   qoxB     BA0702       720261
ref|NC_003997.3|:c723104-722229 NC_003997.3   GeneID:1088154   qoxA     BA0703       722229
ref|NC_003997.3|:723640-724350 NC_003997.3    GeneID:1088145   -        BA0705       723640
ref|NC_003997.3|:725854-727326 NC_003997.3    GeneID:1088955   -        BA0708       725854
ref|NC_003997.3|:729001-730032 NC_003997.3    GeneID:1088157   gerLB    BA0710       729001
ref|NC_003997.3|:734260-735159 NC_003997.3    GeneID:1088208   -        BA0715       734260
ref|NC_003997.3|:735230-736120 NC_003997.3    GeneID:1088172   -        BA0716       735230
ref|NC_003997.3|:736123-737043 NC_003997.3    GeneID:1087004   -        BA0717       736123
ref|NC_003997.3|:737244-737753 NC_003997.3    GeneID:1088185   -        BA0718       737244
ref|NC_003997.3|:c740841-737797 NC_003997.3   GeneID:1088184   -        BA0719       737797
ref|NC_003997.3|:748950-750101 NC_003997.3    GeneID:1088322   -        BA0721       748950
ref|NC_003997.3|:c751828-750668 NC_003997.3   GeneID:1088292   -        BA0724       750668
ref|NC_003997.3|:752459-753154 NC_003997.3    GeneID:1088693   -        BA0725       752459
ref|NC_003997.3|:753123-753872 NC_003997.3    GeneID:1088328   -        BA0726       753123
ref|NC_003997.3|:753872-754624 NC_003997.3    GeneID:1088326   -        BA0727       753872
ref|NC_003997.3|:754621-755622 NC_003997.3    GeneID:1088943   -        BA0728       754621
ref|NC_003997.3|:755633-756253 NC_003997.3    GeneID:1088663   tenI     BA0729       755633
ref|NC_003997.3|:756246-757355 NC_003997.3    GeneID:1088163   goxB     BA0730       756246
ref|NC_003997.3|:757371-757574 NC_003997.3    GeneID:1088809   -        BA0731       757371
ref|NC_003997.3|:757577-758347 NC_003997.3    GeneID:1088315   thiG     BA0732       757577
-                               -             -                -        -        -
ref|NC_003997.3|:758340-759359 NC_003997.3    GeneID:1088895   -        BA0733       758340
ref|NC_003997.3|:759375-760187 NC_003997.3    GeneID:1088343   thiD-1   BA0734       759375
ref|NC_003997.3|:761853-763520 NC_003997.3    GeneID:1088341   kdpA     BA0739       761853
ref|NC_003997.3|:763534-765624 NC_003997.3    GeneID:1088698   kdpB     BA0740       763534
ref|NC_003997.3|:765641-766222 NC_003997.3    GeneID:1088330   kdpC     BA0741       765641
ref|NC_003997.3|:766279-767433 NC_003997.3    GeneID:1088742   kdpD     BA0742       766279
ref|NC_003997.3|:c768639-767458 NC_003997.3   GeneID:1088362   -        BA0743       767458
ref|NC_003997.3|:768792-769241 NC_003997.3    GeneID:1088357   -        BA0744       768792
ref|NC_003997.3|:769370-770224 NC_003997.3    GeneID:1088658   -        BA0745       769370
ref|NC_003997.3|:c771954-770653 NC_003997.3   GeneID:1088364   -        BA0747       770653
ref|NC_003997.3|:772156-773022 NC_003997.3    GeneID:1088354   -        BA0748       772156
ref|NC_003997.3|:773568-773849 NC_003997.3    GeneID:1088132   -        BA0750       773568
ref|NC_003997.3|:c775157-774216 NC_003997.3   GeneID:1088678   scrK     BA0752       774216
ref|NC_003997.3|:c776629-775154 NC_003997.3   GeneID:1087236   scrB     BA0753       775154
ref|NC_003997.3|:c778023-776647 NC_003997.3   GeneID:1088729   scrA     BA0754       776647
ref|NC_003997.3|:c779138-778152 NC_003997.3   GeneID:1088422   scrR     BA0755       778152
ref|NC_003997.3|:c780395-779976 NC_003997.3   GeneID:1088398   -        BA0758       779976
ref|NC_003997.3|:c780809-780561 NC_003997.3   GeneID:1088375   -        BA0759       780561
ref|NC_003997.3|:c781435-780926 NC_003997.3   GeneID:1088723   -        BA0760       780926
ref|NC_003997.3|:c785906-785562 NC_003997.3   GeneID:1088463   -        BA0765       785562
ref|NC_003997.3|:786139-786699 NC_003997.3    GeneID:1088119   -        BA0766       786139
ref|NC_003997.3|:786815-788233 NC_003997.3    GeneID:1088444   spoVR    BA0767       786815
ref|NC_003997.3|:788341-789603 NC_003997.3    GeneID:1086779   -        BA0768       788341
ref|NC_003997.3|:791804-793468 NC_003997.3    GeneID:1087022   -        BA0774       791804
ref|NC_003997.3|:793654-793917 NC_003997.3    GeneID:1088521   -        BA0775       793654
ref|NC_003997.3|:794006-794566 NC_003997.3    GeneID:1088525   -        BA0776       794006
ref|NC_003997.3|:794605-795735 NC_003997.3    GeneID:1088049   -        BA0777       794605
ref|NC_003997.3|:795770-795997 NC_003997.3    GeneID:1088480   -        BA0778       795770
ref|NC_003997.3|:c798511-798071 NC_003997.3   GeneID:1088570   -        BA0782       798071
ref|NC_003997.3|:c799853-798657 NC_003997.3   GeneID:1088597   -        BA0783   798657
ref|NC_003997.3|:800167-801165 NC_003997.3    GeneID:1088661   -        BA0784   800167
ref|NC_003997.3|:c802855-801200 NC_003997.3   GeneID:1086451   -        BA0785   801200
ref|NC_003997.3|:c804385-803186 NC_003997.3   GeneID:1088704   -        BA0787   803186
ref|NC_003997.3|:804704-805792 NC_003997.3    GeneID:1088667   -        BA0789   804704
ref|NC_003997.3|:805865-807805 NC_003997.3    GeneID:1088669   -        BA0790   805865
ref|NC_003997.3|:808627-809937 NC_003997.3    GeneID:1088403   celB-1   BA0793   808627
ref|NC_003997.3|:810181-811266 NC_003997.3    GeneID:1088660   -        BA0795   810181
ref|NC_003997.3|:c812696-811536 NC_003997.3   GeneID:1087481   -        BA0796   811536
ref|NC_003997.3|:c814442-813267 NC_003997.3   GeneID:1088763   -        BA0797   813267
ref|NC_003997.3|:c815119-814445 NC_003997.3   GeneID:1088656   -        BA0798   814445
ref|NC_003997.3|:c816222-815116 NC_003997.3   GeneID:1088672   -        BA0799   815116
ref|NC_003997.3|:816433-817167 NC_003997.3    GeneID:1088664   -        BA0800   816433
ref|NC_003997.3|:c821276-820707 NC_003997.3   GeneID:1088673   cotJC    BA0803   820707
ref|NC_003997.3|:c821564-821289 NC_003997.3   GeneID:1088694   cotJB    BA0804   821289
ref|NC_003997.3|:c821776-821561 NC_003997.3   GeneID:1088675   cotJA    BA0805   821561
ref|NC_003997.3|:822245-823024 NC_003997.3    GeneID:1088761   -        BA0807   822245
ref|NC_003997.3|:c823854-823042 NC_003997.3   GeneID:1088676   -        BA0808   823042
ref|NC_003997.3|:824499-825104 NC_003997.3    GeneID:1088683   -        BA0810   824499
ref|NC_003997.3|:825209-825577 NC_003997.3    GeneID:1088479   -        BA0811   825209
ref|NC_003997.3|:825598-825942 NC_003997.3    GeneID:1088688   -        BA0812   825598
ref|NC_003997.3|:831414-832541 NC_003997.3    GeneID:1088682   -        BA0819   831414
ref|NC_003997.3|:832667-832981 NC_003997.3    GeneID:1088680   -        BA0820   832667
ref|NC_003997.3|:833011-833874 NC_003997.3    GeneID:1088685   -        BA0821   833011
ref|NC_003997.3|:834030-834914 NC_003997.3    GeneID:1088696   -        BA0822   834030
ref|NC_003997.3|:834939-836303 NC_003997.3    GeneID:1088695   -        BA0823   834939
ref|NC_003997.3|:836352-837416 NC_003997.3    GeneID:1088689   -        BA0824   836352
ref|NC_003997.3|:838137-838538 NC_003997.3    GeneID:1088692   -        BA0827   838137
ref|NC_003997.3|:c839970-839059 NC_003997.3   GeneID:1088044   -        BA0829   839059
ref|NC_003997.3|:840174-840668 NC_003997.3    GeneID:1088710   -        BA0830   840174
ref|NC_003997.3|:842405-842980 NC_003997.3    GeneID:1088043   -        BA0834   842405
ref|NC_003997.3|:843191-844393 NC_003997.3    GeneID:1088748   blT      BA0835   843191
ref|NC_003997.3|:c844765-844427 NC_003997.3   GeneID:1088402   -        BA0836   844427
ref|NC_003997.3|:844934-845473 NC_003997.3    GeneID:1088703   -        BA0837   844934
ref|NC_003997.3|:845493-846041 NC_003997.3    GeneID:1088701   -        BA0838   845493
ref|NC_003997.3|:c847853-846114 NC_003997.3   GeneID:1086087   -        BA0839   846114
ref|NC_003997.3|:847959-849215 NC_003997.3    GeneID:1088714   -        BA0840   847959
ref|NC_003997.3|:c850216-849701 NC_003997.3   GeneID:1088687   -        BA0842   849701
ref|NC_003997.3|:c852225-850240 NC_003997.3   GeneID:1088716   -        BA0843   850240
ref|NC_003997.3|:c853629-852430 NC_003997.3   GeneID:1088712   -        BA0844   852430
ref|NC_003997.3|:c855060-853690 NC_003997.3   GeneID:1088700   -        BA0845   853690
ref|NC_003997.3|:855643-856473 NC_003997.3    GeneID:1086628   racE-1   BA0847   855643
ref|NC_003997.3|:856586-857677 NC_003997.3    GeneID:1088722   -        BA0848   856586
ref|NC_003997.3|:c859191-857752 NC_003997.3   GeneID:1088724   gapN     BA0849   857752
ref|NC_003997.3|:859782-861542 NC_003997.3    GeneID:1088721   -        BA0852   859782
ref|NC_003997.3|:863814-864611 NC_003997.3    GeneID:1088726   -        BA0855   863814
ref|NC_003997.3|:864589-865296 NC_003997.3    GeneID:1088719   -        BA0856   864589
ref|NC_003997.3|:865325-866059 NC_003997.3    GeneID:1087718   -        BA0857   865325
ref|NC_003997.3|:866671-866916 NC_003997.3    GeneID:1088465   -        BA0859   866671
ref|NC_003997.3|:c868393-866933 NC_003997.3   GeneID:1088732   -        BA0860   866933
ref|NC_003997.3|:c869466-868414 NC_003997.3   GeneID:1083795   -        BA0861   868414
ref|NC_003997.3|:869619-870737 NC_003997.3    GeneID:1088727   -        BA0862   869619
ref|NC_003997.3|:870879-871235 NC_003997.3    GeneID:1083801   -      BA0863       870879
ref|NC_003997.3|:872857-874545 NC_003997.3    GeneID:1088938   alsS   BA0866       872857
ref|NC_003997.3|:874562-875320 NC_003997.3    GeneID:1088785   alsD   BA0867       874562
ref|NC_003997.3|:c876352-875735 NC_003997.3   GeneID:1084159   -      BA0869       875735
ref|NC_003997.3|:876493-877365 NC_003997.3    GeneID:1088764   -      BA0870       876493
ref|NC_003997.3|:877850-880759 NC_003997.3    GeneID:1088739   -      BA0871       877850
ref|NC_003997.3|:c881863-880817 NC_003997.3   GeneID:1088899   -      BA0872       880817
ref|NC_003997.3|:882813-884303 NC_003997.3    GeneID:1088750   -      BA0875       882813
ref|NC_003997.3|:884618-886174 NC_003997.3    GeneID:1088736   -      BA0876       884618
ref|NC_003997.3|:c886666-886202 NC_003997.3   GeneID:1087714   -      BA0877       886202
ref|NC_003997.3|:886855-888333 NC_003997.3    GeneID:1088790   -      BA0878       886855
ref|NC_003997.3|:909776-910564 NC_003997.3    GeneID:1088107   -      BA0894       909776
ref|NC_003997.3|:910814-911119 NC_003997.3    GeneID:1088324   -      BA0895       910814
ref|NC_003997.3|:911464-912513 NC_003997.3    GeneID:1088814   -      BA0897       911464
-                               -             -                -      -        -
ref|NC_003997.3|:914574-915428 NC_003997.3    GeneID:1088196   -      BA0899       914574
ref|NC_003997.3|:916011-917006 NC_003997.3    GeneID:1088813   -      BA0901       916011
ref|NC_003997.3|:917026-918003 NC_003997.3    GeneID:1088949   -      BA0902       917026
ref|NC_003997.3|:922058-923644 NC_003997.3    GeneID:1088819   -      BA0908       922058
ref|NC_003997.3|:923704-924654 NC_003997.3    GeneID:1087699   -      BA0909       923704
ref|NC_003997.3|:924661-925512 NC_003997.3    GeneID:1087607   -      BA0910       924661
ref|NC_003997.3|:926524-927495 NC_003997.3    GeneID:1088313   -      BA0912       926524
ref|NC_003997.3|:c932480-931158 NC_003997.3   GeneID:1088906   -      BA0921       931158
ref|NC_003997.3|:932706-934295 NC_003997.3    GeneID:1088214   -      BA0923       932706
ref|NC_003997.3|:934314-934991 NC_003997.3    GeneID:1088846   -      BA0924       934314
ref|NC_003997.3|:934988-935965 NC_003997.3    GeneID:1088855   -      BA0925       934988
ref|NC_003997.3|:942788-943126 NC_003997.3    GeneID:1088751   -      BA0929       942788
ref|NC_003997.3|:943390-944133 NC_003997.3    GeneID:1087693   -      BA0931       943390
ref|NC_003997.3|:944714-945574 NC_003997.3    GeneID:1088152   -      BA0933       944714
ref|NC_003997.3|:945571-946857 NC_003997.3    GeneID:1087670   -      BA0934       945571
ref|NC_003997.3|:c949074-948301 NC_003997.3   GeneID:1086642   -      BA0938       948301
ref|NC_003997.3|:949197-949964 NC_003997.3    GeneID:1088873   -      BA0939       949197
ref|NC_003997.3|:c951219-950644 NC_003997.3   GeneID:1088869   -      BA0943       950644
ref|NC_003997.3|:951362-952822 NC_003997.3    GeneID:1088870   -      BA0944       951362
ref|NC_003997.3|:c956750-955344 NC_003997.3   GeneID:1088884   -      BA0950       955344
ref|NC_003997.3|:957182-957766 NC_003997.3    GeneID:1088160   -      BA0952       957182
ref|NC_003997.3|:957883-958437 NC_003997.3    GeneID:1088985   -      BA0953       957883
ref|NC_003997.3|:c960675-958792 NC_003997.3   GeneID:1088879   -      BA0954       958792
ref|NC_003997.3|:c961317-960733 NC_003997.3   GeneID:1088201   -      BA0955       960733
ref|NC_003997.3|:962992-963450 NC_003997.3    GeneID:1087426   -      BA0958       962992
ref|NC_003997.3|:963494-964027 NC_003997.3    GeneID:1088894   pssA   BA0959       963494
ref|NC_003997.3|:964051-964422 NC_003997.3    GeneID:1087684   -      BA0960       964051
ref|NC_003997.3|:965744-966364 NC_003997.3    GeneID:1088897   -      BA0962       965744
ref|NC_003997.3|:c967462-966464 NC_003997.3   GeneID:1088916   -      BA0963       966464
ref|NC_003997.3|:c968048-967482 NC_003997.3   GeneID:1087665   -      BA0964       967482
ref|NC_003997.3|:968227-969978 NC_003997.3    GeneID:1088161   -      BA0965       968227
ref|NC_003997.3|:976635-976916 NC_003997.3    GeneID:1088189   -      BA0977       976635
ref|NC_003997.3|:979208-980941 NC_003997.3    GeneID:1088213   -      BA0981       979208
ref|NC_003997.3|:981082-981396 NC_003997.3    GeneID:1088924   -      BA0982       981082
ref|NC_003997.3|:981413-982021 NC_003997.3    GeneID:1088914   -      BA0983       981413
ref|NC_003997.3|:983749-984138 NC_003997.3    GeneID:1088911   -      BA0986       983749
ref|NC_003997.3|:984189-984389 NC_003997.3    GeneID:1087250   -      BA0987       984189
ref|NC_003997.3|:984465-984716 NC_003997.3    GeneID:1087721   -        BA0988    984465
ref|NC_003997.3|:985298-985633 NC_003997.3    GeneID:1088925   rsbV     BA0990    985298
ref|NC_003997.3|:985640-986122 NC_003997.3    GeneID:1088183   rsbW     BA0991    985640
ref|NC_003997.3|:986088-986861 NC_003997.3    GeneID:1088960   sigB     BA0992    986088
ref|NC_003997.3|:986931-987371 NC_003997.3    GeneID:1088930   -        BA0993    986931
ref|NC_003997.3|:987547-988689 NC_003997.3    GeneID:1088940   -        BA0994    987547
ref|NC_003997.3|:c989585-988728 NC_003997.3   GeneID:1088958   -        BA0995    988728
ref|NC_003997.3|:c992292-989602 NC_003997.3   GeneID:1088076   -        BA0996    989602
ref|NC_003997.3|:993148-993678 NC_003997.3    GeneID:1088928   -        BA0999    993148
ref|NC_003997.3|:993739-994020 NC_003997.3    GeneID:1088876   -        BA1000    993739
ref|NC_003997.3|:994163-994474 NC_003997.3    GeneID:1087707   -        BA1001    994163
ref|NC_003997.3|:c996471-995476 NC_003997.3   GeneID:1087973   -        BA1004    995476
ref|NC_003997.3|:996832-997257 NC_003997.3    GeneID:1088052   -        BA1006    996832
ref|NC_003997.3|:c997469-997284 NC_003997.3   GeneID:1088771   -        BA1007    997284
ref|NC_003997.3|:997638-998879 NC_003997.3    GeneID:1087497   -        BA1008    997638
ref|NC_003997.3|:998876-999475 NC_003997.3    GeneID:1088936   -        BA1009    998876
ref|NC_003997.3|:1001412-1003715NC_003997.3   GeneID:1088932   -        BA1011   1001412
ref|NC_003997.3|:1003757-1004701NC_003997.3   GeneID:1088945   -        BA1012   1003757
ref|NC_003997.3|:1007139-1008083NC_003997.3   GeneID:1087254   -        BA1015   1007139
ref|NC_003997.3|:1008127-1009104NC_003997.3   GeneID:1088944   -        BA1016   1008127
ref|NC_003997.3|:1009328-1010440NC_003997.3   GeneID:1088937   -        BA1017   1009328
ref|NC_003997.3|:1010796-1011671NC_003997.3   GeneID:1088954   -        BA1019   1010796
ref|NC_003997.3|:1012177-1012977NC_003997.3   GeneID:1088952   -        BA1021   1012177
ref|NC_003997.3|:1014674-1015495NC_003997.3   GeneID:1087861   glpF     BA1025   1014674
ref|NC_003997.3|:1015509-1016999NC_003997.3   GeneID:1088947   glpK     BA1026   1015509
ref|NC_003997.3|:1017133-1018815NC_003997.3   GeneID:1087122   glpD     BA1027   1017133
                                NC_003997.3
ref|NC_003997.3|:c1027442-1026879             GeneID:1088181   -        BA1039   1026879
                                NC_003997.3
ref|NC_003997.3|:c1029860-1027530             GeneID:1088968   -        BA1040   1027530
                                NC_003997.3
ref|NC_003997.3|:c1031101-1030238             GeneID:1088973   prsA     BA1041   1030238
                                NC_003997.3
ref|NC_003997.3|:c1031721-1031527             GeneID:1086934   -        BA1043   1031527
ref|NC_003997.3|:1031840-1032175NC_003997.3   GeneID:1087317   -        BA1044   1031840
                                NC_003997.3
ref|NC_003997.3|:c1032738-1032181             GeneID:1088195   hpr      BA1045   1032181
                                NC_003997.3
ref|NC_003997.3|:c1033399-1033037             GeneID:1088970   -        BA1046   1033037
                                NC_003997.3
ref|NC_003997.3|:c1034011-1033577             GeneID:1088971   -        BA1047   1033577
ref|NC_003997.3|:1034571-1035314NC_003997.3   GeneID:1088210   ecsA     BA1048   1034571
ref|NC_003997.3|:1035307-1036518NC_003997.3   GeneID:1088982   ecsB     BA1049   1035307
ref|NC_003997.3|:1036532-1037239NC_003997.3   GeneID:1088983   ecsC     BA1050   1036532
ref|NC_003997.3|:1037579-1038160NC_003997.3   GeneID:1088978   -        BA1052   1037579
ref|NC_003997.3|:1038410-1038886NC_003997.3   GeneID:1087673   -        BA1054   1038410
ref|NC_003997.3|:1041856-1042227NC_003997.3   GeneID:1088974   -        BA1059   1041856
ref|NC_003997.3|:1046206-1046682NC_003997.3   GeneID:1088993   -        BA1065   1046206
                                NC_003997.3
ref|NC_003997.3|:c1048749-1048246             GeneID:1088992   -        BA1068   1048246
ref|NC_003997.3|:1048877-1050994NC_003997.3   GeneID:1089007   pbpF     BA1069   1048877
ref|NC_003997.3|:1051174-1052220NC_003997.3   GeneID:1089006   hemE     BA1070   1051174
ref|NC_003997.3|:1052235-1053170NC_003997.3   GeneID:1089001   hemH-1   BA1071   1052235
ref|NC_003997.3|:1053241-1054611NC_003997.3   GeneID:1089002   hemY-1   BA1072   1053241
                                NC_003997.3
ref|NC_003997.3|:c1056003-1054651             GeneID:1089004   -        BA1073   1054651
ref|NC_003997.3|:1056859-1058610NC_003997.3   GeneID:1089014   -        BA1075   1056859
ref|NC_003997.3|:1060181-1060579NC_003997.3   GeneID:1089016   blaI     BA1078   1060181
ref|NC_003997.3|:1060594-1062483NC_003997.3   GeneID:1088090   -        BA1079   1060594
ref|NC_003997.3|:1062697-1063269NC_003997.3   GeneID:1087214   -        BA1080   1062697
ref|NC_003997.3|:1063484-1066093NC_003997.3   GeneID:1089020   -        BA1081   1063484
                               NC_003997.3
ref|NC_003997.3|:1066474-1066794             GeneID:1088066   -        BA1083       1066474
                               NC_003997.3
ref|NC_003997.3|:1068049-1069026             GeneID:1089029   -        BA1086       1068049
                               NC_003997.3
ref|NC_003997.3|:1069410-1070144             GeneID:1087662   -        BA1088       1069410
                               NC_003997.3
ref|NC_003997.3|:1070154-1071143             GeneID:1089024   -        BA1089       1070154
                               NC_003997.3
ref|NC_003997.3|:1071398-1071826             GeneID:1087667   -        BA1090       1071398
                               NC_003997.3
ref|NC_003997.3|:1071988-1073520             GeneID:1089040   -        BA1091       1071988
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:1082539-1082877             GeneID:1089043   -        BA1096       1082539
                               NC_003997.3
ref|NC_003997.3|:1088152-1089129             GeneID:1089047   -        BA1111       1088152
                               NC_003997.3
ref|NC_003997.3|:c1090778-1090293            GeneID:1084557   -        BA1113       1090293
                               NC_003997.3
ref|NC_003997.3|:1090916-1091818             GeneID:1088065   -        BA1114       1090916
                               NC_003997.3
ref|NC_003997.3|:1091878-1092243             GeneID:1088728   -        BA1116       1091878
                               NC_003997.3
ref|NC_003997.3|:1092369-1092587             GeneID:1089070   -        BA1117       1092369
                               NC_003997.3
ref|NC_003997.3|:c1094707-1092965            GeneID:1084428   -        BA1118       1092965
                               NC_003997.3
ref|NC_003997.3|:c1095421-1094717            GeneID:1089077   -        BA1119       1094717
                               NC_003997.3
ref|NC_003997.3|:1095557-1096411             GeneID:1089093   -        BA1120       1095557
                               NC_003997.3
ref|NC_003997.3|:1096426-1096758             GeneID:1089064   -        BA1121       1096426
                               NC_003997.3
ref|NC_003997.3|:1097424-1098692             GeneID:1084287   -        BA1124       1097424
                               NC_003997.3
ref|NC_003997.3|:1098829-1100556             GeneID:1086061   -        BA1125       1098829
                               NC_003997.3
ref|NC_003997.3|:1104677-1106266             GeneID:1084420   aceB     BA1131       1104677
                               NC_003997.3
ref|NC_003997.3|:1106290-1107567             GeneID:1089079   aceA     BA1132       1106290
                               NC_003997.3
ref|NC_003997.3|:c1108529-1107741            GeneID:1089121   -        BA1133       1107741
                               NC_003997.3
ref|NC_003997.3|:1109954-1110535             GeneID:1089114   -        BA1138       1109954
                               NC_003997.3
ref|NC_003997.3|:1110809-1111402             GeneID:1089123   -        BA1139       1110809
                               NC_003997.3
ref|NC_003997.3|:1111459-1112022             GeneID:1089106   sipT     BA1140       1111459
                               NC_003997.3
ref|NC_003997.3|:1112139-1115654             GeneID:1089116   addB     BA1141       1112139
                               NC_003997.3
ref|NC_003997.3|:1115651-1119376             GeneID:1089102   addA     BA1142       1115651
                               NC_003997.3
ref|NC_003997.3|:c1121189-1120575            GeneID:1084076   gerPC    BA1147       1120575
                               NC_003997.3
ref|NC_003997.3|:c1121698-1121477            GeneID:1089127   gerPA    BA1149       1121477
                               NC_003997.3
ref|NC_003997.3|:1122221-1123120             GeneID:1089171   -        BA1152       1122221
                               NC_003997.3
ref|NC_003997.3|:c1124736-1123546            GeneID:1089152   rocD     BA1154       1123546
                               NC_003997.3
ref|NC_003997.3|:1124887-1125252             GeneID:1083975   -        BA1155       1124887
                               NC_003997.3
ref|NC_003997.3|:1126173-1127951             GeneID:1089151   asnO-1   BA1157       1126173
                               NC_003997.3
ref|NC_003997.3|:1129159-1130625             GeneID:1089138   katB     BA1159       1129159
                               NC_003997.3
ref|NC_003997.3|:c1136107-1135616            GeneID:1089184   -        BA1166       1135616
                               NC_003997.3
ref|NC_003997.3|:1136347-1137201             GeneID:1083793   -        BA1167       1136347
                               NC_003997.3
ref|NC_003997.3|:1138907-1139764             GeneID:1089173   -        BA1171       1138907
                               NC_003997.3
ref|NC_003997.3|:c1139987-1139790            GeneID:1088089   -        BA1172       1139790
                               NC_003997.3
ref|NC_003997.3|:c1141043-1140234            GeneID:1085426   -        BA1174       1140234
                               NC_003997.3
ref|NC_003997.3|:1141925-1144525             GeneID:1086217   clpB     BA1177       1141925
                               NC_003997.3
ref|NC_003997.3|:c1144741-1144559            GeneID:1089206   -        BA1178       1144559
                               NC_003997.3
ref|NC_003997.3|:1144898-1145632             GeneID:1086151   -        BA1180       1144898
                               NC_003997.3
ref|NC_003997.3|:1147155-1148087             GeneID:1089235   fabH     BA1184       1147155
                               NC_003997.3
ref|NC_003997.3|:1148119-1149357             GeneID:1089230   fabF     BA1185       1148119
                               NC_003997.3
ref|NC_003997.3|:1149464-1150252             GeneID:1086088   -        BA1186       1149464
                               NC_003997.3
ref|NC_003997.3|:1150395-1151141             GeneID:1089253   -        BA1187       1150395
                               NC_003997.3
ref|NC_003997.3|:c1153066-1152686            GeneID:1084970   -        BA1189       1152686
                               NC_003997.3
ref|NC_003997.3|:1155145-1156074             GeneID:1089252   -        BA1192       1155145
                               NC_003997.3
ref|NC_003997.3|:1156071-1157087             GeneID:1089251   -        BA1193       1156071
                               NC_003997.3
ref|NC_003997.3|:1157106-1158149             GeneID:1085103   -        BA1194       1157106
                               NC_003997.3
ref|NC_003997.3|:1158142-1159077             GeneID:1085149   -        BA1195       1158142
                               NC_003997.3
ref|NC_003997.3|:c1160621-1159227            GeneID:1089222   -        BA1196       1159227
                               NC_003997.3
ref|NC_003997.3|:1163477-1163872             GeneID:1089241   spxA     BA1200       1163477
                               NC_003997.3
ref|NC_003997.3|:c1164596-1163922            GeneID:1089255   -        BA1201       1163922
                               NC_003997.3
ref|NC_003997.3|:1164953-1165606             GeneID:1089261   mecA     BA1203       1164953
                               NC_003997.3
ref|NC_003997.3|:1165679-1167223             GeneID:1087241   cls      BA1204       1165679
                               NC_003997.3
ref|NC_003997.3|:1167305-1168549             GeneID:1089260   -        BA1205       1167305
                               NC_003997.3
ref|NC_003997.3|:1168600-1170426             GeneID:1089231   pepF-1   BA1206       1168600
                               NC_003997.3
ref|NC_003997.3|:c1171842-1170949            GeneID:1086926   -        BA1208       1170949
                               NC_003997.3
ref|NC_003997.3|:c1172240-1171842            GeneID:1084735   -        BA1209       1171842
                               NC_003997.3
ref|NC_003997.3|:c1172999-1172421            GeneID:1086524   -        BA1210       1172421
                               NC_003997.3
ref|NC_003997.3|:1173146-1173505             GeneID:1084204   -        BA1211       1173146
                               NC_003997.3
ref|NC_003997.3|:1173536-1174174             GeneID:1083632   -        BA1212       1173536
                               NC_003997.3
ref|NC_003997.3|:1174193-1174990             GeneID:1088735   ppnK     BA1213       1174193
                               NC_003997.3
ref|NC_003997.3|:c1178216-1177476            GeneID:1087409   -        BA1217       1177476
                               NC_003997.3
ref|NC_003997.3|:c1182275-1181430            GeneID:1084360   -        BA1221       1181430
                               NC_003997.3
ref|NC_003997.3|:c1183546-1182398            GeneID:1084744   -        BA1222       1182398
                               NC_003997.3
ref|NC_003997.3|:1183712-1184824             GeneID:1085793   -        BA1224       1183712
                               NC_003997.3
ref|NC_003997.3|:1184962-1185651             GeneID:1084620   -        BA1225       1184962
                               NC_003997.3
ref|NC_003997.3|:1186347-1187027             GeneID:1084654   -        BA1227       1186347
                               NC_003997.3
ref|NC_003997.3|:1187042-1187779             GeneID:1084219   -        BA1228       1187042
                               NC_003997.3
ref|NC_003997.3|:1188350-1189318             GeneID:1085406   rfbB     BA1230       1188350
                               NC_003997.3
ref|NC_003997.3|:1189330-1190184             GeneID:1087655   rfbD     BA1231       1189330
                               NC_003997.3
ref|NC_003997.3|:1190293-1191063             GeneID:1084376   fabI     BA1232       1190293
                               NC_003997.3
ref|NC_003997.3|:1191204-1191752             GeneID:1086299   -        BA1233       1191204
                               NC_003997.3
ref|NC_003997.3|:1192324-1192755             GeneID:1087678   -        BA1235       1192324
                               NC_003997.3
ref|NC_003997.3|:c1193624-1193121            GeneID:1084992   -        BA1237       1193121
                               NC_003997.3
ref|NC_003997.3|:c1196378-1194405            GeneID:1088073   -        BA1239       1194405
                               NC_003997.3
ref|NC_003997.3|:c1197513-1196995            GeneID:1087677   -        BA1241       1196995
                               NC_003997.3
ref|NC_003997.3|:c1198337-1197606            GeneID:1083705   -        BA1242       1197606
                               NC_003997.3
ref|NC_003997.3|:1198541-1199452             GeneID:1086895   -        BA1243       1198541
                               NC_003997.3
ref|NC_003997.3|:1199601-1199996             GeneID:1087676   -        BA1244       1199601
                               NC_003997.3
ref|NC_003997.3|:c1200419-1200021            GeneID:1086054   -        BA1245       1200021
                               NC_003997.3
ref|NC_003997.3|:1203055-1204470             GeneID:1085387   trpE     BA1248       1203055
                               NC_003997.3
ref|NC_003997.3|:1204467-1205054             GeneID:1084661   pabA-2   BA1249       1204467
                               NC_003997.3
ref|NC_003997.3|:1205051-1206076             GeneID:1086857   trpD     BA1250       1205051
                               NC_003997.3
ref|NC_003997.3|:1206078-1206839             GeneID:1085544   -        BA1251       1206078
                               NC_003997.3
ref|NC_003997.3|:1206836-1207450             GeneID:1083868   trpF     BA1252       1206836
                               NC_003997.3
ref|NC_003997.3|:1207447-1208640             GeneID:1086833   trpB     BA1253       1207447
                               NC_003997.3
ref|NC_003997.3|:1208644-1209420             GeneID:1085329   trpA     BA1254       1208644
                               NC_003997.3
ref|NC_003997.3|:1209969-1211468             GeneID:1084069   -        BA1256       1209969
                               NC_003997.3
ref|NC_003997.3|:1211560-1212243             GeneID:1087336   -        BA1257       1211560
                               NC_003997.3
ref|NC_003997.3|:c1213091-1212258            GeneID:1086826   -        BA1258       1212258
                               NC_003997.3
ref|NC_003997.3|:1215051-1216385             GeneID:1087666   -        BA1263       1215051
                               NC_003997.3
ref|NC_003997.3|:1217123-1217533             GeneID:1086127   -        BA1265       1217123
                               NC_003997.3
ref|NC_003997.3|:c1219106-1217565            GeneID:1083851   -        BA1266       1217565
                               NC_003997.3
ref|NC_003997.3|:c1221072-1219123            GeneID:1088348   -        BA1267       1219123
                               NC_003997.3
ref|NC_003997.3|:c1222988-1221069            GeneID:1084407   -        BA1268       1221069
                               NC_003997.3
ref|NC_003997.3|:c1224369-1223113            GeneID:1084342   odhB     BA1269       1223113
                               NC_003997.3
ref|NC_003997.3|:c1227372-1224505            GeneID:1086638   odhA     BA1270       1224505
                               NC_003997.3
ref|NC_003997.3|:1228210-1228407             GeneID:1086526   -        BA1271       1228210
                               NC_003997.3
ref|NC_003997.3|:1228410-1228787             GeneID:1087703   -        BA1272       1228410
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:1228816-1228998             GeneID:1085028   -        BA1273       1228816
                               NC_003997.3
ref|NC_003997.3|:1229133-1229492             GeneID:1083646   -        BA1274   1229133
                               NC_003997.3
ref|NC_003997.3|:c1233996-1233241            GeneID:1083925   -        BA1282   1233241
                               NC_003997.3
ref|NC_003997.3|:1234362-1234589             GeneID:1087663   -        BA1284   1234362
                               NC_003997.3
ref|NC_003997.3|:1234745-1236031             GeneID:1085908   -        BA1286   1234745
                               NC_003997.3
ref|NC_003997.3|:1236226-1236795             GeneID:1084505   sipW     BA1287   1236226
                               NC_003997.3
ref|NC_003997.3|:1236858-1237445             GeneID:1088646   -        BA1288   1236858
                               NC_003997.3
ref|NC_003997.3|:1238768-1239361             GeneID:1087580   -        BA1290   1238768
                               NC_003997.3
ref|NC_003997.3|:c1239760-1239437            GeneID:1083726   sinR     BA1292   1239437
                               NC_003997.3
ref|NC_003997.3|:1240318-1242705             GeneID:1084123   -        BA1295   1240318
                               NC_003997.3
ref|NC_003997.3|:1242877-1244244             GeneID:1083696   ywdH     BA1296   1242877
                               NC_003997.3
ref|NC_003997.3|:1244471-1245466             GeneID:1084212   potA     BA1297   1244471
                               NC_003997.3
ref|NC_003997.3|:1245463-1246311             GeneID:1088640   potB     BA1298   1245463
                               NC_003997.3
ref|NC_003997.3|:1246318-1247118             GeneID:1084641   potC     BA1299   1246318
                               NC_003997.3
ref|NC_003997.3|:1247157-1248194             GeneID:1085223   potD     BA1300   1247157
                               NC_003997.3
ref|NC_003997.3|:1249012-1251204             GeneID:1086026   -        BA1302   1249012
                               NC_003997.3
ref|NC_003997.3|:1251305-1251721             GeneID:1088231   -        BA1303   1251305
                               NC_003997.3
ref|NC_003997.3|:c1254308-1253481            GeneID:1086303   -        BA1306   1253481
                               NC_003997.3
ref|NC_003997.3|:c1256102-1254774            GeneID:1083741   -        BA1308   1254774
                               NC_003997.3
ref|NC_003997.3|:c1257511-1256099            GeneID:1088647   glcD     BA1309   1256099
                               NC_003997.3
ref|NC_003997.3|:c1258744-1257629            GeneID:1087121   -        BA1310   1257629
                               NC_003997.3
ref|NC_003997.3|:1258881-1259855             GeneID:1088654   -        BA1311   1258881
                               NC_003997.3
ref|NC_003997.3|:1259848-1260519             GeneID:1086011   -        BA1312   1259848
                               NC_003997.3
ref|NC_003997.3|:1260523-1261923             GeneID:1085561   -        BA1313   1260523
                               NC_003997.3
ref|NC_003997.3|:1262184-1262840             GeneID:1084176   -        BA1314   1262184
                               NC_003997.3
ref|NC_003997.3|:1263008-1263727             GeneID:1086018   -        BA1315   1263008
                               NC_003997.3
ref|NC_003997.3|:1263744-1265165             GeneID:1086037   -        BA1316   1263744
                               NC_003997.3
ref|NC_003997.3|:1265165-1265875             GeneID:1087448   -        BA1317   1265165
                               NC_003997.3
ref|NC_003997.3|:1265988-1266710             GeneID:1086050   comC     BA1318   1265988
                               NC_003997.3
ref|NC_003997.3|:c1267913-1267062            GeneID:1086027   -        BA1321   1267062
                               NC_003997.3
ref|NC_003997.3|:c1268911-1268117            GeneID:1083640   -        BA1322   1268117
                               NC_003997.3
ref|NC_003997.3|:c1270525-1269206            GeneID:1088649   -        BA1323   1269206
                               NC_003997.3
ref|NC_003997.3|:c1271416-1270973            GeneID:1084446   -        BA1326   1270973
                               NC_003997.3
ref|NC_003997.3|:c1272042-1271518            GeneID:1084397   -        BA1327   1271518
                               NC_003997.3
ref|NC_003997.3|:c1272537-1272085            GeneID:1085518   -        BA1328   1272085
                               NC_003997.3
ref|NC_003997.3|:1272736-1273218             GeneID:1086009   -        BA1329   1272736
                               NC_003997.3
ref|NC_003997.3|:1273368-1274111             GeneID:1085124   fabG     BA1330   1273368
                               NC_003997.3
ref|NC_003997.3|:1274194-1275279             GeneID:1084450   phaC     BA1331   1274194
                               NC_003997.3
ref|NC_003997.3|:1275375-1276568             GeneID:1086626   -        BA1332   1275375
                               NC_003997.3
ref|NC_003997.3|:1276592-1277941             GeneID:1085055   -        BA1333   1276592
                               NC_003997.3
ref|NC_003997.3|:c1278321-1277980            GeneID:1085910   -        BA1334   1277980
                               NC_003997.3
ref|NC_003997.3|:1278845-1279921             GeneID:1085816   -        BA1337   1278845
                               NC_003997.3
ref|NC_003997.3|:1281042-1282700             GeneID:1087299   -        BA1339   1281042
                               NC_003997.3
ref|NC_003997.3|:1282722-1283516             GeneID:1087293   phnX     BA1340   1282722
                               NC_003997.3
ref|NC_003997.3|:1283532-1284629             GeneID:1084754   -        BA1341   1283532
                               NC_003997.3
ref|NC_003997.3|:1284626-1285810             GeneID:1085862   -        BA1342   1284626
                               NC_003997.3
ref|NC_003997.3|:1287723-1289351             GeneID:1086745   -        BA1346   1287723
                               NC_003997.3
ref|NC_003997.3|:1290352-1290975             GeneID:1085877   -        BA1348   1290352
                               NC_003997.3
ref|NC_003997.3|:c1293960-1292464            GeneID:1084814   -        BA1351   1292464
                               NC_003997.3
ref|NC_003997.3|:1294151-1294597             GeneID:1085054   -        BA1352   1294151
                               NC_003997.3
ref|NC_003997.3|:1294758-1296452             GeneID:1086024   -        BA1353   1294758
                               NC_003997.3
ref|NC_003997.3|:1296591-1297124             GeneID:1084369   -        BA1354   1296591
                               NC_003997.3
ref|NC_003997.3|:c1298563-1297355            GeneID:1086010   kinB-1   BA1356   1297355
                               NC_003997.3
ref|NC_003997.3|:1298908-1299570             GeneID:1083924   -        BA1359       1298908
                               NC_003997.3
ref|NC_003997.3|:1299570-1300061             GeneID:1084696   -        BA1360       1299570
                               NC_003997.3
ref|NC_003997.3|:1300054-1300770             GeneID:1085906   -        BA1361       1300054
                               NC_003997.3
ref|NC_003997.3|:1300789-1301286             GeneID:1086017   -        BA1362       1300789
                               NC_003997.3
ref|NC_003997.3|:1302032-1302634             GeneID:1084498   -        BA1365       1302032
                               NC_003997.3
ref|NC_003997.3|:c1303248-1302670            GeneID:1086028   -        BA1366       1302670
                               NC_003997.3
ref|NC_003997.3|:1303715-1304032             GeneID:1087268   -        BA1368       1303715
                               NC_003997.3
ref|NC_003997.3|:1304509-1304868             GeneID:1088653   nrdI     BA1369       1304509
                               NC_003997.3
ref|NC_003997.3|:1304855-1308041             GeneID:1086503   nrdE     BA1371       1304855
                               NC_003997.3
ref|NC_003997.3|:1308135-1309103             GeneID:1088648   nrdF     BA1372       1308135
                               NC_003997.3
ref|NC_003997.3|:1309320-1309700             GeneID:1084202   -        BA1373       1309320
                               NC_003997.3
ref|NC_003997.3|:1309697-1310395             GeneID:1086367   -        BA1374       1309697
                               NC_003997.3
ref|NC_003997.3|:1311297-1312103             GeneID:1084760   -        BA1376       1311297
                               NC_003997.3
ref|NC_003997.3|:1312103-1312879             GeneID:1085904   -        BA1377       1312103
                               NC_003997.3
ref|NC_003997.3|:1313082-1314095             GeneID:1086922   -        BA1378       1313082
                               NC_003997.3
ref|NC_003997.3|:c1314860-1314408            GeneID:1086362   -        BA1380       1314408
                               NC_003997.3
ref|NC_003997.3|:1314987-1315415             GeneID:1084675   -        BA1381       1314987
                               NC_003997.3
ref|NC_003997.3|:1315408-1315962             GeneID:1085556   -        BA1382       1315408
                               NC_003997.3
ref|NC_003997.3|:1316049-1316447             GeneID:1086014   -        BA1383       1316049
                               NC_003997.3
ref|NC_003997.3|:1317511-1318605             GeneID:1085875   -        BA1385       1317511
                               NC_003997.3
ref|NC_003997.3|:c1319798-1318623            GeneID:1086097   dltD-1   BA1386       1318623
                               NC_003997.3
ref|NC_003997.3|:c1320034-1319795            GeneID:1086019   dltC     BA1387       1319795
                               NC_003997.3
ref|NC_003997.3|:c1321269-1320103            GeneID:1084416   dltB     BA1388       1320103
                               NC_003997.3
ref|NC_003997.3|:c1322777-1321266            GeneID:1084139   dltA     BA1389       1321266
                               NC_003997.3
ref|NC_003997.3|:1323274-1324443             GeneID:1086153   amaA     BA1392       1323274
                               NC_003997.3
ref|NC_003997.3|:1324869-1325285             GeneID:1084233   -        BA1394       1324869
                               NC_003997.3
ref|NC_003997.3|:1325337-1326083             GeneID:1086124   -        BA1395       1325337
                               NC_003997.3
ref|NC_003997.3|:c1327249-1326347            GeneID:1085114   -        BA1397       1326347
                               NC_003997.3
ref|NC_003997.3|:c1329692-1328331            GeneID:1084137   -        BA1402       1328331
                               NC_003997.3
ref|NC_003997.3|:1329902-1330666             GeneID:1087239   uppP     BA1403       1329902
                               NC_003997.3
ref|NC_003997.3|:c1331250-1330696            GeneID:1085836   -        BA1404       1330696
                               NC_003997.3
ref|NC_003997.3|:1331935-1332330             GeneID:1086000   -        BA1406       1331935
                               NC_003997.3
ref|NC_003997.3|:c1333880-1332645            GeneID:1084440   -        BA1408       1332645
                               NC_003997.3
ref|NC_003997.3|:1335076-1336419             GeneID:1084832   -        BA1409       1335076
                               NC_003997.3
ref|NC_003997.3|:c1336824-1336453            GeneID:1087313   -        BA1410       1336453
                               NC_003997.3
ref|NC_003997.3|:1339090-1339986             GeneID:1086379   ilvE-1   BA1416       1339090
                               NC_003997.3
ref|NC_003997.3|:1341999-1342508             GeneID:1084285   ilvN     BA1418       1341999
                               NC_003997.3
ref|NC_003997.3|:1342535-1343545             GeneID:1084747   ilvC-1   BA1419       1342535
                               NC_003997.3
ref|NC_003997.3|:1343547-1345067             GeneID:1085912   leuA     BA1420       1343547
                               NC_003997.3
ref|NC_003997.3|:1345145-1346209             GeneID:1084163   leuB     BA1421       1345145
                               NC_003997.3
ref|NC_003997.3|:1346209-1347603             GeneID:1084183   leuC     BA1422       1346209
                               NC_003997.3
ref|NC_003997.3|:1347581-1348162             GeneID:1086008   leuD     BA1423       1347581
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:1349711-1350346             GeneID:1087400   hisG     BA1425       1349711
                               NC_003997.3
ref|NC_003997.3|:1350358-1351647             GeneID:1085728   hisD     BA1426       1350358
                               NC_003997.3
ref|NC_003997.3|:1352834-1353553             GeneID:1084571   hisA     BA1429       1352834
                               NC_003997.3
ref|NC_003997.3|:1353547-1354305             GeneID:1085550   hisF     BA1430       1353547
                               NC_003997.3
ref|NC_003997.3|:1354953-1355969             GeneID:1083641   -        BA1432       1354953
                               NC_003997.3
ref|NC_003997.3|:1356351-1357322             GeneID:1085122   -        BA1434       1356351
                               NC_003997.3
ref|NC_003997.3|:c1358056-1357355            GeneID:1084213   -        BA1435       1357355
                               NC_003997.3
ref|NC_003997.3|:c1360124-1358238            GeneID:1084607   -        BA1436       1358238
                               NC_003997.3
ref|NC_003997.3|:1360325-1360768             GeneID:1084771   -        BA1437       1360325
                               NC_003997.3
ref|NC_003997.3|:1361225-1362541             GeneID:1086460   lysA     BA1438   1361225
                               NC_003997.3
ref|NC_003997.3|:1363068-1363748             GeneID:1086013   cysH     BA1440   1363068
                               NC_003997.3
ref|NC_003997.3|:1363787-1364923             GeneID:1087079   sat      BA1441   1363787
                               NC_003997.3
ref|NC_003997.3|:1364936-1365529             GeneID:1085898   cysC     BA1442   1364936
                               NC_003997.3
ref|NC_003997.3|:1365541-1367163             GeneID:1085102   nirA     BA1443   1365541
                               NC_003997.3
ref|NC_003997.3|:1367464-1368240             GeneID:1084656   cysG     BA1445   1367464
                               NC_003997.3
ref|NC_003997.3|:1368242-1368997             GeneID:1085680   -        BA1446   1368242
                               NC_003997.3
ref|NC_003997.3|:1368972-1369589             GeneID:1085940   -        BA1447   1368972
                               NC_003997.3
ref|NC_003997.3|:1370011-1371366             GeneID:1085902   -        BA1448   1370011
                               NC_003997.3
ref|NC_003997.3|:1373373-1374644             GeneID:1084364   -        BA1450   1373373
                               NC_003997.3
ref|NC_003997.3|:1374712-1375230             GeneID:1087388   -        BA1451   1374712
                               NC_003997.3
ref|NC_003997.3|:1375552-1376868             GeneID:1084694   -        BA1452   1375552
                               NC_003997.3
ref|NC_003997.3|:1377097-1377453             GeneID:1084279   -        BA1453   1377097
                               NC_003997.3
ref|NC_003997.3|:1377504-1378166             GeneID:1085994   -        BA1454   1377504
                               NC_003997.3
ref|NC_003997.3|:1378273-1379013             GeneID:1084418   -        BA1455   1378273
                               NC_003997.3
ref|NC_003997.3|:1379013-1380068             GeneID:1083977   -        BA1456   1379013
                               NC_003997.3
ref|NC_003997.3|:1380065-1380697             GeneID:1085998   -        BA1457   1380065
                               NC_003997.3
ref|NC_003997.3|:1380764-1381093             GeneID:1084164   -        BA1458   1380764
                               NC_003997.3
ref|NC_003997.3|:c1382472-1381117            GeneID:1085289   brnQ-3   BA1459   1381117
                               NC_003997.3
ref|NC_003997.3|:1383060-1383269             GeneID:1084109   -        BA1461   1383060
                               NC_003997.3
ref|NC_003997.3|:c1384085-1383309            GeneID:1086113   -        BA1462   1383309
                               NC_003997.3
ref|NC_003997.3|:1384289-1385044             GeneID:1085557   -        BA1463   1384289
                               NC_003997.3
ref|NC_003997.3|:c1385336-1385139            GeneID:1084668   -        BA1464   1385139
                               NC_003997.3
ref|NC_003997.3|:1386699-1387217             GeneID:1085985   -        BA1466   1386699
                               NC_003997.3
ref|NC_003997.3|:1387377-1388585             GeneID:1084422   hmp      BA1467   1387377
                               NC_003997.3
ref|NC_003997.3|:c1389131-1388619            GeneID:1086810   -        BA1468   1388619
                               NC_003997.3
ref|NC_003997.3|:1389302-1389529             GeneID:1086077   -        BA1469   1389302
                               NC_003997.3
ref|NC_003997.3|:c1390611-1389823            GeneID:1086369   -        BA1470   1389823
                               NC_003997.3
ref|NC_003997.3|:c1391739-1390741            GeneID:1087234   -        BA1471   1390741
                               NC_003997.3
ref|NC_003997.3|:c1392371-1391751            GeneID:1086251   -        BA1472   1391751
                               NC_003997.3
ref|NC_003997.3|:1392684-1394705             GeneID:1085723   -        BA1474   1392684
                               NC_003997.3
ref|NC_003997.3|:c1395051-1394824            GeneID:1085571   -        BA1475   1394824
                               NC_003997.3
ref|NC_003997.3|:1398000-1398845             GeneID:1086658   -        BA1479   1398000
                               NC_003997.3
ref|NC_003997.3|:c1399333-1399139            GeneID:1087235   -        BA1480   1399139
                               NC_003997.3
ref|NC_003997.3|:c1399983-1399453            GeneID:1088363   -        BA1481   1399453
                               NC_003997.3
ref|NC_003997.3|:c1402766-1402059            GeneID:1087668   deoD     BA1483   1402059
                               NC_003997.3
ref|NC_003997.3|:1404875-1405648             GeneID:1087407   -        BA1485   1404875
                               NC_003997.3
ref|NC_003997.3|:c1408238-1405653            GeneID:1087361   mprF     BA1486   1405653
                               NC_003997.3
ref|NC_003997.3|:1408836-1409327             GeneID:1087226   -        BA1488   1408836
                               NC_003997.3
ref|NC_003997.3|:1409433-1410347             GeneID:1087225   -        BA1489   1409433
                               NC_003997.3
ref|NC_003997.3|:1410460-1411584             GeneID:1086662   -        BA1490   1410460
                               NC_003997.3
ref|NC_003997.3|:1411577-1412173             GeneID:1086320   spmA     BA1491   1411577
                               NC_003997.3
ref|NC_003997.3|:1412170-1412700             GeneID:1085335   -        BA1492   1412170
                               NC_003997.3
ref|NC_003997.3|:1413813-1414334             GeneID:1086435   resA     BA1494   1413813
                               NC_003997.3
ref|NC_003997.3|:1414456-1416081             GeneID:1086330   resB     BA1495   1414456
                               NC_003997.3
ref|NC_003997.3|:1416096-1417253             GeneID:1087222   resC     BA1496   1416096
                               NC_003997.3
ref|NC_003997.3|:1417556-1418272             GeneID:1087158   resD     BA1497   1417556
                               NC_003997.3
ref|NC_003997.3|:1418272-1420047             GeneID:1086192   resE     BA1498   1418272
                               NC_003997.3
ref|NC_003997.3|:1420185-1420766             GeneID:1086335   -        BA1499   1420185
                               NC_003997.3
ref|NC_003997.3|:1420851-1421465             GeneID:1086924   -        BA1500   1420851
                               NC_003997.3
ref|NC_003997.3|:1425164-1426693             GeneID:1087356   recQ-1   BA1505   1425164
                               NC_003997.3
ref|NC_003997.3|:1426693-1427256             GeneID:1087347   -        BA1506   1426693
                               NC_003997.3
ref|NC_003997.3|:1427279-1427758             GeneID:1086352   -        BA1507       1427279
                               NC_003997.3
ref|NC_003997.3|:1428600-1429475             GeneID:1086310   -        BA1509       1428600
                               NC_003997.3
ref|NC_003997.3|:1429553-1430161             GeneID:1086207   -        BA1510       1429553
                               NC_003997.3
ref|NC_003997.3|:1430430-1431716             GeneID:1086591   gdhA     BA1511       1430430
                               NC_003997.3
ref|NC_003997.3|:1432100-1432333             GeneID:1087221   -        BA1513       1432100
                               NC_003997.3
ref|NC_003997.3|:1432419-1432883             GeneID:1087408   -        BA1514       1432419
                               NC_003997.3
ref|NC_003997.3|:1433053-1434033             GeneID:1086214   -        BA1515       1433053
                               NC_003997.3
ref|NC_003997.3|:c1435045-1434071            GeneID:1087072   ansA-1   BA1516       1434071
                               NC_003997.3
ref|NC_003997.3|:1435527-1436204             GeneID:1087314   cmk      BA1518       1435527
                               NC_003997.3
ref|NC_003997.3|:1436538-1437686             GeneID:1083667   rpsA     BA1519       1436538
                               NC_003997.3
ref|NC_003997.3|:1437699-1438748             GeneID:1086925   -        BA1520       1437699
                               NC_003997.3
ref|NC_003997.3|:1439920-1440813             GeneID:1083982   -        BA1523       1439920
                               NC_003997.3
ref|NC_003997.3|:1441120-1442430             GeneID:1086325   -        BA1525       1441120
                               NC_003997.3
ref|NC_003997.3|:1442449-1443471             GeneID:1086773   gpsA     BA1526       1442449
                               NC_003997.3
ref|NC_003997.3|:1443588-1443839             GeneID:1087002   -        BA1527       1443588
                               NC_003997.3
ref|NC_003997.3|:1444410-1445087             GeneID:1087219   -        BA1529       1444410
                               NC_003997.3
ref|NC_003997.3|:1445330-1446808             GeneID:1087217   spoIVA   BA1530       1445330
                               NC_003997.3
ref|NC_003997.3|:1447107-1447379             GeneID:1086263   hup-1    BA1531       1447107
                               NC_003997.3
ref|NC_003997.3|:1447500-1448069             GeneID:1086534   folE     BA1532       1447500
                               NC_003997.3
ref|NC_003997.3|:1448330-1449034             GeneID:1087208   -        BA1533       1448330
                               NC_003997.3
ref|NC_003997.3|:1449064-1449777             GeneID:1086556   menG     BA1534       1449064
                               NC_003997.3
ref|NC_003997.3|:1449809-1450771             GeneID:1087064   hepT     BA1535       1449809
                               NC_003997.3
ref|NC_003997.3|:1450896-1451342             GeneID:1083673   -        BA1536       1450896
                               NC_003997.3
ref|NC_003997.3|:1451613-1452785             GeneID:1087360   aroF-1   BA1537       1451613
                               NC_003997.3
ref|NC_003997.3|:1452785-1453876             GeneID:1087138   aroB     BA1538       1452785
                               NC_003997.3
ref|NC_003997.3|:1454008-1455120             GeneID:1087402   hisC-1   BA1539       1454008
                               NC_003997.3
ref|NC_003997.3|:1455433-1456695             GeneID:1086326   -        BA1541       1455433
                               NC_003997.3
ref|NC_003997.3|:1456769-1457305             GeneID:1083691   -        BA1542       1456769
                               NC_003997.3
ref|NC_003997.3|:1457459-1457914             GeneID:1086043   -        BA1543       1457459
                               NC_003997.3
ref|NC_003997.3|:1458130-1458570             GeneID:1087085   qcrA     BA1544       1458130
                               NC_003997.3
ref|NC_003997.3|:1458571-1459245             GeneID:1086854   qcrB     BA1545       1458571
                               NC_003997.3
ref|NC_003997.3|:1459289-1460056             GeneID:1087115   qcrC     BA1546       1459289
                               NC_003997.3
ref|NC_003997.3|:1460185-1460769             GeneID:1087403   -        BA1548       1460185
                               NC_003997.3
ref|NC_003997.3|:1460795-1461481             GeneID:1086650   -        BA1549       1460795
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:1461589-1462377             GeneID:1086309   -        BA1550       1461589
                               NC_003997.3
ref|NC_003997.3|:1462490-1463170             GeneID:1083689   -        BA1551       1462490
                               NC_003997.3
ref|NC_003997.3|:1463272-1463913             GeneID:1087216   -        BA1552       1463272
                               NC_003997.3
ref|NC_003997.3|:c1464823-1463942            GeneID:1087218   -        BA1553       1463942
                               NC_003997.3
ref|NC_003997.3|:1465176-1465547             GeneID:1087312   -        BA1554       1465176
                               NC_003997.3
ref|NC_003997.3|:1465547-1466347             GeneID:1086847   dapB     BA1555       1465547
                               NC_003997.3
ref|NC_003997.3|:1466362-1466757             GeneID:1087213   mgsA     BA1556       1466362
                               NC_003997.3
ref|NC_003997.3|:1466769-1467473             GeneID:1087010   -        BA1557       1466769
                               NC_003997.3
ref|NC_003997.3|:1467470-1468615             GeneID:1086392   -        BA1558       1467470
                               NC_003997.3
ref|NC_003997.3|:1468602-1469795             GeneID:1086405   pcnB     BA1559       1468602
                               NC_003997.3
ref|NC_003997.3|:1469780-1470760             GeneID:1085727   birA     BA1560       1469780
                               NC_003997.3
ref|NC_003997.3|:1471657-1472496             GeneID:1084235   panB     BA1562       1471657
                               NC_003997.3
ref|NC_003997.3|:1472493-1473341             GeneID:1086855   panC     BA1563       1472493
                               NC_003997.3
ref|NC_003997.3|:1473354-1473737             GeneID:1086955   panD     BA1564       1473354
                               NC_003997.3
ref|NC_003997.3|:1477099-1477602             GeneID:1086239   -        BA1567       1477099
                               NC_003997.3
ref|NC_003997.3|:1477621-1478808             GeneID:1087215   aspB     BA1568       1477621
                               NC_003997.3
ref|NC_003997.3|:1478930-1479637             GeneID:1086707   dnaD     BA1569       1478930
                               NC_003997.3
ref|NC_003997.3|:c1483539-1480846            GeneID:1086853   -       BA1572   1480846
                               NC_003997.3
ref|NC_003997.3|:c1484207-1483605            GeneID:1086467   recU    BA1573   1483605
                               NC_003997.3
ref|NC_003997.3|:1484311-1485336             GeneID:1087374   -       BA1574   1484311
                               NC_003997.3
ref|NC_003997.3|:1486123-1486467             GeneID:1083821   -       BA1578   1486123
                               NC_003997.3
ref|NC_003997.3|:1486862-1487341             GeneID:1087020   -       BA1580   1486862
                               NC_003997.3
ref|NC_003997.3|:1487496-1487918             GeneID:1084561   -       BA1581   1487496
                               NC_003997.3
ref|NC_003997.3|:1487974-1488528             GeneID:1087220   -       BA1582   1487974
                               NC_003997.3
ref|NC_003997.3|:1488626-1488964             GeneID:1086465   -       BA1583   1488626
                               NC_003997.3
ref|NC_003997.3|:1489623-1490762             GeneID:1085769   -       BA1584   1489623
                               NC_003997.3
ref|NC_003997.3|:1491144-1493081             GeneID:1083701   -       BA1586   1491144
                               NC_003997.3
ref|NC_003997.3|:1493187-1494704             GeneID:1086351   -       BA1587   1493187
                               NC_003997.3
ref|NC_003997.3|:1494750-1495223             GeneID:1087212   -       BA1588   1494750
                               NC_003997.3
ref|NC_003997.3|:1496708-1497454             GeneID:1086469   maP-2   BA1590   1496708
                               NC_003997.3
ref|NC_003997.3|:1497780-1498373             GeneID:1087311   xpt     BA1591   1497780
                               NC_003997.3
ref|NC_003997.3|:1498377-1499699             GeneID:1086474   pbuX    BA1592   1498377
                               NC_003997.3
ref|NC_003997.3|:c1500935-1499772            GeneID:1086463   -       BA1593   1499772
                               NC_003997.3
ref|NC_003997.3|:1501483-1505142             GeneID:1086754   -       BA1595   1501483
                               NC_003997.3
ref|NC_003997.3|:c1505400-1505146            GeneID:1086489   -       BA1596   1505146
                               NC_003997.3
ref|NC_003997.3|:1505473-1505940             GeneID:1086486   -       BA1597   1505473
                               NC_003997.3
ref|NC_003997.3|:1505962-1506234             GeneID:1086481   -       BA1598   1505962
                               NC_003997.3
ref|NC_003997.3|:1506237-1507070             GeneID:1086487   -       BA1599   1506237
                               NC_003997.3
ref|NC_003997.3|:1508283-1508594             GeneID:1086477   -       BA1601   1508283
                               NC_003997.3
ref|NC_003997.3|:1508682-1509833             GeneID:1086483   -       BA1602   1508682
                               NC_003997.3
ref|NC_003997.3|:1509830-1510216             GeneID:1086258   -       BA1603   1509830
                               NC_003997.3
ref|NC_003997.3|:1511765-1512631             GeneID:1086492   -       BA1606   1511765
                               NC_003997.3
ref|NC_003997.3|:1513465-1514658             GeneID:1086495   -       BA1608   1513465
                               NC_003997.3
ref|NC_003997.3|:1514659-1515402             GeneID:1086506   -       BA1609   1514659
                               NC_003997.3
ref|NC_003997.3|:1516708-1518144             GeneID:1086499   -       BA1613   1516708
                               NC_003997.3
ref|NC_003997.3|:1518148-1519362             GeneID:1083722   -       BA1614   1518148
                               NC_003997.3
ref|NC_003997.3|:1519337-1520137             GeneID:1086507   -       BA1615   1519337
                               NC_003997.3
ref|NC_003997.3|:1521260-1522825             GeneID:1087195   -       BA1617   1521260
                               NC_003997.3
ref|NC_003997.3|:c1537990-1522937            GeneID:1083710   -       BA1618   1522937
                               NC_003997.3
ref|NC_003997.3|:1538113-1538973             GeneID:1086269   -       BA1619   1538113
                               NC_003997.3
ref|NC_003997.3|:c1539574-1539014            GeneID:1087160   -       BA1620   1539014
                               NC_003997.3
ref|NC_003997.3|:c1540930-1540019            GeneID:1086271   -       BA1622   1540019
                               NC_003997.3
ref|NC_003997.3|:c1542266-1541394            GeneID:1087181   -       BA1624   1541394
                               NC_003997.3
ref|NC_003997.3|:1543121-1543738             GeneID:1083732   -       BA1626   1543121
                               NC_003997.3
ref|NC_003997.3|:c1544209-1543961            GeneID:1086485   -       BA1628   1543961
                               NC_003997.3
ref|NC_003997.3|:1545657-1546289             GeneID:1083727   -       BA1631   1545657
                               NC_003997.3
ref|NC_003997.3|:1546309-1546602             GeneID:1086631   -       BA1632   1546309
                               NC_003997.3
ref|NC_003997.3|:1546682-1547311             GeneID:1086264   -       BA1633   1546682
                               NC_003997.3
ref|NC_003997.3|:1547879-1549429             GeneID:1087187   -       BA1635   1547879
                               NC_003997.3
ref|NC_003997.3|:1549616-1550968             GeneID:1087186   -       BA1636   1549616
                               NC_003997.3
ref|NC_003997.3|:1551053-1551331             GeneID:1086936   -       BA1638   1551053
                               NC_003997.3
ref|NC_003997.3|:c1552553-1551390            GeneID:1086687   -       BA1639   1551390
                               NC_003997.3
ref|NC_003997.3|:1552885-1554534             GeneID:1086943   -       BA1640   1552885
                               NC_003997.3
ref|NC_003997.3|:1554658-1555488             GeneID:1086232   -       BA1641   1554658
                               NC_003997.3
ref|NC_003997.3|:1555627-1556982             GeneID:1086935   -       BA1642   1555627
                               NC_003997.3
ref|NC_003997.3|:c1557683-1557018            GeneID:1086964   -       BA1643   1557018
                               NC_003997.3
ref|NC_003997.3|:1557904-1558422             GeneID:1086918   -       BA1645   1557904
                               NC_003997.3
ref|NC_003997.3|:1558568-1558885             GeneID:1086927   -       BA1646   1558568
                               NC_003997.3
ref|NC_003997.3|:1559158-1559892             GeneID:1086938   -       BA1647   1559158
                               NC_003997.3
ref|NC_003997.3|:c1561365-1560640            GeneID:1087178   -        BA1649       1560640
                               NC_003997.3
ref|NC_003997.3|:c1564522-1563308            GeneID:1087182   -        BA1652       1563308
                               NC_003997.3
ref|NC_003997.3|:1565523-1565741             GeneID:1086252   -        BA1655       1565523
                               NC_003997.3
ref|NC_003997.3|:c1566613-1566011            GeneID:1087253   -        BA1657       1566011
                               NC_003997.3
ref|NC_003997.3|:1566854-1567618             GeneID:1086246   -        BA1658       1566854
                               NC_003997.3
ref|NC_003997.3|:1567641-1568318             GeneID:1087125   -        BA1659       1567641
                               NC_003997.3
ref|NC_003997.3|:1568469-1568837             GeneID:1083740   -        BA1660       1568469
                               NC_003997.3
ref|NC_003997.3|:1571143-1572783             GeneID:1086225   -        BA1662       1571143
                               NC_003997.3
ref|NC_003997.3|:1572813-1574165             GeneID:1087175   -        BA1663       1572813
                               NC_003997.3
ref|NC_003997.3|:1574193-1574909             GeneID:1086956   -        BA1664       1574193
                               NC_003997.3
ref|NC_003997.3|:c1575725-1574943            GeneID:1087180   cheR     BA1665       1574943
                               NC_003997.3
ref|NC_003997.3|:c1576261-1575770            GeneID:1086946   -        BA1666       1575770
                               NC_003997.3
ref|NC_003997.3|:1576405-1576869             GeneID:1086968   -        BA1667       1576405
                               NC_003997.3
ref|NC_003997.3|:1576886-1577338             GeneID:1086951   -        BA1668       1576886
                               NC_003997.3
ref|NC_003997.3|:1581476-1581748             GeneID:1086950   -        BA1673       1581476
                               NC_003997.3
ref|NC_003997.3|:1582118-1582525             GeneID:1086220   flgB     BA1674       1582118
                               NC_003997.3
ref|NC_003997.3|:1582546-1582959             GeneID:1087169   flgC     BA1675       1582546
                               NC_003997.3
ref|NC_003997.3|:1582976-1583275             GeneID:1086954   -        BA1676       1582976
                               NC_003997.3
ref|NC_003997.3|:1584882-1585886             GeneID:1087174   fliG     BA1679       1584882
                               NC_003997.3
ref|NC_003997.3|:1585873-1586559             GeneID:1086990   -        BA1680       1585873
                               NC_003997.3
ref|NC_003997.3|:1586556-1587860             GeneID:1086211   -        BA1681       1586556
                               NC_003997.3
ref|NC_003997.3|:1589515-1590087             GeneID:1087168   -        BA1685       1589515
                               NC_003997.3
ref|NC_003997.3|:1590109-1591422             GeneID:1086218   -        BA1686       1590109
                               NC_003997.3
ref|NC_003997.3|:1591472-1591810             GeneID:1084523   -        BA1687       1591472
                               NC_003997.3
ref|NC_003997.3|:1594271-1595218             GeneID:1086313   -        BA1692       1594271
                               NC_003997.3
ref|NC_003997.3|:1607990-1608775             GeneID:1086265   -        BA1707       1607990
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:1610076-1610435             GeneID:1086519   -        BA1710       1610076
                               NC_003997.3
ref|NC_003997.3|:1610448-1610768             GeneID:1083753   -        BA1711       1610448
                               NC_003997.3
ref|NC_003997.3|:1610765-1611523             GeneID:1087166   -        BA1712       1610765
                               NC_003997.3
ref|NC_003997.3|:1611557-1611832             GeneID:1086517   -        BA1713       1611557
                               NC_003997.3
ref|NC_003997.3|:1611848-1612609             GeneID:1086529   fliR     BA1714       1611848
                               NC_003997.3
ref|NC_003997.3|:1612620-1613666             GeneID:1087116   -        BA1715       1612620
                               NC_003997.3
ref|NC_003997.3|:1617121-1617894             GeneID:1086186   -        BA1719       1617121
                               NC_003997.3
ref|NC_003997.3|:1618012-1618722             GeneID:1083755   -        BA1720       1618012
                               NC_003997.3
ref|NC_003997.3|:1618740-1619576             GeneID:1086527   -        BA1721       1618740
                               NC_003997.3
ref|NC_003997.3|:1619569-1620294             GeneID:1086544   -        BA1722       1619569
                               NC_003997.3
ref|NC_003997.3|:1620285-1620596             GeneID:1087155   -        BA1723       1620285
                               NC_003997.3
ref|NC_003997.3|:c1622884-1622279            GeneID:1086528   -        BA1727       1622279
                               NC_003997.3
ref|NC_003997.3|:c1623590-1623411            GeneID:1086835   -        BA1729       1623411
                               NC_003997.3
ref|NC_003997.3|:c1624868-1623657            GeneID:1086536   -        BA1730       1623657
                               NC_003997.3
ref|NC_003997.3|:1624988-1626256             GeneID:1086749   -        BA1731       1624988
                               NC_003997.3
ref|NC_003997.3|:1626362-1626889             GeneID:1086316   -        BA1732       1626362
                               NC_003997.3
ref|NC_003997.3|:c1627823-1626930            GeneID:1083759   -        BA1733       1626930
                               NC_003997.3
ref|NC_003997.3|:1627986-1628942             GeneID:1086193   -        BA1734       1627986
                               NC_003997.3
ref|NC_003997.3|:1628955-1629980             GeneID:1087255   -        BA1735       1628955
                               NC_003997.3
ref|NC_003997.3|:1629993-1631663             GeneID:1087146   -        BA1736       1629993
                               NC_003997.3
ref|NC_003997.3|:1632943-1633776             GeneID:1086297   -        BA1738       1632943
                               NC_003997.3
ref|NC_003997.3|:1637471-1638046             GeneID:1086533   -        BA1745       1637471
                               NC_003997.3
ref|NC_003997.3|:1638136-1638507             GeneID:1086551   -        BA1746       1638136
                               NC_003997.3
ref|NC_003997.3|:c1639386-1638526            GeneID:1087147   -        BA1747       1638526
                               NC_003997.3
ref|NC_003997.3|:c1642976-1641153            GeneID:1085719   asnO-2   BA1751       1641153
                               NC_003997.3
ref|NC_003997.3|:1643241-1643807             GeneID:1083758   -        BA1753   1643241
                               NC_003997.3
ref|NC_003997.3|:1643804-1644904             GeneID:1086545   -        BA1754   1643804
                               NC_003997.3
ref|NC_003997.3|:c1645996-1644944            GeneID:1086550   -        BA1755   1644944
                               NC_003997.3
ref|NC_003997.3|:1646208-1647107             GeneID:1087141   -        BA1756   1646208
                               NC_003997.3
ref|NC_003997.3|:c1648199-1647528            GeneID:1086546   -        BA1758   1647528
                               NC_003997.3
ref|NC_003997.3|:c1649184-1648216            GeneID:1086541   -        BA1759   1648216
                               NC_003997.3
ref|NC_003997.3|:c1650554-1649367            GeneID:1087406   -        BA1760   1649367
                               NC_003997.3
ref|NC_003997.3|:1650742-1651719             GeneID:1086554   -        BA1762   1650742
                               NC_003997.3
ref|NC_003997.3|:1651733-1652605             GeneID:1085098   -        BA1763   1651733
                               NC_003997.3
ref|NC_003997.3|:1653710-1655113             GeneID:1087140   nhaC-2   BA1766   1653710
                               NC_003997.3
ref|NC_003997.3|:1655369-1656757             GeneID:1086574   fumC     BA1767   1655369
                               NC_003997.3
ref|NC_003997.3|:1657956-1658720             GeneID:1087097   -        BA1770   1657956
                               NC_003997.3
ref|NC_003997.3|:c1660982-1660284            GeneID:1083764   -        BA1774   1660284
                               NC_003997.3
ref|NC_003997.3|:1662300-1663112             GeneID:1087126   -        BA1777   1662300
                               NC_003997.3
ref|NC_003997.3|:1663166-1663879             GeneID:1086300   ccdA-1   BA1778   1663166
                               NC_003997.3
ref|NC_003997.3|:1664470-1665150             GeneID:1087108   -        BA1780   1664470
                               NC_003997.3
ref|NC_003997.3|:c1665746-1665201            GeneID:1086561   -        BA1781   1665201
                               NC_003997.3
ref|NC_003997.3|:1667802-1669142             GeneID:1086573   dsdA     BA1784   1667802
                               NC_003997.3
ref|NC_003997.3|:1669333-1670535             GeneID:1086579   -        BA1785   1669333
                               NC_003997.3
ref|NC_003997.3|:c1671522-1670566            GeneID:1087128   -        BA1786   1670566
                               NC_003997.3
ref|NC_003997.3|:c1672589-1671519            GeneID:1086350   -        BA1787   1671519
                               NC_003997.3
ref|NC_003997.3|:c1673026-1672586            GeneID:1086567   -        BA1788   1672586
                               NC_003997.3
ref|NC_003997.3|:c1673505-1673023            GeneID:1086555   -        BA1789   1673023
                               NC_003997.3
ref|NC_003997.3|:1673789-1674427             GeneID:1086966   -        BA1791   1673789
                               NC_003997.3
ref|NC_003997.3|:1674432-1675538             GeneID:1087124   -        BA1792   1674432
                               NC_003997.3
ref|NC_003997.3|:1675656-1676594             GeneID:1086190   -        BA1793   1675656
                               NC_003997.3
ref|NC_003997.3|:1678990-1680207             GeneID:1087120   -        BA1796   1678990
                               NC_003997.3
ref|NC_003997.3|:c1681005-1680262            GeneID:1086122   pyrH     BA1797   1680262
                               NC_003997.3
ref|NC_003997.3|:1681380-1682651             GeneID:1087163   -        BA1799   1681380
                               NC_003997.3
ref|NC_003997.3|:1684170-1685903             GeneID:1086234   ykwA     BA1801   1684170
                               NC_003997.3
ref|NC_003997.3|:1685969-1687267             GeneID:1087135   -        BA1802   1685969
                               NC_003997.3
ref|NC_003997.3|:1687270-1688202             GeneID:1087123   -        BA1803   1687270
                               NC_003997.3
ref|NC_003997.3|:c1692487-1692263            GeneID:1087119   -        BA1807   1692263
                               NC_003997.3
ref|NC_003997.3|:1692475-1693458             GeneID:1086656   asnA     BA1808   1692475
                               NC_003997.3
ref|NC_003997.3|:c1694867-1694412            GeneID:1087113   -        BA1810   1694412
                               NC_003997.3
ref|NC_003997.3|:c1696446-1695217            GeneID:1086577   dapG-1   BA1811   1695217
                               NC_003997.3
ref|NC_003997.3|:1698542-1700167             GeneID:1086163   -        BA1815   1698542
                               NC_003997.3
ref|NC_003997.3|:1707734-1708498             GeneID:1086969   -        BA1823   1707734
                               NC_003997.3
ref|NC_003997.3|:c1711065-1710082            GeneID:1086168   -        BA1826   1710082
                               NC_003997.3
ref|NC_003997.3|:1712278-1713537             GeneID:1086704   -        BA1828   1712278
                               NC_003997.3
ref|NC_003997.3|:1715465-1716676             GeneID:1086175   fsR      BA1830   1715465
                               NC_003997.3
ref|NC_003997.3|:1716687-1717604             GeneID:1086158   cysK-2   BA1831   1716687
                               NC_003997.3
ref|NC_003997.3|:1717681-1718193             GeneID:1086171   -        BA1832   1717681
                               NC_003997.3
ref|NC_003997.3|:1721530-1722867             GeneID:1086411   -        BA1835   1721530
                               NC_003997.3
ref|NC_003997.3|:c1723611-1722907            GeneID:1086408   -        BA1836   1722907
                               NC_003997.3
ref|NC_003997.3|:1723942-1724205             GeneID:1087112   -        BA1837   1723942
                               NC_003997.3
ref|NC_003997.3|:1724386-1725072             GeneID:1085484   -        BA1838   1724386
                               NC_003997.3
ref|NC_003997.3|:1725183-1725824             GeneID:1087107   -        BA1840   1725183
                               NC_003997.3
ref|NC_003997.3|:1727710-1728171             GeneID:1086979   -        BA1843   1727710
                               NC_003997.3
ref|NC_003997.3|:c1729262-1728726            GeneID:1086700   msrA-1   BA1846   1728726
                               NC_003997.3
ref|NC_003997.3|:1731076-1731975             GeneID:1086756   ilvE-2   BA1849   1731076
                               NC_003997.3
ref|NC_003997.3|:1731998-1733710             GeneID:1083783   ilvB-2   BA1850   1731998
                               NC_003997.3
ref|NC_003997.3|:1733934-1734941             GeneID:1086430   ilvC-2   BA1852       1733934
                               NC_003997.3
ref|NC_003997.3|:1734988-1736661             GeneID:1086447   ilvD     BA1853       1734988
                               NC_003997.3
ref|NC_003997.3|:1736693-1737955             GeneID:1087106   ilvA     BA1854       1736693
                               NC_003997.3
ref|NC_003997.3|:c1739419-1738316            GeneID:1086157   -        BA1855       1738316
                               NC_003997.3
ref|NC_003997.3|:1739632-1740348             GeneID:1083810   -        BA1856       1739632
                               NC_003997.3
ref|NC_003997.3|:1740352-1741215             GeneID:1087157   -        BA1857       1740352
                               NC_003997.3
ref|NC_003997.3|:1741383-1742597             GeneID:1087100   -        BA1858       1741383
                               NC_003997.3
ref|NC_003997.3|:c1743407-1742646            GeneID:1086648   -        BA1859       1742646
                               NC_003997.3
ref|NC_003997.3|:1744958-1745602             GeneID:1086647   -        BA1861       1744958
                               NC_003997.3
ref|NC_003997.3|:1745730-1747244             GeneID:1086998   -        BA1862       1745730
                               NC_003997.3
ref|NC_003997.3|:1747455-1747898             GeneID:1087102   -        BA1863       1747455
                               NC_003997.3
ref|NC_003997.3|:1748357-1749664             GeneID:1087118   -        BA1865       1748357
                               NC_003997.3
ref|NC_003997.3|:c1750906-1749818            GeneID:1086148   -        BA1866       1749818
                               NC_003997.3
ref|NC_003997.3|:1754487-1754867             GeneID:1083800   -        BA1872       1754487
                               NC_003997.3
ref|NC_003997.3|:1755197-1757242             GeneID:1086142   -        BA1874       1755197
                               NC_003997.3
ref|NC_003997.3|:1757530-1758663             GeneID:1087422   -        BA1875       1757530
                               NC_003997.3
ref|NC_003997.3|:c1759311-1758781            GeneID:1086152   -        BA1876       1758781
                               NC_003997.3
ref|NC_003997.3|:1759454-1760152             GeneID:1087421   -        BA1877       1759454
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:1761364-1762152             GeneID:1087162   -        BA1879       1761364
                               NC_003997.3
ref|NC_003997.3|:c1763506-1762211            GeneID:1086376   -        BA1880       1762211
                               NC_003997.3
ref|NC_003997.3|:1763983-1764942             GeneID:1086844   -        BA1881       1763983
                               NC_003997.3
ref|NC_003997.3|:c1766563-1765184            GeneID:1087098   -        BA1882       1765184
                               NC_003997.3
ref|NC_003997.3|:1766834-1767778             GeneID:1083814   -        BA1884       1766834
                               NC_003997.3
ref|NC_003997.3|:1770811-1771971             GeneID:1087424   -        BA1887       1770811
                               NC_003997.3
ref|NC_003997.3|:1772003-1773211             GeneID:1086941   -        BA1888       1772003
                               NC_003997.3
ref|NC_003997.3|:1774632-1775258             GeneID:1087153   -        BA1890       1774632
                               NC_003997.3
ref|NC_003997.3|:1775616-1776563             GeneID:1087420   -        BA1891       1775616
                               NC_003997.3
ref|NC_003997.3|:1776869-1777540             GeneID:1086144   dra      BA1892       1776869
                               NC_003997.3
ref|NC_003997.3|:1777643-1778824             GeneID:1086129   -        BA1893       1777643
                               NC_003997.3
ref|NC_003997.3|:1778861-1780162             GeneID:1086440   pyn-1    BA1894       1778861
                               NC_003997.3
ref|NC_003997.3|:1780196-1780591             GeneID:1083735   cdd-1    BA1895       1780196
                               NC_003997.3
ref|NC_003997.3|:c1781126-1780896            GeneID:1086372   -        BA1897       1780896
                               NC_003997.3
ref|NC_003997.3|:1784282-1785565             GeneID:1087091   -        BA1901       1784282
                               NC_003997.3
ref|NC_003997.3|:1785683-1787338             GeneID:1086134   -        BA1902       1785683
                               NC_003997.3
ref|NC_003997.3|:c1790364-1789819            GeneID:1086102   -        BA1904       1789819
                               NC_003997.3
ref|NC_003997.3|:1790698-1792842             GeneID:1086238   topB-2   BA1905       1790698
                               NC_003997.3
ref|NC_003997.3|:1793111-1794358             GeneID:1086609   -        BA1906       1793111
                               NC_003997.3
ref|NC_003997.3|:c1795450-1794485            GeneID:1086395   -        BA1907       1794485
                               NC_003997.3
ref|NC_003997.3|:1795810-1796436             GeneID:1087092   acpD     BA1908       1795810
                               NC_003997.3
ref|NC_003997.3|:1798117-1798536             GeneID:1085266   -        BA1910       1798117
                               NC_003997.3
ref|NC_003997.3|:1798881-1800515             GeneID:1086141   -        BA1912       1798881
                               NC_003997.3
ref|NC_003997.3|:1800628-1801248             GeneID:1087365   -        BA1913       1800628
                               NC_003997.3
ref|NC_003997.3|:c1803246-1802341            GeneID:1087054   -        BA1915       1802341
                               NC_003997.3
ref|NC_003997.3|:1803344-1804213             GeneID:1086137   -        BA1916       1803344
                               NC_003997.3
ref|NC_003997.3|:1804334-1804765             GeneID:1086112   -        BA1917       1804334
                               NC_003997.3
ref|NC_003997.3|:1804837-1805487             GeneID:1087090   -        BA1918       1804837
                               NC_003997.3
ref|NC_003997.3|:1805545-1806147             GeneID:1087093   -        BA1919       1805545
                               NC_003997.3
ref|NC_003997.3|:1806517-1808127             GeneID:1087378   -        BA1921       1806517
                               NC_003997.3
ref|NC_003997.3|:1808306-1809319             GeneID:1087094   -        BA1922       1808306
                               NC_003997.3
ref|NC_003997.3|:c1810319-1809375            GeneID:1086286   ldh      BA1923       1809375
                               NC_003997.3
ref|NC_003997.3|:1810521-1811957             GeneID:1085964   -        BA1924       1810521
                               NC_003997.3
ref|NC_003997.3|:1812061-1812984             GeneID:1087088   -        BA1925   1812061
                               NC_003997.3
ref|NC_003997.3|:1818181-1819368             GeneID:1086110   -        BA1931   1818181
                               NC_003997.3
ref|NC_003997.3|:1819458-1820231             GeneID:1087087   -        BA1933   1819458
                               NC_003997.3
ref|NC_003997.3|:1820932-1821792             GeneID:1087086   -        BA1935   1820932
                               NC_003997.3
ref|NC_003997.3|:1821794-1822795             GeneID:1083840   -        BA1936   1821794
                               NC_003997.3
ref|NC_003997.3|:c1823645-1822857            GeneID:1086117   -        BA1937   1822857
                               NC_003997.3
ref|NC_003997.3|:1823766-1824314             GeneID:1086065   -        BA1938   1823766
                               NC_003997.3
ref|NC_003997.3|:1825165-1825608             GeneID:1086066   -        BA1941   1825165
                               NC_003997.3
ref|NC_003997.3|:1825729-1826784             GeneID:1086091   -        BA1942   1825729
                               NC_003997.3
ref|NC_003997.3|:1827402-1828805             GeneID:1087490   cydA-1   BA1943   1827402
                               NC_003997.3
ref|NC_003997.3|:1829808-1831523             GeneID:1086958   -        BA1945   1829808
                               NC_003997.3
ref|NC_003997.3|:1831526-1833250             GeneID:1083879   -        BA1946   1831526
                               NC_003997.3
ref|NC_003997.3|:1833483-1833761             GeneID:1086048   -        BA1947   1833483
                               NC_003997.3
ref|NC_003997.3|:1833852-1834298             GeneID:1086067   -        BA1948   1833852
                               NC_003997.3
ref|NC_003997.3|:1835590-1836447             GeneID:1086607   -        BA1950   1835590
                               NC_003997.3
ref|NC_003997.3|:1836695-1837294             GeneID:1086055   -        BA1951   1836695
                               NC_003997.3
ref|NC_003997.3|:1838210-1839472             GeneID:1087062   -        BA1952   1838210
                               NC_003997.3
ref|NC_003997.3|:c1840335-1839571            GeneID:1085967   -        BA1953   1839571
                               NC_003997.3
ref|NC_003997.3|:1842416-1843102             GeneID:1085997   -        BA1955   1842416
                               NC_003997.3
ref|NC_003997.3|:1843117-1844172             GeneID:1085980   -        BA1956   1843117
                               NC_003997.3
ref|NC_003997.3|:1844971-1845699             GeneID:1086081   fabG     BA1958   1844971
                               NC_003997.3
ref|NC_003997.3|:1846070-1846942             GeneID:1087067   -        BA1960   1846070
                               NC_003997.3
ref|NC_003997.3|:1847060-1847887             GeneID:1087084   -        BA1961   1847060
                               NC_003997.3
ref|NC_003997.3|:1848088-1848297             GeneID:1086923   -        BA1963   1848088
                               NC_003997.3
ref|NC_003997.3|:c1848953-1848345            GeneID:1083883   -        BA1964   1848345
                               NC_003997.3
ref|NC_003997.3|:1849037-1849675             GeneID:1085936   -        BA1965   1849037
                               NC_003997.3
ref|NC_003997.3|:1850639-1851934             GeneID:1086602   hom-1    BA1968   1850639
                               NC_003997.3
ref|NC_003997.3|:1851927-1852985             GeneID:1085983   thrC     BA1969   1851927
                               NC_003997.3
ref|NC_003997.3|:1852982-1853875             GeneID:1085942   thrB     BA1970   1852982
                               NC_003997.3
ref|NC_003997.3|:1854421-1856718             GeneID:1083908   -        BA1972   1854421
                               NC_003997.3
ref|NC_003997.3|:1856923-1857924             GeneID:1085975   -        BA1973   1856923
                               NC_003997.3
ref|NC_003997.3|:1858084-1859331             GeneID:1085961   -        BA1974   1858084
                               NC_003997.3
ref|NC_003997.3|:1859345-1860034             GeneID:1085933   -        BA1975   1859345
                               NC_003997.3
ref|NC_003997.3|:1860031-1861392             GeneID:1086078   -        BA1976   1860031
                               NC_003997.3
ref|NC_003997.3|:1861493-1862314             GeneID:1086062   -        BA1977   1861493
                               NC_003997.3
ref|NC_003997.3|:1862329-1862985             GeneID:1086073   -        BA1978   1862329
                               NC_003997.3
ref|NC_003997.3|:1863145-1863825             GeneID:1087058   -        BA1979   1863145
                               NC_003997.3
ref|NC_003997.3|:1863923-1864444             GeneID:1087065   -        BA1980   1863923
                               NC_003997.3
ref|NC_003997.3|:1864729-1866537             GeneID:1085941   -        BA1981   1864729
                               NC_003997.3
ref|NC_003997.3|:1866596-1868434             GeneID:1083942   -        BA1982   1866596
                               NC_003997.3
ref|NC_003997.3|:1868421-1869659             GeneID:1085953   -        BA1983   1868421
                               NC_003997.3
ref|NC_003997.3|:1869656-1869931             GeneID:1085887   -        BA1984   1869656
                               NC_003997.3
ref|NC_003997.3|:1869955-1870938             GeneID:1085949   -        BA1985   1869955
                               NC_003997.3
ref|NC_003997.3|:1870976-1871818             GeneID:1085888   -        BA1986   1870976
                               NC_003997.3
ref|NC_003997.3|:c1874263-1873649            GeneID:1085885   -        BA1989   1873649
                               NC_003997.3
ref|NC_003997.3|:c1875640-1874675            GeneID:1085956   -        BA1992   1874675
                               NC_003997.3
ref|NC_003997.3|:1878487-1878948             GeneID:1086304   -        BA1997   1878487
                               NC_003997.3
ref|NC_003997.3|:c1879813-1878995            GeneID:1087061   nadE     BA1998   1878995
                               NC_003997.3
ref|NC_003997.3|:1882078-1882365             GeneID:1085957   -        BA2000   1882078
                               NC_003997.3
ref|NC_003997.3|:1882640-1883590             GeneID:1083955   -        BA2001   1882640
                               NC_003997.3
ref|NC_003997.3|:1884047-1884982             GeneID:1085886   -        BA2003   1884047
                               NC_003997.3
ref|NC_003997.3|:c1886844-1886548            GeneID:1085935   -        BA2005   1886548
                               NC_003997.3
ref|NC_003997.3|:c1887204-1886857            GeneID:1085895   -        BA2006       1886857
                               NC_003997.3
ref|NC_003997.3|:1888063-1889157             GeneID:1083941   -        BA2008       1888063
                               NC_003997.3
ref|NC_003997.3|:1889362-1891344             GeneID:1087056   -        BA2009       1889362
                               NC_003997.3
ref|NC_003997.3|:c1893540-1892500            GeneID:1087048   -        BA2012       1892500
                               NC_003997.3
ref|NC_003997.3|:1893782-1894225             GeneID:1085881   dpS      BA2013       1893782
                               NC_003997.3
ref|NC_003997.3|:c1897003-1896002            GeneID:1085871   -        BA2016       1896002
                               NC_003997.3
ref|NC_003997.3|:1897493-1898941             GeneID:1085853   -        BA2018       1897493
                               NC_003997.3
ref|NC_003997.3|:1899026-1899610             GeneID:1085861   -        BA2019       1899026
                               NC_003997.3
ref|NC_003997.3|:c1900537-1899635            GeneID:1085838   -        BA2020       1899635
                               NC_003997.3
ref|NC_003997.3|:1900703-1901653             GeneID:1085839   -        BA2021       1900703
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c1902222-1901752            GeneID:1087050   -        BA2022       1901752
                               NC_003997.3
ref|NC_003997.3|:c1910879-1909929            GeneID:1085851   -        BA2035       1909929
                               NC_003997.3
ref|NC_003997.3|:1911412-1912071             GeneID:1085872   -        BA2037       1911412
                               NC_003997.3
ref|NC_003997.3|:c1913138-1912101            GeneID:1085848   -        BA2038       1912101
                               NC_003997.3
ref|NC_003997.3|:1913733-1914746             GeneID:1085864   -        BA2040       1913733
                               NC_003997.3
ref|NC_003997.3|:1914823-1916484             GeneID:1085845   -        BA2041       1914823
                               NC_003997.3
ref|NC_003997.3|:1916543-1916959             GeneID:1085842   fosB-1   BA2042       1916543
                               NC_003997.3
ref|NC_003997.3|:1917659-1918141             GeneID:1085844   -        BA2044       1917659
                               NC_003997.3
ref|NC_003997.3|:c1918746-1918186            GeneID:1086932   -        BA2045       1918186
                               NC_003997.3
ref|NC_003997.3|:1918928-1920004             GeneID:1085852   cotH     BA2046       1918928
                               NC_003997.3
ref|NC_003997.3|:1920110-1920727             GeneID:1085843   -        BA2047       1920110
                               NC_003997.3
ref|NC_003997.3|:1920832-1921434             GeneID:1086592   -        BA2048       1920832
                               NC_003997.3
ref|NC_003997.3|:1923101-1924042             GeneID:1083991   -        BA2050       1923101
                               NC_003997.3
ref|NC_003997.3|:1924241-1925137             GeneID:1085859   -        BA2051       1924241
                               NC_003997.3
ref|NC_003997.3|:1925141-1926010             GeneID:1083683   -        BA2052       1925141
                               NC_003997.3
ref|NC_003997.3|:1928946-1929125             GeneID:1085826   -        BA2056       1928946
                               NC_003997.3
ref|NC_003997.3|:1929227-1929847             GeneID:1084003   -        BA2057       1929227
                               NC_003997.3
ref|NC_003997.3|:c1931663-1930356            GeneID:1087041   -        BA2059       1930356
                               NC_003997.3
ref|NC_003997.3|:c1932741-1931872            GeneID:1083684   -        BA2060       1931872
                               NC_003997.3
ref|NC_003997.3|:1932918-1933565             GeneID:1087034   -        BA2061       1932918
                               NC_003997.3
ref|NC_003997.3|:1934004-1935341             GeneID:1085835   brnQ-4   BA2063       1934004
                               NC_003997.3
ref|NC_003997.3|:1935755-1936282             GeneID:1087572   -        BA2065       1935755
                               NC_003997.3
ref|NC_003997.3|:1936951-1938105             GeneID:1085832   spoIIP   BA2068       1936951
                               NC_003997.3
ref|NC_003997.3|:1938329-1938826             GeneID:1085820   -        BA2069       1938329
                               NC_003997.3
ref|NC_003997.3|:1938838-1939578             GeneID:1085827   -        BA2070       1938838
                               NC_003997.3
ref|NC_003997.3|:1940233-1941708             GeneID:1085819   -        BA2072       1940233
                               NC_003997.3
ref|NC_003997.3|:1943251-1943679             GeneID:1085825   -        BA2074       1943251
                               NC_003997.3
ref|NC_003997.3|:1943682-1944647             GeneID:1085808   -        BA2075       1943682
                               NC_003997.3
ref|NC_003997.3|:1944754-1945344             GeneID:1085812   -        BA2076       1944754
                               NC_003997.3
ref|NC_003997.3|:c1946596-1946135            GeneID:1087036   -        BA2078       1946135
                               NC_003997.3
ref|NC_003997.3|:1946768-1947943             GeneID:1087070   dal-2    BA2079       1946768
                               NC_003997.3
ref|NC_003997.3|:c1949557-1948670            GeneID:1086677   -        BA2081       1948670
                               NC_003997.3
ref|NC_003997.3|:c1950459-1949581            GeneID:1085828   -        BA2082       1949581
                               NC_003997.3
ref|NC_003997.3|:1950847-1952055             GeneID:1085824   -        BA2083       1950847
                               NC_003997.3
ref|NC_003997.3|:1952223-1953068             GeneID:1086589   -        BA2084       1952223
                               NC_003997.3
ref|NC_003997.3|:1957109-1957666             GeneID:1087563   -        BA2089       1957109
                               NC_003997.3
ref|NC_003997.3|:1957755-1958240             GeneID:1087281   -        BA2091       1957755
                               NC_003997.3
ref|NC_003997.3|:1961864-1962289             GeneID:1087028   -        BA2101       1961864
                               NC_003997.3
ref|NC_003997.3|:1962480-1963217             GeneID:1087734   -        BA2102       1962480
                               NC_003997.3
ref|NC_003997.3|:1963269-1963589             GeneID:1087638   -        BA2103       1963269
                               NC_003997.3
ref|NC_003997.3|:c1964206-1963901            GeneID:1085789   -        BA2105       1963901
                               NC_003997.3
ref|NC_003997.3|:1964527-1965156             GeneID:1085797   -        BA2106   1964527
                               NC_003997.3
ref|NC_003997.3|:1965220-1966908             GeneID:1085010   fhs      BA2107   1965220
                               NC_003997.3
ref|NC_003997.3|:1967546-1968715             GeneID:1085806   -        BA2109   1967546
                               NC_003997.3
ref|NC_003997.3|:1968858-1969304             GeneID:1085799   -        BA2110   1968858
                               NC_003997.3
ref|NC_003997.3|:1969360-1969743             GeneID:1085814   -        BA2111   1969360
                               NC_003997.3
ref|NC_003997.3|:c1970427-1969789            GeneID:1085796   -        BA2112   1969789
                               NC_003997.3
ref|NC_003997.3|:c1971443-1970457            GeneID:1085801   qor-1    BA2113   1970457
                               NC_003997.3
ref|NC_003997.3|:1971649-1972227             GeneID:1087026   -        BA2114   1971649
                               NC_003997.3
ref|NC_003997.3|:1972224-1972904             GeneID:1085786   -        BA2115   1972224
                               NC_003997.3
ref|NC_003997.3|:c1973420-1972962            GeneID:1085784   -        BA2116   1972962
                               NC_003997.3
ref|NC_003997.3|:c1974771-1974550            GeneID:1085785   -        BA2118   1974550
                               NC_003997.3
ref|NC_003997.3|:1974985-1975467             GeneID:1087428   bsaA     BA2119   1974985
                               NC_003997.3
ref|NC_003997.3|:c1977779-1975551            GeneID:1087759   -        BA2120   1975551
                               NC_003997.3
ref|NC_003997.3|:c1979880-1978990            GeneID:1087411   -        BA2122   1978990
                               NC_003997.3
ref|NC_003997.3|:1981682-1985365             GeneID:1087257   narG     BA2125   1981682
                               NC_003997.3
ref|NC_003997.3|:1985469-1986830             GeneID:1087027   narH     BA2126   1985469
                               NC_003997.3
ref|NC_003997.3|:1986850-1987380             GeneID:1087765   narJ     BA2127   1986850
                               NC_003997.3
ref|NC_003997.3|:1987398-1988087             GeneID:1085822   narI     BA2128   1987398
                               NC_003997.3
ref|NC_003997.3|:c1991368-1990688            GeneID:1085777   -        BA2132   1990688
                               NC_003997.3
ref|NC_003997.3|:1991659-1992672             GeneID:1087021   narA-1   BA2133   1991659
                               NC_003997.3
ref|NC_003997.3|:1992690-1993703             GeneID:1085802   -        BA2134   1992690
                               NC_003997.3
ref|NC_003997.3|:1993746-1995035             GeneID:1086256   moeA-1   BA2135   1993746
                               NC_003997.3
ref|NC_003997.3|:1995080-1995550             GeneID:1085742   moaE-1   BA2136   1995080
                               NC_003997.3
ref|NC_003997.3|:1995861-1997030             GeneID:1085756   narK     BA2138   1995861
                               NC_003997.3
ref|NC_003997.3|:1997382-1998299             GeneID:1087019   -        BA2139   1997382
                               NC_003997.3
ref|NC_003997.3|:1998623-1999000             GeneID:1087015   -        BA2140   1998623
                               NC_003997.3
ref|NC_003997.3|:c1999664-1999191            GeneID:1085778   -        BA2142   1999191
                               NC_003997.3
ref|NC_003997.3|:c2000367-1999657            GeneID:1085779   -        BA2143   1999657
                               NC_003997.3
ref|NC_003997.3|:c2001788-2000364            GeneID:1085795   -        BA2144   2000364
                               NC_003997.3
ref|NC_003997.3|:c2002170-2001814            GeneID:1087756   nirD     BA2145   2001814
                               NC_003997.3
ref|NC_003997.3|:c2004591-2002186            GeneID:1085758   nirB     BA2146   2002186
                               NC_003997.3
ref|NC_003997.3|:c2005510-2004803            GeneID:1087359   scdA     BA2147   2004803
                               NC_003997.3
ref|NC_003997.3|:2008024-2008260             GeneID:1085761   -        BA2151   2008024
                               NC_003997.3
ref|NC_003997.3|:c2009195-2008356            GeneID:1085741   -        BA2152   2008356
                               NC_003997.3
ref|NC_003997.3|:2009746-2011347             GeneID:1087023   -        BA2153   2009746
                               NC_003997.3
ref|NC_003997.3|:2013305-2013631             GeneID:1085767   -        BA2159   2013305
                               NC_003997.3
ref|NC_003997.3|:c2014984-2014238            GeneID:1085753   -        BA2162   2014238
                               NC_003997.3
ref|NC_003997.3|:2015094-2015741             GeneID:1085745   -        BA2163   2015094
                               NC_003997.3
ref|NC_003997.3|:2015738-2017633             GeneID:1085744   -        BA2164   2015738
                               NC_003997.3
ref|NC_003997.3|:2018959-2019297             GeneID:1085755   ssb-2    BA2168   2018959
                               NC_003997.3
ref|NC_003997.3|:2021406-2022533             GeneID:1085749   -        BA2171   2021406
                               NC_003997.3
ref|NC_003997.3|:2022537-2022920             GeneID:1086306   -        BA2172   2022537
                               NC_003997.3
ref|NC_003997.3|:2023004-2023438             GeneID:1085740   -        BA2173   2023004
                               NC_003997.3
ref|NC_003997.3|:2023488-2024264             GeneID:1083745   -        BA2174   2023488
                               NC_003997.3
ref|NC_003997.3|:2026380-2026697             GeneID:1085706   -        BA2176   2026380
                               NC_003997.3
ref|NC_003997.3|:2027082-2027960             GeneID:1085748   -        BA2178   2027082
                               NC_003997.3
ref|NC_003997.3|:2028330-2030330             GeneID:1085754   -        BA2179   2028330
                               NC_003997.3
ref|NC_003997.3|:2030406-2032532             GeneID:1085736   -        BA2180   2030406
                               NC_003997.3
ref|NC_003997.3|:2032925-2036026             GeneID:1085720   ileS-1   BA2181   2032925
                               NC_003997.3
ref|NC_003997.3|:2036347-2037858             GeneID:1085737   -        BA2183   2036347
                               NC_003997.3
ref|NC_003997.3|:c2038444-2037962            GeneID:1085730   -        BA2184   2037962
                               NC_003997.3
ref|NC_003997.3|:2039486-2040784             GeneID:1086803   aspS-1   BA2186   2039486
                               NC_003997.3
ref|NC_003997.3|:2069379-2070719             GeneID:1087439   -         BA2216       2069379
                               NC_003997.3
ref|NC_003997.3|:2070754-2071665             GeneID:1085695   -         BA2217       2070754
-                              -             -                -         -        -
                               NC_003997.3
ref|NC_003997.3|:c2072277-2071702            GeneID:1085643   -         BA2218       2071702
                               NC_003997.3
ref|NC_003997.3|:c2073107-2072310            GeneID:1085631   -         BA2219       2072310
                               NC_003997.3
ref|NC_003997.3|:2074181-2075620             GeneID:1085540   -         BA2221       2074181
                               NC_003997.3
ref|NC_003997.3|:2075697-2076875             GeneID:1085530   -         BA2222       2075697
                               NC_003997.3
ref|NC_003997.3|:2077023-2077730             GeneID:1087803   -         BA2223       2077023
                               NC_003997.3
ref|NC_003997.3|:2077805-2078278             GeneID:1087310   -         BA2224       2077805
                               NC_003997.3
ref|NC_003997.3|:c2079767-2079336            GeneID:1087197   -         BA2227       2079336
                               NC_003997.3
ref|NC_003997.3|:2079921-2080631             GeneID:1085617   -         BA2228       2079921
                               NC_003997.3
ref|NC_003997.3|:2080624-2081682             GeneID:1085574   -         BA2229       2080624
                               NC_003997.3
ref|NC_003997.3|:2082108-2082695             GeneID:1084700   -         BA2230       2082108
                               NC_003997.3
ref|NC_003997.3|:2082795-2083436             GeneID:1085611   -         BA2231       2082795
                               NC_003997.3
ref|NC_003997.3|:2083837-2084769             GeneID:1083676   -         BA2233       2083837
                               NC_003997.3
ref|NC_003997.3|:c2087668-2086211            GeneID:1085500   -         BA2235       2086211
                               NC_003997.3
ref|NC_003997.3|:2087867-2088823             GeneID:1085458   thyA      BA2236       2087867
                               NC_003997.3
ref|NC_003997.3|:2088843-2089331             GeneID:1085515   dfrA      BA2237       2088843
                               NC_003997.3
ref|NC_003997.3|:2089487-2091472             GeneID:1085529   pbpC      BA2238       2089487
                               NC_003997.3
ref|NC_003997.3|:2091715-2092350             GeneID:1085516   acpD      BA2239       2091715
                               NC_003997.3
ref|NC_003997.3|:2092462-2093181             GeneID:1087416   -         BA2240       2092462
                               NC_003997.3
ref|NC_003997.3|:c2093878-2093222            GeneID:1085527   hlY-III   BA2241       2093222
                               NC_003997.3
ref|NC_003997.3|:2094335-2095063             GeneID:1087508   -         BA2243       2094335
                               NC_003997.3
ref|NC_003997.3|:2095406-2095657             GeneID:1084049   -         BA2245       2095406
                               NC_003997.3
ref|NC_003997.3|:2095810-2096658             GeneID:1085505   -         BA2246       2095810
                               NC_003997.3
ref|NC_003997.3|:c2097833-2096859            GeneID:1087581   -         BA2247       2096859
                               NC_003997.3
ref|NC_003997.3|:2098169-2098756             GeneID:1085533   -         BA2249       2098169
                               NC_003997.3
ref|NC_003997.3|:c2099259-2098798            GeneID:1085531   -         BA2250       2098798
                               NC_003997.3
ref|NC_003997.3|:2099477-2101378             GeneID:1085386   asnO-3    BA2251       2099477
                               NC_003997.3
ref|NC_003997.3|:2102643-2103605             GeneID:1085517   -         BA2255       2102643
                               NC_003997.3
ref|NC_003997.3|:2104711-2105358             GeneID:1087283   -         BA2257       2104711
                               NC_003997.3
ref|NC_003997.3|:2105618-2106106             GeneID:1085520   -         BA2258       2105618
                               NC_003997.3
ref|NC_003997.3|:2107797-2108234             GeneID:1085198   -         BA2262       2107797
                               NC_003997.3
ref|NC_003997.3|:2108533-2109426             GeneID:1085172   -         BA2263       2108533
                               NC_003997.3
ref|NC_003997.3|:2109598-2110695             GeneID:1085125   -         BA2264       2109598
                               NC_003997.3
ref|NC_003997.3|:2110709-2111338             GeneID:1085185   -         BA2265       2110709
                               NC_003997.3
ref|NC_003997.3|:2112163-2113200             GeneID:1085204   -         BA2267       2112163
                               NC_003997.3
ref|NC_003997.3|:c2114370-2113351            GeneID:1089258   -         BA2268       2113351
                               NC_003997.3
ref|NC_003997.3|:c2115269-2114367            GeneID:1087289   -         BA2269       2114367
                               NC_003997.3
ref|NC_003997.3|:2117230-2118267             GeneID:1087602   -         BA2271       2117230
                               NC_003997.3
ref|NC_003997.3|:2119664-2120884             GeneID:1089254   -         BA2274       2119664
                               NC_003997.3
ref|NC_003997.3|:2120919-2122073             GeneID:1089244   -         BA2275       2120919
                               NC_003997.3
ref|NC_003997.3|:2122219-2122755             GeneID:1089246   -         BA2276       2122219
                               NC_003997.3
ref|NC_003997.3|:2122757-2123986             GeneID:1089232   -         BA2277       2122757
                               NC_003997.3
ref|NC_003997.3|:2124050-2124607             GeneID:1085128   -         BA2278       2124050
                               NC_003997.3
ref|NC_003997.3|:2125661-2127172             GeneID:1086103   -         BA2280       2125661
                               NC_003997.3
ref|NC_003997.3|:2127386-2128813             GeneID:1086115   arcD      BA2281       2127386
                               NC_003997.3
ref|NC_003997.3|:2131066-2132916             GeneID:1086109   -         BA2284       2131066
                               NC_003997.3
ref|NC_003997.3|:2133274-2133789             GeneID:1086071   -         BA2286       2133274
                               NC_003997.3
ref|NC_003997.3|:c2134427-2133885            GeneID:1089233   -         BA2287       2133885
                               NC_003997.3
ref|NC_003997.3|:2134782-2136137             GeneID:1089234   -         BA2288       2134782
                               NC_003997.3
ref|NC_003997.3|:2136270-2137694             GeneID:1089243   -         BA2289       2136270
                               NC_003997.3
ref|NC_003997.3|:c2138206-2137814            GeneID:1086035   -        BA2290       2137814
                               NC_003997.3
ref|NC_003997.3|:c2140359-2139604            GeneID:1086056   -        BA2292       2139604
                               NC_003997.3
ref|NC_003997.3|:2141168-2142478             GeneID:1086068   -        BA2294       2141168
                               NC_003997.3
ref|NC_003997.3|:2142475-2143173             GeneID:1085990   atoD     BA2295       2142475
                               NC_003997.3
ref|NC_003997.3|:2143158-2143820             GeneID:1086070   -        BA2296       2143158
                               NC_003997.3
ref|NC_003997.3|:2143836-2145104             GeneID:1086074   -        BA2297       2143836
                               NC_003997.3
ref|NC_003997.3|:2145101-2145946             GeneID:1086076   -        BA2298       2145101
                               NC_003997.3
ref|NC_003997.3|:2146046-2147431             GeneID:1084944   rocR-2   BA2299       2146046
                               NC_003997.3
ref|NC_003997.3|:2147642-2149063             GeneID:1085899   kamA     BA2300       2147642
                               NC_003997.3
ref|NC_003997.3|:2149060-2149332             GeneID:1085966   -        BA2301       2149060
                               NC_003997.3
ref|NC_003997.3|:2149405-2149620             GeneID:1085944   -        BA2302       2149405
                               NC_003997.3
ref|NC_003997.3|:2149810-2150472             GeneID:1085932   -        BA2303       2149810
                               NC_003997.3
ref|NC_003997.3|:c2150767-2150477            GeneID:1084941   -        BA2304       2150477
                               NC_003997.3
ref|NC_003997.3|:2151266-2152087             GeneID:1084874   -        BA2307       2151266
                               NC_003997.3
ref|NC_003997.3|:2152899-2153540             GeneID:1086266   -        BA2309       2152899
                               NC_003997.3
ref|NC_003997.3|:c2154420-2153530            GeneID:1084751   -        BA2310       2153530
                               NC_003997.3
ref|NC_003997.3|:c2155014-2154700            GeneID:1084847   -        BA2311       2154700
                               NC_003997.3
ref|NC_003997.3|:2170206-2170742             GeneID:1084431   -        BA2334       2170206
                               NC_003997.3
ref|NC_003997.3|:2172225-2173121             GeneID:1084443   prsA     BA2336       2172225
                               NC_003997.3
ref|NC_003997.3|:2174029-2174436             GeneID:1089074   -        BA2338       2174029
                               NC_003997.3
ref|NC_003997.3|:2177431-2179893             GeneID:1084404   -        BA2345       2177431
                               NC_003997.3
ref|NC_003997.3|:2182362-2183480             GeneID:1084225   mmgD     BA2348       2182362
                               NC_003997.3
ref|NC_003997.3|:2183579-2185015             GeneID:1084345   prpD     BA2349       2183579
                               NC_003997.3
ref|NC_003997.3|:2186097-2187806             GeneID:1084229   -        BA2352       2186097
                               NC_003997.3
ref|NC_003997.3|:2187823-2188713             GeneID:1089111   garR     BA2353       2187823
                               NC_003997.3
ref|NC_003997.3|:2188750-2190210             GeneID:1089110   mmsA-1   BA2354       2188750
                               NC_003997.3
ref|NC_003997.3|:c2190913-2190281            GeneID:1084162   -        BA2355       2190281
                               NC_003997.3
ref|NC_003997.3|:c2192152-2191097            GeneID:1089120   -        BA2356       2191097
                               NC_003997.3
ref|NC_003997.3|:2192469-2192726             GeneID:1084272   -        BA2357       2192469
                               NC_003997.3
ref|NC_003997.3|:2193165-2194322             GeneID:1084068   -        BA2359       2193165
                               NC_003997.3
ref|NC_003997.3|:2194319-2197408             GeneID:1089132   -        BA2360       2194319
                               NC_003997.3
ref|NC_003997.3|:2198880-2199179             GeneID:1083864   -        BA2363       2198880
                               NC_003997.3
ref|NC_003997.3|:2200142-2201344             GeneID:1089169   -        BA2367       2200142
                               NC_003997.3
ref|NC_003997.3|:2201928-2202704             GeneID:1083858   entA     BA2368       2201928
                               NC_003997.3
ref|NC_003997.3|:2202731-2203930             GeneID:1083869   dhbC     BA2369       2202731
                               NC_003997.3
ref|NC_003997.3|:2203943-2205559             GeneID:1083816   dhbE     BA2370       2203943
                               NC_003997.3
ref|NC_003997.3|:2205591-2206478             GeneID:1083815   dhbB     BA2371       2205591
                               NC_003997.3
ref|NC_003997.3|:2206510-2213667             GeneID:1083894   dhbF     BA2372       2206510
                               NC_003997.3
ref|NC_003997.3|:2213888-2215330             GeneID:1083915   -        BA2374       2213888
                               NC_003997.3
ref|NC_003997.3|:2215364-2216113             GeneID:1089204   -        BA2375       2215364
                               NC_003997.3
ref|NC_003997.3|:c2217001-2216729            GeneID:1083785   hup-2    BA2377       2216729
                               NC_003997.3
ref|NC_003997.3|:2217206-2217973             GeneID:1089197   -        BA2378       2217206
                               NC_003997.3
ref|NC_003997.3|:2218000-2218512             GeneID:1083743   -        BA2379       2218000
                               NC_003997.3
ref|NC_003997.3|:c2219794-2218601            GeneID:1083771   -        BA2380       2218601
                               NC_003997.3
ref|NC_003997.3|:c2221388-2220021            GeneID:1089196   -        BA2381       2220021
                               NC_003997.3
ref|NC_003997.3|:c2222408-2221833            GeneID:1089188   -        BA2383       2221833
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:2222577-2222903             GeneID:1083811   -        BA2384       2222577
                               NC_003997.3
ref|NC_003997.3|:2223108-2223728             GeneID:1088127   -        BA2385       2223108
                               NC_003997.3
ref|NC_003997.3|:2225273-2227192             GeneID:1083728   thrS-1   BA2388       2225273
                               NC_003997.3
ref|NC_003997.3|:2228225-2230105             GeneID:1083638   -        BA2390       2228225
                               NC_003997.3
ref|NC_003997.3|:2231708-2232889             GeneID:1083672   -        BA2393       2231708
                               NC_003997.3
ref|NC_003997.3|:c2235607-2234870            GeneID:1089201   -        BA2395   2234870
                               NC_003997.3
ref|NC_003997.3|:2237809-2238675             GeneID:1087368   -        BA2399   2237809
                               NC_003997.3
ref|NC_003997.3|:c2239772-2238834            GeneID:1087516   -        BA2400   2238834
                               NC_003997.3
ref|NC_003997.3|:2242782-2243435             GeneID:1087156   -        BA2405   2242782
                               NC_003997.3
ref|NC_003997.3|:c2244162-2243533            GeneID:1089207   -        BA2406   2243533
                               NC_003997.3
ref|NC_003997.3|:c2246740-2246558            GeneID:1087350   -        BA2408   2246558
                               NC_003997.3
ref|NC_003997.3|:2247610-2248323             GeneID:1087352   -        BA2410   2247610
                               NC_003997.3
ref|NC_003997.3|:2248379-2249305             GeneID:1087351   -        BA2411   2248379
                               NC_003997.3
ref|NC_003997.3|:2249453-2249965             GeneID:1087354   -        BA2412   2249453
                               NC_003997.3
ref|NC_003997.3|:c2250887-2250003            GeneID:1087363   -        BA2413   2250003
                               NC_003997.3
ref|NC_003997.3|:2251652-2252602             GeneID:1087164   -        BA2415   2251652
                               NC_003997.3
ref|NC_003997.3|:2253813-2255213             GeneID:1086344   hemY-2   BA2418   2253813
                               NC_003997.3
ref|NC_003997.3|:2256113-2256664             GeneID:1084948   -        BA2420   2256113
                               NC_003997.3
ref|NC_003997.3|:c2263563-2263279            GeneID:1085003   -        BA2431   2263279
                               NC_003997.3
ref|NC_003997.3|:c2266370-2265498            GeneID:1086491   -        BA2435   2265498
                               NC_003997.3
ref|NC_003997.3|:2266500-2267543             GeneID:1084728   asd-1    BA2436   2266500
                               NC_003997.3
ref|NC_003997.3|:2267709-2268833             GeneID:1087348   -        BA2437   2267709
                               NC_003997.3
ref|NC_003997.3|:c2270145-2269243            GeneID:1088513   -        BA2439   2269243
                               NC_003997.3
ref|NC_003997.3|:2270298-2270984             GeneID:1084817   -        BA2440   2270298
                               NC_003997.3
ref|NC_003997.3|:2272163-2272759             GeneID:1087306   -        BA2442   2272163
                               NC_003997.3
ref|NC_003997.3|:2272981-2274735             GeneID:1085019   -        BA2443   2272981
                               NC_003997.3
ref|NC_003997.3|:2274728-2276524             GeneID:1087878   -        BA2444   2274728
                               NC_003997.3
ref|NC_003997.3|:c2282298-2282074            GeneID:1084576   -        BA2451   2282074
                               NC_003997.3
ref|NC_003997.3|:2282935-2283240             GeneID:1084781   -        BA2452   2282935
                               NC_003997.3
ref|NC_003997.3|:2283335-2284645             GeneID:1088487   -        BA2453   2283335
                               NC_003997.3
ref|NC_003997.3|:2284623-2285492             GeneID:1085265   -        BA2454   2284623
                               NC_003997.3
ref|NC_003997.3|:2285995-2286588             GeneID:1086740   -        BA2457   2285995
                               NC_003997.3
ref|NC_003997.3|:2286938-2288014             GeneID:1088194   -        BA2458   2286938
                               NC_003997.3
ref|NC_003997.3|:2288039-2288872             GeneID:1088585   -        BA2459   2288039
                               NC_003997.3
ref|NC_003997.3|:c2290248-2288926            GeneID:1086651   -        BA2460   2288926
                               NC_003997.3
ref|NC_003997.3|:2290714-2291019             GeneID:1085159   -        BA2462   2290714
                               NC_003997.3
ref|NC_003997.3|:2292397-2292663             GeneID:1084691   -        BA2464   2292397
                               NC_003997.3
ref|NC_003997.3|:2292686-2293834             GeneID:1088523   -        BA2465   2292686
                               NC_003997.3
ref|NC_003997.3|:2294878-2295447             GeneID:1086564   -        BA2467   2294878
                               NC_003997.3
ref|NC_003997.3|:2297188-2298189             GeneID:1087333   tdcB     BA2469   2297188
                               NC_003997.3
ref|NC_003997.3|:2299533-2300219             GeneID:1084676   -        BA2472   2299533
                               NC_003997.3
ref|NC_003997.3|:2301084-2301353             GeneID:1087252   -        BA2474   2301084
                               NC_003997.3
ref|NC_003997.3|:2301427-2302779             GeneID:1085525   -        BA2475   2301427
                               NC_003997.3
ref|NC_003997.3|:c2304595-2304092            GeneID:1084766   -        BA2477   2304092
                               NC_003997.3
ref|NC_003997.3|:2306063-2307310             GeneID:1087330   -        BA2480   2306063
                               NC_003997.3
ref|NC_003997.3|:2307317-2309656             GeneID:1087329   -        BA2481   2307317
                               NC_003997.3
ref|NC_003997.3|:2310528-2311238             GeneID:1087331   -        BA2483   2310528
                               NC_003997.3
ref|NC_003997.3|:2312110-2312892             GeneID:1084679   -        BA2485   2312110
                               NC_003997.3
ref|NC_003997.3|:c2314699-2313014            GeneID:1084651   -        BA2486   2313014
                               NC_003997.3
ref|NC_003997.3|:2314806-2315288             GeneID:1087246   -        BA2487   2314806
                               NC_003997.3
ref|NC_003997.3|:2315456-2316193             GeneID:1084851   gpm      BA2488   2315456
                               NC_003997.3
ref|NC_003997.3|:2319100-2320569             GeneID:1086512   pepD     BA2498   2319100
                               NC_003997.3
ref|NC_003997.3|:2321807-2322400             GeneID:1085064   -        BA2501   2321807
                               NC_003997.3
ref|NC_003997.3|:2323145-2323972             GeneID:1089139   -        BA2503   2323145
                               NC_003997.3
ref|NC_003997.3|:c2325750-2323984            GeneID:1087849   -        BA2504   2323984
                               NC_003997.3
ref|NC_003997.3|:2328474-2329403             GeneID:1084799   bla1     BA2507   2328474
                               NC_003997.3
ref|NC_003997.3|:2354237-2354842             GeneID:1085439   -        BA2530   2354237
                               NC_003997.3
ref|NC_003997.3|:2360648-2361154             GeneID:1085318   -        BA2534       2360648
                               NC_003997.3
ref|NC_003997.3|:2362418-2363617             GeneID:1087757   -        BA2537       2362418
                               NC_003997.3
ref|NC_003997.3|:2363684-2365138             GeneID:1086572   -        BA2538       2363684
                               NC_003997.3
ref|NC_003997.3|:2365677-2365928             GeneID:1085541   -        BA2540       2365677
                               NC_003997.3
ref|NC_003997.3|:2366173-2366841             GeneID:1085637   -        BA2541       2366173
                               NC_003997.3
ref|NC_003997.3|:2366838-2367857             GeneID:1085735   -        BA2542       2366838
                               NC_003997.3
ref|NC_003997.3|:2367882-2368535             GeneID:1085615   -        BA2543       2367882
                               NC_003997.3
ref|NC_003997.3|:c2368956-2368657            GeneID:1084036   -        BA2545       2368657
                               NC_003997.3
ref|NC_003997.3|:2369189-2370157             GeneID:1085775   -        BA2546       2369189
                               NC_003997.3
ref|NC_003997.3|:2371535-2372872             GeneID:1086729   -        BA2548       2371535
                               NC_003997.3
ref|NC_003997.3|:2372902-2373114             GeneID:1085766   -        BA2549       2372902
                               NC_003997.3
ref|NC_003997.3|:2373136-2374047             GeneID:1085763   mvaB     BA2550       2373136
                               NC_003997.3
ref|NC_003997.3|:2374052-2374840             GeneID:1085751   -        BA2551       2374052
                               NC_003997.3
ref|NC_003997.3|:2374843-2376384             GeneID:1085738   -        BA2552       2374843
                               NC_003997.3
ref|NC_003997.3|:2376434-2378374             GeneID:1085733   -        BA2553       2376434
                               NC_003997.3
ref|NC_003997.3|:2379012-2379536             GeneID:1089149   -        BA2555       2379012
                               NC_003997.3
ref|NC_003997.3|:c2382414-2381398            GeneID:1088037   -        BA2559       2381398
                               NC_003997.3
ref|NC_003997.3|:c2383753-2382596            GeneID:1085800   -        BA2560       2382596
                               NC_003997.3
ref|NC_003997.3|:c2384438-2383743            GeneID:1085788   -        BA2561       2383743
                               NC_003997.3
ref|NC_003997.3|:2384630-2385238             GeneID:1087264   -        BA2562       2384630
                               NC_003997.3
ref|NC_003997.3|:2385836-2386546             GeneID:1085837   -        BA2564       2385836
                               NC_003997.3
ref|NC_003997.3|:2391718-2392278             GeneID:1085821   -        BA2569       2391718
                               NC_003997.3
ref|NC_003997.3|:2393799-2396966             GeneID:1087633   -        BA2572       2393799
                               NC_003997.3
ref|NC_003997.3|:2399764-2400573             GeneID:1085931   -        BA2576       2399764
                               NC_003997.3
ref|NC_003997.3|:2402875-2403669             GeneID:1085973   -        BA2579       2402875
                               NC_003997.3
ref|NC_003997.3|:2405222-2406316             GeneID:1083877   -        BA2582       2405222
                               NC_003997.3
ref|NC_003997.3|:c2408022-2406331            GeneID:1086121   -        BA2583       2406331
                               NC_003997.3
ref|NC_003997.3|:2408192-2408785             GeneID:1089129   -        BA2584       2408192
                               NC_003997.3
ref|NC_003997.3|:2408895-2410226             GeneID:1086980   -        BA2585       2408895
                               NC_003997.3
ref|NC_003997.3|:2412637-2413266             GeneID:1088529   -        BA2590       2412637
                               NC_003997.3
ref|NC_003997.3|:c2416780-2416352            GeneID:1087364   cwlJ-1   BA2594       2416352
                               NC_003997.3
ref|NC_003997.3|:2416926-2417840             GeneID:1086096   -        BA2596       2416926
                               NC_003997.3
ref|NC_003997.3|:2417966-2418673             GeneID:1085553   -        BA2597       2417966
                               NC_003997.3
ref|NC_003997.3|:c2420580-2419954            GeneID:1086716   -        BA2599       2419954
                               NC_003997.3
ref|NC_003997.3|:2422776-2423354             GeneID:1086811   -        BA2601       2422776
                               NC_003997.3
ref|NC_003997.3|:2424589-2425359             GeneID:1086180   -        BA2603       2424589
                               NC_003997.3
ref|NC_003997.3|:c2428403-2428077            GeneID:1084872   -        BA2606       2428077
                               NC_003997.3
ref|NC_003997.3|:2429986-2431029             GeneID:1086908   -        BA2608       2429986
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:2431151-2432599             GeneID:1086986   -        BA2609       2431151
                               NC_003997.3
ref|NC_003997.3|:2432604-2433518             GeneID:1086552   ddl      BA2610       2432604
                               NC_003997.3
ref|NC_003997.3|:2433820-2434509             GeneID:1086987   tenA     BA2611       2433820
                               NC_003997.3
ref|NC_003997.3|:c2437681-2437217            GeneID:1086957   -        BA2617       2437217
                               NC_003997.3
ref|NC_003997.3|:2438262-2440649             GeneID:1087297   -        BA2618       2438262
                               NC_003997.3
ref|NC_003997.3|:2444475-2444879             GeneID:1086686   -        BA2626       2444475
                               NC_003997.3
ref|NC_003997.3|:2445039-2446274             GeneID:1088311   cypA     BA2627       2445039
                               NC_003997.3
ref|NC_003997.3|:2446543-2447826             GeneID:1089050   -        BA2628       2446543
                               NC_003997.3
ref|NC_003997.3|:2447816-2448448             GeneID:1086396   -        BA2629       2447816
                               NC_003997.3
ref|NC_003997.3|:2449414-2450628             GeneID:1089060   -        BA2632       2449414
                               NC_003997.3
ref|NC_003997.3|:2450742-2451320             GeneID:1087179   -        BA2633       2450742
                               NC_003997.3
ref|NC_003997.3|:2451498-2452349             GeneID:1086866   -        BA2634       2451498
                               NC_003997.3
ref|NC_003997.3|:2453197-2454612             GeneID:1084976   -        BA2636       2453197
                               NC_003997.3
ref|NC_003997.3|:c2459206-2458526                 GeneID:1088392 -        BA2639   2458526
                               NC_003997.3
ref|NC_003997.3|:2459615-2460163                  GeneID:1085791 -        BA2640   2459615
                               NC_003997.3
ref|NC_003997.3|:2460174-2461874                  GeneID:1087320 -        BA2641   2460174
                               NC_003997.3
ref|NC_003997.3|:2471398-2472420                  GeneID:1086012 -        BA2650   2471398
                               NC_003997.3
ref|NC_003997.3|:2473217-2473723                  GeneID:1088533 -        BA2652   2473217
                               NC_003997.3
ref|NC_003997.3|:2473923-2474729                  GeneID:1088519 -        BA2653   2473923
                               NC_003997.3
ref|NC_003997.3|:c2475421-2474849                 GeneID:1086843 -        BA2654   2474849
                               NC_003997.3
ref|NC_003997.3|:2476479-2477441                  GeneID:1086709 -        BA2656   2476479
                               NC_003997.3
ref|NC_003997.3|:2477516-2478148                  GeneID:1087276 -        BA2657   2477516
                               NC_003997.3
ref|NC_003997.3|:c2479902-2479597                 GeneID:1086668 -        BA2659   2479597
                               NC_003997.3        GeneID:1087872
ref|NC_003997.3|:2115918-2117076, ref|NC_003997.3|:2480563-2481729 -      BA2270   2115918
                               NC_003997.3
ref|NC_003997.3|:2482428-2483651                  GeneID:1086426 -        BA2663   2482428
                               NC_003997.3
ref|NC_003997.3|:2483764-2485068                  GeneID:1086909 -        BA2664   2483764
                               NC_003997.3
ref|NC_003997.3|:c2485807-2485109                 GeneID:1084485 -        BA2665   2485109
                               NC_003997.3
ref|NC_003997.3|:2490930-2491844                  GeneID:1086514 -        BA2672   2490930
                               NC_003997.3
ref|NC_003997.3|:2491983-2493344                  GeneID:1086831 -        BA2673   2491983
                               NC_003997.3
ref|NC_003997.3|:2494829-2495095                  GeneID:1086540 -        BA2677   2494829
                               NC_003997.3
ref|NC_003997.3|:2495197-2496213                  GeneID:1088093 -        BA2678   2495197
                               NC_003997.3
ref|NC_003997.3|:2496673-2497881                  GeneID:1086174 -        BA2680   2496673
                               NC_003997.3
ref|NC_003997.3|:c2504516-2503554                 GeneID:1086415 -        BA2688   2503554
                               NC_003997.3
ref|NC_003997.3|:c2509038-2508223                 GeneID:1085038 -        BA2692   2508223
                               NC_003997.3
ref|NC_003997.3|:c2511197-2510832                 GeneID:1087344 -        BA2695   2510832
                               NC_003997.3
ref|NC_003997.3|:c2514372-2513851                 GeneID:1087645 -        BA2700   2513851
                               NC_003997.3
ref|NC_003997.3|:c2514916-2514389                 GeneID:1087935 -        BA2701   2514389
                               NC_003997.3
ref|NC_003997.3|:c2516302-2514980                 GeneID:1087938 -        BA2702   2514980
                               NC_003997.3
ref|NC_003997.3|:c2517938-2517558                 GeneID:1087983 -        BA2705   2517558
                               NC_003997.3
ref|NC_003997.3|:c2518578-2518096                 GeneID:1087505 -        BA2707   2518096
                               NC_003997.3
ref|NC_003997.3|:c2522227-2521568                 GeneID:1087952 -        BA2712   2521568
                               NC_003997.3
ref|NC_003997.3|:c2522975-2522538                 GeneID:1087918 -        BA2713   2522538
                               NC_003997.3
ref|NC_003997.3|:c2524293-2523178                 GeneID:1087511 -        BA2715   2523178
                               NC_003997.3
ref|NC_003997.3|:c2525072-2524419                 GeneID:1088007 -        BA2716   2524419
                               NC_003997.3
ref|NC_003997.3|:c2527106-2526738                 GeneID:1087948 -        BA2719   2526738
                               NC_003997.3
ref|NC_003997.3|:c2527935-2527243                 GeneID:1088003 -        BA2720   2527243
                               NC_003997.3
ref|NC_003997.3|:2528188-2528733                  GeneID:1087342 -        BA2721   2528188
                               NC_003997.3
ref|NC_003997.3|:c2543715-2541157                 GeneID:1087991 -        BA2728   2541157
                               NC_003997.3
ref|NC_003997.3|:c2545903-2544200                 GeneID:1086959 -        BA2730   2544200
                               NC_003997.3
ref|NC_003997.3|:c2548601-2548122                 GeneID:1087875 -        BA2733   2548122
                               NC_003997.3
ref|NC_003997.3|:2549050-2550354                  GeneID:1087864 secY-2   BA2734   2549050
                               NC_003997.3
ref|NC_003997.3|:c2552450-2551533                 GeneID:1087282 -        BA2736   2551533
                               NC_003997.3
ref|NC_003997.3|:2552597-2554030                  GeneID:1087870 -        BA2737   2552597
                               NC_003997.3
ref|NC_003997.3|:2554390-2555253                  GeneID:1087907 -        BA2738   2554390
                               NC_003997.3
ref|NC_003997.3|:c2556879-2555710                 GeneID:1087249 -        BA2740   2555710
                               NC_003997.3
ref|NC_003997.3|:c2560801-2560205                 GeneID:1088377 -        BA2746   2560205
                               NC_003997.3
ref|NC_003997.3|:c2562168-2560828                 GeneID:1086708 -        BA2747   2560828
                               NC_003997.3
ref|NC_003997.3|:c2562945-2562184                 GeneID:1084998 sleB     BA2748   2562184
                               NC_003997.3
ref|NC_003997.3|:2563091-2563423                  GeneID:1087431 -        BA2749   2563091
                               NC_003997.3
ref|NC_003997.3|:c2565409-2564570                 GeneID:1088379 -        BA2751   2564570
                               NC_003997.3
ref|NC_003997.3|:c2566072-2565443                 GeneID:1087435 -        BA2752   2565443
                               NC_003997.3
ref|NC_003997.3|:c2567361-2566075                 GeneID:1088380 kynU     BA2753   2566075
                               NC_003997.3
ref|NC_003997.3|:c2568605-2568168                 GeneID:1088381 -        BA2755   2568168
                               NC_003997.3
ref|NC_003997.3|:2568702-2569505                  GeneID:1085627 -        BA2756   2568702
                               NC_003997.3
ref|NC_003997.3|:c2569991-2569533                 GeneID:1086678 -        BA2757   2569533
                               NC_003997.3
ref|NC_003997.3|:c2570511-2570143            GeneID:1089181   -        BA2759       2570143
                               NC_003997.3
ref|NC_003997.3|:c2570770-2570513            GeneID:1083794   -        BA2760       2570513
                               NC_003997.3
ref|NC_003997.3|:c2572732-2570882            GeneID:1083842   -        BA2761       2570882
                               NC_003997.3
ref|NC_003997.3|:c2573386-2573048            GeneID:1088383   -        BA2763       2573048
                               NC_003997.3
ref|NC_003997.3|:c2573956-2573414            GeneID:1088382   -        BA2764       2573414
                               NC_003997.3
ref|NC_003997.3|:c2574739-2573969            GeneID:1085635   -        BA2765       2573969
                               NC_003997.3
ref|NC_003997.3|:2574990-2575487             GeneID:1083870   -        BA2766       2574990
                               NC_003997.3
ref|NC_003997.3|:c2576149-2575547            GeneID:1085655   -        BA2767       2575547
                               NC_003997.3
ref|NC_003997.3|:c2577582-2577181            GeneID:1088385   -        BA2769       2577181
                               NC_003997.3
ref|NC_003997.3|:2578266-2578862             GeneID:1089177   -        BA2772       2578266
                               NC_003997.3
ref|NC_003997.3|:c2580324-2578945            GeneID:1084372   acoL     BA2773       2578945
                               NC_003997.3
ref|NC_003997.3|:c2581536-2580340            GeneID:1087334   acoC     BA2774       2580340
                               NC_003997.3
ref|NC_003997.3|:c2582598-2581564            GeneID:1087338   acoB     BA2775       2581564
                               NC_003997.3
ref|NC_003997.3|:c2583614-2582616            GeneID:1083832   acoA     BA2776       2582616
                               NC_003997.3
ref|NC_003997.3|:c2584263-2583784            GeneID:1088384   -        BA2777       2583784
                               NC_003997.3
ref|NC_003997.3|:2584452-2585297             GeneID:1089179   -        BA2778       2584452
                               NC_003997.3
ref|NC_003997.3|:2585339-2585848             GeneID:1085658   -        BA2779       2585339
                               NC_003997.3
ref|NC_003997.3|:c2588010-2587186            GeneID:1088387   -        BA2783       2587186
                               NC_003997.3
ref|NC_003997.3|:c2589605-2588769            GeneID:1086167   -        BA2785       2588769
                               NC_003997.3
ref|NC_003997.3|:c2590803-2589598            GeneID:1085649   proV-2   BA2786       2589598
                               NC_003997.3
ref|NC_003997.3|:2590975-2591832             GeneID:1087337   -        BA2787       2590975
                               NC_003997.3
ref|NC_003997.3|:c2592459-2591878            GeneID:1086459   clpP-1   BA2788       2591878
                               NC_003997.3
ref|NC_003997.3|:c2593167-2592481            GeneID:1084789   -        BA2789       2592481
                               NC_003997.3
ref|NC_003997.3|:2593311-2593577             GeneID:1084777   fdX      BA2790       2593311
                               NC_003997.3
ref|NC_003997.3|:c2596284-2594917            GeneID:1088390   -        BA2793       2594917
                               NC_003997.3
ref|NC_003997.3|:c2597240-2596722            GeneID:1087227   -        BA2794       2596722
                               NC_003997.3
ref|NC_003997.3|:c2605187-2604411            GeneID:1085667   -        BA2809       2604411
                               NC_003997.3
ref|NC_003997.3|:c2606888-2605878            GeneID:1087228   -        BA2811       2605878
                               NC_003997.3
ref|NC_003997.3|:c2607219-2606875            GeneID:1085342   -        BA2812       2606875
                               NC_003997.3
ref|NC_003997.3|:c2612409-2612026            GeneID:1088400   -        BA2817       2612026
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c2614552-2612435            GeneID:1085972   recQ-2   BA2818       2612435
                               NC_003997.3
ref|NC_003997.3|:2615626-2616249             GeneID:1087985   -        BA2820       2615626
                               NC_003997.3
ref|NC_003997.3|:c2622553-2621624            GeneID:1088406   ppaC     BA2826       2621624
                               NC_003997.3
ref|NC_003997.3|:c2623380-2622715            GeneID:1085546   -        BA2827       2622715
                               NC_003997.3
ref|NC_003997.3|:c2624108-2623605            GeneID:1085569   -        BA2828       2623605
                               NC_003997.3
ref|NC_003997.3|:c2624766-2624326            GeneID:1088410   -        BA2829       2624326
                               NC_003997.3
ref|NC_003997.3|:c2626287-2624797            GeneID:1086771   -        BA2830       2624797
                               NC_003997.3
ref|NC_003997.3|:c2627879-2626395            GeneID:1085669   aldA     BA2831       2626395
                               NC_003997.3
ref|NC_003997.3|:c2629758-2628817            GeneID:1087183   -        BA2833       2628817
                               NC_003997.3
ref|NC_003997.3|:c2630792-2629755            GeneID:1085580   -        BA2834       2629755
                               NC_003997.3
ref|NC_003997.3|:c2631964-2630789            GeneID:1085575   -        BA2835       2630789
                               NC_003997.3
ref|NC_003997.3|:2632145-2633806             GeneID:1084006   -        BA2836       2632145
                               NC_003997.3
ref|NC_003997.3|:2633915-2634157             GeneID:1085583   -        BA2837       2633915
                               NC_003997.3
ref|NC_003997.3|:c2636051-2635743            GeneID:1084756   -        BA2839       2635743
                               NC_003997.3
ref|NC_003997.3|:c2636488-2636039            GeneID:1085581   -        BA2840       2636039
                               NC_003997.3
ref|NC_003997.3|:2636747-2637511             GeneID:1087301   -        BA2841       2636747
                               NC_003997.3
ref|NC_003997.3|:2639016-2639240             GeneID:1085578   -        BA2845       2639016
                               NC_003997.3
ref|NC_003997.3|:c2642995-2641373            GeneID:1088414   -        BA2848       2641373
                               NC_003997.3
ref|NC_003997.3|:c2645109-2644057            GeneID:1084540   -        BA2850       2644057
                               NC_003997.3
ref|NC_003997.3|:c2648360-2648097            GeneID:1088419   -        BA2857       2648097
                               NC_003997.3
ref|NC_003997.3|:c2649326-2648562            GeneID:1086585   -        BA2858       2648562
                               NC_003997.3
ref|NC_003997.3|:c2651660-2649867            GeneID:1088416   -        BA2860   2649867
                               NC_003997.3
ref|NC_003997.3|:c2653237-2651861            GeneID:1084553   -        BA2861   2651861
                               NC_003997.3
ref|NC_003997.3|:2653890-2654414             GeneID:1088424   -        BA2863   2653890
                               NC_003997.3
ref|NC_003997.3|:c2656032-2655277            GeneID:1087613   -        BA2865   2655277
                               NC_003997.3
ref|NC_003997.3|:c2659199-2658447            GeneID:1087621   -        BA2868   2658447
                               NC_003997.3
ref|NC_003997.3|:c2660288-2659212            GeneID:1088301   -        BA2869   2659212
                               NC_003997.3
ref|NC_003997.3|:c2662010-2661150            GeneID:1088431   -        BA2872   2661150
                               NC_003997.3
ref|NC_003997.3|:2662235-2662666             GeneID:1085551   -        BA2873   2662235
                               NC_003997.3
ref|NC_003997.3|:2663814-2664134             GeneID:1084811   -        BA2876   2663814
                               NC_003997.3
ref|NC_003997.3|:c2665724-2664189            GeneID:1088428   -        BA2877   2664189
                               NC_003997.3
ref|NC_003997.3|:c2666456-2665749            GeneID:1085560   -        BA2878   2665749
                               NC_003997.3
ref|NC_003997.3|:c2667185-2666475            GeneID:1088433   -        BA2879   2666475
                               NC_003997.3
ref|NC_003997.3|:c2667822-2667199            GeneID:1087274   -        BA2880   2667199
                               NC_003997.3
ref|NC_003997.3|:2669821-2671059             GeneID:1087997   -        BA2882   2669821
                               NC_003997.3
ref|NC_003997.3|:c2673284-2672880            GeneID:1088528   -        BA2886   2672880
                               NC_003997.3
ref|NC_003997.3|:c2675855-2675079            GeneID:1087470   -        BA2890   2675079
                               NC_003997.3
ref|NC_003997.3|:c2676419-2676051            GeneID:1086315   -        BA2891   2676051
                               NC_003997.3
ref|NC_003997.3|:2677921-2679123             GeneID:1088436   -        BA2896   2677921
                               NC_003997.3
ref|NC_003997.3|:2680289-2681488             GeneID:1086785   -        BA2899   2680289
                               NC_003997.3
ref|NC_003997.3|:2681545-2681943             GeneID:1086629   -        BA2900   2681545
                               NC_003997.3
ref|NC_003997.3|:2682036-2682866             GeneID:1088439   -        BA2901   2682036
                               NC_003997.3
ref|NC_003997.3|:c2685950-2685234            GeneID:1086850   -        BA2906   2685234
                               NC_003997.3
ref|NC_003997.3|:c2689334-2688288            GeneID:1088564   -        BA2916   2688288
                               NC_003997.3
ref|NC_003997.3|:2689522-2690343             GeneID:1088445   -        BA2917   2689522
                               NC_003997.3
ref|NC_003997.3|:c2691921-2690809            GeneID:1088561   ssuD     BA2919   2690809
                               NC_003997.3
ref|NC_003997.3|:c2692846-2691998            GeneID:1088554   -        BA2920   2691998
                               NC_003997.3
ref|NC_003997.3|:c2693849-2692863            GeneID:1088557   -        BA2921   2692863
                               NC_003997.3
ref|NC_003997.3|:c2695578-2694850            GeneID:1088551   -        BA2923   2694850
                               NC_003997.3
ref|NC_003997.3|:c2696165-2695575            GeneID:1088560   -        BA2924   2695575
                               NC_003997.3
ref|NC_003997.3|:c2700636-2699839            GeneID:1088452   aacC7    BA2930   2699839
                               NC_003997.3
ref|NC_003997.3|:c2704691-2703753            GeneID:1087083   -        BA2936   2703753
                               NC_003997.3
ref|NC_003997.3|:c2707095-2706394            GeneID:1088539   -        BA2940   2706394
                               NC_003997.3
ref|NC_003997.3|:c2707795-2707112            GeneID:1088456   -        BA2941   2707112
                               NC_003997.3
ref|NC_003997.3|:2708639-2709466             GeneID:1085595   -        BA2944   2708639
                               NC_003997.3
ref|NC_003997.3|:c2713103-2711130            GeneID:1088537   -        BA2947   2711130
                               NC_003997.3
ref|NC_003997.3|:c2715245-2713620            GeneID:1088536   -        BA2948   2713620
                               NC_003997.3
ref|NC_003997.3|:c2716471-2715623            GeneID:1088505   -        BA2949   2715623
                               NC_003997.3
ref|NC_003997.3|:c2722119-2720962            GeneID:1085856   -        BA2952   2720962
                               NC_003997.3
ref|NC_003997.3|:c2723594-2722305            GeneID:1086557   aroA     BA2953   2722305
                               NC_003997.3
ref|NC_003997.3|:c2724747-2723611            GeneID:1087404   tyrA     BA2954   2723611
                               NC_003997.3
ref|NC_003997.3|:c2725804-2724704            GeneID:1088520   hisC-2   BA2955   2724704
                               NC_003997.3
ref|NC_003997.3|:c2726995-2725823            GeneID:1089216   aroF-2   BA2956   2725823
                               NC_003997.3
ref|NC_003997.3|:c2728356-2727280            GeneID:1084724   -        BA2958   2727280
                               NC_003997.3
ref|NC_003997.3|:c2731737-2729188            GeneID:1088077   -        BA2959   2729188
                               NC_003997.3
ref|NC_003997.3|:c2732698-2731781            GeneID:1088096   -        BA2960   2731781
                               NC_003997.3
ref|NC_003997.3|:2732848-2733285             GeneID:1088565   -        BA2961   2732848
                               NC_003997.3
ref|NC_003997.3|:c2733964-2733434            GeneID:1088097   -        BA2963   2733434
                               NC_003997.3
ref|NC_003997.3|:2734935-2735450             GeneID:1088204   -        BA2966   2734935
                               NC_003997.3
ref|NC_003997.3|:c2736824-2735502            GeneID:1087231   -        BA2967   2735502
                               NC_003997.3
ref|NC_003997.3|:c2740995-2739949            GeneID:1088571   -        BA2973   2739949
                               NC_003997.3
ref|NC_003997.3|:2741377-2742879             GeneID:1088569   mqo      BA2974   2741377
                               NC_003997.3
ref|NC_003997.3|:c2743966-2742923            GeneID:1088112   -        BA2975   2742923
                               NC_003997.3
ref|NC_003997.3|:c2744952-2743963            GeneID:1088572   -       BA2976       2743963
                               NC_003997.3
ref|NC_003997.3|:c2745902-2744949            GeneID:1084389   -       BA2977       2744949
                               NC_003997.3
ref|NC_003997.3|:c2747389-2745899            GeneID:1089067   -       BA2978       2745899
                               NC_003997.3
ref|NC_003997.3|:2747567-2748508             GeneID:1088113   -       BA2979       2747567
                               NC_003997.3
ref|NC_003997.3|:2750097-2750459             GeneID:1084256   -       BA2981       2750097
                               NC_003997.3
ref|NC_003997.3|:2750466-2751248             GeneID:1088545   -       BA2982       2750466
                               NC_003997.3
ref|NC_003997.3|:c2751874-2751371            GeneID:1084056   -       BA2983       2751371
                               NC_003997.3
ref|NC_003997.3|:c2753989-2753663            GeneID:1088573   -       BA2987       2753663
                               NC_003997.3
ref|NC_003997.3|:c2755306-2754086            GeneID:1084484   -       BA2988       2754086
                               NC_003997.3
ref|NC_003997.3|:c2756401-2755358            GeneID:1084574   -       BA2989       2755358
                               NC_003997.3
ref|NC_003997.3|:2756690-2757178             GeneID:1085307   -       BA2990       2756690
                               NC_003997.3
ref|NC_003997.3|:2757382-2758575             GeneID:1088141   -       BA2991       2757382
                               NC_003997.3
ref|NC_003997.3|:c2761002-2759899            GeneID:1086339   proB    BA2993       2759899
                               NC_003997.3
ref|NC_003997.3|:c2764296-2762656            GeneID:1084476   rocB    BA2996       2762656
                               NC_003997.3
ref|NC_003997.3|:c2765121-2764372            GeneID:1089167   -       BA2997       2764372
                               NC_003997.3
ref|NC_003997.3|:2765389-2766813             GeneID:1088150   -       BA2998       2765389
                               NC_003997.3
ref|NC_003997.3|:c2769296-2768337            GeneID:1084194   -       BA3000       2768337
                               NC_003997.3
ref|NC_003997.3|:2771528-2772010             GeneID:1088133   -       BA3002       2771528
                               NC_003997.3
ref|NC_003997.3|:2772021-2772236             GeneID:1084293   -       BA3003       2772021
                               NC_003997.3
ref|NC_003997.3|:c2777187-2776645            GeneID:1088575   -       BA3010       2776645
                               NC_003997.3
ref|NC_003997.3|:c2777585-2777202            GeneID:1083873   -       BA3011       2777202
                               NC_003997.3
ref|NC_003997.3|:c2779373-2779056            GeneID:1083911   -       BA3015       2779056
-                              -             -                -       -        -
                               NC_003997.3
ref|NC_003997.3|:2779580-2780509             GeneID:1088509   -       BA3016       2779580
                               NC_003997.3
ref|NC_003997.3|:2780506-2781669             GeneID:1088169   -       BA3017       2780506
                               NC_003997.3
ref|NC_003997.3|:2782012-2782752             GeneID:1088600   -       BA3019       2782012
                               NC_003997.3
ref|NC_003997.3|:c2784266-2782809            GeneID:1083957   -       BA3020       2782809
                               NC_003997.3
ref|NC_003997.3|:2785014-2786510             GeneID:1088576   -       BA3022       2785014
                               NC_003997.3
ref|NC_003997.3|:c2786894-2786652            GeneID:1088170   -       BA3023       2786652
                               NC_003997.3
ref|NC_003997.3|:c2788982-2787510            GeneID:1088579   -       BA3024       2787510
                               NC_003997.3
ref|NC_003997.3|:c2789830-2789063            GeneID:1088176   -       BA3025       2789063
                               NC_003997.3
ref|NC_003997.3|:c2791400-2789883            GeneID:1088114   -       BA3026       2789883
                               NC_003997.3
ref|NC_003997.3|:c2792634-2791813            GeneID:1088167   -       BA3028       2791813
                               NC_003997.3
ref|NC_003997.3|:c2794185-2792968            GeneID:1088578   -       BA3029       2792968
                               NC_003997.3
ref|NC_003997.3|:2794457-2795836             GeneID:1088178   -       BA3030       2794457
                               NC_003997.3
ref|NC_003997.3|:c2796487-2795960            GeneID:1089062   -       BA3031       2795960
                               NC_003997.3
ref|NC_003997.3|:c2798355-2796601            GeneID:1088144   -       BA3032       2796601
                               NC_003997.3
ref|NC_003997.3|:c2799891-2798725            GeneID:1088518   adP-2   BA3033       2798725
                               NC_003997.3
ref|NC_003997.3|:c2800656-2800150            GeneID:1088190   -       BA3034       2800150
                               NC_003997.3
ref|NC_003997.3|:c2801234-2800851            GeneID:1086484   -       BA3035       2800851
                               NC_003997.3
ref|NC_003997.3|:c2802707-2801598            GeneID:1088582   -       BA3037       2801598
                               NC_003997.3
ref|NC_003997.3|:c2803636-2802704            GeneID:1088580   -       BA3038       2802704
                               NC_003997.3
ref|NC_003997.3|:c2804077-2803784            GeneID:1087018   -       BA3039       2803784
                               NC_003997.3
ref|NC_003997.3|:c2804682-2804116            GeneID:1089061   -       BA3040       2804116
                               NC_003997.3
ref|NC_003997.3|:c2805129-2804701            GeneID:1087230   -       BA3041       2804701
                               NC_003997.3
ref|NC_003997.3|:2805394-2807337             GeneID:1088193   -       BA3042       2805394
                               NC_003997.3
ref|NC_003997.3|:c2808028-2807384            GeneID:1087372   -       BA3043       2807384
                               NC_003997.3
ref|NC_003997.3|:c2808517-2808050            GeneID:1086860   -       BA3044       2808050
                               NC_003997.3
ref|NC_003997.3|:c2812560-2811538            GeneID:1086480   -       BA3051       2811538
                               NC_003997.3
ref|NC_003997.3|:c2817358-2816411            GeneID:1084246   -       BA3056       2816411
                               NC_003997.3
ref|NC_003997.3|:c2818273-2817383            GeneID:1083789   -       BA3057       2817383
                               NC_003997.3
ref|NC_003997.3|:c2818792-2818322            GeneID:1084973   -       BA3058       2818322
                               NC_003997.3
ref|NC_003997.3|:c2819217-2818810            GeneID:1086490   -        BA3059   2818810
                               NC_003997.3
ref|NC_003997.3|:2819314-2819781             GeneID:1085840   -        BA3060   2819314
                               NC_003997.3
ref|NC_003997.3|:c2820711-2819800            GeneID:1088199   -        BA3061   2819800
                               NC_003997.3
ref|NC_003997.3|:2820837-2822279             GeneID:1087533   -        BA3062   2820837
                               NC_003997.3
ref|NC_003997.3|:c2823192-2822878            GeneID:1087527   -        BA3064   2822878
                               NC_003997.3
ref|NC_003997.3|:c2825603-2824602            GeneID:1088220   -        BA3066   2824602
                               NC_003997.3
ref|NC_003997.3|:c2826271-2825600            GeneID:1088217   -        BA3067   2825600
                               NC_003997.3
ref|NC_003997.3|:c2827298-2826306            GeneID:1083757   -        BA3068   2826306
                               NC_003997.3
ref|NC_003997.3|:c2828222-2827398            GeneID:1084618   -        BA3069   2827398
                               NC_003997.3
ref|NC_003997.3|:c2829022-2828351            GeneID:1088588   -        BA3070   2828351
                               NC_003997.3
ref|NC_003997.3|:c2829979-2829236            GeneID:1084639   -        BA3071   2829236
                               NC_003997.3
ref|NC_003997.3|:c2831731-2830934            GeneID:1088211   -        BA3073   2830934
                               NC_003997.3
ref|NC_003997.3|:2831938-2832840             GeneID:1086618   -        BA3074   2831938
                               NC_003997.3
ref|NC_003997.3|:2833950-2835416             GeneID:1088556   lysP     BA3076   2833950
                               NC_003997.3
ref|NC_003997.3|:2835530-2835835             GeneID:1088586   -        BA3077   2835530
                               NC_003997.3
ref|NC_003997.3|:2835869-2836639             GeneID:1088592   -        BA3078   2835869
                               NC_003997.3
ref|NC_003997.3|:2837390-2838151             GeneID:1089202   -        BA3081   2837390
                               NC_003997.3
ref|NC_003997.3|:c2840521-2840000            GeneID:1088323   -        BA3086   2840000
                               NC_003997.3
ref|NC_003997.3|:c2844411-2843683            GeneID:1088325   -        BA3089   2843683
                               NC_003997.3
ref|NC_003997.3|:c2845134-2844487            GeneID:1086349   pcP      BA3090   2844487
                               NC_003997.3
ref|NC_003997.3|:c2848011-2847049            GeneID:1084996   -        BA3093   2847049
                               NC_003997.3
ref|NC_003997.3|:c2848717-2848013            GeneID:1087394   -        BA3094   2848013
                               NC_003997.3
ref|NC_003997.3|:c2849493-2848732            GeneID:1087399   -        BA3095   2848732
                               NC_003997.3
ref|NC_003997.3|:c2850500-2849538            GeneID:1088549   -        BA3096   2849538
                               NC_003997.3
ref|NC_003997.3|:c2851204-2850491            GeneID:1086475   -        BA3097   2850491
                               NC_003997.3
ref|NC_003997.3|:c2851971-2851219            GeneID:1085566   -        BA3098   2851219
                               NC_003997.3
ref|NC_003997.3|:c2852781-2852230            GeneID:1088352   sipU     BA3099   2852230
                               NC_003997.3
ref|NC_003997.3|:c2853482-2852805            GeneID:1088532   -        BA3100   2852805
                               NC_003997.3
ref|NC_003997.3|:c2855835-2855131            GeneID:1088359   -        BA3103   2855131
                               NC_003997.3
ref|NC_003997.3|:2855905-2856375             GeneID:1088353   -        BA3104   2855905
                               NC_003997.3
ref|NC_003997.3|:c2858525-2857893            GeneID:1088512   -        BA3106   2857893
                               NC_003997.3
ref|NC_003997.3|:c2859443-2858856            GeneID:1087923   -        BA3108   2858856
                               NC_003997.3
ref|NC_003997.3|:c2861435-2860107            GeneID:1088355   -        BA3110   2860107
                               NC_003997.3
ref|NC_003997.3|:c2862427-2861549            GeneID:1086385   -        BA3111   2861549
                               NC_003997.3
ref|NC_003997.3|:c2862943-2862431            GeneID:1088499   -        BA3112   2862431
                               NC_003997.3
ref|NC_003997.3|:c2864880-2863699            GeneID:1085562   -        BA3114   2863699
                               NC_003997.3
ref|NC_003997.3|:2865052-2865669             GeneID:1088356   -        BA3115   2865052
                               NC_003997.3
ref|NC_003997.3|:c2868335-2865729            GeneID:1087396   ppsA     BA3116   2865729
                               NC_003997.3
ref|NC_003997.3|:2868834-2869679             GeneID:1088598   -        BA3118   2868834
                               NC_003997.3
ref|NC_003997.3|:2876459-2876938             GeneID:1088360   -        BA3128   2876459
                               NC_003997.3
ref|NC_003997.3|:c2877489-2876974            GeneID:1087385   -        BA3129   2876974
                               NC_003997.3
ref|NC_003997.3|:2878244-2879377             GeneID:1087387   adhB     BA3131   2878244
                               NC_003997.3
ref|NC_003997.3|:c2884300-2883296            GeneID:1088368   ansA-2   BA3137   2883296
                               NC_003997.3
ref|NC_003997.3|:2884484-2884861             GeneID:1088420   ansR     BA3138   2884484
                               NC_003997.3
ref|NC_003997.3|:c2886046-2885405            GeneID:1088455   -        BA3140   2885405
                               NC_003997.3
ref|NC_003997.3|:c2887628-2886213            GeneID:1088459   -        BA3141   2886213
                               NC_003997.3
ref|NC_003997.3|:c2890282-2889452            GeneID:1086466   proC     BA3143   2889452
                               NC_003997.3
ref|NC_003997.3|:c2899008-2898064            GeneID:1086758   -        BA3153   2898064
                               NC_003997.3
ref|NC_003997.3|:c2901543-2900563            GeneID:1086611   glsA-2   BA3155   2900563
                               NC_003997.3
ref|NC_003997.3|:2904234-2905385             GeneID:1088372   -        BA3157   2904234
                               NC_003997.3
ref|NC_003997.3|:c2910095-2908506            GeneID:1088371   -        BA3162   2908506
                               NC_003997.3
ref|NC_003997.3|:c2913371-2912535            GeneID:1083660   -        BA3165   2912535
                               NC_003997.3
ref|NC_003997.3|:2913864-2914508             GeneID:1087788   -      BA3166       2913864
                               NC_003997.3
ref|NC_003997.3|:2914682-2915326             GeneID:1086562   -      BA3167       2914682
                               NC_003997.3
ref|NC_003997.3|:2915371-2915916             GeneID:1085618   -      BA3168       2915371
                               NC_003997.3
ref|NC_003997.3|:c2918924-2918046            GeneID:1085948   -      BA3170       2918046
                               NC_003997.3
ref|NC_003997.3|:c2922295-2921270            GeneID:1086242   -      BA3174       2921270
                               NC_003997.3
ref|NC_003997.3|:c2923204-2922818            GeneID:1083637   -      BA3176       2922818
                               NC_003997.3
ref|NC_003997.3|:c2924759-2924049            GeneID:1086654   -      BA3178       2924049
                               NC_003997.3
ref|NC_003997.3|:c2926840-2925431            GeneID:1086563   -      BA3180       2925431
                               NC_003997.3
ref|NC_003997.3|:c2927538-2927026            GeneID:1086876   -      BA3181       2927026
                               NC_003997.3
ref|NC_003997.3|:c2930243-2927619            GeneID:1086884   -      BA3182       2927619
                               NC_003997.3
ref|NC_003997.3|:c2931775-2930243            GeneID:1086894   ndhF   BA3183       2930243
                               NC_003997.3
ref|NC_003997.3|:2933335-2933889             GeneID:1084113   -      BA3185       2933335
                               NC_003997.3
ref|NC_003997.3|:c2934886-2933975            GeneID:1086881   -      BA3186       2933975
                               NC_003997.3
ref|NC_003997.3|:c2940154-2939555            GeneID:1086291   -      BA3192       2939555
-                              -             -                -      -        -
                               NC_003997.3
ref|NC_003997.3|:c2942744-2941914            GeneID:1086601   -      BA3195       2941914
                               NC_003997.3
ref|NC_003997.3|:c2943302-2942898            GeneID:1086394   arsC   BA3196       2942898
                               NC_003997.3
ref|NC_003997.3|:c2944368-2943328            GeneID:1087292   acr3   BA3197       2943328
                               NC_003997.3
ref|NC_003997.3|:c2944824-2944387            GeneID:1089107   -      BA3198       2944387
                               NC_003997.3
ref|NC_003997.3|:c2945189-2944884            GeneID:1087300   arsR   BA3199       2944884
                               NC_003997.3
ref|NC_003997.3|:c2951167-2950394            GeneID:1087190   -      BA3204       2950394
                               NC_003997.3
ref|NC_003997.3|:2951326-2951766             GeneID:1087457   -      BA3205       2951326
                               NC_003997.3
ref|NC_003997.3|:c2953038-2951833            GeneID:1087474   -      BA3206       2951833
                               NC_003997.3
ref|NC_003997.3|:c2955583-2953304            GeneID:1087476   -      BA3207       2953304
                               NC_003997.3
ref|NC_003997.3|:2955725-2956117             GeneID:1086781   -      BA3208       2955725
                               NC_003997.3
ref|NC_003997.3|:c2962215-2960140            GeneID:1087646   -      BA3214       2960140
                               NC_003997.3
ref|NC_003997.3|:c2963949-2963644            GeneID:1089210   -      BA3218       2963644
                               NC_003997.3
ref|NC_003997.3|:c2964517-2964167            GeneID:1089208   -      BA3219       2964167
                               NC_003997.3
ref|NC_003997.3|:c2965261-2964842            GeneID:1083719   -      BA3220       2964842
                               NC_003997.3
ref|NC_003997.3|:c2968741-2965544            GeneID:1089205   cypD   BA3221       2965544
                               NC_003997.3
ref|NC_003997.3|:c2970805-2969327            GeneID:1083781   -      BA3223       2969327
                               NC_003997.3
ref|NC_003997.3|:2971230-2971832             GeneID:1083739   -      BA3225       2971230
                               NC_003997.3
ref|NC_003997.3|:c2973281-2972958            GeneID:1089190   -      BA3227       2972958
                               NC_003997.3
ref|NC_003997.3|:c2973772-2973302            GeneID:1089170   -      BA3228       2973302
                               NC_003997.3
ref|NC_003997.3|:2973948-2974622             GeneID:1083819   -      BA3229       2973948
                               NC_003997.3
ref|NC_003997.3|:2974619-2975992             GeneID:1089187   -      BA3230       2974619
                               NC_003997.3
ref|NC_003997.3|:c2978260-2976815            GeneID:1083933   -      BA3232       2976815
                               NC_003997.3
ref|NC_003997.3|:c2981195-2980200            GeneID:1083934   -      BA3236       2980200
                               NC_003997.3
ref|NC_003997.3|:c2982147-2981548            GeneID:1089160   -      BA3238       2981548
                               NC_003997.3
ref|NC_003997.3|:c2982780-2982202            GeneID:1083973   -      BA3239       2982202
                               NC_003997.3
ref|NC_003997.3|:c2993568-2992648            GeneID:1084085   -      BA3252       2992648
                               NC_003997.3
ref|NC_003997.3|:2993783-2994364             GeneID:1084075   -      BA3253       2993783
                               NC_003997.3
ref|NC_003997.3|:2994514-2995632             GeneID:1084110   -      BA3254       2994514
                               NC_003997.3
ref|NC_003997.3|:c2996368-2995697            GeneID:1084102   -      BA3255       2995697
                               NC_003997.3
ref|NC_003997.3|:c2997432-2996368            GeneID:1084149   -      BA3256       2996368
                               NC_003997.3
ref|NC_003997.3|:2997617-2998240             GeneID:1089135   -      BA3257       2997617
                               NC_003997.3
ref|NC_003997.3|:2998310-2999569             GeneID:1084127   -      BA3258       2998310
                               NC_003997.3
ref|NC_003997.3|:c3001132-2999756            GeneID:1089122   -      BA3260       2999756
                               NC_003997.3
ref|NC_003997.3|:c3001811-3001134            GeneID:1089115   -      BA3261       3001134
                               NC_003997.3
ref|NC_003997.3|:c3005349-3004510            GeneID:1089104   -      BA3266       3004510
                               NC_003997.3
ref|NC_003997.3|:c3011931-3011290            GeneID:1089080   -      BA3272       3011290
                               NC_003997.3
ref|NC_003997.3|:3012220-3013251             GeneID:1084368   -      BA3275       3012220
                               NC_003997.3
ref|NC_003997.3|:c3015109-3014897            GeneID:1084441   -        BA3278   3014897
                               NC_003997.3
ref|NC_003997.3|:c3016615-3015413            GeneID:1089063   -        BA3279   3015413
                               NC_003997.3
ref|NC_003997.3|:3021253-3022368             GeneID:1084490   -        BA3284   3021253
                               NC_003997.3
ref|NC_003997.3|:c3029674-3027722            GeneID:1084918   -        BA3291   3027722
                               NC_003997.3
ref|NC_003997.3|:c3038682-3035800            GeneID:1085070   -        BA3299   3035800
                               NC_003997.3
ref|NC_003997.3|:c3040770-3039601            GeneID:1087038   -        BA3302   3039601
                               NC_003997.3
ref|NC_003997.3|:3041141-3041716             GeneID:1086845   -        BA3303   3041141
                               NC_003997.3
ref|NC_003997.3|:c3051186-3048856            GeneID:1088507   hypF     BA3313   3048856
                               NC_003997.3
ref|NC_003997.3|:c3052225-3051197            GeneID:1088500   -        BA3314   3051197
                               NC_003997.3
ref|NC_003997.3|:c3052889-3052308            GeneID:1088502   -        BA3315   3052308
                               NC_003997.3
ref|NC_003997.3|:c3053533-3053093            GeneID:1088496   -        BA3316   3053093
                               NC_003997.3
ref|NC_003997.3|:3053699-3054979             GeneID:1088501   -        BA3317   3053699
                               NC_003997.3
ref|NC_003997.3|:c3056637-3056128            GeneID:1088498   -        BA3318   3056128
                               NC_003997.3
ref|NC_003997.3|:c3059214-3058042            GeneID:1088491   -        BA3320   3058042
                               NC_003997.3
ref|NC_003997.3|:c3060201-3059227            GeneID:1088494   serC     BA3321   3059227
                               NC_003997.3
ref|NC_003997.3|:c3062899-3062708            GeneID:1088489   -        BA3325   3062708
                               NC_003997.3
ref|NC_003997.3|:c3064056-3062989            GeneID:1088484   -        BA3326   3062989
                               NC_003997.3
ref|NC_003997.3|:c3064554-3064237            GeneID:1088486   -        BA3327   3064237
                               NC_003997.3
ref|NC_003997.3|:c3065597-3064770            GeneID:1088483   -        BA3328   3064770
                               NC_003997.3
ref|NC_003997.3|:c3068541-3066151            GeneID:1088469   -        BA3330   3066151
                               NC_003997.3
ref|NC_003997.3|:c3069361-3068621            GeneID:1088472   -        BA3331   3068621
                               NC_003997.3
ref|NC_003997.3|:3071826-3072533             GeneID:1088453   -        BA3335   3071826
                               NC_003997.3
ref|NC_003997.3|:c3072943-3072611            GeneID:1088187   -        BA3336   3072611
                               NC_003997.3
ref|NC_003997.3|:c3076026-3075826            GeneID:1088104   -        BA3341   3075826
                               NC_003997.3
ref|NC_003997.3|:c3077206-3076010            GeneID:1088116   -        BA3342   3076010
                               NC_003997.3
ref|NC_003997.3|:c3078249-3077347            GeneID:1088061   -        BA3343   3077347
                               NC_003997.3
ref|NC_003997.3|:3078439-3078855             GeneID:1088091   -        BA3344   3078439
                               NC_003997.3
ref|NC_003997.3|:3078871-3080070             GeneID:1086327   -        BA3345   3078871
                               NC_003997.3
ref|NC_003997.3|:c3087836-3086298            GeneID:1084629   -        BA3355   3086298
                               NC_003997.3
ref|NC_003997.3|:c3107402-3106926            GeneID:1084764   -        BA3375   3106926
                               NC_003997.3
ref|NC_003997.3|:3107742-3109019             GeneID:1084846   hisS     BA3376   3107742
                               NC_003997.3
ref|NC_003997.3|:3109181-3109492             GeneID:1084820   -        BA3377   3109181
                               NC_003997.3
ref|NC_003997.3|:3109758-3110357             GeneID:1084829   -        BA3378   3109758
                               NC_003997.3
ref|NC_003997.3|:c3110796-3110416            GeneID:1084862   -        BA3379   3110416
                               NC_003997.3
ref|NC_003997.3|:3110925-3111608             GeneID:1084860   -        BA3380   3110925
                               NC_003997.3
ref|NC_003997.3|:3111762-3112037             GeneID:1084854   -        BA3381   3111762
                               NC_003997.3
ref|NC_003997.3|:c3113142-3112084            GeneID:1084882   pykA-1   BA3382   3112084
                               NC_003997.3
ref|NC_003997.3|:c3113945-3113235            GeneID:1084881   -        BA3383   3113235
                               NC_003997.3
ref|NC_003997.3|:c3115041-3114283            GeneID:1084900   fabG     BA3385   3114283
                               NC_003997.3
ref|NC_003997.3|:c3116756-3115098            GeneID:1084898   -        BA3386   3115098
                               NC_003997.3
ref|NC_003997.3|:c3117474-3116749            GeneID:1084899   -        BA3387   3116749
                               NC_003997.3
ref|NC_003997.3|:3117935-3118294             GeneID:1084907   -        BA3389   3117935
                               NC_003997.3
ref|NC_003997.3|:c3119503-3118541            GeneID:1084908   -        BA3391   3118541
                               NC_003997.3
ref|NC_003997.3|:c3120387-3119677            GeneID:1084930   -        BA3392   3119677
                               NC_003997.3
ref|NC_003997.3|:c3122269-3121247            GeneID:1084945   -        BA3394   3121247
                               NC_003997.3
ref|NC_003997.3|:3123295-3124134             GeneID:1084951   -        BA3396   3123295
                               NC_003997.3
ref|NC_003997.3|:c3133245-3132247            GeneID:1085187   -        BA3408   3132247
                               NC_003997.3
ref|NC_003997.3|:3133636-3134793             GeneID:1085180   dxr-1    BA3409   3133636
                               NC_003997.3
ref|NC_003997.3|:c3135953-3134823            GeneID:1085238   -        BA3410   3134823
                               NC_003997.3
ref|NC_003997.3|:c3136256-3136008            GeneID:1085241   -        BA3411   3136008
                               NC_003997.3
ref|NC_003997.3|:c3138086-3137331            GeneID:1085300   -        BA3414   3137331
                               NC_003997.3
ref|NC_003997.3|:c3138675-3138127            GeneID:1085400   -        BA3415   3138127
                               NC_003997.3
ref|NC_003997.3|:3138782-3139963             GeneID:1085371   -        BA3416       3138782
                               NC_003997.3
ref|NC_003997.3|:c3140907-3140020            GeneID:1085368   -        BA3417       3140020
                               NC_003997.3
ref|NC_003997.3|:3141202-3141597             GeneID:1085479   -        BA3418       3141202
                               NC_003997.3
ref|NC_003997.3|:c3142537-3141989            GeneID:1085537   -        BA3420       3141989
                               NC_003997.3
ref|NC_003997.3|:c3143150-3142737            GeneID:1085463   -        BA3421       3142737
                               NC_003997.3
ref|NC_003997.3|:c3144510-3143203            GeneID:1085526   -        BA3422       3143203
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c3145031-3144651            GeneID:1085524   -        BA3423       3144651
                               NC_003997.3
ref|NC_003997.3|:3145506-3146390             GeneID:1085558   -        BA3424       3145506
                               NC_003997.3
ref|NC_003997.3|:c3147257-3146436            GeneID:1085554   -        BA3425       3146436
                               NC_003997.3
ref|NC_003997.3|:c3148870-3147809            GeneID:1085563   -        BA3427       3147809
                               NC_003997.3
ref|NC_003997.3|:c3150539-3148998            GeneID:1085565   gntK     BA3428       3148998
                               NC_003997.3
ref|NC_003997.3|:c3151920-3150595            GeneID:1085585   gntP-2   BA3429       3150595
                               NC_003997.3
ref|NC_003997.3|:c3152978-3152310            GeneID:1085564   -        BA3430       3152310
                               NC_003997.3
ref|NC_003997.3|:c3153923-3153030            GeneID:1085582   -        BA3431       3153030
                               NC_003997.3
ref|NC_003997.3|:c3159518-3158565            GeneID:1085600   -        BA3435       3158565
                               NC_003997.3
ref|NC_003997.3|:c3160485-3159532            GeneID:1085596   -        BA3436       3159532
                               NC_003997.3
ref|NC_003997.3|:3160905-3161912             GeneID:1085598   -        BA3438       3160905
                               NC_003997.3
ref|NC_003997.3|:c3162966-3162172            GeneID:1085604   -        BA3440       3162172
                               NC_003997.3
ref|NC_003997.3|:c3165251-3163554            GeneID:1085605   -        BA3442       3163554
                               NC_003997.3
ref|NC_003997.3|:c3167635-3165407            GeneID:1085616   -        BA3443       3165407
                               NC_003997.3
ref|NC_003997.3|:c3168577-3167978            GeneID:1085614   -        BA3444       3167978
                               NC_003997.3
ref|NC_003997.3|:c3170033-3168960            GeneID:1085613   -        BA3445       3168960
                               NC_003997.3
ref|NC_003997.3|:c3173567-3173094            GeneID:1085630   -        BA3448       3173094
                               NC_003997.3
ref|NC_003997.3|:c3174086-3173610            GeneID:1085620   -        BA3449       3173610
                               NC_003997.3
ref|NC_003997.3|:c3178629-3178216            GeneID:1085640   -        BA3453       3178216
                               NC_003997.3
ref|NC_003997.3|:c3179613-3179218            GeneID:1085665   spxA     BA3456       3179218
                               NC_003997.3
ref|NC_003997.3|:c3183844-3182672            GeneID:1085677   cfa      BA3460       3182672
                               NC_003997.3
ref|NC_003997.3|:3186545-3186961             GeneID:1085692   -        BA3464       3186545
                               NC_003997.3
ref|NC_003997.3|:c3188011-3187187            GeneID:1085689   -        BA3465       3187187
                               NC_003997.3
ref|NC_003997.3|:c3189473-3188625            GeneID:1085700   -        BA3467       3188625
                               NC_003997.3
ref|NC_003997.3|:3189649-3189858             GeneID:1085698   -        BA3468       3189649
                               NC_003997.3
ref|NC_003997.3|:c3190871-3189972            GeneID:1085699   -        BA3469       3189972
                               NC_003997.3
ref|NC_003997.3|:c3194532-3193066            GeneID:1085704   -        BA3473       3193066
                               NC_003997.3
ref|NC_003997.3|:c3198653-3198378            GeneID:1083751   -        BA3479       3198378
                               NC_003997.3
ref|NC_003997.3|:c3203733-3202411            GeneID:1084171   -        BA3482       3202411
                               NC_003997.3
ref|NC_003997.3|:c3204448-3203726            GeneID:1084151   -        BA3483       3203726
                               NC_003997.3
ref|NC_003997.3|:c3205764-3205183            GeneID:1084090   -        BA3485       3205183
                               NC_003997.3
ref|NC_003997.3|:c3206760-3206107            GeneID:1084160   -        BA3486       3206107
                               NC_003997.3
ref|NC_003997.3|:3207377-3207967             GeneID:1084092   -        BA3487       3207377
                               NC_003997.3
ref|NC_003997.3|:c3209124-3208645            GeneID:1084091   -        BA3489       3208645
                               NC_003997.3
ref|NC_003997.3|:3209235-3209894             GeneID:1084084   -        BA3490       3209235
                               NC_003997.3
ref|NC_003997.3|:c3211744-3210995            GeneID:1084058   -        BA3492       3210995
                               NC_003997.3
ref|NC_003997.3|:c3212506-3211745            GeneID:1084060   -        BA3493       3211745
                               NC_003997.3
ref|NC_003997.3|:c3213398-3213078            GeneID:1084025   -        BA3495       3213078
                               NC_003997.3
ref|NC_003997.3|:c3215107-3213821            GeneID:1084026   -        BA3497       3213821
                               NC_003997.3
ref|NC_003997.3|:c3218478-3217741            GeneID:1084108   -        BA3501       3217741
                               NC_003997.3
ref|NC_003997.3|:3218911-3219201             GeneID:1084107   -        BA3503       3218911
                               NC_003997.3
ref|NC_003997.3|:c3222594-3221551            GeneID:1084393   -        BA3508       3221551
                               NC_003997.3
ref|NC_003997.3|:c3223119-3222766            GeneID:1084362   -        BA3509       3222766
                               NC_003997.3
ref|NC_003997.3|:c3223825-3223133            GeneID:1084356   -        BA3510       3223133
                               NC_003997.3
ref|NC_003997.3|:3223959-3224381             GeneID:1084367   -        BA3511       3223959
                               NC_003997.3
ref|NC_003997.3|:3224395-3224859             GeneID:1084325   -        BA3512       3224395
                               NC_003997.3
ref|NC_003997.3|:3224964-3225443             GeneID:1084321   -        BA3513       3224964
                               NC_003997.3
ref|NC_003997.3|:c3226236-3225484            GeneID:1084307   -        BA3514       3225484
                               NC_003997.3
ref|NC_003997.3|:c3228883-3227492            GeneID:1084278   -        BA3516       3227492
                               NC_003997.3
ref|NC_003997.3|:c3230712-3229513            GeneID:1084300   -        BA3518       3229513
                               NC_003997.3
ref|NC_003997.3|:c3232512-3232234            GeneID:1084267   -        BA3522       3232234
                               NC_003997.3
ref|NC_003997.3|:c3234564-3233902            GeneID:1084239   -        BA3524       3233902
                               NC_003997.3
ref|NC_003997.3|:c3234930-3234580            GeneID:1084244   -        BA3525       3234580
                               NC_003997.3
ref|NC_003997.3|:3235193-3236518             GeneID:1084222   -        BA3526       3235193
                               NC_003997.3
ref|NC_003997.3|:c3236817-3236590            GeneID:1084228   -        BA3527       3236590
                               NC_003997.3
ref|NC_003997.3|:c3239236-3238697            GeneID:1084199   -        BA3530       3238697
                               NC_003997.3
ref|NC_003997.3|:c3240240-3239461            GeneID:1084211   -        BA3531       3239461
                               NC_003997.3
ref|NC_003997.3|:c3241397-3240381            GeneID:1084208   -        BA3533       3240381
                               NC_003997.3
ref|NC_003997.3|:c3242432-3241398            GeneID:1084178   -        BA3534       3241398
                               NC_003997.3
ref|NC_003997.3|:3242703-3243467             GeneID:1084174   -        BA3535       3242703
                               NC_003997.3
ref|NC_003997.3|:c3244602-3243745            GeneID:1084599   -        BA3536       3243745
                               NC_003997.3
ref|NC_003997.3|:c3245837-3244851            GeneID:1084601   -        BA3537       3244851
                               NC_003997.3
ref|NC_003997.3|:c3246563-3246108            GeneID:1084600   -        BA3538       3246108
                               NC_003997.3
ref|NC_003997.3|:3246759-3247250             GeneID:1084585   -        BA3539       3246759
                               NC_003997.3
ref|NC_003997.3|:c3247824-3247348            GeneID:1084588   -        BA3540       3247348
                               NC_003997.3
ref|NC_003997.3|:c3248354-3247842            GeneID:1084589   -        BA3541       3247842
                               NC_003997.3
ref|NC_003997.3|:c3249549-3248656            GeneID:1084565   -        BA3543       3248656
                               NC_003997.3
ref|NC_003997.3|:3249673-3250638             GeneID:1084570   qor-2    BA3544       3249673
                               NC_003997.3
ref|NC_003997.3|:c3251408-3250704            GeneID:1084567   -        BA3545       3250704
                               NC_003997.3
ref|NC_003997.3|:c3252095-3251571            GeneID:1084552   -        BA3546       3251571
                               NC_003997.3
ref|NC_003997.3|:c3254003-3252102            GeneID:1084555   -        BA3547       3252102
                               NC_003997.3
ref|NC_003997.3|:3254616-3255245             GeneID:1084549   -        BA3550       3254616
                               NC_003997.3
ref|NC_003997.3|:c3256881-3255340            GeneID:1084526   amyS     BA3551       3255340
                               NC_003997.3
ref|NC_003997.3|:3258004-3259791             GeneID:1084534   pepF-2   BA3553       3258004
                               NC_003997.3
ref|NC_003997.3|:c3260960-3259827            GeneID:1084488   -        BA3554       3259827
                               NC_003997.3
ref|NC_003997.3|:3262877-3263728             GeneID:1084435   -        BA3557       3262877
                               NC_003997.3
ref|NC_003997.3|:c3265995-3265051            GeneID:1084017   -        BA3560       3265051
                               NC_003997.3
ref|NC_003997.3|:3270674-3271009             GeneID:1083966   -        BA3565       3270674
                               NC_003997.3
ref|NC_003997.3|:3271028-3272026             GeneID:1083967   -        BA3566       3271028
                               NC_003997.3
ref|NC_003997.3|:3272205-3273671             GeneID:1083912   -        BA3567       3272205
                               NC_003997.3
ref|NC_003997.3|:c3276915-3276568            GeneID:1083843   -        BA3573       3276568
                               NC_003997.3
ref|NC_003997.3|:c3277896-3276928            GeneID:1083891   -        BA3574       3276928
                               NC_003997.3
ref|NC_003997.3|:c3279292-3277901            GeneID:1083856   -        BA3575       3277901
                               NC_003997.3
ref|NC_003997.3|:c3279860-3279462            GeneID:1083824   -        BA3576       3279462
                               NC_003997.3
ref|NC_003997.3|:c3284721-3283591            GeneID:1083813   -        BA3581       3283591
                               NC_003997.3
ref|NC_003997.3|:c3287296-3284741            GeneID:1083803   -        BA3582       3284741
                               NC_003997.3
ref|NC_003997.3|:c3291495-3288580            GeneID:1083780   -        BA3584       3288580
                               NC_003997.3
ref|NC_003997.3|:c3292376-3291699            GeneID:1083779   -        BA3585       3291699
                               NC_003997.3
ref|NC_003997.3|:3292669-3293187             GeneID:1086359   -        BA3586       3292669
                               NC_003997.3
ref|NC_003997.3|:c3294412-3293483            GeneID:1086357   -        BA3587       3293483
                               NC_003997.3
ref|NC_003997.3|:c3295498-3294587            GeneID:1088064   -        BA3588       3294587
                               NC_003997.3
ref|NC_003997.3|:3296320-3297411             GeneID:1086368   -        BA3590       3296320
                               NC_003997.3
ref|NC_003997.3|:c3298084-3297722            GeneID:1086366   -        BA3591       3297722
                               NC_003997.3
ref|NC_003997.3|:c3299139-3298411            GeneID:1086387   -        BA3593       3298411
                               NC_003997.3
ref|NC_003997.3|:c3301222-3300779            GeneID:1086354   -        BA3596       3300779
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c3301984-3301364            GeneID:1086401   -        BA3597       3301364
                               NC_003997.3
ref|NC_003997.3|:c3302803-3302462            GeneID:1086404   -        BA3599   3302462
                               NC_003997.3
ref|NC_003997.3|:3302914-3303471             GeneID:1086409   -        BA3600   3302914
                               NC_003997.3
ref|NC_003997.3|:c3310595-3303519            GeneID:1088071   -        BA3601   3303519
                               NC_003997.3
ref|NC_003997.3|:3310712-3311461             GeneID:1086410   -        BA3602   3310712
                               NC_003997.3
ref|NC_003997.3|:c3313905-3312397            GeneID:1083763   argH-1   BA3604   3312397
                               NC_003997.3
ref|NC_003997.3|:c3315086-3314007            GeneID:1089183   -        BA3605   3314007
                               NC_003997.3
ref|NC_003997.3|:c3316165-3315233            GeneID:1089198   -        BA3606   3315233
                               NC_003997.3
ref|NC_003997.3|:c3317721-3316282            GeneID:1083802   panF     BA3607   3316282
                               NC_003997.3
ref|NC_003997.3|:c3318003-3317725            GeneID:1089186   -        BA3608   3317725
                               NC_003997.3
ref|NC_003997.3|:3318277-3319761             GeneID:1089172   dhaS     BA3609   3318277
                               NC_003997.3
ref|NC_003997.3|:c3320552-3319812            GeneID:1089168   fabG     BA3610   3319812
                               NC_003997.3
ref|NC_003997.3|:c3322759-3320906            GeneID:1083850   -        BA3612   3320906
                               NC_003997.3
ref|NC_003997.3|:c3323284-3322859            GeneID:1083995   -        BA3613   3322859
                               NC_003997.3
ref|NC_003997.3|:c3324305-3323364            GeneID:1089163   -        BA3614   3323364
                               NC_003997.3
ref|NC_003997.3|:c3326543-3325494            GeneID:1089124   -        BA3620   3325494
                               NC_003997.3
ref|NC_003997.3|:c3327315-3326851            GeneID:1084148   moaE-2   BA3622   3326851
                               NC_003997.3
ref|NC_003997.3|:c3328603-3327296            GeneID:1084200   moeA-2   BA3623   3327296
                               NC_003997.3
ref|NC_003997.3|:c3330442-3329663            GeneID:1089105   -        BA3625   3329663
                               NC_003997.3
ref|NC_003997.3|:c3331648-3330632            GeneID:1084255   narA-2   BA3627   3330632
                               NC_003997.3
ref|NC_003997.3|:c3332466-3331669            GeneID:1089087   fdhD-2   BA3628   3331669
                               NC_003997.3
ref|NC_003997.3|:c3332827-3332483            GeneID:1089090   -        BA3629   3332483
                               NC_003997.3
ref|NC_003997.3|:c3333425-3332943            GeneID:1084323   -        BA3630   3332943
                               NC_003997.3
ref|NC_003997.3|:c3336376-3333437            GeneID:1089073   -        BA3631   3333437
                               NC_003997.3
ref|NC_003997.3|:3336674-3338212             GeneID:1084413   gerSA    BA3633   3336674
                               NC_003997.3
ref|NC_003997.3|:3338209-3339306             GeneID:1089056   gerSB    BA3634   3338209
                               NC_003997.3
ref|NC_003997.3|:c3344185-3340715            GeneID:1084483   -        BA3637   3340715
                               NC_003997.3
ref|NC_003997.3|:c3346343-3344151            GeneID:1084547   -        BA3638   3344151
                               NC_003997.3
ref|NC_003997.3|:c3346836-3346501            GeneID:1089048   -        BA3639   3346501
                               NC_003997.3
ref|NC_003997.3|:3346971-3347366             GeneID:1084591   -        BA3640   3346971
                               NC_003997.3
ref|NC_003997.3|:c3348126-3347407            GeneID:1084595   -        BA3641   3347407
                               NC_003997.3
ref|NC_003997.3|:c3356794-3355757            GeneID:1084869   -        BA3647   3355757
                               NC_003997.3
ref|NC_003997.3|:c3360595-3359702            GeneID:1085889   -        BA3653   3359702
                               NC_003997.3
ref|NC_003997.3|:3360760-3361353             GeneID:1085867   -        BA3654   3360760
                               NC_003997.3
ref|NC_003997.3|:c3362408-3361377            GeneID:1085947   -        BA3655   3361377
                               NC_003997.3
ref|NC_003997.3|:c3365001-3362578            GeneID:1085874   parC     BA3656   3362578
                               NC_003997.3
ref|NC_003997.3|:c3366967-3365003            GeneID:1085976   parE     BA3657   3365003
                               NC_003997.3
ref|NC_003997.3|:c3367756-3367343            GeneID:1085950   -        BA3659   3367343
                               NC_003997.3
ref|NC_003997.3|:c3369077-3367836            GeneID:1086003   -        BA3660   3367836
                               NC_003997.3
ref|NC_003997.3|:c3369957-3369280            GeneID:1085996   -        BA3661   3369280
                               NC_003997.3
ref|NC_003997.3|:c3372281-3370425            GeneID:1086039   -        BA3663   3370425
                               NC_003997.3
ref|NC_003997.3|:3372507-3373103             GeneID:1086107   -        BA3665   3372507
                               NC_003997.3
ref|NC_003997.3|:3373212-3373502             GeneID:1086036   -        BA3666   3373212
                               NC_003997.3
ref|NC_003997.3|:c3373948-3373529            GeneID:1086092   -        BA3667   3373529
                               NC_003997.3
ref|NC_003997.3|:3374058-3375350             GeneID:1089237   -        BA3668   3374058
                               NC_003997.3
ref|NC_003997.3|:c3375576-3375379            GeneID:1086079   -        BA3669   3375379
                               NC_003997.3
ref|NC_003997.3|:c3377086-3376139            GeneID:1089228   -        BA3672   3376139
                               NC_003997.3
ref|NC_003997.3|:c3377777-3377202            GeneID:1089229   -        BA3674   3377202
                               NC_003997.3
ref|NC_003997.3|:c3382797-3380074            GeneID:1089249   acnA     BA3677   3380074
                               NC_003997.3
ref|NC_003997.3|:c3383921-3383280            GeneID:1089257   -        BA3679   3383280
                               NC_003997.3
ref|NC_003997.3|:c3384315-3384052            GeneID:1085169   -        BA3680   3384052
                               NC_003997.3
ref|NC_003997.3|:3384683-3385069             GeneID:1089250   cotM     BA3681   3384683
                               NC_003997.3
ref|NC_003997.3|:c3385388-3385113            GeneID:1085140   -        BA3682   3385113
                               NC_003997.3
ref|NC_003997.3|:c3385853-3385446            GeneID:1085145   -        BA3683       3385446
                               NC_003997.3
ref|NC_003997.3|:c3387681-3387238            GeneID:1085173   -        BA3685       3387238
                               NC_003997.3
ref|NC_003997.3|:3387786-3388367             GeneID:1085186   -        BA3686       3387786
                               NC_003997.3
ref|NC_003997.3|:c3389466-3388375            GeneID:1085222   -        BA3687       3388375
                               NC_003997.3
ref|NC_003997.3|:c3391563-3390988            GeneID:1085233   -        BA3689       3390988
                               NC_003997.3
ref|NC_003997.3|:c3393300-3391687            GeneID:1085360   alkK     BA3690       3391687
                               NC_003997.3
ref|NC_003997.3|:c3394100-3393897            GeneID:1085324   -        BA3692       3393897
                               NC_003997.3
ref|NC_003997.3|:3394253-3395065             GeneID:1085510   -        BA3693       3394253
                               NC_003997.3
ref|NC_003997.3|:3395237-3395449             GeneID:1085448   -        BA3694       3395237
                               NC_003997.3
ref|NC_003997.3|:c3398314-3398066            GeneID:1085513   -        BA3697       3398066
                               NC_003997.3
ref|NC_003997.3|:c3399606-3398803            GeneID:1085662   -        BA3699       3398803
                               NC_003997.3
ref|NC_003997.3|:3399751-3400560             GeneID:1085570   -        BA3700       3399751
                               NC_003997.3
ref|NC_003997.3|:3401189-3402721             GeneID:1085724   kinA     BA3702       3401189
                               NC_003997.3
ref|NC_003997.3|:c3403386-3402775            GeneID:1085729   -        BA3703       3402775
                               NC_003997.3
ref|NC_003997.3|:c3404349-3403411            GeneID:1085783   -        BA3704       3403411
                               NC_003997.3
ref|NC_003997.3|:c3406169-3404691            GeneID:1086255   -        BA3705       3404691
                               NC_003997.3
ref|NC_003997.3|:c3408025-3406457            GeneID:1086260   -        BA3706       3406457
                               NC_003997.3
ref|NC_003997.3|:c3409220-3408093            GeneID:1086226   -        BA3707       3408093
                               NC_003997.3
ref|NC_003997.3|:c3410278-3409802            GeneID:1086259   -        BA3708       3409802
                               NC_003997.3
ref|NC_003997.3|:c3412746-3411475            GeneID:1086228   hutI     BA3710       3411475
                               NC_003997.3
ref|NC_003997.3|:c3414417-3412759            GeneID:1086197   hutU     BA3711       3412759
                               NC_003997.3
ref|NC_003997.3|:c3415958-3414441            GeneID:1086204   hutH     BA3712       3414441
                               NC_003997.3
ref|NC_003997.3|:c3416503-3416063            GeneID:1086203   hutP     BA3713       3416063
                               NC_003997.3
ref|NC_003997.3|:c3418230-3417658            GeneID:1086176   -        BA3715       3417658
                               NC_003997.3
ref|NC_003997.3|:3419012-3419308             GeneID:1086155   -        BA3718       3419012
                               NC_003997.3
ref|NC_003997.3|:3419412-3419852             GeneID:1086684   -        BA3719       3419412
                               NC_003997.3
ref|NC_003997.3|:c3429359-3428853            GeneID:1086723   -        BA3726       3428853
                               NC_003997.3
ref|NC_003997.3|:c3430157-3429450            GeneID:1086807   ccdA-2   BA3727       3429450
                               NC_003997.3
ref|NC_003997.3|:c3430937-3430362            GeneID:1086814   -        BA3728       3430362
                               NC_003997.3
ref|NC_003997.3|:c3432073-3431168            GeneID:1086914   -        BA3729       3431168
                               NC_003997.3
ref|NC_003997.3|:3432226-3432591             GeneID:1086808   -        BA3730       3432226
                               NC_003997.3
ref|NC_003997.3|:3432588-3433265             GeneID:1086907   -        BA3731       3432588
                               NC_003997.3
ref|NC_003997.3|:c3438035-3437469            GeneID:1086988   -        BA3738       3437469
                               NC_003997.3
ref|NC_003997.3|:c3440943-3439180            GeneID:1087063   -        BA3740       3439180
                               NC_003997.3
ref|NC_003997.3|:c3442694-3440943            GeneID:1087030   -        BA3741       3440943
                               NC_003997.3
ref|NC_003997.3|:c3443558-3443118            GeneID:1087133   -        BA3743       3443118
                               NC_003997.3
ref|NC_003997.3|:c3445715-3443715            GeneID:1087096   tkt-2    BA3744       3443715
                               NC_003997.3
ref|NC_003997.3|:c3448329-3447526            GeneID:1087201   -        BA3747       3447526
                               NC_003997.3
ref|NC_003997.3|:c3449123-3448329            GeneID:1087205   -        BA3748       3448329
                               NC_003997.3
ref|NC_003997.3|:c3449893-3449120            GeneID:1087143   -        BA3749       3449120
                               NC_003997.3
ref|NC_003997.3|:c3450915-3449977            GeneID:1087204   -        BA3750       3449977
                               NC_003997.3
ref|NC_003997.3|:c3452962-3452723            GeneID:1087209   -        BA3752       3452723
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c3453664-3453008            GeneID:1087207   -        BA3753       3453008
                               NC_003997.3
ref|NC_003997.3|:3453806-3454426             GeneID:1087206   lexA     BA3754       3453806
                               NC_003997.3
ref|NC_003997.3|:c3455317-3454514            GeneID:1087243   -        BA3755       3454514
                               NC_003997.3
ref|NC_003997.3|:c3455863-3455321            GeneID:1087244   -        BA3756       3455321
                               NC_003997.3
ref|NC_003997.3|:c3508758-3508369            GeneID:1084985   glnR     BA3834       3508369
                               NC_003997.3
ref|NC_003997.3|:c3510205-3508934            GeneID:1085211   -        BA3835       3508934
                               NC_003997.3
ref|NC_003997.3|:c3511393-3510407            GeneID:1085161   -        BA3837       3510407
                               NC_003997.3
ref|NC_003997.3|:3511561-3512184             GeneID:1085237   -        BA3838       3511561
                               NC_003997.3
ref|NC_003997.3|:3513523-3514488             GeneID:1085177   -        BA3840       3513523
                               NC_003997.3
ref|NC_003997.3|:3514602-3516038             GeneID:1085292   -         BA3841   3514602
                               NC_003997.3
ref|NC_003997.3|:c3516343-3516119            GeneID:1085330   hfq-2     BA3842   3516119
                               NC_003997.3
ref|NC_003997.3|:c3517309-3516365            GeneID:1085280   miaA      BA3843   3516365
                               NC_003997.3
ref|NC_003997.3|:c3520968-3519088            GeneID:1085532   -         BA3846   3519088
                               NC_003997.3
ref|NC_003997.3|:c3521893-3520982            GeneID:1085365   fruB      BA3847   3520982
                               NC_003997.3
ref|NC_003997.3|:c3522642-3521890            GeneID:1085521   -         BA3848   3521890
                               NC_003997.3
ref|NC_003997.3|:c3524620-3524081            GeneID:1087690   -         BA3850   3524081
                               NC_003997.3
ref|NC_003997.3|:c3525249-3524935            GeneID:1085446   -         BA3852   3524935
                               NC_003997.3
ref|NC_003997.3|:c3526782-3525388            GeneID:1089133   gabP      BA3853   3525388
                               NC_003997.3
ref|NC_003997.3|:3527156-3528238             GeneID:1087689   chi36     BA3854   3527156
                               NC_003997.3
ref|NC_003997.3|:c3529328-3528435            GeneID:1085731   -         BA3856   3528435
                               NC_003997.3
ref|NC_003997.3|:3529525-3530340             GeneID:1087687   -         BA3857   3529525
                               NC_003997.3
ref|NC_003997.3|:c3533284-3530867            GeneID:1089191   -         BA3859   3530867
                               NC_003997.3
ref|NC_003997.3|:c3533586-3533380            GeneID:1088759   -         BA3860   3533380
                               NC_003997.3
ref|NC_003997.3|:c3534076-3533774            GeneID:1087688   -         BA3861   3533774
                               NC_003997.3
ref|NC_003997.3|:c3535754-3534927            GeneID:1088697   -         BA3863   3534927
                               NC_003997.3
ref|NC_003997.3|:c3536592-3535771            GeneID:1087682   -         BA3864   3535771
                               NC_003997.3
ref|NC_003997.3|:c3537629-3536607            GeneID:1088733   -         BA3865   3536607
                               NC_003997.3
ref|NC_003997.3|:c3538629-3537622            GeneID:1087679   -         BA3866   3537622
                               NC_003997.3
ref|NC_003997.3|:c3540673-3539915            GeneID:1087681   exoA      BA3868   3539915
                               NC_003997.3
ref|NC_003997.3|:3540828-3541424             GeneID:1088757   adaA      BA3869   3540828
                               NC_003997.3
ref|NC_003997.3|:3541405-3541935             GeneID:1088758   ogt-2     BA3870   3541405
                               NC_003997.3
ref|NC_003997.3|:3541932-3542843             GeneID:1088762   alkA      BA3871   3541932
                               NC_003997.3
ref|NC_003997.3|:c3544115-3542883            GeneID:1088747   pepT-1    BA3872   3542883
                               NC_003997.3
ref|NC_003997.3|:c3545355-3545038            GeneID:1088639   -         BA3874   3545038
                               NC_003997.3
ref|NC_003997.3|:c3546254-3545679            GeneID:1088756   -         BA3876   3545679
                               NC_003997.3
ref|NC_003997.3|:c3547100-3546285            GeneID:1089112   -         BA3877   3546285
                               NC_003997.3
ref|NC_003997.3|:3548110-3550845             GeneID:1088652   -         BA3879   3548110
                               NC_003997.3
ref|NC_003997.3|:c3553661-3553002            GeneID:1089259   -         BA3884   3553002
                               NC_003997.3
ref|NC_003997.3|:c3554041-3553685            GeneID:1087660   -         BA3885   3553685
                               NC_003997.3
ref|NC_003997.3|:c3555508-3554075            GeneID:1089109   -         BA3886   3554075
                               NC_003997.3
ref|NC_003997.3|:c3558636-3557647            GeneID:1088002   -         BA3891   3557647
                               NC_003997.3
ref|NC_003997.3|:c3560655-3558814            GeneID:1088014   -         BA3892   3558814
                               NC_003997.3
ref|NC_003997.3|:3562011-3563348             GeneID:1083695   -         BA3894   3562011
                               NC_003997.3
ref|NC_003997.3|:3563739-3565658             GeneID:1087974   -         BA3895   3563739
                               NC_003997.3
ref|NC_003997.3|:c3568527-3565744            GeneID:1085257   -         BA3896   3565744
                               NC_003997.3
ref|NC_003997.3|:c3577103-3575223            GeneID:1085120   mutL      BA3904   3575223
                               NC_003997.3
ref|NC_003997.3|:c3579790-3577112            GeneID:1087964   mutS      BA3905   3577112
                               NC_003997.3
ref|NC_003997.3|:c3580514-3579972            GeneID:1085215   cotE      BA3906   3579972
                               NC_003997.3
ref|NC_003997.3|:c3581071-3580640            GeneID:1086208   -         BA3907   3580640
                               NC_003997.3
ref|NC_003997.3|:c3582604-3581075            GeneID:1087981   -         BA3908   3581075
                               NC_003997.3
ref|NC_003997.3|:c3583898-3583032            GeneID:1085171   -         BA3909   3583032
                               NC_003997.3
ref|NC_003997.3|:c3585642-3583885            GeneID:1086202   -         BA3910   3583885
                               NC_003997.3
ref|NC_003997.3|:c3586793-3585870            GeneID:1087955   -         BA3911   3585870
                               NC_003997.3
ref|NC_003997.3|:c3587113-3586853            GeneID:1086209   spoVS-2   BA3912   3586853
                               NC_003997.3
ref|NC_003997.3|:c3588057-3587263            GeneID:1087927   -         BA3913   3587263
                               NC_003997.3
ref|NC_003997.3|:c3589785-3588223            GeneID:1086205   -         BA3914   3588223
                               NC_003997.3
ref|NC_003997.3|:c3591626-3590268            GeneID:1087627   recA      BA3915   3590268
                               NC_003997.3
ref|NC_003997.3|:c3593608-3593030            GeneID:1087642   pgsA      BA3917   3593030
                               NC_003997.3
ref|NC_003997.3|:c3594583-3593672            GeneID:1085165   -         BA3918   3593672
                               NC_003997.3
ref|NC_003997.3|:c3595390-3594605            GeneID:1086201   -         BA3919   3594605
                               NC_003997.3
ref|NC_003997.3|:c3596567-3595854            GeneID:1086939   fabG      BA3921   3595854
                               NC_003997.3
ref|NC_003997.3|:c3597957-3596671            GeneID:1087612   -        BA3922       3596671
                               NC_003997.3
ref|NC_003997.3|:c3599232-3597958            GeneID:1086931   -        BA3923       3597958
                               NC_003997.3
ref|NC_003997.3|:c3602973-3601441            GeneID:1086912   -        BA3926       3601441
                               NC_003997.3
ref|NC_003997.3|:c3604149-3603082            GeneID:1086937   -        BA3927       3603082
                               NC_003997.3
ref|NC_003997.3|:c3604964-3604239            GeneID:1084491   -        BA3928       3604239
                               NC_003997.3
ref|NC_003997.3|:c3607883-3605502            GeneID:1086911   -        BA3930       3605502
                               NC_003997.3
ref|NC_003997.3|:c3609044-3608295            GeneID:1086920   -        BA3932       3608295
                               NC_003997.3
ref|NC_003997.3|:c3610819-3609149            GeneID:1086904   -        BA3933       3609149
                               NC_003997.3
ref|NC_003997.3|:c3612463-3611585            GeneID:1086559   dapA-2   BA3935       3611585
                               NC_003997.3
ref|NC_003997.3|:c3613707-3612475            GeneID:1086910   dapG-2   BA3936       3612475
                               NC_003997.3
ref|NC_003997.3|:c3614777-3613731            GeneID:1086903   asd-2    BA3937       3613731
                               NC_003997.3
ref|NC_003997.3|:c3615527-3614928            GeneID:1086902   spoVFB   BA3938       3614928
                               NC_003997.3
ref|NC_003997.3|:c3616426-3615524            GeneID:1086865   spoVFA   BA3939       3615524
                               NC_003997.3
ref|NC_003997.3|:c3618320-3617079            GeneID:1086899   -        BA3942       3617079
                               NC_003997.3
ref|NC_003997.3|:c3619306-3618407            GeneID:1086849   -        BA3943       3618407
                               NC_003997.3
ref|NC_003997.3|:c3621596-3619458            GeneID:1086877   pnp      BA3944       3619458
                               NC_003997.3
ref|NC_003997.3|:c3622026-3621757            GeneID:1086841   rpsO     BA3945       3621757
                               NC_003997.3
ref|NC_003997.3|:c3623098-3622127            GeneID:1086886   ribC     BA3946       3622127
                               NC_003997.3
ref|NC_003997.3|:c3624508-3624152            GeneID:1087561   rbfA     BA3948       3624152
                               NC_003997.3
ref|NC_003997.3|:c3624805-3624524            GeneID:1086858   -        BA3949       3624524
                               NC_003997.3
ref|NC_003997.3|:c3626862-3624802            GeneID:1086560   infB     BA3950       3624802
                               NC_003997.3
ref|NC_003997.3|:c3627178-3626867            GeneID:1086851   -        BA3951       3626867
                               NC_003997.3
ref|NC_003997.3|:c3627451-3627179            GeneID:1086830   -        BA3952       3627179
                               NC_003997.3
ref|NC_003997.3|:c3628569-3627463            GeneID:1087548   nusA     BA3953       3627463
                               NC_003997.3
ref|NC_003997.3|:c3629057-3628587            GeneID:1086834   -        BA3954       3628587
                               NC_003997.3
ref|NC_003997.3|:c3633691-3629390            GeneID:1087547   polC     BA3955       3629390
                               NC_003997.3
ref|NC_003997.3|:c3635516-3633816            GeneID:1086582   proS-2   BA3957       3633816
                               NC_003997.3
ref|NC_003997.3|:c3638041-3636899            GeneID:1086817   dxr-2    BA3959       3636899
                               NC_003997.3
ref|NC_003997.3|:c3638856-3638065            GeneID:1086827   cdsA     BA3960       3638065
                               NC_003997.3
ref|NC_003997.3|:c3639650-3638874            GeneID:1086839   uppS     BA3961       3638874
                               NC_003997.3
ref|NC_003997.3|:c3640293-3639736            GeneID:1086824   frr      BA3962       3639736
                               NC_003997.3
ref|NC_003997.3|:c3641018-3640296            GeneID:1086816   -        BA3963       3640296
                               NC_003997.3
ref|NC_003997.3|:c3641972-3641085            GeneID:1086812   tsf      BA3964       3641085
                               NC_003997.3
ref|NC_003997.3|:c3642777-3642076            GeneID:1086819   rpsB     BA3965       3642076
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c3645375-3643984            GeneID:1086805   hslU     BA3967       3643984
                               NC_003997.3
ref|NC_003997.3|:c3645940-3645398            GeneID:1086806   hslV     BA3968       3645398
                               NC_003997.3
ref|NC_003997.3|:c3646882-3645983            GeneID:1086787   -        BA3969       3645983
                               NC_003997.3
ref|NC_003997.3|:c3648252-3646948            GeneID:1086598   gid      BA3970       3646948
                               NC_003997.3
ref|NC_003997.3|:c3650381-3648303            GeneID:1086791   topA     BA3971       3648303
                               NC_003997.3
ref|NC_003997.3|:c3652384-3651482            GeneID:1086597   sucD     BA3973       3651482
                               NC_003997.3
ref|NC_003997.3|:c3653565-3652405            GeneID:1086813   sucC     BA3974       3652405
                               NC_003997.3
ref|NC_003997.3|:c3655474-3654584            GeneID:1086795   -        BA3976       3654584
                               NC_003997.3
ref|NC_003997.3|:c3656492-3656148            GeneID:1086794   rplS     BA3978       3656148
                               NC_003997.3
ref|NC_003997.3|:c3657373-3656639            GeneID:1086804   trmD     BA3979       3656639
                               NC_003997.3
ref|NC_003997.3|:c3657888-3657373            GeneID:1087540   rimM     BA3980       3657373
                               NC_003997.3
ref|NC_003997.3|:c3658236-3658009            GeneID:1086782   -        BA3981       3658009
                               NC_003997.3
ref|NC_003997.3|:c3658523-3658251            GeneID:1086780   rpsP     BA3982       3658251
                               NC_003997.3
ref|NC_003997.3|:c3659973-3658624            GeneID:1087538   ffH      BA3983       3658624
                               NC_003997.3
ref|NC_003997.3|:c3660318-3659986            GeneID:1086774   -        BA3984       3659986
                               NC_003997.3
ref|NC_003997.3|:c3661440-3660451            GeneID:1086789   ftsY     BA3985       3660451
                               NC_003997.3
ref|NC_003997.3|:c3665025-3661456            GeneID:1086762   smC      BA3986       3661456
                               NC_003997.3
ref|NC_003997.3|:c3665909-3665172            GeneID:1087539   rncS      BA3987   3665172
                               NC_003997.3
ref|NC_003997.3|:c3666201-3665968            GeneID:1086750   acpP      BA3988   3665968
                               NC_003997.3
ref|NC_003997.3|:c3667011-3666271            GeneID:1087537   fabG      BA3989   3666271
                               NC_003997.3
ref|NC_003997.3|:c3667955-3667011            GeneID:1086769   fabD      BA3990   3667011
                               NC_003997.3
ref|NC_003997.3|:c3668962-3667970            GeneID:1086734   plsX      BA3991   3667970
                               NC_003997.3
ref|NC_003997.3|:c3669552-3668959            GeneID:1087536   -         BA3992   3668959
                               NC_003997.3
ref|NC_003997.3|:c3671689-3669641            GeneID:1086614   recG      BA3993   3669641
                               NC_003997.3
ref|NC_003997.3|:c3673655-3671979            GeneID:1086765   -         BA3994   3671979
                               NC_003997.3
ref|NC_003997.3|:c3675468-3674827            GeneID:1086760   -         BA3997   3674827
                               NC_003997.3
ref|NC_003997.3|:c3676251-3675607            GeneID:1086753   rpe       BA3998   3675607
                               NC_003997.3
ref|NC_003997.3|:c3677135-3676254            GeneID:1086726   -         BA3999   3676254
                               NC_003997.3
ref|NC_003997.3|:c3679377-3677404            GeneID:1086759   -         BA4000   3677404
                               NC_003997.3
ref|NC_003997.3|:c3680138-3679386            GeneID:1086717   -         BA4001   3679386
                               NC_003997.3
ref|NC_003997.3|:c3681231-3680143            GeneID:1086738   -         BA4002   3680143
                               NC_003997.3
ref|NC_003997.3|:c3682570-3681236            GeneID:1086737   sun       BA4003   3681236
                               NC_003997.3
ref|NC_003997.3|:c3683511-3682567            GeneID:1086742   fmt       BA4004   3682567
                               NC_003997.3
ref|NC_003997.3|:c3684005-3683535            GeneID:1086728   def       BA4005   3683535
                               NC_003997.3
ref|NC_003997.3|:c3686422-3684017            GeneID:1086752   priA      BA4006   3684017
                               NC_003997.3
ref|NC_003997.3|:c3687624-3686419            GeneID:1086733   coaBC     BA4007   3686419
                               NC_003997.3
ref|NC_003997.3|:c3688009-3687797            GeneID:1086722   rpoZ      BA4008   3687797
                               NC_003997.3
ref|NC_003997.3|:c3688629-3688012            GeneID:1087515   gmk       BA4009   3688012
                               NC_003997.3
ref|NC_003997.3|:c3688906-3688643            GeneID:1086719   -         BA4010   3688643
                               NC_003997.3
ref|NC_003997.3|:c3689849-3688974            GeneID:1086724   -         BA4011   3688974
                               NC_003997.3
ref|NC_003997.3|:3692776-3694485             GeneID:1086695   -         BA4013   3692776
                               NC_003997.3
ref|NC_003997.3|:3694813-3695883             GeneID:1086659   -         BA4014   3694813
                               NC_003997.3
ref|NC_003997.3|:c3696371-3696003            GeneID:1087499   -         BA4016   3696003
                               NC_003997.3
ref|NC_003997.3|:c3696752-3696387            GeneID:1086676   -         BA4017   3696387
                               NC_003997.3
ref|NC_003997.3|:3696919-3698304             GeneID:1086669   -         BA4018   3696919
                               NC_003997.3
ref|NC_003997.3|:3698471-3698725             GeneID:1086685   -         BA4019   3698471
                               NC_003997.3
ref|NC_003997.3|:c3700099-3699467            GeneID:1086652   pyrE      BA4021   3699467
                               NC_003997.3
ref|NC_003997.3|:c3700812-3700096            GeneID:1086616   pyrF      BA4022   3700096
                               NC_003997.3
ref|NC_003997.3|:c3701726-3700797            GeneID:1086679   pyrD      BA4023   3700797
                               NC_003997.3
ref|NC_003997.3|:c3702502-3701723            GeneID:1086681   pyrK      BA4024   3701723
                               NC_003997.3
ref|NC_003997.3|:c3705717-3702499            GeneID:1086666   carB      BA4025   3702499
                               NC_003997.3
ref|NC_003997.3|:c3706799-3705702            GeneID:1086653   carA      BA4026   3705702
                               NC_003997.3
ref|NC_003997.3|:c3708082-3706796            GeneID:1086660   pyrC      BA4027   3706796
                               NC_003997.3
ref|NC_003997.3|:c3708980-3708066            GeneID:1086640   pyrB      BA4028   3708066
                               NC_003997.3
ref|NC_003997.3|:c3710412-3709129            GeneID:1086620   uraA      BA4029   3709129
                               NC_003997.3
ref|NC_003997.3|:c3711101-3710559            GeneID:1086216   pyrR      BA4030   3710559
                               NC_003997.3
ref|NC_003997.3|:c3712675-3712217            GeneID:1086123   lspA      BA4032   3712217
                               NC_003997.3
ref|NC_003997.3|:c3716050-3713285            GeneID:1086630   ileS-2    BA4034   3713285
                               NC_003997.3
ref|NC_003997.3|:c3716904-3716398            GeneID:1086635   divIVA    BA4035   3716398
                               NC_003997.3
ref|NC_003997.3|:c3717761-3716994            GeneID:1086627   -         BA4036   3716994
                               NC_003997.3
ref|NC_003997.3|:c3718517-3718047            GeneID:1086622   -         BA4038   3718047
                               NC_003997.3
ref|NC_003997.3|:c3719211-3718537            GeneID:1086636   -         BA4039   3718537
                               NC_003997.3
ref|NC_003997.3|:c3720026-3719208            GeneID:1086621   -         BA4040   3719208
                               NC_003997.3
ref|NC_003997.3|:c3721375-3720596            GeneID:1086511   sigG      BA4042   3720596
                               NC_003997.3
ref|NC_003997.3|:c3723198-3722272            GeneID:1086625   spoIIGA   BA4044   3722272
                               NC_003997.3
ref|NC_003997.3|:c3724662-3723502            GeneID:1086328   ftsZ      BA4045   3723502
                               NC_003997.3
ref|NC_003997.3|:c3726003-3724702            GeneID:1086377   ftsA      BA4046   3724702
                               NC_003997.3
ref|NC_003997.3|:c3727173-3726376            GeneID:1086307   -         BA4047   3726376
                               NC_003997.3
ref|NC_003997.3|:c3728177-3727272            GeneID:1087051   murB      BA4048   3727272
                               NC_003997.3
ref|NC_003997.3|:c3729333-3728239            GeneID:1087469   murG    BA4049       3728239
                               NC_003997.3
ref|NC_003997.3|:c3730530-3729439            GeneID:1086101   spoVE   BA4050       3729439
                               NC_003997.3
ref|NC_003997.3|:c3731973-3730621            GeneID:1086094   murD    BA4051       3730621
                               NC_003997.3
ref|NC_003997.3|:c3732948-3731974            GeneID:1087475   mraY    BA4052       3731974
                               NC_003997.3
ref|NC_003997.3|:c3734446-3732971            GeneID:1086243   murE    BA4053       3732971
                               NC_003997.3
ref|NC_003997.3|:c3736571-3734655            GeneID:1087468   -       BA4054       3734655
                               NC_003997.3
ref|NC_003997.3|:c3738803-3736653            GeneID:1086649   -       BA4055       3736653
                               NC_003997.3
ref|NC_003997.3|:c3739187-3738825            GeneID:1086059   ftsL    BA4056       3738825
                               NC_003997.3
ref|NC_003997.3|:c3740135-3739203            GeneID:1088295   mraW    BA4057       3739203
                               NC_003997.3
ref|NC_003997.3|:c3742122-3740506            GeneID:1085776   -       BA4058       3740506
                               NC_003997.3
ref|NC_003997.3|:3743663-3744136             GeneID:1085555   -       BA4060       3743663
                               NC_003997.3
ref|NC_003997.3|:c3745541-3745041            GeneID:1085006   -       BA4063       3745041
                               NC_003997.3
ref|NC_003997.3|:c3792094-3791072            GeneID:1088657   -       BA4136       3791072
                               NC_003997.3
ref|NC_003997.3|:c3792878-3792087            GeneID:1086643   -       BA4137       3792087
                               NC_003997.3
ref|NC_003997.3|:3792992-3794221             GeneID:1088725   -       BA4138       3792992
                               NC_003997.3
ref|NC_003997.3|:c3794704-3794213            GeneID:1088744   coaD    BA4139       3794213
                               NC_003997.3
ref|NC_003997.3|:c3795267-3794701            GeneID:1088349   -       BA4140       3794701
                               NC_003997.3
ref|NC_003997.3|:c3796487-3796221            GeneID:1088413   -       BA4142       3796221
                               NC_003997.3
ref|NC_003997.3|:c3798532-3798095            GeneID:1088852   -       BA4146       3798095
                               NC_003997.3
ref|NC_003997.3|:c3799712-3798678            GeneID:1088191   -       BA4147       3798678
                               NC_003997.3
ref|NC_003997.3|:c3801329-3800331            GeneID:1088883   -       BA4149       3800331
                               NC_003997.3
ref|NC_003997.3|:c3802461-3801556            GeneID:1089019   -       BA4150       3801556
                               NC_003997.3
ref|NC_003997.3|:c3802879-3802547            GeneID:1088986   ctaF    BA4151       3802547
                               NC_003997.3
ref|NC_003997.3|:c3803506-3802883            GeneID:1089009   ctaE    BA4152       3802883
                               NC_003997.3
ref|NC_003997.3|:c3805341-3803506            GeneID:1088984   ctaD    BA4153       3803506
                               NC_003997.3
ref|NC_003997.3|:c3806451-3805402            GeneID:1088997   ctaC    BA4154       3805402
-                              -             -                -       -        -
                               NC_003997.3
ref|NC_003997.3|:c3807468-3806545            GeneID:1088962   -       BA4155       3806545
                               NC_003997.3
ref|NC_003997.3|:3807967-3808902             GeneID:1088948   ctaA    BA4156       3807967
                               NC_003997.3
ref|NC_003997.3|:c3812426-3808980            GeneID:1088950   pyc     BA4157       3808980
                               NC_003997.3
ref|NC_003997.3|:c3813859-3812750            GeneID:1088773   -       BA4158       3812750
                               NC_003997.3
ref|NC_003997.3|:c3814347-3814060            GeneID:1088768   -       BA4159       3814060
                               NC_003997.3
ref|NC_003997.3|:3814498-3814995             GeneID:1088767   -       BA4160       3814498
                               NC_003997.3
ref|NC_003997.3|:c3816340-3815027            GeneID:1088816   -       BA4161       3815027
                               NC_003997.3
ref|NC_003997.3|:c3817059-3816604            GeneID:1088774   -       BA4162       3816604
                               NC_003997.3
ref|NC_003997.3|:c3820033-3818189            GeneID:1088853   typA    BA4166       3818189
                               NC_003997.3
ref|NC_003997.3|:3820126-3820353             GeneID:1088817   -       BA4167       3820126
                               NC_003997.3
ref|NC_003997.3|:c3821189-3820398            GeneID:1088841   -       BA4168       3820398
                               NC_003997.3
ref|NC_003997.3|:c3821466-3821278            GeneID:1088765   -       BA4169       3821278
                               NC_003997.3
ref|NC_003997.3|:3821672-3822298             GeneID:1088776   -       BA4170       3821672
                               NC_003997.3
ref|NC_003997.3|:c3822649-3822380            GeneID:1089000   -       BA4171       3822380
                               NC_003997.3
ref|NC_003997.3|:3823007-3824488             GeneID:1089028   cad-2   BA4172       3823007
                               NC_003997.3
ref|NC_003997.3|:3824563-3825393             GeneID:1088859   tgl     BA4173       3824563
                               NC_003997.3
ref|NC_003997.3|:c3826409-3826113            GeneID:1088845   -       BA4177       3826113
                               NC_003997.3
ref|NC_003997.3|:c3828808-3827396            GeneID:1089036   pdhD    BA4181       3827396
                               NC_003997.3
ref|NC_003997.3|:c3830073-3828814            GeneID:1088857   pdhC    BA4182       3828814
                               NC_003997.3
ref|NC_003997.3|:c3831143-3830166            GeneID:1088802   pdhB    BA4183       3830166
                               NC_003997.3
ref|NC_003997.3|:c3832262-3831147            GeneID:1088810   pdhA    BA4184       3831147
                               NC_003997.3
ref|NC_003997.3|:3833069-3833623             GeneID:1088919   def     BA4187       3833069
                               NC_003997.3
ref|NC_003997.3|:c3834459-3833686            GeneID:1088865   -       BA4188       3833686
                               NC_003997.3
ref|NC_003997.3|:3835007-3835219             GeneID:1088867   -       BA4189       3835007
                               NC_003997.3
ref|NC_003997.3|:3835224-3836891             GeneID:1089013   -       BA4190       3835224
                               NC_003997.3
ref|NC_003997.3|:c3837596-3836931            GeneID:1088898   -        BA4191   3836931
                               NC_003997.3
ref|NC_003997.3|:c3839931-3838801            GeneID:1088811   -        BA4193   3838801
                               NC_003997.3
ref|NC_003997.3|:c3840715-3839993            GeneID:1088777   -        BA4194   3839993
                               NC_003997.3
ref|NC_003997.3|:c3841671-3840787            GeneID:1088915   -        BA4195   3840787
                               NC_003997.3
ref|NC_003997.3|:c3843916-3843680            GeneID:1089035   -        BA4200   3843680
                               NC_003997.3
ref|NC_003997.3|:3844150-3844386             GeneID:1088775   -        BA4201   3844150
                               NC_003997.3
ref|NC_003997.3|:c3844989-3844501            GeneID:1088769   -        BA4202   3844501
                               NC_003997.3
ref|NC_003997.3|:c3846368-3845172            GeneID:1088782   -        BA4203   3845172
                               NC_003997.3
ref|NC_003997.3|:c3847409-3846645            GeneID:1088834   -        BA4204   3846645
                               NC_003997.3
ref|NC_003997.3|:c3851126-3849018            GeneID:1088872   ppk      BA4208   3849018
                               NC_003997.3
ref|NC_003997.3|:c3852773-3851235            GeneID:1088386   -        BA4209   3851235
                               NC_003997.3
ref|NC_003997.3|:3852951-3853409             GeneID:1088443   -        BA4210   3852951
                               NC_003997.3
ref|NC_003997.3|:c3854103-3853441            GeneID:1088796   -        BA4211   3853441
                               NC_003997.3
ref|NC_003997.3|:c3855378-3854758            GeneID:1088951   -        BA4213   3854758
                               NC_003997.3
ref|NC_003997.3|:3856732-3858273             GeneID:1088972   -        BA4216   3856732
                               NC_003997.3
ref|NC_003997.3|:3859540-3861828             GeneID:1088935   metE     BA4218   3859540
                               NC_003997.3
ref|NC_003997.3|:c3862254-3861865            GeneID:1088931   comJ     BA4219   3861865
                               NC_003997.3
ref|NC_003997.3|:c3862725-3862291            GeneID:1087658   comI     BA4220   3862291
                               NC_003997.3
ref|NC_003997.3|:3862962-3863711             GeneID:1089017   -        BA4222   3862962
                               NC_003997.3
ref|NC_003997.3|:c3865039-3863765            GeneID:1089005   kinB-3   BA4223   3863765
                               NC_003997.3
ref|NC_003997.3|:3865673-3866836             GeneID:1088890   -        BA4225   3865673
                               NC_003997.3
ref|NC_003997.3|:c3867872-3866841            GeneID:1088967   malR     BA4226   3866841
                               NC_003997.3
ref|NC_003997.3|:c3868995-3868153            GeneID:1088792   malD     BA4227   3868153
                               NC_003997.3
ref|NC_003997.3|:c3870297-3868996            GeneID:1089032   malC     BA4228   3868996
                               NC_003997.3
ref|NC_003997.3|:3871947-3873707             GeneID:1089021   -        BA4230   3871947
                               NC_003997.3
ref|NC_003997.3|:c3875424-3873748            GeneID:1089023   malL     BA4231   3873748
                               NC_003997.3
ref|NC_003997.3|:3875686-3876786             GeneID:1088990   -        BA4232   3875686
                               NC_003997.3
ref|NC_003997.3|:c3877362-3876853            GeneID:1088979   -        BA4233   3876853
                               NC_003997.3
ref|NC_003997.3|:c3878158-3877703            GeneID:1089026   -        BA4235   3877703
                               NC_003997.3
ref|NC_003997.3|:3878290-3878730             GeneID:1088778   -        BA4236   3878290
                               NC_003997.3
ref|NC_003997.3|:c3879531-3878770            GeneID:1088988   -        BA4237   3878770
                               NC_003997.3
ref|NC_003997.3|:c3880298-3879570            GeneID:1088892   -        BA4238   3879570
                               NC_003997.3
ref|NC_003997.3|:3880511-3881236             GeneID:1088799   -        BA4239   3880511
                               NC_003997.3
ref|NC_003997.3|:c3882442-3881267            GeneID:1088795   -        BA4240   3881267
                               NC_003997.3
ref|NC_003997.3|:c3883067-3882582            GeneID:1088781   -        BA4241   3882582
                               NC_003997.3
ref|NC_003997.3|:c3883433-3883140            GeneID:1088900   -        BA4242   3883140
                               NC_003997.3
ref|NC_003997.3|:3883594-3884211             GeneID:1089025   -        BA4243   3883594
                               NC_003997.3
ref|NC_003997.3|:c3886702-3885938            GeneID:1088843   -        BA4247   3885938
                               NC_003997.3
ref|NC_003997.3|:c3887034-3886702            GeneID:1088848   -        BA4248   3886702
                               NC_003997.3
ref|NC_003997.3|:c3890506-3889325            GeneID:1088923   -        BA4252   3889325
                               NC_003997.3
ref|NC_003997.3|:c3891590-3890811            GeneID:1088829   -        BA4253   3890811
                               NC_003997.3
ref|NC_003997.3|:3891688-3892866             GeneID:1088912   -        BA4254   3891688
                               NC_003997.3
ref|NC_003997.3|:3893103-3894347             GeneID:1088830   -        BA4255   3893103
                               NC_003997.3
ref|NC_003997.3|:3894344-3895003             GeneID:1088838   -        BA4256   3894344
                               NC_003997.3
ref|NC_003997.3|:3895000-3895638             GeneID:1088836   -        BA4257   3895000
                               NC_003997.3
ref|NC_003997.3|:3895616-3896128             GeneID:1088831   -        BA4258   3895616
                               NC_003997.3
ref|NC_003997.3|:3896435-3896710             GeneID:1088825   -        BA4259   3896435
                               NC_003997.3
ref|NC_003997.3|:c3899693-3898401            GeneID:1088832   -        BA4263   3898401
                               NC_003997.3
ref|NC_003997.3|:3900026-3900643             GeneID:1088760   -        BA4264   3900026
                               NC_003997.3
ref|NC_003997.3|:3901344-3901706             GeneID:1087661   -        BA4266   3901344
                               NC_003997.3
ref|NC_003997.3|:c3903516-3901804            GeneID:1088347   ptsI     BA4267   3901804
                               NC_003997.3
ref|NC_003997.3|:c3903779-3903516            GeneID:1088448   ptsH-1   BA4268   3903516
                               NC_003997.3
ref|NC_003997.3|:c3905977-3903914            GeneID:1088399   ptsG       BA4269       3903914
                               NC_003997.3
ref|NC_003997.3|:c3907164-3906316            GeneID:1088681   glcT       BA4270       3906316
                               NC_003997.3
ref|NC_003997.3|:3907330-3908136             GeneID:1087657   -          BA4271       3907330
                               NC_003997.3
ref|NC_003997.3|:c3908938-3908207            GeneID:1088130   -          BA4272       3908207
                               NC_003997.3
ref|NC_003997.3|:c3909656-3908868            GeneID:1088131   nagB       BA4273       3908868
                               NC_003997.3
ref|NC_003997.3|:c3910803-3909661            GeneID:1088057   nagA       BA4274       3909661
                               NC_003997.3
ref|NC_003997.3|:c3912433-3911993            GeneID:1088147   scpB       BA4276       3911993
                               NC_003997.3
ref|NC_003997.3|:c3913466-3912723            GeneID:1088143   scpA       BA4278       3912723
                               NC_003997.3
ref|NC_003997.3|:c3914737-3914369            GeneID:1088136   ribT       BA4281       3914369
                               NC_003997.3
ref|NC_003997.3|:c3915643-3915206            GeneID:1088139   -          BA4283       3915206
                               NC_003997.3
ref|NC_003997.3|:3915831-3916697             GeneID:1088140   -          BA4284       3915831
                               NC_003997.3
ref|NC_003997.3|:c3917513-3916728            GeneID:1088142   -          BA4285       3916728
                               NC_003997.3
ref|NC_003997.3|:c3919100-3917628            GeneID:1088138   spoVAF     BA4286       3917628
                               NC_003997.3
ref|NC_003997.3|:c3921032-3920016            GeneID:1088478   spoVAD     BA4288       3920016
                               NC_003997.3
ref|NC_003997.3|:c3921504-3921046            GeneID:1088475   spoVAC-1   BA4289       3921046
                               NC_003997.3
ref|NC_003997.3|:c3921935-3921519            GeneID:1088476   spoVAB     BA4290       3921519
                               NC_003997.3
ref|NC_003997.3|:c3922554-3921928            GeneID:1088474   spoVAA     BA4291       3921928
                               NC_003997.3
ref|NC_003997.3|:c3924287-3922761            GeneID:1086821   -          BA4293       3922761
-                              -             -                -          -        -
                               NC_003997.3
ref|NC_003997.3|:c3925183-3924425            GeneID:1088482   sigF       BA4294       3924425
                               NC_003997.3
ref|NC_003997.3|:c3925636-3925196            GeneID:1086822   spoIIAB    BA4295       3925196
                               NC_003997.3
ref|NC_003997.3|:c3925987-3925637            GeneID:1086825   spoIIAA    BA4296       3925637
                               NC_003997.3
ref|NC_003997.3|:c3927348-3926158            GeneID:1087453   dacF       BA4297       3926158
                               NC_003997.3
ref|NC_003997.3|:3927515-3927934             GeneID:1087460   -          BA4298       3927515
                               NC_003997.3
ref|NC_003997.3|:3927900-3928781             GeneID:1087452   -          BA4299       3927900
                               NC_003997.3
ref|NC_003997.3|:c3931057-3930605            GeneID:1087462   -          BA4303       3930605
                               NC_003997.3
ref|NC_003997.3|:3931184-3931855             GeneID:1087461   -          BA4304       3931184
                               NC_003997.3
ref|NC_003997.3|:3931990-3933279             GeneID:1087464   -          BA4305       3931990
                               NC_003997.3
ref|NC_003997.3|:c3934276-3933314            GeneID:1087467   corA       BA4306       3933314
                               NC_003997.3
ref|NC_003997.3|:c3935643-3934339            GeneID:1087465   pyn-2      BA4307       3934339
                               NC_003997.3
ref|NC_003997.3|:c3936472-3935651            GeneID:1087479   -          BA4308       3935651
                               NC_003997.3
ref|NC_003997.3|:c3937669-3936485            GeneID:1087477   deoB       BA4309       3936485
                               NC_003997.3
ref|NC_003997.3|:c3938815-3938075            GeneID:1087488   -          BA4310       3938075
                               NC_003997.3
ref|NC_003997.3|:c3939852-3938962            GeneID:1087478   xerD       BA4311       3938962
                               NC_003997.3
ref|NC_003997.3|:c3940089-3939859            GeneID:1087486   -          BA4312       3939859
                               NC_003997.3
ref|NC_003997.3|:c3940648-3940193            GeneID:1087487   -          BA4313       3940193
                               NC_003997.3
ref|NC_003997.3|:c3941402-3940755            GeneID:1087491   spoIIM     BA4314       3940755
                               NC_003997.3
ref|NC_003997.3|:3941529-3942080             GeneID:1087494   -          BA4315       3941529
                               NC_003997.3
ref|NC_003997.3|:c3942644-3942105            GeneID:1087492   -          BA4316       3942105
                               NC_003997.3
ref|NC_003997.3|:3942901-3943815             GeneID:1087500   lolS       BA4318       3942901
                               NC_003997.3
ref|NC_003997.3|:c3944672-3943845            GeneID:1087501   -          BA4319       3943845
                               NC_003997.3
ref|NC_003997.3|:c3945325-3944801            GeneID:1087509   -          BA4320       3944801
                               NC_003997.3
ref|NC_003997.3|:3945860-3947449             GeneID:1087519   -          BA4322       3945860
                               NC_003997.3
ref|NC_003997.3|:c3948048-3947572            GeneID:1087507   -          BA4323       3947572
                               NC_003997.3
ref|NC_003997.3|:3948170-3949168             GeneID:1087514   -          BA4324       3948170
                               NC_003997.3
ref|NC_003997.3|:3949300-3950619             GeneID:1087522   -          BA4325       3949300
                               NC_003997.3
ref|NC_003997.3|:c3951506-3950643            GeneID:1087517   -          BA4326       3950643
                               NC_003997.3
ref|NC_003997.3|:c3952088-3951606            GeneID:1087521   -          BA4327       3951606
                               NC_003997.3
ref|NC_003997.3|:3952170-3953093             GeneID:1087520   -          BA4328       3952170
                               NC_003997.3
ref|NC_003997.3|:c3953349-3953104            GeneID:1087525   -          BA4329       3953104
                               NC_003997.3
ref|NC_003997.3|:3953429-3953695             GeneID:1087523   -          BA4330       3953429
                               NC_003997.3
ref|NC_003997.3|:3954341-3955453             GeneID:1087530   ribD       BA4331       3954341
                               NC_003997.3
ref|NC_003997.3|:3955435-3956079             GeneID:1087524   ribE     BA4332   3955435
                               NC_003997.3
ref|NC_003997.3|:3956092-3957285             GeneID:1087528   ribBA    BA4333   3956092
                               NC_003997.3
ref|NC_003997.3|:3957304-3957765             GeneID:1087551   ribH     BA4334   3957304
                               NC_003997.3
ref|NC_003997.3|:c3958112-3957741            GeneID:1087550   -        BA4335   3957741
                               NC_003997.3
ref|NC_003997.3|:c3959293-3958295            GeneID:1087549   bioB     BA4336   3958295
                               NC_003997.3
ref|NC_003997.3|:c3960104-3959295            GeneID:1087555   -        BA4337   3959295
                               NC_003997.3
ref|NC_003997.3|:c3960810-3960070            GeneID:1087552   -        BA4338   3960070
                               NC_003997.3
ref|NC_003997.3|:c3961994-3960807            GeneID:1087553   bioF     BA4339   3960807
                               NC_003997.3
ref|NC_003997.3|:c3962688-3961960            GeneID:1087558   bioD     BA4340   3961960
                               NC_003997.3
ref|NC_003997.3|:c3964076-3962688            GeneID:1087557   bioA     BA4341   3962688
                               NC_003997.3
ref|NC_003997.3|:c3964579-3964199            GeneID:1087556   -        BA4342   3964199
                               NC_003997.3
ref|NC_003997.3|:3965194-3966567             GeneID:1087564   nhaC-3   BA4345   3965194
                               NC_003997.3
ref|NC_003997.3|:3969326-3970105             GeneID:1087569   -        BA4347   3969326
                               NC_003997.3
ref|NC_003997.3|:3970178-3970624             GeneID:1087566   -        BA4348   3970178
                               NC_003997.3
ref|NC_003997.3|:c3971456-3970896            GeneID:1087575   -        BA4350   3970896
                               NC_003997.3
ref|NC_003997.3|:c3972583-3971633            GeneID:1087574   argF     BA4351   3971633
                               NC_003997.3
ref|NC_003997.3|:c3973756-3972596            GeneID:1087573   argD     BA4352   3972596
                               NC_003997.3
ref|NC_003997.3|:c3974520-3973753            GeneID:1087577   argB     BA4353   3973753
                               NC_003997.3
ref|NC_003997.3|:c3975755-3974532            GeneID:1087579   argJ     BA4354   3974532
                               NC_003997.3
ref|NC_003997.3|:3979165-3980004             GeneID:1087586   proC-3   BA4359   3979165
                               NC_003997.3
ref|NC_003997.3|:c3980933-3980055            GeneID:1087588   sdhA-2   BA4360   3980055
                               NC_003997.3
ref|NC_003997.3|:c3981611-3980952            GeneID:1087587   sdhB-2   BA4361   3980952
                               NC_003997.3
ref|NC_003997.3|:c3983278-3982355            GeneID:1087591   -        BA4364   3982355
                               NC_003997.3
ref|NC_003997.3|:3983468-3983719             GeneID:1087590   -        BA4365   3983468
                               NC_003997.3
ref|NC_003997.3|:c3985179-3983941            GeneID:1087598   -        BA4366   3983941
                               NC_003997.3
ref|NC_003997.3|:c3986686-3985568            GeneID:1087596   pepT-2   BA4368   3985568
                               NC_003997.3
ref|NC_003997.3|:c3987356-3986814            GeneID:1087601   -        BA4369   3986814
                               NC_003997.3
ref|NC_003997.3|:c3987952-3987713            GeneID:1087600   -        BA4371   3987713
                               NC_003997.3
ref|NC_003997.3|:c3988579-3988019            GeneID:1087606   -        BA4372   3988019
                               NC_003997.3
ref|NC_003997.3|:c3989564-3988596            GeneID:1087605   -        BA4373   3988596
                               NC_003997.3
ref|NC_003997.3|:c3990383-3989661            GeneID:1087604   -        BA4374   3989661
                               NC_003997.3
ref|NC_003997.3|:c3991035-3990376            GeneID:1087610   -        BA4375   3990376
                               NC_003997.3
ref|NC_003997.3|:c3992535-3992101            GeneID:1087609   -        BA4378   3992101
                               NC_003997.3
ref|NC_003997.3|:c3994993-3993815            GeneID:1087615   -        BA4381   3993815
                               NC_003997.3
ref|NC_003997.3|:c3996654-3995335            GeneID:1087618   bfmbB    BA4382   3995335
                               NC_003997.3
ref|NC_003997.3|:c3997653-3996670            GeneID:1087619   bfmbAb   BA4383   3996670
                               NC_003997.3
ref|NC_003997.3|:c3998668-3997667            GeneID:1087625   bfmbAa   BA4384   3997667
                               NC_003997.3
ref|NC_003997.3|:c4000117-3998696            GeneID:1087623   bfmbC    BA4385   3998696
                               NC_003997.3
ref|NC_003997.3|:c4001225-4000122            GeneID:1087622   buk      BA4386   4000122
                               NC_003997.3
ref|NC_003997.3|:c4002413-4001313            GeneID:1087631   -        BA4387   4001313
                               NC_003997.3
ref|NC_003997.3|:c4003347-4002448            GeneID:1087629   yqiS     BA4388   4002448
                               NC_003997.3
ref|NC_003997.3|:c4005615-4003543            GeneID:1087630   -        BA4389   4003543
                               NC_003997.3
ref|NC_003997.3|:c4006762-4006034            GeneID:1087636   -        BA4391   4006034
                               NC_003997.3
ref|NC_003997.3|:c4009745-4008951            GeneID:1087648   spo0A    BA4394   4008951
                               NC_003997.3
ref|NC_003997.3|:c4011331-4010033            GeneID:1087652   spoIVB   BA4396   4010033
                               NC_003997.3
ref|NC_003997.3|:c4013906-4013457            GeneID:1087653   argR     BA4398   4013457
                               NC_003997.3
ref|NC_003997.3|:c4014888-4014049            GeneID:1087708   -        BA4399   4014049
                               NC_003997.3
ref|NC_003997.3|:c4016784-4014892            GeneID:1087729   dxs      BA4400   4014892
                               NC_003997.3
ref|NC_003997.3|:c4017976-4017086            GeneID:1087728   ispA     BA4402   4017086
                               NC_003997.3
ref|NC_003997.3|:c4018206-4017976            GeneID:1087730   xseB     BA4403   4017976
                               NC_003997.3
ref|NC_003997.3|:c4019554-4018196            GeneID:1087732   xseA     BA4404   4018196
                               NC_003997.3
ref|NC_003997.3|:c4020441-4019581            GeneID:1087731   folD     BA4405   4019581
                               NC_003997.3
ref|NC_003997.3|:c4020857-4020465            GeneID:1087738   nusB       BA4406       4020465
                               NC_003997.3
ref|NC_003997.3|:c4021596-4021204            GeneID:1087735   -          BA4407       4021204
                               NC_003997.3
ref|NC_003997.3|:c4022971-4021619            GeneID:1087737   accC       BA4408       4021619
                               NC_003997.3
ref|NC_003997.3|:c4023482-4022988            GeneID:1087741   accB       BA4409       4022988
                               NC_003997.3
ref|NC_003997.3|:c4024878-4024240            GeneID:1087743   -          BA4410       4024240
                               NC_003997.3
ref|NC_003997.3|:c4025589-4024927            GeneID:1087742   spoIIIAG   BA4411       4024927
                               NC_003997.3
ref|NC_003997.3|:c4026211-4025579            GeneID:1087747   spoIIIAF   BA4412       4025579
                               NC_003997.3
ref|NC_003997.3|:c4027396-4026224            GeneID:1087749   spoIIIAE   BA4413       4026224
                               NC_003997.3
ref|NC_003997.3|:c4028017-4027814            GeneID:1087752   spoIIIAC   BA4415       4027814
                               NC_003997.3
ref|NC_003997.3|:c4028547-4028032            GeneID:1087758   spoIIIAB   BA4416       4028032
-                              -             -                -          -        -
                               NC_003997.3
ref|NC_003997.3|:c4029467-4028541            GeneID:1087769   spoIIIAA   BA4417       4028541
                               NC_003997.3
ref|NC_003997.3|:c4029843-4029496            GeneID:1087754   -          BA4418       4029496
                               NC_003997.3
ref|NC_003997.3|:4029966-4030544             GeneID:1087768   -          BA4419       4029966
                               NC_003997.3
ref|NC_003997.3|:c4031420-4030863            GeneID:1087775   efp        BA4421       4030863
                               NC_003997.3
ref|NC_003997.3|:c4032503-4031442            GeneID:1087781   pepQ-1     BA4422       4031442
                               NC_003997.3
ref|NC_003997.3|:c4032948-4032508            GeneID:1087785   aroQ       BA4423       4032508
                               NC_003997.3
ref|NC_003997.3|:4033734-4034654             GeneID:1087783   -          BA4425       4033734
                               NC_003997.3
ref|NC_003997.3|:4034734-4035135             GeneID:1087784   -          BA4426       4034734
                               NC_003997.3
ref|NC_003997.3|:c4035797-4035132            GeneID:1087793   -          BA4427       4035132
                               NC_003997.3
ref|NC_003997.3|:c4036276-4035848            GeneID:1087795   -          BA4428       4035848
                               NC_003997.3
ref|NC_003997.3|:c4037446-4036421            GeneID:1087794   splB       BA4429       4036421
                               NC_003997.3
ref|NC_003997.3|:4037718-4038566             GeneID:1087800   -          BA4430       4037718
                               NC_003997.3
ref|NC_003997.3|:c4039431-4038595            GeneID:1087804   -          BA4431       4038595
                               NC_003997.3
ref|NC_003997.3|:4039602-4039985             GeneID:1087812   -          BA4432       4039602
                               NC_003997.3
ref|NC_003997.3|:4040235-4041212             GeneID:1087801   -          BA4433       4040235
                               NC_003997.3
ref|NC_003997.3|:4041315-4041890             GeneID:1087810   -          BA4434       4041315
                               NC_003997.3
ref|NC_003997.3|:4041962-4042294             GeneID:1087811   sugE-1     BA4435       4041962
                               NC_003997.3
ref|NC_003997.3|:4042296-4042610             GeneID:1087814   sugE-2     BA4436       4042296
                               NC_003997.3
ref|NC_003997.3|:4042626-4042883             GeneID:1087819   -          BA4437       4042626
                               NC_003997.3
ref|NC_003997.3|:c4043930-4043337            GeneID:1087817   -          BA4439       4043337
                               NC_003997.3
ref|NC_003997.3|:c4046767-4045895            GeneID:1087826   -          BA4444       4045895
                               NC_003997.3
ref|NC_003997.3|:c4047145-4046771            GeneID:1087835   -          BA4445       4046771
                               NC_003997.3
ref|NC_003997.3|:c4049495-4048020            GeneID:1087836   yqhK       BA4447       4048020
                               NC_003997.3
ref|NC_003997.3|:c4050835-4049492            GeneID:1087841   yqhJ       BA4448       4049492
                               NC_003997.3
ref|NC_003997.3|:c4051956-4050856            GeneID:1087845   gcvT       BA4449       4050856
                               NC_003997.3
ref|NC_003997.3|:4052348-4054030             GeneID:1087843   -          BA4450       4052348
                               NC_003997.3
ref|NC_003997.3|:4054017-4054811             GeneID:1087853   -          BA4451       4054017
                               NC_003997.3
ref|NC_003997.3|:c4055303-4055076            GeneID:1087854   -          BA4453       4055076
                               NC_003997.3
ref|NC_003997.3|:4055623-4056255             GeneID:1087863   -          BA4455       4055623
                               NC_003997.3
ref|NC_003997.3|:c4056523-4056323            GeneID:1087865   -          BA4456       4056323
                               NC_003997.3
ref|NC_003997.3|:c4057059-4056562            GeneID:1087881   aroK       BA4457       4056562
                               NC_003997.3
ref|NC_003997.3|:c4057830-4057180            GeneID:1087866   -          BA4459       4057180
                               NC_003997.3
ref|NC_003997.3|:c4059563-4059108            GeneID:1087889   comGD      BA4463       4059108
                               NC_003997.3
ref|NC_003997.3|:c4060902-4059871            GeneID:1087902   comGB      BA4465       4059871
                               NC_003997.3
ref|NC_003997.3|:c4061938-4060895            GeneID:1087901   comGA      BA4466       4060895
                               NC_003997.3
ref|NC_003997.3|:4063315-4064709             GeneID:1087914   -          BA4469       4063315
                               NC_003997.3
ref|NC_003997.3|:c4065621-4065379            GeneID:1087925   -          BA4472       4065379
                               NC_003997.3
ref|NC_003997.3|:4065847-4066158             GeneID:1087921   -          BA4473       4065847
                               NC_003997.3
ref|NC_003997.3|:c4066683-4066195            GeneID:1087922   -          BA4474       4066195
                               NC_003997.3
ref|NC_003997.3|:c4067137-4066763            GeneID:1087936   -          BA4475       4066763
                               NC_003997.3
ref|NC_003997.3|:c4067540-4067232            GeneID:1087933   -          BA4476       4067232
                               NC_003997.3
ref|NC_003997.3|:c4068646-4067588            GeneID:1087934   murG     BA4477   4067588
                               NC_003997.3
ref|NC_003997.3|:c4072063-4068665            GeneID:1087945   metH     BA4478   4068665
                               NC_003997.3
ref|NC_003997.3|:c4073900-4072068            GeneID:1087947   -        BA4479   4072068
                               NC_003997.3
ref|NC_003997.3|:4074487-4075599             GeneID:1087946   metC-1   BA4480   4074487
                               NC_003997.3
ref|NC_003997.3|:4075596-4076759             GeneID:1087965   metC-2   BA4481   4075596
                               NC_003997.3
ref|NC_003997.3|:4077603-4078121             GeneID:1087963   -        BA4483   4077603
                               NC_003997.3
ref|NC_003997.3|:c4079372-4078266            GeneID:1087978   -        BA4484   4078266
                               NC_003997.3
ref|NC_003997.3|:c4080014-4079388            GeneID:1087980   -        BA4485   4079388
                               NC_003997.3
ref|NC_003997.3|:c4081421-4080438            GeneID:1087979   glcK     BA4487   4080438
                               NC_003997.3
ref|NC_003997.3|:c4081641-4081441            GeneID:1087987   -        BA4488   4081441
                               NC_003997.3
ref|NC_003997.3|:c4082323-4081745            GeneID:1087988   -        BA4489   4081745
                               NC_003997.3
ref|NC_003997.3|:c4085001-4082647            GeneID:1088012   -        BA4491   4082647
                               NC_003997.3
ref|NC_003997.3|:c4086033-4085377            GeneID:1088000   -        BA4492   4085377
                               NC_003997.3
ref|NC_003997.3|:c4087004-4086189            GeneID:1088009   pstB     BA4493   4086189
                               NC_003997.3
ref|NC_003997.3|:c4087899-4087033            GeneID:1088011   pstA     BA4494   4087033
                               NC_003997.3
ref|NC_003997.3|:c4088851-4087901            GeneID:1088015   pstC     BA4495   4087901
                               NC_003997.3
ref|NC_003997.3|:c4089796-4088879            GeneID:1088017   phoX     BA4496   4088879
                               NC_003997.3
ref|NC_003997.3|:c4092248-4090128            GeneID:1088025   -        BA4497   4090128
                               NC_003997.3
ref|NC_003997.3|:c4093635-4092358            GeneID:1088016   -        BA4498   4092358
                               NC_003997.3
ref|NC_003997.3|:c4094362-4093751            GeneID:1088022   sodA-1   BA4499   4093751
                               NC_003997.3
ref|NC_003997.3|:4096260-4097363             GeneID:1088122   gcpE     BA4502   4096260
                               NC_003997.3
ref|NC_003997.3|:c4097857-4097444            GeneID:1088175   -        BA4503   4097444
                               NC_003997.3
ref|NC_003997.3|:c4098704-4097871            GeneID:1088228   -        BA4504   4097871
                               NC_003997.3
ref|NC_003997.3|:c4099474-4098704            GeneID:1088162   -        BA4505   4098704
                               NC_003997.3
ref|NC_003997.3|:c4100594-4099716            GeneID:1088226   -        BA4506   4099716
                               NC_003997.3
ref|NC_003997.3|:c4101913-4101017            GeneID:1088232   nfo      BA4508   4101017
                               NC_003997.3
ref|NC_003997.3|:c4103454-4102144            GeneID:1088235   -        BA4509   4102144
                               NC_003997.3
ref|NC_003997.3|:c4106606-4105485            GeneID:1088237   -        BA4512   4105485
                               NC_003997.3
ref|NC_003997.3|:c4107310-4106603            GeneID:1088239   -        BA4513   4106603
                               NC_003997.3
ref|NC_003997.3|:c4107832-4107476            GeneID:1088241   cccA     BA4514   4107476
                               NC_003997.3
ref|NC_003997.3|:c4109339-4108218            GeneID:1088240   sigA     BA4515   4108218
                               NC_003997.3
ref|NC_003997.3|:c4111195-4109399            GeneID:1088242   dnaG     BA4516   4109399
                               NC_003997.3
ref|NC_003997.3|:c4112861-4112049            GeneID:1088246   -        BA4520   4112049
                               NC_003997.3
ref|NC_003997.3|:c4113523-4112891            GeneID:1088248   -        BA4521   4112891
                               NC_003997.3
ref|NC_003997.3|:c4114377-4113631            GeneID:1088247   recO     BA4522   4113631
                               NC_003997.3
ref|NC_003997.3|:c4115636-4114731            GeneID:1088253   era      BA4524   4114731
                               NC_003997.3
ref|NC_003997.3|:c4116027-4115629            GeneID:1088257   cdd-2    BA4525   4115629
                               NC_003997.3
ref|NC_003997.3|:c4116480-4116127            GeneID:1088252   dgkA     BA4526   4116127
                               NC_003997.3
ref|NC_003997.3|:c4119088-4116944            GeneID:1088260   -        BA4528   4116944
                               NC_003997.3
ref|NC_003997.3|:c4120241-4119282            GeneID:1088256   -        BA4529   4119282
                               NC_003997.3
ref|NC_003997.3|:c4121444-4120245            GeneID:1088259   -        BA4530   4120245
                               NC_003997.3
ref|NC_003997.3|:c4122466-4122023            GeneID:1088262   -        BA4533   4122023
                               NC_003997.3
ref|NC_003997.3|:c4124338-4122986            GeneID:1088268   -        BA4535   4122986
                               NC_003997.3
ref|NC_003997.3|:c4125001-4124345            GeneID:1088266   -        BA4536   4124345
                               NC_003997.3
ref|NC_003997.3|:c4126178-4125240            GeneID:1088267   prmA     BA4537   4125240
                               NC_003997.3
ref|NC_003997.3|:c4127322-4126207            GeneID:1088271   dnaJ     BA4538   4126207
                               NC_003997.3
ref|NC_003997.3|:c4129362-4127527            GeneID:1088269   dnaK     BA4539   4127527
                               NC_003997.3
ref|NC_003997.3|:c4129955-4129389            GeneID:1088270   grpE     BA4540   4129389
                               NC_003997.3
ref|NC_003997.3|:c4131086-4130070            GeneID:1088273   hrcA     BA4541   4130070
                               NC_003997.3
ref|NC_003997.3|:c4132356-4131220            GeneID:1088276   hemN     BA4542   4131220
                               NC_003997.3
ref|NC_003997.3|:c4132786-4132412            GeneID:1088272   -        BA4543   4132412
                               NC_003997.3
ref|NC_003997.3|:c4134741-4132918            GeneID:1088274   lepA     BA4544   4132918
                               NC_003997.3
ref|NC_003997.3|:c4136420-4135314            GeneID:1088279   gpR      BA4546       4135314
                               NC_003997.3
ref|NC_003997.3|:4136593-4136859             GeneID:1088277   rpsT     BA4547       4136593
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:c4137952-4136942            GeneID:1088278   -        BA4548       4136942
                               NC_003997.3
ref|NC_003997.3|:c4141350-4140793            GeneID:1088281   comEB    BA4552       4140793
                               NC_003997.3
ref|NC_003997.3|:4142120-4142917             GeneID:1088285   -        BA4554       4142120
                               NC_003997.3
ref|NC_003997.3|:c4143838-4143089            GeneID:1088291   -        BA4555       4143089
                               NC_003997.3
ref|NC_003997.3|:c4144191-4143835            GeneID:1088286   -        BA4556       4143835
                               NC_003997.3
ref|NC_003997.3|:c4144757-4144188            GeneID:1088289   -        BA4557       4144188
                               NC_003997.3
ref|NC_003997.3|:c4145262-4144747            GeneID:1088290   nadD     BA4558       4144747
                               NC_003997.3
ref|NC_003997.3|:c4145741-4145448            GeneID:1088293   -        BA4560       4145448
                               NC_003997.3
ref|NC_003997.3|:c4146579-4145653            GeneID:1088306   aroE     BA4561       4145653
                               NC_003997.3
ref|NC_003997.3|:c4147701-4146595            GeneID:1088334   -        BA4562       4146595
                               NC_003997.3
ref|NC_003997.3|:c4148217-4147705            GeneID:1088332   -        BA4563       4147705
                               NC_003997.3
ref|NC_003997.3|:c4149543-4148755            GeneID:1088333   psd      BA4565       4148755
                               NC_003997.3
ref|NC_003997.3|:c4150548-4149835            GeneID:1088335   sigK     BA4566       4149835
                               NC_003997.3
ref|NC_003997.3|:4151153-4151623             GeneID:1088340   -        BA4568       4151153
                               NC_003997.3
ref|NC_003997.3|:c4153160-4151667            GeneID:1088339   -        BA4569       4151667
                               NC_003997.3
ref|NC_003997.3|:c4154148-4153525            GeneID:1088593   -        BA4571       4153525
                               NC_003997.3
ref|NC_003997.3|:4154502-4155152             GeneID:1088595   -        BA4572       4154502
                               NC_003997.3
ref|NC_003997.3|:c4155673-4155206            GeneID:1088603   -        BA4573       4155206
                               NC_003997.3
ref|NC_003997.3|:c4157113-4155728            GeneID:1088594   -        BA4574       4155728
                               NC_003997.3
ref|NC_003997.3|:4158245-4159108             GeneID:1088606   -        BA4577       4158245
                               NC_003997.3
ref|NC_003997.3|:c4159650-4159150            GeneID:1088602   -        BA4578       4159150
                               NC_003997.3
ref|NC_003997.3|:c4163054-4161822            GeneID:1088612   -        BA4583       4161822
                               NC_003997.3
ref|NC_003997.3|:4163283-4166036             GeneID:1088608   vpR      BA4584       4163283
                               NC_003997.3
ref|NC_003997.3|:4166774-4168528             GeneID:1088610   -        BA4586       4166774
                               NC_003997.3
ref|NC_003997.3|:4168509-4168823             GeneID:1088611   -        BA4587       4168509
                               NC_003997.3
ref|NC_003997.3|:4170279-4170824             GeneID:1088614   -        BA4590       4170279
                               NC_003997.3
ref|NC_003997.3|:c4171234-4170857            GeneID:1088617   -        BA4591       4170857
                               NC_003997.3
ref|NC_003997.3|:c4171804-4171346            GeneID:1088619   -        BA4592       4171346
                               NC_003997.3
ref|NC_003997.3|:c4172367-4171861            GeneID:1088622   -        BA4593       4171861
                               NC_003997.3
ref|NC_003997.3|:c4173071-4172673            GeneID:1088618   -        BA4594       4172673
                               NC_003997.3
ref|NC_003997.3|:c4173856-4173038            GeneID:1088621   -        BA4595       4173038
                               NC_003997.3
ref|NC_003997.3|:c4174871-4173843            GeneID:1088620   -        BA4596       4173843
                               NC_003997.3
ref|NC_003997.3|:c4175824-4174877            GeneID:1088625   -        BA4597       4174877
                               NC_003997.3
ref|NC_003997.3|:c4178938-4176335            GeneID:1088623   -        BA4599       4176335
                               NC_003997.3
ref|NC_003997.3|:c4180331-4179198            GeneID:1088628   metC-3   BA4600       4179198
                               NC_003997.3
ref|NC_003997.3|:c4181258-4180335            GeneID:1088626   cysM     BA4601       4180335
                               NC_003997.3
ref|NC_003997.3|:c4182036-4181341            GeneID:1088631   -        BA4602       4181341
                               NC_003997.3
ref|NC_003997.3|:c4182689-4182051            GeneID:1088627   -        BA4603       4182051
                               NC_003997.3
ref|NC_003997.3|:4182826-4183041             GeneID:1088630   -        BA4604       4182826
                               NC_003997.3
ref|NC_003997.3|:c4183724-4183077            GeneID:1088629   -        BA4605       4183077
                               NC_003997.3
ref|NC_003997.3|:c4185595-4183841            GeneID:1088632   -        BA4606       4183841
                               NC_003997.3
ref|NC_003997.3|:c4186164-4185688            GeneID:1088634   greA     BA4607       4185688
                               NC_003997.3
ref|NC_003997.3|:c4187081-4186443            GeneID:1088637   udk      BA4608       4186443
                               NC_003997.3
ref|NC_003997.3|:c4188379-4187099            GeneID:1088633   -        BA4609       4187099
                               NC_003997.3
ref|NC_003997.3|:c4189246-4188398            GeneID:1088635   -        BA4610       4188398
                               NC_003997.3
ref|NC_003997.3|:c4189976-4189335            GeneID:1088644   -        BA4611       4189335
                               NC_003997.3
ref|NC_003997.3|:c4191234-4190179            GeneID:1088636   -        BA4612       4190179
                               NC_003997.3
ref|NC_003997.3|:c4191745-4191467            GeneID:1088655   -        BA4613       4191467
                               NC_003997.3
ref|NC_003997.3|:c4192171-4191758            GeneID:1088650   -        BA4614       4191758
                               NC_003997.3
ref|NC_003997.3|:c4192441-4192175            GeneID:1088741   -         BA4615       4192175
                               NC_003997.3
ref|NC_003997.3|:c4195160-4192518            GeneID:1088737   alaS      BA4616       4192518
                               NC_003997.3
ref|NC_003997.3|:c4197091-4196024            GeneID:1088740   -         BA4618       4196024
                               NC_003997.3
ref|NC_003997.3|:c4197851-4197663            GeneID:1085344   -         BA4621       4197663
                               NC_003997.3
ref|NC_003997.3|:c4200291-4197979            GeneID:1085353   -         BA4622       4197979
                               NC_003997.3
ref|NC_003997.3|:c4201070-4200411            GeneID:1085263   -         BA4624       4200411
                               NC_003997.3
ref|NC_003997.3|:c4202296-4201181            GeneID:1085347   trmU      BA4625       4201181
                               NC_003997.3
ref|NC_003997.3|:c4203458-4202313            GeneID:1085321   -         BA4626       4202313
                               NC_003997.3
ref|NC_003997.3|:c4203910-4203494            GeneID:1085417   -         BA4627       4203494
                               NC_003997.3
ref|NC_003997.3|:4205527-4206168             GeneID:1085442   -         BA4629       4205527
                               NC_003997.3
ref|NC_003997.3|:c4207230-4206463            GeneID:1085373   -         BA4630       4206463
                               NC_003997.3
ref|NC_003997.3|:c4209355-4207580            GeneID:1085460   aspS      BA4632       4207580
                               NC_003997.3
ref|NC_003997.3|:c4210639-4209368            GeneID:1085478   hisS      BA4633       4209368
                               NC_003997.3
ref|NC_003997.3|:c4211796-4211356            GeneID:1085477   dtD       BA4636       4211356
                               NC_003997.3
ref|NC_003997.3|:c4213997-4211814            GeneID:1085523   relA      BA4637       4211814
                               NC_003997.3
ref|NC_003997.3|:c4214720-4214208            GeneID:1085713   apt       BA4638       4214208
                               NC_003997.3
ref|NC_003997.3|:c4217107-4214768            GeneID:1085608   recJ      BA4639       4214768
                               NC_003997.3
ref|NC_003997.3|:c4218105-4217209            GeneID:1085522   -         BA4640       4217209
                               NC_003997.3
ref|NC_003997.3|:c4220520-4218256            GeneID:1085621   secDF     BA4641       4218256
                               NC_003997.3
ref|NC_003997.3|:c4221075-4220791            GeneID:1085760   -         BA4642       4220791
                               NC_003997.3
ref|NC_003997.3|:4221250-4222809             GeneID:1085645   spoVB     BA4643       4221250
                               NC_003997.3
ref|NC_003997.3|:c4223486-4222839            GeneID:1085757   -         BA4644       4222839
                               NC_003997.3
ref|NC_003997.3|:c4224269-4224009            GeneID:1085850   yajC      BA4646       4224009
                               NC_003997.3
ref|NC_003997.3|:c4225436-4224297            GeneID:1084870   tgt       BA4647       4224297
                               NC_003997.3
ref|NC_003997.3|:c4226501-4225449            GeneID:1084883   queA      BA4648       4225449
                               NC_003997.3
ref|NC_003997.3|:c4226721-4226521            GeneID:1084880   -         BA4649       4226521
                               NC_003997.3
ref|NC_003997.3|:c4227719-4226718            GeneID:1084980   ruvB      BA4650       4226718
                               NC_003997.3
ref|NC_003997.3|:c4228342-4227725            GeneID:1084960   ruvA      BA4651       4227725
                               NC_003997.3
ref|NC_003997.3|:4228531-4229475             GeneID:1084969   -         BA4652       4228531
                               NC_003997.3
ref|NC_003997.3|:c4230018-4229488            GeneID:1085206   -         BA4653       4229488
                               NC_003997.3
ref|NC_003997.3|:4231901-4232335             GeneID:1083654   -         BA4657       4231901
                               NC_003997.3
ref|NC_003997.3|:c4232995-4232369            GeneID:1083655   -         BA4658       4232369
                               NC_003997.3
ref|NC_003997.3|:c4234940-4233192            GeneID:1083656   -         BA4659       4233192
                               NC_003997.3
ref|NC_003997.3|:c4236436-4235330            GeneID:1083657   nadA      BA4660       4235330
                               NC_003997.3
ref|NC_003997.3|:c4237300-4236467            GeneID:1083662   nadC      BA4661       4236467
                               NC_003997.3
ref|NC_003997.3|:c4238849-4237320            GeneID:1083663   nadB      BA4662       4237320
                               NC_003997.3
ref|NC_003997.3|:4239004-4240140             GeneID:1083665   -         BA4663       4239004
                               NC_003997.3
ref|NC_003997.3|:4240143-4240685             GeneID:1086213   -         BA4664       4240143
                               NC_003997.3
ref|NC_003997.3|:4240767-4241414             GeneID:1084968   -         BA4665       4240767
                               NC_003997.3
ref|NC_003997.3|:c4242347-4241496            GeneID:1086227   pheA      BA4666       4241496
                               NC_003997.3
ref|NC_003997.3|:c4244360-4242444            GeneID:1087242   -         BA4667       4242444
                               NC_003997.3
ref|NC_003997.3|:c4247083-4246307            GeneID:1089215   -         BA4669       4246307
                               NC_003997.3
ref|NC_003997.3|:c4248958-4248251            GeneID:1083682   -         BA4671       4248251
                               NC_003997.3
ref|NC_003997.3|:c4250384-4249098            GeneID:1086852   obG       BA4672       4249098
                               NC_003997.3
ref|NC_003997.3|:c4250932-4250384            GeneID:1086504   -         BA4673       4250384
                               NC_003997.3
ref|NC_003997.3|:c4251286-4250996            GeneID:1086262   rpmA      BA4674       4250996
-                              -             -                -         -        -
                               NC_003997.3
ref|NC_003997.3|:c4251634-4251290            GeneID:1086278   -         BA4675       4251290
                               NC_003997.3
ref|NC_003997.3|:c4251954-4251646            GeneID:1085870   rplU      BA4676       4251646
                               NC_003997.3
ref|NC_003997.3|:c4253496-4252120            GeneID:1085633   -         BA4677       4252120
                               NC_003997.3
ref|NC_003997.3|:c4254439-4253579            GeneID:1084331   spoIVFB   BA4678       4253579
                               NC_003997.3
ref|NC_003997.3|:c4255178-4254432            GeneID:1083750   spoIVFA   BA4679       4254432
                               NC_003997.3
ref|NC_003997.3|:c4256109-4255312            GeneID:1083748   minD     BA4680   4255312
                               NC_003997.3
ref|NC_003997.3|:c4256798-4256112            GeneID:1083742   minC     BA4681   4256112
                               NC_003997.3
ref|NC_003997.3|:c4257379-4256834            GeneID:1083738   mreD     BA4682   4256834
                               NC_003997.3
ref|NC_003997.3|:c4258245-4257394            GeneID:1083736   mreC     BA4683   4257394
                               NC_003997.3
ref|NC_003997.3|:c4259306-4258287            GeneID:1083734   mreB     BA4684   4258287
                               NC_003997.3
ref|NC_003997.3|:c4260764-4260189            GeneID:1083730   maf      BA4686   4260189
                               NC_003997.3
ref|NC_003997.3|:c4263414-4262113            GeneID:1083723   folC     BA4689   4262113
                               NC_003997.3
ref|NC_003997.3|:c4266153-4263508            GeneID:1083718   valS     BA4690   4263508
                               NC_003997.3
ref|NC_003997.3|:c4267574-4266549            GeneID:1083720   -        BA4691   4266549
                               NC_003997.3
ref|NC_003997.3|:c4268620-4267637            GeneID:1083717   -        BA4692   4267637
                               NC_003997.3
ref|NC_003997.3|:c4270019-4268730            GeneID:1083709   hemL-2   BA4693   4268730
                               NC_003997.3
ref|NC_003997.3|:c4271008-4270019            GeneID:1083716   hemB     BA4694   4270019
                               NC_003997.3
ref|NC_003997.3|:c4271781-4271029            GeneID:1083706   hemD     BA4695   4271029
                               NC_003997.3
ref|NC_003997.3|:c4272712-4271783            GeneID:1083703   hemC     BA4696   4271783
                               NC_003997.3
ref|NC_003997.3|:c4273561-4272728            GeneID:1083699   -        BA4697   4272728
                               NC_003997.3
ref|NC_003997.3|:c4274913-4273579            GeneID:1083700   hemA     BA4698   4273579
                               NC_003997.3
ref|NC_003997.3|:4275329-4275781             GeneID:1083697   -        BA4699   4275329
                               NC_003997.3
ref|NC_003997.3|:4275784-4276200             GeneID:1083693   -        BA4700   4275784
                               NC_003997.3
ref|NC_003997.3|:c4276829-4276233            GeneID:1083692   -        BA4701   4276233
                               NC_003997.3
ref|NC_003997.3|:c4279147-4276826            GeneID:1083690   loN      BA4702   4276826
                               NC_003997.3
ref|NC_003997.3|:c4281013-4279340            GeneID:1083686   loN2     BA4703   4279340
                               NC_003997.3
ref|NC_003997.3|:c4282376-4281117            GeneID:1083685   clpX     BA4704   4281117
                               NC_003997.3
ref|NC_003997.3|:c4283918-4282641            GeneID:1083666   tig      BA4705   4282641
                               NC_003997.3
ref|NC_003997.3|:c4285227-4284229            GeneID:1083669   -        BA4706   4284229
                               NC_003997.3
ref|NC_003997.3|:4286193-4286807             GeneID:1084482   -        BA4710   4286193
                               NC_003997.3
ref|NC_003997.3|:c4288265-4287762            GeneID:1083678   -        BA4713   4287762
                               NC_003997.3
ref|NC_003997.3|:c4288887-4288279            GeneID:1083679   -        BA4714   4288279
                               NC_003997.3
ref|NC_003997.3|:c4289636-4288899            GeneID:1088544   rph      BA4715   4288899
                               NC_003997.3
ref|NC_003997.3|:c4290814-4289765            GeneID:1089211   gerM     BA4716   4289765
                               NC_003997.3
ref|NC_003997.3|:c4291754-4290945            GeneID:1085894   racE-2   BA4717   4290945
                               NC_003997.3
ref|NC_003997.3|:c4293290-4291965            GeneID:1087152   -        BA4718   4291965
                               NC_003997.3
ref|NC_003997.3|:4293651-4294334             GeneID:1087198   -        BA4720   4293651
                               NC_003997.3
ref|NC_003997.3|:c4295022-4294384            GeneID:1083791   -        BA4721   4294384
                               NC_003997.3
ref|NC_003997.3|:c4295845-4295183            GeneID:1083798   -        BA4722   4295183
                               NC_003997.3
ref|NC_003997.3|:c4296685-4296461            GeneID:1084396   gerE     BA4724   4296461
                               NC_003997.3
ref|NC_003997.3|:c4298155-4296851            GeneID:1083799   -        BA4725   4296851
                               NC_003997.3
ref|NC_003997.3|:4310557-4310742             GeneID:1083825   -        BA4739   4310557
                               NC_003997.3
ref|NC_003997.3|:c4311380-4310808            GeneID:1083826   -        BA4740   4310808
                               NC_003997.3
ref|NC_003997.3|:4312590-4313255             GeneID:1083830   -        BA4742   4312590
                               NC_003997.3
ref|NC_003997.3|:c4313745-4313314            GeneID:1083829   -        BA4743   4313314
                               NC_003997.3
ref|NC_003997.3|:c4315971-4315087            GeneID:1083831   -        BA4745   4315087
                               NC_003997.3
ref|NC_003997.3|:4316315-4317142             GeneID:1083833   -        BA4746   4316315
                               NC_003997.3
ref|NC_003997.3|:c4318738-4317944            GeneID:1083836   -        BA4748   4317944
                               NC_003997.3
ref|NC_003997.3|:4319003-4319782             GeneID:1083837   -        BA4750   4319003
                               NC_003997.3
ref|NC_003997.3|:c4320265-4319819            GeneID:1083841   -        BA4751   4319819
                               NC_003997.3
ref|NC_003997.3|:c4321128-4320367            GeneID:1083838   sdhB     BA4753   4320367
                               NC_003997.3
ref|NC_003997.3|:c4322914-4321121            GeneID:1086416   sdhA     BA4754   4321121
                               NC_003997.3
ref|NC_003997.3|:c4323554-4322928            GeneID:1083845   sdhC     BA4755   4322928
                               NC_003997.3
ref|NC_003997.3|:4323856-4324305             GeneID:1083848   -        BA4756   4323856
                               NC_003997.3
ref|NC_003997.3|:c4326204-4324420            GeneID:1083849   uvrC     BA4757   4324420
                               NC_003997.3
ref|NC_003997.3|:c4326667-4326353            GeneID:1083852   trx      BA4758   4326353
                               NC_003997.3
ref|NC_003997.3|:c4328666-4327893            GeneID:1083854   etfB     BA4760   4327893
                               NC_003997.3
ref|NC_003997.3|:c4329521-4328745            GeneID:1083857   -        BA4761       4328745
                               NC_003997.3
ref|NC_003997.3|:c4330120-4329533            GeneID:1083859   -        BA4762       4329533
                               NC_003997.3
ref|NC_003997.3|:c4331917-4330226            GeneID:1083860   fadD     BA4763       4330226
                               NC_003997.3
ref|NC_003997.3|:c4332850-4332101            GeneID:1083861   -        BA4764       4332101
                               NC_003997.3
ref|NC_003997.3|:4333227-4334201             GeneID:1083866   -        BA4766       4333227
                               NC_003997.3
ref|NC_003997.3|:4336358-4336861             GeneID:1083871   -        BA4768       4336358
                               NC_003997.3
ref|NC_003997.3|:4336998-4337330             GeneID:1083872   -        BA4769       4336998
                               NC_003997.3
ref|NC_003997.3|:c4338089-4337394            GeneID:1083874   -        BA4770       4337394
                               NC_003997.3
ref|NC_003997.3|:c4338985-4338116            GeneID:1083880   -        BA4771       4338116
                               NC_003997.3
ref|NC_003997.3|:c4339727-4339023            GeneID:1083881   -        BA4772       4339023
                               NC_003997.3
ref|NC_003997.3|:c4340839-4339916            GeneID:1083885   -        BA4774       4339916
                               NC_003997.3
ref|NC_003997.3|:c4341900-4340965            GeneID:1083887   -        BA4776       4340965
                               NC_003997.3
ref|NC_003997.3|:c4342594-4341902            GeneID:1083888   -        BA4777       4341902
                               NC_003997.3
ref|NC_003997.3|:4342937-4343131             GeneID:1083890   -        BA4779       4342937
                               NC_003997.3
ref|NC_003997.3|:c4344370-4343171            GeneID:1083893   -        BA4780       4343171
                               NC_003997.3
ref|NC_003997.3|:4346561-4346884             GeneID:1083895   -        BA4782       4346561
                               NC_003997.3
ref|NC_003997.3|:c4347714-4346950            GeneID:1083901   -        BA4783       4346950
                               NC_003997.3
ref|NC_003997.3|:c4349489-4348506            GeneID:1087078   -        BA4785       4348506
                               NC_003997.3
ref|NC_003997.3|:c4350392-4349517            GeneID:1083903   -        BA4786       4349517
                               NC_003997.3
ref|NC_003997.3|:c4353125-4350468            GeneID:1088310   -        BA4787       4350468
                               NC_003997.3
ref|NC_003997.3|:c4353608-4353150            GeneID:1083904   -        BA4788       4353150
                               NC_003997.3
ref|NC_003997.3|:c4354345-4353632            GeneID:1083905   -        BA4789       4353632
                               NC_003997.3
ref|NC_003997.3|:c4356157-4354832            GeneID:1083907   brnQ-6   BA4790       4354832
                               NC_003997.3
ref|NC_003997.3|:c4361617-4359899            GeneID:1083918   -        BA4795       4359899
                               NC_003997.3
ref|NC_003997.3|:c4362212-4361673            GeneID:1083921   -        BA4796       4361673
                               NC_003997.3
ref|NC_003997.3|:c4362483-4362214            GeneID:1083922   -        BA4797       4362214
                               NC_003997.3
ref|NC_003997.3|:4362608-4363543             GeneID:1083923   rnh      BA4798       4362608
                               NC_003997.3
ref|NC_003997.3|:4363675-4363929             GeneID:1083926   -        BA4799       4363675
                               NC_003997.3
ref|NC_003997.3|:c4365837-4364446            GeneID:1083928   asnS     BA4802       4364446
                               NC_003997.3
ref|NC_003997.3|:c4368756-4366336            GeneID:1083936   pheT     BA4803       4366336
                               NC_003997.3
ref|NC_003997.3|:c4369809-4368775            GeneID:1083929   pheS     BA4804       4368775
                               NC_003997.3
ref|NC_003997.3|:c4370894-4370130            GeneID:1083938   -        BA4805       4370130
                               NC_003997.3
ref|NC_003997.3|:4371010-4371219             GeneID:1083937   -        BA4806       4371010
                               NC_003997.3
ref|NC_003997.3|:4371381-4371938             GeneID:1083940   -        BA4807       4371381
                               NC_003997.3
ref|NC_003997.3|:4372078-4372788             GeneID:1083939   -        BA4808       4372078
                               NC_003997.3
ref|NC_003997.3|:4374124-4374459             GeneID:1083947   -        BA4811       4374124
                               NC_003997.3
ref|NC_003997.3|:c4376281-4374482            GeneID:1083949   -        BA4812       4374482
                               NC_003997.3
ref|NC_003997.3|:c4376947-4376294            GeneID:1083951   -        BA4813       4376294
-                              -             -                -        -        -
                               NC_003997.3
ref|NC_003997.3|:4377245-4377862             GeneID:1083950   -        BA4814       4377245
                               NC_003997.3
ref|NC_003997.3|:c4378987-4377902            GeneID:1083952   -        BA4815       4377902
                               NC_003997.3
ref|NC_003997.3|:c4379548-4379057            GeneID:1085962   -        BA4816       4379057
                               NC_003997.3
ref|NC_003997.3|:c4380375-4380019            GeneID:1083953   rplT     BA4817       4380019
                               NC_003997.3
ref|NC_003997.3|:c4380613-4380413            GeneID:1083956   rpmI     BA4818       4380413
                               NC_003997.3
ref|NC_003997.3|:c4381195-4380635            GeneID:1083958   infC     BA4819       4380635
                               NC_003997.3
ref|NC_003997.3|:c4383469-4381532            GeneID:1083959   thrS-2   BA4820       4381532
                               NC_003997.3
ref|NC_003997.3|:c4384657-4383776            GeneID:1083935   -        BA4821       4383776
                               NC_003997.3
ref|NC_003997.3|:c4385876-4384938            GeneID:1083962   dnaI     BA4822       4384938
                               NC_003997.3
ref|NC_003997.3|:c4387316-4385910            GeneID:1085841   dnaB     BA4823       4385910
                               NC_003997.3
ref|NC_003997.3|:c4387869-4387444            GeneID:1083965   -        BA4824       4387444
                               NC_003997.3
ref|NC_003997.3|:c4389992-4388964            GeneID:1083970   gap-1    BA4827       4388964
                               NC_003997.3
ref|NC_003997.3|:c4390704-4390102            GeneID:1083978   -        BA4828       4390102
                               NC_003997.3
ref|NC_003997.3|:c4391388-4390756            GeneID:1083972   -        BA4829   4390756
                               NC_003997.3
ref|NC_003997.3|:c4392291-4391461            GeneID:1083979   mutM     BA4830   4391461
                               NC_003997.3
ref|NC_003997.3|:c4394937-4392304            GeneID:1083984   polA     BA4831   4392304
                               NC_003997.3
ref|NC_003997.3|:c4396987-4395224            GeneID:1083983   phoR     BA4832   4395224
                               NC_003997.3
ref|NC_003997.3|:c4397699-4396980            GeneID:1086976   phoP     BA4833   4396980
                               NC_003997.3
ref|NC_003997.3|:c4398850-4398377            GeneID:1083986   -        BA4836   4398377
                               NC_003997.3
ref|NC_003997.3|:c4400005-4399067            GeneID:1083988   mdh      BA4837   4399067
                               NC_003997.3
ref|NC_003997.3|:c4401317-4400025            GeneID:1083987   citC     BA4838   4400025
                               NC_003997.3
ref|NC_003997.3|:c4402593-4401478            GeneID:1083992   citZ     BA4839   4401478
                               NC_003997.3
ref|NC_003997.3|:4403917-4405014             GeneID:1083994   -        BA4841   4403917
                               NC_003997.3
ref|NC_003997.3|:c4405989-4405600            GeneID:1084087   -        BA4842   4405600
                               NC_003997.3
ref|NC_003997.3|:c4407946-4406189            GeneID:1089146   pykA-2   BA4843   4406189
                               NC_003997.3
ref|NC_003997.3|:c4408959-4408000            GeneID:1087130   pfkA     BA4844   4408000
                               NC_003997.3
ref|NC_003997.3|:c4410062-4409088            GeneID:1083998   accA     BA4845   4409088
                               NC_003997.3
ref|NC_003997.3|:c4410919-4410050            GeneID:1083996   accD     BA4846   4410050
                               NC_003997.3
ref|NC_003997.3|:c4411749-4411105            GeneID:1089156   -        BA4847   4411105
                               NC_003997.3
ref|NC_003997.3|:c4412972-4411764            GeneID:1089165   -        BA4848   4411764
                               NC_003997.3
ref|NC_003997.3|:c4416432-4413106            GeneID:1084005   dnaE     BA4849   4413106
                               NC_003997.3
ref|NC_003997.3|:4416550-4416888             GeneID:1084000   -        BA4850   4416550
                               NC_003997.3
ref|NC_003997.3|:4416885-4417388             GeneID:1084008   -        BA4851   4416885
                               NC_003997.3
ref|NC_003997.3|:c4418372-4417440            GeneID:1084007   -        BA4852   4417440
                               NC_003997.3
ref|NC_003997.3|:4418612-4418917             GeneID:1084010   -        BA4854   4418612
                               NC_003997.3
ref|NC_003997.3|:c4421178-4419865            GeneID:1084014   -        BA4858   4419865
                               NC_003997.3
ref|NC_003997.3|:c4422308-4421625            GeneID:1084016   -        BA4860   4421625
                               NC_003997.3
ref|NC_003997.3|:4422458-4423555             GeneID:1084015   pepQ-2   BA4861   4422458
                               NC_003997.3
ref|NC_003997.3|:c4424350-4423976            GeneID:1084019   -        BA4863   4423976
                               NC_003997.3
ref|NC_003997.3|:4424444-4425271             GeneID:1084021   -        BA4864   4424444
                               NC_003997.3
ref|NC_003997.3|:c4425540-4425286            GeneID:1084020   -        BA4865   4425286
                               NC_003997.3
ref|NC_003997.3|:c4426756-4426412            GeneID:1084022   -        BA4867   4426412
                               NC_003997.3
ref|NC_003997.3|:c4427547-4426759            GeneID:1084030   -        BA4868   4426759
                               NC_003997.3
ref|NC_003997.3|:c4427876-4427544            GeneID:1084032   -        BA4869   4427544
                               NC_003997.3
ref|NC_003997.3|:c4431322-4430564            GeneID:1084035   fabG     BA4874   4430564
                               NC_003997.3
ref|NC_003997.3|:4431503-4431961             GeneID:1086718   -        BA4875   4431503
                               NC_003997.3
ref|NC_003997.3|:c4432698-4432003            GeneID:1084029   -        BA4876   4432003
                               NC_003997.3
ref|NC_003997.3|:c4433372-4433031            GeneID:1085914   -        BA4878   4433031
                               NC_003997.3
ref|NC_003997.3|:c4434859-4433471            GeneID:1085916   argH-2   BA4879   4433471
                               NC_003997.3
ref|NC_003997.3|:c4436061-4434856            GeneID:1084039   argG     BA4880   4434856
                               NC_003997.3
ref|NC_003997.3|:4437626-4438288             GeneID:1084041   -        BA4884   4437626
                               NC_003997.3
ref|NC_003997.3|:c4439153-4438320            GeneID:1086727   -        BA4885   4438320
                               NC_003997.3
ref|NC_003997.3|:4439291-4439926             GeneID:1084042   -        BA4886   4439291
                               NC_003997.3
ref|NC_003997.3|:4439998-4440432             GeneID:1084043   -        BA4887   4439998
                               NC_003997.3
ref|NC_003997.3|:c4441649-4440456            GeneID:1086751   ackA     BA4888   4440456
                               NC_003997.3
ref|NC_003997.3|:c4442940-4441948            GeneID:1084051   -        BA4889   4441948
                               NC_003997.3
ref|NC_003997.3|:c4443634-4443134            GeneID:1084050   -        BA4890   4443134
                               NC_003997.3
ref|NC_003997.3|:c4444164-4443769            GeneID:1084054   -        BA4891   4443769
                               NC_003997.3
ref|NC_003997.3|:c4444815-4444177            GeneID:1084053   -        BA4892   4444177
                               NC_003997.3
ref|NC_003997.3|:44450