Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>

BIOTECHNOLOGY by zujt6g

VIEWS: 56 PAGES: 11

									           BIOTECHNOLOGY

Slide 2         What is Biotechnology?
Slide 3         Restriction Enzymes
Slide 4         Ligation
Slide 5         Gel Electrophoresis
Slide 6         PCR
Slide 7         DNA Profiling
Slide 8         DNA Probes
Slide 9         Transgenics and Stem cells
Slide 10        Gene Sequencing
            WHAT IS BIOTECHNOLOGY?
 The use of living organisms or their products to modify human
 health and the human environment.
 Could this be the next stage in our evolution?
 How long have we been doing it…
 About 10,000 years – baking, brewing and fermenting, but more
 deliberately from the mid-1800’s… Thanks Gregor!

DNA technology                  Biotechnology                  Embryonic
                                                            disease detection
      Food production                                    Transgenic
                               Solving   Rare chemical   organisms
                    Cloning
                               crimes      synthesis




 This is the final frontier!
               RESTRICTION ENZYMES
Restriction enzymes cut up DNA




                                       Blunt
chains into smaller bits. There are
about 400 different ones used.
They cut at specific recognition
sites, which are palindronic




                                       Sticky
sequences (top reads the same as the
bottom in the 5’ → 3’ direction).
Either blunt or sticky ends are
created.
Put back together by Ligation.



Restriction enzyme animation
Lab Manual Page 287/8
                              LIGATION
 Ligation sticks our DNA sections back together.
 DNA Ligation is catalysed by the enzyme…
 DNA Ligase (no kidding!).

Along with Restriction
enzymes we can now
make recombinant DNA.
Yay!
Usually a DNA plasmid is
used as the vector (carrier
of the gene).


Clip on recombination

Lab Manual Page 289
              GEL ELECTROPHORESIS
DNA fragments can be separated in a gel on the bases on their
electric charge and size.                       See how.
1. DNA is cut up with restriction enzymes or microsatellites are
amplified using PCR.
2. The DNA fragments are transferred to wells cut into a gel.
3. An electric charge is transferred through the gel. The negatively
charged DNA fragments are repelled by the negative electrode and
attracted to the positive electrode.

The resulting pattern is known as a DNA
fingerprint. If identical patterns appear in
different column the samples may be from the
same source.



Lab Manual Page 290                       Demo of Electrophoresis
       POLYMERASE CHAIN REACTION
One of the biggest limitations of DNA technology has been that
many of the uses require heaps of sample, bro.
PCR’s development has had huge impacts on the use of DNA.

PCR uses heat to denature the DNA strand (95°C).
DNA primers are annealed onto them (60°C).
Nucleotides and DNA (Taq) polymerase are added (72°C) and two
double DNA strands are formed.
The process is repeated…
Repeat:       1    2      3    7    10       20          25
No. copies:   2    4      8   128   1,024 1,048,576 33,554,432
PCR animation and stuff

Lab Manual Page 291/2
         APPLICATION: DNA PROFILING
Much DNA is made up of short repeating units, called
Microsatellites or STR’s (short tandem repeats). The number of
repeats (and therefore the length of that section of DNA) varies
on each of an individuals chromosomes, and from person to
person.
ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCA
TGCATGCATGCATGCATGCATGTTCCATGATAGCACAT
This section of DNA is amplified (PCR) and gel electrophoresis is
carried out.
          APPLICATION: DNA PROFILING

This gives a DNA profile, or DNA
fingerprint.

DNA profiles can be used to show
relatedness (paternity or incest cases, or
to prevent inbreeding of livestock), or
prove a suspect was involved in a crime.

The more STR’s we compare, the more
sure we can be of a match; 10 STR’s =
about 1 in billion chance of having the
same STR match.




                                             Lab Manual Page 293/4
                          TRANSGENICS
Research this topic with reference to…
The purpose – what we hope to gain.
How it works – including key terms (RE, ligation), and simple
diagrams, if relevant.
What successes we have had so far.
Outlook for the future.




                             Lab manual: Transgenics 303-308
                           STEM CELLS
Research this topic with reference to…
The purpose – what we hope to gain.
How it works – including key terms (harvesting stem cells,
culturing/maintaining a stem cell line, cell cloning, therapeutic use
of stem cells), and simple diagrams, if relevant.
What successes we have had so far.
Outlook for the future.




                          Lab manual:          Stem cells      327/8
                 OTHER APPLICATIONS
There are heaps of cool things going on in this field:
DNA chips/microarrays – can quickly compare DNA samples and
their expression.
Gene therapy – fixing diseases in people by delivering normal
genes to replace affected ones.
Gene delivery – how the fixed gene are placed into individuals.
Automated DNA sequencing
Genome analysis – allows fast diagnosis of disorders and
comparison between individuals.
Cloning
Organ transplantation Xenotransplantation
Tissue engineering

								
To top