Tutorial for phylogenetic tree

Shared by: h1fpa24f
Categories
Tags
-
Stats
views:
19
posted:
6/22/2012
language:
pages:
88
Document Sample
scope of work template
							            Phylogenetic Analysis
             ─in implementation
                    way




2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   1
                                 Abstract

             Concepts of Phylogenetic Tree


             Two Categories of Phylogenetic Tree
                 Character State Matrix
                 Distance Matrix


             Tools Introduction


2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY   2
            Definition of Phylogenetic Tree

             What is Phylogenetic Tree?
                 To present how species relate to one
                  another in terms of common ancestors.
             How do we construct a phylogenetic
              tree?
                 Generally, we don’t have enough data
                  about distinct ancestors of present-day
                  species.
             Most of the phylogenetic tree are hypothesis!
2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY        3
             Common Phylogenetic Tree
                  Terminology
            Branches or
             Lineages                                      A   Represent the
                                                               TAXA (genes,
                                                               populations,
                                                           B   species, etc.)
                                                               used to infer
                                                           C   the phylogeny

                                                           D
Ancestral Node
 or ROOT of           Internal Nodes or                    E
   the Tree           Divergence Points
                   (represent hypothetical
                    ancestors of the taxa)

2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY                    4
             Two Categories of Classify Input
               Data for Phylogenetic Tree
             Comparative Characters :
                 Such as beak shape, number of fingers,
                  presence or absence, which called
                  character state matrix.
             Distance numerical data :
                 Distance between objects, the resulting
                  matrix is called the distance matrix.



2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY       5
                      Convergence
                   (parallel evolution)
             Two or more objects have the same
              states for the same characters.
                 Ex:bird and insect do have the power to
                  fly, but these two objects share a state but
                  are not genetically close.
             Convergence events should not happen,
              or their number should be minimized.



2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY            6
Types of data used in phylogenetic inference:
Character-based methods: Use the aligned characters, such as DNA
or protein sequences, directly during tree inference.
          Taxa                Characters
        Species   A      ATGGCTATTCTTATAGTACG
        Species   B      ATCGCTAGTCTTATATTACA
        Species   C      TTCACTAGACCTGTGGTCCA
        Species   D      TTGACCAGACCTGTGGTCCG
        Species   E      TTGACCAGTTCTCTAGTTCG

Distance-based methods: Transform the sequence data into pair-wise
distances (dissimilarities), and then use the matrix during tree building.
                 A        B      C       D      E
  Species   A   ----    0.20   0.50    0.45   0.40
  Species   B   0.23    ----   0.40    0.55   0.50
  Species   C   0.87    0.59   ----    0.15   0.40
  Species   D   0.73    1.12   0.17    ----   0.25
  Species   E   0.59    0.89   0.61    0.31   ----
              Comparison between Character
               method and Distance method
 Pros
       very fast



 Cons
     Sequence information is reduced to a number
     Provide only one tree topology

     Dependent on the model of evolution used


2012/6/22           NDHU CSE ALGOLAB   Yu-Wei TSAY   8
                     Two cases to verify
                 Phylogeny analysis is helpful
 Corona-Viruses
           From "Characterization of a Novel Coronavirus
            Associated with Severe Acute Respiratory Syndrome “ ,
            Science 1 May 2003.
 HIV
           From "Molecular epidemiology of HIV transmission in
            a dental practice", Science 22 May 1992.



2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY       9
                    The Florida dentist case
 A dentist from Florida seems to have infected 7 of his
  patients. The dentist died and the patients claim for
  insurance money.
 Samples:
       dentist, 7 patients, controls (HIV positive of the same area).
 env gene:
    HIV isolates from 5 patients and the dentist strain clustered
     together with sufficient bootstrap support (80%).
    Two patients have different virus strains.
 Conclusion:
    The dentist has infected 5 of his patients.
    The insurance company made a deal with the patients.


 2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY                10
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   11
                       Classifications of
                       Corona-viruses
             There are three groups of corona viruses,
              groups 1 and 2 contains only
              mammalian viruses, while groups 3
              contains only avian viruses.
             Classified into distinct species by
                 host range
                 antigenic relationships
                 genomic organization

2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY   12
            Membrane Spanning




2012/6/22    NDHU CSE ALGOLAB   Yu-Wei TSAY   13
            Phylogenetic Analysis [1]




2012/6/22      NDHU CSE ALGOLAB   Yu-Wei TSAY   14
            Phylogenetic Analysis [2]




2012/6/22      NDHU CSE ALGOLAB   Yu-Wei TSAY   15
                 There are three possible unrooted
                   trees for four taxa (A, B, C, D)
        Tree 1                 Tree 2                        Tree 3
A                  C     A                       B       A            B



B                  D     C                       D       D            C
  Phylogenetic tree building (or inference) methods are aimed at
  discovering which of the possible unrooted trees is "correct".
  We would like this to be the “true” biological tree — that is, one
  that accurately represents the evolutionary history of the taxa.
  However, we must settle for discovering the computationally
  correct or optimal tree for the phylogenetic method of choice.
2012/6/22               NDHU CSE ALGOLAB   Yu-Wei TSAY                 18

n
i 3
       (2i  5)



                           The number of unrooted trees increases in a
                             greater than exponential manner with
                             number of taxa     # Taxa ( N) # Unrooted trees
                                                                 3                 1
                                                                 4                 3
                  A       B         A            C               5                15
                                                                 6               105
                                                                 7               945
                      C             B            D               8            10,935
                                                                 9           135,135
                                                                10         2,027,025
                      C                   C                      .              .
         A                    D     A              D             .              .
                                                                 .              .
                                                                 .              .
          B                   E     B       F     E             30        Å3.58 x 10 36

                                                                                  
                                                                                     n
                          # unrooted trees for N taxa                                i 3
                                                                                            (2i  5)

          2012/6/22                      NDHU CSE ALGOLAB   Yu-Wei TSAY                                19
                  Inferring evolutionary relationships
                 between the taxa requires rooting tree:
                                                          B
                                                                            C


  To root a tree mentally,
                                                           Root                 D
  imagine that the tree is
  made of string. Grab the                                                Unrooted tree
  string at the root and                            A

  tug on it until the ends of
                                                    A          B
                                                               B      C    D
  the string (the taxa) fall
  opposite the root:
 Note that in this rooted tree, taxon A is                                Rooted tree
 no more closely related to taxon B than
 it is to C or D.                                              Root



2012/6/22                        NDHU CSE ALGOLAB       Yu-Wei TSAY                  20
                Now, try it again with the root at another
                                 position:
                B
                                            C
                                                               Unrooted tree
                               Root


                                                D



            A       A

                               B
                                   C            D

                                                                Rooted tree


                                                    Note that in this rooted tree, taxon A is most
                                                    closely related to taxon B, and together they
                        Root
                                                    are equally distantly related to taxa C and D.

2012/6/22                             NDHU CSE ALGOLAB     Yu-Wei TSAY                               21
                Each unrooted tree theoretically can be
                   rooted anywhere along any of its
A                C            branches
                                 # Unrooted                            e
                                                                # Root d
                         # Taxa       Trees      x # Root =
                                                         s         Trees
B                D          3             1            3                3
                            4             3            5                15
            C               5           15             7              105
A                D          6          105             9              945
                            7          945            11          10,395
                            8    10,935               13        135,135
B                E          9   135,135               15      2,027,025
                            .   .                     .            .
                            .   .                     .            .
            C
A                D          .   .                     .            .
                            .   .                     .            .
                                              36                        38
                           30   ~3.58x 10             57     ~2.04x 10
                                i3 (2i  3) = # unrooted trees for N taxa
                                  n

B           F    E
2012/6/22               NDHU CSE ALGOLAB   Yu-Wei TSAY                   22
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   23
            Tree building of phylogeny tree

             Phylogenetic analysis should be
              conceived as a search for a correct
              model.
                 Presumable
                 Particular
                 Rationality
                 Explanation



2012/6/22             NDHU CSE ALGOLAB   Yu-Wei TSAY   24
             Category of Phylogeny Tree

            Distance Base
              UPGMA

              Neighbor Joining
              Fitch-Margoliash

              Minimum Evolution

              Least Square


2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   25
                    Establish by UPGMA
            Unweighted Pair Group Method with Arithmetic Mean

                      ATCC ATGC TTCG TCGG

            ATCC         0                1             2   4

            ATGC                          0             3   3

            TTCG                                        0   2

            TCGG                                            0

2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY           26
               Establish by UPGMA (Cont.)

             { ATCC, ATGC }        ATCC
                                   ATGC
                                    Find the difference metrics to
                                    seek the minimal distance
             0.5      0.5

            ATCC     ATGC



2012/6/22             NDHU CSE ALGOLAB   Yu-Wei TSAY                 27
             Establish by UPGMA (Cont.)

                         {ATCC
                                               TTCG        TCGG
                          ATGC }
            {ATCC                             ½(2+3)       ½(4+3)
                              0
             ATGC }                            =2.5         =3.5
            TTCG                                       0     2

            TCGG                                             0


2012/6/22             NDHU CSE ALGOLAB   Yu-Wei TSAY                28
               Establish by UPGMA (Cont.)

                                       { TTCG, TCGG }
                                          TTCG
                                          TCGG

             0.5    0.5                    1         1

            ATCC   ATGC                TTCG          TCGG

2012/6/22           NDHU CSE ALGOLAB   Yu-Wei TSAY          29
             Establish by UPGMA (Cont.)

                         {ATCC                {TTCG
                          ATGC }               TCGG }
            {ATCC                             ½(3+3)
                              0
             ATGC }                             =3
            {TTCG
                                                       0
             TCGG }



2012/6/22             NDHU CSE ALGOLAB   Yu-Wei TSAY       30
             Establish by UPGMA (Cont.)



                    1.5                      1.5



             0.5      0.5                    1      1

            ATCC     ATGC                TTCG       TCGG

2012/6/22          NDHU CSE ALGOLAB   Yu-Wei TSAY          31
                  Four steps in phylogenetic
                        data analysis
            1. Alignment
                 Building the data model
                 Extracting a phylogenetic dataset
            2. Determining the substitution model
                 models of heterogeneity
                 Which model to use
            3. Tree building
            4. Tree evaluation

2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY   32
                         Alignment ─
                   Building the data model
 How much computer dependence?
    manually ? optimally ?

 Phylogenetic criteria preferred
    explicitly ?

 Alignment parameter estimation
       parameters should vary dynamically with divergence
 Which alignment procedure is best?
       unless the actual tree relationship are known beforehand.
 Mathematical optimization and analysis structure
       statistical models is not yet clear that can determine models

2012/6/22                NDHU CSE ALGOLAB   Yu-Wei TSAY                 33
             Alignment ─Extraction of a
                phylogenetic data set
1. One of the most important steps in p-tree
     analysis because it produce the data set.

2. Be conscious of deleting unambiguously aligned
     regions and inserting or deleting gaps.

3. Slightly modified alignments to determine how
     ambiguous regions in the alignment affect.

2012/6/22          NDHU CSE ALGOLAB   Yu-Wei TSAY   34
                       Determining the
                      Substitution Model
             The substitution model should be given
              the same emphasis as alignment and
              tree building !
             Which substitution model to use?
                 The fewer the parameters the better. This
                  is because every parameter estimate has
                  an associated variance.



2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY         35
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   36
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   37
                            Molecular phylogenetic tree building
                                         methods
            There are many phylogenetic methods available today, each having
            strengths and weaknesses. Most can be classified as follows:
                                                    COMPUTATIONAL METHOD
                                          Optimality criterion           Clustering algorithm
                          Characters




                                       PARSIMONY

                                       MAXIMUM LIKELIHOOD
              DATA TYPE

                          Distances




                                       MINIMUM EVOLUTION               UPGMA

                                       LEAST SQUARES                   NEIGHBOR-JOINING



2012/6/22                                    NDHU CSE ALGOLAB    Yu-Wei TSAY                    39
             Category of Phylogeny Tree

            Distance Base
              UPGMA

              Neighbor Joining
              Fitch-Margoliash

              Minimum Evolution

              Least Square


2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   40
             Establish by N.J




2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   41
                  Establish by N.J (Cont.)

                                     Character

            Object   A          B              C      D   E
              B      5
              C      4           7
              D      7          10             7
              E      6           9             6      5
              F      8          11             8      9   8

2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY           42
            Establish by N.J (Cont.) Step1

             Calculate the net divergence r (i) for
               each OTU from all other OTUs.
            r (A) = 5+4+7+6+8=30
            r (B) = 5+7+10+9+11=42
            r (C) = 32
            r (D) = 38
            r (E) = 34
            r (F) = 44
2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY    43
            Establish by N.J (Cont.) Step2

             Calculate a new distance matrix using
              for each pair of OUTs the formula:
                               r (i )  r ( j )
               M ij  d ij  [                  ]
                                   N 2
                              r ( A)  r ( B)
              M AB  d AB  [                 ]
                                   N 2
                          30  42
                    5 [           ]
                           62
                    13
2012/6/22                NDHU CSE ALGOLAB   Yu-Wei TSAY   44
             Establish by N.J (Cont.) Step2

                           New Distance Matrix

            Object    A           B              C       D       E
              B      -13
              C      -11.5      -11.5
              D      -10         -10          -10.5
              E      -10         -10          -10.5     -13
              F      -10.5      -10.5           -11     -11.5   -11.5

2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY                   45
            Establish by N.J (Cont.) Step3

             choose as neighbors those two OTUs for
              which Mij is the smallest. Now we
              calculate the branch length from the
              internal node U to the external OTUs A
              and B.
                         d AB [r ( A)  r ( B)]
              S ( AU )                        1
                           2        2( N  2)
              S ( BU )  d AB  S ( AU )  4

2012/6/22             NDHU CSE ALGOLAB   Yu-Wei TSAY   46
            Establish by N.J (Cont.) Step4

             define new distances from U to each
              other terminal node:
                                    d AB
             d CU    d AC  d BC       3
                                     2
                                    d
             d DU    d AD  d BD  AB  6
                                      2
                                    d AB
             d EU    d AE  d BE       5
                                     2
                                    d
             d FU    d AF  d BF  AB  7
                                     2
2012/6/22                  NDHU CSE ALGOLAB   Yu-Wei TSAY   47
             Establish by N.J (Cont.) Step4

                             Character

            Object   U          C              D      E
              C      3
              D      6           7
              E      5           6             5
              F      7           8             9      8


2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY       48
            Establish by N.J (Cont.) Step5

             N= N-1 = 5
             The entire procedure is repeated starting
              at step 1




2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY   49
             Category of Phylogeny Tree

            Distance Base
              UPGMA

              Neighbor Joining
              Fitch-Margoliash

              Minimum Evolution

              Least Square


2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   50
                        Use of FM-algorithm
                        for three sequence
               A          B           C                     a  b  22
     A         ─          22         39
                                                            a  c  39
     B         ─          ─          41
     C         ─          ─           ─                     b  c  41
Distance from A to B = a + b = 22 (1) substrate (3) form (2), a – b = - 2 (4)
Distance from A to C = a + c = 39 (2) add (1) and (4), a = 10
Distance from B to C = b + c = 39 (3) from (1) and (2), b = 12, c = 29



  2012/6/22                NDHU CSE ALGOLAB   Yu-Wei TSAY                  51
                 Tree showing relationship among
                    three sequence A,B and C.

                                       This calculation finds that the branch
                                      lengths of A and B form their common
    A                                       ancestor are not the same.
             a
        10            29
                                          C
                            c
                 12
             b
    B
                                   A and B are diverging at different rates of
                                    evolution by this calculation and model



2012/6/22                  NDHU CSE ALGOLAB   Yu-Wei TSAY                  52
                Use of FM-algorithm
                 for five sequence
                A        B           C            D    E
            A   ─        22         39            39   41
            B   ─        ─          41            41   43
            C   ─        ─           ─            18   20
            D   ─        ─           ─            ─    10
            E   ─        ─           ─            ─    ─


2012/6/22        NDHU CSE ALGOLAB   Yu-Wei TSAY             53
                       Use of FM-algorithm
                        for five sequence
                                                             39  41  18
                  D             E            ave ABC       (              )
                                                                  3
      D           ─             10             32.7
                                                               41  43  20
      E           ─             ─              34.7        (                )
                                                                     3
 Average
                  ─             ─                ─
  ABC

 The most closely related sequences given in
the distance table are D and E. A new table is
made with the remaining sequence combined.


 2012/6/22                NDHU CSE ALGOLAB   Yu-Wei TSAY                54
                     Use of FM-algorithm
                      for five sequence
            A   B      C      (DE)                     DE   C    AB
 A          ─   22    39        39            DE       ─    19   41
 B          ─   ─     41        41             C       ─    ─    40
 C          ─   ─      ─        19            AB       ─    ─    ─
(DE)        ─   ─      ─        ─




2012/6/22             NDHU CSE ALGOLAB   Yu-Wei TSAY              55
                 Tree showing relationships
                   among sequence A-E

                                                                       C
            A                                                  c
                     a
                10                     20
                                        f                          5
                         12                               g
                     b                                                     d
            B                                             6                    D
                                                                       4
                                                               e
                                                      E


2012/6/22                     NDHU CSE ALGOLAB   Yu-Wei TSAY                       56
             Steps followed by fitch-margoliash
             algorithm for phylogenetic analysis
1.    Find the most closely related pair of sequence.
2.    Treat the rest of the sequence as a single composite sequence.
3.    Calculate the distance in the above example with three sequence.
4.    Calculate the average distances between AB and make a new
      distance table.
5.    Identify the next pair of most closely related sequences.
6.    When necessary, to calculate lengths of intermediate branches.
7.    Repeat the entire procedure starting with all possible pairs.
8.    Calculate the predicted distances between each pair of
      sequences.


 2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY          57
             Category of Phylogeny Tree

            Distance Base
              UPGMA

              Neighbor Joining
              Fitch-Margoliash

              Minimum Evolution

              Least Square


2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   58
                        Construction of ME




       The trees with the shortest sum of the branch lengths (or overall
                    tree length) is chosen as the best tree.

2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY                   59
            Construction of ME (Cont.)




2012/6/22       NDHU CSE ALGOLAB   Yu-Wei TSAY   60
             Category of Phylogeny Tree

            Distance Base
              UPGMA

              Neighbor Joining
              Fitch-Margoliash

              Minimum Evolution

              Least Square


2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   61
             Category of Phylogeny Tree

            Character Base
              Maximum        Parsimony

              Maximum        Likelihood




2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   62
             Maximum parsimony method

             Requires the minimum number of
              mutational changes.
             Pros:
                 Not reduce all sequence information
                 Evaluate different tree topology
             Cons:
                 Slow for large data sets
                 Sensitive to unequal rates of evolution
                 Only give topology but no branch length

2012/6/22              NDHU CSE ALGOLAB   Yu-Wei TSAY       63
                   Steps in building
                maximum parsimony tree
             Investigate all possible tree topologies


             Reconstruct ancestral sequences


             Choose topology with smallest number
              of steps



2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY      64
                 A      A C T G A
                 B      A T T G A
                 C      G T G G A
                 D      G T G A C
                                      ACTGA                            GTGAA
A                         C                          1             0
                                                               2
                                            ATTGA                  GTGAA

                                                      0            2
B          Topology 1     D
                                      ATTGA                            GTGAC


                           There are 5 substitutions

    2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY                   65
                 A      A C T G A
                 B      A T T G A
                 C      G T G G A
                 D      G T G A C

                                   ACTGA                           ATTGA
A                                                 1            0
                          B
                                                           0
                                         ATTGA                 ATTGA

                                                      2        4
C          Topology 2     D        GTGGA                           GTGAC

                           There are 7 substitutions

    2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY               66
                 A      A C T G A
                 B      A T T G A
                 C      G T G G A
                 D      G T G A C

                                   ACTGA                               ATTGA
A                                                 1                0
                          B
                                                               0
                                         ATTGA                     ATTGA

                                                      4            2
D          Topology 2     C        GTGAC                               GTGGC

                           There are 7 substitutions

    2012/6/22                 NDHU CSE ALGOLAB   Yu-Wei TSAY                   67
                 Maximum Parsimony Method

                Branch and Bound !

char        1       2    3       4          5       6     7   8   9

 C1         A       G    G      A           G       T     G   C   A

 C2         A       G    C      C           G       T     G   C   G

 C3         A       G    A       T          A       T     C   C   A

 C4         A       G    A      G           A       T     C   C   G



2012/6/22                NDHU CSE ALGOLAB   Yu-Wei TSAY               68
            Maximum Parsimony Method
                     (Cont.)




2012/6/22       NDHU CSE ALGOLAB   Yu-Wei TSAY   69
            Maximum Parsimony Method
                     (Cont.)




2012/6/22       NDHU CSE ALGOLAB   Yu-Wei TSAY   70
            Maximum Parsimony Method
                     (Cont.)




2012/6/22       NDHU CSE ALGOLAB   Yu-Wei TSAY   71
            Maximum Parsimony Method
                     (Cont.)




2012/6/22       NDHU CSE ALGOLAB   Yu-Wei TSAY   72
             Category of Phylogeny Tree

            Character Base
              Maximum        Parsimony

              Maximum        Likelihood




2012/6/22         NDHU CSE ALGOLAB   Yu-Wei TSAY   73
             Tree Evaluation




2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   74
                       Tools Introduction

             http://evolution.genetics.washington.edu/
              phylip/software.html
                  Phylogenetic tree whole website
             http://www.tigr.org/tigr-
              scripts/CMR2/webmum/mumplot
                  The Whole Genome Alignment Tool




2012/6/22               NDHU CSE ALGOLAB   Yu-Wei TSAY   75
                               PHYLIP

             Phylogeny inference package(PHYLIP)
             Consisting of about 30 programs that
              cover most aspects of p-tree analysis
             Free and available for a wild variety of
              computer platforms. (dos、mac、unix)
             A command line program without GUI.




2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY      76
Sequence data in
FASTA format file
                    Options
                    Input file in PHYLIP format
                    Option
                    -K2P matrix
                    -Neighbor Join
                    -PAM
                    -outgroup
                    -Jin and Nei
                    -UPGMA
                    -Kimura
                    -rooting
READSEQ             -categories model
                    -randomize
                    -max likeihood
                     input order
                    -Jukes-Cantor
                    treefile with Treetool or
                    TreeView
                    view trees with
 DNADIST            CONSENSE
                    standard text editors




 PRODIST            NEIGHBOR
Sequence data
                DNADIST                 NEIGHBOR
in FASTA file
                Options                 Option
                -k2p                    -Neighbor-join
                -jin and Nei            -UPGMA
  readseq       -max likeihood          -randomize
                -Jukes-Cantor           -input ouderl


SEQBOOT         PROTDIST
Options         Option                   CONSENSE
-bootstrap      -PAM matrix              Option

-jackknife      -Kimura                  -outgroup
-permute        -categories model        -rooting



                            view tree with standard text editor
            PHYLIP input file




2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   79
            PRODIST output




2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   80
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   82
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   83
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   84
2012/6/22   NDHU CSE ALGOLAB   Yu-Wei TSAY   85
                Other Reference In This
                       Reporting
             Molecular Evolution and Phylogenetics
             ─Masatoshi Nei and Sudhir Kumar
             Phylogenetic analysis
             ─Caro-Beth.Stewart
             Introduce to Bioinformatics
             ─Arther M. Lesk



2012/6/22            NDHU CSE ALGOLAB   Yu-Wei TSAY   87
                       THE END



        Thank U for your audient




2012/6/22      NDHU CSE ALGOLAB   Yu-Wei TSAY   88

						
Related docs
Other docs by h1fpa24f
RPP Sejarah Kelas XII IPA SEM II
Views: 906  |  Downloads: 2
??????? ???? ?????? ??? ??? ???? ?????????
Views: 0  |  Downloads: 0
NEW CUPE COLLECTIVE AGREEMENT with SeptwordAA
Views: 45  |  Downloads: 0
Ministerstvo �kolstva Slovenskej republiky
Views: 11  |  Downloads: 0
MAJLIS TILAWAH AL-QURAN
Views: 48  |  Downloads: 0
Tempat - DOC
Views: 24  |  Downloads: 0