Docstoc

science 2 bac

Document Sample
science 2 bac Powered By Docstoc
					                   ‫ا‬


                                              ‫0102‬
‫ما‬
                   ‫ر ,‬
‫ة وا رض‬
                   ‫ما‬
                   ‫ة وا رض‬




               ‫ج‬        ‫ا‬      ‫و‬  ‫، إ زھ اا‬                        ‫تد ا‬          ‫ي‬     ‫ا‬        ‫إ اء ا‬               ‫ھ‬
           ‫)‬                 ‫ا ما‬     ‫ر‬   ‫ا‬                              ‫ا‬       ‫دة م ا ة وا رض‬                      ‫ا را‬
                                                                                               ‫م ا ة وا رض(.‬
       ‫،‬           ‫،ر م‬                            ‫تو‬          ‫،‬        ‫) ر، ر م‬               ‫ا‬            ‫:و‬           ‫و‬
                      ‫أ‬                ‫رة‬          ‫..( , ھ‬      ‫طت‬       ‫،‬       ‫ص‬        ‫،‬                 ‫ا و ط‬
               ‫ة‬                 ‫إ‬             ‫ا‬               ‫ر، و‬           ‫ات ا را‬      ‫لوا‬            ‫ا‬            ‫ا‬
   ‫ت‬                         ‫ا‬                 ‫ل‬             ‫ا وف‬      ‫إ زا ر أ‬                   ‫)ة (‬       ‫ذ)ة( وا‬      ‫ا‬
                                                                                                  ‫.‬          ‫ا‬       ‫ھ اا‬
               ‫و أو ا‬                ‫ة أو ا‬         ‫ا‬         ‫ضا‬      ‫أن‬                 ‫و ر ا رة إ أن ھ ه ا‬
                                                                                             ‫إ زھ .‬             ‫إ‬
                   ‫جا‬            ‫ا‬      ‫و‬            ‫غ ا ھ اف ا‬                       ‫ا ا‬            ‫أ أن ھ ھ ا ا‬
                   ‫ذو‬            ‫ا‬      ‫ا‬      ‫، و إ اء‬        ‫تا‬        ‫ا‬         ‫دة م ا ة و ا رض‬                       ‫ا‬
                                                         ‫.‬      ‫ا‬          ‫ر ا دة ھ ا ا‬                         ‫با‬        ‫ا‬
                                     ‫ذ: و فا د‬    ‫ا‬
                                     ‫وم ا ة وا رض‬
                   ‫ت ـ ا وز‬            ‫را ش ـ‬   ‫أ د‬
  ‫‪Email : alanyouyou@gmail.com‬‬
                                                             ‫ا و دة ا و‬
             ‫اﺳﺘﻬﻼك اﻟﻤﺎدة اﻟﻌﻀﻮﻳﺔ وﺗﺪﻓﻖ اﻟﻄﺎﻗﺔ‬
                                                                 ‫ـــــ م :‬       ‫ـــ ـــ‬
    ‫ر ت، دھ ت، و رو دات، وا ط ظ ھرة‬          ‫و ، ن‬         ‫ا تا‬
                                                     ‫ور ، ا واد ا‬
                                                        ‫ا ر با و .‬
      ‫ا ط ن طرف‬          ‫ءة ن ا ر ب ا و ، م و ل ا ط ا و‬   ‫لا ر ا‬
‫ا و ط ‪( Adénosine‬‬          ‫ل ز ت ‪ ) ATP‬ا د وز ن‬            ‫ا ت، إ ط‬
                                           ‫:‬  ‫‪ Triphosphate‬ب ا ل ا‬


                ‫طــ ــ + ‪ADP + Pi‬‬                          ‫‪ATP‬‬



   ‫واد ا و .‬   ‫ت ر با‬          ‫‪ATP‬‬      ‫ل اط ا ز‬              ‫لا ر ا ظ ،‬
     ‫ط ن‬         ‫، و زود ط ا ز‬       ‫ن‬    ‫دد و‬    ‫و‬            ‫ا دة ا‬   ‫لا‬
 ‫ص اط‬    ‫نا‬     ‫د‬     ‫ھو ‪ATP‬‬   ‫ا‬     ‫ن طرف ا‬     ‫ا‬           ‫أ رى. و أن ل ا ط‬
 ‫ف‬             ‫ل ‪ ، ATP‬ن د ذ ك ا‬                   ‫ا‬         ‫ا واد ا و‬         ‫ا‬
                       ‫ل ا ط، ا ر ، وا ر ت ا و .‬     ‫،‬        ‫ز ط‬      ‫ا ظواھر ا‬

   ‫ل ‪ ATP‬ن‬           ‫ص اط‬           ‫ن نا‬      ‫1( ھ ا ظواھر ا و ا‬
                                            ‫؟‬     ‫ا واد ا و ا‬

                              ‫ص؟‬           ‫ن ‪ ATP‬ا‬    ‫دا‬         ‫2( ف‬

                         ‫؟‬   ‫ء ا دة ا‬        ‫و‬   ‫3( ف وظف ا واد ا‬




         ‫ذ: و فا د‬   ‫ا‬                                       ‫: -1-‬           ‫ا‬
                                              ‫ل ا ول:‬           ‫ا‬
                     ‫ﺗﺤﺮﻳﺮ اﻟﻄﺎﻗﺔ اﻟﻜﺎﻣﻨﺔ ﻓﻲ اﻟﻤﻮاد اﻟﻌﻀﻮﻳﺔ‬
‫و :‬           ‫ا دة ا‬               ‫ا‬     ‫رراط‬      ‫ن‬      ‫ت ا ؤو‬               ‫‪–Ι‬ا ف نأ طا‬
                                                        ‫دم ا ذ :‬             ‫أ – ا س ظ ھرة و‬
                                                                ‫1.‬     ‫1 و‬   ‫ر : أ ظر ا و‬       ‫‪– a‬‬
‫ا و ــــــــــ 1‬
                                                  ‫ل1‬    ‫ا‬                                           ‫1:‬   ‫او‬

                                                                ‫ا رة‬                        ‫و‬          ‫رض‬
                                                                ‫دة 03‬             ‫وا ط‬      ‫و‬        ‫)‪(10g/l‬‬
                                                                                                       ‫؛‬
                                                                ‫ل‬       ‫‪ 5ml‬ن ھذا ا ول دا ل‬
                                                                         ‫وى دة ‪ ) EXAO‬ا ل 1(؛‬
                                                                ‫ل ا دة، طور ر ز‬              ‫،‬
                                                                ‫ل ا وي‬     ‫ن ا ذاب دا ل ا‬      ‫ا و‬
                                                                ‫ن ) (،‬      ‫س ا و‬      ‫س‬       ‫ل‬
                                                                   ‫ا را ق ا‬    ‫إ‬     ‫ر‬      ‫إ رات‬
                                                                   ‫ط ت ر‬      ‫) ول( ا ذي و إ‬
                                                                ‫ن‬     ‫إ‬      ‫وب و ر‬       ‫ا‬
                                                                                       ‫) ا ل2 ( ؛‬
                                                                ‫ل ‪0.1 ml‬‬   ‫ن دا ل ا‬             ‫ا ز ن 1‪t‬‬
                                                                      ‫وز ر ز % 5.‬                ‫ن ول ا‬
                                                                    ‫ل‬    ‫ن ا‬     ‫ف طور ر ز ا و‬
                                                                    ‫ا وز و دھ : ذا‬      ‫ا وي، ل إ‬
                                                                                            ‫؟‬




                       ‫.‬                           ‫ل2‬       ‫ا‬
                                                                             ‫ج:‬     ‫ل وا‬        ‫‪–b‬‬
                                                    ‫رة.‬   ‫ن‬            ‫ا و‬     ‫ا وز، ون‬        ‫لإ‬
                                           ‫ن ا و ط.‬     ‫ا و‬            ‫ض‬      ‫ا وز،‬      ‫رة د إ‬
               ‫وز. ول ادن أن‬           ‫ن دم ا‬     ‫كا و‬      ‫رة‬         ‫ا‬      ‫ن ھذه ا ط ت أن‬
                                                                                      ‫ا رة س.‬
                   ‫ذ: و فا د‬   ‫ا‬                                                  ‫: -2-‬         ‫ا‬
                                                             ‫ذ :‬           ‫و أ رى دم ا‬            ‫ر ظ ھرة‬       ‫ب–ا‬
                                                        ‫: ) ‪.( Fermentation lactique‬‬                  ‫‪ – a‬ا را‬
‫ا و ــــــــــ 1‬                                                           ‫2 و 1.‬                      ‫ر : أ ظر ا و‬
                                                    ‫ل 3:‬        ‫ا‬                                              ‫2:‬      ‫او‬
                                                                         ‫و ل ذي‬         ‫ن ا ب ا ل ا طري و ر‬            ‫ذ‬
          ‫‪Ph‬‬                                                             ‫لء ا و ل إ أ ره طرد‬         ‫م ‪ .250 ml‬رص‬
      ‫ـ‬                                                                         ‫ھوا ــ ؛‬         ‫ل‬        ‫ول‬        ‫ا واء –‬
  ‫ـ 8.5‬                                                                  ‫دا ل ا ب س ‪ ph‬ا ذي ر ط دة ‪EXAO‬‬
      ‫ـ‬
  ‫ـ 6.5‬                                                                  ‫ا ر –‬           ‫ا ب أ ء‬             ‫طور‬       ‫د‬
      ‫ـ‬                                                                  ‫، و م ذك‬     ‫ض‬       ‫وز إ‬     ‫ول ا وز ا ون‬
  ‫ـ 4.5‬                                                                                                  ‫دون طرح2‪ co‬ــ ؛‬
      ‫ـ‬                                                                        ‫رارة‬      ‫در‬       ‫ر دة 51 و‬          ‫رك ا‬
  ‫ـ 2.5‬
      ‫ـ‬                                                                  ‫‪ ph‬وا ط دة‬          ‫طور‬         ‫°04(، د ذ ك‬    ‫)‪C‬‬
     ‫ـ5‬                                                                           ‫ل3.‬           ‫ا‬    ‫ا‬       ‫ل‬     ‫‪EXAO‬‬
      ‫ـ‬                                                                  ‫ن ھذا ا طور وھدم‬       ‫ا‬     ‫وا‬       ‫ف طور ا‬
       ‫002‬          ‫004‬        ‫006‬           ‫008‬    ‫ا ز ن )‪(s‬‬
                                                                                                                   ‫ا وز.‬

   ‫‪ph‬‬              ‫ض‬      ‫ظا‬         ‫) °04 (‬
                                         ‫‪C‬‬                      ‫ج : د 51 و‬
                                                                    ‫رارة‬        ‫ل وا‬
                                                                                 ‫در‬
                                                                   ‫ا ب.‬            ‫أي ار ع‬
        ‫‪Acide‬‬              ‫ض‬             ‫وز، و و إ‬    ‫ظ أ م ھدم ا وز ا ون‬    ‫ن ھذه ا‬
                                         ‫ن. م ادن ن ظ ھرة ا ر ا‬   ‫با و‬     ‫‪ ،lactique‬وذا ك‬

                                                    ‫و : ‪Fermentation alcoolique‬‬                  ‫‪ –b‬ا را‬
                                                                                        ‫1.‬    ‫ر : أ ظر ا و 3 و‬
 ‫ا و ــــــــــ 1‬
                                                                                                                     ‫3:‬   ‫او‬
                                                                                                   ‫ا ل 4 : ا رو و ول ا ر‬
                                                                                     ‫رورة ) ‪( 5g/l‬؛‬     ‫ول ا وز‬
                                                                                             ‫ول ا وز؛‬         ‫زرع ا رة‬
                                                                                      ‫ن ) ° 73 (.‬
                                                                                             ‫‪C‬‬         ‫ء‬     ‫ر‬       ‫ا‬
                                                                                                                   ‫:‬   ‫ا‬
                                                                                          ‫ا وز ا و ط.‬           ‫• ا ض‬
                                                                                                    ‫• طرح 2‪ co‬ا وب.‬
                                                                                              ‫• ار ع ط ف در ا رارة.‬
                          ‫ل 5( .‬     ‫ا‬       ‫ن‬     ‫لا‬        ‫ول وا ط ا‬           ‫• ظ ور ا ول و ط ا زرع. ) ف ن ا‬
                                              ‫و .‬       ‫را‬          ‫وا‬      ‫را‬        ‫ن ھذه ا ط ت ا ر ، رن ن ا‬    ‫اط‬
                                                                                          ‫رن ن ظ ھر ا س و ظ ھر ا ر.‬

                                                                                                      ‫ج:‬      ‫ل وا‬
     ‫دون طرح 2‪.CO‬‬                    ‫ضا‬            ‫ن ذ ك ون ا‬                    ‫ث‬      ‫وز،‬    ‫دم ا‬     ‫ھو طر‬        ‫را‬    ‫ا‬

                    ‫6‪C6H12O‬‬                                                           ‫‪2CH3 – CHOH - COOH‬‬
                    ‫ذ: و فا د‬            ‫ا‬                                                            ‫: -3-‬     ‫ا‬
              ‫ول )‪(Ethanol‬‬         ‫ول ھو ا‬    ‫ن ذك‬              ‫ث‬    ‫وز،‬    ‫دم ا‬       ‫ھو طر‬     ‫ا را و‬
                                                                                               ‫طرح 2‪.CO‬‬

                   ‫6‪C6H12O‬‬                                          ‫2‪2CH3 – CH2OH + 2CO‬‬

                                                                                   ‫:‬            ‫‪–c‬‬
      ‫ن ب ظروف :‬           ‫ھد طر ن‬        ‫بط ،و‬      ‫ا وز‬      ‫لا‬
 ‫وز و و‬       ‫ن (، م ا دم ا‬     ‫و‬     ‫‪ o‬ا س : و ط وا ‪) Aérobie‬‬
                                ‫ط .‬    ‫إ 2‪ CO‬و ء وھ واد د دون‬
‫ا وز دم ر‬         ‫ن (،‬     ‫ھوا ‪ ) Anaérobie‬ب ا و‬    ‫‪ o‬ا ر: و ط‬
                    ‫.‬       ‫زال زن ا ط ا‬    ‫و‬   ‫ز ت‬    ‫م، و و إ‬

                             ‫‪Le hyaloplasme‬‬       ‫.‬         ‫ا‬        ‫وى ا‬              ‫وز‬      ‫لا‬           ‫‪ – ΙΙ‬ا‬
                                                  ‫ا س وا ر‬          ‫1 رف ا ت ا و ا د‬
                                             ‫2.‬   ‫رب و ظ ت : أ ظر ا و 1 و‬    ‫‪–a‬‬
‫ا و ــــــــــ 2‬
                                                                                               ‫ر‬       ‫1:‬     ‫او‬
      ‫ر‬       ‫وا ( و و ط‬        ‫ن)و ط‬                 ‫و ط‬       ‫ش‬    ‫ن أن‬  ‫ري و د ا‬     ‫رة ا رة طر‬
                                                                                ‫ھوا (‬   ‫ن)و ط‬
   ‫ف‬            ‫ر‬    ‫دد ا‬     ‫ظ د رور وم أن‬      ‫ا وز‬       ‫ن وي‬                   ‫ا رة و ط‬        ‫ـ و‬
   ‫ر‬          ‫ظ ا‬     ‫نا‬      ‫2‪ CO‬و‪ H2O‬ا و ط و‬         ‫ن و ار ع‬        ‫ا وز و ا‬         ‫را ا ض‬
                                             ‫ا و و در ت .ا ل 1‬           ‫ت و‬             ‫ر‬   ‫ا‬      ‫أن‬
       ‫ر زاد‬         ‫دد ا‬     ‫ظ د رور وم أن‬       ‫ا وز‬      ‫ن وي‬               ‫ا رة و ط ر‬          ‫و‬
     ‫ظ‬     ‫نا‬        ‫طو‬     ‫ون ول ا ول ‪ C2H5OH‬ا و‬            ‫2‪CO‬‬         ‫ا وز و ار ع‬        ‫ا ض‬
                                      ‫رة . ا ل 2‬   ‫و‬    ‫و و در ت‬           ‫ر وي‬       ‫ا‬    ‫ر أن‬       ‫ا‬
          ‫،‬    ‫ا‬     ‫ن‬       ‫ا و‬     ‫ن و ود ا و در ت، وو ود‬       ‫دد ا‬        ‫ن ھذه ا ط ت ا ر‬      ‫اط‬
                                                                ‫.‬     ‫ل ن ا س وا ر دا ل ا‬           ‫و‬

                                   ‫ل2‬    ‫ا‬                      ‫ل1‬     ‫ا‬




                                             ‫ج:‬  ‫ل وا‬    ‫‪–b‬‬
   ‫ا ظروف ا وا ، أي ل ظ ھرة ا س، ط ب ھدم ا وز‬     ‫ن ن ھذه ا ط ت أ‬
 ‫ھوا ،‬   ‫ا ظروف ا‬    ‫ھ ا و در ت )‪،(Mitochondries‬‬       ‫ت و‬       ‫و ود‬
                   ‫ط ب ھدم ا وز و ود ا و در ت.‬    ‫أي ل ظ ھرة ا ر،‬
       ‫، وھ ا ل ا وز‬     ‫ا‬     ‫م دا ل ا‬  ‫ر‬    ‫دئ ل ن ا س وا ر ر‬
  ‫ط ب ا س د ل ا و در ت.‬       ‫،‬      ‫ا‬  ‫تا ر ا‬       ‫ر‬   ‫)‪.(glycolyse‬‬

                    ‫ذ: و فا د‬       ‫ا‬                                                  ‫: -4-‬       ‫ا‬
2 ‫ا و ــــــــــ‬                                                                                                               ‫وز‬            ‫لا‬    ‫2 را ل ا‬
                               C6H12O6 ‫وز‬           ‫ ا‬GLUCOSE
            ATP
                                                                          6C
                                                                                                    : ‫وز‬               ‫لا‬      ‫تا‬                 –a
            ADP                                   ‫كاط‬       ‫ا‬
                              Glucose 6-phosphate           6C                                  ‫ت‬             ‫2، ا‬ ‫ط ا و 2 وا و 3 و‬
                                                                                                                     .‫ل ا وز‬         ‫ا‬
                              Fructose 6-phosphate 6C                                               ‫ل‬         ‫ن ھذه ا ط ت، ا رج ا‬   ‫اط‬
            ATP
            ADP
                                                  ‫كاط‬       ‫ا‬                                                  .‫ن ا ل ا وز‬        ‫اط ا‬
                              Fructose 1, 6-diphosphate 6C

                                                                                                                       :‫ج‬          ‫ل وا‬           –b
                                                                                                        ‫ل ا وز ب‬         ‫ا‬     ‫دا ل ا‬
                 2           3-phosphoglycéraldéhyde 3C                                                 ‫، ا زة‬    ‫تا‬       ‫نا‬
        2       Pi                                              2    NAD
                                                                              +                           ‫ت ر‬       ‫ز ت و . وھ‬
                 ‫ا زاع ا درو ن‬                                  2    NADH + H
                                                                             +
                                                                                                          ‫ث‬    ‫ن، و م‬    ‫و‬
                     2       1, 3-diphosphoglycérate 3C                                                                       :‫را ل‬
       2    ADP
                                                  ‫ا جاط‬
       2    ATP
                      2        3-phosphoglycérate 3C                                                                                : ‫ا و‬          ‫• ا ر‬

                         2     2-phosphoglycérate 3C                                                      ‫ول ا وز و ت إ ر وز‬
                                                                                                        ‫آ‬   ‫و و‬   ‫ا و ت، د ت‬
                     2        Phosphoénolpyruvate 3C
                                                                                                                       .ATP ‫ن‬
       2    ADP
                                                  ‫ا جاط‬
       2    ATP

            2
                     Pyruvate      2CH3COCOOH ‫ض رو ك‬                              3C                                           2 ‫ا و ــــــــــ‬
                                                                                                     .‫ر‬       ‫س وا‬            ‫وز‬        ‫لا‬    ‫ا‬        :3     ‫او‬
                         ‫وز‬       ‫لا‬     ‫2 : را ل ا‬                  ‫او‬
                                                                                                                                   ‫وز‬
                                                                                                               +
                                                                                                        2NAD

                                                                                                                                                             ‫ا‬
                                                                                                                                                  2ADP

                                                                                                                                                             ‫لا‬
                                                                                                                   +
                                                                                                   2(NADH+H )                                     2ATP
                                                                                                                                                             ‫وز‬


                                              +
                               2(NADH+H )
                                                                                                                            ‫ض رو ك‬           2
                                   2NAD
                                          +                                                               ‫ر‬        ‫ا‬                               ‫س‬     ‫ا‬
                                                                                                                                         +
                                                                                                                            2(NADH+H )
                                       2CH3-CHOH-COOH                                  2CO2

                                    (         ‫ر‬         )        ‫ض‬        2
                                                                                                2CH3-CHO
                                                                                                                                                              ‫و دري‬




                                                                                       +
                                                                     2(NADH+H )
                                                                                  +                                                      +
                                                                      2NAD                                                     2NAD
                                                                                               2CH3 -CH2OH
                                                                                           (   ‫و‬    ‫ر‬     ) ‫ول‬         ‫2ا‬




                              ‫ذ: و فا د‬                 ‫ا‬                                                                           -5- :          ‫ا‬
                                                                             ‫• ا ر ا‬    ‫:‬
       ‫رأ د د و ت(.‬                 ‫و ت )2‬        ‫ز ن ن ر‬       ‫ا و تإ‬      ‫طر ا ر وز‬
      ‫ل درو ن (‬                     ‫ل ن ھ ن ا ز ن إ ا زاع ا درو ن ) أ دة (، وا ط‬
                                                ‫) ‪.NAD+ = Nicotinamide adénine dinucléotide‬‬
            ‫رأ د د‬        ‫ا‬        ‫ر ز‬         ‫ا ل ا ؤ د +‪ NAD‬زل و ول إ +‪NADH + H‬‬
                                             ‫ا و ت.‬     ‫ري‬      ‫ض‬     ‫و ت، ا ن و ن إ‬
                     ‫-‪NAD+ + 2H+ + 2e‬‬                                              ‫+‪NADH + H‬‬

                                                                      ‫:‬   ‫• ا ر ا‬
       ‫‪ ADP‬و و ن إ‬                 ‫إ‬      ‫ا و‬     ‫و‬    ‫ا و ت،‬   ‫ري‬     ‫م ز ا ضا‬
       ‫ول ‪ ADP‬إ‬                    ‫ز ن ن ض ا رو ك ) ‪،( Acide pyruvique CH3COCOOH‬‬
                                                                               ‫‪.ATP‬‬

        ‫ا ل ا وز، ب إ دة أ دة +‪ .NADH + H‬و م ھذه‬        ‫ر‬                                                   ‫وظ :‬
     ‫ن.‬    ‫با و‬      ‫ن، أو ل ا ر‬      ‫ل ا س ا وي، د و ود ا و‬                                                ‫ا دة، إ‬

                                                                          ‫وز:‬    ‫لا‬            ‫اط‬                ‫3ا‬
     ‫+‪C6H12O6 + 2ADP + 2Pi + 2NAD‬‬                              ‫)+ +‪2CH3COOH + 2ATP + 2(NADH‬‬
                                                                                 ‫‪2(NADH+H‬‬
‫وز.‬         ‫نا‬       ‫ل ز‬                  ‫ن ن ‪ATP‬‬     ‫ر ب ز‬             ‫وز ھ‬     ‫لا‬            ‫اط‬                ‫ادن ا‬
                                                       ‫و در ت.‬            ‫ودور ا‬            ‫دات ا‬            ‫‪ – ΙΙΙ‬ا‬
                                                                     ‫و دري ؟ :‬   ‫وى ا‬           ‫1 ذا دث‬
                                                                                    ‫رب :‬        ‫‪–a‬‬
 ‫3.‬     ‫1 و‬          ‫او‬                  ‫رب ا‬   ‫و دري، أ زت ا‬            ‫ض ا رو ك دا ل ا‬        ‫ر‬    ‫ر‬
                                                  ‫ا و ــــــــــ 3‬
                                                                                                    ‫ر‬       ‫1:‬     ‫او‬
                                                           ‫4.7=‪ ph‬ن أ ل زل‬         ‫ر‬   ‫ول‬      ‫د ر‬           ‫رس‬
                                                                                                    ‫ا و در ت.‬
                                                           ‫رة‬      ‫ول‬     ‫رة ن ن ا‬         ‫رض ا ط ذ ذي ر‬
                                                           ‫ول ر‬       ‫‪ culot‬ن ا و در ت. ط زءا ن ا رة‬
                                                                    ‫دة ‪ ،EXAO‬م‬           ‫ل إ‬              ‫م، و‬
                                                                ‫ن )ا ل 1(.‬      ‫ا و‬      ‫وب طور ر ز‬        ‫ا‬
                                                           ‫ن ا وز،‬                   ‫لا‬     ‫فإ ا‬       ‫ا ز ن 1‪t‬‬
                                                                    ‫ن ض ا رو ك.‬                ‫ف‬     ‫و ا ز ن 2‪t‬‬
                                                                      ‫طور ر ز 2‪ O‬د ا ز ن.‬             ‫1( ل‬
                                                                       ‫2‪ O‬ا و ط ؟‬         ‫ذا دل ر‬          ‫2(‬
                                                           ‫؟‬     ‫ا‬      ‫ر‬     ‫ا‬     ‫ھ ا ظ ھرة ا ز و و‬      ‫3(‬
                                                                                                 ‫وأ ن م؟‬
                                                           ‫م دا ل‬      ‫ت ا‬       ‫وص ا‬                 ‫4( ذا‬
                          ‫ل1‬   ‫ا‬                                                              ‫ا و دري؟‬

                                                                    ‫ج:‬    ‫ل وا‬      ‫‪–b‬‬
‫وز‬      ‫ا‬        ‫ف دا، و د إ‬ ‫و در ت‬                     ‫ن ن طرف ا‬    ‫كا و‬     ‫1( ل 1‪ t‬ون ا‬
                 ‫ض ا رو ك ن‬      ‫دإ‬                      ‫ن. أ‬  ‫كا و‬    ‫را‬       ‫ا ز ن 1‪t‬‬
                                                                    ‫ن ر .‬       ‫كا و‬     ‫ا‬
                 ‫ذ: و فا د‬           ‫ا‬                                                 ‫: -6-‬            ‫ا‬
              ‫ط .‬        ‫ل‬                    ‫و در ت‬            ‫ون ا‬              ‫او ط‬        ‫ن‬      ‫ا و‬         ‫ر‬        ‫2( دل‬

                        ‫ق ظ ھرة ا س ا وي.‬                       ‫أن ا ر‬                 ‫ن‬      ‫كا و‬           ‫و در ت‬        ‫3( ا‬

  ‫وز، ا ذي‬              ‫لا‬      ‫ا‬      ‫ل‬               ‫رة، ل‬         ‫وز‬           ‫لا‬           ‫أن ا و در ت‬                     ‫4(‬
                                                                                                 ‫ض ا رو ك.‬                ‫ھو‬

                   ‫ن، دا ل‬          ‫ض ا رو ك و ود ا و‬                                  ‫طرأ‬    ‫ا‬             ‫تا‬     ‫5( إن ا‬
                                        ‫ت وا .‬       ‫وھ‬                                 ‫دات ا‬   ‫لا‬           ‫ا و دري،‬

                                                                                                     ‫:‬               ‫‪–c‬‬
                                                                                         ‫ن:‬        ‫ب ا وز إ‬         ‫رض‬
 ‫ل‬        ‫ا‬             ‫ن، و‬        ‫ا و‬           ‫جإ‬            ‫،و‬        ‫ا‬            ‫وى ا‬         ‫ـ ا ول رج ا و دري‬
                                                                                                      ‫وز. ) ‪( glycolyse‬‬ ‫ا‬

        ‫ر‬          ‫.و‬          ‫دات ا‬          ‫ا‬            ‫نو‬       ‫ا و‬        ‫جإ‬ ‫و دري و‬                   ‫وى ا‬           ‫ـا‬
                                                       ‫.‬        ‫دات ا‬          ‫ب ا ذي رض‬                     ‫ض ا رو ك ھو ا‬

                                                                                     ‫و و ت ا و در ت :‬                               ‫2‬
                                                   ‫3‬       ‫2 و‬         ‫ا و دري : أ ظر ا و‬    ‫‪ – a‬وق‬

‫ا و ــــــــــ 3‬                                                                                                           ‫2:‬       ‫او‬




                               ‫ل3‬                                                  ‫ل2‬                             ‫ل1‬



                                                                  ‫و دري.‬                 ‫ط طو‬    ‫ظ ا رو را‬  ‫ل1=‬                      ‫ا‬
                                                                ‫و دري.‬                   ‫ط ر‬     ‫ظ ا رو را‬  ‫ل2=‬                      ‫ا‬
                                                                    ‫و دري.‬             ‫ا‬    ‫ري وق‬     ‫ل3=ر م طط‬                      ‫ا‬

              ‫. 4 = ‪ =5 . ADN‬ر س.‬                          ‫ز‬     ‫.3=‬          ‫ر‬    ‫ء‬       ‫.2=‬       ‫ء دا‬      ‫:1=‬        ‫ر او‬

                ‫ا ون‬         ‫دة د‬      ‫ط‬           ‫ء زدوج،‬             ‫، و ون ن‬               ‫تا‬            ‫و دري ن‬      ‫را‬
                                    ‫أ راف ) ‪.( crêtes‬‬                         ‫ء ا دا‬       ‫ر ت‬              ‫ر س ) ‪،( matrice‬‬


                    ‫ذ: و فا د‬             ‫ا‬                                                              ‫: -7-‬        ‫ا‬
‫ا و ــــــــــ 3‬
                    ‫3‬          ‫4، و‬     ‫3، ا و‬        ‫و دري : أ ظر ا و‬                  ‫‪ –b‬ا ر با و‬
                ‫ء ن ا دا‬          ‫ا ز‬        ‫رو ، ب= ر م‬        ‫را‬        ‫ظ‬    ‫و دري‬        ‫ء ا دا‬    ‫ا‬    ‫3:أ=‬       ‫او‬
                                                                                                                ‫.‬   ‫وا ر‬




                                                                                                          ‫:4‬          ‫او‬
                ‫رس‬         ‫ا‬                                      ‫ا ء ا دا‬                            ‫ا ءا ر‬
                                                                   ‫رو ت % 08.‬
                                                                                             ‫رو ت % 26.‬
  ‫رة ر و .‬     ‫ز ت‬                               ‫ن‬               ‫دھ ت % 02، ط‬
                                                                                               ‫دھ ت % 83‬
        ‫أز ت و .‬                                         ‫ء‬       ‫ا ز ت ا و ودة‬
                                                                                                     ‫ذات ط‬
      ‫ت ا رو ت‬                                                         ‫ا و ز .‬
                                                                                                ‫ك ا و ودة‬
           ‫وا رو و ت.‬                                ‫ت أ دة‬            ‫أ ز ت ھم‬
                                                                                                     ‫ء‬
    ‫‪ ATP‬و ‪ ADP‬و ‪.P‬‬                                                         ‫ا زال.‬
                                                                                                ‫ا و ز .‬
                                                                       ‫ز.‬   ‫‪ATP‬‬

            ‫ء ا ر ، وا دا ، وا ر س، إذ ون ا ر س‬                                        ‫ظا ف ا ر ب نا‬
     ‫ت ا رو و ت وا رو ت و‪ ،ATP‬أ‬            ‫ر ون،‬       ‫ز‬                              ‫درو ن وا‬     ‫ز تا ز‬
          ‫ر ‪ ADP‬إ ‪ .ATP‬و د ل ھذه‬      ‫ؤو ن‬         ‫تأز‬                                 ‫ز و ود ر‬       ‫ا ء ا دا‬
                           ‫راخ. ) ‪.( sphère pédonculée‬‬                                ‫ر ب ا رات ذات‬    ‫ا ز ت‬

                                                              ‫إ ج ‪:ATP‬‬                    ‫دات ا‬           ‫‪ – ΙV‬دور ا‬
                                                                      ‫:‬        ‫دة ا‬      ‫ت دورة ‪ Krebs‬وا‬             ‫1‬
      ‫ن،‬         ‫ت، و ود ا و‬                 ‫نا‬         ‫و‬       ‫ض ا رو ك‬                  ‫إ ا و دري،‬      ‫دا‬
                                                                                           ‫.‬    ‫دات ا‬  ‫ا‬       ‫و‬
                                             ‫ر را ل:‬          ‫ث م ھدم ا رو ك‬           ‫ت ا ر س،‬       ‫دأ ھذه ا‬

                                                        ‫ل وأ ز م ‪.A‬‬           ‫ا و : ون ا‬             ‫‪ –a‬ا ر‬

                 ‫ل وأ ز م ‪A‬‬              ‫ون ا‬         ‫ر ون،‬          ‫درو ن و ز‬    ‫، ز‬            ‫ت رأز ت و‬
                                                                            ‫ض ا رو ك.‬            ‫ن‬   ‫ا ر س، ا ط‬
                    ‫‪AH‬‬
  ‫+‪CH3CO – COOH + Co-AH + NAD‬‬                                                 ‫2‪CH3CO – CoA + NADH2 + CO‬‬
      ‫ض ا رو ك‬                    ‫وأ ز م ‪A‬‬                                    ‫ل وأ ز م ‪A‬‬        ‫أ‬

                      ‫ذ: و فا د‬          ‫ا‬                                                    ‫: -8-‬         ‫ا‬
                                             .4          ‫1 و‬               ‫. ا ظر ا و‬Krebs ‫: دورة‬                      ‫ا‬     ‫– ا ر‬b
          4 ‫ا و ــــــــــ‬                                                                                        :1        ‫او‬




                                            ‫ض ا رو ك‬         3C

                         NAD+                                     HS – CoA - A ‫وأ ز م‬                                        Remarques :
                                                  1
                   NADH
                                   +
                                  +H                              CO2                                                 Le nombre d’atomes de carbone
                                                                                                                      de chaque type de molécule est
                                            A ‫ل وأ ز م‬   ‫أ‬   2C                                                       indiqué dans le cadre blanc.
                                                                                                                      Chez les végétaux le GDP est
                                                             H2O
                                                                            HS - CoA                             *    remplacé par de l’ADP.

                     ‫ك‬       ‫وأ‬    ‫ض أو‬     4c
                                            4C
                                                                  2
        +
NADH + H                                                              ‫رك‬    ‫ضا‬       6C                                Enzymes impliquées
   NAD+                  9
                                                                                                                 1.    Pyruvate déshydrogénase
                                                                                                                 2.   Citrate synthase
           Malate     4C                                                            3                            3.   Aconitase
                                                                                                                 4.   Isocitrate déshydrogénase
                 8                                                                                               5.   α-cétoglutarate déshydrogénase
                                                                                                                        cétoglutarate
                                                                                   Isocitrate   6C               6.   Succinyl
                                                                                                                      Succinyl-CoA synthétase
                                                                                                                 7.   Succinate déshydrogénase
        Fumarate      4C               Krebs ‫ت دورة‬                                                              8.   Fumarase
                                                                             CO2                     NAD+
                                                                                        4                        9.   Malate déshydrogénase
                                                                                                             +
FADH2                                                                                                NADH + H
                 7
 FAD
                                                                            α-cétoglutarate     5C
          Succinate          4C
                                                                  CO2
                                                                             5
                                                                                                                       Noms des molécules
                                                                                                                       +
                                                                                                                 NAD : nicotine adénine dinucléotide
              GTP                  6
          *                                                                                                      FAD : flavine adénine dinucléotide
                                                                                                                                  5’-diphosphate
                                                                                                                 GDP : guanosine 5’
              GDP + Pi                    Succinyl-CoA       4C                         NAD+                                      5’-triphosphate
                                                                                                                 GTP : guanosine 5’
                                                                                   NADH + H
                                                                                           +                     HS – CoA : coenzyme A




                     Équation bilan du cycle de Krebs à partir de l’acide pyruvique (= pyruvate)
        CH3-CO-COOH + 4 NAD+ + FAD + GDP + Pi + 3H2O → 3 CO2 + 4 NADH + 4H+ + FADH2 + GTP                                                         *
                         .‫ت إزا ا ر ون، وإزا ا درو ن‬                                             ‫ن‬               ‫ون ن‬                ‫ھ دورة و‬
                         ‫ذ: و فا د‬                ‫ا‬                                                                        -9- :      ‫ا‬
    ‫ر ك )6‪.(C‬‬          ‫ضا‬            ‫ط‬
                          ‫ض أو وأ ك )4‪، (C‬‬     ‫م أ ل وأ ز م ‪ A‬إ‬                                        ‫•‬
                                 ‫ل د د.‬    ‫رر ا وأ ز م ‪ ،A‬د ت ق‬                                        ‫•‬
‫،‬       ‫ت إزا ا ر ون، وإزا ا درو ن، وا د أ ز ت‬  ‫ضا رك‬                                                  ‫•‬
  ‫ض ا و وأ ك، ھذا ا ر ود ا ل أ ل وأ ز م‬              ‫ل ا ر‬
                                                                ‫‪.A‬‬
                   ‫ل دورة ‪ Krebs‬م ر ر 2‪ ،CO‬وا زال ز ‪ NAD‬و‪fad‬‬                                           ‫•‬
             ‫) -‪NAD+ + 2 ( H+ + e‬‬                  ‫>----------‬        ‫+‪NADH + H‬‬
             ‫) -‪FAD+ + 2 ( H+ + e‬‬                  ‫>----------‬               ‫2‪FADH‬‬

                                             ‫‪.GTP‬‬         ‫ن أ دة ز‬        ‫‪ ATP‬ا ط‬          ‫ور ب ز‬

                                                    ‫ر س:‬     ‫ا‬       ‫ض ا رو ك‬         ‫دم‬          ‫لا‬       ‫ا‬
‫2‪CH3-CO-COOH + 4NAD+ + FAD + GDP + Pi + 3H2O ---------> 4NADH2 + ATP + 3CO‬‬

                                         ‫ر +‪ NADH+H‬و 2‪.FADH‬‬              ‫:‬     ‫ا‬       ‫‪ –c‬ا ر‬

        ‫، وأ رز أھ‬        ‫دة ا‬        ‫لا‬    ‫ف‬          ‫ن ا و 2، وا و 3، ا و 4، و‬                   ‫اط‬
                                     ‫و دري.‬          ‫ا ء ا دا‬     ‫ل ا رو و ت +‪ H‬ن‬                 ‫ون‬
‫ا و ــــــــــ 4‬                              ‫2:‬     ‫او‬     ‫وز، م ا زال‬          ‫ت أ دة ا‬          ‫ل‬
                                                                               ‫+‬                 ‫+‬
‫م ل ا رو ت ن ا زوج +‪NADH+H+/NAD‬‬                                     ‫+‪NAD‬و ‪ ،FAD‬ط ‪NADH+H‬‬
‫ت أ دة-ا زال،‬  ‫إ ا زوج ‪ O2/H2O‬وا ط‬                          ‫رو و ت‬             ‫و2‪ . FADH‬ادن ھذه ز ت‬
‫ب دل ا د‬      ‫، وذ ك ل‬    ‫ا‬     ‫را‬                                           ‫وا رو ت، ب أن ود إ‬
                         ‫أ دة-ا زال.‬                                                              ‫ا ؤ دة.‬
                                                                 ‫ت دا ل ا ء ا دا‬            ‫م أ دة ھذه ا‬
                                                                  ‫+‬
                                                               ‫و دري. ث طرح ا رو و ت ‪H‬‬
                                                                ‫م ا رو ت إ‬                ‫،‬          ‫ا زا‬
                                                                       ‫وى ا ء ا دا‬              ‫وا ل و د‬
                                                              ‫‪( la‬‬           ‫ا‬       ‫و دري، و ون ا‬
                                                                                 ‫) ‪.chaîne respiratoire‬‬

                                                                 ‫نا ط‬        ‫إن ا رو ت د ق ا ط‬
                                                              ‫ل‬      ‫ا ول +‪ NAD+/NADH+H‬إ ا‬
                                                               ‫ھذا‬      ‫وھو ا زوج ‪.O2/H2O‬‬       ‫ا‬
                                                                               ‫.‬     ‫ا د ق ا دة ا‬
                                                                   ‫+‬     ‫-2‬
                                                             ‫‪، 2H‬‬      ‫ن ا زل ‪O‬‬          ‫لا و‬
                                                               ‫دا ل‬     ‫ط ز ا ء، و م ھذه ا‬
                                                                                 ‫ر س ا و دري.‬

                                                    ‫2‪1/2 O‬‬       ‫+‬     ‫+‪2H‬‬     ‫------------‬
                                                                               ‫>------------‬       ‫‪H2 O‬‬

                   ‫ذ: و فا د‬     ‫ا‬                                                 ‫: - 01 -‬   ‫ا‬
  ‫ل 2‪ ،O‬م طرح رو و ت +‪H‬‬                ‫ل رور ا رو ت ن أول ط +‪ NADH + H‬إ أ ر‬
   ‫ل رو و ت +‪H‬‬      ‫رب‬                   ‫، ر ذ ك ر ز +‪ H‬ھذا ا ز،‬       ‫دا ل ا ز ا‬
                                                              ‫ا ء ا دا .‬      ‫ن‬
‫ا و ــــــــــ 4‬




                                                        ‫ر ا ؤ د:‬ ‫ن وا‬   ‫2 ا زال ا و‬
                                                             ‫ط ت ر :‬     ‫‪–a‬‬
                                                                         ‫أ - ر 1:‬
       ‫ط رو و ت، ل ن‬                    ‫ل ول ق، و ط وي‬             ‫و ت و در ت،‬
                                                          ‫+‬
         ‫ب 2‪.O‬‬   ‫ول‬                   ‫طور ر ز أ و ت ‪ H‬ھذا ا و ط ل و د إ‬     ‫2‪ ،O‬م م‬
                                                       ‫ا و 4 و 4.‬         ‫ا‬    ‫ا‬
‫ا و ــــــــــ 4‬




                                                    ‫؟‬   ‫ل ھذه ا ط ت ا ر‬   ‫ن‬    ‫ذا‬
                                                                         ‫ب– ر 2:‬
                      ‫رب ا‬         ‫راخ، وم‬   ‫وى ا رات ذات‬      ‫ف ن روط إ ج ‪ATP‬‬
                                                                        ‫ا و 1 و 5.‬

                   ‫ذ: و فا د‬   ‫ا‬                                   ‫: - 11 -‬   ‫ا‬
‫ا و ــــــــــ 5‬                    ‫ر ا ؤ د ل‪( ATP‬‬     ‫راخ ) ل ا رو و ت وا‬      ‫1 : دور ا رات ذات‬          ‫او‬




      ‫ر‬        ‫ن وا‬      ‫ن ا زال ا و‬           ‫و دري. م أ رز ا‬     ‫ا رج روط ر ب ‪ ATP‬دا ل ا‬
                                                                                      ‫ا ؤ د.‬
                                                             ‫:‬    ‫لا ط تا ر‬        ‫‪–b‬‬
                                                                                   ‫أ - ر 1:‬
          ‫ا و ط، م‬       ‫2‪ O‬إ‬    ‫ف ) ‪ pH‬ر (. و د إ‬     ‫2‪ ،O‬ر ز +‪ H‬ا ول‬      ‫لإ‬
                                                            ‫+‬
                             ‫در .‬     ‫ر ز ‪ ) H‬ا ض ‪ ،( PH‬م دأ را‬    ‫ل ار ع ر‬
                                                                 ‫+‬
    ‫, 2‪(FADH‬‬             ‫2‪ ،O‬إ ا ل ا وا ل )2‪ (TH‬أي‬   ‫ر ار ع ر ز ‪ H‬ا و ط، د إ‬
                              ‫ا ؤ دة ب ا ل ا :‬            ‫ا ز إ‬     ‫)2‪ NADH‬ن‬
                      ‫2‪TH‬‬           ‫+‪--------------------------- T + 2H‬‬
                                    ‫>---------------------------‬                 ‫+‬        ‫-‪2 e‬‬
                   ‫ا رو ت‬                 ‫ذ 2‪ O‬ا ر‬ ‫ا و ط د ذ ك، إ ا‬           ‫ر ا ض ر ز +‪H‬‬
                   ‫با لا :‬               ‫رو و ت وا رو ت،‬       ‫لا‬            ‫وا رو و ت، ث ر ا‬
                   ‫2‪1/2 O‬‬       ‫+‬     ‫+‪2H‬‬    ‫-‪2 e‬‬    ‫>-----------------------‬        ‫‪H 2O‬‬
                                                            ‫2‪ O‬و ط ھو :‬              ‫دإ‬              ‫لا‬     ‫ا‬
                   ‫2‪TH‬‬    ‫+‬     ‫2‪1/2 O‬‬      ‫>------------------‬       ‫‪R‬‬      ‫+‬        ‫‪H2 O‬‬
                                                                                           ‫ر 2:‬           ‫ب–‬
     ‫راخ ‪(ATP‬‬   ‫وى ا ر ت ذات‬      ‫ن ا ر ‪ a‬أن رة ‪ ADP‬إ ‪ ،ATP‬م‬
                        ‫+‬
             ‫ر ز ‪ H‬نا زا‬        ‫)‪ .Synthétase‬و ط ب ھذه ا رة و ود رق‬
                 ‫، ر زه ا ر س.‬        ‫وا ر س، ث وق ر زه ا ز ا‬
       ‫ج ‪ ،ATP‬و ا ؤول ن‬      ‫و دري روري‬         ‫ن ا ر ‪ b‬أن ا ء ا دا‬
       ‫وا ر س، ھذا ا رق ا ر ز ر‬          ‫ر ز +‪ ،H‬ن ا ز ا‬      ‫ق ا رق‬
                     ‫رة ‪ ADP‬إ ‪ ATP‬ن طرف ا ر ت ذات راخ.‬          ‫رور‬
                    ‫ذ: و فا د‬        ‫ا‬                                          ‫: - 21 -‬         ‫ا‬
                                                             ‫:‬     ‫‪–c‬‬
  ‫رو ت(، ا ء‬     ‫رو ت )2‪ ،(O‬م أ دة )2‪ )(FADH2 , NADH‬ط‬             ‫د و ود ل‬
                                                      ‫+‬
                      ‫.‬       ‫دا ل ا ز ا‬         ‫ا ذي ط طرح رو و ت ‪ ،H‬ر‬
  ‫و دري، د ق ھذه ا رو و ت إ ا ر س‬         ‫ا ء ا دا‬        ‫ل ا ف ر ز +‪ H‬ن‬
      ‫و و‬      ‫‪ ATP‬ن ل ت‬              ‫لط ا دق‬            ‫ر ا رات ذات راخ، وا‬
     ‫‪Phosphorylation oxydative‬‬     ‫ر ا ؤ د.‬     ‫ا‬    ‫ھذه ا‬      ‫ز ‪.ADP‬‬

                                            ‫ر:‬      ‫س وا‬           ‫اط‬               ‫ر ا‬   ‫‪–V‬‬
                                                            ‫ر:‬      ‫س وا‬      ‫س ردود ا‬      ‫1‬
                                                                    ‫س:‬          ‫أ- ا ردود ا ط‬
               ‫5، دد دد ز ت ‪ ATP‬ا‬            ‫ط ت او 2 و‬      ‫و كو‬       ‫ا دا‬
                         ‫ا س.‬                ‫ز وا دة ن ا وز،‬     ‫ن ا دة ا‬    ‫اط‬
         ‫ر ب ث ز ت ن ‪ .ATP‬وأ دة‬              ‫أن أ دة ز وا دة ن 2‪ ،NADH‬ن ن‬
                            ‫ن ‪.ATP‬‬           ‫ز وا دة ن 2‪ ،FADH‬ن ن ر ب ز ن‬

‫ا و ــــــــــ 5‬




     ‫ز وا دة ن‬             ‫ن ا دة ا‬   ‫اط‬          ‫ط ت ا و أ ه، دد دد ز ت ‪ ATP‬ا‬              ‫ا دا‬
    ‫أن أ دة ز وا دة ن 2‪ ،NADH‬ن ن ر ب ث ز ت ن ‪.ATP‬‬                             ‫ا س.‬        ‫ا وز،‬
     ‫وأ دة ز وا دة ن 2‪ ،FADH‬ن ن ر ب ز ن ن ‪ .ATP‬و أ دة ز ‪ GTP‬ن ن ر ب‬
                                                       ‫(‬    ‫ز وا دة ن ‪ ) . ATP‬أ م را ت ا ص أ‬
                                                                ‫ز ا وز، ط :‬            ‫ان ا دة ا‬
   ‫...........)+‪ ......... + ATP ........ + (NADH+H‬ض ا رو ك.‬           ‫ل‬      ‫ل ا ل ا وز‬       ‫•‬
      ‫ل دورة ‪ Krebs‬ون ..........)+‪ .ATP ............... + (FADH2).......... + (NADH+H‬ادن‬       ‫•‬
          ‫ن ن ا ل ز وا دة ن ا وز، ون...........‬                ‫ز ن ن ض ا رو ك، ا‬
                                         ‫)+‪.ATP ........... + (FADH2)............ + (NADH+H‬‬
                                        ‫ك ز وا دة ن ا وز ھو:‬            ‫دا‬      ‫• إن دد ‪ ATP‬ا ر‬

                   ‫ذ: و فا د‬   ‫ا‬                                         ‫: - 31 -‬     ‫ا‬
                                                               ‫وز، ط :‬      ‫ا‬    ‫ز‬              ‫دة ا‬       ‫إن ا‬
              ‫ض‬           ‫)+‪ + 2ATP + 2(NADH+H‬ز ن ن‬         ‫لا‬    ‫•‬    ‫ل‬        ‫وز‬      ‫لا‬
                                                          ‫ا رو ك.‬
‫ز ن‬        ‫ل دورة ‪ Krebs‬ون ) ‪ .1ATP + 1(FADH2) + 3(NADH+H‬ادن‬
                                          ‫+‬
                                                                  ‫•‬
‫وز، ون ) ‪8(NADH+H‬‬
        ‫+‬
                      ‫ن ن ا ل ز وا دة ن ا‬       ‫ن ض ا رو ك، ا‬
                                             ‫+ )2‪.2ATP + 2(FADH‬‬
                  ‫ك ز وا دة ن ا وز ھو:‬      ‫دا‬      ‫• إن دد ‪ ATP‬ا ر‬

                                                       ‫‪4 ATP‬‬     ‫----------------‬        ‫‪4 ATP‬‬
                   ‫ا ـــ ـــوع :‬
                                                      ‫‪30 ATP‬‬     ‫)+‪---------------- 10 (NADH+H‬‬
                     ‫‪38 ATP‬‬                            ‫‪4 ATP‬‬      ‫----------------‬     ‫)2‪2(FADH‬‬

        ‫ا‬    ‫ا‬    ‫63‪ ATP‬ط ن وا ل ‪ NADH‬ا‬    ‫ل‬      ‫83‪ ATP‬ن ا وا‬    ‫ل‬    ‫ظر‬
    ‫ا ب وا د ث وض وا ل ‪. NADH‬‬     ‫ء‬     ‫و و دري و ن وض وا ل ‪2FADH‬‬ ‫د لإ ا‬

 ‫ن ول وا د ن‬     ‫ن ا را‬      ‫ا‬                            ‫أن ا ط ا‬     ‫س،‬      ‫أ ب ا ردود ا ط‬
‫ة ول وا د‬   ‫ن، ھ : ‪ ،2860 KJ‬وأن‬                          ‫رارة ° 73، و و ود ا و‬
                                                                        ‫‪C‬‬           ‫ا وز، ت در‬
                                                          ‫وي ‪.30 KJ‬‬      ‫ررط‬       ‫ن ‪ ،ATP‬ؤدي إ‬

     ‫وز‬           ‫ررھ ول وا د ن ا‬                ‫ا‬    ‫أن ول وا د ن ا وز ر ب 83 ‪ ،ATP‬ط‬
                                                                  ‫ھ : ) 83 ‪1159 KJ = (30.5 x‬‬
                                                   ‫9511‬
                          ‫% 5,04‬     ‫------------------ ‪= 100 x‬‬            ‫س ھو:‬                ‫ادن ا ردود ا ط‬
                                                   ‫0682‬

                                                                                ‫ر:‬           ‫ب- ا ردود ا ط‬
          ‫ر‬       ‫ا‬            ‫وز‬         ‫وا دة ن ا‬    ‫ك ز‬      ‫أن ا‬     ‫ر،‬     ‫أ ب ا ردود ا ط‬
                                                                       ‫ا ، رر ط ز ن ن ‪.ATP‬‬
                                               ‫) 5.03 ‪( 2 x‬‬
                          ‫% 31.2‬     ‫------------------ ‪= 100 x‬‬
                                                                           ‫ر ھو :‬               ‫ا ردود ا ط‬
                                                   ‫0682‬

                                                                                         ‫ر:‬        ‫ر و‬            ‫2‬

      ‫ل‬               ‫،‬            ‫وع ا ط ا‬   ‫ب ) ا وز ( ، طرح‬     ‫لا‬  ‫• أ ءا س‬
    ‫2‪( CO‬‬             ‫د‬            ‫ون‬     ‫رار )‪،(1701 KJ‬‬ ‫)‪ ،(1159 KJ‬وط‬       ‫ط‬
                                                             ‫ن اط .‬    ‫) ‪+ H2 O‬‬

‫(‬         ‫طرح إ زء ن ا ط‬
              ‫ا‬                  ‫و‬    ‫وز (‬   ‫ب)‬     ‫لا‬     ‫• أ ء ا ر،‬
   ‫رار‬    ‫لط‬       ‫) ‪ ،( 61 KJ‬و زء‬         ‫لط‬          ‫) ‪ ،167 KJ‬زء‬
‫. 0682( (‬        ‫ط‬   ‫(، زا ت وي‬        ‫و ) ض‬             ‫) ‪،( 106 KJ‬‬
                                  ‫) ‪.– 167)/2 = 1346.5 KJ/ac.lactique‬‬
                      ‫ذ: و فا د‬       ‫ا‬                                              ‫: - 41 -‬          ‫ا‬
                                ‫ر ن:‬




                           ‫لا رن:‬




‫ذ: و فا د‬   ‫ا‬   ‫: - 51 -‬    ‫ا‬
                                                   ‫:‬        ‫لا‬         ‫ا‬
                     ‫دور اﻟﻌﻀﻠﺔ اﻟﻬﻴﻜﻠﻴﺔ اﻟﻤﺨﻄﻄﺔ ﻓﻲ ﺗﺤﻮﻳﻞ اﻟﻄﺎﻗﺔ‬
                                                                                                                        ‫د:‬
                 ‫،‬            ‫ا‬   ‫، و رر اط‬       ‫ن ل ن ا س وا ر ن ھدم ا واد ا و ا‬
             ‫،‬           ‫تا‬          ‫ط ،‬         ‫ف ا ظواھر ا‬        ‫ل‬        ‫ل ‪ ،ATP‬ل‬
                                                       ‫رات در ا رارة، أو ا م ر .‬       ‫وا‬
                                                    ‫ط .‬          ‫ن ا ظواھر ا‬     ‫را صا‬
                                                       ‫؟‬      ‫طا‬       ‫در ا ط ا ز‬
                                                    ‫؟‬      ‫ھ ا ت ا ؤو ن ا ص ا‬
                                                                    ‫؟‬       ‫ف ما صا‬
                                              ‫در ط ؟‬       ‫ا وز‬        ‫ا‬      ‫لا‬  ‫ف‬
                                                                   ‫.‬           ‫صا‬                  ‫ر‬          ‫ا‬       ‫‪ – Ι‬ا درا‬
                                                                           ‫د‬        ‫دا‬             ‫صا‬             ‫لا‬         ‫1‬
                                              ‫6.‬        ‫2، و‬      ‫1، ا و‬           ‫: أ ظر ا و‬      ‫أ–ا ر با ر‬
‫ا و ــــــــــ 6‬
        ‫2:‬      ‫او‬                                                                                            ‫ا و 1:‬
‫ل‬              ‫دة ر‬                                                       ‫، م أ د د ، رب د‬              ‫درا ا ص ا‬
             ‫ا ظواھر ا‬                                             ‫ا و ، زا ل ردود ا ل ا راد وا إراد .‬               ‫و‬
    ‫ط‬               ‫ا‬                                               ‫راز‬         ‫، رح ا طرف ا‬          ‫و‬            ‫د‬
        ‫.‬       ‫ا‬                                                      ‫طن‬         ‫ا ب ا ور :ا و 2. ط و ر ا ب‬
                                                                     ‫ا ل 1.‬          ‫لا صا‬        ‫ز‬         ‫ا ق، و و‬
                                                                        ‫ن‬      ‫ا رود ن ا‬      ‫رة، و‬       ‫إ‬      ‫ا‬
                                                                           ‫ا رود ن‬       ‫رة، و‬     ‫ر‬        ‫ط ، أو‬
                                                                                                         ‫ا ب ا ور .‬
                                                                 ‫،‬          ‫، ون إ‬      ‫تا ط‬         ‫وا ط‬        ‫ا‬
                                                                                           ‫، أو ر .‬            ‫رار ،‬




                                                                   ‫:‬       ‫ا ر‬                            ‫ا‬             ‫ب–ا‬
                          ‫6.‬       ‫ل2 و‬   ‫2ا‬           ‫ردة: أ ظر ا و‬           ‫ھ‬           ‫ا‬           ‫‪ –a‬ا‬

                       ‫ھ ، ول أ ھ و ،)‪ (Excitable‬و‬        ‫با‬      ‫،‬    ‫ط اھ‬   ‫د‬
                       ‫و .‬           ‫ھذه ا‬   ‫و ،و‬   ‫ص، ول أ‬       ‫ب‬       ‫.‬   ‫ا ھ‬
                      ‫ر ا د، زول، و ط، م ن ر‬      ‫ص‬        ‫ل‬    ‫ردة،‬   ‫د ط ق اھ‬
                                 ‫ث را ل:‬     ‫إ‬    ‫ن‬     ‫)‪ .(Secousse musculaire‬وا‬
                      ‫ذ: و فا د‬      ‫ا‬                                                         ‫: - 61 -‬           ‫ا‬
                         ‫.‬         ‫و دا ا‬       ‫ا ھ‬     ‫ن‬     ‫ا‬    ‫رة ا ون: ھ ا رة ا ز‬                ‫•‬
                                                        ‫.‬   ‫ورا‬           ‫ر ا ص: ر‬                    ‫•‬
                                                 ‫أ دھ ا و .‬     ‫ذا‬         ‫ر ا ر ء:‬                   ‫•‬




                                                                                                 ‫وظ ت:‬

                                          ‫.‬           ‫ب ر ا طوا ا‬               ‫ر لا ططا‬
     ‫ظر‬            ‫دة،‬           ‫دة، ذات دة‬           ‫ھ ت‬        ‫ا‬       ‫أ ظر ا و 3 و 6 : د‬
      ‫‪(Seuil‬‬             ‫ا ھ‬            ‫،‬              ‫وي أو أ ر ن‬        ‫ون دة ا‬       ‫د‬    ‫إ‬        ‫ا‬
                                                                             ‫)‪ ،d'excitation‬أو ا ر و ز.‬
‫ا و ــــــــــ 6‬




                                   ‫4 و 6.‬        ‫ن: أ ظر ا و‬     ‫ن‬   ‫ھ‬        ‫ا‬          ‫‪ –b‬ا‬

          ‫ث‬        ‫ز‬         ‫، وھ ذا‬       ‫ا‬   ‫ا ھ‬     ‫ط‬       ‫با ظ ا‬         ‫ھذه ا‬                  ‫فا‬
                                                                                                      ‫ت:‬
                   ‫ن.‬           ‫نو‬     ‫ن‬    ‫ا و ، ون ا ر‬    ‫د ا ء ار‬                  ‫ا‬      ‫ا‬       ‫1 إذا و‬
 ‫أ ر ن‬               ‫ا‬            ‫ا و ، ون و ا‬        ‫ل ر ار ء ا‬                      ‫ا‬      ‫ا‬       ‫2 إذا و‬
                              ‫م ر ا م.‬   ‫ن. م ن ا‬         ‫ن‬     ‫ا‬                   ‫ا و ،‬              ‫و ا‬
                    ‫ذ: و فا د‬          ‫ا‬                                          ‫: - 71 -‬       ‫ا‬
      ‫م ن‬          ‫ن.‬    ‫ظ را ب ا‬  ‫ا و ،‬       ‫صا‬    ‫ل ر‬                                  ‫ا‬    ‫3 إذا و ا‬
                    ‫زو .‬     ‫أ ر نو ا ور لر‬        ‫ا ورا‬                              ‫و‬    ‫م ا م، ون‬    ‫ا‬
                             ‫: أ ظر ا و 5 و 6.‬   ‫ھ ت‬                                 ‫ا‬      ‫‪ –c‬ا‬

                               ‫ن:‬      ‫ظ‬   ‫،‬       ‫نا ھ تا‬        ‫د ط ق‬
       ‫،‬      ‫ل ون ن ذ ذ ت‬       ‫ل‬      ‫ف،‬     ‫ت‬      ‫ون رددا‬  ‫ا ل 1: د‬
   ‫،‬    ‫م ر م ر تا‬         ‫ھذا ا ص ا زاز ا ص )‪ ،(Tétanos imparfait‬وا ذي ر‬
                             ‫.‬    ‫ا‬        ‫دث ل رة ا ر ء‬            ‫ن ل‬
     ‫ھذا ا ص‬     ‫م،‬    ‫ط‬   ‫ل‬       ‫ل‬     ‫ت وي،‬       ‫ون ردد ا‬  ‫ا ل 2: د‬
            ‫، ن ل‬      ‫م م ر تا‬       ‫ا زاز ا م )‪ ،(Tétanos parfait‬وا ذي ر‬
                                                 ‫.‬     ‫ا‬      ‫رة ا ص‬

                                                                        ‫.‬        ‫ا‬            ‫ا‬           ‫ظ :ا‬

                                                           ‫دة‬       ‫و‬       ‫، د‬                     ‫ا‬     ‫د‬
                                                                ‫،‬                                  ‫اھ ت، ن و‬
                                                                             ‫طو .‬                 ‫أن دة ا ر ء‬


                                                       ‫.‬        ‫صا‬          ‫با‬                    ‫‪ – ΙΙ‬ا ظواھر ا‬
                               ‫.‬   ‫را ظواھر رار ، ط‬
                                            ‫و‬               ‫ظ ھرة‬       ‫ا صا‬
                                           ‫:‬      ‫صا‬     ‫1 ا ظواھر ا رار ا را‬
          ‫رارة ا م ا دا ، و وم ھذا ا ر ع ز دة طرح‬    ‫، ر در‬      ‫ود‬    ‫دا م‬
                                              ‫ف ب دة ا د.‬     ‫ا رارة. ھذا ا طرح‬

                                                ‫6.‬   ‫6 و‬    ‫ل 1 او‬      ‫: أ ظر ا‬          ‫أ–ا ر با ر‬
‫ا و ــــــــــ 6‬
                                   ‫ل2‬   ‫ا‬                                            ‫ل1‬   ‫ا‬




                                    ‫ا ود ا راري ‪.Thermopile‬‬     ‫ل ھذه ا درا‬
       ‫ن‬           ‫د ن‬    ‫ون ا ود ا راري ن إ ر ن رو رار ن، ون ل إ رة ن‬
                                                      ‫) س و ل أو ذھب و ل (.‬
    ‫رارة‬           ‫در‬     ‫ب د‬          ‫إن ا ف ا رارة ن ا ر ن، و د رق د ر‬
                                                                 ‫.‬       ‫ا‬  ‫ا‬

                   ‫ذ: و فا د‬       ‫ا‬                                                 ‫: - 81 -‬         ‫ا‬
                                                               ‫ا ر : أ ظر أ ظر ا ل 2 ا و 6 و 6.‬          ‫ب–ا‬
                        ‫ط.‬                                     ‫، ا رج أ واع ا رارة ا ررة ن طرف ا‬ ‫ن ھذه ا‬   ‫اط‬
                                                                                                                                        ‫ج:‬             ‫ل وا‬                    ‫ج–‬
                        ‫ن:‬    ‫ر نأ‬             ‫ا رارة، و وزع إ‬            ‫صا‬                                                                                              ‫لا‬
            ‫زأ ن: زء ل ا ص ) رارة‬        ‫رارة ا و : ھ ا رارة ا دا ، و رر‬                                                                                                ‫• ا‬
                 ‫.‬  ‫أ زاء ن ا‬   ‫ص(، و زء ل ا ر ء ) رارة ا ر ء(، و دوم‬                                                                                                   ‫ا‬
           ‫، و دوم ن د إ د ن.‬        ‫رة، و رر د ا ص ا‬        ‫رارة ا ؤ رة: أو ا‬                                                                                          ‫• ا‬
                                                                                                                      ‫:‬            ‫وا ط‬                  ‫2 ا ظواھر ا‬
                                                                                                                                                       ‫ظ ت:‬                         ‫أ–‬
                                                              ‫رات ا د و .‬                         ‫،أ‬  ‫ا‬      ‫ر‬     ‫ظ ا‬   ‫نا‬
                    ‫نا ت‬                           ‫تا‬           ‫ر ن‬                        ‫، ون ا ط ا‬     ‫ا‬    ‫رر ا رق ا د د‬
                                                                                        ‫ن طر ق ا دم.‬    ‫لإ ا‬      ‫ن، وا‬  ‫وا و‬
                                                                                                                                          ‫:‬        ‫ر‬                           ‫ب–‬
                        ‫.‬                 ‫ط تا لا‬                                ‫ط ت ھذه ا و ق 1،2،3، و 7، ا‬                                       ‫ل‬              ‫ن‬                 ‫اط‬
‫ا و ــــــــــ 7‬
      ‫ص‬             ‫د‬   ‫ن‬            ‫ت ا طر ن ا‬             ‫ن طرف‬      ‫ا وز ) ل 1 (، وا و ن ) ل 2 (، ا‬           ‫س‬                                                           ‫1:‬       ‫او‬
                                                        ‫زا د ا دة. )0002 ‪(d’après manuel Hatier- mai‬‬        ‫ود‬    ‫ل‬
                                                                               ‫.‬   ‫ط تا لا‬           ‫ل ھذه ا ط ت، وا‬

                                                                     ‫ل1.‬       ‫.ا‬                                                                                         ‫ل2.‬        ‫.ا‬
   ‫وز )‪(mg/min‬‬                       ‫ا‬                                                         ‫0‬
                                                                                                        ‫و ن ) ‪(u.a‬‬             ‫ا‬
          ‫009‬                                                  ‫ق‬      ‫رن‬
                                                                                               ‫02‬
          ‫027‬
                                                                                                                                                        ‫ف‬             ‫رن‬
                                                                                               ‫04‬
          ‫045‬
                                                              ‫رن و ط‬
          ‫063‬                                                                                  ‫06‬
                                                                                                                                                  ‫ر ن و ط ا دة‬
          ‫081‬
                                                               ‫ف‬          ‫رن‬                   ‫08‬                                             ‫ق‬    ‫رن‬              ‫از ن‪t‬‬
            ‫0‬
                ‫0‬           ‫01‬                ‫02‬         ‫03‬          ‫04‬
                                                                            ‫از ن‪t‬‬                                                                                  ‫)‪(mm‬‬
                                                                                                    ‫0‬          ‫03‬             ‫06‬          ‫09‬            ‫021‬
                                          ‫رن د‬                              ‫)‪(mm‬‬
                                                                                                                              ‫رن د‬
   ‫ل ‪ 1Kg‬ن‬                                    ‫ل‬
                                                                          ‫3:‬          ‫او‬                        ‫ن‬         ‫كا و‬            ‫سا‬                      ‫2:‬            ‫او‬
                                 ‫ا‬
                                                                                                                                                                   ‫وز‬           ‫وا‬
  ‫ط‬                                  ‫را‬                                                                                       ‫.‬         ‫ود‬         ‫ل‬
                                                                ‫را‬‫م ا دم ا ذي‬
      ‫523.65‬                         ‫022.21‬                                                         ‫9,0‬                                                                              ‫2‬
                                                                        ‫ب)‪(l‬‬
                                                                                                                                                                       ‫)‪(mmol/min‬‬
                                                                                                                                                                                ‫ا‬




                                                                                                    ‫10‬
                                                                                                           ‫ا‬




                                                         ‫كب‬      ‫نا‬       ‫ما‬
                                                                                                           ‫)‪(L/h/kg‬‬




                                                                                                    ‫7,0‬
      ‫702.5‬                          ‫703.0‬
                                                                                                                                                                      ‫ك ا وز‬
                                                                                                             ‫كا و‬




                                                                            ‫)‪(l‬‬                     ‫15‬                                                                               ‫5,1‬
                                                          ‫أ د ا ر ون‬        ‫م‬                       ‫6,0‬
      ‫059.5‬                          ‫022.0‬
                                                               ‫ا طروح ب ) ‪( l‬‬                       ‫10‬
                                                                                                           ‫ن‬




                                                                                                    ‫4,0‬                                                                              ‫1‬
                                                         ‫ب‬                ‫وز ا‬        ‫ا‬             ‫15‬
      ‫234.8‬                          ‫240.2‬
                                                                                       ‫)‪(g‬‬          ‫3,0‬
                                                                                                    ‫10‬                                                                               ‫5,0‬
                                                         ‫ب (‬                ‫ا رو دات ا‬
          ‫0‬                               ‫0‬                                                         ‫1,0‬
                                                                                   ‫)‪g‬‬               ‫15‬

          ‫0‬                               ‫0‬              ‫ب)‪(g‬‬                       ‫ا دھون ا‬
                                                                                                                 ‫1‬        ‫2‬        ‫3‬      ‫4‬        ‫5‬      ‫6‬             ‫)‪7 t (min‬‬


                            ‫ذ: و فا د‬                    ‫ا‬                                                                             ‫: - 91 -‬               ‫ا‬
                                                                                                ‫ج:‬            ‫ل وا‬        ‫ج–‬
  ‫ض د رات‬            ‫س ا و ت، ا‬           ‫ظ‬       ‫وز، و‬       ‫كا‬          ‫، ار ع ا‬      ‫ود ا‬   ‫ظ لا‬
                                                                                       ‫ن ا و ن.‬           ‫ا‬
         ‫د‬     ‫أ‬     ‫طرح ا ز د ن‬              ‫،‬        ‫ود ا‬     ‫دا‬       ‫ن،‬     ‫كا و‬      ‫ظ ذ ك ار ع ا‬
                                                                                                    ‫ا ر ون.‬
  ‫وز،‬         ‫ل أ دة ا‬    ‫ن‬           ‫،‬           ‫طا‬          ‫ا ز‬        ‫أن ا ط‬      ‫ن ھذه ا ط ت،‬        ‫اط‬
                                                                                   ‫ة ا و ن.‬        ‫ن‬      ‫ا‬

                                                                   ‫.‬         ‫ا‬         ‫ا‬             ‫و وق‬                ‫‪– ΙIΙ‬‬
                                                                              ‫طط :‬         ‫ا‬              ‫ا‬          ‫ا‬      ‫1‬

‫ا و ــــــــــ 7‬                                  ‫7:‬     ‫4، و‬          ‫ردة: أ ظر ا و‬           ‫نا‬             ‫ظت‬           ‫أ–‬
                                                                    ‫ا ظ م، و ظ ر‬          ‫ت‬     ‫ون ا‬
                                                                ‫،‬       ‫طن ا‬     ‫زأ ن: زء أ ر رن،‬
                                                                             ‫وھو أ ر و ود رو ن ص‬
                                                                  ‫)‪ ،(Myoglobine‬و زء‬         ‫با‬      ‫ا‬
                                                                              ‫أ ض ؤ )‪ ،(nacré‬و د‬
                                                                   ‫)‪.(Tendon‬‬          ‫ور‬     ‫،و‬      ‫ا‬
                                                                      ‫أ‬          ‫ظ ا ط ا ر‬         ‫ن‬
                                                                    ‫وا ط‬        ‫و ن‬        ‫ون ن ل‬
                                                                ‫‪(Faisceau‬‬          ‫م، ھ ا زم ا‬
                                                                                         ‫)‪.musculaire‬‬
                                                                  ‫)‪(Délacération‬‬         ‫ن ن ربا‬
                                                                                       ‫.‬       ‫أ ذات‬
                                                                                       ‫ر :‬                ‫ظت‬              ‫ب–‬
                                                                 ‫(‬        ‫7 ) أ ظر ا ر م أ‬            ‫5، و‬               ‫أ ظر و‬
                                                                      ‫ا‬      ‫ر أن ا‬     ‫ظ ا‬     ‫رز ا‬
                                                                ‫ف، ل‬    ‫ون ن دد ر ن ا‬          ‫ا طط‬
                                                                 ‫طط‬       ‫ط‬           ‫رة ن‬    ‫ف ھو‬
                                                                ‫رات(.‬      ‫ن 1.0 م و دة‬           ‫)طو‬
                                                                      ‫دة ت ن ا وى ر‬            ‫و وي‬
                                                                            ‫ط وي.‬       ‫ا ط، م ن‬
                                                                ‫ء‬      ‫ط‬         ‫ون‬          ‫ل ف‬
                                                                     ‫ر و م، و وي‬         ‫و ز ، د‬
                                                                               ‫ر و زم.‬     ‫و زم د‬
                                                                ‫(‬      ‫) ا ف ا‬           ‫ا‬    ‫ظر ا‬
                                                                ‫دا ل‬         ‫ت‬      ‫طط طو ، و ود‬
                                                                  ‫طط‬        ‫ا ر و زم. و ظ ر ھذه ا‬
                                                                ‫ون ن‬              ‫ر ، ون ا ت ا‬
                                                                        ‫.‬         ‫وأ رط‬    ‫وب أ رط‬
                   ‫ذ: و فا د‬      ‫ا‬                                                            ‫: - 02 -‬          ‫ا‬
                                                                                    ‫:‬          ‫ا فا‬           ‫1 وق‬
                                                                            ‫رو :‬    ‫را‬              ‫ظت‬             ‫أ–ا‬
      ‫ت‬        ‫ر‬     ‫ط ا‬       ‫ا‬            ‫ف‬    ‫8،‬          ‫ن ط ت ا و 1، 2، 3، و4، و‬      ‫اط‬
                                   ‫.‬            ‫فا‬           ‫، م ن أن ا ر و ر ر ا و دة ا و‬    ‫ا‬
                                                     ‫ا و ــــــــــ 8‬




‫و ت‬            ‫ف‬      ‫ر‬      ‫ط‬         ‫وم‬       ‫2:‬     ‫او‬
                    ‫: ‪.C , B , A‬‬                                        ‫.‬           ‫رو‬    ‫را‬          ‫ظ‬       ‫1:‬    ‫او‬



                   ‫ون ن وب و ن ن ا رط :‬                                        ‫تا‬       ‫ظ أن ا‬        ‫ن ھذه ا‬
      ‫ن‬    ‫ا‬         ‫ن رو ن‬  ‫ون ن ط ت د‬                     ‫)‪(Isotropique=I‬‬                            ‫• أ رط‬
       ‫)‪ ، (Actine‬و و ط ا ز ‪(de l'allemand zwischen, signifiant "entre") (Strie Z) .Z‬‬
                                ‫,‬
    ‫ن‬            ‫)‪ ،(Anisotropique=A‬ون ن ط ت ا ن، و ط ت‬                          ‫• أ رط‬
 ‫ا وز ن )‪ ،(Myosine‬و و ط ا ط ‪. (de l'allemand heller, plus pâle H‬‬               ‫رو ن‬
                                                                 ‫ط ت ا وز ن ط.‬                   ‫وي‬           ‫ا‬

           ‫ذ: و فا د‬       ‫ا‬                                                             ‫: - 12 -‬         ‫ا‬
‫ا و ــــــــــ 8‬                                ‫4:‬    ‫او‬                                  ‫3:‬   ‫او‬




     ‫ا ر و رات )‪ ،(Sarcomère‬و د ن زي‬          ‫ن و دات‬        ‫ون ل ف‬
                                  ‫.‬    ‫فا‬    ‫‪ .Z‬و ر ا ر و ر ا و دة ا و‬
        ‫وي‬     ‫ن ا و ن،‬     ‫ھ‬   ‫دد ر ن ا و در ت، و‬        ‫وي ا ر و ر‬
                         ‫وم.‬   ‫رة ن ا‬         ‫ر و ز وا رة، وي‬

                                         ‫9.‬   ‫1 و‬    ‫: أ ظر ا و‬   ‫طتا‬           ‫ا ز‬       ‫ب–ا‬
‫ا و ــــــــــ 9‬
                                                                                          ‫1:‬   ‫او‬




                   ‫إ‬        ‫،‬      ‫ن، وھو ا ط‬   ‫ا‬    ‫ون ل ط د ق، أو ط ا ن ن رو ن د‬
                                                        ‫رو ن آ ر ن ھ ا رو و ن وا رو و وز ن.‬

                       ‫ذ: و فا د‬     ‫ا‬                                   ‫: - 22 -‬     ‫ا‬
              ‫ن ز ت رو ن ا وز ن، و ل ز‬                      ‫ط ا ك أو ط ا وز ن، ن ز‬                                  ‫ون ا‬
                                                               ‫.‬    ‫ون ن رأ ن رو ن و‬                                ‫وز ن‬
                                                                                ‫.‬            ‫صا‬         ‫ا‬           ‫‪ – IV‬ا‬
                                                                        ‫؟‬           ‫صا‬           ‫دث أ ء ا‬           ‫1 ذا‬
                                                                                      ‫ر :‬             ‫ظت‬                  ‫أ–‬
‫ن،‬           ‫وى ا‬              ‫ط‬       ‫. د ذك م ا ز‬                         ‫را ، و‬                          ‫د‬         ‫م‬
                                                                             ‫رو .‬     ‫را‬                        ‫ظ‬       ‫م‬
                                                                ‫ظ.‬            ‫ھذه ا‬    ‫8،‬             ‫5 و‬           ‫ل او‬
‫ا و ــــــــــ 8‬
                                                           ‫5:‬   ‫او‬




                                        ‫رات.‬     ‫ر ھذه ا‬    ‫ص، م‬            ‫ا فا‬             ‫ظ‬        ‫رات ا‬          ‫دد ا‬

                                                                        ‫:‬                     ‫صا‬        ‫ظ أن‬

                                               ‫وى ا ر و رات ) رب زي ‪.( z‬‬       ‫ر‬                                      ‫•‬
                                                        ‫‪ ،I‬وا ط ‪.H‬‬  ‫ص طول ا ر ط ا‬                                     ‫•‬
                                                             ‫طول ا ر ط ا م ‪ A‬ت.‬                                       ‫•‬

                                                                                         ‫ج:‬           ‫ر وا‬            ‫ب–‬
    ‫ن‬     ‫ظ ا رو ر س‬          ‫را‬   ‫أن ا‬       ‫ت،‬       ‫أن طول ا رط ا‬
    ‫ض، ا ه ر ز‬                 ‫، ل ن ا ز ق ھذه ا ط ت‬    ‫ر ا طتا‬
                  ‫ن ذ ك ا راب زي ‪Z‬‬      ‫ا وز ن (،‬    ‫ا ر و ر)از قا ن‬
           ‫وا زال ا ط ‪ .H‬م ن آ ا ز ق ا ط ت.‪Glissement des filaments‬‬

                                                                                      ‫طت؟‬             ‫از قا‬            ‫2آ‬
                                                                                         ‫:‬        ‫ر‬     ‫ط ت‬               ‫أ–‬
         ‫دوث ا ص‬           ‫دور ل ن ‪ ATP‬و ++‪Ca‬‬                        ‫اط‬
                                                                     ‫9، ا‬     ‫2، و‬           ‫ط ت او‬             ‫ن‬
                                                                  ‫.‬     ‫ا‬
    ‫وم،‬   ‫د ت درا ت أ رى أن ھ ك ف ن رؤوس ا وز ن وا ن، و و ود ا و ت ا‬
  ‫ا طر‬            ‫ل ر ب ا و وز ن ا ذي ون ت‬         ‫ن‬    ‫ر ط رؤوس ا وز ن‬
        ‫ا ط تا‬       ‫د‬     ‫9 (.‬  ‫)‪ ) (Ponts transversals‬ا و 1، و‬   ‫ر‬    ‫ا‬
        ‫ر .‬      ‫وم و وء ا طر ا‬    ‫ناو تا‬       ‫و ط ت ا و 1، و 9، ن ا‬
                   ‫ذ: و فا د‬       ‫ا‬                                                  ‫: - 32 -‬              ‫ا‬
            ‫.‬        ‫د‬   ‫و و رھ‬    ‫ا‬    ‫+2‪ Ca‬دا ل ر و زم ا‬     ‫س ل ن‬                  ‫ن ا ل 1،‬      ‫ط‬    ‫2:‬   ‫او‬
                                             ‫+2‬
                       ‫.‬     ‫ورا فا‬      ‫ر و ود أو دم و ود ‪ ATP‬و ‪، Ca‬‬                ‫ن ا ل 2،‬      ‫ط‬
                ‫ة ‪.ATP‬‬          ‫دة‬ ‫. ا دة ‪ ،Salyrgan‬ھ‬      ‫وم و‬       ‫ر ط‬                 ‫دة‬  ‫ا دة ‪ X‬ھ‬




                                                   ‫ا و ــــــــــ 9‬
                                                                                        ‫ج:‬        ‫ل وا‬    ‫ب–‬
            ‫و زم ا‬         ‫وم دا ل‬  ‫ظ ار ع ر ز ا‬     ‫رة،‬          ‫ا‬    ‫د‬                      ‫• ا ل1:‬
                                              ‫.‬      ‫ر ع ورا فا‬        ‫و‬                       ‫،‬       ‫ا‬
      ‫وم.‬          ‫د و ود ‪ ،ATP‬وا و ت ا‬    ‫ص ر‬             ‫ظ أن ا ت ا‬                         ‫• ا ل2:‬
                                 ‫و ر ا ف.‬       ‫ة ‪ ATP‬ل ‪،Salyrgan‬‬                                  ‫و د‬
                               ‫و ر ا ف، ر م و ود ‪.ATP‬‬         ‫ل ++‪، Ca‬‬                           ‫د‬     ‫أ‬
        ‫ل‬         ‫زم و ود ‪ ATP‬و ++‪ .Ca‬ھذا ا ر‬           ‫ط ت أن و ر ا ف ا‬                       ‫ن ھذه ا‬
                                ‫ر .‬      ‫ط ن ا وز ن وا ن، ون طر‬                               ‫ر ر وا ا ر‬

‫ا و ــــــــــ 01‬        ‫1، و 01.‬        ‫1، و 9، ا و‬       ‫. أ ظر ا و‬           ‫ا صا‬          ‫:آ‬          ‫ج–‬
                            ‫.‬    ‫صا‬      ‫لا‬   ‫ن‬   ‫ط ت ا وز ن وا‬       ‫ل ن‬   ‫ا‬   ‫1:‬      ‫او‬




                    ‫ذ: و فا د‬        ‫ا‬                                                 ‫: - 42 -‬      ‫ا‬
                         ‫:‬        ‫وم، و م‬   ‫و ود ‪ ،ATP‬وا و ت ا‬        ‫طب ا ص ا‬
                   ‫وم.‬   ‫ا ر و ز او تا‬            ‫، رر ا‬        ‫ا فا‬     ‫• د‬
      ‫و‬    ‫ت‬     ‫ا ن، وا‬       ‫ور ‪ ،Ca‬م ر ر وا ار ط رؤوس ا وز ن‬    ‫++‬
                                                                            ‫•‬
                            ‫رو ت ا رو و وز ن، ون ذ ك طر ا و وز ن.‬
      ‫ة ‪ ،ATP‬و ر ر ط ؤدي إ دوران‬          ‫ب ر ت ا و وز ن دور أ ز م ز‬        ‫•‬
                   ‫.‬       ‫رؤوس ا وز ن ا ه ر ز ا ر و ر، وھذا ؤدي إ‬
      ‫ا ر و ز ، ر ط ز أ رى ل ‪ATP‬‬              ‫++‪ Ca‬دا ل ا‬     ‫،‬   ‫• دا ءا‬
            ‫ل ا ن ن ا وز ن، و دوث ا ر ء.‬         ‫ؤدي إ ا‬     ‫رؤوس ا وز ن،‬

                                           ‫؟‬          ‫صا‬           ‫ا ز‬        ‫‪ –V‬ف م دداط‬
                                                                               ‫أ– ط ت ر :‬
         ‫، ل و د ا ص. رن‬                       ‫ط ا و 2، و 01، رات ض ا و ت ا‬
‫ا و ــــــــــ 01‬
                                     ‫را م ‪ ،ATP‬ل ا ص و ده.‬  ‫ط ت دول ا و ، وا رح‬
                                                 ‫ص..‬   ‫لو دا‬                  ‫رات ض ا و ت ا‬      ‫2:‬   ‫او‬




                                                                                ‫ج:‬        ‫ل وا‬    ‫ب–‬
                    ‫ر ،‬         ‫ضا‬     ‫ا‬       ‫ض، و‬  ‫ظ لا ر ا و‬
                                                       ‫و ن‬     ‫ا‬         ‫أن‬
                                             ‫.‬       ‫‪ ،ATP‬وا و و ر ن،‬
       ‫دد‬    ‫أ‬   ‫،‬  ‫لا صا‬             ‫‪ ATP‬ھذه ا ر ، ر م ا‬      ‫دل ت‬
       ‫وز،‬     ‫ةا و نإ‬     ‫رار. و م ھذا ا د د وا ط ا ر ا ، ث ت‬
                                   ‫+ ‪.ATP‬‬      ‫ض‬      ‫ر ط‬     ‫ھذا ا ر‬
  ‫أن د د ‪ ATP‬ھذه‬     ‫ا و و ر ن ط. دل ھذه ا‬      ‫،ا ض‬       ‫لا ر ا‬
     ‫و ت، دد ‪ ،ATP‬ب ا ل ا :‬          ‫م وا ط ا و و ر ن، وھ دة‬         ‫ا‬

                ‫ن ( ‪ADP + CP‬‬        ‫)ا و و ر‬      ‫ص‬    ‫أزم‬
                                                               ‫ن(‪C‬‬            ‫‪ ) + ATP‬ا ر‬

                    ‫ذ: و فا د‬   ‫ا‬                                              ‫: - 52 -‬      ‫ا‬
‫دم‬          ‫ن ‪ ، ATP‬دل ھذا‬         ‫زو‬        ‫ذ‬       ‫نا ص دا‬                 ‫، و تا‬       ‫لا ر ا‬
                                                                                            ‫د د ‪.ATP‬‬

                                                                              ‫د د ‪:ATP‬‬            ‫ب – طرق‬
                       ‫أ واع:‬           ‫ددة ل ‪ ،ATP‬إ‬             ‫ف ا طرق ا‬     ‫ن‬          ‫د‬           ‫ب ر‬

                                                        ‫‪ – a‬ا طرق ا ھوا ا ر :‬
                                                   ‫ن د د ‪:ATP‬‬    ‫طق‬       ‫أ ل ن 03‬
                 ‫ز ‪(myokinase) MK‬‬            ‫• وا ط ا ل ن ‪ ،ADP‬ت ر ا ز م ا و‬
                                         ‫-------------- ‪ADP + ADP‬‬                  ‫‪ATP + AMP‬‬

                ‫-------------- ‪ADP + CP‬‬                    ‫• وا ط ا و و ر ن : ‪ATP + C‬‬
                               ‫ر ر رارة، ھ ا رارة ا و .‬                  ‫و‬      ‫ل‬     ‫و ون ھذا ا‬

                                                     ‫‪ – b‬ا طرق ا ھوا ا و ط ا ر :‬
      ‫ا‬     ‫ل‬              ‫وز،‬           ‫إ‬            ‫ةا و نا‬    ‫، ث م‬       ‫ل ا را‬
                                             ‫.‬       ‫ض‬     ‫ض ا رو ك، ا ذي ول إ‬   ‫إ‬  ‫ا‬

‫و ن ‪( C6H12O6)n‬‬                 ‫-------------------- ‪+ H2O‬‬                 ‫وز 6‪C6H12O‬‬
                                                     ‫و ن‬    ‫ةا‬

     ‫------------------ ‪C6H12O6 + 2ADP‬‬                     ‫‪2CH3 – CHOH – COOH + 2ATP‬‬
       ‫وز‬                           ‫را‬           ‫ا‬                      ‫ض ا رو ك‬              ‫+‬        ‫ط‬


                                                                   ‫ا ط :‬     ‫‪ – c‬ا طرق ا وا‬
‫ل م و ود‬             ‫وز، م ھد‬   ‫إ‬                    ‫ةا و نا‬     ‫ل ا س ا وي، ث م‬
    ‫ررط‬             ‫رة ن ا ط )‪،(ATP‬‬                     ‫رر‬    ‫ول إ 2‪ CO‬و ء،‬      ‫ن،‬ ‫ا و‬
                                                           ‫ل رارة، ھ ا رارة ا ؤ رة.‬




             ‫ذ: و فا د‬     ‫ا‬                                                   ‫: - 62 -‬           ‫ا‬
                                                                     ‫ل ا ث:‬                         ‫ا‬
           ‫دور اﻟﻤﺎدة اﻟﻌﻀﻮﻳﺔ ﻓﻲ ﺑﻨﺎء وﺗﺠﺪﻳﺪ اﻟﻤﺎدة اﻟﺤﻴﺔ‬
                                                                                                                                            ‫د:‬
      ‫ط ا وي،‬                      ‫اط ا ز‬       ‫ول‬                                  ‫،‬         ‫ل زء ن ا واد ا و ا‬     ‫ما‬
   ‫ءو دد‬      ‫و‬                   ‫ف م وظ ف ا دة ا‬                              ‫.‬        ‫ء و د د ا دة ا‬   ‫ل زء آ ر‬    ‫ما‬
                                                                                                               ‫؟‬  ‫ا دة ا‬

                                                                                                        ‫.‬       ‫‪ – Ι‬ا ف ن د د ا دة ا‬
                                                 ‫ا و ــــــــــ 11‬            ‫11.‬               ‫1، و‬            ‫أ – ط ت ر : أ ظر ا و‬

        ‫ت%‬     ‫رو‬             ‫طا‬             ‫ا‬                                                                       ‫1:‬                          ‫او‬
‫– 001‬                                                                    ‫، و زن‬      ‫رب 001 أ ف‬ ‫ر‬        ‫نا‬    ‫ون م ا‬                            ‫1(‬
                                                                                ‫رأ .‬        ‫ا‬    ‫وا 08 ر رة أ ر ن ا‬
                                                                     ‫دد ا د ل 52 و .‬      ‫ل أر أ م ر ،‬      ‫ءاد‬     ‫دد ا‬                         ‫2(‬
                                                                         ‫ا دو‬    ‫ا‬   ‫ول‬     ‫نا‬     ‫دة ا‬       ‫لا‬      ‫نا‬                         ‫3(‬
                                                                                                             ‫:‬    ‫ا دول ا‬
‫– 05‬                                                                                        ‫ا‬           ‫نا‬      ‫ا‬         ‫ا ر ت‬

                                                                                                    ‫% 07‬                      ‫ا ء‬
‫– 52‬
                                                                                                    ‫% 32‬                  ‫ت‬     ‫ا رو‬
‫– 01‬
‫– 5‬
                                                                                                        ‫%4‬                ‫ر ت‬       ‫ا‬
      ‫‪I‬‬    ‫‪I‬‬   ‫‪I‬‬     ‫‪I‬‬   ‫‪I‬‬   ‫‪I‬‬       ‫‪I‬‬       ‫‪I‬‬    ‫‪I‬‬
    ‫1 0‬    ‫2‬   ‫3‬     ‫4‬   ‫5‬   ‫6‬       ‫7‬       ‫8‬    ‫م 9‬            ‫ا‬                                      ‫%2‬                 ‫ا دھون‬

‫دة ا د د‬       ‫ا دة‬          ‫ا و أو‬               ‫ن‬      ‫ا‬                                              ‫%1‬                 ‫د‬    ‫أ ح‬
   ‫م‬            ‫ا و‬           ‫ا ون‬                      ‫ا‬
     ‫01‬      ‫ا رو ت‬            ‫ا د‬
   ‫051‬       ‫ا رو ت‬                ‫ا‬                                          ‫ضأ‬        ‫أ‬       ‫وي‬     ‫ذا‬  ‫ن ا ران و‬      ‫و‬   ‫4( و ت‬
                                                  ‫ن‬          ‫ا‬
  ‫4إ 8‬       ‫ا رو ت‬                                                  ‫ت‬   ‫رو‬                 ‫)‪. (14C‬و م س ا ط ا‬      ‫ر ون ا‬     ‫و و‬
                                 ‫ز‬       ‫ا‬
      ‫8‬      ‫ا و رول‬                                                                           ‫ا نأ .‬             ‫ا د د ھذه ا ران،‬
 ‫5 إ 41‬      ‫ا رو ت‬
                                 ‫ا د‬                                           ‫وا‬           ‫5( ط ا دول أ ، دة د د ض ا ز ت، وذ ك‬
    ‫5.1‬      ‫ا و ن‬                                 ‫ا ر‬
                                                                                                                ‫ن وا ر.‬     ‫ن ما‬
     ‫12‬      ‫ا رو ت‬                      ‫ا‬


                                                                                                                     ‫ج:‬         ‫ل وا‬         ‫ب–‬
                               ‫‪ .A‬و ا م ن طر ق ا ر، وا ذي ط ب ر ب ا دة ا‬
  ‫رى د دة.‬           ‫ددة، وض‬        ‫ل ظ‬     ‫رار، ث وت‬          ‫دد ا دة ا‬
                     ‫ا دة ا و % 92، و ر‬      ‫، ل‬      ‫ن واد‬     ‫ون ا دة ا‬
                                   ‫ا رو ت ا دة ا و ا ر وا دا ا دة ا .‬

               ‫طا‬        ‫، إ ار ع ا‬  ‫ا‬     ‫ضا‬                                                           ‫ا‬        ‫‪ .B‬أدى ول ا و ا و‬
               ‫دم.‬       ‫إ أن‬ ‫ا وى، م را ت در‬                                                               ‫ت‬   ‫رو ت ا د، إ أن و‬

                   ‫ذ: و فا د‬                 ‫ا‬                                                                       ‫: - 72 -‬           ‫ا‬
      ‫رى‬        ‫د د رو ت ا د ا د ،‬                ‫ن‬         ‫رو ت ا د،‬         ‫إن ار ع ا‬
                                                                                    ‫طا‬
                                                                                  ‫.‬
     ‫رى‬               ‫د د رو ت ا د ا‬            ‫ن‬     ‫رو ت ا د،‬       ‫إن ا ض ا ط ا‬
                                                                                  ‫د .‬
        ‫ر ب‬           ‫ا رو ت، د ل‬                ‫ص ن ھذه ا ط ت أن ا ز ت ا و ، و‬         ‫‪.C‬‬
                                                                ‫رار.‬    ‫ا دة ا ، و دد‬

      ‫ف ن‬            ‫د دھ‬   ‫دد، إ أن دة‬               ‫و‬     ‫ا واد ا‬       ‫ا دول، أن‬      ‫‪ .D‬ن ا ط ت‬
                                 ‫ر.‬               ‫ن‬       ‫و ر، و ن‬         ‫أ رى، و ن‬     ‫و إ‬   ‫دة‬

                                                             ‫ر س.‬           ‫‪ – ΙΙ‬ر ب ا رو دات ا ز‬
‫ا و ــــــــــ 11‬                                            ‫11.‬       ‫ا ر س: أ ظر ا و 2، و‬   ‫أ–‬
                                                                                                       ‫2:‬   ‫او‬




                                          ‫:‬      ‫ن نا‬        ‫و‬      ‫ف ا دة، و ون ن‬   ‫ا ر س دة‬
           ‫ت )‪.(Les acinis‬‬                      ‫ل ت‬               ‫، ظم‬     ‫رزة ز ت ا‬       ‫•‬
           ‫رھ س ‪(Les îlots de‬‬                 ‫ز رات‬         ‫ل ز رات،‬          ‫رزة ر و ت، ظ ر‬            ‫•‬
                                                                                       ‫)‪langerhans‬‬

                ‫ط.‬      ‫ر س دة‬       ‫را‬        ‫ا راز، ذ ك‬        ‫ء، و دة دا‬   ‫ا راز = دة‬       ‫ر‬   ‫ر س دة‬   ‫ا‬
                    ‫ذ: و فا د‬    ‫ا‬                                                  ‫: - 82 -‬       ‫ا‬
                                                                                       ‫تا و :‬                         ‫را‬         ‫د ق ا دة‬             ‫ب–‬
                                                                                                           ‫ط ت ر :‬    ‫‪–a‬‬
                                     ‫21.‬        ‫1، و‬             ‫او‬              ‫رب ا‬                  ‫د ق ا دة، وم‬ ‫راز دور ا ت‬
‫ا و ــــــــــ 21‬
                   ‫ا راز‬             ‫را‬          ‫ا‬        ‫را ز‬        ‫ن وع ا و ن، م‬                      ‫ن‬   ‫ضأ‬  ‫د ن وان‬        ‫1‬    ‫او‬
                                                                              ‫.‬    ‫ل‬                    ‫ا‬‫لأ‬   ‫ا‬‫. لا‬      ‫ر‬
                                                                                                       ‫ل ر م.‬       ‫ءا‬     ‫1( أ ط ا‬
                                                                                               ‫ا راز .‬   ‫ا‬       ‫ع‬    ‫را‬     ‫2( دد‬
                                               ‫ا راز .‬           ‫ا‬     ‫ر‬         ‫ر ب ا رو ت، دد ا ظ ھرة ا‬     ‫أن ا و ن د ل‬        ‫3(‬


                                                                                                                          ‫2‬

                                                            ‫5‬
                                                                                                                          ‫3‬                                ‫1‬
                                                            ‫6‬
                                                                                                                          ‫4‬




                           ‫ا ز ن 3‪t‬‬                                          ‫ا ز ن 2‪t‬‬                                                      ‫ا ز ن 1‪t‬‬

                                                                                                                 ‫ج:‬            ‫ل وا‬       ‫‪–b‬‬
                                                                                                                               ‫ء : أ ظر ا و‬  ‫1( ا‬
                      ‫د .‬             ‫ا‬          ‫ا راز ن‬      ‫و زم ا‬ ‫إ‬                                         ‫ا ز ن 1‪ ،t‬ذ ا واد ا‬                    ‫2(‬
                                                ‫ا راز .‬   ‫و ط و زم ا‬                                         ‫ا ز ن 2‪ ،t‬وا د ا واد ا‬
                      ‫.‬          ‫ا‬              ‫ا راز ، و‬       ‫ا و‬                                          ‫ا ز ن 3‪ ،t‬وا د ا واد ا‬
               ‫ا ،‬                         ‫، م طرح د ذ ك‬                ‫وب‬                 ‫د‬           ‫ن‬              ‫ذ‬        ‫ع‬     ‫ظ أن ا‬ ‫3(‬
               ‫د ، ر ب‬                     ‫د ل ر‬     ‫ا‬                 ‫ضا‬                 ‫لا‬                      ‫ا‬            ‫ن ھذا أن‬
                                                                                                   ‫.‬         ‫ر‬        ‫ا‬        ‫ا ررو ت ا ز‬
                                                           ‫وي:‬          ‫رھ ا‬              ‫ا وي ر ب ا رو ت و‬                                         ‫ج–ا و‬
                                                                                                             ‫:‬        ‫ر‬        ‫ط ت‬   ‫‪–a‬‬
    ‫2، و 21.‬                          ‫او‬                   ‫ر ا‬        ‫ر ب ا رو ت، وم‬                                          ‫ددا تا و ا د‬
          ‫09‬        ‫ـ ت ا و ــ‬            ‫ـ ا ـطا ـ‬                              ‫ا و ــــــــــ 21‬          ‫و ط‬               ‫إ راز‬ ‫و‬    ‫2:‬     ‫او‬
          ‫08‬                                                                                                ‫د ق،‬               ‫أ ضأ‬          ‫وي‬
                                                                                                            ‫أ ض‬        ‫إ و ط وي‬          ‫دذك م‬
          ‫07‬
                                                                                                            ‫ع ر‬      ‫ا‬     ‫طور‬         ‫د ،‬       ‫أ‬
          ‫06‬                                                                                                ‫ل‬    ‫ن.‬  ‫از‬   ‫، د‬        ‫ا تا و ا‬
 ‫ـ‬




                                                                            ‫‪REG‬‬
          ‫05‬                                                                ‫‪Golgi‬‬
                                                                                                                                   ‫ا نأ .‬
                                                                                                                  ‫ا و ز ا دا .‬           ‫‪ = REG‬ا‬
 ‫ــ ت ا‬




          ‫04‬                                                                ‫‪VS‬‬
                                                                                                                             ‫‪ = Golgi‬ز و .‬
          ‫03‬                                                                                                                ‫ت إ راز .‬     ‫‪ = VS‬و‬
 ‫ــ‬




                                                                                                                         ‫ا ر .‬         ‫1( ف‬
  ‫%‬




          ‫02‬
                                                                                                                   ‫ظ ا ط‬        ‫را را‬       ‫2(‬
          ‫01‬
                                                                                       ‫ن )‪(.m in‬‬   ‫از‬               ‫تا و .‬                ‫ا‬
           ‫0‬                                                                                                     ‫را ز ت‬   ‫3‬     ‫او‬      ‫3( ن‬
               ‫0‬           ‫02‬             ‫04‬         ‫06‬          ‫08‬   ‫001‬           ‫021‬        ‫041‬                        ‫ا ر .‬        ‫ا رو‬

                            ‫ذ: و فا د‬                 ‫ا‬                                                                         ‫: - 92 -‬        ‫ا‬
                                                                              ‫ل وا ج:‬                      ‫‪–b‬‬
      ‫) و ود‬              ‫ا‬      ‫ا دا‬       ‫و ز‬       ‫ا‬         ‫ا‬          ‫ر ، ر ا طا‬                    ‫دا ا‬    ‫1(‬
                                                                                   ‫(.‬                   ‫تر‬
       ‫ذك ر‬           ‫و ز ا دا ، و زا ن‬                     ‫ا‬       ‫ا‬        ‫ضا طا‬                      ‫رور ا ز ن،‬
         ‫ت‬           ‫ا و‬      ‫ز و ، ر‬                                    ‫ضا طا‬   ‫و .‬                    ‫ز‬       ‫ع‬   ‫ا‬
                                                                                                              ‫ا راز .‬
     ‫. ث‬             ‫دا ل ا‬       ‫ت ا و ، ن ر ا رو ت ا ر‬                                       ‫2( طور ا ط ا‬
      ‫ر‬              ‫ز و‬           ‫،إ‬    ‫ا‬   ‫ا و ز ا دا‬  ‫نا‬                               ‫ل ا رو ت ا ر‬
                                ‫ت ا راز .‬     ‫را و‬    ‫ا‬   ‫رإ‬                            ‫،‬       ‫تا‬    ‫ا و‬
             ‫ر ب ا رو ت‬       ‫ا د ،ود ل‬                                  ‫ن‬      ‫ا‬   ‫إ‬     ‫ضا‬     ‫3( ذ ا‬
      ‫ز و ، ل أن ل‬         ‫ل د ذك إ‬     ‫،‬                                ‫ا‬   ‫ا و ز ا دا‬       ‫وى ا‬
        ‫، وا ط ظ ھرة ا راج ا وي. أ ظر ا و‬                               ‫رج ا‬     ‫ت ا راز إ‬    ‫را و‬
                                                                                           ‫3، و 21.‬
‫ا و ــــــــــ 21‬
                                                                                                            ‫وف ا‬
                                                                                                        ‫و‬


‫و دري‬
                                                            ‫إ راز‬

     ‫ا واة‬                                                                                                          ‫ت إ راز‬   ‫و‬



                                                                                                        ‫ز و‬
‫رق د وي‬

                                                                                               ‫دا‬       ‫و ز‬



                                             ‫ت.‬           ‫ن ر ب ا رو‬          ‫ؤو‬        ‫تا‬          ‫ا‬           ‫‪ – ΙΙΙ‬وق‬
                                                                             ‫ت ا و ودورھ .‬                  ‫ا‬         ‫1 وق‬
                    ‫31.‬       ‫1، و‬      ‫= ا ر وزو ت:‪ ،Les ribosomes‬أ ظر ا و‬                         ‫ت ار‬                 ‫أ–ا‬
   ‫ا و ــــــــــ 31‬             ‫رو‬     ‫را‬        ‫ظ‬                                                         ‫1‬       ‫او‬




                     ‫ذ: و فا د‬          ‫ا‬                                                    ‫: - 03 -‬           ‫ا‬
         ‫ا ر‬        ‫او‬                      ‫رة دا، ون إ‬
                                        ‫و زم أو‬   ‫ا‬      ‫رة‬ ‫ت‬      ‫رة ن‬     ‫ھ‬
                                                       ‫ا و ز ا دا .‬
      ‫ن رو ت ددة، و ن ا ض ا ووي ا ر وزي )‪ ،80% (ARN‬وھ‬         ‫ت ار‬     ‫ون ا‬
              ‫د .‬       ‫ل‬           ‫ضا‬       ‫ا‬      ‫و دات ر ب ا رو ت، إذ وم‬

             ‫31.‬      ‫2، و‬      ‫. ‪ Réticulum endoplasmique‬أ ظر ا و‬          ‫ا دا‬    ‫و ز‬            ‫ا‬       ‫ب–ا‬
             ‫ا دا‬   ‫و ز‬   ‫ا‬     ‫ا‬       ‫ري‬   ‫م‬         ‫ا و ــــــــــ 31‬     ‫رو‬    ‫را‬         ‫ظ‬            ‫2:‬   ‫او‬




  ‫ء‬            ‫ط‬          ‫ت ط ، ون ن و ف دا‬         ‫ل‬    ‫ن ا وات‬     ‫رة ن‬      ‫ھ‬
                              ‫ء ا واة.‬ ‫ل‬     ‫،‬      ‫ا ءا و ز ،و ل‬          ‫س‬
             ‫م ر‬       ‫م ف و ر ز ا رو دات، ا‬   ‫ا و ز ا دا‬       ‫وى و ت ا‬
      ‫رو د‬           ‫ز ت أ رى، و ذ ك أ‬            ‫،‬      ‫ت ار ا‬       ‫وى ا‬
                                                      ‫.‬ ‫تا‬    ‫و‬          ‫دة، م‬
‫ا و ــــــــــ 31‬
                                        ‫3:‬   ‫او‬
                                                                   ‫‪Appareil de golgi‬‬      ‫:‬        ‫ز و‬      ‫ج–‬
                                                          ‫أ ظر ا و 3، و 31.‬
                                                       ‫ل أ س ط ، و را‬       ‫ھو رة ن وات‬
                                                          ‫وفو‬     ‫ض، ل س وي‬        ‫إ‬
                                                         ‫ا ءا و ز .و ل س‬        ‫س‬    ‫ء‬
                                                                                  ‫وا ن:‬

                                                      ‫س،‬      ‫واھ ا‬          ‫ل‬             ‫ا ل: ا‬   ‫• وا‬
                                                       ‫ن‬        ‫ا ر‬           ‫تا‬           ‫ما و‬   ‫ث‬
                                                                           ‫ا دا .‬         ‫ا و ز‬       ‫ا‬

                                                        ‫واھ ا س،‬          ‫زأ‬      ‫:ا‬     ‫ا‬   ‫• وا‬
                                                        ‫إ راز ، ھذه ا رة‬     ‫ت و‬       ‫ط و‬
                                                           ‫.‬    ‫رج ا‬     ‫ز ن ا واد أو طر‬
                                                          ‫ف ا رو ت و د دات‬         ‫و‬      ‫ل ز و‬
                                                      ‫،‬      ‫ا‬       ‫د ل إ راء ا د ت ا‬          ‫ا ر،‬
                                                          ‫إ‬    ‫، وا و‬   ‫دا ل ا‬     ‫وا ء ا رو ت ا و‬
                                                                                           ‫.‬   ‫رج ا‬

                    ‫ذ: و فا د‬       ‫ا‬                                                   ‫: - 13 -‬       ‫ا‬
                                                   ‫.‬   ‫ا‬   ‫و تا‬    ‫ر‬     ‫ددا‬   ‫2ا‬
             ‫ددا ء‬            ‫راج ا وي‬    ‫4، و 31، ن أھ ظ ھرة ا‬      ‫ن او‬   ‫اط‬
       ‫.‬     ‫د د ا دة ا‬       ‫وا راج ا وي )‪(Exocytose‬‬     ‫ا دقا‬     ‫ا و ز ، وأھ‬

‫ا و ــــــــــ 31‬                        ‫4:‬   ‫او‬




  ‫و د ون‬         ‫،‬    ‫تا‬     ‫ط و‬      ‫ا و ز ا دا‬         ‫ءا‬      ‫ظ أن‬
 ‫رة،‬          ‫ت، وظ ھرة ا ل م‬      ‫ت ز و‬          ‫ت ا و . و أن دد‬        ‫ا‬
    ‫ت ا راز ، ا‬    ‫ت د دة ھ ا و‬    ‫و‬    ‫ت ا د ، رف زءا إ‬          ‫أن ا‬
‫م ، و رغ واھ وا ط ظ ھرة ا راج ا وي. م‬               ‫وا ءا و ز‬          ‫و‬
         ‫ا‬      ‫ا و د‬      ‫ا‬    ‫ا راز ،‬      ‫دا ل ا‬    ‫ادن ن ظ ھرة ا د ق ا‬
               ‫ا .‬      ‫. ھذا ا د ق ھو ا ؤول ن د د وإ دة ء و ت ا‬



              ‫ذ: و فا د‬   ‫ا‬                                   ‫: - 23 -‬   ‫ا‬
                                                                           ‫ا و دة ا‬

      ‫ﻃﺒﻴﻌﺔ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ واﻟﻴﺔ ﺗﻌﺒﻴﺮﻩ – اﻟﻬﻨﺪﺳﺔ اﻟﻮراﺛﻴﺔ‬

                                                                      ‫ـــــ م :‬       ‫ـــ ـــ‬
 ‫ظ دا أن ھ ك‬    ‫ل س،‬              ‫دا ل‬       ‫رد وا‬     ‫ت ا ، ور م ا روق ا‬        ‫ر م وع ا‬
‫ف‬      ‫ف ا رو ت ا و‬                ‫أن‬     ‫ما ،‬       ‫د لا‬        ‫ا وظ‬      ‫وى ا‬       ‫و دة‬
‫دد و وع و ر ب‬      ‫ت‬               ‫، و ف ھذه ا رو‬         ‫ضا‬      ‫لا‬         ‫ا ت، ون ن‬
  ‫،‬     ‫تا‬    ‫ل را‬               ‫ز و و وا و ،‬        ‫وا‬      ‫تا‬       ‫، وأن ا‬    ‫ضا‬       ‫ا‬
                                     ‫ن ل إ آ ر.‬      ‫ل‬      ‫ا ء ا ذي ن أن ھ ك ر ورا‬
  ‫ت‬     ‫د ضا‬          ‫ت‬       ‫د ا ورا ، د ل ا‬         ‫رف‬        ‫ن م ا ورا ،‬       ‫ود را‬
                                                                                     ‫ا .‬


                                                   ‫ا ر ا ورا‬
                                                       ‫؟‬       ‫و‬                   ‫1( أ ن‬
                                      ‫ن ل ر؟‬       ‫م ل ا ر ا ورا‬                  ‫2( ف‬
                                         ‫ر ا ورا ؟‬         ‫ا‬   ‫اط‬                 ‫3( ھ‬
                                  ‫ت ا ورا وا ر ا ورا ؟‬     ‫نا‬                     ‫4( ا‬
      ‫ر ا ورا ؟‬       ‫ا‬       ‫رو ت ط‬         ‫ضا‬     ‫وع و ر ب ا‬                         ‫5(‬
                  ‫؟‬           ‫ت ط‬     ‫؟و‬        ‫دىء ا د ا ورا و‬                        ‫6(‬




         ‫ذ: و فا د‬        ‫ا‬                                         ‫: - 33 -‬      ‫ا‬
                                                    ‫ل ا ول:‬          ‫ا‬
                                            ‫ﻣﻔﻬﻮم اﻟﺨﺒﺮ اﻟﻮاﺛﻲ‬
                                                                            ‫‪ – Ι‬أ ن وا د ا ر ا ورا ؟‬
                                                           ‫دا ل ا‬        ‫ا ر ا ورا‬   ‫1ا ف ن و‬
                                                     ‫‪ : Amibe‬أ ظر ا ر م.‬         ‫دا‬   ‫ر ا ط‬          ‫‪– a‬‬

                                                           ‫.‬         ‫ر ا ط دا‬               ‫ن ار م ا‬
                                                                    ‫ھذه ا ر ؟‬ ‫ل‬           ‫ص ن‬      ‫ذا‬


                                                     ‫زء وى‬


         ‫ثر‬                                                                                      ‫واة‬
                                                                                                           ‫و زم‬



                                                    ‫ر وى‬       ‫زء‬

         ‫ل‬     ‫ا‬

                                                                                                 ‫ط‬



          ‫رور‬       ‫أن ا واة‬           ‫ر.‬    ‫ة، و‬     ‫ا‬        ‫ر‬     ‫ا واة‬     ‫وي‬     ‫ظ أن ا زء ا ذي‬
                                                                                         ‫و رھ .‬      ‫ةا‬
             ‫1.‬    ‫ر 1 و‬    ‫ط 1،‬   ‫و ر ‪:Acetabularia‬أ ظر‬                 ‫دا‬   ‫رب ا ط وا ط م‬            ‫‪–b‬‬
‫ا و ــــــــــ 1‬                                    ‫ةا‬      ‫ط 1 دور ا واة‬
    ‫راء ‪ Les algues vertes‬ا ر‬   ‫و ر ‪ Acétabularia‬ن ن ا ط ب ا‬            ‫دا‬
                              ‫ا و 1 و ن ن ھذا ا ط ب.‬       ‫.و ل‬      ‫ا و دة ا‬
  ‫و‬   ‫ا (، أ زت‬        ‫ل ا واد ا ؤو ن د د ا ل ا ر )‬                ‫نأ ل ر‬
                                                                   ‫ن ا رب‬
‫ا و ن ا ذ ور ن أ ه ن‬    ‫دوه ر ا ط و ا ط م‬      ‫- ا ر 1 م ‪ Hamerling‬و‬
              ‫ھذه ا ر .‬   ‫و ر ، و ن ا و 2 ظروف و‬        ‫ط با‬
                                                  ‫1- دد ا دف ن ھذه ا ر‬
                                           ‫لا‬     ‫ر وا ط‬         ‫ر‬      ‫2-‬
‫3.‬       ‫او‬                ‫ز ا رب ا‬         ‫، مإ‬ ‫ا ر ا ورا دا ل ا‬     ‫د دد و‬     ‫-ا ر 2‬
         ‫ت‬         ‫دا‬       ‫ا ر ا ورا‬        ‫ن و‬       ‫ن ط ت ھذه ا ر ، ا‬      ‫اط‬
                                                                     ‫.‬   ‫ا ددة ا‬

                    ‫ذ: و فا د‬      ‫ا‬                                                  ‫: - 43 -‬         ‫ا‬
    ‫2‬      ‫او‬                                                 ‫ا و ــــــــــ 1‬                      ‫1:‬   ‫او‬



          ‫إزا‬        ‫زرع واة‬
        ‫ا واة‬       ‫ط ب ‪Am‬‬

‫ا زء ا دي‬                                                ‫‪Acetabularia‬‬                               ‫وب‬
‫ط ب ‪Am‬‬             ‫زرع واة‬                               ‫‪mediterranea‬‬
                   ‫ط ب ‪Ac‬‬


                                                                                               ‫و ر ذري‬
                                             ‫‪Acetabularia‬‬
                                              ‫‪crenulata‬‬                     ‫‪Acetabularia‬‬                           ‫‪Acetabularia‬‬
                                                                          ‫‪Mediterranea: Am‬‬                         ‫‪Crenulata: Ac‬‬



                                                     ‫.‬       ‫ةا‬          ‫د د دور ا واة‬         ‫1( ا دف ن ھذه ا ر ھو‬
     ‫،‬                 ‫ر ا ش و دد‬          ‫ا واة، و ده‬   ‫ظ أن ا و ر ا ذري ا ذي وي‬  ‫2(‬
    ‫ن‬           ‫ن ھذا‬     ‫ر ط وع ا واة. ا ط‬       ‫ا ل واة، أي أن ل ا‬    ‫تا‬       ‫س‬
                      ‫ر ا ورا .‬         ‫ا راض أن ا واة ھ ا ؤو ن ل ا ، إذن ھ ا‬

 ‫1.‬        ‫ر 2 و‬             ‫ط 1،‬        ‫وم ‪ : (Crapaud) Xénopes‬أ ظر‬                      ‫دا‬    ‫خ‬        ‫ر ا‬        ‫‪–c‬‬

‫ا و ــــــــــ 1‬                                                                                                           ‫3:‬        ‫او‬
                                                              ‫وم أ ق‬
                         ‫ر‬     ‫وم أ‬

                                         ‫ر‬    ‫ت‬      ‫و‬


                                                                                                         ‫وم‬     ‫03‬
                                                         ‫و‬        ‫ع ا واة ن‬      ‫ا‬                            ‫أ ق‬


                ‫د ر ا واة وا ط ‪UV‬‬                                            ‫واة‬      ‫و‬
                                             ‫دون‬         ‫و‬
                                                   ‫واة‬                      ‫وم أ ق‬



    ‫ت‬        ‫ا واة. ادن ا‬               ‫ت ا وم ا ذي أ ذت‬       ‫خ،‬                         ‫نا‬      ‫ظ أن ا وم ا‬      ‫3(‬
‫.‬          ‫ت ا ددة ا‬                  ‫وا د واة د ا‬      ‫أن ا ر ا ورا‬                       ‫ا واة.‬     ‫و‬      ‫ا ورا‬

                                                                                                                   ‫:‬             ‫2‬
   ‫م‬                ‫و وا دھ ، وأن ھذه ا واة ھ ا‬                     ‫ةا‬    ‫رور‬             ‫أن ا واة‬     ‫ن ن ا رب ا‬
‫وا د‬             ‫و د ا واة. أي أن ا ر ا ورا‬                       ‫ت ا ورا‬                 ‫. إذن ا دة ا‬            ‫ا ونا‬
                                                                                                        ‫وى ا واة.‬

                                                                  ‫م ا وي.‬              ‫را‬          ‫ل ا ر ا ورا‬             ‫‪ – IΙ‬ا‬
                                                                      ‫.‬                  ‫د‬       ‫ر‬      ‫م را‬                 ‫1ا‬
                        ‫م ا وي.‬              ‫را‬          ‫ر ا وي، ا ذي م‬              ‫ه، ن طر ق ا‬              ‫دد‬   ‫مو‬           ‫وا‬
                    ‫ذ: و فا د‬            ‫ا‬                                                           ‫: - 53 -‬          ‫ا‬
   ‫م‬               ‫م‬        ‫ھذا ا‬     ‫،و‬                    ‫ت‬                       ‫ط‬     ‫ا م،‬        ‫ما‬       ‫م ا وي،‬              ‫أ ءا‬
                                                                                                             ‫ر )‪.(Mitose‬‬            ‫را‬

                        ‫ط 2، و 1.‬               ‫ر. أ ظر‬          ‫را‬         ‫م‬            ‫طور ا‬                         ‫ظ‬       ‫أ–‬

   ‫4‬        ‫او‬                                       ‫ا و ــــــــــ 1‬           ‫م ا وي‬           ‫را‬         ‫ط 2 ا ل ا ر ا ورا‬          ‫2‬
                                                                                        ‫ر ا وي‬      ‫ھ‬           ‫تو دد‬        ‫م وا‬
                                                                                           ‫ا و ا وو‬          ‫و ظ ھذا ا ل ن ا وا د‬
                                                                                ‫؟‬       ‫ا ل ا ر ا ورا‬            ‫. ف د ل ھذه ا‬

                                                                                          ‫ظ‬           ‫ط ا و 4 ورة ا رو و را‬
                                                                                                               ‫ذر ا ل.‬       ‫ر‬
                                                                                        ‫ن ف م‬           ‫ل ھذه ا و‬  ‫ن‬     ‫1-اط‬
                                                                                                                       ‫ا ر ا وي؟‬

       ‫م،‬  ‫را‬        ‫ا ظ ر:‬      ‫رة ذات وى‬     ‫ظ أن ا در ون ن‬    ‫ن ھذه ا‬
           ‫ن‬     ‫ا‬      ‫ن ا ط ت ا وو‬        ‫ء ووي، و م‬      ‫و روي ا ل، ط‬
         ‫ت ا واة و و ت‬          ‫طور ا ون، ض ا‬       ‫و ت، ر ھذه ا‬     ‫وي‬
        ‫ر.‬   ‫ا م ر‬          ‫ت ‪ ،Chromosomes‬و ر‬    ‫ا‬       ‫ل طت‬       ‫ت‬
                                                ‫2.‬        ‫ط 2، ا و‬              ‫ر. أ ظر‬          ‫را‬     ‫م‬          ‫ب – را ل ا‬
‫ا و ــــــــــ 2‬                           ‫م.‬         ‫طور ا‬                ‫ضا‬       ‫ط ا و 5 ورا ا رو و را‬
                                                     ‫وا ق‬               ‫2 - أ ط وا ل ورة )1،2...،9( د ر‬
                            ‫م.‬      ‫طور ا‬       ‫ضا‬      ‫ر‬   ‫ظت‬                                        ‫طط‬        ‫ط او 6 ر و‬
                       ‫م.‬        ‫ر ل ر م م دد ا م ل طور ن أطوار ا‬                                              ‫ءا‬   ‫3-أ طا‬
                                                                        ‫ت ل دورة و .‬         ‫ن ا و 7 ظ ھر ا‬
                                                             ‫؟‬            ‫ل طور، ذا‬   ‫ت‬        ‫4 - ا ب دد ا‬
                                                                                ‫ن ھذه ا ط ت ؟‬        ‫5 - ذا‬
                                                                    ‫‪ – a‬ا طور ا‬          ‫دي ‪La prophase‬‬
        ‫ت، ل‬      ‫ا‬      ‫ل طت‬           ‫نوا ظ‬       ‫فا‬        ‫دا‬      ‫ز ھذه ا ر‬
          ‫وى‬        ‫‪ ،Chromatide‬ر ط ن‬           ‫ل وا د‬       ‫ون ن و د ن،‬
       ‫ا ء ا ووي و ا و ت، و ظ ر‬         ‫ھذه ا ر‬        ‫ا زيء ا ر زي ‪،Centromère‬‬
       ‫زل‬       ‫رة ن ت ط ‪ ،Calottes polaires‬ظ ر‬          ‫،ھ‬     ‫ط ا‬            ‫ط‬
                                                      ‫و ‪.Fuseau achromatique‬‬
                                                                                    ‫‪La métaphase‬‬              ‫وا‬       ‫‪ – b‬ا طور ا‬
        ‫و‬                   ‫وا‬     ‫ا وى ا‬                    ‫تأ رو و ،و و‬         ‫ا‬                                      ‫ل ھذه ا ر‬
                                 ‫م.‬    ‫زل ا‬           ‫ل‬       ‫ل‬ ‫‪ ،La plaque équatoriale‬و‬                               ‫ا وا‬        ‫ا‬
                                                                                         ‫‪L'anaphase‬‬                    ‫‪ – c‬ا طور ا‬
    ‫،‬                        ‫ل ل‬      ‫ز ن ر ز ن،‬                        ‫ط‬       ‫ط ر ا زيء ا ر زي،‬                        ‫ز ھذه ا ر‬
                                                                                                                             ‫ف‬
                       ‫ذ: و فا د‬       ‫ا‬                                                                    ‫: - 63 -‬       ‫ا‬
                         ‫م ھ رة ل‬                                             ‫ل‬                       ‫ت وا‬                                        ‫ث دد ا‬                                     ‫و ن ن‬                                               ‫ن‬                 ‫و‬                      ‫ون‬                 ‫ت.‬                                ‫دد ا‬
                                                                                                                                                                                                                                                                                                           ‫وأ د‬                                ‫و‬
                                                                                                                                    ‫رة ا ط .‬                                             ‫ا‬              ‫إ‬                                ‫فا‬                          ‫را‬                                                                       ‫ط ا‬

                                                                                                                                                     ‫‪ – d‬ا طور ا‬                                                          ‫‪La télophase‬‬
‫ن، و ون‬    ‫نا‬                                                                                               ‫ا رادي ا وا ، و ول إ‬         ‫كو د‬     ‫تو‬         ‫ا‬
‫ل ن‬    ‫وزي‬    ‫ءا‬                                                                                              ‫م، و ون دار أو‬    ‫زل ا‬        ‫ا ء ا ووي و ا و ت، و‬
                                                                                                                             ‫ت.‬      ‫س دد ا‬      ‫ن ن و ران‬
                                                                                                                                                                  ‫ا و ــــــــــ 2‬                                                                                                                                                               ‫اﻝوﺜﻴﻘﺔ 5‬




      ‫..................‬                   ‫...................‬                     ‫...................‬                     ‫...................‬                   ‫...................‬                   ‫..................‬                     ‫..................‬                    ‫ور :................‬                                         ‫ا ر باز‬
                                                                                                                                                                                                                                                                                       ‫................ .‬
 ‫........................................................................................................................................................................................................................................................................................................................‬   ‫ا ور :‬                              ‫ق‬
‫................................................................................................................................................................................................................................................................................................................................................................................‬




                                              ‫ذ: و فا د‬                                               ‫ا‬                                                                                                                                                                         ‫: - 73 -‬                                          ‫ا‬
                                 ‫ا و ــــــــــ 3‬                              ‫اﻝوﺜﻴﻘﺔ 6‬




                                             ‫وا .‬   ‫د‬   ‫ر‬       ‫را‬     ‫م‬         ‫2ا‬
  ‫ا‬    ‫ما‬    ‫ا‬      ‫نأ‬      ‫وا‬    ‫،‬‫ر د‬       ‫م را‬        ‫ظ را ل ا‬         ‫ن ل‬
                                   ‫ن:‬     ‫نر‬       ‫طوط ا ر ، و ود ا‬
 ‫م ا ر زي ‪ ،Le centrosome‬ون‬     ‫ا‬       ‫ص‬                   ‫ا وا‬       ‫• ورا‬
‫ا زل‬     ‫ط ‪ ،Aster‬ون‬                ‫ن ر ز ن ‪ ،2Centrioles‬ل ل وا د‬
                                                 ‫م ا وي.‬       ‫ا و أ ءا‬
  ‫وى‬       ‫ظر‬        ‫و‬    ‫ن ا ن، وا ط‬         ‫لا‬      ‫، ما‬      ‫ل ا طور ا‬    ‫•‬
   ‫ق‬     ‫ھذه ا ظ ھرة‬   ‫و ن، و‬     ‫زأ ن‬     ‫إ‬     ‫لا‬      ‫، ض‬         ‫ا واء ا‬
                                      ‫ا وا ‪.L'étranglement équatorial‬‬


        ‫ذ: و فا د‬    ‫ا‬                                      ‫: - 83 -‬       ‫ا‬
                                                                                    ‫7، و 3.‬                ‫و . أ ظر ا و‬        ‫وم ا دورة ا‬           ‫3‬
‫ا و ــــــــــ 3‬                                                                               ‫1‪G‬‬                          ‫2‪G‬‬                   ‫7:‬       ‫او‬
                                                                                                               ‫‪S‬‬
          ‫= ......................................................‬    ‫1‪G‬‬
                                                                                                     ‫1‪G‬‬
          ‫= ........................................................‬   ‫‪S‬‬
                                                                                                                     ‫1‪G‬‬
                                                                                                                                       ‫‪S‬‬
         ‫.......................................................‬   ‫2‪= G‬‬
                                                                            ‫‪T‬‬
          ‫= ........................................................‬   ‫‪P‬‬

          ‫= .......................................................‬    ‫‪M‬‬
                                                                                                                                               ‫2‪G‬‬
         ‫= ........................................................‬    ‫‪A‬‬

           ‫= .......................................................‬   ‫‪T‬‬                   ‫‪A‬‬
                                                                                                                                ‫‪P‬‬
                                                                                                                ‫‪M‬‬

                          ‫ل‬                  ‫ت،‬    ‫ا‬                           ‫ز‬      ‫ون،‬     ‫ر و ر‬       ‫ون ل ا م ر‬
                     ‫ر‬        ‫م‬             ‫وع ر ا‬                         ‫ن. و ل‬        ‫ن‬     ‫ر، و ن‬      ‫نا م ر‬
                                                                                       ‫، دورة و .‬    ‫ر، و ر ا ون ا‬       ‫ا‬
                      ‫ر ا ورا .‬                       ‫ما لا ط ق‬                     ‫ن ل إ أ ر دون ر،‬    ‫ادن ل ا د رة ا ورا‬

                                                                                           ‫دة ا ورا .‬                   ‫ا‬ ‫‪ – IIΙ‬ا ط‬
                                                                                    ‫دة ا ورا .‬                  ‫ا‬     ‫1ا ف ناط‬
                                                                           ‫4.‬   ‫ط 3، و‬             ‫أ – ر ‪ (1928) Griffith‬أ ظر‬
‫ا و ــــــــــ 4‬                                                            ‫ر ا ورا‬            ‫3 ط3ا ر با‬
                                                                 ‫:‬    ‫ا ر ا ورا أ زت ا رب ا‬           ‫د ددط‬
                                                                                      ‫أ ث ‪( 1928 ) Griffith‬‬
   ‫ب‬            ‫ر‬   ‫ا ر و ‪ ، Les pneumocoques‬وھ‬       ‫ظ ا ورات ا‬        ‫زي ‪Griffith‬‬         ‫8291 م ا م ا‬
                                                                            ‫ن:‬        ‫ن‬          ‫ا بار ،وو د‬
    ‫(.‬         ‫دة ) ر‬      ‫ز و‬    ‫رف ‪. ( Smooth ) S‬‬     ‫ء، ر ز‬     ‫( و ون ت‬          ‫ظ )‬          ‫ل وي‬      ‫-‬
                          ‫رف ‪ . (rough) R‬وھو ل ر د.‬         ‫(، ر ز‬      ‫ظ و ون ت ر )‬               ‫ل دون‬    ‫-‬
                         ‫:‬   ‫ا دول ا‬         ‫رب ا‬   ‫ر ‪ R‬ر د ، م ھذا ا م‬             ‫ولا ر ‪S‬إ‬             ‫و‬
                                                                   ‫أ ث ‪ Griffith‬؟‬         ‫ل‬     ‫ن ل‬        ‫ذا‬


                ‫دم‬        ‫ر‬           ‫ظ‬                                         ‫ل‬      ‫ا‬       ‫ا‬                           ‫ر‬    ‫ا ظروف ا‬            ‫رب‬    ‫ا‬

                      ‫ورات ‪S‬‬            ‫و ود‬                                         ‫وت ا ر‬                  ‫ورات ر و ‪S‬‬     ‫ن ر 1‪A‬‬                       ‫1‬

                     ‫ورات ‪R‬‬             ‫و ود‬                                         ‫ا ر‬                    ‫ورات ر و ‪R‬‬      ‫ن ر 2‪A‬‬                       ‫2‬

              ‫ورات ‪S‬‬            ‫دم و ود‬                                              ‫ا ر‬                     ‫ورات ر و ‪S‬‬     ‫ن ر 3‪A‬‬                       ‫3‬
                                                                                                    ‫ورات‬        ‫وي‬    ‫ط‬    ‫ن ر 4‪A‬‬
                      ‫ورات ‪S‬‬            ‫و ود‬                                         ‫وت ا ر‬                                                              ‫4‬
                                                                                                                      ‫و ورات ‪R‬‬    ‫‪S‬‬


                              ‫ذ: و فا د‬                      ‫ا‬                                                            ‫: - 93 -‬         ‫ا‬
                                                                           ‫ج:‬     ‫ل وا‬     ‫ب–‬
                               ‫دة.‬  ‫ر‬       ‫ورات ‪ ، S‬وھ‬            ‫ن‬    ‫وت ا ر 1‪،A‬‬
                       ‫ر دة.‬      ‫ر‬    ‫ن ورات ‪ ، R‬وھ‬           ‫م ت ا ر 2‪ ،A‬وذ ك و‬
                           ‫ر دة.‬     ‫ر‬       ‫، وھ‬     ‫ن ورات ‪S‬‬       ‫م ت ا ر 3‪ ،A‬و‬
           ‫، و ‪ ، R‬ظ رت ده ورات ‪. S‬‬                  ‫ورات ‪S‬‬        ‫ن‬    ‫وت ا ر 4‪،A‬‬
     ‫ورات ‪ ، S‬و ر‬            ‫د ا ر 4‪ ،A‬و ت إ‬          ‫ن ھذا ا ل، أن ا ورات ‪ R‬ا‬
        ‫ورات ‪S‬‬      ‫ھذا ا ول ا رض ‪ Griffith‬أن ا ورات ‪ S‬ا ، و ت ا ورات ‪ R‬ا ، إ‬
      ‫ا و ‪.Principe transformant‬‬       ‫إ ، ھ ‪ : Griffith‬ا‬        ‫، وذ ك ن طر ق دة‬

                                                       ‫‪:Griffith‬‬             ‫ج–ا ق ن ر‬
                                          ‫4.‬    ‫دوه: أ ظر ط 3، و‬              ‫‪ – a‬ر ‪ Avery‬و‬
 ‫ا و ــــــــــ 4‬                                               ‫ث ‪Mc Carthy , Mc Leod , Avery‬‬         ‫أ‬

    ‫، م‬        ‫ر‬    ‫ر ‪S‬‬  ‫د د ا ل ا ؤول ن ول ا ر ‪ R‬ر ا ر ، إ‬                       ‫ر ا ا و ، أي‬
              ‫:‬       ‫ر ، تا‬            ‫ك ضا و تا‬           ‫ت‬                    ‫أز‬      ‫ھؤ ء ا ون‬
            ‫ر ‪. S‬‬      ‫+ أ ز م ل رو ت = ول ا ر ‪ R‬إ‬        ‫ر ‪S‬‬                     ‫+‬    ‫ر ‪R‬‬
              ‫ر ‪. S‬‬         ‫+ أ ز م ل دھون = ول ا ر ‪ R‬إ‬   ‫ر ‪S‬‬                     ‫+‬    ‫ر ‪R‬‬
             ‫ر ‪. S‬‬       ‫+ أ ز م ل ل ‪ = ARN‬ول ا ر ‪ R‬إ‬     ‫ر ‪S‬‬                     ‫+‬    ‫ر ‪R‬‬
         ‫ر ‪. S‬‬      ‫+ أ ز م ل ل ‪ = ADN‬دم ول ا ر ‪ R‬إ‬       ‫ر ‪S‬‬                     ‫+‬    ‫ر ‪R‬‬
         ‫ل د و ود‬  ‫م ن ھذه ا رة ر = وت ا ر و ن‬        ‫ر ‪R‬‬   ‫‪S‬‬                    ‫ن ‪ ADN‬ر‬
                                                                                   ‫.‬    ‫ر ‪S‬‬
                                                   ‫دوه ؟‬    ‫ر ‪ Avery‬و‬            ‫ن ل ل‬         ‫ذا‬

                                                            ‫ج:‬   ‫ل وا‬    ‫‪–b‬‬
           ‫ل أ ز ت ل ل ‪) ،ADN‬ا ض ا ووي‬      ‫دث د ا‬         ‫ظ أن ا ول ا ري‬
         ‫ن ‪ .( Acide désoxyribonucléique‬أن ن ‪ ADN‬ا ر ‪،S‬‬        ‫ا ر وزي ص ا و‬
                                    ‫ر ‪. S‬‬            ‫ر ‪ ،R‬ول ھذه ا رة إ‬
           ‫إ ‪ ، S‬ھو ‪ ،ADN‬و‬    ‫ر ا ؤول ن و ل ‪R‬‬           ‫ن ھذه ا ط ت أن ا‬
                                                    ‫ا و ھ ز ‪.ADN‬‬
                                       ‫ر آ ا ول ا ري: أ ظر ا ر م.‬          ‫‪–c‬‬



           ‫زء ن ‪ADN‬‬     ‫رة )2( د‬               ‫أ زاء‬    ‫د وت ا ورات ‪ S‬ا دة )1( زأ ‪ ADN‬إ‬
            ‫ر با ظ‬       ‫ا درة‬                      ‫)3(، ا‬    ‫ا ورات ‪ ADN ، S‬ا ورات ‪ R‬ا‬
         ‫د دة ن ‪ S‬إ‬ ‫ورا‬     ‫ھذا ل‬                ‫ورات ‪. S‬‬                 ‫ا ؤو ن ا رض، و‬
                                                                                      ‫‪.R‬‬
                          ‫4.‬    ‫2،1، و‬      ‫‪ : Bactériophage‬أ ظر ا و‬     ‫د – دورة ة ا‬
‫ا و ــــــــــ 4‬                                                         ‫ت )ا رو ت ( ‪Les virus‬‬   ‫را‬

   ‫دا.‬   ‫از موا‬        ‫‪ARN‬‬      ‫ض ووي ‪ ADN‬وأ‬       ‫ون ن رو ت و ط‬           ‫لھد‬          ‫،‬   ‫ر ا رو ت ظ‬
    ‫ب‬        ‫ر‬      ‫‪) Bactériophage‬أ ظر ا و 1 (‬       ‫ا‬  ‫أ رى.‬      ‫ب‬          ‫ر‬      ‫ل‬    ‫ب ص‬    ‫س ا‬
                      ‫ت؟‬    ‫ر را‬       ‫ن ھذه ا و ق‬      ‫كا‬     ‫2 (: ذا‬     ‫را ل ) أ ظر ا و‬   ‫ا ر .و مذك‬

                    ‫ذ: و فا د‬    ‫ا‬                                              ‫: - 04 -‬    ‫ا‬
‫ا و ــــــــــ 4‬                                               ‫2‬    ‫او‬                               ‫1‬    ‫او‬




                             ‫را ل ھ :‬       ‫ب ا ر ، و م ذك‬             ‫را‬
         ‫و زم ا ر .‬       ‫إ‬      ‫ا ر ، و رب ز ‪ ADN‬ا‬               ‫تا‬
                                    ‫‪ ADN‬ا ر .‬        ‫و‬    ‫ف ‪ ADN‬ا‬
                       ‫ت د دة.‬        ‫دا ل ا ر ، و ر ب‬      ‫و تا‬
                        ‫.‬      ‫ا‬             ‫ت دد‬      ‫ا را ر و رر‬
   ‫ز ‪ ،ADN‬م‬       ‫أن ھذه ا رة ن ط رھ ا ورا ، ا ل‬             ‫ن ن دورة ة ا‬
         ‫. و ذ ك د أن ‪ ADN‬ل ا ر ا ورا .‬          ‫ا‬           ‫ت د دة‬     ‫ر ب‬
                                                                                     ‫:‬          ‫ه–‬
                                                                     ‫:‬        ‫ص‬     ‫نا‬     ‫ق‬         ‫اط‬
      ‫ر‬      ‫ل‬     ‫ا واة و‬          ‫و‬        ‫‪،ADN‬‬       ‫رة ن ز‬           ‫ھ‬   ‫ر ا ورا‬       ‫ا دة ا ورا ا‬
                                                                              ‫م ا وي.‬     ‫ت لا‬        ‫ا‬

                                                                             ‫ف ن دة ‪.ADN‬‬                 ‫2ا‬
      ‫ف ‪ schiff‬ا ذي ون‬              ‫ل‬          ‫ا‬           ‫د ھذه ا‬   ‫ل طر ‪ ،Feulgen‬إذ‬     ‫ل ذك‬
                                                                  ‫ر د و ود ‪.ADN‬‬     ‫د م ا ون و ون‬
                                    ‫ت.‬                   ‫‪ Feulgen‬أن ز ‪ ،ADN‬ون أ‬               ‫رز‬

       ‫م‬            ‫راء‬      ‫دة ا‬            ‫و و دري و ا‬     ‫وى ا‬          ‫زء ن ‪ADN‬‬           ‫وظ : د أ‬
                                                                         ‫ت.‬   ‫ص ھذه ا‬           ‫ض‬      ‫ط‬
                                                                ‫ز ‪.ADN‬‬                   ‫‪ – IV‬ا ر ب ا‬
                             ‫5.‬         ‫1، و‬        ‫ط 4، و‬    ‫ز ‪ .ADN‬أ ظر‬                  ‫1ا و تا‬
‫ا و ــــــــــ 5‬                              ‫ت‬       ‫نوا‬                ‫ل ‪ ADN‬و‬         ‫صا‬         ‫ط4ا‬    ‫4‬

                               ‫ء:‬  ‫أ زاء‬ ‫ا‬   ‫رة ون ن‬
                                               ‫رر‬         ‫♥ ا و 1 : ر ر ‪ ADN‬ز‬
                                      ‫ن ‪Désoxyribose‬‬       ‫ر ا ر وز ص ا‬        ‫•‬
                                          ‫ض وري ‪Acide phosphorique‬‬             ‫•‬
‫دة ازو ‪ Base azotée‬وھ إ : ا د ن) ‪ ، Adénine (A‬ا وا ن) ‪ ، Guanine (G‬ا ن‬         ‫•‬
                                      ‫)‪ ، Thymine (T‬ا وز ن )‪. Cytosine (C‬‬
 ‫و د ‪ Nucléotide‬و ذ ك ول أن ز ‪ ADN‬ھ‬            ‫ل ‪ ADN‬و‬       ‫، ا و دة ا‬ ‫ون ھذه ا زاء ا‬
                                   ‫و دات ‪). Polynucléotide‬أ ظر ا و 1 (‬     ‫رة ن د د ا‬

                   ‫ذ: و فا د‬        ‫ا‬                                              ‫: - 14 -‬     ‫ا‬
     ‫ا و ــــــــــ 5‬                                                                                           ‫1:‬           ‫او‬




                            ‫رھ :‬                    ‫ون ن‬   ‫ة ز ت ‪ ،ADN‬ذات‬
                                                                ‫أ‬          ‫در‬     ‫ت‬
                                                        ‫ض و وري 4‪. H3PO‬‬           ‫•‬
                                    ‫ن،4‪. C5H10O‬‬     ‫ھو ا ر وز ص أو‬            ‫ر‬   ‫•‬
                                                          ‫• وا د ازو ‪.A ،T ،C ،G‬‬
        ‫ض‬          ‫ن+‬    ‫ـ ‪ ADN‬و ون ن: ر ر وزي ص أ‬               ‫و د ا و دة ا‬   ‫و لا‬
                    ‫و دات.‬  ‫‪ ADN‬د د ا‬      ‫دة أزو ‪ A‬أو‪ T‬أو ‪ C‬أو‪ ،G‬و ذ ك‬       ‫وري +‬
                                                                                          ‫‪.ADN‬‬                  ‫ز‬                 ‫2‬
                                                                             ‫‪:Chargaff‬‬   ‫‪–a‬‬
   ‫در‬         ‫ز ت ‪ ADN‬ذات‬                        ‫م ‪ Chargaff‬د د ب ا وا د ا زو ا ر ، ‪،A, T, C, G‬‬
                                                        ‫ا و 2، و 5.‬          ‫ا‬   ‫ا‬    ‫ل‬  ‫،‬
‫ا و ــــــــــ 5‬                     ‫ت:‬       ‫د ض ا واع ن ا‬    ‫‪ADN‬‬          ‫ا وا د ا زو‬         ‫ا‬        ‫2: ط او‬              ‫♥او‬
                   ‫ا زو‬     ‫ا‬    ‫ا‬                            ‫ب % ‪mol‬‬      ‫ا ا ا زو‬         ‫ا‬
                                                                                                                        ‫م‬     ‫ا‬
   ‫‪A+G/C+T‬‬                ‫‪G/C‬‬             ‫‪A /T‬‬          ‫‪T‬‬            ‫‪C‬‬               ‫‪G‬‬               ‫‪A‬‬
      ‫30.1‬                ‫10.1‬            ‫50.1‬         ‫4.92‬         ‫8.91‬           ‫9.91‬             ‫9.03‬                ‫ن‬     ‫ا‬
      ‫30.1‬                ‫20.1‬            ‫40.1‬         ‫3.82‬         ‫0.12‬           ‫4.12‬             ‫3.92‬                ‫وف‬        ‫ا‬
      ‫79.0‬                ‫59.0‬            ‫89.0‬         ‫3.92‬         ‫5.12‬           ‫5.02‬             ‫8.82‬                ‫ج‬     ‫ا‬

                                                                                  ‫ھذه ا درا ؟‬              ‫ف‬            ‫ن ذا‬
                                                                            ‫‪–b‬‬            ‫ج:‬             ‫ل وا‬
     ‫أن ‪ ،1 = A+G/T+C‬وذ ك ن‬       ‫‪،1 = G/C = A/T‬‬     ‫ت أن ا‬      ‫ا‬            ‫ظ‬
    ‫ن ھذا أن ‪ A‬ر ط ب ‪ ،T‬و‪ C‬ر ط‬           ‫دار ‪ A‬وي دار ‪ ،T‬و دار ‪ C‬وي دار ‪.G‬‬
                                                                              ‫ب ‪.G‬‬
                                                              ‫أ ظر ا و 3، و 5.‬
     ‫رة ن‬       ‫أ‬     ‫ز ‪،ADN‬‬          ‫ن ‪ Watson‬و ‪ ،Crick‬وذ‬     ‫3591 ا رح ا‬
        ‫ر ط‬    ‫و دات، وا‬      ‫نا‬        ‫ف ‪ .Double hélice‬ون ل و ب ن‬            ‫وب‬
      ‫و د‬     ‫ن‬     ‫ر ا ر وز ص أ‬        ‫ن طر ق ا ض ا وري وا ط ا ر ون '5‬
       ‫ا وبو‬         ‫و د ا وا ، وھ ذا إ‬     ‫ن‬    ‫ر ا ر وز ص أ‬      ‫ا ول و ا ر ون '3‬
      ‫ا و '3 -------- '5 .‬            ‫ن ر ن: '3 و '5 ، و ن م ط‬      ‫ون ھ ك‬
                    ‫ذ: و فا د‬             ‫ا‬                                               ‫: - 24 -‬                  ‫ا‬
                   ‫دا ا ط‬           ‫ل ا و ن ب أن و‬         ‫ف،‬      ‫و أن ز ‪ ADN‬و ب‬
                                         ‫دا ا وازي‬ ‫'5 . ول إن و ‪ADN‬‬ ‫'5 >---'3 و '3 >---'5‬
                             ‫وى ا وا د ا زو .‬        ‫ض، روا ط ھ درو‬          ‫ور طا و ن‬
‫ا و ــــــــــ 5‬                        ‫ور ‪ WATSON‬و ‪( CRICK‬‬       ‫ف)‬       ‫ل وب‬       ‫‪ADN‬‬        ‫وذج ز‬     ‫3:‬    ‫او‬




                   ‫ا و ــــــــــ 6‬                     ‫ت، و ‪.ADN‬‬             ‫ن، ا‬         ‫نا‬              ‫‪–V‬ا‬
   ‫لب‬       ‫ن ،ا‬     ‫ا‬        ‫لأ‬      ‫1: ا‬       ‫♥او‬                                       ‫ن.‬            ‫ا‬   ‫1‬
                         ‫:‬     ‫ا‬
                                                                     ‫ل أ ن ا و 1، و 6،‬                ‫ط ا‬
                         ‫لأ‬    ‫ا‬                                  ‫ا وا ،‬      ‫ر ا رو‬                    ‫ظ‬
                                                                    ‫ل‬     ‫وا ط أ ز ت و‬                   ‫ت‬
                                                                                                     ‫ا رو ت.‬
                                                              ‫.‬        ‫ا‬     ‫رج‬      ‫ظ ا‬         ‫ن ھذه ا‬        ‫اط‬
                                                         ‫ون ن‬      ‫أ‬    ‫ن‬         ‫ر‬ ‫ظ ا‬       ‫نا‬
                                                             ‫‪ ،30nm‬و‬      ‫طر ا وا د‬   ‫،‬        ‫طت‬
                                                        ‫ھذه ا ط ت ط ت وو ‪. Les nucléofilaments‬‬
                                                       ‫ت ا درا ت أن ا ط ا ووي ون ن ز ‪ADN‬‬
                                                           ‫وزو ت‬       ‫ول ت ن ا رو ت، و‬            ‫و‬
                                                       ‫ھذه ا رو ت : ھ و ت‬            ‫‪،Nucléosomes‬‬
                                                                                        ‫‪.Les histones‬‬
                    ‫ذ: و فا د‬                ‫ا‬                                        ‫: - 34 -‬       ‫ا‬
                                              ‫6.‬       ‫1،و‬         ‫ل ب ن او‬     ‫ت. أ ظر ا‬               ‫ا‬        ‫2‬
                      ‫ا و ــــــــــ 6‬
                          ‫لب‬      ‫ا‬                          ‫،‬        ‫ت سا ر با‬                  ‫ن وا‬            ‫إن‬
                                                                    ‫ن‬   ‫ون رك ن ا‬                ‫ر ‪ADN‬‬           ‫إذ‬
                                                                                                    ‫ت:‬           ‫وا‬

                                                                 ‫و ت،‬    ‫ط ‪ ADN‬ول ھ‬        ‫• ف ل‬
                                                                                      ‫ل ط ووي.‬
                                                                   ‫• و ب ا ط ت ا وو و ط ،‬
                                                                                          ‫ن.‬     ‫لا‬
                                                                 ‫ر،‬   ‫ا م ر‬            ‫• د د ول ا‬
                                                                  ‫، ظر‬      ‫زداد و ب ا ط ا ووي ول‬
                                                                 ‫ھذا ا و ب د دا و و ،‬        ‫ت. و‬       ‫ا‬
                                                                    ‫ت‬     ‫لا‬      ‫ا ر ا وا ،‬
                                                                                              ‫.‬    ‫د وا‬
                                                                      ‫م م إزا و ب‬        ‫ا‬          ‫•‬
                                                                        ‫ت، ود إ‬            ‫ا ط ت ا وو‬
                                                                                                ‫ن.‬      ‫ا‬

                                                        ‫ت، و ‪.ADN‬‬              ‫ن، ا‬         ‫نا‬                 ‫3ا‬
    ‫أن‬       ‫.‬  ‫ن، وا س‬         ‫ا‬   ‫ت،‬    ‫د ظ را‬    ‫م ا وي، أ‬                                     ‫ظ لا‬
         ‫را‬   ‫ن‬    ‫إذن‬      ‫) ‪ + ADN‬ھ و ت (،‬     ‫ت سا ر با‬                                          ‫ن وا‬
            ‫و ب ا ط ا ووي، وذ ك ب را ل ا دورة ا و .‬    ‫ب در‬                                        ‫وا دا، ر‬

                                                                   ‫ز ‪.ADN‬‬                           ‫‪ – VI‬آ‬
                               ‫1، و 6.‬     ‫ط 5،و‬            ‫ز ‪ .ADN‬أ ظر‬                          ‫1ا ف ن‬
‫ا و ــــــــــ 6‬  ‫ا ر ا ورا :‬      ‫ظ‬         ‫‪ ADN‬و‬                                 ‫ال‬       ‫5 ط5‬
    ‫ر ا ورا ، و ل ن ل ر‬          ‫ت وا ل ا‬                                          ‫ر ال ‪ ADN‬ا ون ا‬
     ‫ن‬ ‫ا ر ا ورا‬ ‫نا ظ‬         ‫ر. د م ا ت ا‬       ‫را‬                                  ‫م ا وي‬  ‫وا ط ا‬
                                     ‫:‬   ‫درا ا و ق ا‬                               ‫رى، وم‬    ‫دورة و‬

                    ‫و ن‬      ‫ل دور ن‬      ‫ن‬        ‫إ‬         ‫‪ ADN‬ا و ودة‬           ‫رة‬        ‫1: ت‬              ‫♥ او‬
                                                                          ‫او 1.‬                              ‫ا‬     ‫ا‬
    ‫را ل:‬          ‫ا ر‬         ‫. م دد ا دة ا ز‬         ‫او‬     ‫روف‬      ‫م ا را ل ا ر إ‬                       ‫1(‬
                                                                               ‫‪ ،I‬و‪ ، C‬و ‪.M‬‬
                                ‫ل ا دورة ا و ؟‬                  ‫‪ ADN‬ا‬        ‫ف طور‬          ‫2(‬
          ‫ا دورة ا و‬        ‫، ، ، ...، (، ر‬                  ‫أ ب ل ل ن أ ل او )‬             ‫3(‬
                                                                  ‫) 1‪.( M,G2,S,G‬‬       ‫ا ط‬
‫.‬   ‫ف را ل ا دورة ا و‬                         ‫و لا‬            ‫‪ ADN‬ا‬        ‫ن‬      ‫نا‬        ‫4(‬

                   ‫ذ: و فا د‬          ‫ا‬                                               ‫: - 44 -‬      ‫ا‬
                  ‫)‪[ADN] (u.a‬‬                                ‫و ن‬      ‫ل دور ن‬       ‫ن‬   ‫إ‬     ‫‪ ADN‬ا و ودة‬               ‫رة‬
         ‫61‬
                     ‫و دات ا ط‬                  ‫‪M‬‬
                                      ‫2‪G‬‬
         ‫‪2q‬‬

         ‫21‬
                          ‫‪S‬‬
                                                                   ‫‪S‬‬
         ‫01‬
                                                             ‫1‪G‬‬
                  ‫1‪G‬‬
         ‫‪q‬‬


          ‫4‬

          ‫2‬
                              ‫‪I‬‬
                                  ‫‪C‬‬                                                                               ‫ا ز ن )‪(h‬‬
          ‫0‬
              ‫0‬                   ‫5‬                     ‫01‬                ‫51‬                  ‫02‬                    ‫52‬




            ‫ت، و ون ن ث رات ھ :‬       ‫ا را ل: ‪ = I‬ر ا ون، دوم 8‬                                                                   ‫1(‬
‫.‬        ‫ف. 2‪ = G‬رة ا و ا‬  ‫1‪ = G‬رة ا و ا و ، ‪ = S‬رة ا ر ب / ا‬
                               ‫ن.‬      ‫ر، و دوم‬ ‫م را‬     ‫‪=M‬ا‬
                            ‫ت.‬    ‫‪ = M+I = C‬دورة و ، و دوم 01‬
                    ‫ا وا :‬      ‫ل ا دورة ا و‬     ‫واة ا‬  ‫‪ADN‬‬     ‫ر‬                                                                 ‫2(‬

    ‫ل‬        ‫ف‬‫‪،q‬‬    ‫رة ا‬     ‫‪ADN‬‬          ‫ل ا رة 1‪ G‬ن ر ا ون‬
         ‫‪ 2q‬ل ا رة 2‪.G‬‬      ‫رة ا‬          ‫‪.2q‬‬    ‫‪q‬إ ا‬   ‫ا رة ‪ S‬و ر ن ا‬
  ‫‪ ،q‬ث أ‬      ‫‪ 2q‬إ ا‬   ‫‪ ،ADN‬ر ن ا‬         ‫ض‬     ‫ر،‬  ‫م را‬      ‫لا‬
           ‫‪ ،2q‬و ا ر ا‬     ‫رة ا‬       ‫‪ADN‬‬      ‫ل ا ر ا د وا وا ،‬
                                     ‫‪.q‬‬    ‫رة ا‬    ‫‪ADN‬‬           ‫،‬      ‫وا‬
‫ل‬    ‫ب ر 1‪ ،G‬ا ل 4. و ر ‪ ،S‬ا ل 1. و ر 2‪ ،G‬ا ل 2. أ ا‬                  ‫3(‬
    ‫ر، ) 3 ر ا د ، 5 ر‬           ‫م را‬   ‫ب ا ر ‪ ،M‬أي ا‬     ‫3، 5، 6، 7،‬
                              ‫(.‬    ‫، 6 ر ا وا ، 7 ر ا‬               ‫ا‬

                                                                           ‫ن ر ن:‬                 ‫ون ا دورة ا و‬                   ‫4(‬
             ‫ف ‪ADN‬‬                    ‫،و‬        ‫واة ا‬        ‫‪ADN‬‬            ‫ف‬                      ‫ر ا ون،‬
                                                                                                                             ‫ف‬
                                                                 ‫ن.‬             ‫ن‬     ‫و‬              ‫ل‬              ‫ث‬
        ‫وى ا زيء ا ر زي،‬                         ‫ت‬            ‫طر ا‬                  ‫ر،‬       ‫را‬     ‫م‬         ‫ا‬     ‫ر‬
                                                                                                                              ‫ل‬
                   ‫‪ q‬ن ‪.ADN‬‬                 ‫ا‬        ‫وي ل وا دة‬            ‫ت،‬               ‫ن نا‬          ‫ن‬         ‫و‬

     ‫‪ ،2q‬أ ء رة‬                   ‫ا‬       ‫لإ‬   ‫،‬   ‫ور‬   ‫‪ ADN‬ا‬     ‫ف‬                                      ‫ن ن ھذا أن ا‬
    ‫م ر‬                           ‫ا‬        ‫‪q‬أ ءا ر‬    ‫ا‬    ‫‪ ADN‬إ ا‬                                 ‫ا ون، م ود د ذ ك‬
                                                                                                                  ‫ر.‬  ‫ا‬
                   ‫ذ: و فا د‬          ‫ا‬                                                            ‫: - 54 -‬             ‫ا‬
                                                                                                                     ‫‪.ADN‬‬                             ‫2آ‬
                                                                   ‫7.‬       ‫2، و‬        ‫ر ‪ Meselson‬و ‪ .Stahl‬أ ظر ا و‬                        ‫أ–‬
‫ا و ــــــــــ 7‬
                                                                                        ‫2 : ر ‪ Meselson‬و ‪Stahl‬‬       ‫♥او‬
   ‫ل‬     ‫ذرات ا زوت ا‬                   ‫وي‬           ‫ا ذ ‪ ، centrifugation‬ن ‪ Meselson‬و ‪ Stahl‬ن زل ز ت ‪ADN‬‬           ‫وا ط‬
                    ‫2:‬                   ‫او‬           ‫ھو ن‬   ‫ذرات ا زوت ا ف ‪. 14N‬‬     ‫وي‬     ‫وا‬     ‫‪ 15N‬ن ز ت ‪ ADN‬ا‬
                                                                    ‫ر ‪ Meselson‬و ‪ Stahl‬؟‬         ‫ل‬  ‫ن ل‬          ‫1( ذا‬
                 ‫ر .‬      ‫ا‬         ‫ر‬               ‫ز ‪ ،ADN‬د‬       ‫ا ز‬     ‫ر اط‬     ‫ل ر وم ط ط‬      ‫ت‬      ‫2( ر م ھذه ا‬
             ‫ر‬    ‫زرع ا‬                                        ‫ل‬    ‫ا ذ‬    ‫ع ‪ADN‬‬             ‫إ‬                                               ‫ل1 :‬      ‫ا‬
                                                                      ‫دا ل ول ذي‬              ‫84‬

                                                                                                                   ‫017,1 = ‪d‬‬
                                         ‫ر ت‬




           ‫وي‬           ‫و ط‬
                                         ‫زل ‪ ADN‬ا‬




        ‫51‬
       ‫ل )‪( N‬‬          ‫ا زوت ا‬                                                                                                             ‫427,1 = ‪d‬‬


                                                      ‫41‬
                                                       ‫‪ ADN‬ب ‪N‬‬                                                                       ‫‪100% ADN‬‬
                                                                                                         ‫‪100% ADN‬‬
                                                       ‫‪ ADN‬ھ ن‬                                              ‫ف‬                           ‫ل‬
                                                      ‫51‬
         ‫و ط دي وي‬                                     ‫‪ ADN‬ب ‪N‬‬                                              ‫ز ت نا‬         ‫ر د ز ت ‪ ADN‬وا ط‬
        ‫41‬
       ‫ا زوت ا ف )‪( N‬‬                                                                                                          ‫وق ا‬
                                                                              ‫رب ‪ Meselson‬و ‪stahl‬‬               ‫و‬      ‫ر‬        ‫ل 2 : ا رو و ول ا‬      ‫ا‬

                                                     ‫زرع ل دورة و‬                                                      ‫زرع و ط‬
                                                    ‫وا دة و ط وي‬                                                     ‫ا زوت‬    ‫وي‬
                                                     ‫ا زوت )‪(14N‬‬                                                          ‫)‪(14N‬‬
                                                                                             ‫1‪G‬‬
                                                                                                                     ‫2‪G‬‬                          ‫3‪G‬‬

          ‫و ط‬    ‫ر‬                ‫زرع‬
       ‫ا زوت )‪(15N‬‬                ‫وي‬

                                                                                             ‫1‪G‬‬
                                                                                                                     ‫2‪G‬‬


                              ‫ا‬
                       ‫0‪G‬‬
                                                                                             ‫1‪G‬‬


                                                                                ‫ر ت‬     ‫زل ‪ ADN‬ا‬

                                                                    ‫ول ذي‬      ‫دا ل‬      ‫ل 84‬      ‫ا ذ‬      ‫ع ‪ADN‬‬          ‫إ‬

                        ‫ا زوت ا ل‬     ‫و ط وي‬           ‫0‪= G‬‬
             ‫0‪G‬‬                                         ‫51‬                              ‫1‪G‬‬                    ‫2‪G‬‬
                        ‫ن‬     ‫ر ا ل ا ول ا‬   ‫)‪= G1 ---- ( N‬‬                                                                                 ‫3‪G‬‬
                         ‫ا زوت ا ف‬      ‫0‪ G‬و ط وي‬           ‫ا‬
                                         ‫41‬
                                       ‫)‪.( N‬‬
                          ‫ن 1‪ G‬و ط وي‬              ‫2‪ = G‬ا ل ا‬
                                                  ‫41‬
                        ‫ن‬    ‫ا زوت )‪ =G3 ------- ( N‬ا ل ا ث‬                                                          ‫017,1 = ‪d‬‬
                          ‫41‬
                       ‫ا زوت )‪. ( N‬‬      ‫2‪ G‬و ط وي‬            ‫ا‬
                                                                            ‫717,1 = ‪d‬‬                                ‫717,1 = ‪d‬‬

                    ‫427,1 = ‪d‬‬



                                                                                  ‫‪100% ADN‬‬               ‫‪ 1/2 ADN‬ھ ن‬
                                                                                                         ‫‪ 1/2 ADN‬ف‬                          ‫??‬
                                                                                     ‫ھ ن‬

                              ‫ذ: و فا د‬                    ‫ا‬                                                                   ‫: - 64 -‬     ‫ا‬
                                                            ‫أن :‬   ‫ط تا ر‬        ‫ن نا‬              ‫1(‬

        ‫و ط ن ‪ ADN‬ا ل )427.1( و‬        ‫717.1= )‪) d(ADN‬‬                         ‫ا ل 1‪ : G‬ل ا‬
                   ‫ا ف ) 017.1 ( وا ر ھذا ا ـ ‪ ADN‬ھ .‬                                  ‫‪ADN‬‬
                     ‫‪ ADN‬ھ ن و % 05 ‪ AND‬ف.‬                                ‫ا ل 2‪ 50% : G‬ن ا‬
                     ‫‪ ADN‬ھ ن و % 57 ‪ AND‬ف.‬                                ‫ا ل 3‪ 25% : G‬ن ا‬

        ‫ر ون‬     ‫رھ إ‬     ‫ن‬   ‫‪ ADN‬ا ل ا ول 1‪G‬‬     ‫و‬     ‫، ن‬   ‫ھذه ا‬  ‫ءا‬
                     ‫51‬                ‫41‬
                    ‫‪. N‬‬     ‫‪ N‬وا ف ا ر‬        ‫ف ز ‪ ADN‬ا ل ا ول و ر‬
          ‫ر ون ف ا ز ت ط ق‬        ‫رھ إ‬    ‫ن‬    ‫2‪G‬‬     ‫‪ ADN‬ا ل ا‬     ‫و و‬
                        ‫41‬
                   ‫ط.‬     ‫‪N‬‬    ‫ورإ‬     ‫‪ ADN‬ا ل ا ول، وا ف ا ر ن ا ز ت‬

                                                                              ‫2( أ ظر ا ر م :‬
                    ‫3‪G‬‬                     ‫2‪G‬‬

      ‫ھ ن‬
                                                                   ‫1‪G‬‬                         ‫0‪G‬‬
   ‫ف‬




      ‫ھ ن‬

                                                              ‫001 % ھ ن‬               ‫ل‬       ‫001 %‬
   ‫ف‬




    ‫ف‬       ‫52 % ھ ن + 57 %‬        ‫ف‬   ‫05 % ھ ن + 05 %‬


                                                ‫8.‬   ‫3، و‬    ‫ر ‪ .Taylor‬أ ظر ا و‬       ‫ب–‬

‫ا و ــــــــــ 8‬                                                        ‫3 : ر ‪Taylor‬‬               ‫♥ او‬

     ‫ر وم ³‪ ، H‬وھو‬         ‫م‬   ‫دن‬      ‫ا‬    ‫وي‬   ‫ذور ت ‪Bellevalia‬‬
                                                     ‫و ط‬                             ‫‪Taylor‬‬        ‫و‬
                                                        ‫ط درو ن.‬                     ‫ا‬        ‫ظرإ‬
‫و ط‬           ‫وو‬      ‫ت ) دة طور ا ون (، أ رج ‪ Taylor‬ھذه ا ذور م‬                       ‫و د رور 8‬
  ‫ت‬        ‫ا ذا وذ ك أ ء ا‬       ‫ورا‬      ‫(، و ا د ج ا د ن‬        ‫ر‬                   ‫د)‬            ‫ا‬
    ‫نا‬      ‫دة ا و‬       ‫ول ا‬    ‫ت، أ ف ‪taylor‬‬        ‫ظ ا‬     ‫ل‬     ‫ل‬                 ‫ا و ،و نأ‬
        ‫او 3 :‬             ‫ا‬   ‫ا‬    ‫ل‬     ‫ا طور ا وا .‬          ‫ت‬                       ‫ا راق ا‬
                               ‫ن ھذه ا ر .‬        ‫وظ ف ا د ن وا و‬                       ‫1( ن أھ‬
                                                          ‫ھذه ا ر .‬                      ‫ف‬      ‫2(‬
‫ون ن ز ‪ ADN‬وا دة.‬                 ‫ھذه ا ر ، ا م أن ل‬         ‫ط ر وم‬                   ‫ر وا‬      ‫3(‬




                   ‫ذ: و فا د‬   ‫ا‬                                          ‫: - 74 -‬        ‫ا‬
                                                           ‫ا ــــــــــــــــــ 3‬
                                                                         ‫ت و‬             ‫ا‬
 ‫ل‬                 ‫و‬            ‫و‬   ‫ت‬         ‫ا‬                                                         ‫د‬   ‫ت‬       ‫ا‬
                                                             ‫دورة‬             ‫ل ة‬              ‫و‬
                          ‫دور‬           ‫ة ز‬                                                                  ‫م‬          ‫ا‬




         ‫ر د‬                        ‫دة ازو ، و م ا‬               ‫ن‬       ‫د ن ون ـ ‪،ADN‬‬
                                                                         ‫ا‬          ‫وي‬                                       ‫ا‬  ‫1(‬
                                                                           ‫ز ‪.ADN‬‬                                             ‫إد‬
     ‫ت د‬                 ‫ث ون ا‬         ‫وا ،‬          ‫ا‬     ‫ر ا ر‬   ‫م را‬    ‫ن دة و ف ا‬                                       ‫ا و‬
                                                  ‫.‬           ‫ظ و دد ط ا‬      ‫ن ن‬      ‫،‬                                      ‫وا‬

              ‫.‬           ‫ط إ‬        ‫ظر‬              ‫ظ أن ل ا‬    ‫،‬  ‫دنا‬                                 ‫رة د ا‬      ‫2(‬
         ‫،‬         ‫ون‬               ‫ا‬             ‫ظ أن أ د‬    ‫ل دورة و ،‬                             ‫نا‬      ‫د دة ز‬
                                                                                                      ‫.‬    ‫وا ر ر‬
      ‫ف‬           ‫، وا‬      ‫ر‬       ‫ت ون‬                   ‫ظ أن ف ا‬                 ‫و ن،‬       ‫ل دور ن‬       ‫د دة ز‬
                                                          ‫.‬    ‫ت ر‬                    ‫و‬         ‫ت‬       ‫ا ر ون ن‬

‫ل،‬           ‫وب‬         ‫ون ل و ب ن و ‪ ،ADN‬ل ب د‬    ‫ر‬                                                ‫ھذه ا‬      ‫ر‬        ‫3(‬
     ‫م‬                ‫ن ز ‪ ADN‬ا ل. و ظ أ أ ء ا‬   ‫ز ن‬                                                  ‫ون‬
                  ‫ظ. ‪Semi‬‬   ‫، ذك م ن ا ر ب ا ف‬ ‫ل ز أ‬                                                ‫ف‬          ‫ظ‬       ‫ا‬
                                                    ‫م.‬                                              ‫‪.conservatif‬أ ظر ا ر‬

                                                                                             ‫ر ‪Taylor‬‬          ‫ري‬           ‫ر م‬




                    ‫ذ: و فا د‬           ‫ا‬                                                           ‫: - 84 -‬        ‫ا‬
                                ‫8.‬    ‫4، و‬           ‫‪ .ADN‬أ ظر ا و‬                        ‫ز‬      ‫ظ‬               ‫ف‬     ‫فا‬              ‫ج–ا‬
‫ا و ــــــــــ 8‬
                         ‫ل 4:‬   ‫ا‬                                                             ‫ل 2:‬       ‫ا‬                              ‫ا ل 1:‬
                                                                  ‫‪ ADN‬ا‬           ‫ز‬
           ‫‪ ADN‬ا‬         ‫ز‬                                                                                                       ‫ظ ا رو را‬
                                                                 ‫‪C‬‬    ‫‪G‬‬                                                             ‫ر ا ون.‬
            ‫‪G‬‬        ‫‪C‬‬
                                                                  ‫‪T‬‬   ‫‪A‬‬
            ‫‪A‬‬        ‫‪T‬‬
            ‫‪C‬‬        ‫‪G‬‬                                           ‫‪G‬‬    ‫‪C‬‬

            ‫‪A‬‬        ‫‪T‬‬                                            ‫‪T‬‬   ‫‪A‬‬
            ‫‪A‬‬        ‫‪T‬‬                                       ‫‪T‬‬            ‫‪A‬‬
            ‫‪G‬‬        ‫‪C‬‬                               ‫‪C‬‬            ‫‪ADN‬‬         ‫‪G‬‬
            ‫‪G‬‬        ‫‪C‬‬                           ‫‪C‬‬               ‫و راز‬                ‫‪G‬‬
                                                             ‫‪G‬‬            ‫‪C‬‬
            ‫‪T‬‬        ‫‪A‬‬                       ‫‪A‬‬                                            ‫‪T‬‬
                                                         ‫‪T‬‬                    ‫‪A‬‬
            ‫‪A‬‬        ‫‪T‬‬
                                             ‫‪T‬‬       ‫‪A‬‬                            ‫‪T‬‬       ‫‪A‬‬



                                                             ‫وب دد‬
            ‫‪T‬‬        ‫‪A‬‬
                                             ‫‪A‬‬       ‫‪T‬‬                        ‫‪A‬‬           ‫‪T‬‬
            ‫‪C‬‬        ‫‪G‬‬
                                             ‫‪G‬‬       ‫‪C‬‬                        ‫‪G‬‬           ‫‪C‬‬



                                                                                                                                           ‫ل3:‬   ‫ا‬
                                     ‫‪ADN‬‬   ‫ز‬                                           ‫‪ADN‬‬           ‫ز‬                  ‫‪ ADN‬ا‬



                                                                                                                                ‫ون ا‬


                                                                                      ‫زيء ر زي‬
            ‫‪G‬‬       ‫‪C‬‬
            ‫‪T‬‬       ‫‪A‬‬
            ‫‪A‬‬       ‫‪T‬‬
            ‫‪T‬‬       ‫‪A‬‬
            ‫‪C‬‬       ‫‪G‬‬
                                                                                                                                  ‫+‬


     ‫ن‬     ‫ن ‪ADN‬‬         ‫ز‬
                                                                                                                         ‫‪ ADN‬ا د د‬


                   ‫و دات رة، وأ ز ت، وط . و م ا ر ب ا‬                                         ‫،و‬             ‫أ‬    ‫ط ب ر ب ‪ ADN‬ز‬
                                                                                                                 ‫ا لا :‬    ‫ـ‪ADN‬‬
     ‫ن‬      ‫ا را ط‬   ‫ل ا روا ط ا درو‬                             ‫ن،‬      ‫ت ر أ ز م ص، م ر ق ا و ن ا‬
               ‫) ا ل 1 (.‬    ‫ل ون ا‬                                   ‫ا وا د ا زو ، و ذ ك ظ ر طق ا راق ا و ن‬
         ‫ل ل رط دم‬       ‫ث‬                   ‫و دات ت ر أ ز م ‪ ADN‬و راز،‬          ‫رة در‬
         ‫ك ا وا دة ا و ب‬                      ‫ل ا وا د ا زو‬ ‫د ر ط د د، وذ ك ا رام‬    ‫وذج‬
                                                     ‫ـ ‪.ADN‬‬   ‫ا ز‬  ‫، )ا ل2(، م ن ا‬       ‫ا‬
       ‫ؤدي إ‬  ‫، )ا ل3(‬  ‫وى ن ا‬           ‫ھن‬    ‫ما ط ا رطنا ددن ا‬
      ‫ز ن ن ن ‪ ،ADN‬ل وا دة ون ن‬             ‫ول‬   ‫ا ض ما‬    ‫م‬     ‫،‬     ‫ا‬
                         ‫ر ط د د. ) ا ل 4 (‬    ‫،‬    ‫نا ز ا‬ ‫ر ط د م، ور‬



                    ‫ذ: و فا د‬         ‫ا‬                                                                              ‫: - 94 -‬          ‫ا‬
                                                 ‫:‬         ‫لا‬       ‫ا‬
                                         ‫ﺗﻌﺒﻴﺮ اﻟﺨﺒﺮ اﻟﻮاﺛﻲ‬
                                                                                                              ‫د:‬
    ‫ب‬      ‫ن ا دة ا ورا )‪ ،(ADN‬وظ ور أو‬   ‫رب ‪ GRIFFITH‬ن أن‬                                            ‫ن ل درا‬
           ‫ظ‬            ‫ت ورا‬    ‫م ‪ ADN‬ظ ور‬    ‫؟و ف‬    ‫ھ ھذه ا‬                                          ‫.‬
                                                                                                          ‫وا س؟‬

                                                          ‫ل، وا ط رة.‬             ‫، ا ور ، ا‬          ‫وم ا‬              ‫‪–Ι‬‬
                                                                                     ‫ا ورا .‬           ‫وم ا‬
           ‫ل.‬  ‫أ راد و ، و ل ر ا‬    ‫، ز ردا ن‬        ‫زة و أو‬     ‫ا ورا ھ‬   ‫ا‬
           ‫رز أ رى إ وا ط‬ ‫ن‬      ‫(،‬   ‫ن ا ردة ) ون ا زھ ر‬    ‫ظ‬    ‫ت‬     ‫ضا‬
                                      ‫(.‬     ‫اد و‬       ‫)ا‬     ‫ل‬    ‫ا رات أو‬

                                                                   ‫.‬         ‫وا‬     ‫ر ا ورا‬    ‫نا‬                   ‫ا‬
                                                                       ‫ط 1، و 1.‬         ‫رب. أ ظر‬           ‫أ –‬
‫ا و ــــــــــ 1‬                                               ‫ل، وا ط رة.‬    ‫، ا ور ، ا‬       ‫وم ا‬         ‫ط1‬
                                             ‫.‬       ‫ت ا ورا‬    ‫ا ل ضا‬              ‫ول‬   ‫ن‬      ‫لا ر نا‬                 ‫ن‬
                                                                                                       ‫♥ا ر 1:‬
    ‫ل ر ‪ .Echerichia-Coli‬إذا ت ا ظروف‬     ‫رة ز‬     ‫دورة و‬       ‫ا‬    ‫تا‬      ‫ر إ دى ا‬
        ‫رة ر )‪ (colonie‬د ا )‪ ،(clone‬ون ا ر‬                   ‫ل‬      ‫م ھذه ا ر‬
          ‫و ط أد ) أ ح د + راء + ر ( =‬         ‫ص وا ط ت. و د وا د ھذه ا ر‬            ‫سا‬
      ‫د ا وي‬    ‫ا‬     ‫ا ش وا ر و ط وي‬          ‫ر درة‬       ‫)‪.(M.m‬و ن زات ھذه ا ر أ‬
     ‫د ا وي ر ز‬     ‫ذا ا‬      ‫ر و ن ‪ ،Streptomycine‬ث ر‬                 ‫)‪ (Antibiotique‬ا‬
                                                                              ‫ـ ‪.Strep S‬‬
          ‫ھو ن‬           ‫( إ أو ط‬   ‫)‬     ‫و ط دون ر و ن، م‬            ‫د زرع ھذه ا ر‬
                                                                                  ‫ا و 1:‬
                                                 ‫.‬    ‫ن ھذه ا ط ت، أ ط ر‬           ‫1( ا ط‬
                                 ‫؟‬  ‫ل ا ذي طر ھذه ا‬    ‫2( ف ھذه ا ر ، م دد ھو ا‬
                                                          ‫ھذه ا ر .‬       ‫را‬    ‫3( ا رح‬

                                                                                                               ‫1:‬        ‫او‬
                                                                                     ‫ر ‪Strep S‬‬
                                                                              ‫ن‬     ‫و ط ‪ Mm‬دون ر و‬
                                                                  ‫ري‬                                    ‫ر‬      ‫رة‬


‫ن‬    ‫ر و‬           ‫‪+ Mm‬‬        ‫ن‬       ‫ر و‬   ‫‪+ Mm‬‬                                        ‫ل‬


                                                                        ‫‪Mm‬‬                      ‫ن‬      ‫ر و‬         ‫‪+ Mm‬‬

         ‫‪Mm‬‬                              ‫‪Mm‬‬
                   ‫ذ: و فا د‬       ‫ا‬                                                     ‫: - 05 -‬       ‫ا‬
                                                                                          ‫♥ا ر 2:‬
       ‫اا وز )‪.(Lactose‬و ط ب ھذه‬                 ‫وي‬        ‫ا ش و ط‬         ‫ر ‪ Strep s‬ر درة‬
 ‫ر ز إ ب ) - ‪.(Strep s , Lac‬‬    ‫ر‬              ‫ا ر ھذا ا ر ش و ذا ر ز إ ب )- ‪ ، (Lac‬ادن ھذه ا‬
   ‫أ واع أ رى وا ھ : , ‪(Strep r‬‬                      ‫ر ا ذ ورة‬             ‫ل‬         ‫ھذه ا رب‬       ‫إذا‬
                                                   ‫) - ‪. ( Strep s , Lac + ) ,(Strep r , Lac + ) ، Lac‬‬

                                                                   ‫ل ط تا ر 2؟‬    ‫ن‬                        ‫4( ذا‬
           ‫ل‬       ‫وم ا‬    ‫وم ا ور ‪ Le gène‬و‬      ‫ص‬           ‫ز ‪ ADN‬م ا‬    ‫ا ر نو‬                      ‫5( ار ط ن‬
                                                                                                    ‫‪. L’allèle‬‬

                                                                                  ‫ج.‬         ‫ل وا‬           ‫ب–‬
                          ‫ت.‬     ‫ن ا راد م س ا ر ا ورا ، و ن م س ا‬                       ‫و‬          ‫ھ‬        ‫ا‬    ‫1(‬

             ‫ر د و ود ا ر و ن )‪ ،(Strep S‬ن ظ ر‬        ‫ظ أن ا ر‬   ‫2(‬
      ‫)‪.(Strep R‬‬           ‫ر و ن، ط‬       ‫ر ت أ رى ھذا ا و ط، و‬
                 ‫ت ا ر ‪ Strep S‬ر ‪ Strep R‬؟‬     ‫ل ا طروح ھو ف أ‬  ‫ا‬

    ‫ھو‬             ‫م‬       ‫‪ Strep R‬دورھ ورا ، ن ا‬              ‫أن ا‬
                                                                 ‫‪ Strep S‬ورا ، وا‬
                                                                       ‫3(‬
                                                                  ‫‪.ADN‬‬
                ‫دوث ر‬   ‫ر ‪ Strep R‬إ‬     ‫ر ول ا ر ‪ Strep S‬إ‬    ‫ن ادن‬
      ‫ر‬        ‫ھذا ا ر ط رة ‪ ،Mutation‬ول أن ا ر ‪Strep R‬‬   ‫وى ‪ ،ADN‬و‬
                                    ‫ر و .‬          ‫ط رة أ ا ر ‪Strep S‬‬

                                                ‫ن:‬       ‫ظ ھذه ا ر‬          ‫4(‬
   ‫ن، ا ل ا و ش ‪ ،Strep S‬وا ط ر ‪.Strep R‬‬        ‫ر و ن: و ظ ر‬             ‫ا‬
              ‫+‬                   ‫-‬
          ‫ن، ا ل ا و ش ‪ ،Lac‬وا ل ا ط ر ‪.Lac‬‬           ‫وز: و ظ ر‬          ‫ا‬
                                     ‫+‬
                     ‫ن ھ : ) ‪.( Strep S, Lac‬‬                 ‫ا و‬       ‫وھ ذا‬
                                           ‫-‬
                            ‫ن ھ : ) ‪.( Strep R, Lac‬‬             ‫ا ط رة‬     ‫وا‬
  ‫ا رى، و ن‬      ‫رورة ظ ور ط رة ا‬        ‫ر ر ط‬              ‫ظ أن ظ ور ط رة‬
                            ‫ن.‬      ‫ن‬    ‫ن ا‬         ‫‪ ADN‬ا‬      ‫ر ذك ن ط‬

          ‫، ذا‬            ‫وى ا‬           ‫ر‬   ‫وى ا دة ا ورا ‪ ADN‬أدى إ‬                         ‫ر‬      ‫أن ا‬        ‫5(‬
                                        ‫ور ‪.Gène‬‬      ‫زء ص ن ‪،ADN‬‬                                           ‫أن ل‬

                                                      ‫.‬         ‫ور – رو ن / رو ن -‬                                ‫ا‬
                                   ‫ط 2، و 1.‬      ‫ر ‪ :Beadle et Tatum‬أ ظر‬                    ‫ل أول :‬         ‫أ–‬
‫ا و ــــــــــ 1‬                                                              ‫– رو ن – ور‬         ‫ط2ا‬
                                                          ‫:‬     ‫ط تا‬   ‫را‬      ‫ا‬    ‫ل‬     ‫د ا ف ن ھذه ا‬

                                                                                       ‫ر ‪ Beadle‬و ‪Tatum‬‬                ‫♥‬

          ‫ش‬   ‫أن‬    ‫ا و‬    ‫ا ز. ن‬      ‫ل زل طري، و دة‬                        ‫ري‬     ‫ا ورو ورا ‪ Neurospora‬ن‬
              ‫ا ش ھذا ا و ط.‬    ‫ط رة ر درة‬    ‫و د‬    ‫و وم.‬                  ‫ر+ ء+أ حا‬          ‫وي‬      ‫و ط أد‬
     ‫ظ أن ھذه‬    ‫ا ر و ن ‪L’acide aminé Tryptophane‬‬    ‫ضأ‬                    ‫ا ط رة و ط أد + ا‬      ‫وم زرع ا‬
                                                    ‫ط و ده.‬                 ‫ا ش وا ر ھذا ا و‬      ‫درة‬        ‫ا‬
                                                                                   ‫ن ھذه ا ر ؟‬      ‫1( ذا‬
                       ‫ذ: و فا د‬    ‫ا‬                                                  ‫: - 15 -‬         ‫ا‬
                                                    ‫:‬                        ‫ن‬   ‫،‬      ‫تا ز‬               ‫نا‬            ‫ر‬         ‫م ر با ر و ن‬

                                                                                                                                       ‫أ ح ا و وم‬
    ‫ر و ن‬                                ‫أ دول‬                               ‫ض أ را ك‬                                                   ‫)و ط أد (‬
 ‫‪Tryptophane‬‬                  ‫‪ Indole‬أ ز م 3‪E‬‬               ‫أ ز م 2‪E‬‬         ‫‪Antranilique‬‬                  ‫أ ز م 1‪E‬‬


                ‫ر؟‬      ‫شو‬            ‫او ط‬    ‫ك‬     ‫ض أ را‬          ‫و ود‬             ‫ت ا ط رة‬        ‫ت أن ض ا‬                ‫ص إذا‬              ‫2( ذا‬


      ‫ون ن أ ح‬    ‫ر ب ا ر و ن و ط أد‬          ‫ا ط رة ر درة‬          ‫ظ أن ا‬  ‫1(‬
                                          ‫-‬
     ‫ر ذا ا ر ب ر و ن‬         ‫ب ‪ ،Try‬و ول أ‬         ‫ا و وم ط. ذا ر ز ذه ا‬
                        ‫+‬
         ‫ذا ا ر ب‬    ‫‪Try‬‬    ‫ا و‬      ‫ا‬      ‫‪.Auxotrophe pour la tryptophane‬‬
                                  ‫ر و ن ‪.Autotrophe pour la tryptophane‬‬
               ‫ن.‬      ‫ر ب رو‬      ‫درة‬    ‫ر ط‬         ‫ظ أن ا‬    ‫ن ھذه ا‬
                    ‫ض‬            ‫د د ا ول أ ح ا و وم‬                            ‫ا ط رة -‪ Try‬ر درة‬    ‫2( إن ا‬
                                                                                 ‫ا را ك. وذ ك ب ا ز م 1‪.E‬‬
   ‫ن.‬               ‫ن، وا ذي ر ط دوره ر ب أ ز‬                                ‫ر ط ر ب رو‬        ‫ص ادن أن ل‬

        ‫2‬       ‫1 و‬       ‫ط1، و‬        ‫‪ L'anémie falciforme‬ا ظر‬                                     ‫: ر ا دم ا‬                     ‫ل‬           ‫ب–‬
 ‫ا و ــــــــــ 2‬                                                                                                                              ‫1‬    ‫او‬
        ‫ل ا زات‬                  ‫ب ا د وي رو ن و د دا ل ا ر ت ا راء و دور ن، وظ‬           ‫ا‬
                             ‫إ ط ء ا ل ا روي ا ر ر ت ا راء.‬               ‫، و وي‬          ‫ا‬
 ‫ب د وي ‪ Hémoglobine‬ر دي ) وه‬                      ‫ن ر ب‬           ‫رض ا‬          ‫ر ا دم ا‬
   ‫ب ا دم ا دي ب :‬            ‫رز‬       ‫ا ل( ر ز ب ) ‪،( HbS‬‬                 ‫ا ر ت ا راء‬
                                                              ‫)‪.(HbA‬أ ظر ا و 1، ل1.‬
 ‫ل ا ر وه ظ ر‬                 ‫ب ر دواب و ر ب‬          ‫ا‬    ‫ن‬        ‫د ر ر ) ‪( HbS‬‬
    ‫ر إ داد ا ــــــــــــــ ـ‬             ‫د و و د ا رات ا د و ،‬         ‫ا ر ت ا راء ا‬
                                                                              ‫ن.‬
 ‫زء ن‬               ‫ب ا د وي‬    ‫زء ن ز ا‬           ‫ا و‬     ‫ضا‬      ‫لا‬       ‫ط ا ل2‬
                                                            ‫.‬    ‫ر‬    ‫ن‬        ‫ا ور ن ا‬
                     ‫أ رى.‬    ‫و ور ‪ HbA‬و ‪ HbS‬ن‬          ‫‪ HbA‬و ‪ HbS‬ن‬           ‫1( رن‬
                                                                       ‫؟‬       ‫2( ذا‬
                         ‫ؤول ن ر ب ‪HbA‬‬             ‫زء ا ور ا‬                          ‫ل2‬        ‫ا‬      ‫1‬        ‫او‬           ‫ل1‬        ‫ا‬
                        ‫‪G T GC A CC T T A C T CC AGAGGAG‬‬

                        ‫‪C A CG T GGA A T GAGG T C T CC T C‬‬


                                                                                 ‫‪β‬‬         ‫دا ا‬                   ‫راء‬        ‫ر ت‬
‫ب ا د وي ‪HbA‬‬            ‫‪ val his‬ا‬      ‫‪leu‬‬   ‫‪thr‬‬    ‫‪pro‬‬       ‫‪glu‬‬      ‫‪glu‬‬
                                                                                                                         ‫د‬
                           ‫1‬      ‫2‬     ‫3‬     ‫4‬         ‫5‬       ‫6‬       ‫7‬
                         ‫ؤول ن ر ب ‪HbS‬‬             ‫زء ا ور ا‬
                        ‫‪G T GC A CC T T A C T CC AG T GGAG‬‬

                        ‫‪C A CG T GGA A T GAGG T C A CC T C‬‬
                                                                                                ‫‪β‬‬      ‫ا‬
                                                                                                                  ‫راء‬        ‫ر ت‬
‫ب ا د وي ‪HbS‬‬          ‫‪ val his‬ا‬        ‫‪leu‬‬   ‫‪thr‬‬   ‫‪pro‬‬        ‫‪val‬‬   ‫‪glu‬‬                                                 ‫وھ‬
                          ‫1‬      ‫2‬     ‫3‬      ‫4‬         ‫5‬      ‫6‬       ‫7‬
                     ‫ذ: و فا د‬          ‫ا‬                                                                       ‫: - 25 -‬                   ‫ا‬
    ‫ب ا د وي ‪،HbS‬‬      ‫ب ا د وي ‪ HbA‬وا‬   ‫‪β‬‬      ‫ف او د ن ا‬        ‫نا‬    ‫1(‬
        ‫‪.HbS Val‬‬           ‫ضا‬      ‫ر م 6 ) ‪HbA ( Glu‬‬        ‫وضا ضا‬
     ‫زء‬    ‫ا وا د ا زو‬      ‫ف ن‬      ‫زء ا ور ‪HbA‬‬      ‫ا وا د ا زو‬    ‫وأن‬
 ‫و دي ر م 71، ث م ا دال ‪ HbS A – T‬ـ ‪T‬‬        ‫ا ور ‪ ،HbS‬إذ ا دل ا زوج ا‬
                                                             ‫‪.HbA – A‬‬

          ‫ضا‬         ‫ا‬            ‫ر‬       ‫ا ور ، ر ب‬        ‫زو‬   ‫ا وا د ا‬         ‫2( إن ا دال‬
                                        ‫ن ا ور وا رو ن.‬            ‫أن ھ ك‬          ‫ا رو ن.‬
             ‫) ر‬                      ‫ر ا ظ را ر‬         ‫ؤدي إ‬   ‫ا رو ن،‬            ‫إن ل ر‬
            ‫وا رو ن.‬         ‫نا‬         ‫و ود‬    ‫راء (، ھذا دل‬     ‫لا ر تا‬         ‫ب ر‬      ‫ا‬

                                                               ‫.‬     ‫ج–‬
    ‫ب ا وا د‬     ‫ص، وأن ل ر‬           ‫ر م و ود رو ن وي، أو ط رو‬         ‫إن ل‬
       ‫دا ل‬     ‫ضا‬       ‫با‬      ‫ر‬           ‫و دات( دا ل ز ‪، ADN‬‬    ‫ا زو )ا‬
            ‫ز ‪ ،ADN‬ھو ا ذي دد ط‬        ‫و دات‬     ‫أن ر ب ا‬  ‫ا رو . وھذا‬     ‫ا‬
                                                ‫ا رو ت.‬        ‫ضا‬     ‫ور با‬
    ‫دة أ ل، ن‬          ‫ور ، و أن ا‬         ‫ورا‬         ‫م‬  ‫ل ط ن ‪ADN‬‬
                         ‫‪.Allele‬‬         ‫دة أ ل ذ ك، و ل ل‬            ‫ور ا‬
                                  ‫ر و ن دى ا ر ‪:E.coli‬‬            ‫ا‬     ‫ل:‬
                                 ‫ا ل ا و ش ‪ ، StrepS‬ا ل ا ط ر ‪.StrepR‬‬

                                          ‫ا رو ن.‬     ‫ر ا ورا : ن ا ور إ‬         ‫را‬             ‫‪ – IΙ‬آ‬
         ‫و زم.‬        ‫وى ا‬            ‫م‬   ‫ر ب ا رو ت‬       ‫ا واة، أ‬ ‫ا ور ت ط ن ‪ ،ADN‬و و‬
                                                        ‫ا ذي ب دور ا و ط ن ا واة وا و زم؟‬

                                                             ‫و زم.‬     ‫ا و ط ن ا واة وا‬
                                                                        ‫أ– ط ت ر .‬
              ‫و زم.‬      ‫ا و ط ن ا واة وا‬           ‫ط 3، و 2، دد ط‬   ‫1،‬        ‫ط ت او‬       ‫ن‬      ‫اط‬
‫ا و ــــــــــ 2‬                                                 ‫:‬   ‫ر ا ورا‬    ‫را‬      ‫ط3 آ‬

          ‫ر ب ا رو ت م دا ل ا و زم. ن ل‬                        ‫دا ل ا واة‬   ‫و‬    ‫إن ا ر ا ورا‬
         ‫ر ب‬  ‫ن ا واة و ا و زم ودورھ‬  ‫ددا‬                        ‫إ‬        ‫ر‬   ‫ظت‬     ‫ر و‬
                                                                                   ‫ا رو ت .‬

  ‫ف ن و‬      ‫‪.ARN‬‬           ‫ر ب ‪ ،ADN‬و‬          ‫ا‬   ‫ز ت رب ر‬          ‫ما‬
‫ر ا ل ا ذي ون ‪ADN‬‬          ‫ل ط ن و ن:أ‬            ‫ا ر س،‬           ‫ا ز ن‬
                                 ‫ر، و ا رو ن ا ذي ون ‪ ARN‬وردي.‬     ‫زرق ا‬
       ‫ع دا ل ا‬   ‫ظ ط ور ا‬   ‫، م‬    ‫ـ ‪ARN‬‬    ‫ون و‬        ‫ف إ و ط زرع ا‬
                                          ‫ا ل 1 و 2.‬         ‫ا‬   ‫ا‬   ‫ل‬
      ‫ب ‪ ARN‬ا ر ول.‬         ‫ا زة ـ ‪ARN‬‬       ‫ن ط ت ا ر ؟ دد ا‬         ‫ذا‬


                   ‫ذ: و فا د‬      ‫ا‬                                       ‫: - 35 -‬      ‫ا‬
                                                ‫ل2‬       ‫ا‬                                                  ‫ل1‬     ‫ا‬                ‫1:‬       ‫او‬




       ‫ر ت دة ‪15 mn‬‬             ‫ذا‬                            ‫ورة إ‬       ‫ر‬        ‫زر ت دة ‪ 15 mn‬و ود‬                    ‫ذا‬          ‫ورة إ‬
      ‫و ف و ط‬       ‫، م زر ت دة‬    ‫را‬                          ‫سا‬                           ‫ـ ‪ARN‬‬    ‫و‬
               ‫ر أ رى د‬       ‫وي‬


                                                                ‫ل وا‬      ‫ب–‬                           ‫ج.‬
              ‫ن‬     ‫،و ا ر ا‬     ‫واة ا‬  ‫ع‬     ‫ظ ا ر ا و نا ر ر زا‬
                                                    ‫ع و ا و زم.‬       ‫ا ر ا لا‬
           ‫ظ ت أن ‪ ARN‬ر ب دا ل ا واة، و ل د ذ ك إ ا و زم. وھ ذا‬     ‫ن ھذه ا‬
          ‫ن ا راض أن ا و ط ن ا ور ت ا واة، و ا رو ت ا و زم، ھو ‪ ،ARN‬ذ ك‬
                           ‫‪ ARN‬ا ر ول، و ر ز ب ‪.(ARN méssager) .ARNm‬‬

                                                                ‫2، و 3.‬               ‫. أ ظر ا و‬       ‫ق نا ر‬                  ‫ج–ا‬
‫ا و ــــــــــ 3‬
              ‫ا د‬     ‫ضا‬     ‫ا‬                            ‫‪ ARNm‬ا و وا‬
          ‫(‬     ‫رو ن )و دات ا ط‬                      ‫(‬     ‫ا و ط )و دات ا ط‬
                                                                                       ‫ا ز ج.‬      ‫ت‬    ‫ر ب ا رو‬          ‫ر‬    ‫2:‬        ‫♥او‬
 ‫4‬                                                                             ‫4‬
                                                                                        ‫وي‬          ‫د‬    ‫ت وو‬                        ‫ن‬       ‫اط‬
                                                                                     ‫ر ب‬     ‫و ز ا ز‬        ‫تا‬                     ‫ا و‬
 ‫3‬                                                                             ‫3‬
                                                                                     ‫ف ذا‬     ‫دا ‪ .ADN‬د ذ ك‬                        ‫ا رو ت،‬
                                                                                     ‫،‬   ‫ن ن ‪ ARNm‬وأ ض أ‬                            ‫ص‬        ‫ا‬
  ‫2‬                                                                            ‫2‬                          ‫ن.‬                        ‫ل ر ن‬
                                                                                     ‫‪ARNm‬‬          ‫، ط ور‬    ‫نأ‬                       ‫ط ا‬
                                                                                     ‫ا رو ت د ل‬         ‫ا د‬                        ‫ضا‬      ‫وا‬
  ‫1‬                                                                            ‫1‬
                                                                                                                                        ‫ن.‬
                                                                               ‫0‬
  ‫0‬                                                                                                          ‫ر .‬       ‫ھذه ا‬         ‫1( ف‬
      ‫0‬         ‫01‬        ‫02‬      ‫03‬       ‫04‬            ‫05‬      ‫06‬     ‫07‬
                                                                  ‫ا ز ن )‪(mn‬‬
                                                                                                                           ‫؟‬         ‫2( ذا‬
        ‫ا ن ا ول:‬                    ‫:‬ ‫ا نا‬
      ‫‪ + ARNm‬أ ض أ‬                 ‫‪ + ARNm‬أ ض أ‬




                      ‫ا د‬         ‫ضا‬             ‫ا‬               ‫، ر‬            ‫ضا‬          ‫د ل ن ـ ‪ ARNm‬وا‬ ‫1(‬
                                                                              ‫‪.ARNm‬‬              ‫ا رو ت، ا ض‬

     ‫رة ن ر ب ا رو ن وو ود ‪ ،ARNm‬أي أن‬                                                ‫ن ھذه ا ر أن ھ ك‬       ‫2(‬
              ‫وى ا واة، و ر ب ا رو ت‬                                           ‫ا و ط ن ا دة ا ورا‬    ‫‪ ARNm‬ھو‬
                                                                                               ‫وى ا و زم.‬

                      ‫ذ: و فا د‬        ‫ا‬                                                                    ‫: - 45 -‬           ‫ا‬
3 ‫ا و ــــــــــ‬                                                  .3 ‫3، و‬            ‫. أ ظر ا و‬ARN              ‫ز‬
                  . ‫ب‬      ‫ ا‬ARNm ‫ و‬HbA ‫ب ا د وي‬          ‫ن ر با‬          ‫ؤو‬    ‫زء ا ور ا‬            ‫ا‬    ‫ط او‬           :3           ‫♥او‬
                                                                                                    .‫ن‬   ‫رن ا ز‬

              G T GC A C C T T A C T C C A G A GG A G                   G UG C A C C U U A C U C C A G A GG A G

              C A CG T GG A A T GA GG T C T C C T C                 HbA ‫ؤول ن ر ب‬              ‫ ا‬ADN ‫ب ـ‬       ‫ ا‬ARNm

                  HbA ‫ؤول ن ر ب‬      ‫ ا‬ADN ‫زء ن‬                                           ( Uracile ) ‫ھ ا ورا ل‬          ‫دة ازو‬       =U


  ‫و دات‬    ‫نا‬      ‫، ون ن‬Acide ribonucléique ‫ ھو ا ض ا ووي ا ر وزي‬ARN
  + ‫و د ون ن ض و وري + ر ا ر وز‬              ‫ل و ب وا د ) ر ط وا د (، و ل‬
              .U ‫، أو ا ورا ل‬C ‫، أو ا وز ن‬G ‫، أو ا وا ن‬A ‫ون إ ا د ن‬     ‫دة ازو‬

                                                                                             . ‫ر ا ور‬              ‫را ل‬
                                     .ARNm                               ‫: ن ا ور إ‬ARN                            ‫أ– ر‬
             ‫، م دد را ل ر ب‬ADN ‫ و‬ARNm ‫ز‬                                 ‫ن ا و 4، و 3، رن ن‬      ‫اط‬
                                                                                    .ADN ‫ن‬  ‫ ا ط‬ARNm
3 ‫ا و ــــــــــ‬
                                                                                                              :1 ‫ل‬         ‫4.ا‬          ‫او‬




                                            ‫راز‬    ‫ و‬ARN
                                                                        A TGA                ‫راز‬   ‫ و‬ARN ‫ل‬
                                                                   GA           GG
     '   ‫ل‬    ‫ر‬    ‫وب‬                                         TG                     TC
                                                                                                                       3
                                                                                                                                  '
 5                                                        G                               T
                                                      C                                    '
         G T G C A C C T T A C T C C A G A G G A GC A                                     3 C C T CG T G C A C C T T A C
                                                                                                                                       ADN
                                                                                      CU
 3
     '   C A C G T G G A A T G A G G T C T C C T CG T G C
                                        AAU          U      G A GC A C G T G G A A T G
                                   A CG       GAGG        G                          5
                                                                                       '
                                     GC
      ‫وب ل‬                         U    T              G A
                                          TA       CA
                                 G            CTC
   '
                                C
 5                           CA           A      C
                           G                C        U
                       GGA
     GUGCACCUUACUCCAGA                    G     UG                  ‫و دات رة‬
                                              C    A
 ARNm             ‫ز‬



             ‫رة‬       ‫ا ر ا ورا ، أو ا‬            ‫و زم‬        ‫ا‬     ‫لإ‬      ‫ م دا ل ا واة، م‬ARNm ‫إن ر ب‬
                                                                                       .‫ا رور ر ب ا رو ن‬


                        ‫ذ: و فا د‬      ‫ا‬                                                           - 55 - :          ‫ا‬
         ‫م‬         ‫خ وا‬           ‫ر ب ‪ARNm‬‬                         ‫إن ‪ ARNm‬ھو‬
                                                                  ‫د ر ط ‪ ،ADN‬و‬
                                                                           ‫:‬
          ‫ا رات ا ورا ا ؤو ن ا ط ق ر ب‬           ‫• رف أ ز م ‪ARN polymérase‬‬
                                                         ‫ق .‬      ‫‪ ARNm‬و‬
            ‫م ا روا ط ا‬ ‫ارا‬    ‫ز ‪ADN‬‬       ‫رق و‬       ‫ل ‪ARN polymérase‬‬     ‫•‬
                                      ‫.‬             ‫ا وا د ا زو ا‬        ‫ا‬
       ‫ل ا وا د‬    ‫ـ ‪ ،ARNm‬وذ ك ب‬  ‫و دات ا‬   ‫رة ا‬     ‫ل ‪ARN polymérase‬‬     ‫•‬
                                                           ‫ا زو ـ ‪ G ) ،ARNm‬أ م ‪ C‬و ‪ U‬أ م ‪.( A‬‬
  ‫وف ن‬             ‫خ،‬         ‫ا‬       ‫ن‬      ‫ؤو‬     ‫ا‬   ‫ا و دات ا ر ز‬     ‫• رف ‪ARN polymérase‬‬
                                             ‫.‬      ‫ا‬       ‫د ز ‪ADN‬‬        ‫ا رة، و‬
                               ‫ا و زم: ن ‪ ARNm‬إ ا رو ن.‬               ‫ب– ر ا ر‬
‫ا و ــــــــــ 4‬                      ‫‪ – a‬ط ت ول ا ط رات: أ ظر ا و 1، و 4.‬
 ‫و أدوات ر ا ر ا ورا :‬                 ‫ضا‬    ‫ا‬      ‫ن و دات ‪ ADN‬و‬           ‫ط4 ا‬
                                                           ‫♥ ا و 1 : ط ت ول ا ط رات‬
                                                      ‫:‬     ‫ت درا ا ط رات ن‬
    ‫ر‬            ‫ا ور ، إ‬         ‫و دات‬        ‫و د وا د أو ا ن أو‬    ‫• ؤدي ر‬
           ‫وا د ا رو ن.‬         ‫ر ضأ‬            ‫و دات ‪ ،ARNm‬و‬          ‫ا‬
                     ‫ر‬     ‫ا ور ، إ‬       ‫و د‬      ‫• ؤدي ر أر أو س أو ت‬
                      ‫ن أ ن ا رو ن.‬        ‫ر‬          ‫و دات ‪ ،ARNm‬و‬         ‫ا‬
                                                              ‫ن ذا ف ھذه ا ط ت ؟‬
                                                                       ‫ن ھذه ا ط ت‬     ‫:‬
                  ‫رو ن.‬                   ‫ضا‬  ‫و دات ا و ـ ‪ ARNm‬وا‬   ‫نا‬     ‫• ھ ك‬
             ‫و دات ‪.ARNm‬‬                     ‫وا د ا رو ن، م وا ط‬  ‫• إن ا رة ض أ‬

‫ا و ــــــــــ 4‬
                             ‫4.‬    ‫2، و‬       ‫رب ‪ Nirenberg‬و ‪ Matthaei‬أ ظر ا و‬                       ‫‪–b‬‬
                                             ‫ر‬       ‫لا‬         ‫ص وي ن ر ‪ E.coli‬و ر‬                              ‫زل‬
             ‫ف‬          ‫ضأ‬   ‫‪20 + Poly U‬‬     ‫ر ب ا رو ت،) ر وزو ت، ‪،GTP ،ATP‬‬                   ‫ا و ز ا ز‬
    ‫+‬                  ‫+‬                ‫+‬                           ‫+2‪ ، Mg‬أ ز ت (. دا ‪ ،ADN‬و‪.ARNm‬‬
 ‫‪Val‬‬               ‫‪Phe‬‬               ‫‪Ala‬‬     ‫02 أ وب ا ر، م‬             ‫وى ا وي ت رارة °73‬
                                                                            ‫‪C‬‬                                ‫ا‬      ‫و‬
                                             ‫ز‬      ‫. ث أن ل أ وب‬             ‫أ ف ل أ وب ا ر 02 ض أ‬
                                             ‫ف‬       ‫‪ . 14C‬د ذ ك‬          ‫وا د و وم ر ون ا‬             ‫ون ض أ‬
                                                 ‫و د‬             ‫، ذات‬      ‫ل و ط ز ت ‪ ARNm‬ا ط‬                       ‫إ‬
                          ‫‪ARNm Poly U‬‬        ‫دة‬           ‫وي إ‬         ‫و دات‬       ‫ن‬      ‫و‬                 ‫رو ،‬
                                             ‫ـ ‪Poly U‬‬           ‫وا دة ھ ا ورا ل - ‪ - U‬و ذ ك ر ز‬                   ‫ازو‬
                                                                                                          ‫‪.ARNm‬‬
                                             ‫د‬     ‫د دا‬           ‫آ ر ا ر و ط وا د ن ھ ذه ا و ط ظ ر‬
                                                    ‫ن.‬         ‫ا‬       ‫ا ضا‬           ‫ز و ره‬     ‫، ھذا ا و ط‬
                                                                                ‫ن ھذه ا ط ت ؟‬              ‫1( ذا‬
     ‫1‬                 ‫2‬               ‫02‬           ‫ن ا رو ن‬                ‫ل‬      ‫ل ‪Poly-C ARN‬‬                   ‫د‬
                                                                                                                ‫‪.Pro‬‬
                                               ‫ن ا ز ن ‪.Lys‬‬                 ‫ل‬      ‫ل ‪Poly-A ARN‬‬                   ‫د‬
                                                  ‫ن‬       ‫ن‬               ‫ل‬      ‫ل ‪Poly-GU ARN‬‬                    ‫د‬
  ‫روا ب رو‬           ‫روا ب رو‬       ‫روا ب رو‬                                 ‫ن - ا ن ‪.Val-Cys‬‬               ‫أ نا‬
     ‫ر‬                                  ‫ر‬          ‫ض‬      ‫نا‬        ‫ط ق ل ضأ‬              ‫2( دد ا و دة ا ر ز ا‬
                                                                     ‫.‬      ‫ا رب ا‬          ‫ف‬        ‫ا‬         ‫ا‬
                   ‫ذ: و فا د‬   ‫ا‬                                                    ‫: - 65 -‬       ‫ا‬
                     ‫و دات،‬              ‫نا‬             ‫ل‬        ‫و د‬                   ‫ا‬     ‫ا ورا‬         ‫1( ن ن ھذه ا ط ت أن ا ط‬
                                                               ‫ن.‬                ‫ا‬           ‫ضا‬             ‫‪ UUU‬ر ز‬        ‫ث أن ا‬

   ‫ض‬                             ‫ا رو ن. وا و دة ا ر ز ‪ AAA‬ر ز‬    ‫ضا‬   ‫2( ا و دة ا ر ز ‪ CCC‬ر ز‬
                                ‫ا ن، وا و دة ا ر ز‬  ‫ضا‬      ‫ا ز ن . وا و دة ا ر ز ‪ GUG‬ر ز‬   ‫ا‬
                                                                 ‫ن.‬  ‫ا‬      ‫ضا‬       ‫‪ UGU‬ر ز‬

                               ‫و دي ل و دة ر ز ‪ ،Codon‬و ر ز د‬                                              ‫ص ن ھذه ا رب أن ل‬
                               ‫، ن ا ون ن د د ا و دات‬      ‫ا ر ا‬                                         ‫ل سا‬          ‫.و‬ ‫ضا‬    ‫ا‬
                                    ‫ا‬      ‫رو ت، م‬    ‫ا و‬    ‫ضا‬                                        ‫ر إ 02 و ن ا‬        ‫ار ز ا‬
                                               ‫ا و 3، و 4.‬    ‫ا ل‬                                       ‫دول ا ر ز ا ورا‬     ‫ل‬   ‫ا‬
‫ا و ــــــــــ 4‬
                                                                                                                              ‫♥ او 3 :‬
     ‫(‬                         ‫ا و 3 ) دول ا ر ز ا ورا‬   ‫ل‬             ‫ا دول ا‬                  ‫ول‬    ‫ما‬           ‫رب ا‬         ‫رب‬
                              ‫ھذه‬      ‫و‬          ‫و دات وذة‬                ‫ر‬                ‫ف ا وا ت ا‬            ‫‪ Code génétique‬ا ذي ط‬
                                                                                                                                          ‫ت.‬                              ‫ا ر‬
                                                                       ‫ا ــــــ ـــــرف ا ــــ ـــــ‬
                                          ‫‪U‬‬                     ‫‪C‬‬                                ‫‪A‬‬                         ‫‪G‬‬
                                   ‫‪UUU‬‬   ‫ن‬          ‫ا‬   ‫‪UCU‬‬                     ‫‪UAU‬‬                  ‫روز ن‬       ‫‪UGU‬‬      ‫ن‬               ‫‪U‬‬
                                   ‫‪UUC‬‬    ‫‪Phe‬‬           ‫‪UCC‬‬                     ‫‪UAC‬‬                ‫‪Tyr‬‬           ‫‪UGC‬‬           ‫‪Cys‬‬        ‫‪C‬‬
                                                              ‫‪Ser‬‬     ‫رن‬
                               ‫‪U‬‬                                                                                                ‫دون‬
                                   ‫‪UUA‬‬         ‫و ن‬      ‫‪UCA‬‬                     ‫‪UAA‬‬                              ‫‪UGA‬‬                      ‫‪A‬‬
                                                                                           ‫‪STOP‬‬            ‫دون‬             ‫‪STOP‬‬
                                             ‫‪Leu‬‬
                                   ‫‪UUG‬‬                  ‫‪UCG‬‬                     ‫‪UAG‬‬                              ‫‪UGG‬‬    ‫ر و ن ‪Trp‬‬         ‫‪G‬‬




                                                                                                                                               ‫ا ـــــــ ــــــرف ا ـــــــــ ُث‬
                                   ‫‪CUU‬‬                  ‫‪CCU‬‬                     ‫‪CAU‬‬                   ‫ھ دن‬       ‫‪CGU‬‬                      ‫‪U‬‬
   ‫ا ــــــــ ــــــرف ا ول‬




                                   ‫‪CUC‬‬        ‫و ن‬       ‫‪CCC‬‬          ‫رو ن‬       ‫‪CAC‬‬                ‫‪His‬‬           ‫‪CGC‬‬       ‫ن‬     ‫أر‬       ‫‪C‬‬
                               ‫‪C CUA‬‬
                                             ‫‪Leu‬‬        ‫‪CCA‬‬         ‫‪Pro‬‬         ‫‪CAA‬‬                              ‫‪CGA‬‬           ‫‪Arg‬‬        ‫‪A‬‬
                                                                                           ‫‪Gln‬‬         ‫ن‬    ‫و‬
                                   ‫‪CUG‬‬                  ‫‪CCG‬‬                     ‫‪CAG‬‬                              ‫‪CGG‬‬                      ‫‪G‬‬
                                   ‫‪AUU‬‬                  ‫‪ACU‬‬                     ‫‪AAU‬‬                ‫ر ن‬       ‫أ‬   ‫‪AGU‬‬       ‫رن‬             ‫‪U‬‬
                                         ‫ازو و ن‬
                                   ‫‪AUC‬‬                  ‫‪ACC‬‬                     ‫‪AAC‬‬               ‫‪Asn‬‬            ‫‪AGC‬‬        ‫‪Ser‬‬           ‫‪C‬‬
                               ‫‪A‬‬           ‫‪Ileu‬‬               ‫ر و ن ‪Thr‬‬
                                   ‫‪AUA‬‬                  ‫‪ACA‬‬                     ‫‪AAA‬‬                        ‫زن‬    ‫‪AGA‬‬       ‫أر ن‬           ‫‪A‬‬
                                   ‫‪AUG Met‬‬    ‫و ن‬       ‫‪ACG‬‬                     ‫‪AAG‬‬            ‫‪Lys‬‬               ‫‪AGG‬‬        ‫‪Arg‬‬           ‫‪G‬‬
                                   ‫‪GUU‬‬                  ‫‪GCU‬‬                     ‫‪GAU‬‬         ‫ضأ ر ك‬               ‫‪GGU‬‬                      ‫‪U‬‬
                                   ‫‪GUC‬‬       ‫ن‬          ‫‪GCC‬‬         ‫ن‬           ‫‪GAC‬‬            ‫‪Asp‬‬               ‫‪GGC‬‬                      ‫‪C‬‬
                               ‫‪G‬‬                                                                                         ‫ن ‪Gly‬‬
                                   ‫‪GUA‬‬        ‫‪Val‬‬       ‫‪GCA‬‬          ‫‪Val‬‬        ‫‪GAA‬‬           ‫‪ GGA‬ض ا و ك‬                                 ‫‪A‬‬
                                   ‫‪GUG‬‬                  ‫‪GCG‬‬                     ‫‪GAG‬‬                 ‫‪Glu GGG‬‬                               ‫‪G‬‬



                              ‫ت ن‬  ‫ون ن‬     ‫ون ن 34 أي 46 و دة ر ز‬ ‫ن ن ھذه ا و أن ا ر ز ا ورا‬
                               ‫ت رز ي‬      ‫،و ضا‬       ‫ت ر ز سا ضا‬         ‫و دات، ث أن دة‬     ‫ا‬
                                       ‫أو ف، ھ ) ‪.( UGA , UAG , UAA‬‬       ‫ول أ دون‬        ‫ضأ‬

                                                ‫‪ – c‬را ل ا ر‬                 ‫5.‬        ‫: أ ظر ا و ق، و‬
                                              ‫ر :‬       ‫را ز‬      ‫ا‬
                          ‫إ ‪ ARNm‬و ا ور إ :‬      ‫ج ر ب ا رو ت‬
 ‫رة و و دة‬   ‫ن و دة‬  ‫ل ل وا د‬   ‫رة‬      ‫ت و ز‬       ‫ر وزو ت و ھ‬
  ‫رة، و ون ل و دة ن ‪ ARN‬ر وزو )‪ (ARNr‬و ن رو ت. و ون ا ر وزو ت‬
                                                         ‫دا ل ا و .‬
                                      ‫ذ: و فا د‬         ‫ا‬                                                              ‫: - 75 -‬       ‫ا‬
             ‫ا رة‬        ‫ضا‬         ‫لا‬     ‫ص‬       ‫و زم، و‬            ‫ل )‪ (ARNt‬ا و ود‬            ‫‪ARN‬‬
                                                                                                                 ‫ا ط‬
                   ‫ن و ن: أ ظر ا و‬      ‫و دات و‬    ‫و دة ا ر ز . ون ز ‪ ARNt‬ن‬
   ‫ن،‬               ‫و دة ا ر ز ا رة ض أ‬             ‫و دات‬    ‫ث‬    ‫وي‬    ‫• و‬
                         ‫د ا و دة ا ر ز ‪.Anticodon‬‬      ‫و دي‬   ‫ا‬  ‫ھذا ا‬  ‫و‬
                               ‫ب و دة و دة ا ر ز .‬      ‫ا‬     ‫تا ضا‬     ‫• و‬

                                                     ‫.‬      ‫ط‬       ‫ضأ‬      ‫و ھ 02‬            ‫ضأ‬             ‫أ‬

                                     ‫.‬     ‫ب اط‬           ‫درھ ا‬       ‫ف را ل ا ر ب ،‬                         ‫ط‬

                                                                                  ‫وا ل ط‬
                                                                                   ‫را ل ا ر :‬
                                    ‫وھ :‬           ‫را ل أ‬              ‫ص ظ ھرة ر ب ا رو ت‬     ‫ن‬

‫ا و ــــــــــ 5‬                                                                ‫ا و :.ا دا‬           ‫ا ر‬
  ‫ث‬      ‫و‬                 ‫‪ARNt‬‬      ‫ل2 : ز‬    ‫ا‬                ‫ـ ‪ ARNm‬و ‪ARNt‬‬       ‫ل1: ا ر وزوم و‬   ‫ا‬
       ‫ا ضا‬




                                        ‫رف‬       ‫و‬
                                         ‫ا و دة ا ر ز‬
                                     ‫د ا و دة ا ر ز‬   ‫=‬
      ‫‪ARNm‬‬


        ‫وى ا و دة ا ر ز ‪ ،AUG‬ا‬  ‫ق و د ا ر وزو ت ـ ‪،ARNm‬‬            ‫ل ھذه ا ر‬
           ‫‪ARNt‬‬     ‫ا و ن ا ذي ر ط ـ ‪ ARNt‬ص‬     ‫ضا‬         ‫ل إ رة ا دء، و ر ز‬
                                       ‫د ا و دة ا ر ز ‪.UAC‬‬      ‫ا ديء، وا ل‬

                                                                   ‫ا ر ا‬        ‫ط‬     ‫:ا‬
        ‫‪. ARNm‬‬       ‫ط ق و دة ا ر ز ا وا‬        ‫ضأ‬               ‫و ول ‪ ARNt‬آ ر‬
          ‫ل ا را ط ن ‪ Met‬و ‪ARNt‬‬      ‫ا وا ،‬   ‫د ن ‪ Met‬و ا ض ا‬         ‫ل را ط‬
                                                       ‫ا ديء ا ذي در ا ر وزوم.‬
             ‫ضا‬      ‫فا‬       ‫ل ‪ ARNt‬ث، وھ ذا‬    ‫رك ا ر وزوم و دة ر ز وا دة،‬
                                                                   ‫ا د .‬      ‫ا‬

                                                              ‫:ا‬   ‫ا ر ا‬
          ‫د أي ض‬             ‫ل ا ر وزوم إ ا و دة ا ر ز ف )‪ UAA‬أو‪ UAG‬أو‪(UGA‬‬ ‫د‬
          ‫ا ر وزوم ن‬        ‫ل ھذه ا و دات ا ر ز . رق و د‬  ‫أ ، إذ و د أي ‪ARNt‬‬

                    ‫ذ: و فا د‬   ‫ا‬                                                    ‫: - 85 -‬            ‫ا‬
          Met            ‫ضا‬      ‫لا‬               . ‫د‬    ‫ا‬   ‫ررا‬    ‫ و م‬ARNm ‫ا ض و ن‬
5 ‫ا و ــــــــــ‬
                                                                          . ‫ا د‬    ‫ا‬                                  ‫ن‬
‫ديء‬       ‫ا‬ARNt                                                                       .    ‫5 : را ل ا ر‬               ‫♥ او‬
                               PHE
                                                  ARNt
           MET                                                                                           ‫ا دا‬             ‫ر‬
                            A A A
          U A C
      '
          AUGUUUCUGGCCGCCCAAUAAUAC
      5                   ARNm   3
                                   '
                           ‫ر وزوم‬
                                                                                                        ‫ط‬         ‫ا‬           ‫ر‬
           MET     PHE


           UACAAA
           A UGU U U C UGGC CGC C C A A U A A U A C

                                      LEU
           MET     PHE

UAC                                  GAC
               AAA
           A UGU U U C UGGC CGC C C A A U A A U A C



           MET     PHE   LEU


              AAAGAC
           AUGUUUCUGGCCGCCCAAUAAUAC


                                            ALA
           MET     PHE   LEU

                                            CGG
AAA              GAC
           AUGUUUCUGGCCGCCCAAUAAUAC



      MET     PHE    LEU   ALA       ALA    VAL
                                                                   PHE
                                                                           ALA                                ‫ا‬           ‫ر‬
                                                             MET     LEU
                                                                               ALA   GUU
                                                                         VAL
                     G U U STOP
                                                                                                       STOP
      AUGUUUCUGGCCGCCCAAUAAUAC
                                                             AUGUUUCUGGCCGCCCAAUAAUAC




                                                                                : ‫وظ‬
              ‫ل‬     ،      ‫تر‬              ‫س ا و ت وا ط دة‬      ‫ م ر‬ARNm ‫إن ز وا دة ن‬
                                             .‫س ا و ت‬  ‫ون دة رو ت‬       ،ARNm ‫طول ط‬




                     ‫ذ: و فا د‬         ‫ا‬                                             - 59 - :      ‫ا‬
                                                   ‫ل ا ث:‬          ‫ا‬
                           ‫اﻟﻬﻨﺪﺳﺔ اﻟﻮراﺛﻴﺔ : ﻣﺒﺎدﺋﻬﺎ وﺗﻘﻨﻴﺎﺗﻬﺎ‬
    ‫أ رى‬         ‫ن‬      ‫ت ن ل و وظ ف ور ت و‬                                   ‫ذا‬   ‫ء ا ورا‬  ‫ن‬   ‫د:‬
   ‫ل ن‬       ‫م ن و ودة ن ل ا ط . د ذ ك م ا‬                                    ‫ھ‬      ‫، ا ء ا ذي ط‬                          ‫أ‬
       ‫ا ر ا ورا‬       ‫د‬           ‫ت‬     ‫، ث‬                                    ‫رب ا ر إ ا ل ا‬                             ‫ا‬
 ‫دة ھذا ا ر ا ورا : ا د ا ورا .‬      ‫ا تا‬                                    ‫وا ط ل ا ور ت.‬    ‫ا‬

                                                                           ‫‪ – Ι‬وم ا ر ا ورا ؟‬
                                              ‫ت:‬         ‫ر ‪ At‬إ‬        ‫ور ت ا‬      ‫لاط‬   ‫1ا‬
‫ا و ــــــــــ 1‬                                          ‫ط 1، و 1.‬            ‫: أ ظر‬       ‫ر‬      ‫ط ت‬           ‫أ–‬
                                   ‫1‬     ‫او‬                                     ‫ر ا ورا :‬       ‫وم ا‬           ‫ط 1:‬
                                               ‫‪ ، La galle du collet‬رة ن ورم‬     ‫: رض رب ا‬            ‫درا‬
                                               ‫ط ا ء‬    ‫، وھ‬   ‫وى ا‬        ‫م ظ ر د ضا ت‬              ‫رط‬
                                               ‫د د ن و وع‬      ‫ا‬    ‫م‬   ‫1( ، و ظرا ره ا‬  ‫ا ق وا ذر )ا و‬
                                                                                        ‫دة أ ث و رب.‬
                                                    ‫ا ر ا و : ) 7091 ‪( E . Smith et C . Townsend en‬‬
                                                  ‫د‬         ‫ت ر‬         ‫ذر‬          ‫رط‬ ‫ن ن ورم‬         ‫زل ا‬
                                               ‫2 (. و د ذ ك م‬     ‫‪ ) At = Agrobacterium tumefaciens‬ا و‬
                                               ‫م،‬    ‫ت‬       ‫د ) أ ل ن و ن ( أ زت‬                ‫زرع ھ ذه ا ر‬
                                                                                ‫ا .‬      ‫و ظ ظ ور ا ورم ا رط‬
                                                                           ‫ن ھذه ا ر ؟‬     ‫كا‬     ‫1( ذا‬
                                   ‫ورم‬                                   ‫: ) 2791 ‪. ( A. Braun‬‬         ‫ا ر ا‬
                                                   ‫ر‬     ‫وي‬            ‫رب ا‬         ‫د ا ط ع ھ ذا ا ث أن زرع‬
                                                   ‫ا‬  ‫ظ أن‬  ‫د .‬       ‫و ط ن د ، ون ط ن ا روز وأ ح‬
                                               ‫ر طء ط و ود‬            ‫ا د ا‬         ‫سا‬        ‫ورة و و‬        ‫ر‬
                                                                                                 ‫.‬      ‫ا ر و تا‬
                                   ‫2‬     ‫او‬                    ‫و ود ا ر‬         ‫ا‬    ‫2( ا ر ا ذي دث‬
                                                                                    ‫‪A.Tumefaciens‬؟‬
                                                    ‫ك إ ط ؤھ ول ا ر ا ذي أ ب وك‬             ‫ا‬      ‫3( ا ر‬
                                                                                           ‫؟‬       ‫ا‬      ‫ا‬
                                               ‫ن و ود ط ن ن ر ت ‪Agrobacterium‬‬                 ‫نا‬      ‫و‬     ‫ت‬    ‫ا‬
                                               ‫ون‬    ‫ن ا رض ) ؤد ن إ‬       ‫‪ A : tumefaciens‬و ‪. B‬وھذان ا ط ن‬
                                               ‫ه ا و ن ‪Nopaline‬‬      ‫ون ورم ر ب‬        ‫ورم (. ث ؤدي ا ط ‪ A‬إ‬
                                               ‫و ن ‪Octopine‬‬      ‫ها‬    ‫ون ورم ر ب‬          ‫ؤدي ا ط ‪ B‬إ‬
                                                  ‫ون‬     ‫ر‬     ‫ت‬      ‫ت ن‬         ‫رة ن‬        ‫)ا و ن و ا و ن‬
                      ‫‪At‬‬
                                                         ‫أو ر ت (.‬           ‫وأ ض و‬            ‫نأ ضأ‬           ‫ظ‬
                                                ‫ك إ ط ؤه ول ا ر ا ذي أ ب وك‬         ‫ا ذي‬     ‫لا ر‬        ‫4(‬
                                                                                               ‫؟‬     ‫ھذه ا‬

                                                                         ‫:‬         ‫ر‬   ‫ط تا‬        ‫لا‬            ‫ب–‬

   ‫ت‬        ‫دا‬       ‫ن ظ ور ا ورم ا رط‬              ‫ؤو‬    ‫ر ‪ At‬ھ ا‬            ‫ن ھذه ا ر أن ا‬                          ‫1(‬
                                                                                                       ‫.‬          ‫ا‬

                   ‫ذ: و فا د‬   ‫ا‬                                                        ‫: - 06 -‬           ‫ا‬
    ‫ر‬          ‫ر ا وا وا ر‬                     ‫ر ‪ At‬ھ ا‬               ‫وا ط ا‬            ‫ا‬               ‫طرأ‬       ‫رات ا‬            ‫2( ا‬
        ‫.‬       ‫ا‬   ‫ن و‬                       ‫ا ؤو أ‬                 ‫ا ر و تا‬           ‫إ‬             ‫دو‬    ‫ا‬        ‫ظم‬            ‫ا‬

            ‫وى ا ر‬                    ‫ر‬              ‫دة أدت إ‬                ‫ا‬       ‫ر ‪ At‬إ ا‬              ‫: تا‬                ‫3( ا ر‬
                                                    ‫ر ا وا .‬             ‫ا‬            ‫ا‬   ‫با‬             ‫ا‬    ‫و‬               ‫ا ورا‬

 ‫، ھذه‬             ‫ا‬       ‫ا‬     ‫ر إ‬            ‫ن إد ل ور ت‬        ‫ا‬                           ‫وم ا‬          ‫ر‬  ‫4( ر أن ا‬
                                                    ‫ر ب ا و ن وا و ن.‬                           ‫م‬           ‫ا ور ت ھ ا‬
‫ا و ــــــــــ 1‬
                               ‫° 73‬
                                  ‫‪C‬‬           ‫زرا‬             ‫3‬     ‫او‬                                           ‫:‬     ‫ا ر ا‬
   ‫أ ل ذر ‪A‬‬                                                           ‫‪Agrobacterium‬‬               ‫ون ن زل ا ر‬                   ‫ن‬
  ‫رارة‬                                                                       ‫و دوا ‪ADN‬‬        ‫و‬        ‫‪ ، tumefaciens‬و د درا‬
                                                            ‫أ ل ذر 1‪A‬‬   ‫رارة ‪ 37 ° C‬أ ل ذر‬         ‫د ‪ . Ti‬زرع در‬               ‫د ا‬
                                                                               ‫ل ‪ Agrobacterium tumefaciens‬ن ا ط ‪A‬‬
                                                                            ‫3‬      ‫أ ل ذر 1‪ .A‬ن ا و‬               ‫ل‬         ‫رارة،‬
                                                                                                                            ‫ا ر .‬
 ‫د ر زإ‬                                                                                       ‫.‬       ‫ل‬      ‫ا‬      ‫5( ر ا‬
‫ر با و ن‬                                                                                                        ‫ا ر ا را :‬
                                                                      ‫ل ور ت‬         ‫رة ن ‪ADN‬‬               ‫د)‬        ‫دور ا‬       ‫و‬
                                                                                                       ‫:‬    ‫( زا ر ا‬                ‫إ‬
                                                                         ‫ب ا رض و و‬             ‫م ر ت 1‪A‬‬             ‫ت‬          ‫د ل‬
                                                                               ‫رض و‬              ‫دات ا و ، و ر ت ‪B‬‬
                                                                             ‫ون ورم ) أ ظر ا و 4، و 2 (.‬             ‫دات ا و‬
                                                                        ‫ھذه ا ر ؟‬                     ‫ر ا ذي ر‬        ‫6( ا‬
                                                                      ‫دات‬            ‫وي‬     ‫ق ا ورم و ط وق و ط زرع‬
                                                                      ‫4،‬      ‫ل ناو‬       ‫ا زء ا‬                ‫ا ر‬           ‫و :‬
                                                                                                                              ‫و 2.‬
                                                                          ‫.‬       ‫ل‬     ‫ا ر ت1و2و3ا‬                 ‫7( رف‬
                                                                                           ‫د؟‬       ‫ك د د دور ا‬        ‫8( ھل‬
                                                                                 ‫دك‬     ‫و‬       ‫ا رب ا‬         ‫ن‬       ‫9( ا ط‬
                                                                                ‫ون ا ورم‬        ‫5 و 2 ، ا رح‬           ‫او‬
        ‫ظ ور ا ورم‬                                  ‫دم ظ ور ا ورم‬                                ‫د ا ت.‬         ‫وى ا‬

      ‫أ ل ذر 1‪A‬‬                        ‫أ ل ذر ‪B‬‬                                                          ‫ا و ــــــــــ 2‬         ‫4:‬      ‫او‬
    ‫دات ا و‬     ‫و‬                ‫و‬    ‫دات ا‬
                                                                ‫د ر زإ‬
                                                               ‫ر با و ن‬                                             ‫و‬       ‫دات‬
                                                                     ‫1‬


                                                                     ‫2‬


                                                                     ‫3‬
            ‫ون ا ورم‬
                                                                                                                        ‫ون ا ورم‬


    ‫ن‬                  ‫د ا ؤول ن ر ب ا و ن، و‬                                ‫كا‬      ‫ت ر ا رارة، م‬     ‫5( ظ أ‬
  ‫ر .‬                     ‫د ادن ھو ا ؤول ن ا درة ا ر‬                               ‫ورم،‬      ‫ا‬   ‫ھذا ا ك دم إ‬

                        ‫ذ: و فا د‬         ‫ا‬                                                            ‫: - 16 -‬           ‫ا‬
       ‫ن ور أن ا ر ‪B‬‬                       ‫د. ذا‬   ‫با‬     ‫6( إن ا ر 1‪ A‬دت در ا ر‬
     ‫ؤدي إ ظ ور ا ورم د‬                    ‫د ا ؤول ن ر ب ا و ن ھ ا‬   ‫ا‬  ‫ا و رة‬
                                                                          ‫ا .‬

                       ‫دات ا و ، ادن ھ ا ر 1‪.A‬‬       ‫و و‬                             ‫ر‬    ‫ر‬    ‫ر 1‬     ‫7( ا‬
‫ت 1‪ A‬و ‪.B‬‬             ‫طھ ن ل‬    ‫دات، ادن ھ‬       ‫دو و‬                                    ‫وي‬    ‫ر 2‬     ‫ا‬
                              ‫ر ‪.B‬‬      ‫دات ا و ، ادن ھ‬                                       ‫ر 3ھ‬      ‫ا‬

   ‫ن‬       ‫د ا ر ‪ ،B‬و دث ا رض،‬    ‫1‪ A‬و ك‬                                      ‫8( د ظ رت ر د دة‬
‫ت، و ن ھذا‬   ‫را ا‬   ‫ر إ أ رى د‬          ‫ل ن‬                                  ‫د ط ا‬     ‫ھذا أن ا‬
                               ‫ر ا ر ا ورا .‬                                  ‫د ؤول ن‬     ‫نا‬

 ‫ا و ــــــــــ 2‬                                                                                     ‫5:‬      ‫او‬
                                    ‫د ‪Ti‬‬                                        ‫ر‬    ‫ا‬

                                                             ‫‪ADN-T‬‬




                                                      ‫ل ‪ ADN-T‬إ‬
                                                          ‫ا‬     ‫ا‬




                                                                                                      ‫ظ ور ا ورم‬

                                              ‫ر‬   ‫ا‬
                                                                        ‫إد ج ‪ADN-T‬‬
                                                                         ‫ا‬   ‫ا‬



                                ‫أو ن‬

       ‫ا‬   ‫رضا‬
 ‫ط‬     ‫إ راز واد‬                       ‫أو ن‬                                     ‫‪ARNm‬‬
     ‫ر ا وي‬                                              ‫ر‬
                                      ‫ز‬


                                                                     ‫را ل ھ :‬                 ‫9( ظ ر رب ا‬
   ‫دھ ‪Ti‬‬      ‫ا ت، وم‬ ‫ن‬    ‫رح ون ر ن‬           ‫- ا ر ا و : دا ر‬
            ‫ط ن ‪ ADN‬د ‪.ADN-T‬‬              ‫د وي‬       ‫. ھذا ا‬  ‫ا‬     ‫ا‬
  ‫، د ل كا ط‬     ‫ا‬   ‫ا‬   ‫ن ‪ ADN‬ا‬     ‫: د ا ر ت ‪ADN-T‬‬         ‫- ا ر ا‬
                                                 ‫ن ذ ر ا ورا .‬
‫وب زم‬     ‫‪ ARNm‬ن ور ت ‪ ،ADN-T‬و ر م إ رو ن‬                 ‫:‬  ‫- ا ر ا‬
       ‫.‬   ‫ل ر ب ا و ن ن طرف ا‬      ‫. ھذا ا رو ن ھو أ ز م ز‬   ‫ا‬     ‫ا‬
          ‫ع ر ،‬        ‫ا‬     ‫را‬      ‫- ا ر ا را : ؤدي ا و ن ا ر ب إ‬
                ‫ر ا ر ‪.At‬‬     ‫ؤدي إ‬      ‫أن ا و ن ا رز رج ا‬     ‫ورم.‬

                    ‫ذ: و فا د‬   ‫ا‬                                                    ‫: - 26 -‬     ‫ا‬
                                                                                                    ‫:‬
        ‫د‬     ‫ت ورا ، و ر‬     ‫أ‬     ‫ا .ھ ا‬        ‫ن ر ورا‬      ‫إن رب ا‬
        ‫. و د ت درا ھذه ا ظ ھرة ن و‬   ‫ا‬    ‫ل ل ا ور ن ا ر إ ا‬     ‫ا ر‬
                         ‫د ‪ Ti‬د ا ر ‪ .At‬أ ظر ا و 6 و 2.‬     ‫ا ر ط ا ورا‬
                     ‫‪ADN-T‬‬             ‫ا و ــــــــــ 2‬
                                                                 ‫ر ‪At‬‬    ‫دا‬   ‫د ‪Ti‬‬              ‫ا ر ط ا ورا‬
                     ‫‪ONC‬‬      ‫‪OPS‬‬
                                                          ‫ـ ‪ Tumor inducing‬أي‬                 ‫ر ز ذا ا‬
                                                                                         ‫د ـ ‪، Ti‬‬
                                                                                               ‫رض ورم.‬
                                                     ‫ل إ‬      ‫• ‪ Transferred ADN = ADN-T‬ا زء ا ذي‬
                                                   ‫ا ورا . و ر ز ور ت‬         ‫ذ ر‬       ‫و د‬     ‫ا‬        ‫ا‬
                                                   ‫ن ا ر‬        ‫ن ر ب ا و ت )‪ ،(OPS‬وا ؤو‬          ‫ا ؤو‬
‫‪OCC‬‬
                                                                                          ‫ا وا )‪(ONC‬‬
                                                      ‫ا دة ا ورا‬     ‫ن إد ج ‪ADN-T‬‬     ‫• ا وظ ‪ VIR‬ؤو‬
                                               ‫‪VIR‬‬                                          ‫.‬     ‫ا‬
                                                   ‫ن ھدم ا و ت ا ررة ن طرف‬           ‫ؤو‬    ‫‪OCC‬‬       ‫• ا وظ‬
                                                                                                    ‫ا .‬
‫‪OCC‬‬
                                                   ‫د ن ا ر.‬          ‫ا ذي ن ا‬     ‫• ا وظ ‪ ORI‬ؤو ن ا‬

                       ‫‪ORI‬‬

                                                                              ‫ا ورا .‬             ‫‪ – IΙ‬آ ت ا د‬
                                                           ‫ا ورا :‬      ‫ا د‬                       ‫او لا‬
                                          ‫3.‬       ‫1، و‬        ‫ر ,‪ : Escherichia coli‬أ ظر ا و‬                  ‫أ –‬
‫ا و ــــــــــ 3‬
                             ‫ا ورا .‬       ‫ا د‬            ‫ر ‪Eschérichia-coli‬‬         ‫ر‬     ‫ا‬     ‫1: أھ‬        ‫او‬

     ‫ن دان‬   ‫ل دا ءا‬     ‫ا و و ‪ ، La Colibacille E.coli‬ا ن ا‬      ‫را‬
     ‫م ل 02‬ ‫ا ر)‬    ‫ا د ا ورا وذ ك دة ا رات، أھ ا درة ا رة ذا ا ن‬
      ‫ت‬        ‫دات ن ا‬     ‫دة‬         ‫ا‬               ‫د (، و ذ ك و ره‬
      ‫ر ا رور ر ب‬    ‫ت ا ر وا‬            ‫أن و زم ھذه ا ر‬       ‫ور ت،‬
                                                              ‫ا رو ت.‬

                                     ‫3.‬        ‫2، و‬          ‫ل وأ ز ت ا ر ط : أ ظر ا و‬           ‫ب– أز تا‬
                                     ‫‪les enzymes de restriction‬‬                 ‫ل‬        ‫‪-a‬أز تا‬
      ‫ن ا وا د‬       ‫تد‬                 ‫وى ز ‪ADN‬‬                          ‫ا رف‬            ‫درة‬      ‫إ أز ت و‬
‫.‬     ‫ص‬       ‫ري ا ذي ا‬         ‫ل ل أ ز م ل ا م ا وع ا‬                  ‫واھ . و‬                 ‫ا زو ، و ط ا ز‬

                                                                 ‫‪Les ligases‬‬    ‫‪-b‬أز تارط‬
                   ‫ر ط أ زاء ‪ ADN‬طو ، وذ ك ر ط ا طراف ا و دة‬     ‫درة‬                                    ‫ھ أز ت و‬
                                                         ‫ا وا د ا زو .‬                                     ‫ب دأ‬



                    ‫ذ: و فا د‬    ‫ا‬                                                        ‫: - 36 -‬        ‫ا‬
3 ‫ا و ــــــــــ‬                                          C‫و‬G‫ن‬       ‫ و ط‬GGCC          ‫ : رف ا‬HaeIII ‫أ ز م‬

                                                                                              |
                           A T G G        C C T C                               A T G G| C C T C T
                                                                                       |
                                                                 ‫دا ط‬                  |
                           T A C C        C C A G                               T A C C G G A G A
                                                                                       |



              ‫أطراف و دة‬                               G‫و‬G‫ن‬    ‫ و ط‬GGATCC           ‫ : رف ا‬BamH1 ‫أ ز م‬


                     A G             G A T C C G                                A G G A T C C G T
                                                                 ‫دا ط‬
                     T C C T A G                GC                              T C C T A G G C A


                                                          A‫و‬G‫ن‬     ‫ و ط‬CTGCAG             ‫: رف ا‬Pst1 ‫أ ز م‬
              ‫أطراف و دة‬


                           A C T G C A          G T                             A C T G C A G T T
                                                                 ‫دا ط‬
                           T G           A C G T C A                            T G A C G T C A A




                                                         .3 ‫: أ ظر ا و 3، و‬ ‫ا‬ ‫ج– ا‬
                                          .ARNm         ‫ن ز‬   ‫ ا ط‬ADN ‫ھو أ ز م ط ر ب ز‬

3 ‫ا و ــــــــــ‬                                     .Transcriptase inverse           ‫ا‬           ‫3: ا‬           ‫او‬
       ‫ن‬  ‫، وھ ذا‬ARNm ‫ن ز‬         ‫ ا ط‬ADN ‫ر ب ز‬       ‫ھو أ ز م ل‬     ‫ا‬    ‫ا‬
                      . ‫ ا ذي ر ز‬ARNm ‫ن‬     ‫ر ز رو ن ن ا ط‬     ‫ر ب ا ور ا‬
       ‫، م دد ز‬     ‫ا‬   ‫نا‬      ‫ ا رد ا‬ADN ‫، دد ط‬     ‫ ا‬ARNm ‫ن ز‬        ‫اط‬
                                         . ‫ل ا ور ا ر و‬    ‫ ا زدو وا‬ADN


                                                                                                             A
                                                                                                             U
                                                                                                             C
                                                                                                             G
                                                                                                             G
                                                                                                             U
                                              ‫أزم و‬                             ‫ا‬         ‫ا‬                  A
                                                                                                             C
                                                                                                             G
                                                                                                             U
                                                                                                             C
       ‫ و ن‬ADN        ‫ز‬                      ARNm ‫ل ـ‬     ‫ ذات و ب وا د‬ADN ‫ن‬                                 ARNm

                   ‫ذ: و فا د‬         ‫ا‬                                              - 64 - :             ‫ا‬
                                                  ‫4.‬            ‫1، و‬         ‫ر : أ ظر ا و‬             ‫را ل ل ور إ‬

‫ا و ــــــــــ 4‬                                                                           ‫ر‬     ‫إ‬         ‫ن‬   ‫1: ل ا ور‬           ‫او‬
                                 ‫ر‬   ‫د نا‬          ‫زل ا‬
                                                                                                 ‫زل ‪ADN‬‬

                                                                         ‫ل‬      ‫ا‬   ‫و‬

                   ‫ر‬
                                                                ‫د‬

                                                                                                      ‫‪C A C G A A T T C TG C A‬‬
        ‫د وا ط‬ ‫لا‬                                                                                     ‫‪G T G C T T A A G A C G T‬‬
          ‫أز تا ل‬
                                                           ‫د‬         ‫د ‪ ADN‬ا‬                                          ‫وا‬       ‫ل ‪ADN‬‬
                                                               ‫وا ط أ ز ت ا ر ط‬
                                                                                                  ‫.‬
                                                                                            ‫‪C A C G‬‬              ‫‪A A T T C T G C A‬‬
            ‫رة ورا‬       ‫ر‬                                           ‫ر‬   ‫د‬                        ‫.‬
                                                                                            ‫‪G T G C T T A A‬‬                    ‫‪G A C G T‬‬
                                                                          ‫ورا‬
                                     ‫د‬       ‫زرع ا‬
                                         ‫)ا ور (‬


                                                                ‫:‬      ‫ا رور ن ا را ل ا‬                ‫ر‬         ‫ط ب ل ور إ‬

                                                                                      ‫أ – زل ا ور ) زء ن ‪( ADN‬‬
                                     ‫، وذ ك طر ن:‬                        ‫رز‬         ‫ا ر و ، م زل ا ور ا‬   ‫د ددا‬

    ‫‪ ADN‬وا ط‬                 ‫ز‬           ‫، م م ط‬                     ‫ا ور ا راد‬             ‫وي‬         ‫ا‬
                                                                                                       ‫زل ‪ ADN‬ا‬                   ‫•‬
                                                                                                         ‫ت ا ل.‬                  ‫أز‬
             ‫، و وا ط ا‬                           ‫ا ور ا راد‬   ‫وي‬                          ‫ا‬   ‫ص ‪ ARNm‬ن ا‬       ‫ا‬                 ‫•‬
      ‫ف ـ ‪ ADNc‬أطراف‬                              ‫ور ا ر و ، م‬                            ‫م ر ب ‪ ADNc‬ا ذي ون‬                       ‫ا‬
                                                                                                              ‫دة.‬                ‫و‬

                                               ‫ل.‬       ‫ب – إد ج ا ور دا ل‬
     ‫د وا ط أ ز م ا ل. م‬       ‫د (. م ط ا‬       ‫‪ E.coli‬ل زول ) =‬      ‫رج ن‬
          ‫ل ذك‬      ‫وا ط أ ز م ا ر ط.‬     ‫د زء ن ‪ ADN‬ا راد‬        ‫م ر ط ‪ ADN‬ا‬
                                 ‫‪.( E.coli‬‬     ‫ل)‬        ‫دا ل‬  ‫د ر م إد‬

                                                                                               ‫ج – ل و م ا ور .‬
    ‫ت‬       ‫ون ت، م ل ھذه ا‬                                ‫ر،‬       ‫‪ ADN‬ا‬                ‫ري، م زرع ا ر ا و‬      ‫دا ل‬
                ‫ر ا رة ورا .‬                           ‫ا‬            ‫وي‬                  ‫دة ت‬    ‫ل ذك‬    ‫ب د دة،‬    ‫إ‬

                                                   ‫4.‬               ‫د – ر د ا ر ت ا رة ورا . أ ظر ا و 2، و‬
         ‫ل ذا ا رض‬                       ‫ر,‬       ‫دا‬                 ‫ا‬       ‫وي‬      ‫د نا د ن و‬       ‫ل زرع ا‬
                                                                       ‫دات ا و .‬      ‫ا و‬       ‫د،‬   ‫صا‬
                       ‫ذ: و فا د‬              ‫ا‬                                                            ‫: - 56 -‬        ‫ا‬
          ‫د‬         ‫ز و ود ور ن: ا ور ‪) A‬‬
                    ‫ا‬     ‫و‬                    ‫ل ھذه ا‬        ‫دا‬                                             ‫ظ أن ا‬
                                   ‫د ا وي ‪.( B‬‬    ‫ور ‪ ) B‬و ا‬                                            ‫ا وي ‪ ( A‬وا‬
            ‫د ا ور ‪ A‬دون أن د ا ور ‪. B‬ادن ا ر ا‬      ‫ا د دة، د ا‬                                       ‫ور‬          ‫دد‬
       ‫د ا وي ‪ . B‬وھ ذا م ر دھ‬     ‫د ا وي ‪ A‬و و‬             ‫ون‬                                         ‫دا ر‬
                                                    ‫دات ا و .‬                                            ‫ل ھذه ا‬
‫ا و ــــــــــ 4‬
                                                                       ‫رة ورا‬       ‫ر تا‬       ‫2: ر د ا‬           ‫او‬
   ‫و‬      ‫ور‬                              ‫و‬      ‫ور‬
‫وي ‪A‬‬    ‫دا‬                             ‫وي ‪B‬‬    ‫دا‬
                                                                                       ‫د‬         ‫إ ج‬
                                                                                            ‫ر ورا‬

                                                      ‫‪ADN‬‬
                                                 ‫ضا ر ت ط د‬             ‫د ر ا ور ا و‬             ‫د ا ول ور ن‬            ‫نا‬
                                                  ‫د ا ر ورا‬ ‫ا‬           ‫د ا وي ‪A‬‬                 ‫دن و ن‪A‬و‪B‬‬              ‫و ن‬




                                                                                                                       ‫ل ل‬
                                                                                                      ‫ر ،و ل‬             ‫ري،‬
                                                                                                           ‫ا‬ ‫ط ا‬         ‫ا‬   ‫ا‬
                                                                                                        ‫دات ا رة.‬



              ‫وي ‪B‬‬       ‫دا‬                    ‫وي ‪A‬‬    ‫دا‬                ‫وي‬     ‫د‬    ‫دون‬

                                                                                    ‫ر ا ور .‬     ‫ه –‬
                    ‫رة‬        ‫ا‬   ‫ا ور ا ط و ، م زرع ھذه ا‬                   ‫وي‬    ‫ا تا‬      ‫ول‬    ‫دا‬
                              ‫ا ور ا د‬    ‫ن ر‬       ‫ن ا دة ا‬                  ‫أ ر‬ ‫رو‬            ‫رات‬
                                                                                               ‫د.‬     ‫ا‬
    ‫ظ .‬                 ‫ا ور ا ر و و دات وظ‬                 ‫فإ‬   ‫،‬             ‫ج رو ت‬     ‫وم ا ر‬

                                                                     ‫ا ورا‬      ‫: رفا د‬
       ‫أ رى‬                        ‫ط و ، وزر‬           ‫ص زء ن ‪ ADN‬ل ور‬             ‫ا د ا ورا ھ ا‬
     ‫م ن و ودة ن‬                    ‫ھ‬                    ‫ول ا ط‬ ‫ا رة ... (. وھ ذا م ا‬    ‫) ر أو‬
                                                         ‫طو .‬    ‫إ ج رو ت‬          ‫ل ا ط ، درة‬

                                                               ‫ت ا د ا ورا .‬                      ‫ط‬              ‫‪ – IIΙ‬أ‬
                         ‫4.‬     ‫1، و‬        ‫ط 3، و‬     ‫ر ون ا و ا ري أ ظر‬                          ‫جا‬            ‫ا‬
 ‫ا و ــــــــــ 4‬       ‫ر ون ا و ‪( Human growth hormone ) HGH‬‬                               ‫جا‬        ‫1: ا‬       ‫او‬
 ‫.‬   ‫ف ن 191 ض أ‬           ‫رو‬       ‫، و ون ن‬        ‫ھر ون ا و ا ري ‪ HGH‬رز ن طرف ا دة ا‬
 ‫ر ا و. و ض ھذا ا ص، ا ل ھر ون ا و‬          ‫ن إ رازه إ‬       ‫، إذ ؤدي ل‬    ‫وھو ا ؤول ن و ا‬
 ‫ن‬       ‫ت‬          ‫ا ت ذك‬     ‫،‬      ‫فا ر با‬           ‫ت ر و‬     ‫دى ا ر ذ 4491 ن ا و‬
               ‫ل وا ر.‬  ‫إ ج ھر ون ا و‬    ‫م‬    ‫ل ا د ا ورا‬       ‫. ن‬      ‫ث ر . وھ ذ ك ر‬
       ‫ا و 1 و 5، ن ف ن إ ج ھر ون ا و.‬           ‫ت ا د ا ورا ، و‬        ‫و ك ول‬       ‫د‬

                        ‫ذ: و فا د‬       ‫ا‬                                                  ‫: - 66 -‬          ‫ا‬
                                                                     ‫5.‬    ‫1، و‬             ‫‪ - a‬ل ا ور : أ ظر ا و‬
‫ا و ــــــــــ 5‬                          ‫ر‬    ‫ا‬   ‫ري إ‬   ‫1 : را ل ل ور ا ر ون ا‬                    ‫او‬
                                                                                                                     ‫ر‬

                                                                                                                         ‫‪ADN‬‬
‫إ راز ھر ون ا و ا‬




                                                                                                    ‫‪1a‬‬
                                                                           ‫ر‬       ‫ا ور ا‬
                           ‫5‬          ‫4‬                    ‫3‬


                                                                       ‫2‬
                                                                                                                               ‫ري‬
‫ري‬




                                                                                                              ‫‪1b‬‬                   ‫د‬

                                                                                     ‫د‬          ‫ا‬                   ‫ر ‪E.coli‬‬


   ‫ل‬      ‫زل ‪ ADN‬ا ري و ز‬                                        ‫إ‬         ‫ول‬ ‫+ زل ا ور ا ر وب : ن ا‬
  ‫ا ر وا ذي‬      ‫ا دة ا‬     ‫رة ن‬                                   ‫ص‬       ‫ن ‪ ARNm‬ا‬  ‫أ ز ت ا ل. أو ا ط‬
         ‫ل أ ز م ا رة ) ‪ADN‬‬    ‫ر‬                                 ‫م رة ا ر ط ا‬      ‫ا‬  ‫ا‬      ‫د ذك‬
                                                                                                                         ‫‪.(polymérase‬‬

                        ‫د ز .ذ رأ ور‬            ‫ل‬      ‫زاء ‪ ADN‬ا‬                           ‫نأ‬                ‫+ ر د ا زء ا ر وب‬
    ‫د‬                   ‫ن زيء ‪ .ADN‬ا دا‬           ‫ن ا زاء ا‬                                ‫وث‬            ‫ول ا زء ا‬      ‫و ت‬
           ‫ط‬             ‫‪ .Elèctrophorése‬د ذا ك‬     ‫ا رة ا ر‬                               ‫ل‬              ‫:‬       ‫ن ل ا زاء‬
                              ‫ا ر ط زء ‪ ADN‬ا وث (.‬          ‫درة‬                           ‫و ا‬               ‫‪ ARN‬س ) ون‬
                    ‫د. ھذه ا ر‬        ‫ھ ھ ا‬                    ‫ا‬  ‫: او‬   ‫ا‬   ‫او‬                               ‫ل‬      ‫+ إد ج ا ور ا‬
                                          ‫ا ور .‬               ‫د م أزم ارط د‬    ‫ا‬                         ‫ل‬        ‫لأزما‬    ‫طب ا‬
            ‫++‪Ca‬‬               ‫أھ‬   ‫رة ھ إ‬         ‫نا‬     ‫ر)‬     ‫دا‬            ‫ر‬      ‫ا‬      ‫د ا ر ب)ا ر(‬   ‫+ إد ل ا‬
                                                                                          ‫د ا ر ب.‬        ‫صا‬    ‫ا‬

                                                                             ‫‪ - b‬ر د ا ر ا رة ورا :‬
  ‫ون درة‬     ‫د ا ر ب، وا‬   ‫ا‬                                            ‫و ر دا‬    ‫ددا ر ا‬    ‫دف ھذه ا ر إ‬
        ‫ل لد‬      ‫دا‬     ‫صا‬                                           ‫ر‬      ‫إ ج ھر ون ا و) ن ا رة إ أھ‬
                                                                      ‫دات ا و (.‬     ‫ضا‬    ‫و‬       ‫ور ا د‬

                                                                                            ‫:‬‫‪ - c‬زرع ا ر ا ر‬
                    ‫د‬           ‫ا‬                    ‫ا ظروف ا‬              ‫ث‬                ‫رات‬        ‫زرع ا ر ا ر‬
                                                                                     ‫وا رة.‬     ‫ج ھر ون ا و‬  ‫رھ‬

                                                             ‫ص ا وج ) ھر ون ا و(:‬       ‫‪-d‬ا‬
                    ‫ف،‬     ‫ول د‬               ‫ول ري د ر ز ) رط ا و ر (، م د رھ‬            ‫را ر‬
                                                ‫ر وب ا ظ .‬      ‫و طرد ا ر ون إ ا و ط ا ر‬    ‫ا‬
                               ‫ذ: و فا د‬       ‫ا‬                                                              ‫: - 76 -‬         ‫ا‬
                               ‫5.‬       ‫2، و‬      ‫و ن ‪ Insuline‬أ ظر و‬              ‫جا‬             ‫ا‬
‫ا و ــــــــــ 5‬                                           ‫و ن ‪Insuline‬‬      ‫جا‬        ‫2: ا‬       ‫او‬

            ‫‪ β‬ز رات‬        ‫ن طرف‬       ‫ا ر ا دم، و م إ‬         ‫ا و ن ھر ون ض‬
          ‫. و ل ص ھذا ا ر ون ؤدي إ رض ا ري. ا ذي‬                ‫‪ Langerhans‬ا ر‬
    ‫ت‬    ‫ؤدي إ ظ ور‬      ‫ھذه ا‬        ‫و ن ا وا ، إ أن ا‬        ‫نا ص‬            ‫ھذه ا‬
                 ‫ن أ و ن ا وا ت وا و ن ا ري.‬               ‫أر ، م ا ف ا ر ب ا‬
     ‫إذ م ر ب ا ور ا ط‬          ‫ت‬    ‫ت ا د ا ورا م إ ج ا و ن ا ري‬             ‫ل‬
    ‫ر‬    ‫ت‬         ‫ن ‪ ARNm‬ا ول ن إ راز ھذا ا ر ون . م د ذ ك ت ھذه ا ور إ‬
        ‫او ط ا ر‬      ‫وم د ذ ك ج ھذا ا ر ون وطر‬           ‫تا‬     ‫رة ا رة و ض ا‬
                                                                            ‫رة.‬
                        ‫و ن ر ك ول آ ت ا د ا ورا :‬              ‫نا ط تا‬        ‫اط‬
                             ‫ج ا و ن ا ري‬          ‫1( ن أھ ا وء إ ا د ا ورا‬
                              ‫ج ا و ن ا ري.‬          ‫2( أ ط را ل ط ق ا د ا ورا‬

          ‫ت ا ر ب‬        ‫ف ا د ت، إ أ ظ ر ض ا‬     ‫و ن س ا دور د‬    ‫1(‬
        ‫ت أر .‬    ‫ن، ؤدي إ ظ ور‬   ‫دا‬    ‫ل ا و ن ا وا‬      ‫. وذك‬    ‫ا‬
        ‫و ن ا ري.‬    ‫جأ و ن ط ق‬      ‫و ن ھ ظ ر أھ ا وء إ ا د ا ورا‬
                                ‫أ ل.‬   ‫ت وا رة، و‬  ‫أن ھذا ا و ن ون‬

                                          ‫و ن ا ري :‬      ‫2( را ل ط ق ا د ا ورا‬
                                                              ‫جا‬
                                              ‫.‬     ‫ن ور ا‬          ‫ا‬         ‫+ زل ا‬
           ‫‪ ADN‬ا طوع أطرا‬      ‫وا ط أ ز م ا ل.) ظ ر‬            ‫+ ط ‪ ADN‬ا راد ا‬
                                                                               ‫و دة(.‬
                                                   ‫د ) ل( ن ر‬             ‫+ ا راج ا‬
            ‫د ا طوع أطرا‬    ‫د وا ط أ ز م ا ل. ) ك ‪ ADN‬ا‬                ‫+ ط ‪ ADN‬ا‬
                         ‫ل أطراف ‪ ADN‬ا ري ا زول (.‬                    ‫وا‬        ‫و دة،‬
                                      ‫د وا ط أ ز م ا ر ط.‬        ‫ا‬        ‫+ د ا ور‬
                                                     ‫د إ دا ل ا ر .‬             ‫+ لا‬
                                                      ‫+ ر د ا ر ت ا رة ورا .‬
                       ‫.‬  ‫ا ور ا راد‬        ‫ت ور‬           ‫ول‬       ‫+ ما ر ت‬
                                   ‫إ ج ا و ن.‬            ‫+ ث ا ر ت ا رة ورا‬

                        ‫5.‬      ‫3، و‬           ‫رة أ ظر و‬     ‫رات ا‬    ‫ر ا‬         ‫ل ا درة‬
    ‫د‬           ‫ل ا زار ون ا دات ا ر ، إ أ أ طت‬    ‫و أ رو ت ا را ت ا ر ، ا‬
               ‫ل ا ور ا ؤو ن إ ج رو ن م‬       ‫ا ون إ ا د ا ورا‬        ‫دودة. ذا‬
                       ‫رو ت.‬      ‫ذك و‬         ‫ا ،‬       ‫وم‬        ‫رو ت، ود‬


                   ‫ذ: و فا د‬        ‫ا‬                                       ‫: - 86 -‬          ‫ا‬
‫ا و ــــــــــ 5‬                                            ‫رة.‬   ‫رات ا‬       ‫ر ا‬              ‫3: ل ا درة‬           ‫او‬

‫ف‬   ‫ر أ رو ت ا را ت ا ر )‪ ، La pyrale du maïs (Ostrinia nubilalis‬أ ر‬
   ‫دث أ رارا‬      ‫،‬    ‫أ‬    ‫ذى‬       ‫ت ا ذرة، إذ و ل ا رو ت دا ل ق ا‬
                           ‫ف ا و.‬       ‫ب‬   ‫ا تا‬      ‫وى ا ل وا ذور،‬
‫‪Bacillus‬‬     ‫نا ر ت د‬     ‫و أ رو ت ا را ت ا ر ، ا ف ض ا ء و‬
  ‫ر ت.‬         ‫رو ت، و ر ر‬             ‫ط ر ب رو ن م‬        ‫‪thuringiensis‬‬

     ‫ر ‪La pyrale‬‬           ‫را‬                                                                                       ‫3‬    ‫او‬
                                               ‫و و‬
                                            ‫رة ا زاوج‬                          ‫ا وض‬        ‫و‬
                                                                                                       ‫و و- و وز‬
                                  ‫ل2‬    ‫ا‬                                                             ‫ظ ور ا رو ت‬


                                                                                 ‫دورة و‬
                                                                                ‫ا را ا ر‬
                                                                                                           ‫ت‬
                                                                                                      ‫ن‬    ‫د را‬
                                         ‫ي‬
                                       ‫لا ر‬



    ‫‪Bacillus thuringiensis‬‬        ‫ل3‬    ‫ا‬                                                                           ‫ل1‬   ‫ا‬
                                                                                   ‫ء‬    ‫ا رف-ا‬


   ‫ا و ــــــــــ 6‬
                                       ‫ت ا ذرة.‬         ‫6، را ل ل ور ا رو ن ا م‬                           ‫4 و‬       ‫ط او‬
           ‫ر ‪Bacillus thuringiensis‬‬                                 ‫ت ا ذرة‬    ‫م‬       ‫4 : را ل ل ور ا رو ن ا‬                ‫او‬


     ‫ن‬     ‫ا ور ا ؤو‬                                                                ‫رو ت‬       ‫وت ا‬
      ‫م‬   ‫إ ج ا رو ن ا‬




                                             ‫م‬   ‫ا رو ن ا‬




              ‫ت ا ذرة‬             ‫م‬     ‫إ ج ا رو ن ا‬

                      ‫ذ: و فا د‬    ‫ا‬                                                            ‫: - 96 -‬        ‫ا‬
   ‫ر ‪.( Agrobacterium turingiensis‬‬                                        ‫ا ط )‬                             ‫دا‬         ‫+ رف ا ور ذات ا‬
                                                                                                                    ‫+ زل ا ور ذات ا .‬
                                                                                        ‫ل.‬       ‫د‬               ‫+ د ا ور ذات ا دا ل‬
                                                                                                                ‫د ا ر ورا .‬       ‫+ ما‬
                                                                                                                 ‫ا رة ورا .‬      ‫+ر دا‬
                                                                                                                   ‫+ إ ت ت رة ورا .‬

                                                                ‫6.‬        ‫5، و‬                ‫أ ظر و‬            ‫ن ا ردود ا زرا‬                     ‫ار‬
‫ا و ــــــــــ 6‬                               ‫) ‪( OGM‬‬           ‫د ورا‬             ‫تا‬               ‫وا ط ا‬           ‫ن ا ردود ا زرا‬                ‫5: ا ر‬              ‫او‬
                                     ‫ا‬         ‫ت ا د ورا وا‬                              ‫تا‬                 ‫رج‬       ‫ا‬              ‫نا ط تا‬   ‫اط‬
                                                                                                                                        ‫ردود ا ج.‬
                                                                                   ‫ل2‬     ‫ا‬     ‫ر‬    ‫ون ھ‬                                                     ‫ل1‬       ‫ا‬
                        ‫د ورا‬       ‫تا‬         ‫ت ا زرو‬          ‫طور ا‬                                     ‫005‬
                                                                                                          ‫004‬
                   ‫001‬
                                                                                                          ‫003‬
                       ‫08‬                                                                                 ‫002‬

                                                                                                          ‫001‬
                       ‫06‬
                                                                                        ‫دول‬
      ‫ون ھ ر‬




                                                                                                            ‫0‬
                                                                                    ‫دول‬                          ‫و‬         ‫طن‬         ‫و زا‬       ‫ذرة‬          ‫وع‬   ‫ا‬
                       ‫04‬
                                                                                                      ‫ر ‪OGM‬‬      ‫ت زرو ت‬                  ‫ت زرو ت ‪OGM‬‬
                       ‫02‬
                                                                                                          ‫ت ا د ورا )‪(OGM‬‬              ‫ت ا زرو‬         ‫وع ا‬
                       ‫0‬                                                                                     ‫ت ر ا د ورا‬             ‫ت ا زرو‬             ‫ر‬
                             ‫وات 6002 4002 2002 0002 8991 6991‬                 ‫ا‬


               ‫ا‬                ‫ا‬    ‫ا‬                           ‫ل4‬        ‫ا‬                                                                                   ‫ل3‬          ‫ا‬
   ‫و‬               ‫ا‬        ‫ون‬   ‫ا زرو‬                                                                ‫د ورا‬       ‫تا‬                ‫ت ض أ واع ا‬
                               ‫ھ ر‬                     ‫وع ا زرا ت‬
                                                                                          ‫ط طس‬                             ‫ذرة‬                                ‫و‬
 ‫06 %‬                           ‫4.84‬           ‫ب‬       ‫دا‬   ‫و‬
                                                                                          ‫دات‬        ‫لا‬  ‫-‬           ‫رات‬        ‫ا‬     ‫و‬      ‫-‬    ‫دات‬  ‫- لا‬
 ‫41%‬                            ‫2.11‬                    ‫ا ذرة ‪Bt‬‬
                                                                                                         ‫ا‬                           ‫رة‬      ‫ا‬         ‫.‬     ‫ا‬
 ‫5%‬                             ‫3.4‬             ‫ل دا ب‬   ‫ا و زا‬
                                                                                                      ‫- و‬                ‫دات‬        ‫لا‬       ‫-‬   ‫ر ب‬     ‫- ر‬
 ‫2%‬                             ‫5.1‬              ‫ل دا ب‬     ‫طن‬
                                                                                                    ‫ا راض.‬                                   ‫ا‬            ‫ازت‬
 ‫5%‬                             ‫3.4‬              ‫دا ب‬       ‫ذرة‬
                                                                                                       ‫ر‬             ‫ا راض‬         ‫و‬         ‫-‬       ‫وا رو ت‬
 ‫6%‬                             ‫5.4‬                     ‫طن ‪Bt‬‬
                                                                                                      ‫ا .‬                           ‫ر‬             ‫-ا ج ز ت‬
 ‫4%‬                              ‫3‬             ‫ل دا ب‬   ‫طن ‪Bt‬‬
                                                                                                                                ‫ا رو ت.‬                    ‫و‬
                                                                                                                                                     ‫ز ت.‬
 ‫001%‬                           ‫18‬                                   ‫وع‬        ‫ا‬


                            ‫:‬            ‫ھ ت ھذه ا‬      ‫ت د ورا ،‬
                                                            ‫ث‬               ‫ول‬  ‫نا‬     ‫ت ا د ا ورا‬
                                                        ‫رات ) ذرة وا طن (.‬     ‫+ ل ضا ت و‬
  ‫.‬      ‫ب اط‬                          ‫رة وا‬    ‫ل ا رات ا‬     ‫ل‬       ‫دات ا‬    ‫+ ل ضا ت و‬
        ‫ص‬    ‫ا‬                          ‫درة‬       ‫ل ا ور ت ا ر ا ؤو ن ت أزوت ا واء إ ا ت و‬
                                                                 ‫ل ا دة ا زو .‬    ‫دم ا‬         ‫ا زوت،‬
                                                      ‫ذ .‬      ‫ن‬    ‫ا‬       ‫إ ج رو ت‬      ‫+ ر ا درة‬
                                                       ‫ا ج.‬       ‫و ذا م ا ر ن ردود ا ج، وا ص ن‬
                                ‫ذ: و فا د‬          ‫ا‬                                                                           ‫: - 07 -‬                ‫ا‬
                                                                          ‫ا و دة ا‬

    ‫ﻧﻘـﻞ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ ﻋﺒﺮ اﻟﺘﻮاﻟﺪ اﻟﺠﻨﺴﻲ – ﻋﻠﻢ اﻟﻮراﺛﺔ اﻟﺒﺸﺮﻳﺔ‬

     ‫د ن ھ ن:‬          ‫ن ل ر، و ز ھذه ا ظ ھرة‬         ‫ن ل ا ر ا ورا‬         ‫ن ا وا د ا‬
          ‫ل‬             ‫ا م ا واة ا ذ ر وا واة ا و ، ؤدي إ‬           ‫ب ا ذي‬       ‫•ا‬
                                                                      ‫.‬     ‫ا‬        ‫ا‬
         ‫م‬        ‫ا‬    ‫درة‬         ‫ا‬    ‫أ د ا‬       ‫إ ج‬          ‫ج ا ذي‬     ‫لا‬      ‫•‬
                                                         ‫.‬     ‫ا‬        ‫ا‬    ‫رداد‬


‫؟‬            ‫ا‬      ‫تا‬        ‫د‬        ‫ر ا وا د ا‬      ‫ر ا ورا‬     ‫1( ف ل ا‬
     ‫؟‬             ‫و ا‬       ‫ت ا ورا ؟ و‬      ‫لا‬                 ‫2( ا وا ن ا‬




                 ‫ذ: و فا د‬   ‫ا‬                                     ‫: - 17 -‬    ‫ا‬
                                                      ‫ل ا ول:‬               ‫ا‬
                             ‫ﻧﻘـﻞ اﻟﺨﺒﺮ اﻟﻮراﺛﻲ ﻋﺒﺮ اﻟﺘﻮاﻟﺪ اﻟﺠﻨﺴﻲ‬
‫ا و ــــــــــ 1‬                                                                                                                ‫د:‬
        ‫– و ود د د –‬            ‫ن– و‬       ‫وان وي –‬             ‫–‬        ‫إ ن‬    ‫ن:‬    ‫را ل و ا‬              ‫ط تا‬                 ‫لا‬
                                                                                                                                 ‫.‬
                                                                          ‫ن ھذه ا طوار.‬          ‫1( أ ز ط ط ن ا‬
                                         ‫ز ا وا د ا‬         ‫ا‬            ‫زة، ن ا ظواھر ا‬       ‫نا طط ا‬    ‫2( ا ط‬


                                             ‫(‬     ‫م ا زا‬       ‫ج)ا‬       ‫لا‬
                   ‫‪2n‬‬                  ‫‪2n‬‬                           ‫‪2n‬‬                    ‫‪2n‬‬                     ‫وان وي‬              ‫‪n‬‬
                    ‫إ ن‬             ‫و ود د د‬                        ‫ن‬                                ‫ب‬      ‫إ‬
                                                                                                                            ‫و‬        ‫‪n‬‬

                                                  ‫د نھ نھ :‬               ‫ز ا وا د ا‬
                                     ‫ل.‬      ‫وى ا‬       ‫ج ا ذي م‬       ‫لا‬
            ‫، ون‬      ‫وا دة ھ ا‬   ‫طء‬    ‫ب وھو ا م وا ن ذ ر وأ و‬             ‫ا‬
                    ‫.‬      ‫ا‬    ‫جأ د ا‬     ‫أن ا‬    ‫، ا ء ا ذي‬        ‫ا‬        ‫ا‬
            ‫ت ن ل ر د س ا وع ؟‬          ‫ت دد ا‬             ‫ظ ا وا د ا‬     ‫ف‬

                                                                ‫‪La méiose‬‬                 ‫زا‬      ‫ما‬             ‫‪ – Ι‬را ل ا‬
‫ا و ــــــــــ 1‬           ‫1.‬      ‫1، و‬          ‫زا . أ ظر ا و‬           ‫ما‬       ‫را ل ا‬         ‫ر‬         ‫ظت‬               ‫1‬
                                                        ‫ت ا رد‬           ‫ن وع ا‬      ‫ؤو‬        ‫ا ظواھر ا‬        ‫ط 1 : درا‬
      ‫ھذا‬     ‫نآ‬          ‫لاو قا‬    ‫ث ن‬       ‫أ د .‬           ‫إ‬                           ‫ن ا رور ن‬      ‫م ا زا‬    ‫نا‬
                                                  ‫ت ا رد .‬  ‫وع ا‬                ‫‪ ، ADN‬م دوره‬       ‫طور‬        ‫مو ن‬    ‫ا‬
                                          ‫م ا زا .‬    ‫تأ ءا‬                     ‫ر‬     ‫ظت‬      ‫ا و 1 : ط ھذه ا و‬
                                         ‫ر ز .‬       ‫ل ورة د ر‬                      ‫م أ ط وا‬      ‫ف ظ ر ھذه ا‬

                                                                                                                        ‫.‬   ‫1‬        ‫او‬




                    ‫ذ: و فا د‬        ‫ا‬                                                           ‫: - 27 -‬           ‫ا‬
                       ‫ن ل وا د‬          ‫ن،‬            ‫ن‬          ‫را‬     ‫م‬         ‫زا‬        ‫ما‬   ‫ظ أن ا‬                  ‫ن ن ھذه ا‬
                                                                                        ‫ر.‬     ‫م را‬                     ‫ا را ل ا دة‬
       ‫وا‬       ‫‪ = C .I‬ا طور ا‬                       ‫دي ‪ = B .I‬ا طور ا‬                   ‫ور: ‪ = A‬ا طور ا‬                      ‫ا ر ب از‬
                                                                                                                                    ‫‪.II‬‬
  ‫‪.I‬‬           ‫‪ = F .I‬ا طور ا‬                ‫وا‬      ‫دي ‪ = E .II‬ا طور ا‬                 ‫‪ = D‬ا طور ا‬
                           ‫‪.II‬‬                        ‫‪ = H .II‬ا طور ا‬                   ‫‪ = G‬ا طور ا‬

                           ‫1.‬     ‫2، و‬             ‫زا . أ ظر ا و‬              ‫ما‬             ‫لا‬             ‫‪ADN‬‬          ‫2 طور‬
‫ا و ــــــــــ 1‬
   ‫؟‬        ‫ل ھذه ا و‬      ‫ص ن‬               ‫زا . ذا‬         ‫ما‬     ‫‪ ADN‬أ ء ا‬                    ‫طور‬        ‫2 : ط ھذه ا و‬             ‫او‬
                                                                                                                                  ‫2‬ ‫او‬
                                                                  ‫‪ADN‬‬                                                       ‫ت‬    ‫دد ا‬
                                                                  ‫ل‬                     ‫2‪G‬‬                                    ‫------‬
                                                     ‫‪2Q‬‬

                                                       ‫41‬

                                     ‫3‬        ‫او‬       ‫21‬                           ‫‪S‬‬

                                                       ‫01‬

                                                       ‫‪Q‬‬
                                                                    ‫1‪G‬‬
                                                       ‫6‬
                                                                                                                             ‫‪2n‬‬
                                                       ‫2/‪Q‬‬
                                                                                                                             ‫‪n‬‬
                                                       ‫2‬

                                                        ‫0‬                                                                       ‫از ن‬


  ‫طور ا ر ب ‪ S‬ن‬                     ‫‪ADN‬‬                      ‫رف‬          ‫ا‬      ‫ون‬ ‫ما‬      ‫قا‬‫ا‬          ‫ر‬       ‫زا‬
                                                                                ‫‪ q‬إ 2‪. q‬‬
       ‫‪ q‬ن ‪.ADN‬‬                           ‫ل ل‬             ‫تا‬     ‫لا‬         ‫ف‬      ‫ما‬      ‫لا‬
                                                    ‫.‬      ‫إ ‪n‬‬       ‫ت ن ‪2n‬‬         ‫ض دد ا‬
                ‫2/‪ q‬ن‬                 ‫ل ل‬      ‫ا وا د‬      ‫تا‬      ‫ل‬          ‫ما د‬         ‫لا‬
                                                                                          ‫‪.ADN‬‬
                                                                     ‫ت ت.‬         ‫دد ا‬
                  ‫أ د ا‬                 ‫ول‬    ‫نا‬          ‫م ا زا‬     ‫ل ھذه ا و أن ا‬      ‫ن ن‬
                ‫ا‬    ‫لا‬             ‫ل‬      ‫، وھذه ا ظ ھرة‬     ‫ا‬    ‫ا‬          ‫ن‬       ‫اط‬      ‫ا‬
                                                            ‫.‬    ‫ا‬       ‫ب أن ون أ د ا‬        ‫ا‬

                                                        ‫2.‬        ‫4، و‬         ‫م ا زا . أ ظر ا و‬                    ‫3 را ل ا‬
                                                                                     ‫ن:‬        ‫ن‬                   ‫م‬      ‫ز ھذا ا‬
                   ‫ا‬      ‫نأ د‬        ‫ل‬              ‫ف و ؤدي إ‬               ‫تإ ا‬         ‫زل دد ا‬                 ‫ف:‬        ‫ا م‬
                                                                                                                        ‫‪.n‬‬        ‫ا‬
                         ‫أ د ا‬                ‫ل أر‬            ‫، ؤدي إ‬          ‫ت‬                 ‫دد ا‬              ‫ا م د :‬
                                                                                                                           ‫‪n‬‬      ‫ا‬


                        ‫ذ: و فا د‬        ‫ا‬                                                                   ‫: - 37 -‬       ‫ا‬
       ‫زا .‬        ‫ما‬      ‫ف أطوار ا‬       ‫ددا‬   ‫ل ھذه ا ر وم‬   ‫.‬   ‫زا‬   ‫ما‬   ‫طوار ا‬        ‫ر‬     ‫طط‬       ‫4 : ر وم‬   ‫او‬
‫ا و ــــــــــ 2‬                                          ‫‪II‬‬                                                          ‫‪I‬‬
                                                                                    ‫1‬
                                                                                    ‫2‬
                                                                                    ‫3‬




                                                                                        ‫4‬




                                                                                ‫5‬


                                                                                ‫6‬




                                                                                    ‫7‬




                        ‫ذ: و فا د‬      ‫ا‬                                                        ‫: - 47 -‬        ‫ا‬
                                                               ‫ما‬       ‫أ–ا‬                    ‫ف:‬
                                                    ‫د ‪:I‬‬    ‫‪–a‬ا ر ا‬
     ‫ار ت‬           ‫ل أزوا‬       ‫تا‬       ‫ت وا ران ا‬    ‫فا‬        ‫ز ھذه ا ر‬
     ‫ن (، ا ء ا ء ا ووي و ا و ت.‬     ‫ون ن‬            ‫ن ل‬     ‫ن‬       ‫) ل ن‬
  ‫دھ ،‬    ‫أ ء‬         ‫ن، م دل أ زاء‬      ‫نا‬       ‫تا‬      ‫ط‬       ‫ل ھذه ا ر‬
‫د د.‬        ‫تور ب‬          ‫ط‬        ‫ھذه ا ظ ھرة ا ور ‪ Crossing-over‬ا ذي‬     ‫و‬
                                                          ‫أ ظر ا و 3، و 1.‬

                                                                               ‫‪:I‬‬          ‫وا‬       ‫ا‬      ‫‪–b‬ا ر‬
    ‫ا زل‬           ‫نوظ ر‬               ‫ون ا‬        ‫،‬          ‫وا‬           ‫ا وى ا‬                       ‫تا‬     ‫ا‬    ‫و‬
                                                                                                                 ‫ا و .‬

                                                ‫‪:I‬‬     ‫‪–c‬ا ر ا‬
‫،‬    ‫و ا طب ا وي ا ر ب‬     ‫دون ا م ا زيء ا ر زي، وھ ر‬   ‫تا‬   ‫لا‬    ‫ا‬
        ‫ل وا د‬      ‫، أي ‪n‬‬     ‫ا‬     ‫فا‬        ‫ل طب ن ط ا‬      ‫وھ ذا‬
                                                            ‫ن.‬

                                                                                      ‫‪:I‬‬            ‫ا‬        ‫‪–d‬ا ر‬
      ‫و زم‬         ‫ما‬     ‫و دث ا‬           ‫و‬       ‫ا زل ا‬                 ‫ل طب،‬   ‫ت‬                       ‫ف دد ا‬
                                                     ‫) ‪.( n‬‬             ‫ا‬     ‫نأ د ا‬                    ‫ن‬        ‫ول‬

                                                                                       ‫ما د :‬     ‫ب–ا‬
                                                                                ‫د ‪: II‬‬     ‫‪–a‬ا ر ا‬
     ‫و‬     ‫زل ا‬    ‫طرة طو ، و ظ ر ا‬                    ‫ت‬           ‫ا‬         ‫‪،I‬‬     ‫رة د ا‬   ‫رة دا دئ‬
                                                                                                   ‫.‬  ‫ل‬

                                                                               ‫‪: II‬‬        ‫وا‬     ‫‪–b‬ا ر ا‬
                        ‫وا .‬       ‫ا‬           ‫ا‬              ‫وا‬           ‫ا وى ا‬                ‫ت ل‬    ‫ا‬ ‫و‬

                                                                                 ‫‪: II‬‬             ‫‪–c‬ا ر‬
                                                                                                    ‫ا‬
‫،‬                 ‫ل ل وا د‬                     ‫ت ل‬             ‫ل‬            ‫،و‬            ‫ا ط ر ا زيء ا ر زي ل‬
                                                                                           ‫.‬  ‫ر وأ د ط ا‬

                                                                                 ‫‪: II‬‬    ‫‪–d‬ا ر ا‬
‫زل‬          ‫ل ا ء ا ووي و ظ ر ا و ت، و‬                          ‫و‬           ‫ل طب و زال و‬     ‫ت‬  ‫ا‬
         ‫) ‪ ،( n‬ل‬      ‫ا‬     ‫أ د ا‬                            ‫أر‬            ‫م، و م ا و زم ون ا‬      ‫ا‬
                                                                                       ‫وا د.‬   ‫ون ن‬

                                       ‫ت‬           ‫طا‬                  ‫ب‬         ‫وا‬       ‫زا‬      ‫ما‬         ‫‪ – ΙΙ‬دور ا‬
                                                                                      ‫:‬    ‫م ا زا‬    ‫أ – دور ا‬
              ‫ا‬              ‫ن‬             ‫اط‬      ‫ا‬                    ‫أ د ا‬             ‫م ا زا إ ج‬       ‫نا‬
                        ‫ل إ آ ر.‬           ‫ن‬  ‫ت ا ورا‬                  ‫ت وا ل ا‬            ‫طا‬   ‫ن‬        ‫،‬     ‫ا‬


             ‫ذ: و فا د‬         ‫ا‬                                                                ‫: - 57 -‬       ‫ا‬
                                                    ‫ل أ، و 3.‬      ‫5،‬             ‫: أ ظر ا و‬            ‫طا‬        ‫‪–a‬ا‬
‫ا و ــــــــــ 3‬
‫ت ا رد ؟‬           ‫وع ا‬              ‫طا‬       ‫ت. ن ف ؤرا‬          ‫طا‬                  ‫زا‬   ‫ما‬   ‫دور ا‬     ‫ن ھذه ا و‬       ‫5:‬     ‫او‬




                                                                            ‫ا راق ا‬
                                                                            ‫تا‬
                                                                            ‫ا‬
                                                                            ‫ل‬
                                                                            ‫ت ل‬




                               ‫أ ط د دة ا ر ب‬
                                                      ‫طا‬    ‫لب:ا‬       ‫ا‬                                         ‫طا‬            ‫لأ:ا‬      ‫ا‬



     ‫تأ ء‬                       ‫وا‬    ‫رة ا‬      ‫‪ Brassage interchromosomique‬ن ا‬                                   ‫طا‬             ‫ا‬
                                                   ‫ددة.‬       ‫و ت‬       ‫ل ذك‬    ‫‪،I‬‬                                             ‫ا طور ا‬

                                              ‫ل ب، و 3.‬           ‫5،‬        ‫: أ ظر ا و‬                  ‫طا‬        ‫‪–b‬ا‬

       ‫ھذه ا ظ ھرة ا ور، وا‬                     ‫،‬          ‫تا‬          ‫ا طور ا دي‪ I‬ن دل ط‬
                                                                       ‫نا‬
   ‫‪.Brassage intrachromosomique‬‬                              ‫طا‬      ‫ھذا ا ط‬     ‫ت،‬  ‫طا‬   ‫ن ن‬
                                                                  ‫ج.‬  ‫وا ذي ن ن إ ج ر ت د دة ن ا‬

                                                                  ‫3.‬        ‫6، و‬           ‫ب : أ ظر ا و‬         ‫ب – دور ا‬

     ‫ت ذات‬                ‫ون‬         ‫ج ا ذ ر وا و ا و ورا ، إ‬      ‫1( ؤدي ا ء ا وا‬
     ‫قا ط‬                 ‫ب‬           ‫. وھ ذا ن ا‬ ‫ت‬    ‫د و ، ط أ رادا‬          ‫ر‬
                                                      ‫. ) أ ظر ا و 6، و 3 (.‬     ‫ا‬


                     ‫ذ: و فا د‬            ‫ا‬                                                        ‫: - 67 -‬           ‫ا‬
    ‫ا و ــــــــــ 3‬                                                                                                                                                       ‫6‬               ‫او‬
      ‫ج‬            ‫أم‬                                                                             ‫ج‬              ‫أم‬
               ‫و‬        ‫ا‬                                                                                      ‫اذ ر‬

                                                                                                                                                                   ‫زا‬           ‫ما‬              ‫ا‬
                                                                                                                                                            ‫ج‬                  ‫لا‬           ‫د‬




                                                                                                                                                                           ‫ب‬           ‫ا‬




           ‫،‬                     ‫لا‬         ‫) ‪ ( 2n‬أ ء‬  ‫ا‬        ‫ا‬                                                  ‫ب ا رداد‬                      ‫ل دور ا‬                      ‫2(‬
    ‫ا و ــــــــــ 4‬                     ‫ل وا د. ) أ ظر ا و 7، و 4 (.‬                                                  ‫نب)‪(n‬‬                       ‫اد ج‬
                                                                                                                                                                                   ‫7‬            ‫او‬
               ‫لأ‬                ‫ذ‬                ‫لذ ر‬       ‫ذ‬


                                                                           ‫1‬         ‫2‬                ‫3‬         ‫4‬         ‫5‬              ‫1‬            ‫2‬                ‫3‬           ‫4‬            ‫5‬



                                                                          ‫6‬          ‫7‬            ‫8‬            ‫9‬          ‫01‬            ‫6‬             ‫7‬            ‫8‬               ‫9‬            ‫01‬


                                                                          ‫11‬        ‫21‬            ‫31‬          ‫41‬          ‫51‬
‫‪X‬‬                                                                                                                                       ‫11‬         ‫21‬           ‫31‬              ‫41‬              ‫51‬
                                         ‫‪X‬‬
                                                                          ‫61‬        ‫71‬            ‫81‬                           ‫‪Y‬‬
                                     ‫‪X‬‬        ‫‪Y‬‬                                                                                         ‫61‬         ‫71‬              ‫81‬
                                                                                                                          ‫‪X‬‬
                                                                          ‫91‬        ‫02‬            ‫12‬           ‫22‬                                                                               ‫‪X‬‬
                                                                                                                                        ‫91‬            ‫02‬           ‫12‬           ‫22‬

                    ‫رط‬                                    ‫رط‬                   ‫ار ل‬      ‫د‬                     ‫رط‬                            ‫ا رأة‬    ‫د‬                    ‫رط‬




           ‫1‬                 ‫2‬               ‫3‬      ‫4‬        ‫5‬            ‫1‬          ‫2‬            ‫3‬            ‫4‬          ‫5‬         ‫1‬             ‫2‬            ‫3‬               ‫4‬            ‫5‬



          ‫6‬                  ‫7‬           ‫8‬         ‫9‬     ‫01‬               ‫6‬     ‫7‬            ‫8‬            ‫9‬         ‫01‬             ‫6‬           ‫7‬           ‫8‬               ‫9‬               ‫01‬



          ‫11‬                ‫21‬           ‫31‬        ‫41‬    ‫51‬          ‫11‬        ‫21‬            ‫31‬           ‫41‬        ‫51‬             ‫11‬         ‫21‬           ‫31‬              ‫41‬              ‫51‬


          ‫61‬                ‫71‬           ‫81‬                          ‫61‬        ‫71‬            ‫81‬                                    ‫61‬         ‫71‬           ‫81‬
                                                                                                                      ‫‪Y‬‬
                                                         ‫‪X‬‬                                                                                                                              ‫‪X‬‬
          ‫91‬                                       ‫22‬                ‫91‬        ‫02‬            ‫12‬           ‫22‬                       ‫91‬                                      ‫22‬
                            ‫02‬            ‫12‬                                                                                                   ‫02‬          ‫12‬


          ‫دار ل‬              ‫وان وي‬                      ‫رط‬          ‫دار ل‬          ‫وان وي‬                            ‫رط‬                ‫د ا رأة‬            ‫و‬                           ‫رط‬
                                     ‫ذ: و فا د‬                   ‫ا‬                                                                       ‫: - 77 -‬                      ‫ا‬
      ‫د‬            ‫ت:‬             ‫ز دد ت ن ا‬                                                ‫ن‬      ‫ط ت ھذه ا و أن ل‬                                 ‫ن ن‬
                                     ‫ا ل 8 = ‪.2n‬‬                                       ‫دذ‬        ‫ھ 64 = ‪،2n‬‬       ‫ا‬                                    ‫ن‬          ‫ا‬
        ‫دى ا‬                      ‫، إذ ون‬  ‫تا‬                                                ‫وى ا‬       ‫ف نا‬      ‫أن ا ذ ر‬
     ‫ت ون ا س‬                     ‫ب ‪ .XY‬د ض ا‬                                               ‫رة دى ا ذ ر ر ز‬   ‫ر ز ب ‪ ،XX‬و‬
                                                                                               ‫ك وا را ت.‬   ‫ا ط ور و ض ا‬
           ‫ب ھو ا ذي ن ن‬                                      ‫، وھ ذا‬                        ‫ا‬                  ‫ج ون أ د ا‬                         ‫ظ أن ا‬
             ‫،ارا ء‬      ‫ا‬                                  ‫ا‬       ‫ت‬                        ‫زة‬               ‫ا‬     ‫ا‬    ‫ا‬                               ‫ا رداد‬
                                                                                                                                                        ‫ج.‬    ‫ا‬

                                                                                                                            ‫ض دورات ا و‬                          ‫‪ – ΙΙ‬درا‬
                                                                                                              ‫:‬               ‫ا‬        ‫ا‬      ‫أ – دورة ا و‬
                                   ‫4.‬               ‫1، و‬                      ‫ا ل. أ ظر ا و‬                           ‫دذ‬          ‫‪ – a‬ل أول: دورة ا و‬
‫ا و ــــــــــ 4‬
      ‫.‬     ‫ا‬    ‫أ د ا‬                              ‫م ا زا ا ذي‬    ‫ن: ا‬    ‫دوث ظ ھر ن أ‬                                              ‫،‬       ‫تا‬     ‫دا‬   ‫ز ا وا د ا‬
    ‫. و ب ھ ن ا ظ ھر ن‬                  ‫ا‬              ‫ا د ا‬    ‫نا‬      ‫اط‬     ‫ا‬     ‫ا‬                                                         ‫ل‬  ‫ب ا ذي ؤدي إ‬      ‫وا‬
                                                                                                                                              ‫دورة ا و‬      ‫ل دورة‬
      ‫ب‬       ‫وا‬   ‫زا‬    ‫ما‬        ‫ن أ ل د د أھ ا‬    ‫ت‬    ‫ت أ ء دورات و‬                                                              ‫طور دد ا‬     ‫ن لاو قا‬
     ‫زا‬     ‫ما‬      ‫ا‬    ‫د د أھ‬    ‫نأ ل‬     ‫ت‬    ‫ت أ ء دورات و‬    ‫طور دد ا‬                                                               ‫ن لاو قا‬               ‫بأ‬
                                                                                                                                                    ‫بأ‬       ‫ب‬      ‫وا‬
                                                                                                                      ‫1‬      ‫او‬
                                                                                                 ‫و‬
                                                                                                                                         ‫ا ل:‬      ‫1: را ل طور ذ‬      ‫او‬

                   ‫درة‬                                                                                                                        ‫رة ش‬             ‫ا لذ‬       ‫ذ‬
                                                                                                                                         ‫ل‬      ‫دة: و‬     ‫را‬    ‫وا‬    ‫ا وا‬
                                                                                                                                                ‫را ل طورھ‬        ‫و‬       ‫ر‬
   ‫ر 3‬                                              ‫ل‬               ‫ذ‬                  ‫وان وي‬                                                      ‫م.‬    ‫ر و ط زرع‬         ‫ا‬
                                                                                                                                         ‫ا ل‬        ‫ذ رذ‬       ‫د ا زاوج‬
                                                                                                                                                 ‫زا‬    ‫وا ت و دا ل ا‬
                                                                                                                                         ‫ن ا ذ ري‬        ‫،و دا ما‬
                                                                                                                                               ‫ا‬             ‫وا وي، ون‬
                                  ‫ر 2‬                                                   ‫ر‬                                                ‫ر‬    ‫ت‬           ‫رض‬     ‫،‬         ‫ا‬
                                                                                       ‫1‬                                                    ‫م درة م ذ‬        ‫رة ط ر‬
                                                                                                                                                                   ‫.‬    ‫ل‬



                                                                                  ‫م ا زا‬         ‫‪ RC‬ا‬                                         ‫ظ د ذ ا ل أن‬
                                                                        ‫‪2n‬‬
                                        ‫‪2n‬‬                                              ‫‪n‬‬
                                                                                                                                         ‫د‬    ‫رة‬         ‫م‬   ‫ب‬      ‫ا‬
                                                                                                                      ‫طور أ دي ا‬




                                                                                                                                                    ‫م ا زا .‬        ‫ا‬
     ‫طور‬




                                                                                   ‫‪n‬‬
                                                                        ‫‪n‬‬
                                                                                                                                         ‫ر ا طور ا دي‬             ‫ادن‬
                                                                                                                           ‫ا‬




                                                            ‫‪n‬‬
           ‫ا‬




                                                                                                     ‫‪n‬‬
                     ‫رد د د ‪2n‬‬
                                                                                             ‫‪n‬‬           ‫ج‬        ‫أ‬                      ‫د ھذا‬             ‫ا‬        ‫ا‬
     ‫ا‬




                                                        ‫‪n‬‬
                                                                            ‫‪n n‬‬        ‫‪n n‬‬                    ‫‪γ‬‬                               ‫ج،‬      ‫ا‬        ‫ا وان‬
                                                                        ‫‪n‬‬               ‫ب‬            ‫إ‬
                                                                                             ‫‪F‬‬                                               ‫ون ا دة طور ا‬
                                                                              ‫‪2n‬‬                                                                       ‫.‬     ‫ا‬      ‫ا‬
                                                                                                                                         ‫ن دورة و ذ ا ل‬           ‫اط‬
                                                                              ‫‪W‬‬
                                                                                                                                               ‫ز ا دورة ا‬    ‫ن أن‬
‫‪Cycle diplophasique‬‬                         ‫ا‬                   ‫ا‬            ‫ا ل : دورة‬                  ‫دذ‬               ‫ا دورة ا‬                ‫:)ا ر م أ (‬

                    ‫ذ: و فا د‬                   ‫ا‬                                                                                            ‫: - 87 -‬        ‫ا‬
                                           ‫5.‬       ‫2، و‬            ‫ن. أ ظر ا و‬                     ‫دا‬        ‫: دورة ا و‬                     ‫ل‬       ‫‪–b‬‬
                                                                                                         ‫ن:‬                ‫دا‬     ‫2: دورة ا و‬                     ‫او‬
‫ا و ــــــــــ 5‬
       ‫م‬         ‫ا‬                                                                                                                               ‫م‬            ‫ا‬
           ‫زا‬        ‫ا‬                                                    ‫ب‬           ‫ا‬
                                                                                                                                                     ‫زا‬           ‫ا‬

                                      ‫وا ت و‬                                                                                ‫و‬
      ‫ت و‬                                                                                                                                                 ‫ت‬
                                          ‫32 = ‪n‬‬                                                                       ‫32 = ‪n‬‬
                     ‫64 = ‪2n‬‬                                                                                                                                      ‫64 = ‪2n‬‬
                                                                                              ‫64 = ‪2n‬‬
                                               ‫رة‬       ‫ر‬   ‫ت‬        ‫ا‬
                                                                                              ‫64 = ‪2n‬‬
                                               ‫رة‬       ‫ر‬   ‫ت‬        ‫ا‬
                                                                              ‫ن‬               ‫64 = ‪2n‬‬                                ‫64 = ‪2n‬‬
                            ‫64 = ‪2n‬‬
                                               ‫رة‬       ‫ر‬   ‫ت‬        ‫ا‬



                               ‫رة‬     ‫ر‬    ‫ت‬        ‫ا‬                                         ‫64 = ‪2n‬‬
                                                                                                              ‫رة‬            ‫ر‬    ‫ت‬      ‫ا‬
                ‫ذر‬                                                                                                                                            ‫أ‬
                                                                     ‫و ود د د‬


    ‫ن ھ دورة‬                    ‫دا‬    ‫ج، دورة ا و‬                    ‫ا‬                          ‫ا‬             ‫ا‬         ‫ر ا طور ا‬   ‫ن‬                                 ‫دا‬
                                                                         ‫ل1 ، و 6 .‬                   ‫5،‬           ‫. أ ظر ا و‬     ‫ا‬                               ‫ا‬

‫ا و ــــــــــ 6‬                                                                                    ‫م ا زا‬         ‫ا‬                    ‫ل1:‬               ‫5،‬               ‫او‬
                                                                                      ‫‪2n‬‬
                                                                         ‫‪2n‬‬                               ‫‪n‬‬
                                                                                                     ‫‪n‬‬
                                                                                      ‫‪n‬‬
                                                                                  ‫‪n‬‬
                                                                                                                       ‫‪n‬‬
                                                                                                               ‫‪n‬‬
                                                        ‫رد د د ‪2n‬‬
                                                                                          ‫‪n n‬‬            ‫‪n n‬‬
                                                                              ‫‪n‬‬
                                                                                      ‫‪n‬‬                   ‫ب‬            ‫إ‬

                                                                                                    ‫‪2n‬‬




  ‫5.‬            ‫3، و‬           ‫وردار : أ ظر ا و‬              ‫ن‬       ‫د‬        ‫ل‬           ‫:‬               ‫ا‬                 ‫ب – دورة ا و أ د ا‬

‫ا و ــــــــــ 5‬                                                          ‫وردار ‪.Sordaria‬‬                          ‫ن‬            ‫3: را ل دورة و‬                        ‫او‬
     ‫و ر‬                  ‫ون‬             ‫م ز ن طر ن،‬       ‫ن وردار ھو رة ن زل طري. م ا وا د د ھذا ا وع ن ا ن‬
     ‫تأ و‬                    ‫ظ دا‬    ‫ت وداء. د ا ح ھذه ا رة،‬       ‫ل‬        ‫ظ ر و ط ا زرع‬    ‫ا رة ا ز ، ا‬      ‫ا م‬
                                                                                                         ‫د ا ز ت.‬
           ‫وى‬            ‫ط أر‬      ‫ا م ا زا‬          ‫) ‪ .( 2n‬د ل ا‬     ‫ا‬     ‫ا‬          ‫ل‬   ‫ا رة ا ز ،‬      ‫م وا‬
                                 ‫.‬     ‫ا‬      ‫ل ن وى أ د ا‬               ‫ر‬    ‫رة ا م ر‬        ‫د ل‬      ‫ا‬     ‫أ د ا‬

                            ‫ذ: و فا د‬           ‫ا‬                                                                                 ‫: - 97 -‬           ‫ا‬
‫ا و ــــــــــ 5‬                        ‫راء‬       ‫ذات أ واغ‬                            ‫ذات أ واغ وداء‬                                      ‫3‬    ‫او‬
                                                  ‫7=‪n‬‬                                        ‫7=‪n‬‬



                                                                                                                            ‫وا ن‬
                                                                                                                            ‫41= ‪n + n‬‬
                                                                  ‫م ز ن طر ن‬       ‫ا‬




                                ‫وغ‬
                               ‫7=‪n‬‬

                                                  ‫م ا زا‬      ‫ا‬                ‫41 = ‪2n‬‬


                                                                                                                                ‫رة ز‬
                    ‫زق‬

               ‫ر‬         ‫ر‬    ‫م‬     ‫ا‬                                                                            ‫ب‬      ‫إ‬


      ‫دة طور‬                 ‫زا ، و ون ا‬              ‫ما‬               ‫رة‬          ‫و‬        ‫ب ون‬                 ‫ظ أن ا‬                     ‫ھذه ا‬
                                                                                                                 ‫.‬      ‫ا‬                  ‫ا دي ا‬

                               ‫6.‬       ‫ل 2، و‬             ‫5،‬          ‫او‬   ‫ن‬           ‫ھو‬                   ‫ھذه ا‬                ‫ل ا دورة ا‬

‫ا و ــــــــــ 6‬                                                                                                            ‫ل2:‬            ‫5،‬        ‫او‬
                                                                        ‫‪n‬‬      ‫ب‬        ‫إ‬

                                                                   ‫‪n‬‬                                 ‫م‬       ‫ا‬
                                                                                        ‫‪2n‬‬
                                                                                                         ‫ا زا‬



                                         ‫‪n‬‬                                                   ‫‪n‬‬           ‫‪n‬‬
                                                  ‫رد د د‬



                                                                                        ‫‪n‬‬                ‫‪n‬‬       ‫‪n‬‬
                                                                                             ‫‪n‬‬

                                                                                                 ‫ج‬       ‫أ‬



                   ‫ول أن ا دورة ھ دورة أ د ا‬                           ‫ط،‬          ‫ا‬                         ‫ا‬         ‫ا‬        ‫ر ا طور ا‬
                                                                                                 ‫‪.Cycle haplophasique‬‬                                ‫ا‬


                     ‫ذ: و فا د‬                ‫ا‬                                                                      ‫: - 08 -‬          ‫ا‬
                                                                       ‫:‬               ‫ا‬         ‫ا‬              ‫ج – دورة ا و أ د -‬
                                                                                   ‫6.‬          ‫4، و‬     ‫د ا ر س : أ ظر ا و‬                      ‫ل‬
‫ا و ــــــــــ 6‬                                                           ‫ت ا ر س ‪Le fougère‬‬                      ‫4: را ل طور‬                  ‫او‬
    ‫، ظر ل ن ت‬                                        ‫، أوراق‬         ‫ا‬    ‫ا‬    ‫وري زھري‬    ‫ا ر س ت‬
    ‫، ت ھذه ا واغ‬                                 ‫ا‬       ‫أ واغ أ د ا‬    ‫وي‬      ‫رة ن أ س و‬    ‫راء، ھ‬
  ‫ج‬    ‫واھ ون ا‬                                   ‫رة ا د،‬         ‫رة، وھ‬            ‫ا‬    ‫أ د ا‬     ‫ل‬
                                                                          ‫ر س د دة.‬    ‫ل‬    ‫ب‬      ‫و ما‬

                                                                                                                                            ‫4‬        ‫او‬
          ‫) ‪( 2n‬‬            ‫ت و‬


                                                                                                                                            ‫أ س و‬



                                                                           ‫ور‬


                                                                                ‫وغ ) ‪( n‬‬
                                                                                                                                            ‫س و‬
                                          ‫ب‬       ‫إ‬



                                                                                                                      ‫م ا زا‬    ‫ا‬
                   ‫ا‬
                                              ‫)‪(n‬‬
     ‫ر )‪(n‬‬             ‫ت‬
                        ‫ر‬
                                                                       ‫)‪(n‬‬                 ‫ت‬
                                                                                  ‫رة‬       ‫=‬



                                                                                           ‫ن:‬        ‫دا ر س ر‬                ‫ز دورة ا و‬

                                      ‫.‬       ‫= ت و‬            ‫ا‬       ‫ر‬          ‫) ‪ ( 2n‬ھ‬                  ‫ا‬         ‫ا‬                 ‫ر‬       ‫•‬
                                  ‫.‬            ‫رة = ت‬              ‫ا‬   ‫ر‬          ‫)‪(n‬ھ‬                  ‫ا‬            ‫أ د ا‬              ‫ر‬       ‫•‬

         ‫م ن دورة أ د –‬                               ‫، ذا‬   ‫دنز‬                  ‫زا‬       ‫ما‬      ‫ون ا‬
                                                                                                      ‫ب وا‬                              ‫ھذه ا‬
                                                                            ‫. ‪.Cycle haplodiplophasique‬‬                                 ‫ا‬     ‫ا‬


                                                                                       ‫:‬             ‫دا ر س‬                    ‫ز ا دورة ا‬

                       ‫ذ: و فا د‬              ‫ا‬                                                                   ‫: - 18 -‬          ‫ا‬
                                                  ‫ا‬             ‫طور أ دي ا‬
                  ‫أ واغ‬       ‫‪n‬‬                                 ‫‪n‬‬
                                      ‫‪n‬‬                       ‫رد د د‬
                                          ‫‪n‬‬
                                              ‫‪n‬‬
                                                                    ‫ت‬
                          ‫‪n‬‬
                                                                          ‫ج‪γ‬‬    ‫أ‬   ‫‪n‬‬        ‫‪n‬‬
                                      ‫‪n‬‬

‫‪RC‬‬   ‫م ا زا‬   ‫ا‬                                                                                       ‫ب‬     ‫‪ F‬إ‬
                      ‫‪2n‬‬                                                                ‫‪2n‬‬
                                                                                                 ‫‪W‬‬



                                                         ‫ت و‬
                                                      ‫رد د د‬
                                                               ‫‪2n‬‬

                                                      ‫ا‬          ‫ا‬       ‫طور‬

     ‫‪Cycle haplodiplophasique‬‬                             ‫ا‬          ‫ا‬    ‫د ا ر س : دورة أ د -‬              ‫ا دورة ا‬




         ‫ذ: و فا د‬                ‫ا‬                                                              ‫: - 28 -‬        ‫ا‬
                                               ‫:‬           ‫لا‬    ‫ا‬
                          ‫اﻟﻘﻮاﻧﻴﻦ اﻹﺣﺼﺎﺋﻴﺔ ﻻﻧﺘﻘـﺎل اﻟﺼﻔـﺎت اﻟﻮراﺛﻴﺔ‬
                                    ‫ﻋﻨﺪ ﺛﻨﺎﺋﻴﺎت اﻟﺼﻴﻐﺔ اﻟﺼﺒﻐﻴﺔ‬
                                                                                                 ‫د:‬
    ‫،ا ء‬      ‫ا‬   ‫أ د ا‬           ‫ب‬     ‫إ‬                                         ‫ا‬      ‫ا‬   ‫تا‬   ‫را‬
   ‫وذك و د ل‬     ‫تا‬     ‫أزواج ن ا‬     ‫وي‬                                      ‫ا‬        ‫ا‬        ‫ا ذي ط‬
     ‫ت ر أ ل ھذه‬   ‫م ا لا‬         ‫ھ ا وا ن ا‬                                 ‫ن.‬       ‫ل زوج ن‬       ‫ور‬
                                                                                                ‫ت؟‬     ‫ا‬

                   ‫.‬        ‫و ا‬         ‫:ا‬   ‫دة ا‬      ‫ا‬             ‫ت‬        ‫ا ل زوج ن ا‬                  ‫‪ – Ι‬درا‬
                                                            ‫:.‬       ‫ا‬       ‫رب ‪ Mendel‬و و‬                     ‫1‬

                                                   ‫1‬   ‫ط 1، و‬        ‫رب ‪ .Mendel‬أ ظر‬              ‫‪-a‬‬
‫ا و ــــــــــ 1‬
                            ‫.‬   ‫دل ) 2281 – 4881( ‪JOHANN GREGOR MENDEL‬‬                           ‫ر‬        ‫ط1:‬
‫راء، أزھ ر‬      ‫راء أو‬       ‫) ذور‬      ‫ر‬    ‫ت‬     ‫ا ذي ظ ر‬      ‫تا‬        ‫ا ر ‪ Mendel‬ذه ا درا‬
  ‫ا و‬       ‫، زا‬             ‫ن ن تا‬          ‫ن‬      ‫دة ( م زرع‬      ‫ء أو‬     ‫، ذور‬         ‫ء أو‬
‫ب‬        ‫نا‬      ‫دة )‪ .(Graines ridées‬و‬            ‫ذور‬      ‫ا‬     ‫ء ‪ Graines lisses‬وا‬          ‫ذور‬
‫أزھ ر‬       ‫ل‬         ‫ورة ط‬      ‫ب ا ذا ا ذي م‬          ‫‪ Mendel‬ا‬         ‫ن‬        ‫ا دل ن ھ ن ا‬
‫وب ا ح ن‬                  ‫وى ا زھ ر ا‬                ‫وذ ك ط ا د ‪ Les étamines‬ل‬                     ‫ا‬
                                                                    ‫أزھ ر أ رى )أ ظر ا ر م أ (.‬
           ‫رف 1‪. F‬‬            ‫ء ون ا ل ا ول ا ذي وف ر ز‬                ‫ن ھذا ا زاوج ل ذور‬
     ‫ل‬            ‫س ا طر ا‬            ‫م ‪ Mendel‬داث زاوج ن أ راد ا ل ا ول ) 1‪( F1 X F‬‬
    ‫دة . أ ظر ا و 1، و 2.‬            ‫ء ،و 52 % ن ذور‬        ‫2‪ F‬ون ن 57 % ن ذور‬               ‫ا لا‬
       ‫:‬      ‫ا‬     ‫ا‬       ‫ل‬      ‫ذا .‬      ‫م ‪ Mendel‬د ذ ك زرع ذور ا ل 2‪ F‬ر أزھ رھ‬
                                  ‫دة.‬     ‫دة 2‪ F‬ط 001 % ن ا ذور ا‬            ‫ا ذور ا‬
             ‫ء.‬     ‫ء أ راد ا ل 2‪ F‬ط 001 % ن ا ذور ا‬             ‫52 % ن ا ذور ا‬
 ‫ء و 52 % ن‬          ‫ء أ راد ا ل 2‪ F‬طون 57 % ن ا ذور ا‬           ‫05 % ن ا ذور ا‬
                                                                     ‫دة.‬     ‫ا ذور ا‬
                                                      ‫دل ؟‬    ‫ر‬        ‫ل‬     ‫ن‬         ‫1( ذا‬
 ‫ول ا ر ز :‬         ‫ر ط ت ا دول أ‬            ‫دل، آ ذا ن ا‬     ‫ر‬                ‫2( أ ط ا و ل ا‬

                                                                 ‫‪B‬‬       ‫ا‬                                ‫‪A‬‬        ‫ا‬
                                                                                       ‫وب‬
       ‫‪B‬‬                                ‫‪A‬‬                                              ‫ا ح‬




                                                                         ‫‪A‬و‪B‬‬          ‫نا‬   ‫ط‬     ‫با‬        ‫ا‬

                       ‫ذ: و فا د‬    ‫ا‬                                                 ‫: - 38 -‬        ‫ا‬
                                             ‫ـــــــــ ــــطــــــ ـــــ ت ـــول ا ـــ ـــــر ــــــ ــــــز‬

       ‫ا درو . و ب ھذا‬            ‫ا ر‬       ‫نا‬        ‫رف ا ول ا‬           ‫رد‬     ‫ر ز ظ را ر‬
               ‫دة ‪ ،Dominante‬و‬          ‫ون ا‬     ‫رة ‪ Majuscule‬د‬              ‫ا رف ن و ن و‬
                                         ‫‪.Récessif‬‬               ‫ون ا‬      ‫رة‪ Minuscule‬د‬
                                              ‫دة ] ‪. [ r‬‬      ‫ذور‬     ‫ء ]‪، [L‬‬            ‫ل : ذور‬
         ‫ن‬       ‫رف ا ول ا‬     ‫ظ را ر‬                ‫ھو ا ن‬               ‫تا و ن‬              ‫رز‬
                                                                         ‫.‬    ‫ذه ا‬        ‫ا ر‬    ‫ا‬
            ‫ن‬     ‫ا ذي ل ا‬      ‫ل ا : ‪ L / / L‬ث ل ا ط ن ا زوج ا‬                    ‫ر ز ط ا و را‬
                                                                             ‫رز ل ل ر .‬
       ‫ء ھو إ ‪ L / / L‬أو‬   ‫ذور ا‬      ‫دة ھو : ‪ r / / r‬و ا ط ا و را‬     ‫ذور ا‬      ‫ل : ا ط ا و را‬
                                                                                            ‫‪.L//r‬‬
                                                                           ‫رف ضا‬                             ‫ھم:‬
     ‫ن لإ آ ر‬           ‫ل ھذه ا‬    ‫، د‬                                     ‫ا‬       ‫ا‬                     ‫: ون ا‬
                                                                         ‫دون ر.‬
                    ‫ورا ا ط .‬         ‫ا ر‬     ‫ا ر‬       ‫ذات ا‬    ‫:ا‬     ‫ا و‬        ‫ا‬
        ‫،‬      ‫ت‬     ‫ن وا ت أو ت ن أ واع أو‬             ‫أو ا ط‬    ‫ن : زاوج ط‬       ‫ا‬
                                                               ‫أ راد ھ ء.‬
                               ‫.‬          ‫ا ظ ر ا ر : ھو ا ل ا ظ ھر أو ا ر‬
            ‫ا‬    ‫تا‬        ‫ا درو ، و د‬    ‫ا‬            ‫ت ا ور ا‬       ‫ا ط ا ورا :‬
          ‫. وھ ذا ون‬        ‫تا‬     ‫نا‬       ‫ل‬       ‫ن، ل‬               ‫ون ل ور‬
       ‫ون‬     ‫ف ا ران، د‬         ‫ن، أو‬      ‫ن‬     ‫ون ا‬     ‫ا ران د‬            ‫ا رد إ‬
                                                                    ‫ن.‬      ‫ن‬      ‫ا‬

‫ا و ــــــــــ 2‬                     ‫ا زاوج ا ول.‬                 ‫وا و ل ا‬           ‫تا‬       ‫د‬       ‫ل ا ذور‬        ‫لا‬       ‫ا‬   ‫درا‬            ‫1:‬     ‫او‬

                                                                                                  ‫ء‬       ‫ور‬                                ‫ة‬      ‫ور‬
                                                                                          ‫‪P‬‬
         ‫‪r‬‬         ‫‪r‬‬                                  ‫‪L‬‬       ‫‪L‬‬

                                  ‫زاوج‬

                                 ‫م ا زا‬     ‫ا‬
                                                                                                                                   ‫% 001‬
 ‫‪r‬‬                       ‫‪r‬‬       ‫ج‬      ‫أ‬        ‫‪L‬‬                    ‫‪L‬‬
                                                                                          ‫1‪F‬‬                                      ‫ء‬   ‫ور‬

                                 ‫ب‬      ‫إ‬                                                                       ‫1‪F‬‬                ‫1‪F‬‬
                                                                                                                      ‫زاوج‬

                             ‫‪r‬‬         ‫‪L‬‬
                                                                                          ‫2‪F‬‬
             ‫ء‬         ‫ل ا ول 1‪ %100 ،F‬ذور‬                ‫ا‬                                       ‫ة‬       ‫ء + 57 % ور‬             ‫ور‬            ‫52 %‬


                                                                                  ‫رب ‪.Mendel‬‬                              ‫ل‬        ‫‪-b‬‬
              ‫ون‬         ‫ون و‬                   ‫ط ا زاوج ا ول ن ا ء ‪ ،P‬ا ل ا ول 1‪ F‬ون ن أ راد‬
                                                     ‫د.‬   ‫با ل‬      ‫ا ظ ر ا ر ا ب ذي ا ل ا س،‬

                       ‫ذ: و فا د‬             ‫ا‬                                                                   ‫: - 48 -‬               ‫ا‬
‫ن )52%‬     ‫2‪ ،F‬ون ن أ راد ر‬  ‫) 1‪ ،( F1 X F‬ظ ر ل‬         ‫د ا زاوج ا‬
  ‫م‬    ‫دو‬   ‫أن أ راد ا ل ا ول 1‪ F‬ت ل ا ل‬     ‫ء (. ھذا‬   ‫دة + 57%‬
‫ن ا ورا ن ا ؤو ن ن‬  ‫أن ا رد ا ن 1‪ F‬ل ا‬   ‫2‪ .F‬ھذا‬      ‫ا لا‬       ‫ظ رإ‬
                                         ‫ا ظ ر ن ا ر ن ا ر ن.‬
                  ‫‪.Récessif‬‬                    ‫د‬               ‫ل‬          ‫ا‬                ‫د ‪،Dominant‬‬                                ‫لأ س‬                       ‫ن ھذا أن ا‬

                                                                                     ‫ون ا ول ـ ‪.Mendel‬‬                                              ‫ج: ا‬                 ‫‪-c‬ا‬
                                                                                                               ‫ء:‬             ‫سا‬   ‫ھذا ا ون ون‬
          ‫أ راد‬           ‫ا ل ا ول 1‪F‬‬                          ‫ل‬              ‫وا دة،‬                           ‫ن‬              ‫ن‬  ‫ن‬    ‫زاوج‬
                                                                                                                           ‫ا ب ا دة.‬   ‫ذات‬

                                                                           ‫ل ‪.Mendel‬‬                                 ‫أ‬                                  ‫‪-d‬ا ولا‬

                                                                                                                                 ‫ء‪P‬‬                ‫دا‬            ‫ا زاوج ا ول :‬
         ‫]‪[r‬‬          ‫‪X‬‬        ‫:]‪[L‬‬         ‫................‬   ‫ـ‪P‬‬                 ‫ا ظ ھر ا ر‬
     ‫‪r‬‬                         ‫‪L‬‬
                  ‫‪X‬‬                           ‫..................................‬          ‫ط ا ورا‬                     ‫ا‬                    ‫ر ز ب ‪.L‬‬                      ‫دة‬       ‫أ س‬          ‫ا‬
     ‫‪r‬‬                         ‫‪L‬‬                                                                                                          ‫ر ز ب ‪.r‬‬                                ‫د‬            ‫ا‬

 ‫‪r‬‬                ‫‪X‬‬                 ‫‪L‬‬
                                                     ‫.............................................‬   ‫ج‬                ‫ا‬
                  ‫‪L‬‬                                                                                                                ‫راد ا ل ا ول 1‪ F‬م ا ط‬                                ‫لأ‬
                                                                                                                                   ‫د‬    ‫ل‪L‬‬  ‫‪ ،L//r‬و أن ا‬                               ‫ا ورا‬
                  ‫‪r‬‬                 ‫........................................................‬     ‫ب‬                    ‫ا‬            ‫ل ‪ ،r‬ن ل أ راد 1‪ F‬وف‬                               ‫ا‬
‫ا ل 1‪[L] 100 % F‬‬                                                                                                                     ‫م س ا ظ ر ا ر ]‪.[L‬‬                                 ‫ون‬



                                                                                                                                 ‫: 1‪.F1 X F‬‬                               ‫ا زاوج ا‬
                      ‫1‪F‬‬    ‫‪X‬‬                           ‫1‪F‬‬
                        ‫]‪[L‬‬   ‫‪X‬‬                         ‫]‪[L‬‬                   ‫:‬     ‫...................................‬   ‫ـ 1‪F‬‬                 ‫ا ظ ھر ا ر‬
                          ‫‪L‬‬                                    ‫‪L‬‬
                                    ‫‪X‬‬                                                 ‫..........................................................‬         ‫ط ا ورا‬                  ‫ا‬
                           ‫‪r‬‬                                   ‫‪r‬‬

           ‫‪r‬‬              ‫‪L‬‬         ‫‪X‬‬                          ‫‪r‬‬                           ‫‪L‬‬
                                                                                                                 ‫.................................................‬   ‫ج‬            ‫ا‬

                                                                                   ‫...........................................................................‬   ‫ب‬                ‫ا‬
                                   ‫ا ل 2‪F‬‬


‫‪L'échiquier de‬‬        ‫ا زاوج‬                            ‫دول ذي د ن،‬    ‫ب،‬      ‫ا‬                                                                    ‫صإ‬  ‫2‪ F‬ن‬
‫ا د ل‬          ‫،و‬      ‫جا و و‬                          ‫فأ فا‬       ‫ا د ل ا ودي،‬                                                                    ‫‪ .croisement‬ث ب‬
                                                                 ‫.‬    ‫ج اذ ر و‬                                                                     ‫فأ فا‬     ‫،‬   ‫ا‬

                  ‫ذ: و فا د‬             ‫ا‬                                                                                                          ‫: - 58 -‬                   ‫ا‬
                                                                        ‫‪r‬‬                ‫‪L‬‬
                                                             ‫%05‬               ‫%05‬
               ‫2‪ F‬ن :‬     ‫ون ا ل ا‬
‫ا ظ ھر ا ر : % 52 ]‪.[L] 75 % + [r‬‬                                       ‫‪L‬‬                ‫‪L‬‬
                                                                                                    ‫‪L‬‬   ‫%05‬
    ‫ا ط ا ورا : % 52 ط ورا ‪.r//r‬‬                             ‫%52‬               ‫%52‬
                                                                        ‫‪r‬‬                ‫‪L‬‬
                 ‫% 05 ط ورا ‪.L//r‬‬
                 ‫%52 ط ورا ‪.L//L‬‬                                        ‫‪r‬‬                ‫‪L‬‬          ‫‪r‬‬   ‫%05‬
                                                             ‫%52‬               ‫%52‬
                                                                        ‫‪r‬‬                ‫‪r‬‬


                                                            ‫ـ ‪.Mendel‬‬          ‫ج: ا ون ا‬   ‫‪-e‬ا‬
                                                                    ‫ج:‬           ‫ھذا ا ون ون وة ا‬

        ‫وي ل‬                 ‫ن،‬   ‫ر‬      ‫نا‬       ‫نا‬        ‫ن ا ورا ن ا ذان‬  ‫ج رق ا‬               ‫لا‬     ‫أ ء‬
                                                                   ‫ا ور ، ادن ھو .‬               ‫أ د‬

                                                                  ‫ون ا رو د ا ران:‬ ‫ا ل‬
‫ا و ــــــــــ 2‬
                                                       ‫2.‬    ‫‪ - a‬ط ت ر . أ ظر ر ن 1، و‬
                                                                                                   ‫رن 1 :‬
                                                          ‫ن ون ا رو، أ دھ ذو‬         ‫ن ن ا ران‬         ‫ن‬        ‫د‬
    ‫رو ر دي‬                                  ‫رو أ ض‬          ‫ذو رو ر دي. ط ا زاوج ن ران‬                 ‫رو أ ض وا‬
                                                                     ‫ا ء‪،(P‬‬          ‫ء)‬      ‫إ داھ ر د وا رى‬
                                                                 ‫ون ط ن ران ر د ا ون ) ا ل ا ول 1‪. ( F‬‬
                                                          ‫2‪F‬‬       ‫ا لا‬      ‫ل‬                  ‫وم زاوج أ راد 1‪F‬‬
           ‫1‪F‬‬                         ‫001% ر دي‬         ‫(‬     ‫ء. ) أ ظر ا و أ‬     ‫ون ن ران ر د و ران ا‬
                                                                                    ‫1( دد ط ا زاوج ا ز.‬
                                                                                        ‫.‬     ‫ا‬      ‫2( رف ا‬
                                                                   ‫1‪ F‬و 2‪.F‬‬              ‫ل‬       ‫ا‬     ‫3( ل ا‬
                        ‫1‪F‬‬        ‫1‪F‬‬
                                                            ‫ل ن 1‪ F‬و‬             ‫ل‬        ‫ا‬      ‫ا‬       ‫4( ر‬
                                                                                                       ‫2‪. F‬‬
                                                           ‫ا ران ذات ا ون ا ر دي وم‬           ‫ن أ ل ا د ن وة‬
  ‫2‪F‬‬
                                                                 ‫ل‬      ‫راء زاوج ن رد ر دي و رد آ ر أ ض‬
    ‫201 ر دي‬                           ‫43 أ ض‬                  ‫ف م 05 % ن ا ران ر د و 05% ن ا ران‬
                                                                                                             ‫ء.‬
                                                        ‫ن ل‬             ‫ھذا ا وع ن ا زاوج ؟ ذا‬            ‫5( ذا‬
                                                                                          ‫ھذا ا زاوج ؟‬

                                                                            ‫ا زاوج.‬          ‫ل‬   ‫‪-b‬‬

     ‫وا دة. ادن‬                   ‫ن‬          ‫ن،‬   ‫ن‬         ‫ون‬     ‫1( د م ا زاوج ن أ راد ن س ا وع،‬
                                                                 ‫ط ا زاوج ھو رة ن ھ و أ د .‬
          ‫ر‬         ‫ر‬     ‫إ ا ف دون‬   ‫ل ھذه ا‬   ‫د‬                  ‫،‬                            ‫2( ون ا‬
                ‫.‬        ‫ور ا ر ط ك ا‬         ‫ن‬                     ‫ن‬       ‫رھ و ود‬      ‫أ ل ددة. و‬

                        ‫ذ: و فا د‬        ‫ا‬                                            ‫: - 68 -‬      ‫ا‬
  ‫ون ا ظ ر ا ر ا ب ذي ا ون‬                                         ‫م، و‬     ‫ون‬     ‫أ راد ا ل 1‪F‬‬   ‫3( إن‬
   ‫دة،‬       ‫ا ون ر دي‬ ‫أن‬                                          ‫ا ون ا ول ـ ‪Mendel‬‬    ‫ا ر دي. ا دا‬
                                                                           ‫.‬          ‫ون أ ض‬    ‫ا‬
          ‫أ ض ظ رت دى أ راد ا ل 2‪ ،F‬و م ن ظ ر د ا ل 1‪،F‬‬                                                                                            ‫ظ ذ ك أن ا‬
        ‫ل‬     ‫أ ض، و ظ ر دھم و‬      ‫ون ا ل ا ؤول ن ا‬                                                                                              ‫أن أ راد ا ل 1‪F‬‬
                                                                                                                                                            ‫.‬

                                                                                                   ‫ا زاوج:‬                                                ‫4( ا ر ا‬
                                        ‫ب ‪.b‬‬               ‫رز‬                                  ‫ب ‪ ،G‬وأ ض‬                              ‫رز‬                ‫أن ر دي د‬

        ‫]‪[b‬‬          ‫‪X‬‬      ‫:]‪[G‬‬            ‫................‬   ‫ـ‪P‬‬                 ‫ا ظ ھر ا ر‬                            ‫ء‪P‬‬                 ‫دا‬           ‫ا زاوج ا ول :‬

        ‫‪b‬‬                   ‫‪G‬‬
                 ‫‪X‬‬                           ‫..................................‬        ‫ط ا ورا‬                     ‫ا‬
        ‫‪b‬‬                   ‫‪G‬‬

    ‫‪b‬‬            ‫‪X‬‬                  ‫‪G‬‬
                                                   ‫.............................................‬   ‫ج‬               ‫ا‬
                 ‫‪G‬‬
                                    ‫........................................................‬   ‫ب‬                   ‫ا‬
                 ‫‪b‬‬
                                        ‫ل‬      ‫ا‬           ‫د‬        ‫ل أ راد ا ل ا ول 1‪ F‬م ا ط ا ورا ‪ ،G//b‬و أن ا ل ‪G‬‬
    ‫ا ل 1‪[L] 100 % F‬‬                                                  ‫‪ ،b‬ن ل أ راد 1‪ F‬وف ون م س ا ظ ر ا ر ]‪.[G‬‬


                                                                                                                        ‫: 1‪.F1 X F‬‬                               ‫ا زاوج ا‬
                  ‫1‪F‬‬   ‫‪X‬‬                           ‫1‪F‬‬
                   ‫]‪[G‬‬   ‫‪X‬‬                         ‫]‪[G‬‬                  ‫:‬    ‫...................................‬   ‫ـ 1‪F‬‬                 ‫ا ظ ھر ا ر‬
                     ‫‪G‬‬                                ‫‪G‬‬
                                ‫‪X‬‬                                             ‫..........................................................‬        ‫ط ا ورا‬               ‫ا‬
                     ‫‪b‬‬                                ‫‪b‬‬

            ‫‪b‬‬        ‫‪G‬‬          ‫‪X‬‬                     ‫‪G‬‬                            ‫‪b‬‬
                                                                                                         ‫.................................................‬   ‫ج‬        ‫ا‬

                                                                          ‫...........................................................................‬   ‫ب‬             ‫ا‬
                            ‫ا ل 2‪F‬‬
                                                                                                                          ‫ا زاوج‬
                                                                                                     ‫‪b‬‬                                           ‫‪G‬‬
                                                                              ‫%05‬                                          ‫%05‬
              ‫2‪ F‬ن :‬    ‫ون ا ل ا‬
‫ا ظ ھر ا ر : % 52 ]‪.[G] 75 % + [b‬‬                                                                   ‫‪G‬‬                                            ‫‪G‬‬
                                                                                                                                                                      ‫‪G‬‬   ‫%05‬
   ‫ا ط ا ورا : % 52 ط ورا ‪.b//b‬‬                                               ‫%52‬                                          ‫%52‬
                                                                                                     ‫‪b‬‬                                           ‫‪G‬‬
               ‫% 05 ط ورا ‪.G//b‬‬
               ‫%52 ط ورا ‪.G//G‬‬                                                                       ‫‪b‬‬                                           ‫‪G‬‬                    ‫‪b‬‬   ‫%05‬
                                                                              ‫%52‬                                          ‫%52‬
                                                                                                     ‫‪b‬‬                                            ‫‪b‬‬


                ‫ذ: و فا د‬       ‫ا‬                                                                                                          ‫: - 78 -‬               ‫ا‬
   ‫ري ‪ ،Test Cross‬وھو زاوج م ن رد ذي‬  ‫ھذا ا وع ن ا زاوج زاوج ا‬     ‫5(‬
           ‫أي‬      ‫ر روف، و رد ذي ظ ر ر‬      ‫د و ط ورا‬    ‫ظر ر‬
                                           ‫ا درو .‬           ‫ا ران‬
        ‫ا ب ذو ا ظ ر ا ر‬                               ‫جا‬                 ‫طا‬              ‫ف‬                ‫ھذا ا زاوج، ر ط ا ظ ر ا ر‬
                                                                                                                  ‫ن:‬    ‫ا د. و ذ ك د‬

  ‫ط وا دا‬      ‫ب ذو ا ظ ر ا د ھو ‪ ،G//G‬وف‬  ‫ا و : إذا ن ا ط ا ورا‬                                                                         ‫ا‬
      ‫% 001 ‪ .G//b‬أي % 001 ران ر د .‬    ‫ل دا ف‬           ‫ج /‪ ، G‬و‬                                                                        ‫نا‬

     ‫طن ن‬       ‫ب ذو ا ظ ر ا د ھو ‪ ،G//b‬وف‬   ‫: إذا ن ا ط ا ورا‬   ‫ا‬     ‫ا‬
       ‫% 05 ‪ .b//b 50 % + G//b‬أي % 05‬    ‫ل دا ف‬          ‫ج /‪ G‬و /‪ ،b‬و‬     ‫ا‬
                                              ‫ء + %05 ران ر د .‬       ‫ران‬

                   ‫ء + % 05 ران ر د .‬                               ‫ري ھ % 05 ران‬                                ‫ھذا ا زاوج ا‬   ‫ظ أن‬
                                                                            ‫ران ‪.G//b‬‬                            ‫فا‬     ‫ادن أن ا ر ا ر دي‬

                                        ‫دة.‬             ‫وي ا‬         ‫ت‬      ‫ا ل زوج ن ا‬                                             ‫‪ – ΙΙ‬درا‬
‫ا و ــــــــــ 2‬                                        ‫ن د ت ب ا ل أ ظر ر ن 2، و 2.‬                                                ‫1ا‬
                                                                         ‫ر ن 2:‬
‫ن ن ب ا ل ‪ La belle de nuit‬إ داھ ذات أزھ ر راء ‪ Rouge‬وا رى ذات‬      ‫ن‬      ‫وم زاوج‬
         ‫ذات أزھ ر ورد ‪ Rose‬ل ا ل ا ول 1‪.F‬‬     ‫تھ‬         ‫ل‬    ‫ء ‪. Blanche‬‬      ‫أزھ ر‬
                                                        ‫؟‬   ‫. ذا‬      ‫1( ل ھذه ا‬
‫ء و 52 %‬    ‫س و ون ن 52 % ت ذات أزھ ر‬       ‫2‪ F‬ر‬       ‫ل‬          ‫ط زاوج ت 1‪F‬‬
                                      ‫ت ذات أزھ ر راء و 05 % ت ذات أزھ ر ورد .‬
                                       ‫1‪ F‬و 2‪.F‬‬           ‫ل‬   ‫ا‬     ‫ا‬       ‫2( ر‬

                                                            ‫ا زاوج:‬     ‫ل‬   ‫2‬
                    ‫ت ا وا د ن، ل ھ‬ ‫ن‬     ‫أي‬   ‫م‬      ‫ون، إ أن‬       ‫إن أ راد ا ل 1‪F‬‬
           ‫دة.‬      ‫دة أو ول ذ ك وي ا‬    ‫ن ھذا أن ھ ك ب‬       ‫ا و ن.‬      ‫و ط ن‬
                              ‫ر ب ‪ ،R‬وا ض ب ‪.B‬‬  ‫ا زاوج: ر ز‬            ‫1( ا ر ا‬

                                                                                                                ‫ء‪P‬‬   ‫دا‬   ‫ا زاوج ا ول :‬
            ‫]‪[R‬‬           ‫‪X‬‬     ‫:]‪[B‬‬           ‫................‬   ‫ـ‪P‬‬                 ‫ا ظ ھر ا ر‬
           ‫‪R‬‬                    ‫‪B‬‬
                      ‫‪X‬‬                         ‫..................................‬         ‫ط ا ورا‬          ‫ا‬
           ‫‪R‬‬                    ‫‪B‬‬

      ‫‪R‬‬               ‫‪X‬‬                 ‫‪B‬‬
                                                       ‫.............................................‬   ‫ج‬    ‫ا‬
                      ‫‪R‬‬
                                        ‫........................................................‬   ‫ب‬        ‫ا‬
                      ‫‪B‬‬
                                            ‫دة، ن‬              ‫وي ا‬             ‫ل أ راد ا ل ا ول 1‪ F‬م ا ط ا ورا ‪ ،R//B‬و أن ھ ك‬
       ‫ا ل 1‪[L] 100 % F‬‬                                                           ‫ل أ راد 1‪ F‬وف ون م س ا ظ ر ا ر ] ‪.[ RB‬‬

                    ‫ذ: و فا د‬       ‫ا‬                                                                                ‫: - 88 -‬   ‫ا‬
                                                                                                                   ‫: 1‪.F1 X F‬‬                            ‫ا زاوج ا‬
                    ‫1‪F‬‬     ‫‪X‬‬                ‫1‪F‬‬
                    ‫] ‪[ RB‬‬   ‫‪X‬‬              ‫] ‪[ RB‬‬             ‫:‬   ‫...................................‬   ‫ـ 1‪F‬‬                ‫ا ظ ھر ا ر‬
                       ‫‪R‬‬                         ‫‪R‬‬
                                ‫‪X‬‬                              ‫..........................................................‬        ‫ط ا ورا‬             ‫ا‬
                       ‫‪B‬‬                         ‫‪B‬‬

        ‫‪R‬‬              ‫‪B‬‬        ‫‪X‬‬                ‫‪R‬‬                 ‫‪B‬‬
                                                                                         ‫.................................................‬   ‫ج‬       ‫ا‬

                                                           ‫...........................................................................‬   ‫ب‬           ‫ا‬
                              ‫ا ل 2‪F‬‬

                                                                                                                    ‫ا زاوج‬
                                                                                                ‫‪B‬‬                                            ‫‪R‬‬
                ‫2‪ F‬ن :‬ ‫ون ا ل ا‬                                          ‫%05‬                                         ‫%05‬
‫ا ظ ھر ا ر : % 52 ]‪[B] 25 % + [R‬‬                                                                ‫‪R‬‬                                            ‫‪R‬‬
        ‫+ % 05 ] ‪.[ RB‬‬                                                                                                                                        ‫‪R‬‬   ‫%05‬
                                                                         ‫%52‬                                         ‫%52‬
  ‫ا ط ا ورا : % 52 ط ورا ‪.R//R‬‬                                                                  ‫‪B‬‬                                            ‫‪R‬‬
    ‫+ % 05 ط ورا ‪.R//B‬‬                                                                          ‫‪B‬‬                                            ‫‪R‬‬                ‫‪B‬‬   ‫%05‬
    ‫+ % 52 ط ورا ‪.B//B‬‬                                                   ‫%52‬                                         ‫%52‬
                                                                                                ‫‪B‬‬                                            ‫‪B‬‬



                                       ‫.‬             ‫ا ور ا‬                                 ‫ت‬                  ‫ل زوج ن ا‬                         ‫ا‬            ‫‪ – ΙΙΙ‬درا‬
‫ا و ــــــــــ 2‬                                         ‫2.‬                 ‫د ا ران أ ظر ر ن 3، و‬                                                ‫ن‬            ‫1ا‬
                                                                                                                                                         ‫ر ن 3:‬
     ‫رو‬       ‫م:202 ر أ‬        ‫س‬           ‫ر‬      ‫ف‬            ‫ل‬               ‫.‬          ‫راء ‪ Jaune‬ھ‬                     ‫ن ن ران‬      ‫وم زاوج‬
                                                                                                                               ‫89 ر ر دي ‪. Gris‬‬
                              ‫ل وا ك ؟‬           ‫ر؟‬     ‫ون أ‬     ‫ون ر دي وا‬                                        ‫ك ا ول ن ا‬     ‫1( ذا‬
                                                           ‫ظ؟‬      ‫. ذا‬     ‫ل‬                                        ‫ا طا‬       ‫2( أ ب‬
                                           ‫راء‬        ‫أ و ظ ر م ا م ران‬                                                ‫ھذه ا‬      ‫3( ر‬

                                                               ‫ا زاوج:‬      ‫ل‬  ‫2‬
         ‫د‬     ‫ن‬             ‫أن ا ل ا ؤول ن ھذه ا‬    ‫د ا ف، دل‬   ‫1( إن ظ ور ران ر د‬
    ‫ر‬        ‫ون أ‬          ‫و‬            ‫ون ر دي‬   ‫ا ول إذن أن‬  ‫ا ء و م ظ ر دھم.‬
                                                                        ‫دة.‬
                                                                                                           ‫:‬            ‫ل‬     ‫2( ب ا ط ا‬
        ‫+ % 57‬                     ‫ر‬       ‫ھ % 52 ظ ر‬                              ‫با و‬                        ‫،‬         ‫دة‬            ‫أ‬
                                                                                                                          ‫د.‬     ‫ظر ر‬
             ‫3/ 2‬           ‫: ) 202 + 89 ( / 202 * 001 = % 33.76‬                                                       ‫ا ران ا راء ھ‬
              ‫3/ 1‬            ‫: ) 202 + 89 ( / 89 * 001 = % 66.23‬                                                      ‫ا ران ا راء ھ‬
                  ‫.‬        ‫ا دة ا‬       ‫د 2‪F‬‬       ‫ل‬     ‫فا با‬                                                            ‫ظ أن ھذه ا ب‬
                      ‫ذ: و فا د‬        ‫ا‬                                                                                            ‫: - 98 -‬              ‫ا‬
                                                                      ‫ا زاوج:‬                                                                     ‫3( ا و ل ا‬
            ‫ر ھو ] ‪.[ g‬‬     ‫ا ون أ‬                ‫ا ون أ ر ھو ] ‪ .[ J‬و ا ظ ر ا ر‬                                                                    ‫ا ظ را ر‬

                                                                                       ‫زاوج ] ‪.[ g ] X [ J‬‬                                                  ‫ا ولا‬

                            ‫] ‪[ RB‬‬            ‫‪X‬‬        ‫] ‪[ RB‬‬        ‫:‬    ‫.........................‬   ‫ء‪P‬‬                        ‫ا ظ ھر ا ر‬
                            ‫‪R‬‬                      ‫‪R‬‬
                                          ‫‪X‬‬                     ‫..........................................................‬        ‫ط ا ورا‬               ‫ا‬
                            ‫‪B‬‬                      ‫‪B‬‬

                   ‫‪R‬‬        ‫‪B‬‬             ‫‪X‬‬        ‫‪R‬‬                ‫‪B‬‬
                                                                                          ‫.................................................‬   ‫ج‬         ‫ا‬

                                                            ‫...........................................................................‬   ‫ب‬             ‫ا‬
                             ‫ا زاوج‬           ‫أ ظر‬


                                                                                                           ‫ا زاوج‬
  ‫ن ا د ن ‪j//j‬‬            ‫ا ران‬       ‫إن‬                        ‫%05‬
                                                                                      ‫‪g‬‬
                                                                                                            ‫%05‬
                                                                                                                                   ‫‪J‬‬

‫ر و ود‬      ‫ؤدي إ وت ھذه ا ران، وھذا‬
‫ر م ا م، و ر أن ث ا ران‬            ‫ران‬                                                ‫‪J‬‬                                            ‫‪J‬‬
                                                                                                                                                        ‫‪J‬‬       ‫%05‬
     ‫ذات ون ر دي، وا ث ا ر ون أ ر.‬                              ‫%52‬
                                                                                      ‫‪g‬‬
                                                                                                           ‫%52‬
                                                                                                                                   ‫‪J‬‬
 ‫‪.G.létale‬‬       ‫ن ور‬        ‫م ھذه ا‬
                                                                                      ‫‪g‬‬                                            ‫‪J‬‬                    ‫‪g‬‬       ‫%05‬
                                                                ‫%52‬                                        ‫%52‬
                                                                                      ‫‪g‬‬                                           ‫‪g‬‬



                           ‫س.‬             ‫ر ط‬        ‫ور‬                       ‫ت‬                   ‫ل زوج ن ا‬                               ‫ا‬         ‫‪ – ΙV‬درا‬
                                                                                                                   ‫3(.‬              ‫1، و‬                ‫)أ ظر ا و‬
‫ا و ــــــــــ 3‬                                                                          ‫س‬           ‫ددا‬                           ‫تا‬             ‫1 : دور ا‬      ‫او‬


                                                                                              ‫‪X‬‬
     ‫ذ‬




                                                                                                                                          ‫‪X‬‬
     ‫لأ‬




                                ‫‪X‬‬
                                          ‫‪X‬‬                                                                                                   ‫‪Y‬‬

                                                                                              ‫‪X‬‬
                                                          ‫ا زا‬
                             ‫8 = ‪2n‬‬




                                                                                                                                                  ‫8 = ‪2n‬‬
                                                                                                                                              ‫ا‬
                                                          ‫4=‪n‬‬
                                                     ‫را‬
                                                     ‫لا‬
                                ‫أم‬




                                                                                                                                                     ‫ل‬
                                                                                                                                              ‫ب‬




                                                                                                 ‫‪Y‬‬
                                                     ‫م‬
                                                     ‫ج‬
                             ‫ج‬
     ‫ذ‬




                                ‫‪X‬‬                                                                                                         ‫‪X‬‬
                                 ‫‪Y‬‬                                                                                                                          ‫‪X‬‬
     ‫لذ ر‬




                                                                                                 ‫‪X‬‬




                       ‫ذ: و فا د‬      ‫ا‬                                                                                 ‫: - 09 -‬                    ‫ا‬
         ‫أزواج ن‬    ‫وي‬             ‫ن أن ا واة‬        ‫ا‬      ‫ا‬   ‫ن‬        ‫ظ ا رط ا‬      ‫إن‬
         ‫ن. د ا ذ ر ون‬               ‫ن‬          ‫إ‬      ‫،‬      ‫تا‬     ‫، لا‬        ‫تا‬     ‫ا‬
                                   ‫ج و ر ز ب ‪.XY‬‬         ‫را‬     ‫ن ول أ‬     ‫ن‬     ‫نا‬     ‫ا‬
               ‫ب ‪.XX‬‬         ‫جور ز‬        ‫ا‬       ‫ن ول أ‬       ‫ن‬     ‫نا‬     ‫ون ا‬    ‫دا‬
                 ‫ك(‬           ‫ا ط ور وا‬       ‫ج‬   ‫رة ا‬    ‫ون‬     ‫ھ ا‬    ‫تا‬     ‫ضا‬    ‫)‬

                             ‫3.‬      ‫ا ل أ ظر ر ن 4، و‬             ‫دذ‬             ‫س‬                      ‫ر ط‬                         ‫ل‬              ‫1ا‬
‫ا و ــــــــــ 3‬                                                                                                                            ‫ر ن 4:‬
  ‫راء ‪Rouge‬‬         ‫ون‬       ‫ذات‬          ‫و‬     ‫ن نذ با ل‬
                                              ‫ن ون ا ون، ا و‬   ‫ن‬        ‫ز زاو ت ن‬
                                                  ‫ء ‪. Blanche‬‬      ‫ط رة ذات ون‬         ‫و‬
‫أ راد‬  ‫ا ل ا ول 1‪F‬‬         ‫ء‬    ‫ا زاوج ا ول : م ن أ ذات ون راء وذ ر ذو ون‬
                                                                        ‫م ون راء.‬
                                           ‫ھذا ا زاوج ؟‬    ‫ص ن‬        ‫1( ذا‬
‫ء وذ ر ذو ون‬    ‫‪ Croisement réciproque‬م ن أ ذات ون‬           ‫: زاوج‬      ‫ا زاوج ا‬
                                                                                  ‫راء.‬
      ‫ء.‬     ‫ل 1‪ F‬ون ن 05 % إ ث ون راء و 05 % ذ ور ون‬
                                                ‫؟‬       ‫؟ ذا‬    ‫2( ل ھذه ا‬
                                       ‫.‬     ‫ل‬      ‫ا‬         ‫را‬      ‫3( أ ط‬

                                                                                                  ‫ا زاوج:‬                            ‫ل‬                  ‫2‬
     ‫ون راء.‬              ‫ون و م ا‬     ‫ظ أن ل أ راد ا ل ا ول 1‪F‬‬   ‫ا زاوج ا ول‬   ‫1(‬
        ‫د ) ‪،( R‬‬        ‫أ ر‬     ‫أن ا ل ا ؤول ن ا‬         ‫ون ا ول ـ ‪Mendel‬‬     ‫ط‬
                                                   ‫) ‪.( b‬‬       ‫لأ ض‬          ‫و‬

      ‫ظ أن ا ظ ر‬      ‫ن،‬    ‫ل 1‪ ،F‬ون ن أ راد ر‬             ‫2( ط ا زاوج ا‬
     ‫ادن أن ا ر ق ور ر ط‬         ‫ف ب ا س.‬          ‫راد ھذا ا ل‬      ‫ا ر‬
 ‫" ون ا ون " ظ ر د ل ن ا ذ ور وا ث، ن ھذه‬      ‫. و أن ا‬        ‫تا‬
                                          ‫‪.X‬‬        ‫ا‬     ‫ا‬         ‫ا ور‬
                                       ‫:‬     ‫ل‬        ‫ا‬          ‫3( ا ر ا‬

                                                                                                                           ‫ا زاوج ا ول :‬
       ‫راء ] ‪[ R‬‬        ‫ون‬          ‫ء]‪ X [b‬إ ث‬              ‫ون‬   ‫: ذ ور‬                                 ‫ـ‪P‬‬                     ‫ا ظ ھر ا ر‬
                    ‫‪R‬‬                               ‫‪b‬‬
                            ‫‪X‬‬                               ‫‪X‬‬     ‫..........................................................‬        ‫ط ا ورا‬                 ‫ا‬
                            ‫‪X‬‬         ‫‪X‬‬                     ‫‪Y‬‬
                    ‫‪R‬‬


                    ‫‪R‬‬                           ‫‪b‬‬
                                                                      ‫‪Y‬‬                ‫......................................................‬       ‫ج‬       ‫ا‬
                            ‫‪X‬‬         ‫‪X‬‬                 ‫‪X‬‬

                                                                   ‫......................................................................‬   ‫ب‬               ‫ا‬
                        ‫‪R‬‬                           ‫‪R‬‬
                                ‫‪X‬‬                           ‫‪X‬‬        ‫ا ل 1‪[R] 100 % F‬‬
                        ‫‪b‬‬
                                ‫‪X‬‬                           ‫‪Y‬‬       ‫+ % 05 ‪RX//Y‬‬ ‫% 05 ‪Rx//xb‬‬
                   ‫ذ: و فا د‬          ‫ا‬                                                                       ‫: - 19 -‬                          ‫ا‬
                                                                                        ‫:‬                  ‫= ا زاوج ا‬                             ‫ا زاوج ا‬
      ‫ء]‪[b‬‬             ‫ون‬       ‫راء ] ‪ X [ R‬إ ث‬              ‫ون‬    ‫: ذ ور‬                                     ‫ـ‪P‬‬                     ‫ا ظ ھر ا ر‬
                   ‫‪b‬‬                                 ‫‪R‬‬
                            ‫‪X‬‬                                ‫‪X‬‬          ‫..........................................................‬        ‫ط ا ورا‬               ‫ا‬
                            ‫‪X‬‬           ‫‪X‬‬                    ‫‪Y‬‬
                   ‫‪b‬‬


                   ‫‪b‬‬                            ‫‪R‬‬
                                                                            ‫‪Y‬‬                ‫......................................................‬   ‫ج‬         ‫ا‬
                            ‫‪X‬‬           ‫‪X‬‬                ‫‪X‬‬

                                                                         ‫......................................................................‬   ‫ب‬             ‫ا‬
                       ‫‪R‬‬                             ‫‪b‬‬
                                ‫‪X‬‬                            ‫‪X‬‬    ‫]‪[b‬‬     ‫ا ل 1‪50 % + [R] 50 % F‬‬
                       ‫‪b‬‬
                                ‫‪X‬‬                            ‫‪Y‬‬     ‫% 05 ‪bX//Y 50 % + Rx//xb‬‬

                                                                                                                                                          ‫ظ :‬
                                    ‫‪Y‬‬                                                                        ‫ت ا ورا‬      ‫را لا‬         ‫ن‬
 ‫‪X‬‬                                                                                                        ‫ت‬    ‫ون ا ور‬      ‫س‬          ‫ا ر ط‬
                                                                                                              ‫ت و‬         ‫ن ھ ذه ا‬    ‫ؤو‬   ‫ا‬
                                                             ‫‪Y‬‬                              ‫ط‬
                                                                                                          ‫‪ X‬ا ذي س‬            ‫ا‬    ‫زء ا‬
                                                                                                          ‫زء‬        ‫‪ .Y‬أو‬        ‫ا‬    ‫ل‬
          ‫‪X‬‬                     ‫ط‬               ‫ط‬                                                          ‫‪.X‬‬      ‫ل‬        ‫‪ Y‬ا ذي س‬       ‫ا‬
                                            ‫ن‪X‬و‪Y‬‬

                                                   ‫دا‬     ‫ور‬ ‫:‬      ‫ا‬‫ادن ا و ت ا‬
         ‫و ل وا د د ا ذ ر.‬       ‫ن دا‬            ‫‪ : X‬ا ور‬         ‫ا زء ا ز‬           ‫•‬
        ‫ن د‬      ‫،و‬     ‫ن دا‬            ‫‪ :Y‬ا ور‬     ‫ل ا‬          ‫ا زء ‪ X‬ا ذي‬         ‫•‬
                                   ‫س.‬       ‫را ر ط‬        ‫س وا ن ا‬            ‫ا ذ ر.‬
      ‫ي ل د‬          ‫ل وا د د ا ذ ر، و ر‬          ‫‪ :Y‬ا ور‬         ‫ا زء ا ز‬           ‫•‬
                                                      ‫ذ ور.‬              ‫. ادن‬     ‫ا‬

                                            ‫.‬            ‫و ا‬       ‫ت: ا‬                      ‫ل زو ن ن ا‬                                     ‫ا‬             ‫‪ – V‬درا‬
       ‫ن. و‬     ‫ن‬    ‫ن‬   ‫ن‬    ‫إذا ن ا زاوج ن أ راد ون‬   ‫م نا و ا‬
      ‫م ن ور ت ر ط ، ‪Les gène‬‬       ‫سا‬       ‫ور ن إ أن و ن‬       ‫ھذه ا‬
             ‫‪Les gènes‬‬     ‫م ن ور ت‬     ‫ن‬    ‫ن‬        ‫‪ .liés‬وإ أن و ن‬
                                                      ‫‪. indépendants‬‬

                                                                                    ‫ا ور ت ا‬  ‫1‬   ‫:‬
                                                                   ‫.‬    ‫د تا‬           ‫أ–ا و ا‬
‫ا و ــــــــــ 3‬
                                                                 ‫‪ - a‬ر ن أ ظر ا ر ن 5، و 3.‬
     ‫ن، ل و ون ا ذرة: ا و‬   ‫ن‬                           ‫ن ن تا‬      ‫ن‬     ‫م ‪ Mendel‬زاوج‬          ‫ر ن 5:‬
     ‫ل‬      ‫دة ‪ Ridée‬و راء ‪.Verte‬‬                        ‫ا‬   ‫ء ‪ Lisse‬و راء ‪ . Jaune‬وا‬
                                                    ‫ء و راء.‬         ‫ذور‬      ‫ا ل ا ول 1‪F‬‬
                                                                    ‫ھذا ا وع ن ا زاوج ؟‬       ‫ذا‬   ‫1(‬
                                                                 ‫ن ذك ؟‬        ‫، ذا‬     ‫ل ھذه ا‬    ‫2(‬
                   ‫ذ: و فا د‬            ‫ا‬                                                                              ‫: - 29 -‬                       ‫ا‬
‫655‬        ‫ل‬      ‫ذور ا ل 2‪F‬‬                   ‫ر‬        ‫ذا . و د ا‬                       ‫م ‪ Mendel‬زرع ذور ن 1‪ F‬و رك ا زھ ر‬
                                                                                                               ‫:‬   ‫ذرة وزع‬
             ‫ء‬    ‫راء و‬         ‫ذرة‬        ‫101‬                                                ‫513 ذرة راء و ء‬
           ‫دة‬     ‫راء و‬         ‫ذرة‬         ‫23‬                                               ‫دة‬   ‫801 ذرة راء و‬
                                                    ‫ا ل 2‪.F‬‬                                          ‫ل‬      ‫3( أ ب ا ب ا و ا‬
        ‫ر )‪ ، (J,j‬أ س )‪، (L,l‬‬             ‫ا ر وز: أ ر)‪ ،(V,v‬ا‬                                        ‫1‪ F‬و 2‪، F‬‬         ‫ر‬  ‫4(‬
                                                                                                          ‫د )‪. (R,r‬‬

                                                                                                                     ‫‪ - b‬ل ا ر ن:‬
       ‫و‬         ‫ق ا ر ادن‬                ‫ن ا ن،‬                   ‫ن‬                ‫ن‬             ‫ن‬                  ‫1( م ا زاوج ن رد ن ن‬
                                                                                                                                  ‫.‬   ‫ا‬

 ‫ل‬     ‫ظ رھم ا ر ا ب ذو ا‬     ‫ون، و ون‬        ‫ظ أن أ راد ا ل ا ول 1‪F‬‬                                                                                                               ‫2(‬
          ‫د، وأ ر د‬        ‫أ س دة‬      ‫ادن أن ا‬     ‫ر.‬    ‫س وا ون ا‬                                                                                                        ‫ا‬
             ‫د ‪ ،r‬وأ ر ‪.v‬‬ ‫: أ س ‪ ،L‬أ ر ‪،J‬‬       ‫ت‬     ‫ر. وھ ذا ب ا‬                                                                                                         ‫أ‬

                                                                 ‫د 2‪:F‬‬ ‫با با و‬             ‫3(‬
      ‫ن ا ظ ھر ا ر‬                 ‫ظ ھر ر . ظ ران‬           ‫س و م أر‬    ‫ظ أن ا ل 2‪ F‬ر‬
                                 ‫ء: ] ‪ [ L,J‬و ] ‪ ،[ r,v‬و ظ ران ر ن د دان: ] ‪ [ L,v‬و ] ‪.[ r,J‬‬

       ‫ظ ھر أ و‬              ‫] ‪.(315 / 556).100 = 56.6 % : [ L,J‬‬                                                                 ‫ر‬            ‫ظ را‬                 ‫ا‬       ‫•‬
                               ‫] ‪.(32 / 556).100 = 5.75 % : [ r,v‬‬                                                               ‫ر‬            ‫ظ را‬              ‫ا‬           ‫•‬
  ‫ظ ھر د دة‬                ‫] ‪.(101 / 556).100 = 18.16 %: [ L,v‬‬                                                                  ‫ر‬            ‫ظ را‬              ‫ا‬           ‫•‬
       ‫ا ر ب‬                  ‫] ‪.(108 / 556).100 = 19.4 %: [ r,J‬‬                                                                ‫ر‬            ‫ظ را‬              ‫ا‬           ‫•‬

                 ‫ج.‬        ‫لا‬             ‫تأ ء‬                 ‫ل‬             ‫راق ا‬                         ‫ت د دة إ‬                          ‫ر ظ ور‬                        ‫ن‬

                                                                                               ‫ا زاوج:‬                                      ‫4( ا و ل ا‬
                                                                                                          ‫ء‪P‬‬                        ‫ا زاوج ا ول : د ا‬
                 ‫] ‪[ r,v‬‬              ‫‪X‬‬                ‫ـ ‪[ L,J ] : ..........................................P‬‬                        ‫ا ظ ھر ا ر‬
           ‫‪r‬‬          ‫‪v‬‬                            ‫‪L‬‬              ‫‪J‬‬
                                 ‫‪X‬‬                                                      ‫..................................................‬         ‫ط ا ورا‬                     ‫ا‬
           ‫‪r‬‬          ‫‪v‬‬                            ‫‪L‬‬              ‫‪J‬‬


                                                   ‫‪L‬‬              ‫‪J‬‬
           ‫‪r‬‬          ‫‪v‬‬
                                  ‫‪X‬‬                                                       ‫..................................................................‬   ‫ج‬               ‫ا‬
                            ‫‪L‬‬              ‫‪J‬‬                           ‫.................................................................................‬   ‫ب‬                   ‫ا‬
                            ‫‪r‬‬              ‫‪v‬‬

                 ‫ا ل 1‪[L,J] 100 % F‬‬
 ‫د ن، ن ل أ راد 1‪F‬‬                    ‫أن ‪ L‬و‪V‬‬             ‫ل أ راد ا ل ا ول 1‪ F‬م ا ط ا ورا ‪ ، L//r,J//v‬و‬
                                                                    ‫وف ون م س ا ظ ر ا ر ] ‪.[ L,J‬‬
                 ‫ذ: و فا د‬            ‫ا‬                                                                                             ‫: - 39 -‬                           ‫ا‬
                                                                                                                   ‫: 1‪F1 X F‬‬                                    ‫ا زاوج ا‬

                                   ‫] ‪[ L,J‬‬                            ‫‪X‬‬                        ‫.............................. : ] ‪[ L,J‬‬                     ‫ا ظ ھر ا ر‬
                       ‫‪L‬‬            ‫‪J‬‬                                                      ‫‪L‬‬              ‫‪J‬‬

                                                                ‫‪X‬‬                                                                ‫.......................‬        ‫ط ا ورا‬             ‫ا‬
                       ‫‪r‬‬            ‫‪v‬‬                                                      ‫‪r‬‬              ‫‪v‬‬


     ‫‪L‬‬             ‫‪J‬‬                ‫‪r‬‬                 ‫‪v‬‬                   ‫‪L‬‬            ‫‪J‬‬                   ‫‪r‬‬                   ‫‪v‬‬
                               ‫,‬                            ‫,‬                                  ‫,‬                                           ‫,‬                                ‫ج‬       ‫ا‬
           ‫‪L‬‬                   ‫‪v‬‬              ‫‪r‬‬             ‫‪J‬‬
                                                                ‫‪X‬‬                 ‫‪L‬‬            ‫‪v‬‬                         ‫‪r‬‬                 ‫‪J‬‬
                                                                                                                                                      ‫...................‬

                                    ‫,‬                                                                      ‫,‬
                                                                                                    ‫.................................................................‬   ‫ب‬           ‫ا‬
                                                            ‫ا ل 2‪F‬‬

    ‫و :‬    ‫ج ب‬      ‫ل رد ھ ن ن ا ل 1‪ F‬أر أ واع ن ا‬                                                                                                          ‫لا طا‬
  ‫% 05.)أ ظر ا و 2،‬     ‫ن د دا ا ر ب‬   ‫% 05 و‬     ‫نأو ن‬                                                                                                    ‫4/1 ل وع،‬
                                                                                                                                                               ‫و 3(.‬

‫ا و ــــــــــ 3‬                                                                               ‫ت‬               ‫ل‬             ‫راق ا‬                         ‫را‬           ‫2: ا‬       ‫او‬
                                                                          ‫‪L‬‬       ‫‪J‬‬
                                                                                                                    ‫‪L‬‬              ‫‪J‬‬                ‫+‬            ‫‪L‬‬             ‫‪J‬‬
                                                                          ‫‪L‬‬       ‫‪J‬‬
                                                                                                 ‫ا ر‬
                                                                ‫ا ر‬




                                         ‫‪L‬‬            ‫‪J‬‬                   ‫‪L‬‬       ‫‪v‬‬
     ‫‪L‬‬      ‫‪J‬‬                                                                                                       ‫‪L‬‬              ‫‪v‬‬                ‫+‬            ‫‪L‬‬             ‫‪v‬‬
                                         ‫‪L‬‬            ‫‪J‬‬                   ‫‪L‬‬       ‫‪v‬‬
                                                                                                 ‫ا‬
                                                                ‫ا‬




                                         ‫‪r‬‬            ‫‪v‬‬
     ‫‪r‬‬      ‫‪v‬‬                                                             ‫‪r‬‬       ‫‪J‬‬
                                         ‫‪r‬‬            ‫‪v‬‬                                                              ‫‪r‬‬             ‫‪J‬‬                ‫+‬            ‫‪r‬‬             ‫‪J‬‬
                                                                          ‫‪r‬‬       ‫‪J‬‬
                                                                                                   ‫‪II‬‬
                                                                ‫‪I‬‬




 ‫ج‬        ‫ا م‬              ‫ا‬       ‫د ‪I‬‬        ‫ا‬       ‫ا ر‬                 ‫‪r‬‬       ‫‪v‬‬
         ‫‪2n‬‬                                  ‫‪2n‬‬                                                                      ‫‪r‬‬             ‫‪v‬‬                ‫+‬            ‫‪r‬‬             ‫‪v‬‬
                                                                          ‫‪r‬‬       ‫‪v‬‬




                                                                                                ‫4:‬             ‫1، و‬                    ‫ا زاوج : أ ظرا و‬

                                                                      ‫:‬       ‫ا‬       ‫ا ظ ھر ا ر‬                             ‫ل‬                 ‫2‪F‬‬                    ‫ا لا‬
                                   ‫ون 61/9 ن 2‪ F‬أي % 52.65.‬                                     ‫] ‪، [ L,J‬‬                        ‫• أ راد م ا ظ ر ا ر‬
                                   ‫ون 61/3 ن 2‪ F‬أي % 57.81.‬                                     ‫] ‪، [ L,v‬‬                        ‫• أ راد م ا ظ ر ا ر‬
                                    ‫ون 61/3 ن 2‪ F‬أي % 57.81.‬                                       ‫] ‪، [ r,J‬‬                     ‫• أ راد م ا ظ ر ا ر‬
                                        ‫ون 61/1 ن 2‪ F‬أي % 52.6.‬                                    ‫] ‪، [ r,v‬‬                     ‫• أ راد م ا ظ ر ا ر‬


                           ‫ذ: و فا د‬              ‫ا‬                                                                                ‫: - 49 -‬                      ‫ا‬
                                                                                            ‫1‬    ‫او‬
     ‫ا و ــــــــــ 4‬                       ‫ا زاوج‬
          ‫‪r‬‬             ‫‪v‬‬       ‫‪r‬‬       ‫‪J‬‬    ‫‪L‬‬        ‫‪v‬‬         ‫‪L‬‬    ‫‪J‬‬


          ‫‪r‬‬             ‫‪v‬‬       ‫‪r‬‬       ‫‪J‬‬    ‫‪L‬‬        ‫‪v‬‬         ‫‪L‬‬    ‫‪J‬‬
                                                                                    ‫‪L‬‬       ‫‪J‬‬
          ‫‪L‬‬             ‫‪J‬‬       ‫‪L‬‬       ‫‪J‬‬    ‫‪L‬‬        ‫‪J‬‬         ‫‪L‬‬    ‫‪J‬‬



          ‫‪r‬‬             ‫‪v‬‬       ‫‪r‬‬       ‫‪J‬‬    ‫‪L‬‬        ‫‪v‬‬         ‫‪L‬‬    ‫‪J‬‬
                                                                                    ‫‪L‬‬       ‫‪v‬‬
          ‫‪L‬‬             ‫‪v‬‬       ‫‪L‬‬       ‫‪v‬‬    ‫‪L‬‬        ‫‪v‬‬         ‫‪L‬‬    ‫‪v‬‬



          ‫‪r‬‬             ‫‪v‬‬       ‫‪r‬‬       ‫‪J‬‬    ‫‪L‬‬        ‫‪v‬‬         ‫‪L‬‬    ‫‪J‬‬
                                                                                    ‫‪r‬‬       ‫‪J‬‬
          ‫‪r‬‬             ‫‪J‬‬       ‫‪r‬‬       ‫‪J‬‬    ‫‪r‬‬        ‫‪J‬‬         ‫‪r‬‬    ‫‪J‬‬



          ‫‪r‬‬             ‫‪v‬‬       ‫‪r‬‬       ‫‪J‬‬    ‫‪L‬‬        ‫‪v‬‬         ‫‪L‬‬    ‫‪J‬‬
                                                                                    ‫‪r‬‬       ‫‪v‬‬
          ‫‪r‬‬             ‫‪v‬‬       ‫‪r‬‬       ‫‪v‬‬    ‫‪r‬‬        ‫‪v‬‬         ‫‪r‬‬    ‫‪v‬‬




                                               ‫‪ - c‬ا ون ا ث ـ ‪:Mendel‬‬
                                           ‫ت.‬       ‫أزواج ا‬       ‫ھذا ا ون: ون ا‬
                   ‫ن أن‬       ‫‪ ،I‬ن ل رد ن زوج‬            ‫ج وأ ء ا ر ا‬        ‫أ ء لا‬
          ‫أن‬           ‫ن،‬     ‫ر ن زوج‬    ‫ن ھذا أن ل‬       ‫ا ر. و‬        ‫د ردي ا زوج ا‬
                      ‫ت.‬    ‫ل‬   ‫راق ا‬         ‫ا ر، وھذا‬        ‫ري ا زوج ا‬       ‫د‬

                                                          ‫دذ ا ل‬           ‫ب–ا و ا‬
‫ا و ــــــــــ 4‬                                 ‫4.‬       ‫‪ - a‬ر ن أ ظر ا ر ن 6، و‬
                                                                                        ‫ر ن 6:‬
 ‫ذات‬   ‫‪ . Longues‬وا‬        ‫طو‬    ‫ن ن ذ ا ل ا و ذات م ر دي ‪ Gris‬وأ‬               ‫ن‬     ‫وم زاوج‬
‫ل ر د ذات‬     ‫281 ذ‬         ‫ل ا ل ا ول 1‪F‬‬        ‫أ ر ‪. Véstigiales‬‬         ‫م أ ود ك ‪ Eben‬وأ‬
                                                                                     ‫طو .‬     ‫أ‬
                                                     ‫؟‬       ‫ھذا ا زاوج . ذا‬     ‫1( ل‬
  ‫ل‬     ‫أر .‬      ‫ل ذات م أ ود ك وأ‬        ‫ل ن ا ل ا ول 1‪ F‬و ذ‬         ‫نذ‬       ‫وم د ذ ك زاوج‬
                                                                                      ‫ا‬    ‫ا‬
    ‫طو‬     ‫وذات أ‬      ‫ل وداء‬     ‫905 ذ‬           ‫طو‬      ‫ل ر د ا ون و ذات أ‬       ‫294 ذ‬
   ‫أر‬     ‫وذات أ‬      ‫ل وداء‬     ‫784 ذ‬             ‫أر‬      ‫ل ر د ا ون وذات أ‬       ‫515 ذ‬
                                      ‫؟‬       ‫ھذا ا وع ن ا زاوج ؟ و ھ ا‬         ‫2( ف‬
                              ‫؟‬     ‫2‪ .F‬ذا‬         ‫ل‬     ‫واع ا‬      ‫3( أ ب ا ب ا و‬
  ‫ا ر وز : ر دي )‪ ،(G,g‬أ ود )‪ ،(E,e‬طو )‪،(L,l‬‬         ‫.‬    ‫ھذا ا زاوج ا‬           ‫4( ر‬
                                                                          ‫أ ر )‪.(V,v‬‬

                    ‫ذ: و فا د‬       ‫ا‬                                    ‫: - 59 -‬       ‫ا‬
                                                                                                  ‫‪ - b‬ل ا ر ن:‬

    ‫م‬           ‫ا ب ذو ا‬    ‫ظ رھم ا ر‬     ‫ون و ون‬        ‫ظ أن أ راد ا ل ا ول 1‪F‬‬                                                                            ‫1(‬
                        ‫أن :‬      ‫ون ا ول ـ ‪Mendel‬‬     ‫ا طو . ادن ط‬      ‫دي وا‬                                                                        ‫ار‬
                                      ‫ا ل أ ود.‬     ‫ا ون ر دي د‬      ‫ؤول ن‬                                                                            ‫•ا لا‬
                                    ‫ا لأر .‬       ‫د‬     ‫طو‬       ‫ا‬   ‫ؤول ن‬                                                                            ‫•ا لا‬
                            ‫دي ب )‪ ،(G‬وأ ود ب )‪ .(e‬ر ز طو ب )‪ ،(L‬وأ ر ب )‪(v‬‬                                                                           ‫رز ر‬
        ‫.‬           ‫م ن رد ھ ن 1‪ F‬و أب ‪P‬‬      ‫ھذا ا وع ن ا زاوج زاوج ا را ،‬                                                                                ‫2(‬
                                    ‫ن.‬     ‫ل زو ا‬     ‫لا‬      ‫ھو ا ق ن ا‬                                                                               ‫ا‬

                                                        ‫2‪:F‬‬                           ‫ل‬                  ‫با با و ا‬                                         ‫3(‬

‫طو ( :))294+515+905+784(/294(.001=%65.42‬                                                  ‫)ر د ، أ‬                         ‫ا ظ را ر‬                             ‫•‬
                             ‫( : )3002/905(.001=%14.52‬              ‫طو‬                   ‫) وداء، أ‬                         ‫ا ظ را ر‬                             ‫•‬
                             ‫( : )3002/515(.001=%17.52‬             ‫أر‬                   ‫)ر د ،أ‬                            ‫ا ظ را ر‬                             ‫•‬
                             ‫( : )3002/784(.001=%13.42‬               ‫أر‬                  ‫) وداء، أ‬                         ‫ا ظ را ر‬                             ‫•‬

    ‫ظر‬                  ‫ج ) /‪ ،( e/,v‬و‬      ‫وى ط وا د ن ا‬         ‫] ‪،[ e,v‬‬   ‫ا‬   ‫إن ا رد ا‬
                    ‫ا رد ا ن. و‬        ‫أ‬     ‫جا‬       ‫س ا ط ا ورا‬     ‫راد ا ف 2‪F‬‬     ‫ا ر‬
                                                                  ‫ة أم ر ط .‬   ‫ھل ا ور ت‬

‫ل‬     ‫ل‬     ‫أ‬    ‫2‪( 25 % + 25 % + 25 % + 25 % ) :F‬‬            ‫ل‬      ‫دل ا ب ا‬
      ‫ا زوج‬     ‫ز أ د‬      ‫ن‬          ‫ل ل ن زوج‬           ‫ج د ا رد ا ن،‬       ‫ا‬
    ‫ن ن‬       ‫زو ن‬    ‫و ن‬    ‫ن ) ‪ ( G,e‬و) ‪( L,v‬‬   ‫ن ذ ك أن ا‬       ‫ا ر.‬       ‫ا‬
                                                ‫.‬        ‫ت. أي أن ا ور ت‬      ‫ا‬

                                                                                     ‫ا زاوج:‬                                            ‫4( ا و ل ا‬


                     ‫] ‪[ e,v‬‬                ‫‪X‬‬                      ‫ـ 1‪[ G,L ] : ..............F‬‬                                   ‫ا ظ ھر ا ر‬
                ‫‪e‬‬        ‫‪v‬‬                                   ‫‪G‬‬                  ‫‪L‬‬

                                        ‫‪X‬‬                                                             ‫.......................‬         ‫ط ا ورا‬               ‫ا‬
                ‫‪e‬‬        ‫‪v‬‬                                   ‫‪e‬‬                  ‫‪v‬‬


            ‫‪e‬‬        ‫‪v‬‬                          ‫‪G‬‬        ‫‪L‬‬                      ‫‪G‬‬                    ‫‪v‬‬
                                        ‫‪X‬‬                           ‫,‬                                            ‫,‬          ‫...................‬   ‫ج‬         ‫ا‬
                                                    ‫‪e‬‬               ‫‪L‬‬                        ‫‪e‬‬                   ‫‪v‬‬
                                                                                ‫,‬
                                                                 ‫..........................................................................‬   ‫ب‬             ‫ا‬
                                   ‫ا ل 2‪F‬‬


                    ‫ذ: و فا د‬       ‫ا‬                                                                            ‫: - 69 -‬                         ‫ا‬
                                                                                                               ‫ا زاوج‬
           ‫‪e‬‬          ‫‪v‬‬         ‫‪e‬‬            ‫‪L‬‬          ‫‪G‬‬            ‫‪v‬‬            ‫‪G‬‬             ‫‪L‬‬

               ‫2/1‬                   ‫2/1‬                     ‫2/1‬                          ‫2/1‬
           ‫‪e‬‬          ‫‪v‬‬         ‫‪e‬‬            ‫‪L‬‬          ‫‪G‬‬            ‫‪v‬‬            ‫‪G‬‬             ‫‪L‬‬
                                                                                                                  ‫‪e‬‬              ‫‪v‬‬
           ‫‪e‬‬          ‫‪v‬‬         ‫‪e‬‬            ‫‪v‬‬          ‫‪e‬‬            ‫‪v‬‬            ‫‪e‬‬              ‫‪v‬‬
               ‫4/1‬                   ‫4/1‬                     ‫4/1‬                          ‫4/1‬                         ‫2/1‬

      ‫% 52 ] ‪.[ e,v ] 25 % + [ e,L ] 25 % + [ G,v ] 25 % + [ G,L‬‬  ‫ل 2‪F‬‬
                            ‫.‬     ‫ا ر ،ادن ا ور ت‬      ‫ا ظر ط ق ا‬   ‫ظ أن ا‬

                                                                                 ‫ا ور ت ا ر ط :‬     ‫2‬
                                                                               ‫ن د ذ ا ل.‬        ‫أ–ا‬
‫ا و ــــــــــ 4‬                                                ‫4.‬       ‫‪ - a‬ر ن أ ظر ا ر ن 7، و‬
   ‫د‬       ‫ت . ا و ذات أ‬  ‫ن زو ن ن ا‬      ‫ن نذ ا ل‬      ‫ن‬    ‫وم زاوج‬  ‫ر ن 7:‬
    ‫‪. Brun‬‬     ‫ورة ‪ Tronqué‬و ون‬     ‫‪ Normal‬و ون راء ‪ Rouge‬وا رى ذات أ‬
      ‫د و ون راء.‬             ‫س ذو ظ ر ر‬     ‫ف‬      ‫ل ا ل ا ول 1‪F‬‬
                                                                                  ‫؟‬           ‫ل ھذه ا‬         ‫ن‬             ‫ذا‬       ‫1(‬
                       ‫:‬      ‫2‪F‬‬          ‫ا لا‬              ‫،‬        ‫ا‬         ‫ن 1‪ F‬وذ ر‬                ‫ھ‬      ‫نأ‬           ‫وم زاوج‬
               ‫د و ون‬           ‫ل ذات أ‬          ‫901 ذ‬                         ‫ورة و ون‬                 ‫ل ذات أ‬         ‫004 ذ‬
    ‫راء‬        ‫د و ون‬           ‫ل ذات أ‬          ‫014 ذ‬               ‫راء‬       ‫ورة و ون‬                 ‫ل ذات أ‬         ‫111 ذ‬
                                                    ‫؟‬          ‫ھذا ا وع ن ا زاوج و ھ ا‬     ‫2( ذا‬
                                                    ‫؟‬        ‫2‪ . F‬ذا‬      ‫ل‬      ‫3( دد ب ا راد ا‬
                                                                      ‫.‬     ‫ذه ا‬       ‫را‬  ‫4( أ ط‬
                     ‫راء.‬   ‫د و ون‬               ‫ذ ر 1‪ F‬ذو أ‬              ‫ورة و ون‬               ‫ذات أ‬         ‫وم زاوج ث ن أ‬
                                                                                                                ‫ا ل 2’‪ F‬ون ن:‬
       ‫.‬       ‫ورة و ون‬            ‫ل ذات أ‬        ‫571 ذ‬                  ‫راء‬    ‫د و ون‬                      ‫ل ذات أ‬         ‫071 ذ‬
                                                   ‫ظ؟‬       ‫2’‪ . F‬ذا‬                  ‫ل‬         ‫5( دد ب ا راد ا‬
                                                                                          ‫؟‬        ‫6( ف ر ھذه ا‬

                                                                                              ‫‪ - b‬ل ا ر ن:‬
    ‫د و ون‬                    ‫ظ ره ا ر ا ب ذو أ‬                           ‫سو‬      ‫ظ أن ا ل ا ول 1‪F‬‬  ‫1(‬
       ‫ورة،‬                 ‫أ‬      ‫د‬   ‫د‬    ‫أن أ‬                         ‫ون ا ول ـ ‪Mendel‬‬    ‫راء. ط‬
                                                                           ‫ون .‬        ‫و ون راء د‬

             ‫ب ] ‪.[ t,b‬‬            ‫ورة و ون‬     ‫د و ون راء ب ] ‪ [ N,R‬وأ‬                                                      ‫رز‬
           ‫ھو ا ق ن‬                  ‫ھذا ا وع ن ا زاوج زاوج ا را ‪ ،BackCross‬وا‬                                                       ‫2(‬
                                                                ‫ت.‬   ‫ل‬    ‫لا‬                                                     ‫ا‬
                      ‫ذ: و فا د‬       ‫ا‬                                                              ‫: - 79 -‬           ‫ا‬
                                                                 ‫2‪:F‬‬                               ‫ل‬                 ‫واع ا‬                    ‫3( ا ب ا و‬

‫] ‪ [ N,R‬ھ : ))901+111+004+014(/014(.001 = % 18.93‬                                                                                         ‫ر‬       ‫را‬        ‫ظ‬       ‫ا‬            ‫•‬
                ‫] ‪ [ t,b‬ھ : )0301/004(.001 = % 38.83‬                                                                                      ‫ر‬       ‫را‬        ‫ظ‬       ‫ا‬            ‫•‬
               ‫] ‪ [ N,b‬ھ : )0301/901(.001 = % 85.01‬                                                                                       ‫ر‬       ‫را‬        ‫ظ‬       ‫ا‬            ‫•‬
               ‫] ‪ [ t,R‬ھ : )0301/111(.001 = % 87.01‬                                                                                       ‫ر‬       ‫را‬        ‫ظ‬       ‫ا‬            ‫•‬

     ‫ت ( إذ‬     ‫ل‬      ‫ف ا ون ا ث ـ ‪ ) Mendel‬ون ا راق ا‬           ‫ظ أن ھذه ا‬
‫ظ ر ن ر ن أ و ن ‪[ N,R‬‬            ‫ل‬    ‫و ، ل‬     ‫ب‬     ‫ظ ھر ر‬       ‫أر‬     ‫ل‬
     ‫.‬      ‫ب‬     ‫د دة ا ر ب ] ‪[ t,R ] ، [ N,b‬‬   ‫] ، ] ‪ [ t,b‬ب رة، و ظ ھر ر‬
              ‫أن ا ور ن ر ط ن.‬           ‫ت، وھو‬    ‫ل‬    ‫دم ا راق ا‬       ‫ھذا دل‬

                                                                                           ‫ا زاو ت :‬                                                  ‫4( ا و ل ا‬

                                                                                                          ‫ء‪.P‬‬                    ‫دا‬           ‫ا زاوج ا ول :‬
                     ‫] ‪[ t,b‬‬         ‫‪X‬‬              ‫: ] ‪[ N,R‬‬        ‫..........................................‬   ‫ـ‪P‬‬                ‫ا ظ ھر ا ر‬
             ‫‪t‬‬            ‫‪b‬‬                     ‫‪N‬‬            ‫‪R‬‬
                                    ‫‪X‬‬                                              ‫..................................................‬         ‫ط ا ورا‬                    ‫ا‬
             ‫‪t‬‬            ‫‪b‬‬                     ‫‪N‬‬            ‫‪R‬‬


     ‫‪t‬‬               ‫‪b‬‬
                                     ‫‪X‬‬               ‫‪N‬‬           ‫‪R‬‬                   ‫..................................................................‬     ‫ج‬            ‫ا‬
                                ‫‪N‬‬           ‫‪R‬‬
                                                                 ‫.................................................................................‬   ‫ب‬                   ‫ا‬
                                ‫‪t‬‬           ‫‪b‬‬            ‫ا ل 1‪[N,R] 100 % F‬‬

                                                                                                       ‫: ا زاوج ا را .‬                                      ‫ا زاوج ا‬
                      ‫] ‪[ t,b‬‬           ‫‪X‬‬           ‫: ] ‪[ N,R‬‬            ‫.....................................................‬          ‫ا ظ ھر ا ر‬
                 ‫‪t‬‬        ‫‪b‬‬                     ‫‪N‬‬            ‫‪R‬‬
                                     ‫‪X‬‬                                               ‫..................................................‬        ‫ط ا ورا‬                       ‫ا‬
                 ‫‪t‬‬        ‫‪b‬‬                     ‫‪t‬‬            ‫‪b‬‬


         ‫‪t‬‬            ‫‪b‬‬                         ‫‪N‬‬            ‫‪R‬‬                         ‫‪t‬‬              ‫‪b‬‬
                                     ‫‪X‬‬                                                                                     ‫..............................‬   ‫ج‬                ‫ا‬


     ‫‪t‬‬               ‫‪b‬‬          ‫‪N‬‬           ‫‪R‬‬                                                             ‫ب ط ا ل 2‪ ،F‬أ ظر‬                                                   ‫ا‬
         ‫% 05‬                       ‫% 05‬                                                                                                                                ‫ا زاوج‬
     ‫‪t‬‬               ‫‪b‬‬          ‫‪N‬‬           ‫‪R‬‬                                                ‫فا‬        ‫ا ظر‬    ‫ظ أن ا‬
                                                         ‫‪t‬‬           ‫‪b‬‬
                                                                                     ‫ظ ھر‬      ‫ل 2‪F‬‬          ‫ث‬      ‫ا ر‬
     ‫‪t‬‬               ‫‪b‬‬          ‫‪t‬‬           ‫‪b‬‬                                           ‫ر أ و ط، ) ]‪.( [N,R] , [t,b‬‬
         ‫% 05‬                       ‫% 05‬                 ‫% 001‬


                     ‫ذ: و فا د‬          ‫ا‬                                                                                        ‫: - 89 -‬                       ‫ا‬
      ‫أ ج‬                ‫راض و ود ر ت د دة‬                      ‫2‪ ،F‬ر‬               ‫د دة ا ر ب‬      ‫إن ظ ور ظ ھر ر‬
      ‫زا .‬              ‫ما‬    ‫لا‬       ‫تا‬                        ‫نا‬                 ‫، وذ ك دوث دل أ زاء‬     ‫ا‬     ‫ا‬
                                 ‫ا لا :‬                          ‫ا زاوج‬              ‫ون‬        ‫)أ ظر ا و 1، و 5(. و‬
‫ا و ــــــــــ 5‬                                                                    ‫ا لا‬        ‫ذ‬        ‫دأ‬    ‫ج‬    ‫إ جا‬            ‫1:‬       ‫او‬

 ‫ج‬        ‫ا م‬            ‫ا‬          ‫د ‪I‬‬        ‫ا‬        ‫ا ر‬                                                         ‫‪N‬‬       ‫‪R‬‬
         ‫‪2n‬‬                                   ‫‪2n‬‬                                ‫‪N‬‬     ‫‪R‬‬




                                                                                                                                         ‫أ‬
                                                                                                     ‫ا ر‬
                                                                ‫ا ر‬
                                                                                ‫‪N‬‬     ‫‪b‬‬
                                          ‫‪N‬‬             ‫‪R‬‬                                                           ‫‪N‬‬       ‫‪b‬‬




                                                                                                                                         ‫جأ د ا‬
     ‫‪N‬‬          ‫‪R‬‬




                                                                                                                                             ‫ا‬
                                                                                                     ‫ا‬
                                          ‫‪N‬‬             ‫‪R‬‬
                                                        ‫‪b‬‬




                                                                ‫ا‬
                                          ‫‪t‬‬             ‫‪R‬‬
                                                        ‫‪b‬‬
     ‫‪t‬‬          ‫‪b‬‬                                                                                                       ‫‪t‬‬   ‫‪R‬‬
                                          ‫‪t‬‬             ‫‪b‬‬




                                                                                                         ‫‪II‬‬
                                                                                ‫‪t‬‬     ‫‪R‬‬



                                                                ‫‪I‬‬
                                                                                ‫‪t‬‬     ‫‪b‬‬
                                                                                                                        ‫‪t‬‬   ‫‪b‬‬




                    ‫‪t‬‬          ‫‪b‬‬              ‫‪t‬‬             ‫‪R‬‬   ‫‪N‬‬           ‫‪b‬‬         ‫‪N‬‬             ‫‪R‬‬

                        ‫% 52‬                      ‫% 52‬               ‫% 52‬                     ‫% 52‬
                    ‫‪t‬‬          ‫‪b‬‬              ‫‪t‬‬             ‫‪R‬‬   ‫‪N‬‬           ‫‪b‬‬         ‫‪N‬‬             ‫‪R‬‬
                                                                                                                    ‫‪t‬‬       ‫‪b‬‬

                    ‫‪t‬‬          ‫‪b‬‬              ‫‪t‬‬             ‫‪b‬‬    ‫‪t‬‬          ‫‪b‬‬             ‫‪t‬‬          ‫‪b‬‬
                        ‫% 52‬                      ‫% 52‬               ‫% 52‬                     ‫% 52‬                  ‫% 001‬


                               ‫2'‪:F‬‬     ‫ب ب ا ظ ھر ا ر‬     ‫،‬     ‫5( ا زاوج ا ث ھو زاوج‬
                             ‫ظ ر ا ر ] ‪ [ N,R‬ھ : ))571+071(/071(.001 = % 72.94‬         ‫•‬
                              ‫] ‪ [ t,b‬ھ : ))571+071(/571(.001 = % 37.05‬  ‫ظ را ر‬        ‫•‬
                                   ‫% 05 + % 05‬                   ‫أو‬         ‫ر‬       ‫ط ظر‬             ‫ظ أن ھذا ا زاوج ط‬

                ‫ج ا د دة‬ ‫ا‬                            ‫أو ، وم‬        ‫طأ‬         ‫ون ا ذ ر ا ن أ‬     ‫6( ر ھذه ا‬
                ‫د ذ ر ذ ا ل.‬                          ‫ج‬    ‫لا‬   ‫ل‬                 ‫ا ر ب، وذ ك دم دوث ا ور ا‬
                                                                                   ‫ن د ت ا ط طم.‬       ‫ب–ا‬
‫ا و ــــــــــ 5‬                                                      ‫5.‬        ‫‪ - a‬ر ن أ ظر ا ر ن 8، و‬
      ‫و‬    ‫ا‬                ‫ت.ا و‬    ‫ن زو ن ن ا‬         ‫ن ن ا ط طم،‬          ‫ن‬       ‫ر ن 8 : وم زاوج‬
  ‫ا ل ا ول 1‪F‬‬             ‫ل‬     ‫ذا ا ط .‬    ‫و و‬       ‫ا‬       ‫‪ stemphyllium‬وا رى‬             ‫ط‬
                                  ‫و و ط .‬           ‫ا‬        ‫س ون ن ط طم‬               ‫ف‬
                                                            ‫؟‬      ‫ل ھذه ا‬     ‫ن‬         ‫2( ذا‬
                    ‫:‬     ‫2‪F‬‬     ‫ا لا‬            ‫ن 1‪،F‬‬        ‫وط طم ھ‬          ‫ا‬      ‫ن ط طم‬     ‫وم زاوج‬
          ‫ط‬           ‫و و‬     ‫ا‬   ‫% 11 ن ا ط طم‬            ‫ط .‬             ‫و‬       ‫ا‬    ‫% 93 ن ا ط طم‬
         ‫ط‬          ‫و و‬     ‫ا‬     ‫% 93 ن ا ط طم‬                ‫ط‬          ‫و‬      ‫ا‬      ‫% 11 ن ا ط طم‬
                                     ‫؟‬         ‫ھذا ا وع ن ا زاوج و ھ ا‬               ‫2( ذا‬
                                          ‫2‪ . F‬؟‬          ‫ل‬       ‫نا با‬              ‫3( ذا‬
                                                          ‫.‬     ‫ذه ا‬          ‫را‬     ‫4( أ ط‬
                         ‫ذ: و فا د‬                ‫ا‬                                                           ‫: - 99 -‬          ‫ا‬
                                                                              ‫‪ - b‬ل ا ر ن: ر ن ز .‬
                                                                                                                     ‫:‬            ‫ج–‬
          ‫م ا زا ، ھم ظ ھرة‬      ‫تأ ءا‬    ‫ا‬           ‫ا ذي‬    ‫إ ا طا‬
   ‫ج‬      ‫ون أ‬    ‫ؤدي إ‬    ‫(‬        ‫ط‬  ‫ت)‬       ‫ذه ا‬       ‫طإ‬ ‫ز‬          ‫ا ور ا‬
            ‫ر ن أ راد ا ل.‬   ‫وع ورا‬   ‫جإ‬    ‫ذه ا‬     ‫و ورا ، و ؤدي ا ء ا وا‬
                                                                                        ‫ن ور ن.‬                               ‫سا‬        ‫‪– VI‬‬
              ‫5.‬      ‫ط4 و‬       ‫ن ور ن: أ ظر‬                               ‫ت ا د دة وا‬                  ‫ا ر‬             ‫ن‬             ‫1ا‬
‫ا و ــــــــــ 5‬     ‫) ‪.( La carte factorielle‬‬                      ‫ا رط ا‬                ‫ن ور ن وو‬                          ‫سا‬   ‫ط 4:‬
          ‫ن‬          ‫ن‬‫زاوج‬ ‫ن‬       ‫‪ Thomas Hunt Morgan‬أ‬            ‫دم: د ظا ما ر‬
                   ‫.‬      ‫ن ھذا ا زاوج ون دا‬        ‫ا ر ت ا د دة ا‬     ‫ور ن ر ط ن، ن‬
     ‫ن‬        ‫. و‬     ‫ون دا‬      ‫ظ ا رض ‪ Morgan‬أن و ا ور وق ا‬               ‫ن ھذه ا‬       ‫اط‬
    ‫ا ل‬   ‫ن ور ن إ وار ت‬         ‫رت ا‬        ‫. إذ‬       ‫ا ل دوث ور‬       ‫ا ر ت ا د دة و‬
                                              ‫ا ر ت ا د دة.‬      ‫ار ت‬        ‫دوث ا ور و‬
      ‫ل و دة )‪ ، (Centimorgan) : (CMg‬ث أن ‪ % 1 = 1 CMg‬ن ا ر ت‬                     ‫س ھذه ا‬
                                   ‫ن ور ن ‪ a‬و ‪ b‬ھ )‪.d(a-b‬‬            ‫ا‬         ‫ا د دة. وھ ذا‬

                                             ‫دد ا راد ذوي ا ر ت ا د دة‬
                                ‫‪100 X‬‬       ‫)‪ = d (a-b‬ــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬
                                                        ‫راد‬                     ‫ا دد ا‬


              ‫ن ا ور ن ون ا ون و ل ا‬                         ‫با‬         ‫4،أ‬          ‫ط تا رن7 و‬                     ‫ر ھذه ا ط ت و‬
                                                                                                                            ‫) ‪d (N – R‬‬



                                        ‫‪N‬‬                                    ‫‪R‬‬
                                                                                                                    ‫ف‬
                                        ‫‪t‬‬                                     ‫‪b‬‬
                           ‫لا‬                                                           ‫ون ا ون‬



                   ‫ن ا ور ن ون ا ون و ل ا‬                               ‫با‬             ‫4،‬         ‫ط ت ا ر ن 7، و‬                   ‫ن‬    ‫اط‬
                                                                                                                                  ‫)‪: d(R,N‬‬
                     ‫ت ا د دة‬     ‫دد ا راد ذوي ا ر‬                                   ‫111 + 901‬
    ‫= )‪d(R,N‬‬                  ‫001 ‪ X‬ـــــــــــــــــ‬                                 ‫001 ‪ X‬ـــــــــ =‬                      ‫‪= 21.36 cMg‬‬
                          ‫راد‬                  ‫ا دد ا‬                                  ‫0301‬
                           ‫‪N‬‬                                                             ‫‪R‬‬

                           ‫‪t‬‬                                                             ‫‪b‬‬
                                            ‫‪21.36 cMg‬‬
                    ‫ذ: و فا د‬      ‫ا‬                                                                             ‫: - 001 -‬         ‫ا‬
                                                                 ‫ل د ا ط طم:‬     ‫2 درا‬
‫ا و ــــــــــ 6‬                                   ‫6.‬    ‫‪ - a‬ر ن أ ظر ا ر ن 9، و‬
   ‫راء و د دي و ر‬    ‫) ‪ ( SM‬ذات أوراق‬             ‫ن ن ا ط طم،‬    ‫ن‬      ‫ر ن 9 : م ا زاوج ن‬
 ‫ل أول‬    ‫ل‬     ‫.‬      ‫رو ر‬      ‫رود‬                  ‫) ‪ ( M‬ذات وأوراق‬       ‫ء،‬
   ‫1‪F‬‬   ‫ھ‬    ‫ن‬    ‫ء. و ط ا زاوج ا را‬             ‫راء و د دي و ر‬     ‫س وراق‬       ‫1‪F‬‬
                                                       ‫ا :‬       ‫) ‪( M‬ا‬    ‫نا‬     ‫و‬
                                   ‫ء‬   ‫راء و د دي و ر‬      ‫ذات أوراق‬   ‫714‬
                                        ‫رو ر‬      ‫ود‬       ‫ذات أوراق‬   ‫524‬
                                       ‫راء و د دي و ر‬      ‫ذات أوراق‬    ‫61‬
                                   ‫ء‬   ‫رو ر‬    ‫راء و د‬     ‫ذات أوراق‬     ‫3‬
                                       ‫رو ر‬    ‫راء و د‬     ‫ذات أوراق‬    ‫55‬
                                     ‫ء‬   ‫و د دي و ر‬        ‫ذات أوراق‬    ‫95‬
                                         ‫و د دي و ر‬        ‫ذات أوراق‬     ‫5‬
                                     ‫ء‬  ‫رو ر‬     ‫ود‬        ‫ذات أوراق‬    ‫02‬
                                               ‫ا زاوج ا ول ؟‬     ‫ل‬    ‫ن‬      ‫ذا‬               ‫1(‬
‫ر ‪( C,c‬‬    ‫ء ) ‪ ،( L,l‬د‬   ‫راء ) ‪ ،( V,v‬ر‬ ‫ل ا ر وز ا : د دي ) ‪ ،( N,n‬أوراق‬                     ‫2(‬
  ‫2‪،F‬‬   ‫ا لا‬            ‫ل‬   ‫) ‪ .( R,r‬دد ا ظ ھر ا ر ا‬      ‫) ‪ ،( T,t‬ر‬     ‫)، أوراق‬
                                                             ‫ل ظ ر.‬     ‫ب‬
         ‫ا زاوج ا را ؟ و ف ر ظ ور ا ر ت ا د دة د ت ا ط طم؟‬            ‫ن‬      ‫ذا‬               ‫3(‬
                                                   ‫ن ا ور ت ا درو .‬       ‫ا با‬                ‫4(‬
                          ‫ور ت ا ث.‬        ‫‪La carte factorielle‬‬      ‫أ زا رط ا‬                ‫5(‬
                                                 ‫‪ - b‬ل ا ر ن:‬
   ‫.‬    ‫ت ورا ، م ادن ن ا و ا‬     ‫ن ث‬      ‫ن‬    ‫ن‬     ‫1( د م ا زاوج ن‬
     ‫ظ رھم ا ر ا ب ذو د‬    ‫ون و ون‬       ‫ظ أن ل أ راد ا ل ا ول 1‪F‬‬
       ‫ت د‬   ‫ا ون ا ول دل ن ا‬     ‫ء. وا دا‬   ‫راء، و ر‬      ‫دي، أوراق‬
       ‫،و ر‬     ‫ر، أوراق‬ ‫ت د‬    ‫ا‬    ‫ء دة‬    ‫راء، و ر‬      ‫دي، أوراق‬
                                                                 ‫.‬
                         ‫2‪ F‬ھ :‬     ‫ا لا‬       ‫ل‬     ‫2( ا ظ ھر ا ر ا‬
                                          ‫% 7.14‬     ‫)0001/714(.001 =‬          ‫] ‪[ V,N,L‬‬      ‫•‬
     ‫% 2.48‬              ‫ظ ھر أ و‬
                                         ‫% 5.24‬      ‫)0001/524(.001 =‬          ‫] ‪[ t , c, r‬‬   ‫•‬
                                           ‫% 6.1‬     ‫)0001/61(.001 =‬           ‫] ‪[ V,N ,r‬‬     ‫•‬
                                           ‫% 3.0‬     ‫)0001/3(.001 =‬            ‫] ‪[ V,c,L‬‬      ‫•‬
                                          ‫% 5.5‬      ‫)0001/55(.001 =‬           ‫] ‪[ V,c,r‬‬      ‫•‬
               ‫ظ ھر د دة ا ر ب‬             ‫% 9.5‬      ‫)0001/95(.001 =‬           ‫] ‪[ t,N,L‬‬     ‫•‬
                ‫% 8.51‬
                                           ‫% 5.0‬      ‫)0001/5(.001 =‬            ‫] ‪[ t,N,r‬‬     ‫•‬
                                             ‫%2‬       ‫)0001/02(.001 =‬           ‫] ‪[ t,c,L‬‬     ‫•‬

   ‫ا د دة ا ر ب.‬         ‫ا ظ ھر ا ر‬          ‫ر‬     ‫رة دا‬   ‫ا ظ ھر ا ر ا و‬        ‫ظ أن‬
                                                            ‫ن ھذا أن ا ور ت ر ط .‬
      ‫ج دى ا ب‬          ‫لا‬     ‫د‬          ‫دوث ظ ھرة ا ور ا‬     ‫ر ظ ور ر ت د دة دى ا‬
                                                             ‫ا ن 1‪ .F‬أ ظر ا و 1، و 6.‬
                   ‫ذ: و فا د‬   ‫ا‬                                         ‫: - 101 -‬     ‫ا‬
 ‫ا و ــــــــــ 6‬                                                      ‫ت ا د دة‬   ‫را ر‬       ‫و‬   ‫ت ا ور ا‬         ‫1:‬   ‫او‬
               ‫‪V‬‬       ‫‪N‬‬   ‫‪L‬‬                                              ‫‪V‬‬       ‫‪N‬‬      ‫‪L‬‬
‫]‪[V,N,L‬‬                                         ‫‪V‬‬     ‫‪N‬‬     ‫‪L‬‬
                                                                                                     ‫‪V‬‬        ‫‪N‬‬        ‫‪L‬‬
               ‫‪V‬‬       ‫‪N‬‬   ‫‪r‬‬                                ‫‪r‬‬
‫]‪[V,N,r‬‬                                                                   ‫‪V‬‬       ‫‪N‬‬      ‫‪L‬‬
                                                ‫‪V‬‬     ‫‪N‬‬
               ‫‪t‬‬       ‫‪c‬‬   ‫‪L‬‬                    ‫‪t‬‬     ‫‪c‬‬                                              ‫‪t‬‬        ‫‪c‬‬        ‫‪r‬‬
‫]‪[ t,c,L‬‬                                                    ‫‪L‬‬             ‫‪t‬‬       ‫‪c‬‬      ‫‪r‬‬
               ‫‪t‬‬       ‫‪c‬‬   ‫‪r‬‬
‫] ‪[ t,c,r‬‬                                       ‫‪t‬‬      ‫‪c‬‬     ‫‪r‬‬
                                                                          ‫‪t‬‬       ‫‪c‬‬      ‫‪r‬‬
               ‫‪V‬‬       ‫‪N‬‬   ‫‪L‬‬                                              ‫‪V‬‬       ‫‪N‬‬      ‫‪L‬‬
‫]‪[V,N,L‬‬                                         ‫‪V‬‬     ‫‪N‬‬     ‫‪L‬‬
                                                                                                     ‫‪V‬‬        ‫‪N‬‬        ‫‪L‬‬
               ‫‪V‬‬       ‫‪c‬‬   ‫‪r‬‬                           ‫‪c‬‬
‫]‪[ V,c,r‬‬                                                                  ‫‪V‬‬       ‫‪N‬‬      ‫‪L‬‬
                                                ‫‪V‬‬            ‫‪r‬‬
               ‫‪t‬‬       ‫‪N‬‬   ‫‪L‬‬                    ‫‪t‬‬                                                    ‫‪t‬‬        ‫‪c‬‬        ‫‪r‬‬
‫]‪[ t,N,L‬‬                                              ‫‪N‬‬          ‫‪L‬‬        ‫‪t‬‬       ‫‪c‬‬      ‫‪r‬‬
               ‫‪t‬‬       ‫‪c‬‬   ‫‪r‬‬
‫] ‪[ t,c,r‬‬                                       ‫‪t‬‬      ‫‪c‬‬     ‫‪r‬‬
                                                                          ‫‪t‬‬       ‫‪c‬‬      ‫‪r‬‬
               ‫‪V‬‬       ‫‪N‬‬   ‫‪L‬‬                                              ‫‪V‬‬       ‫‪N‬‬      ‫‪L‬‬
‫]‪[V,N,L‬‬                                         ‫‪V‬‬     ‫‪N‬‬     ‫‪L‬‬
                                                                                                     ‫‪V‬‬        ‫‪N‬‬        ‫‪L‬‬
               ‫‪V‬‬       ‫‪c‬‬   ‫‪L‬‬
‫]‪[V,c,L‬‬                                              ‫‪c‬‬                    ‫‪V‬‬       ‫‪N‬‬      ‫‪L‬‬
                                                ‫‪V‬‬           ‫‪L‬‬
               ‫‪t‬‬       ‫‪N‬‬   ‫‪r‬‬                    ‫‪t‬‬     ‫‪N‬‬     ‫‪r‬‬                                        ‫‪t‬‬        ‫‪c‬‬        ‫‪r‬‬
‫] ‪[ t,N,r‬‬                                                                 ‫‪t‬‬       ‫‪c‬‬      ‫‪r‬‬
               ‫‪t‬‬       ‫‪c‬‬   ‫‪r‬‬
‫] ‪[ t,c,r‬‬                                       ‫‪t‬‬      ‫‪c‬‬     ‫‪r‬‬
                                                                          ‫‪t‬‬       ‫‪c‬‬      ‫‪r‬‬



                                                                              ‫ن ا ور ت:‬              ‫با‬           ‫3(‬
               ‫3+55+95+5‬
     ‫ن ا د و ون ا وراق ھ : ‪ X 100 = 12.2 cMg‬ـــــــــــــــــــــــــــــ = )‪d(V-N‬‬                                ‫ا‬
                      ‫0001‬
               ‫02+5+3+61‬
     ‫‪ X 100 = 4.4 cMg‬ـــــــــــــــــــــــــــــ = )‪d(N-L‬‬                   ‫رھ :‬       ‫نا دو لا‬                 ‫ا‬
                      ‫0001‬
              ‫02+95+55+61‬
      ‫‪ X 100 = 15 cMg‬ـــــــــــــــــــــــــــــ = )‪d(V-L‬‬               ‫رھ :‬        ‫ن ا ون و ل ا‬                ‫ا‬
                       ‫0001‬

             ‫ن‬         ‫و‬   ‫ن ھذا أن ا ور )‪(N,c‬‬                       ‫ظ أن: )‪d(V-L) = d(V-N) + d(N-L‬‬
                                                                                   ‫ا ور ن )‪ (V,t‬و)‪.(L,r‬‬

       ‫ن ا ور ن، ذ ك‬                    ‫ددا‬     ‫ل‬   ‫ب‬    ‫ظ ذ ك دوث ور زدوج ن ‪ L‬و‪ ،v‬و م‬
                                                                 ‫ن )‪.d(V-L) < d(V-N) + d(N-L‬‬
                    ‫)‪ d(V-L‬ھ :‬                ‫س او ت وذك‬      ‫ر و وع ور ن‬     ‫ادن ب ا ذ ن ا‬

                                        ‫))3+5(‪16+55+59+20 + (2X‬‬
                               ‫‪ X 100 = 16.6 cMg‬ــــــــــــــــــــــــــــــــــــــــــــــــــــــــ = )‪d(V-L‬‬
                                                             ‫0001‬
                     ‫ذ: و فا د‬      ‫ا‬                                                    ‫: - 201 -‬        ‫ا‬
              ‫ب‬        ‫ا ور ت‬       ‫ل ط طو ، ر ب‬                                     ‫ل‬        ‫ھ‬         ‫4( ا ر ط ا‬
                                                                          ‫ت.‬              ‫وق ا‬        ‫ا‬      ‫و‬
                   ‫‪V‬‬                                                                        ‫‪N‬‬              ‫‪L‬‬

                                ‫‪12.2 cMg‬‬                                                        ‫‪4.4 cMg‬‬
                                                        ‫‪16.6 cMg‬‬
                                    ‫ا ــــــر ـــــطـــ ا ـــــــ ـــــ ـــــ ــــ‬
                                                                        ‫ل د ذ ا ل:‬        ‫3 درا‬
                                                         ‫7.‬      ‫‪ - a‬ر ن أ ظر ا ر ن 01، و‬
‫ا و ــــــــــ 7‬
     ‫ء ‪Lisse‬‬  ‫ذات م ر دي ‪ Gris‬و ون‬        ‫نذ با ل ن‬         ‫ر ن 01 : م زاوج ن أ‬
        ‫ذو م أ ر ‪ Jaune‬و ون ر ء‬         ‫‪ Complètes‬ذ ر ن‬               ‫وأ‬
      ‫س ذو‬    ‫ف‬     ‫ا ل 1‪F‬‬         ‫ورة ‪.Tronquées‬‬        ‫‪ Rugueuses‬وأ‬
                                        ‫.‬       ‫ء، وأ‬    ‫م ر دي، ون‬
                                                  ‫ھذا ا وع ن ا زاوج ؟‬    ‫1( ذا‬
                                                ‫؟‬      ‫ھذا ا زاوج. ذا‬    ‫2( ل‬
             ‫ورة.‬         ‫ون ر ء، وأ‬        ‫ر،‬    ‫ذو م أ‬     ‫ن ا ل ا ول 1‪ F‬ذ ر ن‬                                ‫م زاوج أ‬
                                                  ‫8 ظ ھر ر :‬     ‫ل وز‬   ‫0882 ذ‬                                 ‫ا ل 2‪F‬‬
                                                 ‫.‬              ‫ء، وأ‬    ‫ون‬    ‫دي،‬        ‫مر‬      ‫ل ذات‬        ‫0801 ذ‬
                                                    ‫.‬            ‫ء، وأ‬    ‫ون‬    ‫ر،‬        ‫مأ‬      ‫ل ذات‬        ‫ذ‬   ‫87‬
                                              ‫ورة.‬            ‫ر ء، وأ‬     ‫ون‬    ‫ر،‬        ‫مأ‬      ‫ل ذات‬        ‫1701 ذ‬
                                              ‫ورة.‬            ‫ر ء، وأ‬    ‫ون‬    ‫دي،‬        ‫مر‬      ‫ل ذات‬        ‫ذ‬   ‫66‬
                                                ‫ورة.‬            ‫ء، وأ‬    ‫ون‬    ‫دي،‬        ‫مر‬      ‫ل ذات‬        ‫392 ذ‬
                                                ‫.‬             ‫ر ء، وأ‬    ‫ون‬    ‫دي،‬        ‫مر‬      ‫ل ذات‬        ‫ذ‬    ‫6‬
                                                  ‫.‬            ‫ر ء، وأ‬    ‫ون‬    ‫ر،‬        ‫مأ‬      ‫ل ذات‬        ‫282 ذ‬
                                                 ‫ورة.‬            ‫ء، وأ‬    ‫ون‬    ‫ر،‬        ‫مأ‬      ‫ل ذات‬        ‫ذ‬    ‫4‬
                                                         ‫ھذا ا وع ن ا زاوج ؟ و ا‬
                                                          ‫؟‬                             ‫3( ذا‬
                                                           ‫4( ن ذا ر ر ب ا ل 2‪ F‬؟‬
                      ‫ن ھذه ا ب ؟‬           ‫كا‬     ‫2‪ . F‬ذا‬        ‫ل‬      ‫5( أ ب ب ا راد ا‬
 ‫ر‬     ‫) ‪ ،( C,c‬م أ‬           ‫ء ) ‪ ،( L,l‬أ‬    ‫ل ا ر وز ا : م ر دي ) ‪ ،( G,g‬ون‬              ‫6(‬
          ‫ا زاوج ا ول‬            ‫را‬     ‫ورة ) ‪ .( T,t‬أ ط‬     ‫) ‪ ،( J,j‬ون ر ء ) ‪ ،( R,r‬أ‬
                                                                              ‫وا زاوج ا .‬
                          ‫ن ا ور ‪ j‬و ‪ .r‬و ن ا ور ‪ r‬و ‪ .t‬و ن ا ور ‪ j‬و ‪.t‬‬             ‫7( أ ب ا‬
                                           ‫ور ت ا ث.‬         ‫ا‬    ‫أن ول ن ا و‬           ‫8( ذا‬
                                                      ‫ت ا ث.‬                   ‫9( أ ز ا ر ط ا‬

                                                                                         ‫‪ - b‬ل ا ر ن:‬

      ‫ن‬        ‫ن‬        ‫م ن‬         ‫‪Trihybridisme‬‬                  ‫و ا‬          ‫ھذا ا وع ن ا زاوج‬                   ‫1(‬
                                                                               ‫ت ورا .‬    ‫ن ث‬

                    ‫ذ: و فا د‬   ‫ا‬                                                              ‫: - 301 -‬        ‫ا‬
    ‫ظ رھم ا ر ا ب ذو م ر دي، ون‬      ‫ون و ون‬     ‫2( ل أ راد ا ل 1‪F‬‬
      ‫ت م ر دي، ون‬    ‫ون ا ول ـ ‪ Mendel‬ن ا‬   ‫.وط‬        ‫ء وأ‬
                                                           ‫ء‬
             ‫ورة.‬   ‫ت م أ ر، ون ر ء، وأ‬      ‫ا‬   ‫دة‬            ‫وأ‬
     ‫م ن رد ن 1‪ F‬ر‬   ‫‪،BackCross‬‬                                        ‫ھذا ا وع ن ا زاوج زاوج ا را‬     ‫3(‬
  ‫ن ھذا‬   ‫.ا‬   ‫ا‬   ‫رد ن ا ط ا وي‬                                        ‫روف،‬     ‫ا ران، ط ا ورا‬
                             ‫ت.‬                                         ‫ل‬     ‫لا‬     ‫ا زاوج ھو ا ق ن ا‬
                 ‫ج ا و ، ن ا ذ ر ھو ن‬    ‫4( إن ر ب ا ل 2‪ F‬ر ن ر ب أ ط ا‬
                       ‫ج.أ ظر ا و .‬   ‫وى ط وا د ن ا‬   ‫ن‬    ‫،‬   ‫ا‬   ‫و‬
                                                                  ‫2‪:F‬‬                               ‫ل‬                 ‫ب ا راد ا‬                        ‫ب‬               ‫5(‬

 ‫أ طأو‬          ‫: 001‪37.50 % = (1080/2880)X‬‬                                   ‫و‬        ‫ا‬              ‫راد ] ‪ [ G,L,C‬ا‬                              ‫ا‬           ‫•‬
‫% 96.47‬         ‫: 001‪37.19 % = (1071/2880)X‬‬                                   ‫و‬         ‫ا‬              ‫راد ] ‪ [ j, r, t‬ا‬                           ‫ا‬           ‫•‬
                 ‫: 001‪10.17 % = (293/2880)X‬‬                                   ‫و‬         ‫ا‬              ‫راد ] ‪ [ G,L, t‬ا‬                            ‫ا‬           ‫•‬
                   ‫: 001‪9.79 % = (282/2880)X‬‬                                   ‫و‬         ‫ا‬              ‫راد ] ‪ [ j, r, C‬ا‬                          ‫ا‬           ‫•‬
‫أ ط د دة‬            ‫: 001‪2.71 % = (78/2880)X‬‬                                  ‫و‬        ‫ا‬              ‫راد ] ‪ [ j, L, C‬ا‬                            ‫ا‬           ‫•‬
    ‫ا ر ب‬           ‫: 001‪2.29 % = (66/2880)X‬‬                                  ‫و‬         ‫ا‬              ‫راد ] ‪ [ G, r, t‬ا‬                           ‫ا‬           ‫•‬
‫% 13.52‬
                      ‫: 001‪0.21 % = (6/2880)X‬‬                                  ‫و‬         ‫ا‬              ‫راد ] ‪ [ G,r,C‬ا‬                            ‫ا‬           ‫•‬
                      ‫: 001‪0.14 % = (4/2880)X‬‬                                 ‫و‬         ‫ا‬              ‫راد ] ‪ [ j, L, t‬ا‬                           ‫ا‬           ‫•‬

     ‫ن ھذا أن‬             ‫طا و ،‬              ‫ر‬                            ‫ب‬              ‫ظ أن ا ط ا د دة ا ر ب ظ ر‬
                                                                                                          ‫ا ور ت ر ط .‬

                                                                                               ‫ا زاوج:‬                                             ‫را‬          ‫6( ا‬

                                                                                                       ‫ء‪.P‬‬                  ‫دا‬           ‫ا زاوج ا ول :‬

            ‫] ‪[ j, r, t‬‬           ‫‪X‬‬       ‫: ] ‪[ G,L,C‬‬                   ‫.....................................‬   ‫ـ‪P‬‬               ‫ا ظ ھر ا ر‬
        ‫‪j‬‬   ‫‪r‬‬    ‫‪t‬‬                        ‫‪G‬‬   ‫‪L‬‬      ‫‪C‬‬
                              ‫‪X‬‬                                           ‫........................................................‬         ‫ط ا ورا‬                 ‫ا‬
        ‫‪j‬‬   ‫‪r‬‬    ‫‪t‬‬                        ‫‪G‬‬   ‫‪L‬‬      ‫‪C‬‬


        ‫‪j‬‬   ‫‪r‬‬    ‫‪t‬‬
                              ‫‪X‬‬           ‫‪G‬‬   ‫‪L‬‬      ‫‪C‬‬                      ‫........................................................................‬   ‫ج‬           ‫ا‬
                                               ‫.................................................................................................‬   ‫ب‬               ‫ا‬
                          ‫‪G‬‬   ‫‪L‬‬       ‫‪C‬‬
                                              ‫ا ل 1‪[G,L,C] 100 % F‬‬
                          ‫‪j‬‬   ‫‪r‬‬       ‫‪t‬‬




                ‫ذ: و فا د‬         ‫ا‬                                                                                        ‫: - 401 -‬                       ‫ا‬
                                                                                                                   . ‫: ا زاوج ا را‬                                 ‫ا زاوج ا‬

                        [ j, r, t ]             X             [ G,L,C ] :                   .....................................   P‫ـ‬                 ‫ا ظ ھر ا ر‬
                j        r    t                            G          L       C
                                               X                                                 ........................................................      ‫ط ا ورا‬                  ‫ا‬
                j        r    t                               j       r       t

j     r     t                                          G          L       C                  j        r        t                      G       L        t
                                               X                                                                                                                   .....       ‫ج‬        ‫ا‬
                                                                              j    r    C                          j      L       C

                                                       G          r       t                 G         r       C                        j      L        t


                                                                                        ............................................................................   ‫ب‬                ‫ا‬
                                      F2 ‫ا ل‬

                                                                                                                                                                ‫ا زاوج‬
    j L t                G r C         G r t          j L C                   j r C              G L t                     j r t                  G L C


    j L t                G r C         G r t          j L C                   j r C              G L t                     j r t                  G L C
                                                                                                                                                                           G L C

    j r t                j r t          j r t         j r t                   j r t               j r t                    j r t                   j r t


                                                                                                                                                                       ‫ا ظ ھر‬
[ j,L,t ]           [ G,r,C ]         [ G,r,t ]     [ j,L,C ]             [ j,r,C ]         [ G,L,t ]                   [ j,r,t ]            [ G,L,C ]                   ‫ا ر‬


                                                      d(j-r) :r‫ و‬j ‫ن ا ور‬ ‫با‬                                                                                                       (7
                             d(j-r) = ((4+6+66+78)/2880)X100 = 5.35 cMg
                                                   d(r-t) :t‫ و‬r ‫ن ا ور‬ ‫با‬
                        d(r-t) = ((4+6+282+293)/2880)X100 = 20.31 cMg
                                                d(t-j) :t‫ و‬j ‫ن ا ور‬ ‫با‬
                    d(t-j) = ((2X(4+6)+66+78+282+293)/2880)X100 = 25.66 cMg

                                                           :‫ق أن‬                  ‫ا ؤال ا‬                          ‫ل‬      ‫ا‬     ‫8( ن ن ا‬
                                                                                                               d (j-t) ≈ d(r-j) + d(r-t)
                                                   .t ‫ وا ور‬j ‫ وا د ن ا ور‬r ‫ن ھذا أن ا ور‬

                                                                                       :‫ث‬           ‫تا‬                                                      ‫9( ا ر ط ا‬
                    j                  r                                                                                                                       t

                        5.3 cMg                                                   20.3 cMg
                                                                          25.6 cMg
                                           ‫ا ــــــر ـــــطـــ ا ـــــــ ـــــ ـــــ ــــ‬
                ‫ذ: و فا د‬                  ‫ا‬                                                                                            - 105 - :                          ‫ا‬
                                                                                                                     ‫ظ :‬
             ‫د ذ ا ل ن ا ف ن و ود أ رط‬                                    ‫ت‬       ‫ر‬  ‫ظ ا‬      ‫د تا‬
‫ت‬         ‫ل ظ ور ا‬       ‫ب ھذه ا رط ؤدي إ‬                               ‫ف ب و . و د ن أن ل ل‬
                                                                             ‫ت د دة.‬   ‫وظ ور‬     ‫ا و‬
          ‫ا ور ت‬            ‫و‬         ‫و‬             ‫را ط‬            ‫ظ ت ن ا ون ن و‬      ‫ن ھذه ا‬   ‫اط‬
                                                                                              ‫ت.‬   ‫ا‬

                                                                                        ‫1، و 7.‬          ‫: أ ظر ا و‬
‫ا و ــــــــــ 7‬

                                                    ‫ا‬           ‫ا‬
                                                                                                                ‫1:‬         ‫ا‬
                     ‫2‪F‬‬      ‫ا‬   ‫ا‬                      ‫ا ول 1‪F‬‬           ‫ا‬

                          ‫4/1 ، 4/3‬             ‫ا‬          ‫ا ب ذي ا‬               ‫% 001‬                 ‫دة‬                   ‫ا‬
                                                                                                                         ‫ا د‬
                      ‫4/1 ، 4/1 ،‬
                                                                    ‫و‬             ‫% 001‬        ‫دة‬     ‫وي ا‬
                                                                                                                         ‫) أ ان‬
                              ‫2/1‬                                                                                ‫(‬
                                                  ‫% 001‬
                    ‫61/1 ، 61/3 ،‬                                                   ‫دة‬
                                                ‫ا ب ذي ا‬
           ‫ر‬          ‫61/3 ، 61/9‬
                                                       ‫ا‬
      ‫،‬                                    ‫ة‬    ‫ا‬           ‫ا‬
‫اوج‬                                                                                   ‫دة‬
                      ‫61/1 ، 61/1 ،‬        ‫وج‬
                ‫ذ‬                                                                    ‫وج‬


                                                                                                                     ‫(‬
                      ‫61/2 ، 61/3 ،‬       ‫ا ول،‬             ‫ا‬
               ‫‪A‬‬                                                     ‫دة‬           ‫و وي ا‬              ‫ر ن‬
                        ‫61/3 ، 61/6‬           ‫و‬            ‫و‬
    ‫‪B‬‬                                                                                                 ‫ن‬
                                           ‫وج‬
‫ا اوج‬
                                                                                                                          ‫ا‬
                                              ‫ا‬             ‫ا‬
 ‫، أي‬           ‫ا‬     ‫61/1 ، 61/1 ،‬
                ‫أ‬
                                                                                                                     ‫) أ ان‬

                      ‫61/1 ، 61/1 ،‬                                     ‫دة‬        ‫وي ا‬
                                                ‫و‬
                                                                                                                       ‫ا‬
      ‫‪A‬‬               ‫61/2 ، 61/2 ،‬                                           ‫و‬
‫‪.B‬‬                                          ‫و‬
                      ‫61/2 ، 61/2 ،‬                                                        ‫ا‬
                                                    ‫.‬       ‫ا‬
                               ‫61/4‬
                                                  ‫% 001‬
                                                                                    ‫ا‬      ‫أ‬          ‫ر ن‬
                          ‫4/1 ، 4/3‬             ‫ا ب ذي ا‬
                                                                                         ‫وا‬          ‫ن‬
                                                  ‫.‬    ‫ا‬




                    ‫ذ: و فا د‬    ‫ا‬                                                                  ‫: - 601 -‬        ‫ا‬
                                           ‫ل ا ث:‬         ‫ا‬
                                       ‫ﻋﻠﻢ اﻟﻮراﺛﺔ اﻟﺒﺸﺮﻳﺔ‬
                                                                          ‫ط 1، و 1‬              ‫د : أ ظر‬
‫ا و ــــــــــ 1‬
                                                              ‫ر .‬    ‫ا ورا ا‬      ‫و ت درا‬           ‫ط 1:‬
                                   ‫زاو ت و .‬            ‫نإ‬      ‫ن دة ر‬       ‫را‬                               ‫1(‬
                  ‫أ راد ل ل. و ذ ك طول ر ل ل.‬         ‫ظرا‬        ‫ن ط ق ا وا ن ا‬                               ‫2(‬
   ‫642 وع‬    ‫جو‬      ‫نا‬         ‫ن )64( ن ن إ ط ء )³²2( و‬      ‫ا‬     ‫ت‬       ‫ا دد ا ر‬                          ‫3(‬
                                      ‫ا ث.‬      ‫و‬   ‫، ا ء ا ذي طرح‬       ‫نا و تا‬
   ‫ا ر‬     ‫د‬    ‫ت ورا‬      ‫ور أ ب ا درا ت ول ا ل ا راض ا ورا ، وا درا ت ا ر ر‬                                 ‫4(‬
          ‫ا ر .‬      ‫ورا دا ل ا‬      ‫ل درا ا ل‬      ‫ذا ؤ ذ‬   ‫ون رو‬            ‫ا ر ا‬

              ‫ن.‬ ‫ن ل ر دا‬         ‫ت ا ورا‬    ‫ن م ا ورا ا ر ن درا آ ت ا ل ا‬
                ‫ا ل ض ا ھ ت ا ورا ، ن أ ل ا ؤ‬         ‫م‬    ‫و‬     ‫و دف ھذه ا درا إ‬
     ‫در ا و .إ أن ھذه ا درا‬        ‫ظ ورھ ن د د وا ذ ا راءات ا رور . إذن ا دف و‬
                 ‫ا وا ت.‬    ‫ت د‬        ‫س وا ن ا ل ا‬          ‫و تر مأ‬      ‫دة‬   ‫وا‬

                                                        ‫ن.‬          ‫دا‬        ‫ا ورا‬          ‫ل درا‬       ‫‪–Ι‬و‬
                             ‫:‬   ‫لا‬   ‫دت ذا ا رض ا و‬     ‫ن، ا‬        ‫دا‬        ‫ا ورا‬        ‫و درا‬            ‫ظرا‬

                                             ‫ب ‪Les arbres généalogiques‬‬                     ‫رات ا‬        ‫1‬
         ‫دة‬         ‫ا‬      ‫ن، د ا رداد ل ا داث ا‬   ‫ز رات ا ب ن طرف أط ء ا‬
                         ‫ظ د ا ف و د ا ف. أ ظر ط2، و 1.‬       ‫ا‬  ‫أ ل، ر د ا‬

‫ا و ــــــــــ 1‬                            ‫ن.‬     ‫دا‬    ‫ا ورا‬      ‫ن ن درا‬            ‫لا‬     ‫ط2:او‬           ‫2‬

                                                 ‫ب = ‪Les arbres généalogiques‬‬                   ‫رات ا‬

 ‫ت‬   ‫ل ھذه ا‬            ‫لا‬     ‫و ذك ا‬             ‫ت وا راض ر أ ل‬          ‫ل ضا‬          ‫ن‬
     ‫داث ا‬            ‫ا‬       ‫ن‬        ‫رة ا ب، وھ ر م‬             ‫ز‬       ‫ل ا وا وذ ك‬
   ‫ف)ا ء‬                ‫د ا ف وا‬       ‫ا ورا ا درو‬      ‫ن زواج وإ ب وظ ور أو دم ظ ور ا‬
 ‫ن ا رد ل‬             ‫ود إذا‬     ‫ث دا رة وا ذ ور ر و ون ھذه ا ر وز‬        ‫وا ء (. ث ر ز‬
                                    ‫.‬     ‫ل ھذه ا‬     ‫ر إذا ن ا رد‬       ‫ا درو .و ر‬       ‫ا‬
               ‫ن‬    ‫ا‬       ‫ر‬     ‫ا رإ ا‬          ‫سا ط نا ر‬            ‫أ راد ا ل ا وا د‬
                                                                     ‫ل زوج. ) أ ظر ا و 1 (.‬




                   ‫ذ: و فا د‬     ‫ا‬                                             ‫: - 701 -‬             ‫ا‬
                                                                                                                        ‫ب‬    ‫رة ا‬     ‫ز‬                      ‫1: ا ر وز ا‬             ‫او‬

     ‫ل‬         ‫‪ = III , II , I‬أر م ا‬                    ‫رض‬               ‫ل‬        ‫رد‬                     ‫ون‬         ‫أ راد‬                                             ‫ر ل‬
                                                                             ‫ل‬                                    ‫رض‬                                ‫ون‬
     ‫1 ، 2 ، 3 = أر م ا راد‬                                                                                       ‫ا دروس‬                                              ‫ا رأة‬

         ‫‪I‬‬


         ‫‪II‬‬                                                                                                             ‫زواج أ رب‬                                     ‫زواج‬
                          ‫1‬            ‫2‬    ‫3‬               ‫4‬                     ‫5‬            ‫6‬         ‫7‬

         ‫‪III‬‬
                      ‫1‬            ‫2‬   ‫3‬                        ‫4‬        ‫5‬                 ‫6‬        ‫7‬

         ‫‪IV‬‬
                                       ‫1‬        ‫2‬               ‫3‬                ‫4‬             ‫5‬
                                                                 ‫ب‬           ‫رة‬                                              ‫ر‬      ‫وأم‬                                   ‫وأم‬


                                   ‫ط3، و 1.‬                          ‫‪ Les cartes chromosomiques‬أ ظر‬                                                 ‫2 ا را ط ا‬

‫ا و ــــــــــ 1‬                                                     ‫‪.Les cartes chromosomiques‬‬                                                ‫ط 3 : ا را ط ا‬                       ‫3‬

 ‫ص‬                             ‫صا‬           ‫ا‬                     ‫ت إ دى‬        ‫ور‬            ‫ا زا رط ا‬                                                                       ‫د‬
                                                    ‫.‬            ‫ب ا د وا ل و و ا زيء ا ر زي ,,, أ ظر ا و أ‬                                                                 ‫ور‬
 ‫وھ ت‬                 ‫صا‬               ‫،و ن‬                       ‫ت ا ذوذ ا‬      ‫نا ف ن‬          ‫لا رط ا‬                                                                  ‫و ن‬
                                                                                         ‫ت.‬   ‫ر دد أو ل ا‬                                                                 ‫ا ر ط‬
                                                                     ‫ل أزواج .‬        ‫أ ، مر‬      ‫تا رط ا‬                                                                    ‫ط‬

                                                                     ‫9‬                 ‫8‬       ‫2‬         ‫6‬          ‫4‬         ‫5‬           ‫6‬              ‫3‬
                  ‫4‬       ‫3‬            ‫2‬        ‫7‬                                                                                                                     ‫5‬                 ‫1‬
‫1‬



‫7‬              ‫21‬             ‫11‬       ‫22‬       ‫41‬                           ‫02‬                ‫51‬   ‫22‬            ‫11‬             ‫41‬            ‫01‬            ‫21‬                 ‫8‬


 ‫9‬           ‫01‬               ‫31‬       ‫02‬                       ‫61‬
                                                                                               ‫71‬                       ‫71‬                                   ‫61‬                 ‫12‬


               ‫51‬             ‫12‬                        ‫91‬                                                                                ‫91‬
‫31‬                                                                                   ‫81‬                      ‫81‬
                                                                                                                                                                                ‫‪X‬‬    ‫‪Y‬‬



               ‫ن، ر‬            ‫ن‬                    ‫و د‬   ‫تا‬       ‫وع ا‬  ‫ن‬                                               ‫رة ن و‬      ‫ھ‬       ‫ا رط ا‬
                                                ‫ر د و و ا زيء ا ر زي ,,,‬                                                 ‫نا‬       ‫ل أزواج ب‬
                      ‫ص ا وھ ت‬                     ‫ون‬       ‫ت ا ذوذ ا‬   ‫ف ن‬                                              ‫نا‬        ‫ل ا را ط ا‬   ‫ن‬
                                                                          ‫ت.‬                                               ‫ا‬   ‫دد أو‬     ‫ر‬     ‫ا ر ط‬


                              ‫ذ: و فا د‬                 ‫ا‬                                                                             ‫: - 801 -‬                   ‫ا‬
                                                                                         ‫ط4، و 2.‬          ‫ل ا ـ ‪ ADN‬أ ظر‬
                                                                                                                  ‫ل ا ـ ‪.ADN‬‬         ‫ط4:‬
‫ا و ــــــــــ 2‬
               ‫زل ر ت‬                 ‫ص ‪ADN‬‬             ‫ا‬            ‫زيء ‪ADN‬‬               ‫ز ت‬          ‫رو‬     ‫ا صا‬         ‫زل ‪ ADN‬ن‬
                ‫ء‬
                                                                                             ‫ر أ زت‬               ‫طا ط ا‬        ‫ل و ،و‬
‫دم‬




                                                                                                                        ‫‪.Agarose‬‬         ‫راء‬
                                                                                                ‫ل ر : أن ط ‪ ADN‬ذات‬            ‫ا راء‬
                                                                                            ‫ب و دھ ،‬       ‫ر و ا طب ا و ب ر‬
                                                                                          ‫ن دد‬       ‫ط‬       ‫ل‬   ‫ن ض،‬                  ‫ر‬
                                                                    ‫‪ ADN‬ا راد ر ده‬           ‫ر (.‬    ‫وا ط أ رى رو ا د ) ط‬           ‫ر‬     ‫دھ‬
               ‫+‬                                                                                            ‫ور ب:‬                    ‫ر د‬
                                                                                                            ‫ل و .‬      ‫ط ‪ADN‬‬           ‫•‬
                                                                                           ‫‪ ADN‬ا‬                ‫و‬       ‫ط ‪ADN‬‬         ‫•إ‬
                                                                                          ‫ل ر ده‬     ‫‪ ADN‬ھ ن‬        ‫ل‬    ‫، ث‬     ‫ث‬
 ‫‪G‬‬
                                                                                                                ‫ا ذا .‬       ‫ورا‬


               ‫-‬                                                                         ‫ر د ‪ADN‬‬
                                                                         ‫ھد‬   ‫‪ADN‬‬

                                         ‫ب ض ا ور ت.‬                               ‫ف ن و ود أو‬        ‫ل ا د ق ـ ‪ ADN‬ن ا‬                 ‫نا‬

                                                                    ‫س.‬               ‫ر ر ط‬            ‫ل أ راض ورا‬           ‫ا‬    ‫‪ – IΙ‬درا‬
                                                                                            ‫1 ا ل رض ‪Mucoviscidose‬‬
                                                                                           ‫أ – ر ن : أ ظر ر ن 1، و 2‬
                                                                                    ‫س.‬        ‫ر ر ط‬          ‫أ راض ورا‬      ‫ط 5 : درا‬
 ‫ا و ــــــــــ 2‬                                                                                                           ‫رن1:‬
 ‫‪I‬‬                                                                                          ‫طرا ت‬   ‫ز‬      ‫رض ‪ Mucoviscidose‬رض ورا‬
                                 ‫1‬                      ‫2‬                            ‫دد ا ط ، ا ء ا ذي‬         ‫إ رازات ز‬        ‫،‬    ‫و‬     ‫ھ‬
                                                                                             ‫،و‬   ‫رة ا ر‬            ‫ؤدي إ ا داد ا وات ا‬
                                                                                        ‫ؤدي إ ا داد‬      ‫ر س:‬             ‫ا طرا ت ا وظ ا‬
 ‫‪II‬‬                                                                                       ‫ت.‬           ‫وا‬       ‫بذك ر‬          ‫تارو ،‬       ‫ا‬
                   ‫1‬             ‫3 2‬     ‫4‬              ‫5‬       ‫6‬             ‫7‬        ‫ون ذا‬      ‫ض أ رادھ‬        ‫رة ب‬            ‫أ‬   ‫ط او‬
                                                                                                                                       ‫ا رض.‬
‫‪III‬‬
           ‫1‬                      ‫2‬                         ‫3‬        ‫4‬        ‫5‬       ‫وع ا دة ن ا ل ا دي‬             ‫1( ل ھذه ا رة م ا‬
                                                                                                             ‫وا ل ا ؤول ن ا رض.‬
                                                                                      ‫ر ف ل ھذا ا رض ن‬                 ‫نا ولا‬       ‫2( ا ط‬
      ‫ون‬               ‫أ راد‬                   ‫ون‬           ‫أ راد‬                           ‫ل ا دي ب ‪ N‬أو ‪ n‬و ل‬         ‫ل ر. ) ر ز‬
                                                                                                      ‫ا رض ـ ‪ M‬أو ‪( m‬‬

                                                                                                                ‫لا رن:‬          ‫ب–‬

           ‫ن.‬                  ‫أ واھ 1‪ I‬و 2‪I‬‬                ‫رض،‬                       ‫أن ا ت 3‪II‬‬  ‫1( ن رة ا ب ھذه ا‬
                                                                                          ‫.‬      ‫ن ھذا أن ا رض ا‬
                   ‫ض، ل‬                         ‫3‪II‬‬                 ‫وا‬            ‫وا ب 2‪I‬‬      ‫ون ا ل ا ؤول ن ا رض‬
                                         ‫(.‬                                         ‫)‬                        ‫أن ا ر ا‬

                                ‫ذ: و فا د‬           ‫ا‬                                                           ‫: - 901 -‬        ‫ا‬
                  ‫نا‬     ‫إ‬     ‫ھ ها‬                        ‫ادن‬      ‫3‪،II‬‬   ‫1‪ I‬و 2‪ I‬أ ا‬     ‫أن ا‬                        ‫2(‬
                    ‫ج: /‪ N‬و /‪ ،m‬و‬                     ‫ا‬                ‫أب‬   ‫ان ‪ .N//m‬وھ ا‬    ‫ا‬
                ‫، و‪m//m‬‬      ‫اد ا‬                            ‫ء ون ‪ N//N‬أو ‪N//m‬‬           ‫ظ ھر ا ر‬
                                                                                       ‫.‬      ‫اد ا‬
                                    ‫% 05.‬                 ‫% 52 + ‪N//m‬‬               ‫% 52 + ‪m//m‬‬                      ‫‪N//N‬‬
                                                                 ‫% 52.‬              ‫% 57 + ] ‪[ m‬‬                     ‫]‪[N‬‬
                                                                               ‫ل رض ‪Thalassémie‬‬                  ‫2ا‬

                                                                          ‫ر ن : أ ظر ر ن 2، و 2‬                ‫أ –‬

                                                                                                               ‫رن2:‬
 ‫ا و ــــــــــ 2‬
                                                                       ‫)‪ (Thalassémie‬ض ورا‬                 ‫ا‬           ‫ا ما‬
 ‫‪I‬‬
                              ‫1‬                   ‫2‬                       ‫ا‬       ‫ا‬        ‫ا ول ا‬           ‫ص‬        ‫ا‬
                                                                        ‫ر‬                 ‫دم د‬        ‫ھاا ض‬             ‫.‬     ‫ا‬
                                                                     ‫ت‬                     ‫إ‬           ‫،و‬       ‫اء ا‬    ‫تا‬
‫‪II‬‬                                                                   ‫.‬       ‫ا زات ا‬             ‫دورا أ‬         ‫با يا‬         ‫ا‬
      ‫1‬                 ‫3 2‬                   ‫4‬       ‫5‬          ‫6‬   ‫ض‬                ‫ا واج‬                ‫ضا‬        ‫ب‬    ‫ا‬
                                                                            ‫ض(. ا‬              ‫ھ‬        ‫ن ا وج وا و‬           ‫)‬
‫‪III‬‬                                                                             ‫أي أ اض ظ ھ ة و‬                   ‫ض‬           ‫ا‬
      ‫1‬        ‫2‬            ‫3‬                 ‫4‬       ‫5‬          ‫6‬                                       ‫.‬    ‫ا‬

                                                                           ‫ل‬  ‫وع ا دة ن ا‬       ‫1( ل ھذه ا رة م ا‬
‫‪IV‬‬
                                                                                    ‫ا دي وا ل ا ؤول ن ا رض.‬
           ‫1‬            ‫2‬       ‫3‬     ‫4‬       ‫5‬
                                                                      ‫ظ ور ا رض ا ل‬           ‫د‬  ‫2( ا رج ا ل ا ذي‬
                                                                         ‫ل ا ر وز ا‬    ‫ذ ك. )‬     ‫را‬   ‫ا را وأ ط‬
      ‫ون‬       ‫أ راد‬                   ‫ون‬         ‫أ راد‬              ‫رض (.‬     ‫ل ا دي، و ‪ M‬أو ‪m‬‬          ‫: ‪ S‬أو ‪s‬‬


                                                                                                ‫لا رن:‬         ‫ب–‬

 ‫دا ف‬            ‫د ا ف و و ود‬  ‫ظ أن ا ل ا ؤول ن ا رض ا دروس ب ظ ھر‬        ‫1(‬
                          ‫.‬   ‫ن ھذا أن ا ل ا ؤول ن ا رض‬     ‫)2‪ IV‬و 4‪،( IV‬‬
               ‫ت‬       ‫‪ Y‬نھ كإ ث‬     ‫ا‬      ‫ا ل ا ؤول ن ا رض ر ر ط‬
               ‫: ادن ا‬   ‫وأ ھ‬   ‫‪ X‬ن ا ت 2‪IV‬‬     ‫ا‬       ‫رض، و ر ر ط‬
                                                    ‫.‬              ‫ل‬

                   ‫ا ا ھ زواج ا رب.‬      ‫ظ را ض ا‬                   ‫ي‬                                     ‫ا‬     ‫2( إن ا‬
            ‫ض 2‪ IV‬و 4‪ ،IV‬و أن ا‬            ‫أ ء‬    ‫أ‬      ‫3‪ III‬و 2‪III‬‬                                         ‫أن ا‬
      ‫ان ‪.S//m‬‬   ‫ا‬           ‫نا‬    ‫إ‬    ‫ھ ها‬                     ‫ض‬                                       ‫ا‬     ‫ول‬      ‫ا‬
        ‫ء ون‬         ‫ظ ھر ا ر‬        ‫ج: /‪ S‬و /‪ ،m‬و‬  ‫ا‬                                                     ‫أب‬      ‫وھ ا‬
                      ‫.‬       ‫اد ا‬        ‫، و‪m//m‬‬     ‫اد ا‬                                               ‫‪ S//S‬أو ‪S//m‬‬



                       ‫ذ: و فا د‬          ‫ا‬                                                     ‫: - 011 -‬        ‫ا‬
                    ‫2‪[ S ] : III‬‬                         ‫‪X‬‬                ‫3‪[ S ] : III‬‬                          ‫.........................................................................................‬    ‫:‬                                                              ‫ھ ا ر‬                        ‫ا‬
                             ‫‪S‬‬                                                   ‫‪S‬‬
                                                                                                                                                                                                                          ‫:‬                                                          ‫ط ا را‬              ‫ا‬
                             ‫‪m‬‬
                                                     ‫‪X‬‬                           ‫‪m‬‬
                                                                                                         ‫.............................................................................................................‬




                                                                                     ‫............................................................................................................................................................................................................‬   ‫ج:‬   ‫ا‬
                    ‫‪S‬‬            ‫‪m‬‬                                        ‫‪S‬‬                                   ‫‪m‬‬
                         ‫،‬                           ‫‪X‬‬                           ‫،‬
                                                                                                                               ‫............................................................................................................................................................‬    ‫ب:‬        ‫ا‬
        ‫‪S‬‬                            ‫‪S‬‬                                    ‫‪S‬‬                                   ‫‪m‬‬

        ‫‪S‬‬                        ‫‪m‬‬                                       ‫‪m‬‬                                    ‫‪m‬‬

‫% 52 ]‪[S‬‬                     ‫% 52 ]‪[S‬‬                            ‫% 52 ]‪[S‬‬                        ‫% 52 ]‪[m‬‬                                                                    ‫.................................................‬    ‫ء:‬                                                          ‫ھ ا ر‬          ‫ا‬

                                                                                                                                                   ‫3 ا ل رض ‪Huntington‬‬
                                                                                                                          ‫3‬                      ‫أ – ر ن : أ ظر ر ن 3، و‬

 ‫ا و ــــــــــ 3‬                                                                                                                                                                                                                                                          ‫رن3:‬
   ‫‪I‬‬                                                                                          ‫ورا ؤ ر‬         ‫رض ھ ون ‪ Huntington‬ھو رض‬
                                 ‫1‬                           ‫2‬
                                                                                               ‫أھم‬      ‫،‬    ‫ن 03 و54‬     ‫وظ ا د غ، ظ ر و‬
                                                                                             ‫ب‬      ‫، ث‬      ‫أ راض ھذا ا رض ا طرا ت ر و‬
  ‫‪II‬‬                                                                                        ‫رف ،و د ا ذا رة. و ف ا رض ول‬     ‫ر ض داء ھ ون‬
        ‫1‬                 ‫2‬      ‫3‬           ‫4‬                   ‫5‬         ‫6‬                     ‫د ا ط ب ا ر ‪Huntington‬‬          ‫2781‬    ‫رة‬
                                                                                                          ‫‪ George‬و ن ھ ا ب ا رض ھذا ا م.‬
  ‫‪III‬‬                                                                                                       ‫و‬    ‫دة‬    ‫ر ط ظ ور ھذا ا رض ور‬
                                         ‫3‬       ‫4‬                   ‫5‬
        ‫1‬           ‫2‬                                                                            ‫ض أ رادھ‬       ‫رة ب‬       ‫أ‬    ‫.و ناو‬
                                                                                                                            ‫ون ذا ا رض.‬
  ‫‪IV‬‬                             ‫2؟‬                                                              ‫ل د.‬       ‫1( ن أن رض ‪ Huntington‬ر ط‬
                    ‫1‬                    ‫روف‬         ‫ر‬           ‫ر‬       ‫؟ ظ ر‬             ‫.) ر ز‬                   ‫ول‬   ‫2( ن أن ھذا ا رض‬
                                                                                            ‫ل ا دي ـ ‪ N‬أو ‪ n‬وا ل ا رض ـ ‪ H‬أو ‪.( h‬‬
‫ون‬          ‫أ راد‬                        ‫ون‬              ‫أ راد‬                            ‫ھو ا ل ظ ور ا رض دى ا رد 2 ن ا ل ا را .‬      ‫3(‬

                                                                                                                                                                                                                           ‫ب– لا رن:‬
        ‫ن ) 4‪ II‬و 5‪ ،( II‬س د م‬ ‫أن ا ء ا‬ ‫ل،‬ ‫ا‬      ‫ظ أن ا رض ظ ر‬     ‫1(‬
                 ‫ن ھذا أن ا ل ا ؤول ن ا رض ھو ل د.‬     ‫ون.‬      ‫أ ء‬
        ‫‪ ،X‬ت 1‪III‬‬       ‫ا‬                  ‫ول‬    ‫أن ا ل ا ؤول ن ا رض‬
                                                                  ‫ا‬     ‫2( إذا ا ر‬
          ‫ب أن ون ھذه ا ت‬              ‫رث ن أ ‪ XH‬و أن ا ل ا ؤول ن ا رض د،‬
                                                                        ‫.‬
                         ‫و‬       ‫ب، ور ا ؤو ن ا رض‬      ‫، ن أب‬  ‫أن ا ت 1‪III‬‬
                                                                      ‫.‬
                                            ‫3( ا ل ظ ور ا رض دى ا رد 2 ن ا ل ا را :‬
   ‫ن ى‬                   ‫أن‬         ‫ا را‬          ‫و ن 2‪ III‬و 3‪ :III‬أن ا م 3‪III‬‬      ‫ا ط ا ورا‬
 ‫ب )1‪IV‬‬                   ‫ا را إ ‪ H//H‬أو ‪ .H//n‬و أن ا ا ب ا‬          ‫ب‬      ‫‪ ، n//n‬أ ا ب 2‪ III‬ا‬
                              ‫ن ى ‪.H//n‬‬       ‫ب 2‪III‬‬       ‫ا را‬     ‫ا ض أ ،‬               ‫(أ ا‬

                        ‫ذ: و فا د‬                ‫ا‬                                                                                                                                                                        ‫: - 111 -‬                                                                 ‫ا‬
                                                                                                                                                      ‫:‬                           ‫ا‬                                 ‫ا‬                               ‫ن‬                                     ‫اوج‬             ‫وھ ا‬

             ‫2‪[ H ] : III‬‬                     ‫‪X‬‬           ‫3‪[ n ] : III‬‬                                             ‫.........................................................................................‬    ‫:‬                                                             ‫ھ ا ر‬                        ‫ا‬
                       ‫‪H‬‬                                                     ‫‪n‬‬
                                                                                                                                                                                                                            ‫:‬                                                         ‫ط ا را‬               ‫ا‬
                       ‫‪n‬‬
                                              ‫‪X‬‬                              ‫‪n‬‬
                                                                                                           ‫.............................................................................................................‬




                                                                                      ‫............................................................................................................................................................................................................‬   ‫ج:‬    ‫ا‬
           ‫‪H‬‬                     ‫‪n‬‬                                            ‫‪n‬‬
                   ‫،‬                          ‫‪X‬‬
                                                                   ‫..........................................................................................................................................................................................................................‬   ‫ب:‬         ‫ا‬
                             ‫‪H‬‬                        ‫‪n‬‬

                             ‫‪n‬‬                        ‫‪n‬‬

                   ‫% 05 ]‪[H‬‬                   ‫% 05 ]‪[n‬‬                  ‫.........................................................................................................................................‬    ‫ء:‬                                                       ‫ھ ا ر‬                        ‫ا‬

                                     ‫د ا ن 2‪ VI‬ھ 2/1.‬                               ‫ل ظ ور ا رض‬                                                                                                 ‫ن أن ا‬                                               ‫ل‬                              ‫ن ھذا ا‬                ‫اط‬

                                                           ‫س.‬                                                     ‫ر ط‬                                                      ‫ل أ راض ورا‬                                                                                         ‫ا‬                     ‫‪ – IIΙ‬درا‬
                                                                                                      ‫‪Le daltonisme‬‬                            ‫1 ا ل رض ا د و‬
                                                                                                                                     ‫أ – ر ن : أ ظر ر ن 1، و 3‬
‫ا و ــــــــــ 3‬
                                                                                         ‫ط 6 : درا‬                ‫س.‬                                              ‫ر ط‬                                          ‫أ راض ورا‬
                                                                                          ‫رن1:‬
    ‫ر.‬   ‫ز ن ا ر وا‬              ‫ب‬       ‫ر ا د و ‪ Daltonisme‬ذوذا م إ ر ا وان، إذ أن ا ص ا‬
                                                                 ‫.‬           ‫ا ل ھذا ا رض د‬        ‫رح‬
       ‫ب‬    ‫و د ن و ت : ) و د 1‪II‬‬           ‫ن ھذا ا ب ) 2‪،( I‬‬        ‫زوج ر ل م ن ا د و ) 1‪ ( I‬رأة‬
                                               ‫ن ا د و (.‬       ‫د و ، وو د 2‪ II‬م ن ا د و ، و ت 3‪II‬‬
   ‫د و‬         ‫ن ن ا د و 1‪ III‬و 2‪ .III‬و ت‬              ‫: ودن‬     ‫ب د و ،‬          ‫زو ت ا ت 3‪ II‬ر ل 4‪II‬‬
                                                                                                    ‫3‪.III‬‬
                                                                           ‫.‬   ‫1( أ ز رة ب ھذه ا‬
                         ‫.‬       ‫ون ا ل ا ؤول ن ا رض‬                    ‫د‬     ‫2( ا رج ن ا ط ت ا‬
      ‫ر نا ل‬          ‫‪D‬‬           ‫‪ ،X‬و‬          ‫ا‬        ‫ا‬   ‫ول‬       ‫أن ا ل ا ؤول ن ا د و‬         ‫3(‬
                      ‫راد 1‪.II3 ،II1 ،I2 ،I‬‬        ‫: أ ط ا ط ا ورا‬       ‫ر نا لا‬          ‫ا د، و‪d‬‬

                                                                                                                                                                                                                                      ‫ب– لا رن:‬
                                                                                                                                                                                                                                 ‫رة ا ب:‬                                                             ‫1( ا ز‬

                       ‫‪I‬‬                  ‫1‬                            ‫2‬                                                                                                                                 ‫م‬                    ‫ر ل‬

                                                                                                                                                                                                  ‫ب‬                           ‫ر ل‬
                       ‫‪II‬‬             ‫1‬           ‫2‬            ‫3‬                                        ‫4‬
                                                                                                                                                                                                                           ‫ا رأة‬

                       ‫‪III‬‬                                                                                                                                                                                                 ‫ا رأة‬
                                                           ‫1‬                                   ‫2‬                                   ‫3‬

                   ‫ذ: و فا د‬              ‫ا‬                                                                                                                                                                                         ‫: - 211 -‬                                                         ‫ا‬
                      ‫أن ا‬          ‫ض ) 1‪ ،( II‬ھ ا‬                            ‫ا‬   ‫وأ‬           ‫1‪ I‬و 2‪I‬‬        ‫أن ا‬           ‫2(‬
                    ‫ول‬     ‫ا‬                   ‫ھ ،و‬                        ‫ض دون أن‬      ‫ا‬       ‫ول‬    ‫ا‬        ‫نا‬
                                                                                               ‫.‬               ‫ضھ‬        ‫ا‬

                                                                                                ‫اد:‬        ‫ط ا را‬        ‫3( ا‬
                                        ‫ن ى ‪.XDY‬‬                                                         ‫• 1‪ : I‬ذ‬
         ‫ن إ ‪ XDXD‬أو ‪ ،XDXd‬و أن ھ ه ا أة‬     ‫ا را‬                                                         ‫• 2‪ : I‬أ‬
       ‫ن ى‬          ‫ا را‬    ‫ا ض ‪،Xd‬‬      ‫ول‬  ‫ا‬    ‫ا‬                                             ‫ب ورث‬            ‫ا‬
                                                                                                         ‫‪. XD Xd‬‬
                                   ‫ن ى ‪. Xd Y‬‬        ‫ا را‬                                      ‫ب‬        ‫• 1‪ : II‬ذ‬
                      ‫أ‬   ‫ن إ ‪ XDXD‬أو ‪،XDXd‬‬       ‫ا را‬                                              ‫• 3‪ : II‬ھ أ‬
        ‫ا را‬            ‫و‬   ‫أة 3‪II‬‬        ‫ا ض ‪ ،Xd‬و‬       ‫ا‬                                     ‫)3‪ (III‬ور‬
                                                                                                     ‫ھ ‪. XD Xd‬‬

                                                                      ‫ـ ‪Duchenne‬‬        ‫2 ا ل رض ا زال ا‬
                                                                               ‫أ – ر ن : أ ظر ر ن 2، و 3‬
‫ا و ــــــــــ 3‬                                                                                                  ‫رن2:‬

                                                                           ‫ث‬ ‫ب ض ا ط ل،‬       ‫ـ ‪ Duchenne‬رض‬              ‫ا زال ا‬
  ‫‪I‬‬                            ‫1‬                     ‫2‬                      ‫ر درة‬           ‫ما‬          ‫ظ ور وا ل در‬
                                                                                                            ‫ن ا ر وا س.‬
 ‫‪II‬‬                                                                      ‫أ ب ض أ رادھ رض‬             ‫رة ب‬           ‫أ‬   ‫ط او‬
                      ‫1‬        ‫2‬        ‫3‬        ‫4‬            ‫5‬                                    ‫ـ ‪.Duchenne‬‬           ‫ا زال ا‬
                                                                      ‫س‬      ‫ل رة ا ب ن أن ا رض ر ط‬             ‫1( ا دا ل‬
 ‫‪III‬‬                                                                                   ‫‪.X‬‬        ‫ا‬    ‫و ول ن طرف ا‬
           ‫1‬          ‫2‬             ‫3‬        ‫4‬           ‫5‬          ‫6‬             ‫.‬   ‫2( ھل ا ل ا ؤول ن ا رض د أم‬
                                                                                ‫،‬     ‫و ن 1‪ I‬و 2‪ .I‬و‬     ‫3( أ ط ا ط ا ورا‬
 ‫‪IV‬‬                                                                                                       ‫:‬      ‫ر وز ا‬
       ‫1‬        ‫2‬      ‫3‬        ‫4‬
                                                                      ‫ا د .‬     ‫ل ا ؤول ن ا‬             ‫- ‪ S‬أو ‪s‬‬
                                                                         ‫ل ا ؤول ن ا رض‬                ‫- ‪ M‬أو ‪m‬‬
‫ون‬         ‫أ راد‬                        ‫ون‬           ‫أ راد‬                           ‫رض.‬      ‫ا ل 4‪IV‬‬         ‫4( دد ا ل إ‬

                                                                                                      ‫ب– لا رن:‬

               ‫أن ا ور‬             ‫ث، ھذا‬        ‫ل رة ا ب أن ا رض‬
                                                     ‫ب ا ذ ور دون ا‬                                             ‫1( ظ ر ن‬
                                                   ‫س.‬      ‫ن ا رض ر ط‬                                            ‫ا ؤو‬
          ‫أن‬   ‫دل‬      ‫) 3‪( III‬‬    ‫رة ا ب أن ا ب 1‪ II‬م، وأ ب ذ را‬                                              ‫ن‬
             ‫و‬      ‫‪ ،Y‬ادن ھ‬     ‫ا‬       ‫ا‬       ‫و‬    ‫ؤو ن ا رض ر‬                                               ‫ا ور ا‬
        ‫‪X‬‬      ‫‪ Y‬وأ ذ ن ا م 2‪ II‬ا‬       ‫ن 3‪ III‬ا‬     ‫‪) .X‬ا ب 1‪ II‬أ ط‬                                           ‫ا‬     ‫ا‬
                                                                                                              ‫ا رض(.‬
           ‫ؤول ن‬           ‫لا‬        ‫أن ا‬                ‫دل‬       ‫)3‪(III‬‬           ‫ط‬         ‫ن وأ‬      ‫2( ا وان 1‪ II‬و 2‪II‬‬
                                                                                                         ‫.‬      ‫ا رض‬

                      ‫ذ: و فا د‬              ‫ا‬                                                        ‫: - 311 -‬      ‫ا‬
                                                                   ‫ط ا ورا :‬                                                                                                                                                                                                                              ‫3( ا‬
                                                    ‫ذ ر م.‬   ‫• ا ب 1‪XSY : I‬‬
                      ‫ب 3‪ II‬أ ط ا ل ‪.Xm‬‬   ‫وأ ت ا ن‬       ‫أ‬  ‫• ا م 2‪XSXm : I‬‬
                                                   ‫ذ ر م.‬   ‫• ا ن 1‪XSY : II‬‬
                    ‫ب 3‪ III‬أ ط ا ل ‪.Xm‬‬  ‫وأ ت ا ن‬       ‫أ‬   ‫• ا ت 2‪XSXm : II‬‬
                                                   ‫ذ ر م.‬   ‫• ا ن 4‪XSY : II‬‬
                           ‫ب.‬    ‫و س د ان‬        ‫• ا ت 5‪ XSXS : II‬أو ‪ XSXm‬أ‬

                                                                                                    ‫رض:‬                                                ‫ل 4‪IV‬‬                                                    ‫ا‬                                  ‫لإ‬                                      ‫با‬              ‫4(‬

                         ‫2‪[ S ] : III‬‬                      ‫‪X‬‬            ‫1‪[ S ] : III‬‬                          ‫.........................................................................................‬    ‫:‬                                                              ‫ھ ا ر‬                              ‫ا‬
                                    ‫‪S‬‬                                         ‫‪S‬‬
                            ‫‪X‬‬                                            ‫‪X‬‬
                                                                                                                                                                                                                       ‫:‬                                                          ‫ط ا را‬                     ‫ا‬
                            ‫‪Y‬‬                              ‫‪X‬‬             ‫‪X‬‬   ‫‪m‬‬
                                                                                                      ‫.............................................................................................................‬




                                                                                  ‫............................................................................................................................................................................................................‬   ‫ج:‬          ‫ا‬
                    ‫‪S‬‬                                                    ‫‪S‬‬                                                   ‫‪m‬‬
    ‫‪X‬‬                           ‫،‬        ‫‪Y‬‬                 ‫‪X‬‬      ‫‪X‬‬               ‫،‬                ‫‪X‬‬

                                                                                                                                                 ‫.......................................................................................................................................‬    ‫ب:‬               ‫ا‬

                        ‫‪S‬‬                          ‫‪S‬‬                     ‫‪S‬‬                                                            ‫‪m‬‬
            ‫‪X‬‬                                ‫‪X‬‬                    ‫‪X‬‬                                         ‫‪X‬‬
            ‫‪X‬‬           ‫‪S‬‬                    ‫‪X‬‬     ‫‪m‬‬              ‫‪Y‬‬                                         ‫‪Y‬‬

    ‫]‪[S‬‬             ‫% 52‬                 ‫]‪[S‬‬      ‫% 52‬            ‫]‪[S‬‬    ‫% 52‬                       ‫]‪[m‬‬                                ‫% 52‬                                 ‫........................................‬  ‫ء:‬                                                      ‫ھ ا ر‬                              ‫ا‬



                                     ‫رض ھو 4/1 أي % 52.‬                       ‫ل 4‪IV‬‬                                                  ‫ا‬                                  ‫لإ‬                                   ‫أن ا‬                                                        ‫ا‬                            ‫ا‬

                         ‫ن ‪Le Rachitisme Vitamino-résistant‬‬                                                                          ‫3 ا ل رض ا ح ا وم‬
                                                                                                                                 ‫أ – ر ن : أ ظر ر ن 3، و 3‬
‫ا و ــــــــــ 3‬
                                                                                                                                                                                                                                                                                  ‫رن3:‬
‫،‬           ‫وه ظ م ا طراف ا‬                        ‫ؤدي إ‬       ‫ن ‪ Le Rachitisme Vitamino-résistant‬رض ورا‬                  ‫رض ا ح ا وم‬
        ‫ن. و ن ا و‬       ‫وم‬                       ‫و رض‬         ‫ن‪D‬‬        ‫وا ط ا ن ا د ن‬           ‫ن‬      ‫س رديء ظ م. وھذا ا رض‬
                                                                            ‫ن.‬     ‫ح ا وم‬        ‫ون‬       ‫، ض أ رادھ‬         ‫رة ب‬          ‫أ‬
                                                                                     ‫ن ر ط‬        ‫1( ھل ا ور ا ؤو ن ا ح ا وم‬
            ‫1‬                        ‫2‬                                             ‫؟ ل وا ك .‬           ‫تا‬          ‫أم‬      ‫تا‬
                                                                      ‫أ راد‬         ‫رة ا ب دد ا ل ا د وا ل‬             ‫ك‬       ‫ن‬    ‫2( ا ط‬
                                                                   ‫ون‬                                                           ‫.‬      ‫ا‬
        ‫3‬                           ‫4‬                  ‫5‬                          ‫راد 2 ،4 ،3 ،6 ،11، و9 . ) ر ز‬        ‫3( دد ا ط ا ورا‬
                                                                                ‫ل ا ؤول ن ا رض ـ ‪ R‬أو ‪ ،r‬و دي ـ ‪ N‬أو ‪.(n‬‬
                ‫6‬                        ‫7‬                     ‫8‬      ‫أ راد‬         ‫. ل وا ك.‬       ‫ت رض دا ل ھذه ا‬          ‫4( دد ا ث ا‬
                                                                   ‫ون‬                ‫5( إذا ت أن ا ت 8 د زو ت ر ل م ، دد ا ط‬
    ‫9‬               ‫01‬          ‫11‬           ‫21‬                                                ‫.‬      ‫دأ‬         ‫ول‬    ‫ا ورا ا ن ا‬


                                ‫ذ: و فا د‬                  ‫ا‬                                                                                                                                                                     ‫: - 411 -‬                                                        ‫ا‬
                                                                                                                                                                                                                   ‫ب– لا رن:‬

            ‫ون‬            ‫ون ون أ م ا ذ ور‬     ‫ظ أن ا ء ا ذ ور ا‬  ‫ن رة ا ب‬        ‫1( ا ط‬
                 ‫ا‬          ‫و‬     ‫أن ا ور ا ؤو ن ھذا ا رض‬        ‫ت، وھذا دل‬      ‫ا ث‬
                                      ‫.‬     ‫تا‬          ‫أن ا ور ر ط‬      ‫‪ ،X‬وھذا‬    ‫ا‬
        ‫‪X‬‬              ‫ل ا دي، و ن ا م 4 ا‬ ‫ل‬                                         ‫‪X‬ا‬                                                            ‫2( د ور ت ا ت 8 ن ا ب 5 ا‬
         ‫د.‬           ‫أن ا ل ا ؤول ن ا ح‬                                            ‫. ھذا‬                                                          ‫ل ا رض، و ت‬       ‫ا ل‬
                                                                                                                                                                                         ‫راد:‬                                                    ‫ط ا ورا‬                                ‫3( ا‬

‫ران.‬         ‫ا‬        ‫، ب ادن أن ون‬          ‫و ل‬         ‫أ‬  ‫• ا رد 2 : ‪XnXn‬‬
                        ‫ور ت ن ا ب ا ل ‪ XR‬و ن ا م ا ل ‪.Xn‬‬   ‫• ا رد 4 : ‪XRXn‬‬
                                                    ‫ذ ر م.‬   ‫• ا رد 3 : ‪XnY‬‬
             ‫ل ا دي.‬               ‫ا‬     ‫ب أن ون‬         ‫أ‬  ‫• ا رد 6 : ‪XnXn‬‬
    ‫ل‬       ‫ور ت ن ا ب ا ل ا رض ‪ XR‬و ن ا م ا‬           ‫أ‬   ‫• ا رد 11 : ‪XRXn‬‬
                                                                       ‫‪.X n‬‬
                                                    ‫ذ ر م.‬   ‫• ا رد 9 : ‪XnY‬‬

 ‫ؤول ن ظ ور ا رض‬                              ‫لا‬       ‫لا‬      ‫ت رض ھو أ إ ث‬     ‫ثا‬                                                                                                                                                               ‫ود‬                            ‫4( إن ا‬
                                                                 ‫م (.‬   ‫) ظر ر‬                                                                                                                                                                     ‫ر‬                            ‫إ أ‬
        ‫ل‬        ‫ؤول ن ا رض‬                    ‫ل‪R‬ا‬          ‫ت رض ن ا‬      ‫و دإ ث‬                                                                                                                                                                 ‫ھذه ا‬                           ‫ادن‬
                                                ‫.‬           ‫ا ران ‪ XRXn‬ون‬         ‫لأ‬                                                                                                                                                                                         ‫د، و‬

                 ‫م:‬       ‫نر ل‬                ‫د أ ء ا ت 8 د زوا‬                                                                              ‫ول‬                                      ‫نا‬                                     ‫ا‬                    ‫ط ا ورا‬                                ‫5( ا‬

                     ‫]‪[n‬‬                  ‫‪X‬‬              ‫]‪[R‬‬                        ‫:‬           ‫.........................................................................................‬    ‫:‬                                                              ‫ھ ا ر‬                          ‫ا‬
                          ‫‪n‬‬                                     ‫‪R‬‬
                 ‫‪X‬‬                                     ‫‪X‬‬
                                          ‫‪X‬‬                                             ‫.............................................................................................................‬    ‫:‬                                                          ‫ط ا را‬                 ‫ا‬
                 ‫‪Y‬‬                                      ‫‪X‬‬       ‫‪n‬‬
                                                                    ‫............................................................................................................................................................................................................‬   ‫ج:‬      ‫ا‬
        ‫‪n‬‬                                                   ‫‪R‬‬                                                    ‫‪n‬‬
‫‪X‬‬                     ‫،‬       ‫‪Y‬‬           ‫‪X‬‬        ‫‪X‬‬                ‫،‬                ‫‪X‬‬

                                                                                                                                   ‫.......................................................................................................................................‬    ‫ب:‬           ‫ا‬

            ‫‪R‬‬                         ‫‪n‬‬                     ‫‪R‬‬                                                             ‫‪n‬‬
    ‫‪X‬‬                             ‫‪X‬‬                ‫‪X‬‬                                          ‫‪X‬‬
    ‫‪X‬‬       ‫‪n‬‬                     ‫‪X‬‬   ‫‪n‬‬            ‫‪Y‬‬                                          ‫‪Y‬‬

‫]‪[R‬‬         ‫% 52‬              ‫]‪[n‬‬     ‫% 52‬         ‫]‪[R‬‬      ‫% 52‬                           ‫]‪[n‬‬                            ‫% 52‬                                ‫........................................‬  ‫ء:‬                                                      ‫ھ ا ر‬                          ‫ا‬




                      ‫ذ: و فا د‬           ‫ا‬                                                                                                                                                                      ‫: - 511 -‬                                                          ‫ا‬
                                                                                                 ‫:‬
                                                                       ‫س:‬               ‫ر ر ط‬        ‫ل أ راض‬   ‫دا‬

                                                                 ‫:‬              ‫ل‬       ‫رض ر ط‬                 ‫•‬
                        ‫ل ا ؤول ن ا رض.‬                          ‫ا ران‬      ‫ب ون‬      ‫صا‬                           ‫-ا‬
                 ‫ل ا دي.‬            ‫ا ران‬                        ‫ف ا ران أو‬   ‫ص ا م ون‬                             ‫-ا‬
‫م ھو 4/3.‬      ‫ب ھو 4/1 وإ ب ط ل‬   ‫لإ بطل‬                         ‫ا ران‬      ‫زاوج رد ن‬                              ‫-‬

                                                                  ‫د:‬            ‫ل‬       ‫رض ر ط‬                 ‫•‬
                  ‫ل ا رض.‬                  ‫ا‬
                                           ‫ران‬ ‫ف ا ران أو‬     ‫ب ون‬        ‫صا‬                                       ‫-ا‬
                                      ‫.‬   ‫لا‬         ‫ا ران‬      ‫ص ا م ون‬                                           ‫-ا‬
                        ‫ب ھو % 05.‬      ‫لإ بطل‬      ‫ب،‬     ‫زاوج أ و ن أ دھ‬                                          ‫-‬
                                                                            ‫س:‬             ‫ل أ راض ر ط‬         ‫دا‬

                                                                 ‫:‬              ‫ل‬       ‫رض ر ط‬                 ‫•‬
        ‫ن ‪.X‬‬       ‫ا‬    ‫ل ا رض وا ط أ د‬                   ‫ت ذا ا‬     ‫ت ا ران‬       ‫ت‬    ‫- ون ا‬
                  ‫ل ا رض، ون‬     ‫‪X‬ا ل‬                       ‫ا‬     ‫- د رث ا ء ا ذ ور ن ا م ا‬
                                                                                       ‫رض.‬
 ‫ل ا رض ن ا م وا ب‬             ‫ل‬    ‫‪X‬ا‬           ‫ا‬          ‫ا‬   ‫ول‬      ‫ا‬        ‫إ‬   ‫با‬       ‫-‬
                                                                                            ‫.‬

                                                                  ‫د:‬            ‫ل‬       ‫رض ر ط‬                 ‫•‬
               ‫ن رض.‬           ‫م، إ ب ذ ور وإ ث‬               ‫ران ب‬         ‫ا‬                    ‫ن ران أم‬           ‫-‬
‫رض.‬             ‫ون وإ ث‬       ‫ا ران (، إ ب ذ ور‬                  ‫)‬              ‫ب م‬            ‫ن ران ر ل‬            ‫-‬

       ‫‪Les anomalies chromosomiques chez‬‬   ‫.‬         ‫ن و وا‬            ‫دا‬                      ‫‪ – IV‬ا ذوذات ا‬
                                                                                                       ‫‪.l’Homme‬‬
             ‫ا وا‬       ‫ب أ راض ؤ ر‬  ‫،‬     ‫ت ن ا ذوذ ا‬     ‫ن دة‬  ‫رف د ا‬
‫ط 7،‬        ‫ت. أ ظر‬       ‫دد أو ل ا‬ ‫ب، و ر ط ھذه ا ذوذات ر‬    ‫صا‬       ‫وا‬
                                                                   ‫و 4.‬




                                                     ‫ت.‬         ‫دد ا‬                ‫ر‬     ‫1 ا ذوذ ا ر ط‬

                                                          ‫:‬            ‫تا‬               ‫دد ا‬     ‫ر‬      ‫أ –‬




            ‫ذ: و فا د‬     ‫ا‬                                                             ‫: - 611 -‬        ‫ا‬
‫ا و ــــــــــ 4‬                                                          ‫.‬      ‫ن و وا‬              ‫دا‬             ‫ط 7 : ا ذوذات ا‬
                                     ‫.‬                ‫ن ا ذوذات ا‬         ‫ت‬                      ‫ط ا و ق ، ، ، ، ، ، ، . را ط‬
                                                                                            ‫.‬       ‫ص ل‬          ‫ھذه ا ت و‬     ‫1( رف‬
                                                                                   ‫5.‬           ‫1 و‬    ‫ن ھذه ا و ق أ م دول ا و‬  ‫2( ا ط‬
                                     ‫.‬                ‫ھذه ا را ط ا‬            ‫ا ذوذ ا‬                  ‫3( وا ط ر وم ط ط أ ط ا و ل ا‬




       ‫1‬            ‫2‬           ‫3‬                ‫4‬            ‫5‬                         ‫1‬              ‫2‬           ‫3‬            ‫4‬            ‫5‬



      ‫6‬             ‫7‬       ‫8‬                ‫9‬                ‫01‬                    ‫6‬                 ‫7‬        ‫8‬            ‫9‬                ‫01‬



     ‫11‬            ‫21‬       ‫31‬               ‫41‬            ‫51‬                      ‫11‬                ‫21‬        ‫31‬           ‫41‬               ‫51‬

     ‫61‬            ‫71‬       ‫81‬                                                     ‫61‬                ‫71‬        ‫81‬
                                                              ‫‪X‬‬                                                                              ‫‪X‬‬
      ‫91‬            ‫02‬      ‫12‬               ‫22‬                                     ‫91‬                ‫02‬       ‫12‬           ‫22‬




       ‫1‬                ‫2‬        ‫3‬                ‫4‬               ‫5‬
                                                                                        ‫1‬              ‫2‬           ‫3‬            ‫4‬            ‫5‬



      ‫6‬             ‫7‬       ‫8‬                ‫9‬                ‫01‬                                      ‫7‬
                                                                                    ‫6‬                          ‫8‬            ‫9‬                ‫01‬


     ‫11‬            ‫21‬       ‫31‬               ‫41‬               ‫51‬                                                            ‫41‬
                                                                                   ‫11‬                ‫21‬        ‫31‬                            ‫51‬

     ‫61‬            ‫71‬       ‫81‬                                        ‫‪Y‬‬            ‫61‬                ‫71‬        ‫81‬
                                                           ‫‪X‬‬
                                             ‫22‬                                                                                              ‫‪X‬‬
      ‫91‬            ‫02‬       ‫12‬                                                     ‫91‬                ‫02‬                    ‫22‬
                                                                                                               ‫12‬




       ‫1‬                ‫2‬        ‫3‬                ‫4‬               ‫5‬                             ‫1‬          ‫2‬            ‫3‬            ‫4‬            ‫5‬



      ‫6‬             ‫7‬       ‫8‬                ‫9‬                ‫01‬                         ‫6‬                ‫7‬         ‫8‬            ‫9‬               ‫01‬



     ‫11‬            ‫21‬       ‫31‬               ‫41‬               ‫51‬                        ‫11‬             ‫21‬          ‫31‬           ‫41‬               ‫51‬


     ‫61‬            ‫71‬       ‫81‬                                                          ‫61‬             ‫71‬           ‫81‬
                                                               ‫‪Y‬‬
                                                          ‫‪X‬‬                                                                                      ‫‪X‬‬
      ‫91‬                                     ‫22‬                                         ‫91‬                ‫02‬        ‫12‬          ‫22‬
                    ‫02‬       ‫12‬

                   ‫ذ: و فا د‬             ‫ا‬                                                                     ‫: - 711 -‬                 ‫ا‬
     ‫1‬              ‫2‬                ‫3‬           ‫4‬       ‫5‬                   ‫1‬                             ‫2‬           ‫3‬            ‫4‬                ‫5‬



    ‫6‬               ‫7‬            ‫8‬           ‫9‬       ‫01‬                      ‫6‬                         ‫7‬           ‫8‬            ‫9‬                ‫01‬



    ‫11‬             ‫21‬            ‫31‬          ‫41‬      ‫51‬                  ‫11‬                        ‫21‬              ‫31‬       ‫41‬                   ‫51‬

   ‫61‬              ‫71‬            ‫81‬                          ‫‪Y‬‬           ‫61‬                        ‫71‬              ‫81‬                                    ‫‪Y‬‬
                                                     ‫‪X‬‬                                                                                           ‫‪X‬‬
    ‫91‬              ‫02‬           ‫12‬          ‫22‬                          ‫91‬                            ‫02‬          ‫12‬       ‫22‬



                                                                                                                                            ‫1:‬               ‫او‬
‫ا و ــــــــــ 5‬
                                                                                                                        ‫د‬                                ‫ا‬
                   ‫ا ظ را ر‬                          ‫وذ‬          ‫دد ا‬        ‫وذ‬        ‫ا‬               ‫ا‬
                                                                                                                   ‫ت‬        ‫ا‬                            ‫ا‬
      ‫ا ، و ذو‬             ‫،‬
                                                                                  ‫أو‬
 ‫ة و د‬                           ‫ة،‬
                                                     ‫00001 / 81‬           ‫12‬  ‫ا‬                                                         ‫:‬                     ‫ا‬
       ‫، ھ ت دا‬              ‫ط و ة‬
                                                                        ‫أو ض ‪DOWN‬‬
          ‫ء... (‬      ‫)ا ، ا و ، ا‬
             ‫ي،‬          ‫ا‬      ‫با‬
                                                     ‫00001 / 1‬          ‫31‬                     ‫ا‬                                        ‫:‬                     ‫ا‬
             ‫.‬         ‫، ا ا‬
      ‫أو‬         ‫أ ي، ب ا‬                                                ‫أ اض ض‬
                                                     ‫00001 / 4‬                                                                          ‫:‬                     ‫ا‬
                   ‫رھ ، ، ...‬                                             ‫‪Turner‬‬
    ‫ن،‬         ‫ن‬          ‫ذ ي،‬                                           ‫أ اض ض‬
                                                         ‫0001 / 2‬                                                                       ‫:‬                     ‫ا‬
     ‫ن.‬     ‫ا ف، ن‬                ‫ب‬                                      ‫‪Klinefelter‬‬
‫ط ،‬                ‫أ ي دي،‬
                                                         ‫0001 / 1‬        ‫‪X‬‬                 ‫ا‬                                            ‫:‬                     ‫ا‬
   ‫د .‬             ‫د ،‬        ‫رات ذھ‬
  ‫د .‬             ‫،‬        ‫دي ا‬      ‫ر‬                   ‫0001 / 2‬       ‫‪XYY‬‬                        ‫ا‬                                    ‫:‬                     ‫ا‬
              ‫د، ھ ت‬
                                                     ‫00004 / 1‬                    ‫حا‬                                                    ‫:‬                     ‫ا‬
        ‫ة‬      ‫ىا‬


                                                                                                               ‫:‬            ‫• ا رط ا‬
     ‫ذج و‬          ‫ث‬         ‫ل‬         ‫12 و‬            ‫ءا‬          ‫ت د‬      ‫ھذه ا ر ط أن ل ا‬       ‫ظ‬
     ‫12‬                  ‫ا‬            ‫ا ذوذ‬          ‫ذك‬         ‫وا د ھذه ا ر ط ا‬        ‫ھ ك ز دة‬
                                                                                            ‫‪.Trisomie‬‬
                                                          ‫أو م ن رض ‪ Down‬أو ا و ‪.Mongolisme‬‬
  ‫وى‬       ‫، وھ ت دا‬                                     ‫) ر‬     ‫ون ذا ا رض ن ذوذ دي و‬           ‫ا‬
 ‫رة و ود ط و دة ر ،‬                                          ‫رة، د ن‬       ‫ء،‬   ‫ا بو ا و اد و و ا‬
                                                                                   ‫م زة (.‬      ‫و ذو‬

                   ‫ذ: و فا د‬             ‫ا‬                                                                     ‫: - 811 -‬                    ‫ا‬
                                                                     ‫2، و 5.‬               ‫رض ‪ :Down‬أ ظر ا و‬                         ‫را‬        ‫ا‬
‫ا و ــــــــــ 5‬
                                                                                                                                          ‫2:‬   ‫او‬
                                 ‫12‬           ‫ا زوج ا‬


                            ‫م‪I‬‬        ‫ا‬




                                          ‫م ‪II‬‬        ‫ا‬




     ‫م‪I‬‬       ‫لأ ءا‬              ‫دم ا‬                               ‫دي‬        ‫م ا زا‬   ‫ا‬                      ‫م ‪II‬‬       ‫لأ ءا‬       ‫دم ا‬
                                                          ‫ب‬    ‫إ‬                             ‫ب‬    ‫إ‬
                                                                     ‫ـ )1+‪( 2n‬‬
                                                                     ‫12‬        ‫ا‬



           ‫زا‬         ‫12 أ ء را ل ا‬
                       ‫ما‬               ‫ا زوج ا‬      ‫ل‬     ‫ر دوث ھذا ا ذوذ دم ا‬
                 ‫(‬ ‫12 إ‬       ‫ر دي )‬       ‫ج دى أ د ا و ن، إذ ؤدي ا ء‬      ‫د لا‬
                ‫ب رض.‬      ‫رد‬        ‫ت 12‬       ‫ث‬       ‫وي‬         ‫ون‬     ‫آ ر دي إ‬
                                                                                                        ‫:‬                ‫• ا رط ا‬
                ‫ل‬           ‫با‬            ‫،‬           ‫د و‬          ‫وھ ت‬       ‫ون ذا ا ذوذ ن‬   ‫ا‬                      ‫31،‬            ‫ا‬
                                                                                ‫.‬      ‫و ، دا ا‬                      ‫و‬           ‫ري،‬           ‫ا‬
                                                                                       ‫:‬          ‫تا‬   ‫دد ا‬          ‫ر‬      ‫ب –‬

                                                          ‫د:‬              ‫تا‬             ‫ن ر‬
                                                                                           ‫دد ا‬      ‫ن ن ا ذوذات ا‬
                                                                              ‫(‬         ‫• رض ‪ ) :Turner‬ا ر ط ا‬
   ‫ث ط، و ن‬                  ‫با‬               ‫. ادن‬                       ‫‪ X‬وا د و44‬           ‫ر ط ھذا ا رض و ود‬
                                               ‫ا و ، وا م.‬                  ‫تا‬     ‫ر ا ، و ف طور ا‬           ‫أھم أ را‬
                                                 ‫(‬        ‫• رض ‪ ) :Klinefelter‬ا ر ط ا‬
   ‫44‬              ‫،‬          ‫ون 74‬  ‫ن، ث‬      ‫‪ X‬زا د د ا ر ل ا‬       ‫ر ط ھذا ا رض و ود‬
          ‫ا و‬                ‫تا‬    ‫ا عا‬  ‫‪ .XXY‬و ن أھم أ را‬       ‫ت‬      ‫،و ث‬
                                                        ‫ن، وا م.‬      ‫را‬    ‫ا ذ ر وا و ،‬
                                                   ‫‪ ) :X‬ا ر ط ا‬      ‫ا‬    ‫• رض‬
                                                                          ‫(‬
                    ‫44‬    ‫،‬    ‫ون 74‬     ‫‪ X‬زا د د ا ء، ث‬        ‫ر ط ھذا ا رض و ود‬
                   ‫ب ظ ر أ وي دي،‬    ‫‪ .XXX‬دة ز ا ص ا‬            ‫ت‬       ‫،و ث‬
                                      ‫دودة.‬  ‫و‬   ‫د ،‬     ‫و ط إ‬      ‫طو ، درات ذھ‬
                                                                     ‫(‬                 ‫‪ ) :XYY‬ا ر ط ا‬                ‫ا‬       ‫• رض‬

                       ‫ذ: و فا د‬                  ‫ا‬                                                      ‫: - 911 -‬               ‫ا‬
   ‫44‬      ‫،‬                ‫ون 74‬                     ‫ن، ث‬     ‫‪ Y‬زا د د ا ر ل ا‬        ‫ر ط ھذا ا رض و ود‬
   ‫دي، و درات‬              ‫ب ظر‬                       ‫‪ .XYY‬دة ز ا ص ا‬            ‫ت‬       ‫،و ث‬
                                ‫م.‬                  ‫ا‬    ‫و‬   ‫ظ دا ط ل‬           ‫د . وأ‬     ‫د ،و و‬      ‫ذھ‬
                   ‫1، و 6.‬             ‫: أ ظر ا و‬                       ‫تا‬         ‫ر دد ا‬          ‫ذوذات ا ر ط‬                          ‫را‬            ‫ا‬
‫ا و ــــــــــ 6‬                       ‫ا ب‬                                   ‫ل1‬    ‫ا‬                                ‫ا م‬                 ‫1:‬       ‫او‬
                               ‫‪X‬‬   ‫‪Y‬‬                                                                       ‫‪X‬‬    ‫‪X‬‬


                                       ‫دي‬               ‫م ا زا‬      ‫ا‬                                               ‫دي‬     ‫ر‬        ‫م ا زا‬        ‫ا‬


                       ‫‪X‬‬                        ‫‪Y‬‬
                                                                                                                        ‫‪X X‬‬




 ‫ج‬        ‫ا‬                                                                                                                              ‫ج‬        ‫ا‬
          ‫ا‬                                                                                                                                       ‫ا‬
               ‫‪X‬‬           ‫‪X‬‬           ‫‪Y‬‬                  ‫‪Y‬‬                                                      ‫‪XX‬‬            ‫‪XX‬‬




                       ‫‪X‬‬      ‫ا‬                                    ‫‪X‬‬      ‫أ دي ا‬                     ‫‪Y‬‬      ‫أ دي ا‬                        ‫ا‬
                   ‫)‪(2n = 44 + XXX‬‬                               ‫)‪(2n = 44 + X‬‬                     ‫)‪(2n = 44 + Y‬‬                ‫)‪(2n = 44 + XXY‬‬

                                       ‫ا ب‬                                   ‫ل2‬    ‫ا‬                                ‫ا م‬
                               ‫‪X‬‬   ‫‪Y‬‬                                                                       ‫‪X‬‬    ‫‪X‬‬


                                       ‫دي‬           ‫ر‬         ‫م ا زا‬     ‫ا‬                                          ‫دي‬         ‫م ا زا‬        ‫ا‬



                     ‫‪X Y‬‬                                                                           ‫‪X‬‬                       ‫‪X‬‬




 ‫ج‬        ‫ا‬                                                                                                                              ‫ج‬        ‫ا‬
          ‫ا‬                                                                                                                                       ‫ا‬
               ‫‪XY‬‬          ‫‪XY‬‬                                                                  ‫‪X‬‬       ‫‪X‬‬            ‫‪X‬‬           ‫‪X‬‬



                       ‫ا‬                                                                                 ‫‪X‬‬      ‫أ دي ا‬
               ‫)‪(2n = 44 + XXY‬‬                                                                         ‫)‪(2n = 44 + X‬‬

               ‫م‬           ‫أ ءا‬                 ‫تا‬                  ‫م زواج ا‬           ‫ر ظ ور ھذه ا ذوذات إ ا راق ر ا‬
                                                                                       ‫ج دى أ د ا و ن.‬ ‫د لا‬        ‫ا زا‬
                                                                                  ‫ت.‬       ‫ا‬           ‫ر‬        ‫2 ا ذوذ ا ر ط‬
          ‫(‬             ‫‪ ) : La délétion chromosomique‬ا ر ط ا‬         ‫ع ط‬   ‫أ –‬
      ‫ر‬        ‫ع ا ذراع ا‬    ‫ت ھو‬     ‫ت، وأھم ھذه ا‬   ‫ھذه ا ذوذات ن دان زء ن أ د ا‬
                             ‫د، و ن وھ ت‬            ‫ون ذا ا ذوذ ن ر‬     ‫ا‬   ‫5.‬

                     ‫ذ: و فا د‬              ‫ا‬                                                                  ‫: - 021 -‬            ‫ا‬
          ‫ھذا ا رض ـ‬               ‫واء ا ط ، ذا‬             ‫و‬    ‫ب‬       ‫در ا ط ل ا‬      ‫ث‬        ‫رة،‬    ‫وى ا‬
                                                                                                    ‫" ح ا ط ".‬
                         ‫(‬          ‫‪ ) : La translocation‬ا ر ط ا‬    ‫لا‬   ‫ب – ا‬
              ‫ھذه ا‬       ‫ت أ رى.‬             ‫و‬     ‫ت أو ط‬      ‫ل ھذه ا ذوذات ا ل‬
         ‫و‬         ‫12، أ ا وذج ا‬        ‫ا وازن، إذ د وذج وا د ن ا‬      ‫لا‬     ‫م نا‬
           ‫ون ذا ا ذوذ ظ ر دي ن ر ط م‬                ‫صا‬      ‫41. ز ا‬       ‫ا‬    ‫ول‬
           ‫ون أ‬       ‫ص د‬      ‫)12-41(. إ أن ھؤ ء ا‬    ‫ھ‬      ‫ن‬      ‫،ر مأ‬         ‫ا‬
           ‫(.‬       ‫12 ا‬     ‫ا‬      ‫و )‬        ‫ن ذوذات‬      ‫ب إ بأ ء‬         ‫ر د ،‬

                                                             ‫ل ا و دة:‬            ‫ص ا ذوذ ا‬                     ‫‪–V‬‬
                                                                 ‫ص ل ا و دي:‬              ‫إ راء ا‬         ‫دوا‬
                                           ‫.‬      ‫أو ذوذ‬   ‫ب وه‬     ‫- إذا ق و ن إ ب ط ل‬
                                        ‫وازن.‬        ‫، لا ل‬     ‫ذوذ‬      ‫- إذا ن أ د ا و ن‬
                      ‫.‬                 ‫ب ف‬         ‫و ود ا ل ر‬    ‫- إذا وز ر ا م ا ل 04‬
                                                       ‫دى.‬   ‫دا ص‬     ‫- ظ ور ؤ رات ر د‬

                                                                ‫ص:‬       ‫ھذا ا‬    ‫دة‬         ‫لا‬     ‫2 أھم ا و‬
                                                            ‫دى ‪: L'échographie‬‬            ‫ور‬       ‫أ – ا‬
         ‫، م م‬   ‫ا نو س‬            ‫ا د، ط و ت وق و‬                                           ‫ر و‬   ‫وا ط‬
       ‫ف‬    ‫سا و ت ل‬      ‫،‬      ‫ت ل‬    ‫ف‬    ‫ر. و ظرا‬                                    ‫ا ط وا ط س ا‬
          ‫ت ا د . ) أ ظر ا و 2، و 6 (.‬     ‫و ر‬       ‫ن‬                                    ‫ن،‬   ‫ورا‬  ‫ط‬
                                                                     ‫دى ‪.Echographie‬‬                 ‫ور‬         ‫ا‬
‫ا و ــــــــــ 6‬
   ‫ل‬       ‫ت زة د ا‬         ‫دى ا و : ا ل1:‬            ‫رض ‪ Down‬د ا ل وا ط ا و ر‬         ‫ف نا‬                ‫2:ا‬      ‫او‬
       ‫ل ا دي ) ا ل2 (.‬      ‫ظ دة د ا‬    ‫ت‬             ‫ط ، ق ر ض... (. ھذه ا‬ ‫ب رض ‪ ) Down‬و‬                 ‫ا‬

                                            ‫ل2‬    ‫ا‬                                                   ‫ل1‬        ‫ا‬




                                                             ‫ص ل ا و دي :‬             ‫تا د‬        ‫ب – ا‬
                                                             ‫‪Embryoscopie‬‬                ‫ار دا‬              ‫1.‬
       ‫ن ن‬         ‫ء ا ذي‬   ‫ن، ا‬             ‫ن أ ذ ور وا‬         ‫د ل ر ق ا ر م،‬                   ‫وا ط ظ م د‬
                                    ‫.‬       ‫ض ا ذوذات ا‬           ‫وھ ت ا و ا را‬                   ‫صا ر‬       ‫ا‬
                    ‫ذ: و فا د‬       ‫ا‬                                                 ‫: - 121 -‬       ‫ا‬
                                             ‫1، ‪ ،A‬و 7 (‬   ‫‪ ) Amniocentèse‬أ ظر ا و‬              ‫2.‬

             ‫ل ا وي ا ذي ط و دا‬            ‫ھو ا ر رى ا وع 71 ن ا ل، ث ذ ل ن ا‬
      ‫ف‬      ‫ن نا‬        ‫نا‬                   ‫ذا ا ل ز ا ر ط ا‬   ‫ا‬   ‫نا‬   ‫ا ل، وا ط‬
                                                               ‫.‬   ‫ا‬    ‫ن ا ذوذات ا‬

                                            ‫1، ‪ ،B‬و 7 (‬    ‫‪ ) Choriocentèse‬أ ظر ا و‬             ‫3.‬

      ‫ل(‬           ‫ن دد ا ء ا ر‬     ‫)أ ذ‬    ‫ا‬    ‫ت نا‬   ‫ط ما طع‬   ‫وا ط‬
      ‫در ن‬           ‫. ) ھذه ا‬  ‫د ن وھ ن أي ذوذ‬       ‫و‬     ‫دإ ز رط‬
                                       ‫ل (.‬     ‫ك س از ا‬        ‫و‬      ‫ا‬
‫ا و ــــــــــ 7‬
 ‫(.‬        ‫تا‬      ‫ل ا وي وا ز‬       ‫صا‬     ‫‪) .Choriocentèse‬‬   ‫‪ Amniocentèse‬و‬         ‫1:‬        ‫او‬
                                                     ‫دا نأ ءا لإ :‬          ‫ن ا ف ن ا ذوذات ا‬
                                            ‫ر ا ل ا وي د 51 إ 71 أ وع ن و ف ا دورة ا‬      ‫•‬
                                          ‫.‬      ‫ر دم ا ل ا ري د ا وع 02 ن و ف ا دورة ا‬   ‫•‬
                                                   ‫ل.‬         ‫ن ا وع ا‬  ‫،اط‬     ‫و‬      ‫ا عز ت‬

                                                                                           ‫1:‬        ‫او‬

                                          ‫‪Amniocentèse‬‬




      ‫‪Choriocentèse‬‬




                   ‫ذ: و فا د‬     ‫ا‬                                       ‫: - 221 -‬     ‫ا‬
                     ‫2، و 7 (‬                    ‫ل ا دم: ) أ ظر ا و‬     ‫ف ن رض ‪Down‬‬                       ‫4. ا‬
                                                      ‫ل ا دم.‬        ‫ف ن رض ‪Down‬‬            ‫2: ا‬          ‫او‬

‫12 (، و ود ر ز ر ن ھر ون ‪hCG‬‬   ‫ا‬    ‫رض ‪) Down‬‬            ‫ت ا وا ل‬  ‫ل ا دم د ا‬ ‫ت‬
  ‫)‪ ،( human Chorionic Gonadotropin‬و رو ن ‪ = (alpha-fœtoprotéine) AFP‬رو ن ر ا ل.‬

                              ‫ا و ــــــــــ 7‬                          ‫2:‬     ‫او‬
                                                                                    ‫ل‬     ‫ھذه ا واد ا و ودة‬
                                                                                               ‫تا‬            ‫وا‬
                                                                                       ‫‪.Marqueurs sériques‬‬
                                                                                      ‫ا ر زا ز‬       ‫أ‬    ‫ن او‬
                                                                  ‫ل ر ز ‪hCG‬‬
                                                                                    ‫ب دة ا ل‬       ‫ر ون ‪hCG‬‬
                                                                ‫ا ل ا دي‬
                                                                                    ‫ن‬   ‫ا‬     ‫أ ب‬        ‫د 68‬
                                                                                                  ‫رض ‪.Down‬‬

                                                                                    ‫ل دم‬           ‫ن‬    ‫ن ف‬
                                                                                                ‫ا رأة ا ل ن د م‬
                                                                                                    ‫دى.‬  ‫ا ص‬




          ‫ص‬           ‫ھر ون ‪ hCG‬و رو ن ‪ AFP‬دم ا رأة ا ل ن‬      ‫رة‬                                              ‫ن‬
 ‫ب رض ‪. Down‬‬           ‫ن‬  ‫12، وذ ك ر ع ر ز ھذه ا واد دم ا رأة ا ل‬                                                    ‫ا‬

             ‫زاد ن ا م.‬                ‫ن رض ‪ Down‬زداد‬                        ‫ب أط ل‬        ‫لإ‬      ‫وظ : إن ا‬

  ‫54‬      ‫24‬         ‫73‬              ‫53‬             ‫03‬          ‫52‬      ‫02‬                  ‫نا م‬

 ‫06/1‬    ‫001/1‬   ‫003/1‬             ‫005/1‬         ‫0032/1 0061/1 0001/1‬               ‫ب‬      ‫لإ بطل‬                ‫ا‬




         ‫ذ: و فا د‬        ‫ا‬                                                         ‫: - 321 -‬         ‫ا‬
                                                                          ‫ا و دة ا را‬
                     ‫اﻟﺘﻐﻴﺮ وﻋﻠﻢ وراﺛﺔ اﻟﺴﺎﻛﻨﺔ‬
                                                                           ‫ـــــ م :‬       ‫ـــ ـــ‬
          ‫ن و در ن‬               ‫را‬     ‫ل‬      ‫ون‬   ‫ن ا راد ن س ا وع‬     ‫و‬                 ‫ھ‬        ‫ا‬
                                         ‫ر:‬    ‫ر دة‬         ‫وم ا‬  ‫م. و ن م‬                     ‫ا زاوج‬

                         ‫.‬                 ‫رة ز‬      ‫ن‬    ‫را : أ راد وطن ل را‬                   ‫•‬
                                       ‫س ا وع.‬     ‫إ‬    ‫ر ، أ راد‬    ‫ورا : ذ رة ورا‬             ‫•‬
‫م.‬        ‫او ط و‬     ‫ر‬                ‫ل‬       ‫س ا ل ا را ، و‬       ‫ون‬     ‫: أ راد‬               ‫•‬
                                                        ‫ا زاوج ن ا راد.‬      ‫وو :إ‬              ‫•‬

 ‫و‬   ‫ط ا ورا‬    ‫م درا وا ن وز ا ور ت و ا‬                   ‫ھ زء ن م ا ورا ،‬     ‫ورا ا‬
                ‫:‬    ‫أھداف ر‬     ‫،و‬                         ‫ر ا ورا دا ل‬ ‫ذا ا ت ا ددة‬

                                       ‫ت س ا ور .‬     ‫ن ردد‬      ‫س ا ر ا ورا ا ط‬                ‫•‬
                                                 ‫ن ل ر.‬       ‫ا ل ا ر ا ورا‬     ‫م‬               ‫•‬
                                              ‫ل.‬   ‫با‬     ‫م آ ت طور ھذا ا ر ا ورا‬               ‫•‬

           ‫ن طر ق ا ر ن ورا ا‬                    ‫ا زاو ت ا و‬         ‫د‬      ‫إذا ت ا ورا ا د‬
‫دة آ ء.‬      ‫درون ن زاو ت ر و‬                    ‫ن ا راد‬    ‫و‬       ‫د‬    ‫درس ب ا ط ا ورا‬
                                                    ‫.‬    ‫وى ا‬             ‫ط ق ورا ا د‬


                                        ‫؟‬          ‫دا ل‬   ‫ر ا ورا‬    ‫ا‬ ‫ف م درا‬               ‫7(‬
                                                         ‫؟‬      ‫ھ وا ل ر ا‬                   ‫8(‬
                                                      ‫ل؟‬   ‫ف ل ھذا ا ر ر ا‬                   ‫9(‬
     ‫؟‬      ‫دا‬  ‫ت ا ورا‬ ‫لا‬                    ‫دة درا ا‬        ‫ا‬       ‫ا وا ن ا‬              ‫01(‬
           ‫ت؟ و آ ت د ؟‬                         ‫ا وع ا ورا‬       ‫ھ ا وا ل ا د‬               ‫11(‬




           ‫ذ: و فا د‬         ‫ا‬                                           ‫: - 421 -‬     ‫ا‬
                                               ‫ل ا ول:‬           ‫ا‬
                                  ‫:اﻟﻘﻴﺎس‬
                          ‫اﻟﺪراﺳﺔ اﻟﻜﻤﻴﺔ ﻟﻠﺘﻐﻴﺮ:اﻟﻘﻴﺎس اﻹﺣﻴﺎﺋﻲ‬
                                                                                                                 ‫د :‬
    ‫، ور د ض‬    ‫س ھذه ا‬      ‫د د دى‬   ‫إ‬     ‫دا‬                                  ‫ا‬   ‫ت ا ورا‬         ‫دف س ا‬
      ‫ن‬    ‫نأ ل‬        ‫ل ر ا وا ت و ا ل ا‬                                                       ‫ت ا ر وب‬    ‫ا‬
     ‫ت رف م ا س‬         ‫م ا ذي م ذه ا‬   ‫(، وھ ذا‬                               ‫ط‬     ‫ءا‬        ‫ردود ا ج ) ا‬
                                                                                                       ‫.‬    ‫ا‬

                       ‫‪:La biométrie‬‬             ‫سا‬      ‫ما‬                ‫دة‬        ‫ا‬               ‫‪ – Ι‬ا طرق ا‬
           ‫،و ت‬  ‫إ‬    ‫ودرا‬       ‫ن‬       ‫ا‬   ‫تا‬     ‫نا‬   ‫و‬         ‫تا‬      ‫زا‬
         ‫ل ل،‬     ‫ا وزن، ا طول، دد ا ذور ا رة، دد ا وا د‬     ‫رات. ذ ر ن‬
                             ‫ا و رول ا دم، ...‬       ‫ن طرف ا ر،‬          ‫ا با‬
     ‫ر ا دروس)ا وزن، ا د، ا ، إ ج ا ب،‬        ‫ا ر ط‬        ‫ا ط تا‬           ‫•‬
                                                             ‫دد ا ذور...(.‬
    ‫ض‬    ‫ت.)‬    ‫نا‬             ‫ل‬        ‫دي أو ز‬      ‫• ر ب ھذه ا ط ت ل‬
                              ‫ل أ م ...(.‬           ‫ر با‬     ‫ر‬       ‫ت‬     ‫ا‬
                           ‫ل راء .‬      ‫ت نأ ل‬        ‫إ‬  ‫• ول ا ط ت ار‬
       ‫ت‬    ‫أو ن‬       ‫ل ا ط ت و رھ , ن أ ل إ راء ا ر ت دا ل س ا‬            ‫•‬
                                           ‫.‬   ‫ض ا ت ار‬      ‫إ‬      ‫ر ،‬

                                                                     ‫:‬     ‫تا‬            ‫ر ر ا وا ل‬                ‫1ا‬
                      ‫ط 1، و 1 (.‬        ‫ن ) أ ظر‬       ‫قا‬               ‫د ت‬               ‫أ– ط تإ‬
‫ا و ــــــــــ 1‬                                    ‫.‬        ‫ا‬       ‫ت ا ورا‬        ‫ر ا وا ل‬         ‫ر‬   ‫ط 1: ا‬
 ‫م‬   ‫،‬   ‫ا‬              ‫رة‬           ‫ق ا ن ‪) Anemone coronaria‬ا‬
                                      ‫ل 1( د‬                              ‫ون ت‬
‫)ا ل 2(.‬                 ‫ل أ رط‬    ‫طءا‬      ‫رات، و ظ ر ا وا ل‬    ‫وا ل إ‬         ‫ل‬
    ‫ر ر‬                 ‫درا ا‬ ‫ل وذ‬      ‫م ن ث دد ا وا ل‬        ‫ف أ راد ھذا ا وع‬
                                                                          ‫ا وا ل.‬
        ‫ر‬      ‫ن‬     ‫و‬  ‫م ‪ (1900) Pearson‬د‬        ‫دد ا رط ا‬        ‫إط ر درا إ‬
                       ‫ا دول أ :‬      ‫ا‬    ‫ل لا‬      ‫،‬     ‫ق ا ن د ا رط ا‬

  ‫8 9 01 11 21 31 41 51 61 71 81 91 02‬                                                    ‫7‬     ‫6‬        ‫ط‬         ‫دا‬
              ‫11 61 32 03 23 03 32 31‬
  ‫15 81 4 2‬                           ‫53‬                                                  ‫9‬     ‫1‬        ‫ت‬        ‫دا‬
               ‫0 2 6 8 0 4 5 2‬

                                                          ‫ط‬
                                                         ‫ر.‬     ‫ل ھذه ا ط ت، وا‬
                                                                     ‫ا‬           ‫1(‬
                               ‫ا رددات (‬     ‫ا رددات و‬ ‫ذا ا ر: )‬       ‫2( أ ز ا ل ا‬
                                      ‫ا رددات م ا رج ا ر ا ر رارا.‬       ‫ف طور‬   ‫3(‬
                   ‫ذ: و فا د‬      ‫ا‬                                                      ‫: - 521 -‬           ‫ا‬
‫ل1‬       ‫ا‬



                                               ‫ت )ا رددات(‬       ‫دد ا‬
                                                     ‫033‬

                                                     ‫003‬

                                                     ‫072‬

                                                     ‫042‬

                                                     ‫012‬

                                                     ‫081‬

                                                     ‫051‬

‫ل2‬       ‫ا‬                                           ‫021‬
                 ‫أ رط‬
                                                     ‫09‬

                                                     ‫06‬

                                                     ‫03‬                                                    ‫رط‬   ‫دد ا‬
                                                             ‫02 91 81 71 61 51 41 31 21 11 01 9 8 7 6‬
                                                                                                           ‫م(‬       ‫)ا‬


     ‫،‬                ‫ل ل‬    ‫،‬      ‫ب دد ا رط ا‬                  ‫ق ا ن 51 ظ را،‬        ‫م‬  ‫د ظت‬
                              ‫ل ا ر.‬      ‫دد ا رط‬                 ‫ا ردد. أ‬  ‫و ل ل م دد ن ا راد‬
 ‫ن‬           ‫و ط‬          ‫ن أن د أ‬     ‫دودا ن ا م )‬               ‫ذ ط ددا‬    ‫ظ أن ا ر ا دروس ھ‬
                         ‫وا ل. ‪Variation discontinu‬‬                ‫( ذا م ن ا ر ر ا‬      ‫ا رط ا‬

                                                                               ‫:‬   ‫ب–ا را‬
         ‫ت.‬       ‫ل‬                     ‫، وم‬     ‫ل راء و‬                 ‫أ رو و ،و‬   ‫ل ا ط ت ار‬
                             ‫:‬         ‫تا‬    ‫ھذا ا وع ن ا‬                        ‫ا‬  ‫تا‬     ‫ون ن ا‬

                                                           ‫وي ‪:Diagramme en bâtons‬‬                      ‫طط ا‬    ‫ا‬

‫ف‬  ‫ور ا را ب‬                        ‫ف م ا ر، و‬    ‫ل‬     ‫ور ا‬                               ‫د ظم‬     ‫ل‬
‫ب ا ردد ا ل .‬                    ‫ن م ا ر،‬       ‫ا ظم ل‬       ‫ط، ل‬                         ‫. وا ط‬  ‫ا رددات ا‬
   ‫ن، و 1 (.‬                     ‫ل وا ط ط ودي. ) أ ظر ا‬       ‫ور ا‬                           ‫و‬   ‫ل ل ط‬
                         ‫ا رددات ‪:Polygone et courbe de fréquences‬‬                          ‫ا رددات و‬

         ‫ض وا ط‬                   ‫طط‬      ‫دة ھذا ا‬        ‫ا‬   ‫د ا ز ا طط ا وي، ل ا ط ا‬
                                                        ‫ا رددات.‬        ‫ل ذك‬   ‫،‬        ‫ط‬
             ‫ر‬    ‫رددات ا‬     ‫ز وز‬       ‫ا رددات، وا ذي‬          ‫ل‬    ‫ا رددات،‬   ‫و دود‬
                                                                                    ‫ا دروس‬

                                                                             ‫:‬      ‫تا‬        ‫ر ا وا ل‬              ‫2ا‬
                        ‫ط 2، و 2 (.‬       ‫ل ‪ ) Gibbule‬أ ظر‬                 ‫د وا‬              ‫أ– ط تإ‬


                   ‫ذ: و فا د‬       ‫ا‬                                                      ‫: - 621 -‬        ‫ا‬
‫ا و ــــــــــ 2‬                                                           ‫.‬         ‫ا‬     ‫ت ا ورا‬                ‫ر ا وا ل‬        ‫ط 2: ا‬
                                        ‫وا‬   ‫س طر ا وا وا ط‬                         ‫ل " ‪ ،Gibbule‬م‬   ‫ن 005 رد ن وا "‬
                                     ‫ت ن ‪ ،0.5 mm‬وان ن‬     ‫إ‬                            ‫ا‬     ‫ف دذكا‬     ‫)‪،(pied à coulisse‬‬                          ‫د‬
                                      ‫د ت‬                                             ‫ھذه ا درا :‬     ‫. ط ا دول أ‬      ‫ل‬                             ‫ل‬
                                      ‫ا ر ل‬
                                         ‫د‬                                                       ‫ر.‬      ‫ا‬        ‫ط‬      ‫4( ل ھذه ا ط ت، وا‬
   ‫‪1cm‬‬                                ‫ل‬                                                                         ‫ر.‬  ‫ذا ا‬        ‫5( أ ز ا ل ا‬
                                                                                                ‫؟‬             ‫، ذا‬      ‫ل‬      ‫تا‬     ‫6( ل ا‬

  ‫161-‬         ‫651-‬         ‫151-‬          ‫641-‬          ‫141-‬        ‫631-‬            ‫131-‬        ‫621-‬              ‫121-‬      ‫611-‬         ‫ا ا‬
  ‫561‬          ‫061‬          ‫551‬           ‫051‬           ‫541‬         ‫041‬             ‫531‬         ‫031‬               ‫521‬       ‫021‬         ‫‪10-1mm‬‬
      ‫3‬            ‫3‬         ‫62‬               ‫16‬        ‫28‬          ‫701‬              ‫55‬         ‫92‬                 ‫8‬          ‫1‬         ‫ا ددات‬
                        ‫)ا رددات(‬    ‫دد ا وا‬
                            ‫011‬

                            ‫001‬

                             ‫09‬

                             ‫08‬

                             ‫07‬

                             ‫06‬

                             ‫05‬

                             ‫04‬

                             ‫03‬

                             ‫02‬

                             ‫01‬                                                                                              ‫طر ا وا‬
                                    ‫611‬       ‫8‬    ‫01‬    ‫21‬    ‫41‬    ‫61‬        ‫81‬     ‫02‬   ‫61‬       ‫81‬       ‫02‬
                                                                                                                            ‫م(‬    ‫)ا‬



     ‫ا م ا ر (،‬                      ‫لا ر)‬         ‫ا م‬   ‫أن ا ر ا دروس ذ‬  ‫ظ ھذه ا‬
     ‫ر‬     ‫،‬   ‫ل‬                    ‫تا‬     ‫وض ل ل ا‬       ‫وا ل. ھذه ا‬  ‫ذك ت ا ر و‬
        ‫ا وز ادن‬                     ‫ت ا ر دا ل س ا م. ل ا م ]611 – 021[.‬     ‫ا‬
        ‫و‬    ‫م.)ھ‬                   ‫لا‬        ‫سو ا ل‬          ‫ظ‬ ‫م، ث‬   ‫نا‬       ‫رة ن‬
                                                                            ‫ا ل ھو 5(‬
                                                                ‫ن، و 2 (.‬                  ‫: ) أ ظر ا‬                  ‫را‬     ‫ب–ا‬
                                                               ‫دراج ا رددات ‪:Histogramme de fréquences‬‬

          ‫ف‬            ‫ور ا را ب‬    ‫م، و‬   ‫ل دود ا‬    ‫ور ا‬                                                      ‫د ظم‬                  ‫ل‬
                        ‫ا ردد ا ل .‬      ‫و‬      ‫ط ل ون طو‬                                            ‫م‬       ‫. ل ل‬                  ‫ا رددات ا‬
                                                                     ‫ا رددات ‪:Polygone de fréquences‬‬

               ‫م‬    ‫فا‬                 ‫م او ط‬                       ‫ن دراج ا رددات و ل ا ط ا‬     ‫اط‬                                       ‫ل‬
  ‫ل‬           ‫ا رددات‬               ‫.و و دود‬                           ‫ض وا ط ط‬           ‫ط ت‬                                           ‫دة ا‬     ‫ا‬
                                                                                            ‫ا رددات.‬

                       ‫ذ: و فا د‬          ‫ا‬                                                                       ‫: - 721 -‬         ‫ا‬
                                                                                                                              ‫ر:‬             ‫ا‬      ‫درا‬     ‫ا رددات‬      ‫3 وا ت وز‬
      ‫ر‬        ‫تا‬      ‫راء ا ر ت وا‬                                                                                ‫ر ف‬                      ‫وز ا رددات‬                ‫ا لا‬
       ‫ر تا ز .‬   ‫وا م‬      ‫دى ر ا‬                                                                                 ‫ر‬                         ‫تر‬      ‫دة إ‬              ‫ا دروس. ذا‬
                                                                                                                                                          ‫تا و :‬           ‫أ–‬
  ‫رى، وھ :‬                  ‫ا ما‬                  ‫وزع و‬                              ‫را‬                        ‫ا ما و ط‬                                 ‫ن و‬  ‫وط‬                     ‫ن‬
                                                                                                                                                          ‫ا وال )‪: Mode (Mo‬‬
‫ر ا وا ل‬                    ‫ا‬                      ‫ر رددا، و‬                           ‫را‬                ‫ا‬               ‫ر ا وا ل ن‬                         ‫ا ر‬        ‫ر ا وال‬
                                                                                                                             ‫ر رددا.‬                         ‫و طا ما‬      ‫ر ن‬
                                                                                                                                                             ‫_‬
                                      ‫‪:Moyenne arithmétique‬‬                                                                                               ‫)‪(X‬‬        ‫ا دل ا‬
                              ‫دد ا راد.‬        ‫ردده‬       ‫روب‬                                                                                                ‫ر‬   ‫ل‬      ‫وع‬     ‫ھو‬
                                                       ‫_‬
             ‫وع دد أ راد ا‬  ‫‪= n‬‬               ‫‪ = X‬ا دل ا‬
                                                                     ‫‪i‬‬
                       ‫‪ = fi‬ردد ا ر أو ردد م أو ا ر‬           ‫_‬    ‫)‪∑1 (fixi‬‬
                                                                  ‫__________‬
                                                              ‫= ‪X‬‬
                 ‫ا ر ر ا وا ل أو‬          ‫ا ر‬        ‫‪= xi‬‬              ‫‪n‬‬
                 ‫ا ر ا وا ل.‬            ‫و ط ا م أو ا‬

                                                                                                                                                   ‫ن:‬     ‫قا‬     ‫ل د ت‬
                                                                                                                                                                ‫ا وال: 31 = ‪.Mo‬‬
‫_‬          ‫)2 ‪(6 x 1) + (7 x 9) + (8 x 35) + … + (20 x‬‬                                                                                                            ‫_‬
        ‫ــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬
‫=‪X‬‬                                                                                                                                                 ‫77.21 =‬      ‫‪: X‬‬      ‫ا دل ا‬
                                                                   ‫7291‬

 ‫)ا رددات(‬                                                                                 ‫1‬           ‫او‬           ‫ا و ــــــــــ 2‬
‫033‬
                                                                                                                                                                         ‫ظ :‬
‫003‬

‫072‬
                                                                            ‫1‬         ‫ا‬     ‫وز‬                            ‫ر‬     ‫ا و ط‬           ‫ر ا دل ا‬
‫042‬
                                                                                                                         ‫ر ف د د زات‬              ‫) ا دل (،‬
‫012‬
                                                                                                                          ‫ن أن ر‬    ‫ا درو ، ث ن‬           ‫ا‬
‫081‬
                                                                                                                            ‫ر م ا ف وز‬       ‫س ا دل ا‬
‫051‬
                                                                                                                                      ‫ت ول ھذا ا دل.‬      ‫ا‬
‫021‬
                                                                            ‫2‬         ‫ا‬     ‫وز‬
‫09‬
                                                                                                                                                           ‫1، و 2 (.‬           ‫) أ ظر ا و‬
‫06‬

‫03‬


       ‫7 6‬     ‫21 11 01 9 8‬
                                             ‫_‬        ‫02 91 81 71 61 51‬
                                             ‫‪X‬‬                                     ‫م(‬             ‫)ا‬
                                               ‫دل ا‬      ‫ا‬



                      ‫ذ: و فا د‬                              ‫ا‬                                                                                               ‫: - 821 -‬         ‫ا‬
                                                           ‫ت ا ت ) ا دد ( :‬ ‫ب–‬
                                     ‫ن ن د ر ا ر و ت وز ا رددات ول ا م ا و ط وھ :‬
                                         ‫) ‪:Ecart moyen arithmétique ( E‬‬                         ‫ا رق ا و ط ا‬
          ‫د‬       ‫لا‬              ‫،و م‬          ‫و‬           ‫، و ذ دا‬    ‫ر وا دل ا‬            ‫ل‬        ‫ھو دل ا رق ن‬
                                                                                                               ‫ا :‬
                                                             ‫_‬
               ‫دل ا‬       ‫ا‬   ‫- ‪ =| xi‬رق ا ر‬                 ‫|‪X‬‬                   ‫‪i‬‬      ‫_‬
     ‫رد‬       ‫رق‬           ‫ا ط‬     ‫لا‬
                                                                       ‫=‪E‬‬
                                                                              ‫∑‬   ‫‪| xi - X | x fi‬‬
                                                                              ‫_______________‬
                                                                                ‫1‬
                            ‫ت ا م.‬    ‫ن‬
                                                                                             ‫‪n‬‬
      ‫ر‬       ‫ا‬        ‫‪ = fi‬ردد ا ر أو ردد م أو‬
                               ‫وع دد أ راد ا‬              ‫‪=n‬‬                          ‫= ا رق ا و ط ا‬          ‫‪E‬‬

                                                                               ‫رة ) ‪:Variance ( V‬‬                 ‫ا‬
‫دل‬            ‫دل ا وارق. و‬      ‫ا وارق دل‬            ‫دل ر‬    ‫ب‬     ‫م‬        ‫ن ا وء ر . و‬      ‫ل ا وارق و‬
                                                                                    ‫ر ا وارق ا رة ) ‪.( V‬‬

                                ‫= ا رق ا و ط ا‬              ‫‪V‬‬                     ‫‪i‬‬      ‫2 _‬
      ‫ر‬       ‫ا‬        ‫م أو‬   ‫ر أو ردد‬              ‫‪ = fi‬ردد ا‬         ‫=‪V‬‬
                                                                              ‫∑‬   ‫‪( xi - X ) x fi‬‬
                                                                              ‫_______________‬
                                                                                ‫1‬

                                                                                             ‫‪n‬‬
                              ‫وع دد أ راد ا‬               ‫‪=n‬‬

                                                            ‫( ‪:Ecart type‬‬   ‫ري ) ‪σ‬‬            ‫ا راف ا ط ا‬
                                                                                           ‫رة.‬       ‫ھو ا در ا ر‬

                                ‫= ا رق ا و ط ا‬              ‫‪σ‬‬                              ‫2 _‬

                                                                            ‫√‬
                                                                                       ‫‪i‬‬

                                                                                ‫∑‬   ‫‪( xi - X ) x fi‬‬
     ‫ر‬        ‫ا‬        ‫م أو‬   ‫ر أو ردد‬           ‫‪ = fi‬ردد ا‬            ‫=‪σ‬‬       ‫_______________‬
                                                                                  ‫1‬

                                                                                                  ‫‪n‬‬
                              ‫وع دد أ راد ا‬               ‫‪=n‬‬

 ‫:‬        ‫تا‬           ‫ذ اد‬   ‫ا ذي‬         ‫لا‬         ‫ب‬  ‫ل ا راف ا ط ا ري وا دل ا‬
                                                              ‫_‬      ‫_‬
                                         ‫ا ل ] ‪ [ X - σ , X + σ‬د % 86 ن أ راد ا‬
                                                         ‫_‬         ‫_‬
                                ‫ا ل ] ‪ [ X - 2 σ , X + 2 σ‬د % 4.59 ن أ راد ا‬
                                                ‫ا رددات ؟‬        ‫ت وز‬                        ‫ھ اد تا‬                  ‫‪– IΙ‬‬
‫ا رددات‬                   ‫،وذك ن دل‬                       ‫وا د ر‬      ‫أ‬        ‫رإ‬       ‫ظ وز ا رددات‬    ‫إن‬
      ‫2،‬               ‫‪) .Gauss‬أ ظر ا و‬                   ‫ا ون ا ظ أو‬                 ‫ل ور‬      ‫ل رس‬
                                                                                                    ‫و 2.(‬

                  ‫ذ: و فا د‬          ‫ا‬                                                      ‫: - 921 -‬     ‫ا‬
            ‫ا و ــــــــــ 2‬           ‫ا رددات‬                                                     ‫2‬         ‫او‬
                                                                                            ‫دراج ا رددات‬

                                                                                           ‫‪Gauss‬‬



                                                                                                        ‫م‬     ‫ا‬

                                                      ‫‪ ) Mo‬ا وال (‬
                                       ‫ا رددات‬

                                                                                           ‫‪Gauss‬‬
                                                                 ‫‪σ‬‬       ‫‪σ‬‬

                                                          ‫‪2σ‬‬             ‫‪2σ‬‬                             ‫م‬     ‫ا‬
                                   ‫_‬            ‫_‬         ‫_‬          ‫_‬       ‫_‬        ‫_‬        ‫_‬
                                   ‫3-‪X‬‬   ‫‪σ‬‬      ‫2-‪X‬‬   ‫‪σ‬‬     ‫-‪X‬‬   ‫‪σ‬‬   ‫‪X‬‬       ‫+‪X‬‬   ‫‪σ‬‬   ‫2+‪X‬‬  ‫‪σ‬‬   ‫3+‪X‬‬      ‫_‪σ‬‬
                                           ‫ري‬       ‫راف ا‬        ‫‪=σ‬ا‬                        ‫دل ا‬    ‫‪= X‬ا‬

            ‫دل ا‬   ‫ر طن‬                                 ‫،‬    ‫ران ن دد ا ر‬                                   ‫رة وا راف ا ط‬    ‫ا‬
                ‫دي أي ط ق‬                    ‫ر‬        ‫إذا ن وز ھذا ا‬   ‫ر‬                                        ‫و ران ن ا وز ا‬
                                                                                                                         ‫‪.Gauss‬‬
 ‫ب أن ط‬            ‫ث‬        ‫ا ر دد م ا ر ا دروس‬
                               ‫ر‬                      ‫ر‬    ‫ن ا راف ا ط‬
                            ‫.‬    ‫ظ ول ا دل ا‬      ‫راف ا ط %86 ن م ا ر ا‬                                                         ‫ا‬
      ‫أز‬              ‫ر دد ا ر د س ا‬           ‫تأ‬    ‫راف ا ط‬    ‫ھذا ا س‬
                                           ‫ر .‬       ‫ت‬    ‫، أو ر ا دد د‬
‫ھذه‬        ‫‪,Gauss‬‬                ‫ون وز ا ر دي أي و ق‬                                       ‫د‬       ‫رة‬         ‫ا راف ا ط‬
  ‫ل‬        ‫رة ا‬                ‫ا ل ] ‪ [X+б ,X -1б‬و %59‬                                    ‫رة‬                ‫ظت‬     ‫%86 ن ا‬      ‫ا‬
                                                                                                               ‫] ‪. [X +2б , X -2б‬‬




               ‫ذ: و فا د‬               ‫ا‬                                                                      ‫: - 031 -‬   ‫ا‬
                                                                     ‫ر‬      ‫ب‬      ‫ت‬       ‫ضا‬
                                                                          ‫ث أن ا‬         ‫راف ا ط‬      ‫ا‬
                                                                     ‫رورة دد ر،‬                ‫ا رى‬
                                                                     ‫دد‬    ‫د ر ط ذك‬              ‫نا‬
                                                                     ‫ر ا دروس.‬              ‫ظت‬        ‫ا‬
                                                                        ‫دى دد وز‬          ‫ذا و رف‬
                                                                     ‫لا ر‬           ‫دة إ‬       ‫ر‬      ‫ا‬
                                                                            ‫دل ا‬     ‫ا ر طھوا ر‬
                                                                               ‫أ :‬               ‫وا ذي‬




                                                        ‫ء:‬       ‫ا‬             ‫سا‬          ‫ا‬   ‫‪ – IIΙ‬أھ‬
                   ‫و :‬          ‫دا‬     ‫ا ذور‬        ‫وز‬               ‫ا رددات‬               ‫ظ را نا‬

   ‫11‬    ‫01‬    ‫9‬    ‫8‬           ‫7‬        ‫6‬     ‫5‬          ‫4‬      ‫3‬       ‫2‬        ‫دد ا ذور دا ل ا‬
    ‫2‬    ‫5‬     ‫9‬    ‫22‬          ‫53‬      ‫62‬     ‫02‬        ‫01‬      ‫8‬       ‫3‬     ‫ت ‪Gousse‬‬       ‫دد ا‬




   ‫ا وزن. ل‬                    ‫ا درو‬     ‫سا‬         ‫و‬         ‫أ دي ا وال‬       ‫ل‬     ‫ا‬         ‫ظ أن ا‬
                                                                                      ‫؟‬                 ‫ھذه ا‬
‫م ا ول ] 02-52[( ن ا ذور‬                ‫)ا‬     ‫: وم زل ا دور ا‬     ‫ءا ط‬                ‫د ن ذ ك وم‬
                                                             ‫ر ] 58-09[ (.‬          ‫ما‬         ‫)ا‬           ‫ا‬


           ‫ذ: و فا د‬       ‫ا‬                                                   ‫: - 131 -‬       ‫ا‬
       ‫)‬     ‫ب ا ذا‬       ‫دذك‬                              ‫ل‬         ‫تا‬   ‫و ط ن ز ن, ا‬                  ‫ف‬   ‫و وم زرع ل‬
           ‫ل‬      ‫ا ذور ا‬                ‫ا‬            ‫ا‬        ‫ت(. د ا ر ز س ا درا‬                    ‫ا زھور وب ح س ا‬
                                                                        ‫:‬     ‫ت ا رددات ا‬                 ‫ل‬    ‫ن,‬   ‫دا‬

                                                                        ‫ھ‬     ‫ردد‬        ‫ن‬                ‫ظأ‬
                                                                                                           ‫ل‬
                                                                      ‫وال ل‬             ‫ف وا‬          ‫أ دي ا وال‬
                                                                                                           ‫ا‬
                                                                      ‫) 1‪ ( P‬و و ا ذور‬             ‫و : ا ذور ا‬
                                                                                                ‫) 2‪ .(P‬ھذه ا‬         ‫ا‬
                                                                                     ‫‪ P‬ر‬            ‫أن ا‬      ‫ر‬
                                                                      ‫ء دا ل‬    ‫ظ أن ا‬       ‫ا درو ، ث‬
                                                                      ‫ن‬       ‫ن‬         ‫ن زل‬                   ‫ھ ذه ا‬
                                                                                      ‫.‬       ‫ھن ل‬        ‫1‪ P‬و 2‪P‬‬
                                                                      ‫ا ط ء‬        ‫ن وم‬        ‫سا‬        ‫ف ن‬
                                                                      ‫،‬                     ‫و‬              ‫د دة. و‬
                                                                           ‫ن.‬   ‫ن‬         ‫را‬    ‫ء ر ل(‬              ‫)ا‬


‫س‬          ‫، ھ ذا ا‬          ‫وي ن أ راد س ا‬                     ‫سا‬       ‫نا‬            ‫ء اط‬ ‫ظ ھرة ا‬   ‫اط‬
                                                                                    ‫.‬   ‫تا‬    ‫دف إ ا رار ا‬
  ‫ذات رد ود‬                  ‫وا‬    ‫ض ا واع ا وا‬                         ‫ول‬            ‫ءا ط‬     ‫نإ ا‬    ‫ا‬
                                                                                                  ‫...‬ ‫ا جا‬

                                                                                                           ‫ت:‬         ‫‪ – IV‬ط‬
                                                                                                               ‫ا ر ن ا ول:‬
       ‫ت 2441 ذرة و ظ ر ا دول ا‬                        ‫, ا درا‬          ‫نا‬           ‫د‬       ‫ا دور‬ ‫وزن‬      ‫ا ل ا ول:‬
                                                                                             ‫وز ردد ھذه ا ذور ب ا :‬

‫]58-‬       ‫]08-‬   ‫]57-‬   ‫]07-‬     ‫]56-‬       ‫]06-‬   ‫]55-‬       ‫]05-‬   ‫]54-‬   ‫]04-‬   ‫]53-‬     ‫]03-‬   ‫]52-‬   ‫ا وزن)‪-20] Xi=(cg‬‬
 ‫09[‬        ‫58]‬    ‫08]‬    ‫57]‬      ‫07]‬        ‫56]‬    ‫06]‬        ‫55]‬    ‫05]‬    ‫54]‬    ‫04]‬      ‫53]‬    ‫03]‬    ‫52]‬
   ‫2‬          ‫4‬      ‫6‬     ‫01‬       ‫83‬         ‫08‬   ‫051‬        ‫043‬    ‫045‬    ‫081‬      ‫09‬       ‫23‬      ‫5‬      ‫3‬  ‫دد ا ذور=‪fi‬‬

                                           ‫1 ( ھل ق ا ر ر وا ل أم ر وا ل؟ ل وا ك.‬
‫د ھ ذه‬       ‫ق وز وزن ا ذور‬                ‫ن راء ك ذا ا‬       ‫ب و ذا‬   ‫ا رددات ا‬      ‫2(أ ز‬
                                                                                 ‫ا درو ؟‬    ‫ا‬
                                   ‫ت.‬    ‫ل ھذه ا‬      ‫رزا‬  ‫وا راف ا ط‬         ‫3 ( أ ب ا دل ا‬
                                                    ‫ب وز ھذا ا ر.‬     ‫‪ Gauss‬ا‬         ‫4(أ ز‬
                       ‫: ] ‪ [+б. -б‬و ] ‪. [ +2б .-2б‬‬     ‫تا‬   ‫وزن ا ذور ا‬      ‫5 ( دد ا ل و‬

                                                                                                               ‫:‬     ‫ا رنا‬
  ‫م وز‬        ‫س‬       ‫ب: ا‬          ‫ر ا وردة وا‬                  ‫ت أ زت د وع ن ا‬                               ‫ظ ر ا دول ا‬
                              ‫ا درو 05 رد.‬                       ‫ا وم )‪ .( Kg‬دد ا‬              ‫با‬      ‫ا‬         ‫ردد ا راد ب‬

 ‫31-61 61-91 91-22 22-52 52-82 82-13 13-43 43-73 73-04‬                                                             ‫ا ب)‪(Xi‬‬
   ‫1‬     ‫2‬     ‫4‬     ‫5‬    ‫01‬    ‫21‬     ‫8‬     ‫6‬     ‫2‬                                                                    ‫ا ردد )‪(fi‬‬

                  ‫ذ: و فا د‬          ‫ا‬                                                              ‫: - 231 -‬          ‫ا‬
                                   ‫ر وا ل أم ر وا ل ؟ ل وا ك.‬          ‫1 ( ھل ق ا ر‬
                                                 ‫ن.‬      ‫ا رددات ا‬      ‫2 ( أ ز دراج و‬
                                                   ‫و ت ا دد .‬        ‫3(أ ب تا و‬
                                    ‫] ‪[+2б , -2б‬‬ ‫ر ا لا‬            ‫4 ( دد ا ل ا س ا‬
                                     ‫ا ر ا درو .‬      ‫س‬         ‫5 ( ن ف ن د أو‬

                                                                           ‫ا ر ن ا ث:‬
‫ا رددات أ دي‬               ‫وزن ا دور‬        ‫د ا درة‬   ‫وز ا رددات‬           ‫ا‬  ‫د ا م درا‬
                                                                                   ‫ا وال:‬
                   ‫ا درو ؟‬        ‫دا‬   ‫وزن ا دور‬         ‫ظ‬      ‫ن ھذه ا‬      ‫كإ‬   ‫1 ( ذا‬
                                                      ‫؟‬    ‫س ھذه ا‬      ‫كا د ن‬    ‫2( ف‬
                              ‫؟‬        ‫لا‬    ‫ا‬        ‫و ا دف‬         ‫ءا ط‬     ‫3( نأ طا‬




           ‫ذ: و فا د‬   ‫ا‬                                           ‫: - 331 -‬    ‫ا‬
                                                          ‫:‬      ‫لا‬     ‫ا‬
                                                    ‫ﻋﻠﻢ وراﺛﺔ اﻟﺴﺎﻛﻨﺔ .‬
                                                                               ‫1، و 1 (‬           ‫د : ) أ ظر ا و‬
‫ا و ــــــــــ 1‬
                                ‫.‬     ‫ت ل ن ا ورا ا د وورا ا‬            ‫ر ظ ر اھ‬         ‫،ر‬     ‫ا‬        ‫ط او‬       ‫1:‬           ‫او‬
            ‫.‬         ‫، م دد أھداف ورا ا‬    ‫ا ورا ا د وورا ا‬             ‫ت ل ن‬      ‫اھ‬   ‫ل ھذه ا و‬       ‫دد ن‬
                                                                                                                                 ‫او‬
                                            ‫ورا ا‬                                        ‫د‬      ‫ا ورا ا‬              ‫3:‬



 ‫إ ث‬                                                             ‫ذ ور‬
        ‫‪aa AA aa AA aa‬‬                              ‫‪aa AA aa AA aa‬‬                  ‫أ‬                     ‫ذر‬
        ‫‪aa Aa Aa Aa‬‬                                 ‫‪aa Aa Aa Aa‬‬
        ‫‪Aa Aa Aa Aa Aa‬‬
        ‫‪Aa Aa Aa Aa Aa‬‬
                                        ‫‪X‬‬           ‫‪Aa Aa Aa Aa Aa‬‬
                                                    ‫‪Aa Aa Aa Aa Aa‬‬
                                                                                   ‫‪Aa‬‬         ‫‪X‬‬           ‫‪Aa‬‬         ‫ء‬       ‫ا‬

        ‫… ‪Aa Aa aa‬‬                                  ‫… ‪Aa Aa aa‬‬
                                                                                                            ‫زاوج را ب‬
                                                                                                             ‫ن رد ن‬
                                                                                                              ‫ن‬
                   ‫زاوج‬
                ‫ن‬      ‫وا‬
                 ‫أ راد‬
                            ‫ا‬                                                                                            ‫ء‬       ‫ا‬
                                                                               ‫‪¼ A/A ½ Aa ¼ aa‬‬
    ‫ء‬           ‫ا‬
                      ‫? = ‪A/A = ? Aa = ? aa‬‬

        ‫و‬           ‫ط ا ورا‬          ‫م درا وا ن وز ا ور ت و ا‬               ‫ھ زء ن م ا ورا ،‬     ‫ورا ا‬
                                     ‫:‬    ‫أھداف ر‬     ‫،و‬                     ‫ر ا ورا دا ل‬ ‫ذا ا ت ا ددة‬
                                                    ‫ت س ا ور .‬     ‫ن ردد‬      ‫س ا ر ا ورا ا ط‬                        ‫•‬
                                                              ‫ن ل ر.‬       ‫ا ل ا ر ا ورا‬     ‫م‬                       ‫•‬
                                                           ‫ل.‬   ‫با‬     ‫م آ ت طور ھذا ا ر ا ورا‬                       ‫•‬
                            ‫ن طر ق ا ر ن ورا ا‬                  ‫ا زاو ت ا و‬         ‫د‬           ‫إذا ت ا ورا ا د‬
     ‫دة آ ء.‬                  ‫درون ن زاو ت ر و‬                  ‫ن ا راد‬    ‫و‬       ‫د‬         ‫درس ب ا ط ا ورا‬
                                                                   ‫.‬    ‫وى ا‬                  ‫ط ق ورا ا د‬

                                                     ‫زا ا ورا ؟‬       ‫و‬      ‫ھ ا‬                                    ‫21(‬
                     ‫؟‬            ‫دا‬  ‫ت ا ورا‬ ‫دة درا ا ل ا‬        ‫ا‬       ‫ا وا ن ا‬                                  ‫31(‬
                                                  ‫؟‬       ‫را‬        ‫ھ ا وا ل ا د‬                                    ‫41(‬
                                                          ‫ل؟‬   ‫ف ل ھذا ا ر ر ا‬                                      ‫51(‬
                                 ‫ت؟ و آ ت د ؟‬       ‫ا وع ا ورا‬      ‫ھ ا وا ل ا د‬                                    ‫61(‬


                                ‫ذ: و فا د‬     ‫ا‬                                              ‫: - 431 -‬          ‫ا‬
                   ‫‪:La population et pool génétique‬‬                       ‫وى ا‬                 ‫وا‬                 ‫وم ا‬           ‫‪–Ι‬‬
                                               ‫رب:‬             ‫وط‬     ‫تا‬                 ‫ض أ واع ا‬                ‫ظ‬             ‫1‬
           ‫ن او ق او‬           ‫، وورا . ن ذ ك ا ط‬             ‫، وز‬            ‫ر‬          ‫ر‬          ‫ا‬            ‫ددا‬
                                                                                                                 ‫2، 3، و 1.‬
‫ا و ــــــــــ 1‬                                ‫ا و ــــــــــ 1‬
                                  ‫3‬      ‫او‬                                                                        ‫او‬           ‫2‬
‫رد ز ط وط‬   ‫‪ Macaca sylvanus‬ا روف‬                ‫ل وس وا ط س‬              ‫ا ط سا رو‬                 ‫ر أر ن أ‬     ‫و د‬
‫وطن ا رب، و ل‬         ‫ھ و وع ن ا ردة ا‬           ‫ن 000.007 و 000.058 ھ ر.‬                ‫در‬              ‫ر، و ط‬      ‫ا‬
‫زھ ء 00001 ن ا رب‬         ‫ددھ‬                    ‫،‬        ‫،‬            ‫ا ر ) و وق ر‬              ‫و‬           ‫وھ و وع‬
                                   ‫وا زا ر.‬          ‫ط‬          ‫ف‬       ‫ل ا رارة ) +°05( و وم ا‬             ‫(و‬
‫ر‬    ‫ت‬       ‫وص‬    ‫ا‬           ‫ر ھ ذه ا‬          ‫ت‬       ‫وز وه 01 أ ر، ن‬             ‫،‬       ‫وا‬        ‫ا‬             ‫ا‬
‫ار ع راوح ن‬      ‫ل ا ط س ا و ط،‬         ‫ا رز‬     ‫ث رر‬              ‫ر ن طر ق ا وا د ا‬            ‫لار‬        ‫ا ذور زھر‬
‫ل‬            ‫ز در‬    ‫ر،‬     ‫0021 و0002‬           ‫ت‬        ‫ق‬       ‫م ا زھ رة‬       ‫لإ‬      ‫وب ا ح‬             ‫ا ر د‬
‫) ف ر و ف و ء رد دا‬               ‫ا رات ا‬        ‫ا ت إ إذا ن‬            ‫.ون م‬        ‫أ وب ا ح ا ذي و ا ه ا‬
‫د‬      ‫(. وھ و رد دون ذ ل، ل وز إ 02‬             ‫ن س ا وع ( و ھو أ ر‬          ‫م ) أي‬     ‫ھ ك ؤم ن وب ا ح وا‬
   ‫د ا ث، وطو زھ ء 06 م.‬        ‫ا ذ ور و51‬       ‫م.و ل ل‬          ‫ل ن وب ا ح وا‬               ‫ا ورا‬      ‫ا ر‬    ‫م‬
                                                       ‫.‬     ‫وى ا‬                     ‫ت ا وا دة د ل أ راد ا‬          ‫ا‬




              ‫ل وس.‬                  ‫ل ا طس ا ر و‬        ‫ر أر ن: ل ا طق ا‬         ‫•‬
        ‫ت ر ا رز‬                      ‫• ا رد ‪ Macaca sylvanus‬ا روف رد ز طوط، ا ذي ل‬
                                                ‫ل ا ط س ) ار ع ن 0021 و0002 ر (.‬
                                                              ‫1، و 2.‬                 ‫: أ ظر ا و‬                 ‫وم ا‬           ‫2‬
‫ا و ــــــــــ 2‬
                                                                                  ‫.‬          ‫وم ا‬           ‫ري‬    ‫وذج‬           ‫1:‬   ‫او‬
                                                                                               ‫ن ھ ذه ا و‬                   ‫رج ا ط‬     ‫ا‬
                                                                                        ‫وم‬        ‫ط‬       ‫ر‬                    ‫وا و ق ا‬
                                                     ‫دان ا راد‬                                   ‫تا‬       ‫د د‬                    ‫،‬     ‫ا‬
                                                                                                                                 ‫.‬  ‫اط‬
                                                     ‫و وج ا راد‬


                                                                                    ‫د ، ل رد س‬    ‫= زاوج‬
                                                                                  ‫.‬  ‫ل ن زاوج و ط‬     ‫ا‬
                                                          ‫أ‬          ‫ذر‬
                                                                                                        ‫ا‬    ‫ل وز‬           ‫=‬
                                                     ‫س ا وع‬           ‫أ راد‬

                   ‫ذ: و فا د‬     ‫ا‬                                                             ‫: - 531 -‬                ‫ا‬
              ‫ش‬      ‫و‬     ‫س ا وع. وھ‬        ‫ن ا راد ا‬    ‫و‬                              ‫‪ La population‬ھ‬       ‫ا‬
           ‫ل رد ن أ رادھ ن ا زاوج وا وا د أي رد آ ر ن أ راد‬                               ‫ن‬     ‫ن،‬      ‫ل را‬
          ‫د ق راد‬              ‫د‬    ‫ا س ن ذك‬          ‫دا ل ھ‬                               ‫ت‬         ‫و . وا‬    ‫ا‬
                                                                                                         ‫ن ل:‬
                                                 ‫.‬    ‫ن ا و دات وھ رة أ راد ا وع و ھذه ا‬      ‫• و وج أ راد دد‬
                                         ‫.‬         ‫• دان أ راد م ن ا و ت وھ رة أ راد ا وع رج ل وز ا‬
                                                                           ‫ن ل ار م ا :‬            ‫ا‬      ‫و ن و‬
                                                                                              ‫راز ن‬
                     ‫ن ظور ورا :‬                                                                                                                                     ‫ن ظور ا و و :‬
                     ‫ون س‬       ‫أ راد‬                                                                                                                                 ‫أ راد ن س ا وع‬
                        ‫ا ور ت إ‬                                                                                                                                        ‫ون و زاو ون‬
                         ‫ا وا د‬                                                                                                                                      ‫ددة‬     ‫را‬     ‫ط‬
                                                                                                  ‫وم ا‬
                                             ‫ر ا ورا‬                                                                                                            ‫ن‬           ‫را‬

                                                                                                                               ‫2 ا وى ا‬          ‫:‬
                                                                                                             ‫:‬       ‫أ – ر ف ا وى ا‬
            ‫و د‬                      ‫تا‬                  ‫وع ا‬            ‫، وھو‬                             ‫ا وى ا‬           ‫وم‬        ‫زا‬
         ‫ل، و ون‬                      ‫را‬                 ‫رار‬               ‫.و ز‬                        ‫ت د ل أ راد ا‬     ‫ا‬     ‫ا ور ت‬    ‫وا‬
    ‫ا و ــــــــــ 2‬
                                                                                                         ‫ر ر ا ز ن. أ ظر ا و 2، و 2.‬
                                                                                                                                                                                                  ‫2:‬     ‫او‬
                                 ‫‪A‬‬               ‫‪a‬‬
                                                         ‫‪A‬‬           ‫‪A‬‬                        ‫ن 31 ردا.‬ ‫و‬                     ‫وى ا‬ ‫ا‬ ‫‪P‬‬     ‫دم ا ر م أ‬  ‫د‬
                 ‫‪A‬‬           ‫‪A‬‬                                                                ‫د،‬   ‫ن: ‪ A‬ل‬          ‫ك‬         ‫ر ر ط‬       ‫ر أن ا ور‬   ‫س، و‬
                                                                         ‫‪A‬‬        ‫‪A‬‬                                                    ‫.‬      ‫و‪ a‬ل‬
                                         ‫‪a‬‬           ‫‪a‬‬
                                                                                              ‫،‬       ‫ت، أ ب ردد ل ن ا ظ ھر ا ر‬      ‫ا‬     ‫دام طر‬
     ‫‪A‬‬       ‫‪a‬‬
                                                                                                                         ‫أن:‬    ‫ت.‬ ‫ا ط ا ورا ، وا‬
                                                         ‫‪A‬‬           ‫‪A‬‬
                         ‫‪A‬‬           ‫‪a‬‬
                                                                             ‫‪A‬‬        ‫‪a‬‬                ‫ظ ر ]‪[A‬‬                    ‫ن‬                ‫دد ا راد ا‬
                                                                                                        ‫ــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬   ‫]‪= [A‬‬   ‫ر‬    ‫ردد ظ ر‬
     ‫‪a‬‬       ‫‪a‬‬                                                                                                     ‫‪N‬‬                    ‫وع أ راد ا‬
                                                             ‫‪a‬‬           ‫‪a‬‬
                     ‫‪A‬‬           ‫‪A‬‬           ‫‪A‬‬           ‫‪A‬‬
                                                                                                        ‫ط ‪AA‬‬                      ‫ن‬                ‫دد ا راد ا‬
                                                                                                        ‫ــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬    ‫‪= AA‬‬       ‫ردد ط ورا‬
                                                                                                                   ‫‪N‬‬                    ‫وع أ راد ا‬

                         ‫‪P‬‬                           ‫وى ا‬       ‫ا‬
                                                             ‫ت : ‪f(AA) = D , f(Aa) =H , f(aa) = R‬‬             ‫ردد ا‬
‫ن‬        ‫ب رد‬            ‫ا ول‬            ‫ء ا ذي ط ب‬                 ‫،ا‬       ‫نا‬
                                                           ‫ب ا ل ب ‪ tirage‬ھذا ا‬           ‫د‬‫ب ردد ا ل ‪A‬‬
                                                                                                  ‫ل‬            ‫ن‬
                                                                                 ‫:‬       ‫م بأ د‬           ‫ن ھذه ا‬
           ‫د ن ھذا ا رد وي 1 ) ن‬      ‫،ا ل با ل‪A‬‬               ‫ل ‪ ،D‬ھذه ا‬       ‫وب ‪AA‬‬        ‫ن أن ون ا رد ا‬
                                                                                   ‫ھذا ا رد ل ا ل ‪ A‬ط (.‬
       ‫د ن ھذا ا رد وي 2/1 ) ن ھذا‬       ‫،ا ل با ل‪A‬‬                ‫ل ‪ ،H‬ھذه ا‬      ‫وب ‪Aa‬‬        ‫أو أن ون ا رد ا‬
                                                                                      ‫ا رد ل ذ ك ا ل ‪.( a‬‬
          ‫د ن ھذا ا رد وي 0 ) ن ھذا‬      ‫،ا ل با ل‪A‬‬                 ‫ل ‪ ،R‬ھذه ا‬     ‫وب ‪aa‬‬        ‫أو أن ون ا رد ا‬
                                                                                         ‫ل ا ل ‪.( A‬‬        ‫ا رد‬
                                      ‫إذن ردد ا ل ) ‪ ( A‬ھو )‪f(A) = ( D x 1 ) + ( H x 1/2 ) + ( R x 0 ) : f(A‬‬
                                   ‫2/‪f(A) = D + H‬‬
                                     ‫) 1 ‪f(a) = ( D x 0 ) + ( H x 1/2 ) + ( R x‬‬          ‫ردد ا ل ) ‪ ( a‬ھو )‪: f(a‬‬
                                   ‫2/‪f(a) = R + H‬‬
                    ‫ذ: و فا د‬    ‫ا‬                                                 ‫: - 631 -‬          ‫ا‬
                                                                                                                                    ‫:‬            ‫ا‬                ‫لا‬                                     ‫ل دا ل‬            ‫ب ردد‬       ‫ن‬     ‫وھ ذا‬


                                                            ‫دد ا ور ا‬                                                                                                     ‫دد ا ور ا‬
                                                          ‫ا ران‬                                              ‫1‬                                         ‫ل‬                               ‫ا ران‬
                                       ‫ــــــــــــــــــــــــــــــــــــــــــــــــــ‬               ‫ـــــــــ ‪X‬‬                              ‫ــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬          ‫ل‬     ‫ردد‬
                                                                                                                                        ‫+‬                                                                              ‫=‬
                                         ‫‪N‬‬                    ‫وع أ راد ا‬                                     ‫2‬                                        ‫‪N‬‬                    ‫وع أ راد ا‬                                              ‫دا ل‬


                    ‫ران‬            ‫ا‬                  ‫ل + دد ا ور ا‬                                                        ‫ران‬            ‫ا‬                      ‫2 ‪ X‬دد ا ور ا‬
                   ‫ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬                 ‫ل‬     ‫ردد‬
                                                                                                                                                                                                                       ‫=‬           ‫دا ل‬
                                                          ‫ت(‬                   ‫‪ ) N‬دد ا‬                                  ‫وع أ راد ا‬                       ‫2‪X‬‬


                                                                                                       ‫ت:‬       ‫ل طر ا‬                                                                         ‫ب ا رددات‬    ‫ب–‬
                                                 ‫2، و 2 (.‬                                      ‫‪ ) AA , Aa , aa‬أ ظر ا و‬                                                                   ‫‪ P‬ا ط ا ورا‬          ‫ن‬
                                                                                                                                                                                          ‫• ردد ا ظ ھر ا ر :‬
                                                                                                                                    ‫31/3 = ]‪f [a‬‬                                                 ‫31/01 = ]‪f [A‬‬
                                                                                                                                                                                                ‫• ردد ا ط ا ورا :‬
     ‫31/6 = ‪f(AA) = D‬‬                                                        ‫,‬                   ‫31/4 = ‪f(Aa) = H‬‬                                                               ‫,‬                ‫31/3 = ‪f(aa) = R‬‬
                                                                                                                                                                                                                      ‫ت:‬         ‫• ردد ا‬

                  ‫4+)6‪(2x‬‬                                                                                                                         ‫4+)3‪(2x‬‬
           ‫ــــــــــــــ = )‪f(A‬‬ ‫26.0 =‬                                                                                                    ‫ــــــــــــــ = )‪f(a‬‬ ‫83.0 =‬
                       ‫31 ‪2 x‬‬                                                                                                                          ‫31 ‪2 x‬‬
                                                                                                                                                        ‫ون ‪:Hardy - Weinberg‬‬                                                            ‫‪– IΙ‬‬
                                                                                                                                                             ‫:‬    ‫ا ظر ا‬                                                               ‫1ا‬
       ‫ء‬  ‫ل ) ا ط رات، ھ رة ا راد، ا‬                                                                                   ‫را‬                              ‫و درا ا رات ا ورا‬       ‫ظرا‬
     ‫وذ ك ط ق ون‪.H–W‬‬             ‫ظر‬                                                                                                                 ‫ت ا ورا‬      ‫ا لا‬     ‫ا ط ...(،‬
                                                                                                                           ‫؟‬                      ‫ا ظر ا‬       ‫تا‬      ‫ھذا ا ون و‬

‫ا و ــــــــــ 3‬
                                                                                                               ‫.‬                   ‫ا ظر ا‬                                       ‫تا‬                             ‫1، و 3‬                  ‫ط او‬
                                                                                                                                                                                                           ‫ا ظر‬             ‫تا‬          ‫1:‬      ‫او‬

‫(.‬         ‫لا‬           ‫) س ھ ك أي زاوج ن أ راد ا‬         ‫ذات وا د‬         ‫ا‬    ‫ا‬    ‫ت‬            ‫•‬       ‫ر را‬                             ‫وأ‬
                                                         ‫ل‬      ‫ث م ا زاو ت‬           ‫ذات دد‬      ‫•‬                                       ‫وا .‬
                                                        ‫نا‬           ‫ورا ) س ھ ك د ت‬              ‫•‬                                        ‫رة (.‬
‫ء‬     ‫ا ش= با‬      ‫إ ط ء ف در‬      ‫ا وا د وا درة‬      ‫ن ط م ا ورا ، ا درة‬         ‫،‬     ‫أ راد ا‬   ‫•‬
       ‫م ا زا ) ط ا رد ن ا ط ‪ Aa‬دا % 05 ن‬        ‫تارا‬        ‫• ب ا ط رات وا رات ا ورا أ ء ا راق ا‬
                                                                       ‫ج ‪.a‬‬   ‫ج ‪ A‬و % 05 ن ا‬    ‫ا‬
     ‫ت ط‬        ‫ء‬       ‫ما را ركا‬        ‫د ‪) Panmixie‬‬       ‫ن ا راد : ا راد زاو ون‬    ‫• ا زاوج ا وا‬
                               ‫د ‪.( Pangamie‬‬       ‫ل ذك‬         ‫ج‬     ‫ا ورا أو ظ ره ا ر ، وا ء ا‬


                                                                                                                                                                     ‫2 ون ‪ Hardy‬و ‪:Weinberg‬‬
                                                                                                                                                                               ‫أ – ص ا ون:‬


                         ‫ذ: و فا د‬                                   ‫ا‬                                                                                                                                    ‫: - 731 -‬                ‫ا‬
      ‫رة ن ل ر دا ل‬          ‫ت و رددات ا ط ا ورا‬                                                                      ‫ر ون ‪ H.W‬أن رددات ا‬
           ‫ا زي و‬   ‫وازن. ) ‪ = Hardy‬ر‬                                                                                  ‫، و فا‬        ‫ظر‬
                                                                                                                    ‫(.‬      ‫‪ = Weinberg‬ط ب أ‬

                                                                               ‫ن:‬             ‫ور ذات‬                         ‫ب – رھ ا ون‬
                                                                    ‫3.‬        ‫2 و‬            ‫ل ط ت او‬                      ‫ر ون ‪ H.W‬ن ل ا‬
‫ا و ــــــــــ 3‬
‫ن‬    ‫دى‬                    ‫واھ ا‬            ‫ط ور‬                ‫،و‬        ‫ظر‬        ‫ر‬           ‫2 : إ ء ون ‪Hardy - Weinberg‬‬        ‫او‬
‫س ذات‬                ‫ر ر ط‬    ‫ور‬                        ‫ت‬         ‫ط ا ورا و ردد ا‬     ‫ط ور ل ن ا‬     ‫ن 0‪ G‬و 1‪ ، G‬وذ ك ن ل‬
                                                                                                                        ‫ن ‪ A‬و ‪.a‬‬
                                                                           ‫0‪.G‬‬       ‫ت ا لا‬       ‫1( دد ردد ل ن ا ط ا ورا وا‬
                                                                                               ‫ا ل 1‪.G‬‬      ‫2( دد ردد ا ط ا ورا‬
                                                                             ‫ت ا ل 1‪ G‬ن ل ردد أ ط ا ورا .‬            ‫3( دد ردد ا‬
                                                                                                                   ‫؟‬        ‫ذا‬   ‫4(‬
                                                                ‫) ا ل 0‪( G‬‬         ‫ظر‬
‫ل 0‪: G‬‬       ‫ا‬          ‫ط ا ورا‬         ‫ردد ا‬                        ‫‪Aa‬‬                           ‫‪AA‬‬                          ‫ل 0‪: G‬‬       ‫ا‬   ‫ت‬    ‫ردد ا‬

‫.…............…………………… = )‪f(AA‬‬                                                                                                 ‫……..………………… = ‪f(A) = p‬‬
                                                ‫‪AA‬‬                       ‫‪Aa‬‬                                         ‫‪aa‬‬
‫..…...………………………… = )‪f(Aa‬‬                                                                         ‫‪Aa‬‬                            ‫..……………………… = ‪f(a) = q‬‬

‫.……………………………… = )‪f(aa‬‬                                                                                                                ‫.…….………………… = ‪p + q‬‬
                                                    ‫‪Aa‬‬                                                          ‫‪AA‬‬
                                                                                    ‫‪AA‬‬
‫= )‪f(AA) + f(Aa) + f(aa‬‬
          ‫.………………………… =‬                                                                                    ‫‪AA‬‬
                                                                    ‫‪AA‬‬
  ‫جاذ ر :‬              ‫تا‬         ‫ردد‬                                                   ‫‪aa‬‬                                    ‫و :‬     ‫جا‬       ‫تا‬    ‫ردد‬
  ‫..………….…………………… = )‪f(A‬‬                                                                                                     ‫..………….…………………… = )‪f(A‬‬
  ‫………………………………… = )‪f(a‬‬                          ‫ج‬           ‫ا‬                                                  ‫ج‬       ‫ا‬     ‫………………………………… = )‪f(a‬‬
  ‫………………… = )‪f(A) + f(a‬‬                             ‫و‬       ‫ا‬                                                      ‫اذ ر‬      ‫………………… = )‪f(A) + f(a‬‬
  ‫.……..………………………………………‬                                                                                                       ‫.……..………………………………………‬


                                                                ‫ب‬        ‫أ ءا‬       ‫د‬        ‫ج‬        ‫ءا‬   ‫ا‬


     ‫ل 1‪:G‬‬       ‫ا‬      ‫ط ا ورا‬     ‫ردد ا‬                           ‫ل 1‪G‬‬        ‫ا‬        ‫ا زاوج‬                                ‫ل 1‪:G‬‬       ‫ا‬   ‫ت‬    ‫ردد ا‬
  ‫..…………….…………………… = )‪f(AA‬‬                                                          ‫‪A‬‬                      ‫‪a‬‬                ‫= )‪f(A‬‬
                                                                                             ‫‪p‬‬                       ‫‪q‬‬      ‫..…………..……………………………‬

  ‫.…………………………………… = )‪f(Aa‬‬
                                                                                                                            ‫= )‪f(a‬‬
   ‫..…………………..……………… = )‪f(aa‬‬                                ‫‪A‬‬                                                               ‫…………………….……………………‬

                                                                    ‫‪p‬‬                                                       ‫…………….…………… = )‪f(A) + f(a‬‬
  ‫..……..……………….… = )‪f(A) + f(a‬‬
  ‫………………………………………………………‬
                                                            ‫‪a‬‬                                                               ‫.……..…………………….…………………………‬


                                                                    ‫‪q‬‬                                                       ‫..……..………………………………………………‬




                                              ‫ت ا ل 0‪:G‬‬    ‫1( ردد ا ط ا ورا وا‬
                             ‫: ‪f(AA) = D , f(Aa) = H , f(aa) = R‬‬     ‫ا ط ا ورا‬
                                     ‫ن 1=‪D+H+R‬‬        ‫و دا‬    ‫ردد ا ط ا ورا‬
                       ‫ذ: و فا د‬                ‫ا‬                                                                           ‫: - 831 -‬          ‫ا‬
              ‫2/‪f(A) = p = D + H‬‬ ‫2/‪, f(a) = q = R + H‬‬             ‫ت:‬           ‫ا‬
                      ‫1=‪p+q=D+H+R‬‬

                                            ‫ا ل 1‪:G‬‬        ‫ط ا ورا‬     ‫ردد ا‬         ‫2(‬
                                                          ‫ا زاوج:‬         ‫ن‬           ‫اط‬
                     ‫‪f(AA) = p X p = p2 = D‬‬
                      ‫‪f(Aa) = ( p q ) + ( p q ) = 2pq = H‬‬
                      ‫‪f(aa) = q x q = q2 = R‬‬
                 ‫2‪D + H + R = p2 + 2pq + q‬‬
                            ‫1 = 2) ‪= ( p + q‬‬
                                                 ‫ا ل 1‪:G‬‬      ‫ت‬        ‫ردد ا‬         ‫3(‬
                         ‫2/‪f(A) = f(AA) + f(Aa)/2 = D + H‬‬
                               ‫2/)‪= p2 + (2pq‬‬
                              ‫‪= p2 + pq‬‬
                              ‫)‪=p(p+q‬‬
                            ‫و أن 1 = ) ‪ ( p + q‬ن ‪f(A) = p‬‬

                         ‫2/‪f(a) = f(aa) + f(Aa)/2 = R + H‬‬
                              ‫2/)‪= q2 + (2pq‬‬
                             ‫‪= q2 + pq‬‬
                             ‫)‪=q(p+q‬‬
                            ‫و أن 1 = ) ‪ ( p + q‬ن ‪f(a) = q‬‬
                                                                      ‫ج:‬           ‫4( ا‬
‫رف‬     ‫ل، وھذا‬  ‫وا ا‬      ‫ت و ردد ا ط ا ورا‬      ‫ردد ا‬    ‫ظ أن ھ ك ا رارا‬
‫، ظل رددات ا ط ا ورا و رددات‬     ‫ا ظر ا‬        ‫ا‬     ‫وازن ‪.Hardy-Weinberg‬‬
                        ‫وازن.‬             ‫رة ن ل ر، ول أن ا‬          ‫ت‬    ‫ا‬

   ‫ل ر ا دا‬   ‫ط‬        ‫د‬    ‫ت‬     ‫ن ردد ا‬       ‫اط‬     ‫م د د رددات ا ط ا ورا‬
‫ث ‪ p‬ھو ردد ا ل ‪ A‬و ‪ q‬ھو ردد ا ل ‪ ،a‬ن ردد‬       ‫ن،‬      ‫ور ذات‬          ‫2)‪.(p+q‬‬
                                                     ‫:‬       ‫ب‬      ‫ا ط ا ورا‬
           ‫2‪f(AA) + f(Aa) + f(aa) = ( p + q )2 = p2 + 2pq + q‬‬
           ‫, 2‪f(AA) = p‬‬       ‫‪f(Aa) = 2pq‬‬      ‫,‬   ‫2‪f(aa) = q‬‬

   ‫ت، ث إذا‬      ‫ا ور ت ددة ا‬           ‫ظ : ط ق ون ‪ Hardy-Weinberg‬أ‬
     ‫فا ط‬       ‫ا وا 1‪ pn . . . p3 , p2 , p‬ن رددات‬        ‫ت‬   ‫فا‬     ‫ت رددات‬
                                                            ‫2‬
                                    ‫)1‪.(pn . . . p3 , p2 , p‬‬  ‫ر ا دا‬   ‫ا ورا ھ‬


         ‫ذ: و فا د‬   ‫ا‬                                    ‫: - 931 -‬        ‫ا‬
               ‫ت ھ ‪ A‬و‪ B‬و‪O‬‬          ‫ن دد ن طر ق‬    ‫ل ا د و ‪ ABO‬د ا‬                                                                                                                        ‫ظما‬
                        ‫2‬   ‫2‬   ‫2‬   ‫2‬
           ‫ا وا ‪ p‬و‪ q‬و‪ .r‬ادن + ‪( p + q + r ) = p + q + r + 2pq + 2pr‬‬                                                                                                                        ‫رددات‬
                                                                                                                                                                                               ‫‪2qr‬‬

                 ‫2‪f(AA) = p‬‬  ‫2‪, f(BB) = q2 , f(OO) = r‬‬                                                                    ‫ھو‬                 ‫ط ا ورا‬                              ‫وھ ذا ردد ا‬
                ‫‪f(AB) = 2pq , f(AO) = 2pr , f(BO) = 2qr‬‬

                           ‫ون ‪:H-W‬‬              ‫ب‬          ‫ط ا ورا‬                ‫ت و ردد ا‬                                              ‫ن ردد ا‬                                                   ‫3ا‬
                                                                                                                                                                                          ‫ؤال :‬
          ‫ل ‪ .(q) a‬دد‬         ‫ردد ا‬      ‫ف ا ط ا ورا د‬                                                  ‫4 ردد‬                ‫1 و‬                                    ‫ت او‬      ‫ل‬
           ‫ا با د‬             ‫5.0 = ‪ .p = q‬م رن ھذه ا ط ت‬                                                                  ‫ط ا ورا‬                                  ‫فا‬      ‫م ردد‬
‫ا و ــــــــــ 4‬
                                                                                                ‫ران.‬                     ‫ا‬       ‫ء‬                                   ‫زاوج ا‬
          ‫0.1‬
                                                                     ‫ون ‪H-W‬‬                         ‫ب‬              ‫‪q‬‬                          ‫د‬            ‫ط ا ورا‬                    ‫ردد ا‬               ‫1:‬               ‫او‬
          ‫9.0‬       ‫‪AA‬‬                               ‫‪aa‬‬                            ‫2)‪f(AA) = p2 = (1 – q‬‬                                                                            ‫د ت:‬                    ‫ط قا‬
                                                                                    ‫)‪f(Aa) = 2pq = 2q(1 – q‬‬
          ‫8.0‬
                                                                                    ‫2‪f(aa) = q‬‬
          ‫7.0‬
‫ردد ا‬




          ‫6.0‬                      ‫‪Aa‬‬                            ‫ردد‬                                ‫د‬              ‫ط ا ورا‬                     ‫فا‬   ‫ت ردد‬                                         ‫ل‬    ‫ن‬
          ‫5.0‬
                                                                                                                         ‫.‬                      ‫ا ل‬    ‫ل‬                                       ‫ا ل ‪،(q) a‬‬
‫ط ا ورا‬




          ‫4.0‬                                                    ‫5.0 = ‪ .p = q‬م‬                                                                ‫ط ا ورا‬ ‫فا‬    ‫دد م ردد‬
          ‫3.0‬                                                    ‫ء‬    ‫زاوج ا‬                                                           ‫د‬        ‫ا با‬    ‫رن ھ ذه ا ط ت‬
          ‫2.0‬                                                                                                                                             ‫ا ران.‬
          ‫1.0‬                                                     ‫…………………= )‪f(AA) =………………… , f(Aa) =………………… , f(aa‬‬
           ‫0‬                                                                                                                                                                                                ‫ر :‬
                                                                  ‫..............................................................................................................................................................‬
                ‫0.1 9.0 8.0 7.0 6.0 5.0 4.0 3.0 2.0 1.0 0‬
                                                                 ‫..............................................................................................................................................................‬

                          ‫ل ‪(q) a‬‬       ‫ردد ا‬                    ‫..............................................................................................................................................................‬




                                                                                                                                                                           ‫واب :‬
                            ‫4/1 = )‪f(aa‬‬              ‫,‬    ‫: 4/1 )‪f(Aa) = 1/2 , f(AA‬‬                                                                                 ‫ردد ا ط ا ورا‬
                          ‫ء‬    ‫ل زاوج ا‬                      ‫ا ورا ا د ا‬    ‫ط ا ورا‬                                                                                 ‫ھ س رددات ا‬
                                                         ‫ن ون ‪.Hardy-Weinberg‬‬                                                                                             ‫ا ران، وھ‬

                               ‫:‬                ‫ظر‬                    ‫‪Hardy – Weinberg‬‬            ‫‪ – IIΙ‬ط ق ون‬
                                                                                                                                             ‫2‬
                                                                                 ‫1 ا ر ا وازن ‪:( Khi deux ) χ‬‬
                ‫ن‬      ‫2‪ ، χ‬وا ذي‬            ‫را ط‬         ‫زا‬    ‫وازن أم ، وم‬                                                            ‫د و ر ھل ا‬
                                                                                                                                ‫ث را ل ھ :‬

                                                                                                                                        ‫2‬                          ‫ب 2‪: χ‬‬                                ‫•‬
                             ‫) دد ا راد ا ظري – دد ا راد ا ظ (‬
                       ‫ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ = 2‪χ‬‬
                                                         ‫دد ا راد ا ظري‬

                      ‫ذ: و فا د‬          ‫ا‬                                                                                                   ‫: - 041 -‬                                     ‫ا‬
                                             ‫د در ا ر ) ‪:Degré de liberté (ddl‬‬          ‫• دد‬
       ‫ت = ‪ddl‬‬             ‫– دد ا‬         ‫ت ا درو . دد ا ط ا ورا‬     ‫ھ رق دد ا ط ا ورا و دد ا‬
         ‫4(‬         ‫2 و‬          ‫ص ) أ ظر ا و‬              ‫دول‬        ‫رأ‬                   ‫و‬        ‫2‪ χ‬ا‬     ‫رن‬           ‫•‬
                                                                                                      ‫ر ن:‬            ‫د‬

                   ‫دة 50.0 أي % 5.‬                 ‫ر وھو‬         ‫ره ن طرف ا‬          ‫ا لا ط ‪α‬و ما‬
                                                                                        ‫در ا ر ‪.ddl‬‬
                           ‫2‪ χ‬ا ول، ل أن ا‬          ‫ا‬    ‫ر نا‬                         ‫و أ‬     ‫2‪ χ‬ا‬     ‫وھ ذا إذا ت‬
  ‫2‪χ‬‬       ‫ا‬             ‫و أ ر نا‬      ‫‪χ‬ا‬‫2‬
                                               ‫وازن. و إذا ت‬                            ‫ن ‪ Hardy – weinberg‬أي أ‬
         ‫وازن.‬                ‫ت‬     ‫ن ‪ Hardy – weinberg‬أي أ‬                                      ‫ا ول، ل أن ا‬

‫ا و ــــــــــ 4‬                                                                                 ‫ر ا وازن 2 ‪: χ‬‬       ‫2: ا‬    ‫او‬

                   ‫‪α‬‬      ‫09,0‬      ‫05,0‬           ‫03,0‬     ‫02,0‬     ‫01,0‬     ‫50,0‬     ‫20,0‬     ‫10,0‬     ‫100,0‬

                   ‫‪ddl‬‬
                    ‫607,2 246,1 470,1 554,0 8510,0 1‬                         ‫148,3‬    ‫214,5‬    ‫536,6‬     ‫728,01‬
                    ‫506,4 912,3 804,2 683,1 112,0 2‬                          ‫199,5‬    ‫428,7‬    ‫012,9‬     ‫518,31‬
                    ‫152,6 246,4 566,3 663,2 485,0 3‬                          ‫518,7‬    ‫738,9‬    ‫543,11‬    ‫662,61‬
                    ‫977,7 989,5 878,4 753,3 460,1 4‬                          ‫884,9‬    ‫866,11‬   ‫772,31‬    ‫764,81‬
                    ‫632,9 982,7 460,6 153,4 016,1 5‬                          ‫070,11‬   ‫883,31‬   ‫680,51‬    ‫515,02‬
                    ‫546,01 855,8 132,7 843,5 402,2 6‬                         ‫295,21‬   ‫330,51‬   ‫218,61‬    ‫754,22‬
                    ‫710,21 308,9 383,8 643,6 338,2 7‬                         ‫760,41‬   ‫226,61‬   ‫574,81‬    ‫223,42‬
                    ‫263,31 030,11 425,9 443,7 094,3 8‬                        ‫705,51‬   ‫861,81‬   ‫090,02‬    ‫521,62‬
                    ‫486,41 242,21 656,01 343,8 861,4 9‬                       ‫919,61‬   ‫976,91‬   ‫666,12‬    ‫778,72‬
                   ‫789,51 244,31 187,11 243,9 568,4 01‬                       ‫703,81‬   ‫161,12‬   ‫902,32‬    ‫885,92‬
                    ‫.‬    ‫.‬      ‫.‬      ‫.‬      ‫.‬      ‫.‬                          ‫.‬        ‫.‬        ‫.‬         ‫.‬
                    ‫.‬    ‫.‬      ‫.‬      ‫.‬      ‫.‬      ‫.‬                          ‫.‬        ‫.‬        ‫.‬         ‫.‬
                   ‫652,04 052,63 035,33 633,92 995,02 03‬                     ‫377,34‬   ‫269,74‬   ‫298,05‬    ‫307,95‬


   ‫4‬      ‫3 و‬            ‫: أ ظر ا و‬                  ‫ظر‬                    ‫‪Hardy – Weinberg‬‬         ‫ون‬       ‫ط ق‬
‫ا و ــــــــــ 4‬                      ‫.‬       ‫دة ا‬     ‫ا‬              ‫ظر‬             ‫ون ‪Hardy-Weinberg‬‬       ‫3: ط ق‬           ‫او‬
                                                           ‫ء دد ا راد زھ ر‬ ‫زھر ، م إ‬    ‫ف ن 005‬     ‫ظر‬       ‫دا ل‬
   ‫ظ ر ر‬               ‫ظ ر ر‬              ‫ا ظ ر‬          ‫.‬      ‫ا دول‬      ‫ا‬     ‫ا‬          ‫ء،‬  ‫راء، و دد ا راد زھ ر‬
  ‫د]‪[R‬‬               ‫]‪[b‬‬                    ‫ا ر‬          ‫دة‬                      ‫و‬   ‫رة ور ا ؤو ن ون ا زھ ر‬
                                                     ‫ا ل ا ؤول ن ا ون ا ض ) ‪.( b‬‬        ‫ا ل ا ؤول ن ا ون ا ر ) ‪( R‬‬
                                          ‫ا ط‬
       ‫‪RR‬‬                 ‫‪bb‬‬
                                           ‫ا ورا‬            ‫د ‪Hardy-Weinberg‬‬          ‫وازن، و ط ق‬                 ‫ر ھذه ا‬

                                           ‫دد‬                    ‫‪ = p‬ردد ا ل ‪، R‬‬         ‫1 = )‪p2(RR) + 2pq(Rb) + q2(bb‬‬
       ‫084‬                ‫02‬
                                          ‫ا راد‬                  ‫ل‪ b‬و1=‪.p+q‬‬           ‫‪ = q‬ردد ا‬

                                                     ‫ا ت،‬        ‫ا م وا‬      ‫ت دا‬   ‫أ ب رددات ا ط ا ورا و رددات ا‬
                                                                 ‫.‬      ‫ط ا ورا ‪ RR‬و‪ Rb‬ھذه ا‬      ‫ا دد ا ظري‬   ‫ما‬

                       ‫ذ: و فا د‬          ‫ا‬                                                    ‫: - 141 -‬          ‫ا‬
                                                             ‫ا م:‬             ‫دا‬       ‫ب ا رددات‬            ‫1(‬
                                                                               ‫‪:bb‬‬       ‫ردد ا ط ا ورا‬
     ‫ط‬      ‫دد ا‬     ‫و‬     ‫ون‬          ‫، ن دد ظ ھرھ ا ر‬              ‫ا‬          ‫ا‬          ‫ب ردد‬     ‫ل‬
                                                                                                      ‫ا ورا‬

                                      ‫40.0 = 005/02 = ]‪f (bb) = f [b‬‬
                                                                                 ‫ن‪R‬و‪:b‬‬        ‫ردد ا‬
      ‫ت ن ل ردد ا ط‬         ‫ب ردد ا‬  ‫ن‬     ‫وازن،‬                                     ‫إذا ا ر أن ھذه ا‬
       ‫2‬                  ‫2‬
      ‫2) ‪ ( p + q‬أي 1 = )‪p (RR) + 2pq(Rb) + q (bb‬‬                            ‫ل ر ا دا‬       ‫ا ورا ، وا‬
         ‫‪ f(R) = p‬و ‪f(b) = q‬‬                 ‫2‪f(RR) = p2 , f(Rb) = 2pq , f(bb) = q‬‬
                            ‫2‪( f(bb) = f [b] = q2 = 0.04 ) q‬‬                         ‫رف‬             ‫‪q‬‬       ‫دأ‬
                                                 ‫ــــــ‬
                                    ‫2.0 = 40.0 √ = ‪f(b) = q‬‬              ‫إذن :‬


                                                ‫2.0 = ‪q‬‬
                         ‫م أن 1 = ‪ p + q‬ادن 8.0 = 2.0 – 1 = ‪p = 1 – q‬‬                          ‫‪:p‬‬       ‫ب‬
                                                ‫8.0 = ‪p‬‬

                                    ‫2.0 = )‪f(R) = 0.8 , f(b‬‬         ‫ن ‪ R‬و ‪ b‬ھو :‬                ‫وھ ذا ردد ا‬

                                                                       ‫‪:RR‬‬               ‫ردد ا ط ا ورا‬
                                                                     ‫ب‬   ‫ن‬               ‫م‪p‬و‪q‬‬          ‫ء‬
                   ‫46.0 = 2)8.0( = 2‪f(RR) = p‬‬             ‫ران ‪:RR‬‬    ‫ا‬                    ‫ردد ا ط ا ورا‬
    ‫23.0 = )2.0 ‪f(Rb) = 2pq = (2 x 0.8 x‬‬                  ‫ران ‪:Rb‬‬        ‫ا‬                ‫ردد ا ط ا ورا‬

                                                          ‫‪ RR‬و ‪:Rb‬‬           ‫ط ا ورا‬       ‫ا دد ا ظري‬
                                                                                       ‫دد ا راد‬
     ‫‪f(RR) x ( N‬‬                ‫دد أ راد ا‬   ‫دد ا راد ‪) = RR‬‬             ‫= )‪f(RR‬‬ ‫ـــــــــــــــــــــــــــ‬
                                                                                           ‫دد أ راد ا‬

                          ‫ن ل ‪ RR‬ھو ‪320 = 0.64 x 500 = f(RR) x N‬‬                           ‫ادن دد ا راد ا‬
                          ‫ن ل ‪ Rb‬ھو ‪160 = 0.32 x 500 = f(Rb) x N‬‬                           ‫و دد ا راد ا‬
                           ‫ن ل ‪ bb‬ھو ‪20 = 0.04 x 500 = f(bb) x N‬‬                           ‫و دد ا راد ا‬

                                                       ‫ا ت:‬                   ‫دا‬     ‫ب ا رددات‬         ‫2(‬
‫.‬         ‫ھذه ا‬           ‫س ا ردد ا ذي و د‬        ‫ن‪R‬و‪b‬‬   ‫نا‬                          ‫ا مأ‬      ‫أ راد ا‬
                                                                                       ‫ا زاوج:‬       ‫ز‬


              ‫ذ: و فا د‬         ‫ا‬                                                  ‫: - 241 -‬        ‫ا‬
        ‫ا تھ :‬        ‫دا‬   ‫رددات ا ط ا ورا‬                                                              ‫‪R‬‬                    ‫‪b‬‬
                     ‫2‬                                                                                      ‫8.0 = ‪p‬‬                  ‫2.0 = ‪q‬‬
           ‫46.0 = ‪f(RR) = p‬‬
           ‫23.0 = 61.0 ‪f(Rb) = 2pq = 2 x‬‬                                                      ‫‪R‬‬         ‫‪RR‬‬                   ‫‪Rb‬‬
                                                                                                          ‫2‬
           ‫40.0 = 2‪f(bb) = q‬‬                                                                ‫8.0 = ‪p‬‬      ‫46.0 = ‪p‬‬            ‫61.0 = ‪Pq‬‬
   ‫ا ت‬        ‫ت وا ط ا ورا‬      ‫ظ أن ردد ا‬                                                     ‫‪b‬‬        ‫‪Rb‬‬                   ‫‪bb‬‬
                                                                                            ‫2.0 = ‪q‬‬      ‫61.0 = ‪Pq‬‬           ‫40.0 = 2‪q‬‬
     ‫ون ‪.( H-W‬‬              ‫ا م)‬

                   ‫ت ا ورا :‬                      ‫ل ضا‬               ‫ا‬       ‫‪Hardy – Weinberg‬‬             ‫‪ – IV‬ط ق ون‬
                                                                     ‫:‬             ‫تا‬                 ‫ور ت ر ط‬
                                                                                                         ‫دة.‬        ‫ا‬        ‫أ–‬

                                       ‫5(‬    ‫1 و‬          ‫ا د و ر زوس ) أ ظر ا و‬                      ‫ل أول: ا‬          ‫‪–a‬‬
‫ا و ــــــــــ 5‬
                                                                                               ‫ن‬   ‫ا د و ر زوس د ا‬       ‫1:ا‬   ‫او‬
                               ‫+‬
      ‫ل‪d‬‬      ‫] ‪ ،[ Rh‬وا‬                    ‫د ط ا‬         ‫ل‪D‬‬        ‫ن ‪ d‬و ‪ .D‬ا‬      ‫ا د و ر زوس ‪ (Rh) Rhésus‬وا ط ا‬           ‫ر ز‬
                                                                                             ‫-‬
                                                                                      ‫] ‪.[ Rh‬‬         ‫ث ا ط ا ورا ‪ dd‬ط ا‬
                           ‫] +‪.[ Rh‬‬               ‫م نا‬        ‫أن 032‬         ‫ك‬     ‫ت 004 رد ن ط ا‬            ‫6791 أظ رت درا‬
                                                                                   ‫.‬     ‫ط ق ون ‪ ،Hardy -Weinberg‬أ م ا دول ا‬

 ‫و ..………… = )‪ f(dd‬ادن …..…………… = .………..……………………………………… = )‪f(d‬‬                         ‫..………… = )‪f(d‬‬            ‫ل‪d‬‬       ‫ا‬
                                                                                                                                 ‫ت‬          ‫ردد ا‬
 ‫…………….……………… = )‪f(D‬‬                   ‫..…….………………… = .……….…………..…………………………………………………… =‬                        ‫ل‪D‬‬       ‫ا‬

 ‫………………………… = )‪f(DD‬‬                    ‫..…….…………………… = .……….………………………..…………………………………… =‬                          ‫‪DD‬‬
 ‫……………..…………… = )‪f(Dd‬‬                  ‫..…….………………… = .……….……………………………………………………………… =‬                                                ‫ط‬     ‫ردد ا‬
                                                                                                                 ‫‪Dd‬‬
                                                                                                                                          ‫ا ورا‬
 ‫.….…………………… = .……….……………………………………………………………… = …………..………………… = )‪f(dd‬‬                                             ‫‪dd‬‬

 ‫………..………………………………………………………………………………………………………………………………………………………‬
                                                                                                          ‫وا‬        ‫] +‪ [ Rh‬ا ذ ن ھم‬
                                                                                                                                 ‫ران :‬              ‫ا‬


                                                                                                                                           ‫ا ل‬
                                                                ‫2‬
    ‫‪f(d) = q‬‬                   ‫ادن‬                ‫‪f(dd) = q‬‬              ‫و‬       ‫‪f(d) = q‬‬                 ‫ل‪d‬‬        ‫ا‬
                                                                                                                            ‫ت‬            ‫ردد ا‬
    ‫= )‪f(D‬‬         ‫‪p‬‬        ‫=‬          ‫‪1-q‬‬            ‫53.0 =‬                                              ‫ل‪D‬‬        ‫ا‬
                           ‫2‬                      ‫2‬
    ‫= )‪f(DD‬‬            ‫‪p‬‬           ‫=‬     ‫)53.0(‬           ‫=‬     ‫221.0‬                                         ‫‪DD‬‬
                                                                                                                             ‫ط‬         ‫ردد ا‬
    ‫= )‪f(Dd‬‬        ‫= ‪2pq‬‬                    ‫53.0 ‪2 x 0.65 x‬‬              ‫=‬   ‫554.0‬                             ‫‪Dd‬‬
                                                                                                                                      ‫ا ورا‬
                        ‫2‬                             ‫2‬
    ‫= )‪f(dd‬‬            ‫‪q‬‬           ‫=‬        ‫)56.0(‬             ‫=‬         ‫324.0‬                                 ‫‪dd‬‬
                                                                                                                ‫] +‪ [ Rh‬ا ذ ن ھم‬
     ‫68.87 = 001‪(f(Dd)/(f(Dd) + f(DD)))x‬‬
                                                                                                                     ‫وا ا ران :‬


                       ‫ذ: و فا د‬              ‫ا‬                                                          ‫: - 341 -‬               ‫ا‬
‫ا و ــــــــــ 5‬
                            ‫5(‬      ‫2 و‬             ‫: رض ‪ ) Mucoviscidose‬أ ظر ا و‬                                     ‫ل‬      ‫‪–b‬‬
                                                                                                       ‫ل رض ‪Mucoviscidose‬‬              ‫2:ا‬        ‫او‬
    ‫ر ر ط‬           ‫‪m‬‬        ‫ل‬              ‫‪La mucoviscidose‬‬                    ‫د‬     ‫ب ط ل ن ن 0003 رض ورا‬                     ‫واز ،‬         ‫د‬
                                                                                                                                          ‫س.‬
           ‫د(‬       ‫لا‬               ‫ل ا ر ز +‪m‬‬          ‫ك. ) أ‬      ‫لإ‬       ‫راد ا د ن.‬                 ‫ا‬  ‫ط ا ورا‬       ‫1( أ ط ا ط ا ورا أو ا‬
                                                                                               ‫.‬        ‫ن ھذه ا‬              ‫2( أ ب ردد ا راد ا‬
                                                                                       ‫.‬           ‫ا ران ھذه ا‬                 ‫3( أ ب ردد ا راد‬


 ‫دن‬         ‫راد ا د ن ھ +‪ m+m‬و ‪ ،m+m‬ن ا راد ا‬                                                           ‫ن‬      ‫1( ا ط ن ا ورا ن ا‬
                       ‫ا ران.‬      ‫ھ‬    ‫ران و‬                                              ‫ا‬                        ‫ن:‬      ‫ون‬
                               ‫1‬
       ‫= )‪f(mm‬‬               ‫ھو )‪ = 3.3 10- 4:f(mm‬ـــــ‬       ‫ن ھذه ا‬    ‫2( ردد ا راد ا‬
                            ‫0003‬
                                                      ‫ر ‪ q‬ردد ا ل ‪ m‬و ‪ p‬ردد ا ل +‪.m‬‬
                                                ‫وأن 2‪f(mm) = f(m) = q‬‬    ‫م أن 1 = ‪p + q‬‬
                             ‫أي )‪( f(mm‬‬     ‫ن ا‬        ‫ب ادن ‪ q ) :q‬وي در ردد ا راد ا‬
                                                              ‫ـــــــــ‬
                                                    ‫=‪q‬‬     ‫3.3 √‬
                                                       ‫810.0 = 4 -01‬
                                        ‫289.0 = 810.0 – 1 = ‪P = 1 – q‬‬

                                                ‫:‬   ‫ران )‪ f(m+m‬ھو ‪ ،2pq‬و‬                           ‫ا‬          ‫م أن ردد ا راد‬                 ‫3(‬
                                                ‫530.0 = )810.0 ‪f(m+m) = 2 x (0.982 x‬‬

                                                         ‫5(‬         ‫3 و‬             ‫دة. ) أ ظر ا و‬           ‫وي ا‬                ‫ب–‬
‫ا و ــــــــــ 5‬                                                                                         ‫ن‬    ‫دا‬      ‫3: ا ظ م ا د وي ‪MN‬‬      ‫او‬
            ‫أ رت‬        ‫و ا دة ‪ M‬و ‪ .N‬أ طت درا‬    ‫ن‬    ‫ر‬   ‫ا ظ م ‪MN‬‬      ‫اد و‬        ‫ا‬    ‫ن‬     ‫دا‬
                     ‫: 9303 ] ‪.[ N ] 1303 + [ M ] 1787 + [ MN‬‬    ‫ا‬        ‫ا‬      ‫ص رط ا‬        ‫9216‬
                                                              ‫.‬    ‫ھذه ا‬      ‫ف ا ط ا ورا‬     ‫1( أ ب ردد‬
                                                                                ‫ن ‪ M‬و ‪.N‬‬    ‫2( أ ب ردد ا‬
                                                                ‫وازن ‪،Hardy – Weinberg‬‬            ‫إذا ا ر أن ھذه ا‬
                                                                               ‫3( أ ب ا ردد ا ظر ل ن ا ط ا ورا .‬
                                                     ‫4( أ ب دد ل ن ا ط ا ورا ا ظر ب ون ‪.Hardy – Weinberg‬‬
                                                    ‫2‪.( χ‬‬   ‫لا را ط‬       ‫وازن ) د ن ذ ك‬            ‫5( ھل ر ھذه ا‬
                ‫:‬       ‫ا‬    ‫ا‬     ‫طت ھذه ا درا‬        ‫را ،‬        ‫ن‬           ‫د 037 رد ن ا‬
                                                                              ‫نا‬                   ‫أ ر ت س ا درا ا‬
                                                                               ‫612 ] ‪.[ N ] 492 + [ M ] 22 + [ MN‬‬
                                 ‫وازن ؟ .‬              ‫ھ‬          ‫ن ھذا ا ر ن، ن ھل ھذه ا‬   ‫دة ا زء‬       ‫ط ك س ا را ل ا‬



                                                                          ‫:‬         ‫ھذه ا‬               ‫ط ا ورا‬        ‫فا‬         ‫ردد‬        ‫1(‬
                               ‫دد ا راد ‪MM‬‬                                  ‫7871‬
                   ‫ـــــــــ = )‪D = f(MM‬‬                                  ‫92.0 = ــــــــــــــ =‬                     ‫92.0 = )‪f(MM‬‬
                                 ‫وع ا راد‬                                    ‫9216‬

                    ‫ذ: و فا د‬               ‫ا‬                                                                   ‫: - 441 -‬          ‫ا‬
                       ‫دد ا راد ‪NN‬‬                         ‫3031‬
           ‫ـــــــــ = )‪R = f(NN‬‬                         ‫12.0 = ــــــــــــــ =‬                ‫12.0 = )‪f(NN‬‬
                         ‫وع ا راد‬                           ‫9216‬
                       ‫دد ا راد ‪MN‬‬                         ‫9303‬
           ‫= )‪H = f(MN‬‬ ‫ـــــــــ‬                         ‫=‬ ‫94.0 = ــــــــــــــ‬                ‫94.0 = )‪f(MN‬‬
                         ‫وع ا راد‬                           ‫9216‬
                                                                                     ‫ن‪M‬و‪:N‬‬                 ‫ردد ا‬      ‫2(‬
                                     ‫‪H‬‬            ‫94.0‬
             ‫+ ‪f(M) = D‬‬              ‫35.0 = ــــــــــــــ + 92.0 = ــ‬                          ‫35.0 = )‪f(M‬‬
                                     ‫2‬                ‫2‬

                                     ‫‪H‬‬            ‫94.0‬
             ‫+ ‪f(N) = R‬‬              ‫54.0 = ــــــــــــــ + 12.0 = ــ‬                          ‫54.0 = )‪f(N‬‬
                                     ‫2‬                ‫2‬

                                          ‫1 = 54.0 + 35.0 = ‪p + q‬‬

‫ا ظري ) ا و (‬              ‫ب ردد ا ط ا ورا‬      ‫وازن، وم‬           ‫ر أن ھذه ا‬                                         ‫3(‬
                                     ‫2‬         ‫2‬
                                 ‫ل د ‪.( p + 2pq + q ) Hardy - Weinberg‬‬
  ‫82.0 = )‪f(MM‬‬     ‫وي 2‪ p‬و ل 2) 35.0 ( أي 82.0‬                                              ‫ردد ‪ MM‬ا ظر‬
   ‫02.0 = )‪f(NN‬‬    ‫وي 2‪ q‬و ل 2) 54.0 ( أي 02.0‬                                              ‫ردد ‪ NN‬ا ظر‬
‫وي ‪ 2pq‬و ل )54.0‪ (2x0.53 x‬أي 74.0 74.0 = )‪f(MN‬‬                                              ‫ردد ‪ MN‬ا ظر‬

                                                                             ‫ا ظري :‬        ‫ط ا ورا‬        ‫دد ا‬       ‫4(‬
         ‫:‬   ‫دد أ راد ا‬ ‫روب‬   ‫وي ردد ھذا ا ط‬   ‫ن ط ا ورا‬      ‫دد ا راد ا‬
                              ‫2‬
       ‫ن ط ا ورا ‪ MM‬ھو ‪1716 = 0.28 X 6129 = p x N‬‬        ‫ردد ا راد ا‬
     ‫ن ط ا ورا ‪ MN‬ھو ‪2880.6 = 0.47 X 6129 = 2pq x N‬‬      ‫ردد ا راد ا‬
                               ‫2‬
      ‫ن ط ا ورا ‪ NN‬ھو ‪1225.8 = 0.20 X 6129 = q x N‬‬       ‫ردد ا راد ا‬

                                                                                              ‫ر ا وازن :‬           ‫5( ا‬
                                                                                                ‫‪:χ‬‬  ‫2‬
                                                                                                              ‫ب‬
                            ‫:‬        ‫لا‬    ‫ا‬        ‫ب 2‪χ‬‬         ‫‪ MM‬و ‪ MN‬و ‪NN‬‬                   ‫3 أ ط و را‬

   ‫2‪χ‬‬   ‫‪= (EMMo – EMMt )2/EMMt +(ENNo – ENNt )2/ENNt +(EMNo – EMNt )2/EMNt‬‬

                                                                         ‫ظ ‪ Et‬وا داد ا ظر‬             ‫‪ = Eo‬ا داد ا‬
      ‫2) 6171 – 7871 (‬                      ‫2) 6.0882 – 9303 (‬                       ‫2) 8.5221 – 3031 (‬
 ‫ــــــــــــــــــــــــــــــــــــ + ــــــــــــــــــــــــــــــــــــ = ‪χ‬‬
  ‫2‬
                                                                                  ‫ــــــــــــــــــــــــــــــــــــــ +‬
                ‫6171‬                                  ‫6.0882‬                                  ‫8.5221‬

     ‫5.61 = 68.4 + 17.8 + 39.2 =‬
              ‫ذ: و فا د‬          ‫ا‬                                                         ‫: - 541 -‬          ‫ا‬
                                                                    ‫ا ر ‪: ddl‬‬                 ‫در‬         ‫ب‬
                                         ‫ط ا ورا = ‪ddl‬‬       ‫ت – دد ا‬    ‫دد ا‬
                                             ‫2–3=‬
                                             ‫1=‬
                                                           ‫ل ا ط ‪ α‬وي 50.0 أي % 5‬                               ‫ا‬
                                         ‫48.3‬    ‫4ھ‬     ‫دول ا و 2 و‬    ‫ا روءة‬ ‫2‪ χ‬ا‬

                                                                     ‫ا روءة‬                ‫2‪ χ‬ا‬              ‫48.3 =‬
    ‫و‬    ‫ا‬      ‫‪ χ‬ا‬      ‫2‬
                             ‫>‬          ‫ا روءة‬    ‫‪ χ‬ا‬  ‫2‬
                                                                        ‫و‬          ‫ا‬       ‫2‪ χ‬ا‬              ‫5.61 =‬
             ‫ت واز و‬        ‫ول أن ھذه ا‬
                ‫ون ‪Hardy - Weinberg‬‬


                                                               ‫(:‬    ‫نا رن) رن ز‬                               ‫ا طر‬
                                                                ‫ت‪M‬و‪:N‬‬        ‫ب رددات ا‬                         ‫1ـ‬
                                                                       ‫ل‪:M‬‬
                                             ‫871,0 = 037 / )612 ‪p = (22 + 1/2 x‬‬
                                                                      ‫ل‪: N‬‬
                                             ‫228,0 = 037 / )612 ‪q = 492 + 1/2 x‬‬

                                                 ‫ط ا ورا :‬    ‫فا‬     ‫ظرة‬       ‫داد ا ظر ا‬           ‫با‬         ‫2ـ‬

                               ‫1,32 = 037 ‪MM = p2 x 730 = (0,178)2 x‬‬

                               ‫6,312 = 037 ‪MN = 2pq x 730 = (2 x 0,178 x 0,822) x‬‬

                               ‫2,394 = 037 ‪NN = q2 x 730 = (0,822)2 x‬‬

                                                                                                    ‫ر 2‪χ‬‬       ‫3ـا‬

        ‫380,0 = 2,394/2)2,394-294( + 6,312/2)6,312-612( + 1,32/2)1,32-22( = 2‪χ‬‬
    ‫ھ 48,3‬       ‫ا‬           ‫د أن‬       ‫ل ط %5‬        ‫ر 1=2-3=‪ ddl‬و ا‬         ‫در‬             ‫ا دول و‬         ‫ر وع إ‬

         ‫ظ وا‬        ‫ا‬       ‫إذن س ھ ك رق ن ا‬              ‫ر نا‬     ‫ا ر‬     ‫ـ 2‪χ‬‬‫و‬             ‫ا‬       ‫ظ أن ا‬
                         ‫وازن ‪.Hardy-Weinberg‬‬                 ‫را‬     ‫ن‬       ‫ا نا‬                  ‫ا ظر ، و ول أن‬

                                                                                                     ‫:‬
‫ت‬       ‫ا ورا‬   ‫نا‬       ‫ن إ ط ء رة‬                     ‫وذج ‪Hardy-Weinberg‬‬              ‫ت ن‬     ‫أ با‬
  ‫ء ت در‬      ‫رات ا ط رات و ا رة و ا‬                    ‫رم و‬        ‫د‬     ‫ت‬             ‫ا زاو‬ ‫ن ر‬       ‫اط‬
‫ل‬   ‫وذج ‪ Hardy-Weinberg‬و ن م ن ا‬                        ‫ن رددات ا ط ا ورا و‬              ‫إ داث ا ف‬         ‫ا‬
                             ‫ل اط .‬                     ‫ا‬    ‫ت ذر ن‬     ‫دة‬                ‫و ت‬    ‫ھذا ا ون و‬

             ‫ذ: و فا د‬              ‫ا‬                                                  ‫: - 641 -‬         ‫ا‬
                                                                   ‫:‬           ‫تا‬                        ‫ور ت ر ط‬
                                                ‫5(‬        ‫4 و‬              ‫ا ل. ) أ ظر ا و‬               ‫دذ‬        ‫ل أول :‬       ‫أ–‬
‫ا و ــــــــــ 5‬
                                                                                        ‫‪X‬‬        ‫ا‬             ‫ر ط‬        ‫ل ور‬       ‫4:ا‬      ‫او‬
   ‫ؤول ن ا ون‬              ‫ل‪w‬‬   ‫ن: ا‬                ‫ن‬      ‫‪X‬‬      ‫و‬    ‫ا‬       ‫ا‬
                                                                         ‫ون ا ون د ذ ا ل ور‬                 ‫ر ط‬
                                                                ‫ء. وا ل ‪ S‬د ؤول ن ا ون ا راء.‬                    ‫ا‬
‫و ن ذ ور وإ ث ذ ت ا ل.‬       ‫ت ( ددا‬    ‫طور ردد ا ط ا ورا و ردد ا‬          ‫) ص ن ن‬               ‫دا ل ص ا‬
 ‫ء‬    ‫رف ا ط رات و ا‬    ‫وازن‬         ‫د (، وأ‬      ‫‪ ) Panmixie‬زاوج‬            ‫وا د و ق ا ظ م ا‬       ‫ر أن ھذه ا‬
      ‫ا وا ‪ p‬و ‪ q‬ا ل ا ول 0‪. G‬‬         ‫ن‪S‬و‪w‬ھ‬          ‫ت، وأن رددات ا‬        ‫رة دا ط ق وا ن ا‬           ‫ا ط ، وأ‬
                                                              ‫.‬     ‫د أ راد ھذه ا‬         ‫1( أ ط ا ط ا ورا ا‬
      ‫ط ق ون ‪ Hardy – Weinberg‬د ل ن ا ذ ور‬               ‫1‪ .G‬م رن‬        ‫ا لا‬          ‫2( أ ب ردد ا ط ا ورا‬
                                                                                                      ‫وا ث.‬
                                               ‫س.‬      ‫ور ر ط‬              ‫ن ط ق ون ‪H –W‬‬                 ‫3( ذا‬
                   ‫ذ ك.‬   ‫ن. و‬   ‫و ا ر ض ا راض د ا‬                ‫د ط ق ون ‪Hardy – Weinberg‬‬                   ‫4(‬

                                                                           ‫:‬           ‫دا ل ھذه ا‬              ‫ا‬     ‫ط ا ورا‬          ‫1( ا‬
                       ‫‪w‬‬
                           ‫‪X‬‬
                                                                   ‫‪S‬‬
                                                                           ‫‪X‬‬                              ‫‪S‬‬             ‫ث:‬           ‫دا‬
                                            ‫،‬                                                                       ‫‪X‬‬
                           ‫‪X‬‬                                               ‫‪X‬‬            ‫،‬
                                                                                                                    ‫‪X‬‬
                       ‫‪w‬‬                                           ‫‪w‬‬                                      ‫‪S‬‬
                                                                   ‫‪w‬‬                                      ‫‪S‬‬
                                                                           ‫‪X‬‬                                        ‫د ا ذ ور : ‪X‬‬
                                                                           ‫‪Y‬‬            ‫،‬                           ‫‪Y‬‬

                                                               ‫‪w‬‬                                 ‫‪S‬‬
                                                                       ‫‪X‬‬           ‫،‬                     ‫و :‪X‬‬             ‫جا‬         ‫دا‬

                                                               ‫‪w‬‬                                 ‫‪S‬‬
                                ‫‪Y‬‬               ‫،‬                      ‫‪X‬‬           ‫،‬                     ‫ج ا ذ ر :‪X‬‬                  ‫دا‬

                                                                  ‫1‪: G‬‬   ‫ا لا‬       ‫2( ردد ا ط ا ورا‬
                            ‫وازن (‬                              ‫و)ا‬    ‫ت د ا ذ ور و د ا ث‬     ‫ردد ا‬
                                                        ‫1 = ‪f( w ) = q , f( S ) = p , p + q‬‬

                                                                                             ‫:‬            ‫ھذه ا‬        ‫ا زاوج‬

                                        ‫‪S‬‬                                          ‫‪w‬‬
                                                    ‫‪X‬‬                                    ‫‪X‬‬                                     ‫‪Y‬‬
                                                           ‫‪p‬‬                                         ‫‪q‬‬

                                        ‫‪S‬‬                                          ‫‪S‬‬                                  ‫‪S‬‬
                                                    ‫‪X‬‬                                    ‫‪X‬‬                                   ‫‪X‬‬
           ‫‪S‬‬
                   ‫‪X‬‬                                ‫‪X‬‬                                    ‫‪X‬‬                                   ‫‪Y‬‬
                       ‫‪p‬‬                ‫‪S‬‬                  ‫2‪p‬‬                      ‫‪w‬‬                 ‫‪pq‬‬                                   ‫‪p‬‬

                                        ‫‪S‬‬                                          ‫‪w‬‬                                 ‫‪w‬‬
                                                    ‫‪X‬‬                                    ‫‪X‬‬                                   ‫‪X‬‬
          ‫‪w‬‬
                   ‫‪X‬‬                                ‫‪X‬‬                                    ‫‪X‬‬                                   ‫‪Y‬‬
                       ‫‪q‬‬                ‫‪w‬‬                  ‫‪pq‬‬                      ‫‪w‬‬                 ‫2‪q‬‬                                   ‫‪q‬‬
                   ‫ذ: و فا د‬        ‫ا‬                                                                         ‫: - 741 -‬          ‫ا‬
                                                               ‫1‪: G‬‬        ‫دا لا‬             ‫ط ا ورا‬      ‫ردد ا‬

                               ‫د ا ث : 2‪f(XwXw) = q2 , f(XSXw) = 2pq , f(XSXS) = p‬‬
                                               ‫‪f(XwY) = q‬‬   ‫د ا ذ ور : ‪, f(XSY) = p‬‬
       ‫د ا ذ ور‬        ‫ون ‪ ، Hardy – Weinberg‬أ‬                                ‫3( د ا ث ردد ا ط ا ورا‬
                                           ‫ت.‬                         ‫وي ردد ا‬       ‫ن ردد ا ط ا ورا‬
   ‫ون -‪H‬‬                     ‫دا ث‬        ‫س، ردد ا ط ا ورا‬      ‫4( إذا ت ا ور ر ط‬
   ‫د و‪ a‬ل‬            ‫ل‬                     ‫2‬
                           ‫‪ ،W‬ث 2‪A) .f(XaXa) = q , f(XAXa) = 2pq , f(XAXA) = p‬‬
                              ‫ت.‬    ‫وي ردد ا‬     ‫د ا ذ ور ردد ا ط ا ورا‬   ‫(. أ‬

   ‫ر ن ردد‬               ‫ر ن ردد ا ظ ھر ا ر‬        ‫ل‬                      ‫ن د ر ردد ا رض‬                ‫5( د ا ذ ور‬
                          ‫(‬    ‫ا زاوج. ) أ ظر ا دول ا‬                      ‫ل‬      ‫دا ث‬                  ‫ت. أ‬     ‫ا‬

                                                       ‫أ‬                        ‫ذر‬
                           ‫ا‬                                               ‫ر‬
                                                   ‫ر‬                                 ‫ب‬
                                                                          ‫ب‬
                   ‫2‪q > q‬‬

             ‫ن‬        ‫ا ثالإ‬               ‫‪p2+2pq‬‬              ‫2‪q‬‬           ‫‪p‬‬            ‫‪q‬‬                ‫ل‬
                    ‫ا ذ ور‬
                 ‫‪p2 +2pq>p‬‬

            ‫ن‬        ‫ثأ رإ‬           ‫ا‬        ‫2‪q‬‬           ‫2‬
                                                       ‫‪p +2pq‬‬               ‫‪q‬‬            ‫‪p‬‬          ‫د‬    ‫ل‬
                    ‫ا ذ ور‬

‫ا و ــــــــــ 6‬
                                                       ‫6(‬           ‫1 و‬     ‫. ) أ ظر ا و‬           ‫ب– رن ط‬
                                                                                  ‫1: رن ط‬     ‫او‬
      ‫ل‪d‬‬        ‫ھذا ا ب ن‬     ‫‪.X‬‬     ‫ا‬     ‫ا‬  ‫و‬      ‫ب إ ر ا وان، و ق ا ر ذوذ ر ط ور‬         ‫اد و‬
                   ‫و ن أط ل، أن ردد ا ل ا ؤول ن ا رض ھو 1.0 = ‪.q‬‬       ‫د‬  ‫ردد ا د و‬  ‫. ت درا‬
                                  ‫؟‬      ‫. ذا‬   ‫ظ ور ا رض د ل ن ا ث وا ذ ور ھذه ا‬     ‫1( أ ب‬

           ‫ھو 780.0 = ‪.p‬‬         ‫د‬       ‫ؤول ن ا رض‬    ‫‪ .X‬ردد ا ل ا‬      ‫ا‬      ‫د ر ط‬   ‫‪ H‬رض ورا‬   ‫و‬                   ‫ا‬
                                         ‫؟‬     ‫. ذا‬      ‫ظ ور ا رض د ل ن ا ث وا ذ ور ھذه ا‬    ‫2( أ ب‬


                                                                                ‫ظ ور ا رض:‬                ‫ب‬       ‫1(‬

                   ‫: 10.0 = 2)1.0( = 2‪f(Xd,Xd) = q‬‬                          ‫ا‬      ‫ت‬         ‫إذا‬              ‫ون ا‬

            ‫ل : 1.0 = ‪f(Xd,Y) = q‬‬                              ‫ذ ور ون ردد ا رض و ردد ا‬
    ‫ظ ور ا رض د ا ذ ور ھ % 01،‬                                 ‫ظ ور ا رض د ا ث ھ % 1، و‬      ‫وھ ذا‬
  ‫ا ل ظ ور ا رض د ا ذ ور‬      ‫ون‬                                    ‫ل‬   ‫رض ر ط‬       ‫ن ھذا أ‬
                                                                      ‫د ا ث.‬       ‫ر‬      ‫دا‬    ‫ر‬
                   ‫ذ: و فا د‬         ‫ا‬                                                       ‫: - 841 -‬        ‫ا‬
                                                                                  ‫ظ ور ا رض :‬                  ‫ب‬            ‫2(‬

     ‫‪X‬‬      ‫ا‬           ‫ول‬         ‫د، و‬           ‫أن ا ل ا ؤول ن ا رض‬                       ‫ث:‬       ‫دا‬     ‫ردد ا رض‬
     ‫ران ‪: XHXn‬‬         ‫فا‬          ‫ا‬              ‫ا ران ) ‪ ( XHXH‬و‬                                        ‫ون‬       ‫نا‬
                                                     ‫‪f(XHXn) = 2pq‬‬                    ‫و‬      ‫2‪f(XHXH) = p‬‬                   ‫ادن‬
                                                         ‫وي ‪p2 + 2pq‬‬              ‫ث‬        ‫دا‬      ‫ن ردد ا رض‬                    ‫و‬
                                                  ‫319.0 = 780.0 – 1 = ‪q = 1 – p‬‬                           ‫1=‪p+q‬‬
                       ‫وي: 661.0 = )319.0 ‪(0.087)2 + 2(0.087 x‬‬                                      ‫ث‬     ‫دا‬    ‫ردد ا رض‬
                                               ‫% 6.61‬      ‫أي‬
                            ‫‪.X H‬‬              ‫ا‬                            ‫ون ا ذ ر‬         ‫د ا ذ ور :‬        ‫ردد ا رض‬

                                          ‫780.0 = 401 / 1 = ‪f(XHY) = p‬‬                             ‫ادن‬
                                                        ‫% 07.8‬      ‫أي‬
        ‫ظ ور ا رض د ا ذ ور ھ %‬   ‫د ا ث ھ % 6.61، و‬                                              ‫ظ ور ا رض‬   ‫وھ ذا‬
       ‫ا ل ظ ور ا رض د‬       ‫ل د ون‬     ‫رض ر ط‬                                                    ‫ن ھذا أ‬    ‫7.8،‬
                                         ‫د ا ذ ور.‬                                                 ‫ر‬      ‫ا ث ر‬

                            ‫6(‬          ‫2 و‬        ‫د ا طط. ) أ ظر ا و‬          ‫: ون ا رو‬            ‫ج– رن ز‬

‫ا و ــــــــــ 6‬                                                                          ‫د ا طط‬    ‫ون ا رو‬        ‫ل‬       ‫2:ا‬       ‫او‬
                                         ‫‪ .X‬ذه ا ور‬
                                              ‫ن:‬             ‫ا‬          ‫ون ا رو د ا طط ور ر ط‬          ‫م‬
                                           ‫ط و أ ودا رو.‬              ‫ن،‬       ‫ل ‪ Cn‬ن ن ر ب ا‬         ‫•‬
         ‫طط‬      ‫ا ظ را ر‬                       ‫ط و أ را رو.‬               ‫ن،‬       ‫ر با‬      ‫ل ‪Cj‬‬    ‫•‬
          ‫ر‬         ‫رو‬                              ‫ا دول أ :‬               ‫ا‬      ‫ا‬          ‫ن ا طط‬     ‫د‬
 ‫رو أ ر‬                   ‫رو أ ود‬                              ‫ب ل ظ ر ر .‬            ‫1( أ ط ا ط ا ورا ا‬
              ‫وا ود‬
                                             ‫ر وا ود د ا ذ ور.‬                ‫ر با ظ را ر ا‬             ‫2(‬
   ‫05‬            ‫0‬          ‫003‬     ‫ذ ور‬
                                                     ‫.‬   ‫3( أ ب ردد ا ل ‪ Cn‬و ردد ا ل ‪ Cj‬د ھذه ا‬
   ‫01‬           ‫05‬          ‫003‬      ‫إ ث‬
                                                      ‫ن ؟ ل إ ك.‬         ‫4( ھل ردد ا ل ‪ Cn‬ط ق د ا‬
 ‫ا درو .‬    ‫وى ا‬        ‫ل وا‬      ‫إذا ت ا زاو ت‬                 ‫5( أ ب ردد ا ط ت رو أ ود ا ل ا وا‬



                                                              ‫ھو :‬     ‫ر‬     ‫ب ل ظر‬                   ‫ا‬   ‫1( ا ط ا ورا‬

       ‫ر‬      ‫رو أ‬      ‫ر‬      ‫رو أ‬                      ‫رو‬          ‫رو أ ود‬              ‫رو أ ود‬
                                                                                                               ‫ا ظ را ر‬

           ‫‪Cj‬‬               ‫‪Cj‬‬                      ‫‪Cn‬‬                ‫‪Cn‬‬                   ‫‪Cn‬‬
                   ‫‪X‬‬                ‫‪X‬‬                     ‫‪X‬‬                   ‫‪X‬‬                     ‫‪X‬‬
                                                                                                               ‫ا ط ا ورا‬
                   ‫‪X‬‬                ‫‪Y‬‬                     ‫‪X‬‬                   ‫‪X‬‬                     ‫‪Y‬‬
           ‫‪Cj‬‬                                       ‫‪Cj‬‬                ‫‪Cn‬‬

                   ‫ذ: و فا د‬        ‫ا‬                                                              ‫: - 941 -‬           ‫ا‬
 ‫ن ‪ Cn‬و ‪،Cj‬‬       ‫إ ون ھذا ا ظ ر ط ب و ود‬                        ‫ا‬   ‫با ظ را ر‬     ‫2( ر‬
   ‫د‬      ‫ن‬       ‫ن أن د ا‬         ‫‪ x‬وا د، و‬                           ‫و رون إ‬ ‫ا ذ ور‬
                                                                                  ‫ا ذ ور.‬

                              ‫:‬   ‫با‬              ‫نا م‬         ‫ن ا ؤال 1‬             ‫ا‬        ‫دا‬         ‫3( ا‬

  ‫98.0= 053+)2‪q = ((300x2)+50+300)/(360x‬‬        ‫ردد ا ل ) ‪ ( Cn‬وي ‪:q‬‬
                ‫ردد ا ل ) ‪ ( Cj‬وي ‪p = 1 – q = 1 – 0.89 = 0.11 : p‬‬   ‫و‬

         ‫دا‬   ‫وا دة‬        ‫]‪ ،[Cn‬و‬    ‫ن دا‬         ‫ن ا ل ‪ Cn‬و ود‬        ‫4(‬
                   ‫وا دة ن ا ل ‪.Cn‬‬           ‫]‪ ،[Cn,Cj‬أ ا ذ ور ]‪ [Cn‬و رون‬
          ‫ن ردد ا ل ‪ Cn‬د ا ث ھو : 09.0 = )2‪((300x2)+50))/(360x‬‬           ‫و‬
                                ‫و ردد ا ل ‪ Cn‬د ا ذ ور ھو : 68.0 = 053/003‬
‫أ وي‬     ‫ب ن‬       ‫دوث إ‬    ‫ط ت رو أ ود ا ل ا وا إ‬          ‫ول‬  ‫5( ر ا‬
                                     ‫ل ‪ Cn‬وآ ر ذ ر ل س ا ل.‬         ‫ل‬
 ‫ردد س ا ل د ا ذ ور ھو 68.0، و‬         ‫م أن ردد ا ل ‪ Cn‬د ا ث ھو 9.0،‬
                         ‫ا ط و ھ % 4.77 = 001 ‪0.90 x 0.86 x‬‬          ‫نا‬

                                                                      ‫:‬           ‫‪ – V‬وا ل ر ا‬
                                              ‫:‬          ‫ا ظ را ر‬               ‫ا ط رات و را‬
                                                                    ‫ض ا ط رات.‬    ‫أ–أ‬
  ‫6(.‬   ‫3 و‬     ‫ا ل د ل آ ف )ا ور ت أ ظر ا و‬                     ‫دذ‬     ‫ر ط ل ا ط ا در‬

    ‫ظ رط ر‬                        ‫ا و ــــــــــ 6‬                        ‫ا ل‬     ‫دذ‬         ‫3 : ط رة ورا‬       ‫او‬
  ‫در 3‪T‬‬    ‫ط‬      ‫ظ ر و ش‬
    ‫ظ ر 2‪T‬‬         ‫) دي(‬
                                            ‫در 2‪T‬‬    ‫ا‬   ‫ا ط‬


                                    ‫3‪T‬‬       ‫ا در‬        ‫ا ط‬
                  ‫رن ا وازن‬                                                                     ‫أ‬       ‫ل ر‬     ‫ذ‬



   ‫ل ر‬         ‫ط ذ‬     ‫در 2‪،T‬‬       ‫ا‬       ‫در 3‪ T‬ظ ر ا ط‬            ‫ا‬     ‫ذا ط‬          ‫ت‬          ‫ضا‬
                                                                                                      ‫.‬         ‫أ‬
         ‫ور ت‬         ‫س‬                 ‫ا‬       ‫ن ورام ل رات ا‬     ‫با د دا‬
                                  ‫د .‬         ‫ل ھذه ا ط رات إ ا ف: إ ط رات‬ ‫ا رة، و‬
            ‫‪.Leucisme‬‬              ‫ط رة ورا‬              ‫ضإ‬     ‫دا را‬      ‫ب ا ون رو‬                      ‫ر‬

  ‫ت د دة‬       ‫ن ن ظ ور‬            ‫ر ا ورا ،‬ ‫در‬                    ‫أن ا ط رات ھ‬ ‫ن ن ھذه ا‬
        ‫.‬       ‫د دة دا ل ا‬       ‫ن ظ ور ظ ھر ر‬                  ‫ت ا ط رة، ون ؤو‬


         ‫ذ: و فا د‬      ‫ا‬                                                       ‫: - 051 -‬           ‫ا‬
                                                          ‫ب – ر ف ا ط رة :‬
             ‫ز‬    ‫و د‬  ‫ا‬     ‫وى ا‬          ‫ب ا دة ا ورا‬            ‫ر ورا‬     ‫ا ط رة ھ‬
     ‫راد‬       ‫لا ر‬   ‫ر ا رو ت م دد ا‬           ‫ا ورا و‬    ‫را ر‬        ‫‪ ،ADN‬ؤدي إ‬
                                                                              ‫.‬     ‫ا‬
       ‫ا ورا ، ل ا ط رة إ‬    ‫با‬              ‫ا م،‬       ‫ف‬     ‫ب ا ط رات‬      ‫ن أن‬
                                  ‫م ن ط رة ورا ) ‪.( Mutation génétique‬‬         ‫ا ف،‬

                                                               ‫ج – أ واع ا ط رات .‬
                                                             ‫د و ن ن ا ط رات ا ورا :‬
                                                                 ‫:‬       ‫‪ – a‬ا ط رات ا‬
  ‫أو‬               ‫ن ور أو ور‬      ‫ب ط‬   ‫ت، و ن أن‬        ‫أو دد ا‬           ‫رات ورا‬    ‫ھ‬
                   ‫ا و 4 و 6.‬          ‫ا‬     ‫ف أ واع ا ط رات ا‬         ‫دة ور ت. رف‬
‫ا و ــــــــــ 6‬
                                                                                  ‫4 : ا ط رات ا‬        ‫او‬
 ‫‪c‬‬
 ‫‪b‬‬
 ‫‪a‬‬                  ‫‪a‬‬




                                                                                               ‫‪c‬‬
                                                                                               ‫‪b‬‬
                                                                                               ‫‪a‬‬
                                            ‫‪c‬‬           ‫‪a‬‬                 ‫‪c‬‬                    ‫‪c‬‬
                                            ‫‪b‬‬           ‫‪b‬‬                 ‫‪b‬‬                    ‫‪b‬‬
                                            ‫‪a‬‬           ‫‪c‬‬                 ‫‪a‬‬                    ‫‪a‬‬




                                                                ‫ت:‬            ‫ر دد ا‬
                                                             ‫‪.Aneuploïdie‬‬                          ‫إ‬
                                                      ‫ت ‪.Polyploïdie‬‬     ‫دد ا‬
                                                             ‫‪.Monoploïdie‬‬                  ‫ع‬
                                                                  ‫:‬         ‫ا‬  ‫ر‬
                          ‫ع ور ت (.‬    ‫ر ت)‬        ‫ون‬      ‫، و‬            ‫ع ط نا‬
                              ‫.‬     ‫ور‬     ‫، ا ء ا ذي ز د دد‬            ‫ط نا‬
                                  ‫ر ب ا ور ت.‬    ‫ر‬      ‫، ؤدي إ‬          ‫ا ب ط نا‬
                                           ‫ن.‬     ‫ن ر‬         ‫ن‬            ‫دل ط ن ا‬

                   ‫ذ: و فا د‬   ‫ا‬                                      ‫: - 151 -‬        ‫ا‬
                                      (7      ‫1 و‬          ‫ ( ) أ ظر ا و‬Ponctuelle ) :                    ‫ – ا ط رات ا و‬b
7 ‫ا و ــــــــــ‬
                                                                                                              ‫1: ا ط رات ا و‬             ‫او‬

   ‫و د‬      .HbA ‫ن وا ط ا ل‬
              ‫رأ‬               ‫ ( د ا‬β – globuline ) ‫ب ا د وي ا دي‬    ‫ا‬
                  .‫ن‬ ‫راض ر ط ر ا دم د ا‬           ‫ت ا ط رة ا‬     ‫نا‬   ‫و‬
،β – globuline ‫ر ا و ( ور‬          ‫)ا‬      ‫ت‬         ‫تا و و د أ‬       ‫لا‬
                                          . ‫ر زإ‬      ‫ا‬     ‫ضا‬      ‫ا‬    ‫و‬

   .‫ا رو ن‬                  ‫رھ‬         ‫ و ر‬β – globuline ‫ب ور‬         ‫1( رن ن أ واع ا ط رات ا‬
                     .‫ب‬                  ‫ا دول أ‬    ‫ن ل‬       ‫ف أ ف ا ط رات ا و‬        ‫2( رف‬
                            .         ‫ت و دد ا ظ ھر ا ر‬  ‫دد ا‬          ‫3( أ رز أھ ا ط رات ا و‬


                                                                                                                                ‫ا ور ا د‬
CAC    CTG     ACT    CCT      GAG    GAG    AAG    TCT    GCC    GTT    ACT    GCC     CTG     TGG     GGC     AAG    GTG
                                                                                                                                 HbA
                                                                                                                              ‫ا رو ن ا دي‬
His    Leu     Thr    Pro      Glu     Glu   Lys    Ser    Ala    Val    Thr    Ala     Leu     Thp     Gly     Lys     Val
                                                                                                                                 HbA

                                                                                                                                ‫ا لاط ر‬
CAT    CTG    ACT     CCT   GAG       GAG    AAG    TCT    GCC    GTT    ACT    GCC     CTG     TGG     GGC    AAG     GTG
                                                                                                                                  Hba1
His   Leu     Thr     Pro   Glu       Glu    Lys    Ser    Ala    Val    Thr    Ala     Leu    Thp      Gly     Lys    Val HbA ‫ا رو ن‬


                                                                                                                                ‫لاط ر‬     ‫ا‬
CAC    CTG     ACT    CCT      GTG    GAG    AAG    TCT    GCC    GTT    ACT    GCC     CTG     TGG     GGC     AAG    GTG
                                                                                                                                  HbS
His    Leu     Thr    Pro      Val     Glu   Lys    Ser    Ala    Val    Thr    Ala     Leu     Thp     Gly     Lys     Val HbS ‫ا رو ن‬


                                                                                                                                 ‫لاط ر‬        ‫ا‬
CAC    CTG     ACT    CCT       AAG    GAG    AAG    TCT    GCC    GTT    ACT    GCC     CTG     TGG      GGC     AAG     GTG
                                                                                                                                  HbC
                                                                                                                                  ‫ا رو ن‬
His    Leu     Thr    Pro       Lys    Glu    Lys    Ser    Ala    Val    Thr    Ala     Leu     Thp      Gly     Lys     Val
                                                                                                                                   HbC

                                                                                                                                ‫ا لاط ر‬
CAT    CTG     ACT    CCT       GAG    GAG    AAG    TCT    GCC    GTT    ACT    GCC      CTG     TAG    GGC     AAG     GTG
                                                                                                                                  Tha2
                                                                                                                                 ‫ا رو ن‬
His    Leu     Thr    Pro       Glu    Glu    Lys    Ser    Ala    Val    Thr     Ala    Leu
                                                                                                                                  Tha2

                          -A


                                                                                                                                ‫ا لاط ر‬
CAC    CTG    ACT     CCT   GGG       AGA    AGT    CTG    CCG    TTA    CTG    CCC     TGT     GGG     GCA     AGG     TGA
                                                                                                                                  Tha3
His    Leu    Thr     Pro      Glu    Arg    Ser    Leu    Pro    Leu    Leu    Pro     Cys     Gly     Ala     Arg           Tha3 ‫ا رو ن‬

                                             +C


CAC    CTG     ACT    CCT      GAG    GAG    AAG    CTC    TGC    CGT    TAC    TGC     CCT     GTG     GGG     CAA     GGT     ‫ل اط ر‬     ‫ا‬
                                                                                                                                  Tha4

His    Leu     Thr    Pro      Glu     Glu   Lys    Lru    Cys    Arg    Tyr    Cys     Pro     Val     Gly     Gln     Gly Tha4 ‫ا رو ن‬




                     ‫ذ: و فا د‬           ‫ا‬                                                            - 152 - :           ‫ا‬
                 ‫دة‬     ‫أو ذف‬                    ‫ب ور ‪ β – globuline‬ا دال أو إ‬        ‫ا ط رات ا‬    ‫1(‬
                      ‫وف ر ب‬                  ‫ا ورا . و ؤدي إ‬        ‫ر راءة ا‬ ‫ازو ، ا ء ا ذي ؤدي إ‬
                                               ‫.‬          ‫ن ذ ك أ را‬       ‫ف.‬ ‫ا رو ن، أو ر ب رو ن‬

         ‫ا و ــــــــــ 7‬
                                                                                                                                                    ‫ا دول :‬               ‫2(‬
                      ‫ف ا ط رة‬                          ‫وى ا رو ن‬                                ‫ا‬               ‫ل‬       ‫وى ا‬                  ‫ر‬     ‫وع ا‬             ‫ل‬     ‫ا‬
                          ‫ط رة‬                                                                                   ‫دال ‪ C‬ـ‬        ‫رى ) ا‬         ‫دة‬    ‫دال‬      ‫ا‬
                                                                                         ‫ء‬                                                                            ‫1‪Hba‬‬
                  ‫‪Silencieuse‬‬                                                                                                                               ‫‪(T‬‬
          ‫ا ط ‪Faux sens‬‬       ‫ا‬
                                                                  ‫ر‬                ‫ضأ‬    ‫دال‬         ‫ا‬       ‫41 : ‪ A‬ـ ‪T‬‬              ‫دة ا زو‬        ‫دال ا‬     ‫ا‬       ‫‪HbS‬‬
                                                                                                                  ‫31 : ‪ G‬ـ‬           ‫دة ا زو‬        ‫دال ا‬  ‫ا‬
         ‫‪Faux sens‬‬              ‫ا ط‬             ‫ا‬                 ‫ر‬                ‫ضأ‬    ‫دال‬         ‫ا‬                                                                ‫‪HbC‬‬
                                                                                                                                                          ‫‪A‬‬
                                                                                                                  ‫14 : ‪ G‬ـ‬           ‫دة ا زو‬        ‫ا دال ا‬
         ‫‪Non sens‬‬                         ‫دون‬           ‫دال‬           ‫ا‬    ‫و‬        ‫و ف ا راءة‬                                                                        ‫2‪Tha‬‬
                                                                                                                                                          ‫‪A‬‬
                                                              ‫ر طور ا راءة : ا دال‬
         ‫‪Frame – shift‬‬                    ‫ع‬                     ‫د و‬        ‫ضا‬      ‫ا‬                                 ‫41 ) ‪( A‬‬         ‫دة ا زو‬        ‫عا‬               ‫3‪Tha‬‬
                                                                             ‫دال‬   ‫ا‬
         ‫‪Frame – shift‬‬                          ‫إ‬
                                                                               ‫ر طور ا راءة‬                          ‫22 ) ‪( C‬‬         ‫دة ا زو‬        ‫ا‬        ‫إ‬       ‫4‪Tha‬‬


          ‫دا ل‬            ‫ر ا ورا‬         ‫در ا‬            ‫ت د دة، و ذ ك د‬   ‫3( ا ط رة ھ ظ ھرة ن ن ظ ور‬
                                                        ‫د دة.‬  ‫ؤو ن ظ ور أ ط ورا‬     ‫و‬    ‫اط‬      ‫ا‬
             ‫8.‬           ‫1 و‬            ‫. أ ظر ا و‬                       ‫ت دا ل ا‬               ‫ا ط رات و ردد ا‬                           ‫ن‬                  ‫د–ا‬
‫ا و ــــــــــ 8‬                                                                                             ‫.‬                  ‫وى ا‬       ‫ا‬        ‫ر ا ط رات‬          ‫1:‬           ‫او‬
                                     ‫ل‬   ‫ظ ور ا‬
                      ‫‪a‬‬    ‫‪a‬‬                                                   ‫‪a‬‬    ‫‪a‬‬
         ‫‪a‬‬       ‫‪a‬‬                     ‫‪ a‬وا ط‬                 ‫‪a‬‬           ‫‪a‬‬                                  ‫ور‬                        ‫ا ط رات ا‬                      ‫ط ا دول أ‬
‫‪A‬‬     ‫‪a‬‬                     ‫‪A‬‬        ‫‪ A‬ط رة ‪a‬‬                 ‫‪a‬‬                      ‫‪A‬‬       ‫‪a‬‬                                           ‫.‬       ‫ت‬                     ‫د أر‬
                      ‫‪A‬‬    ‫‪a‬‬                                                   ‫‪A‬‬    ‫‪a‬‬                                                                                    ‫ظ؟‬    ‫ذا‬
       ‫‪A‬‬         ‫‪a‬‬                                            ‫‪A‬‬           ‫‪a‬‬                                              ‫ر ا ط رات‬         ‫ري‬     ‫وذج‬                   ‫ط ار مأ‬
‫‪a‬‬     ‫‪a‬‬                    ‫‪A‬‬         ‫‪a‬‬                  ‫‪A‬‬     ‫‪A‬‬                      ‫‪a‬‬       ‫‪a‬‬                       ‫.‬      ‫ل ما‬         ‫. أ م ھذا ا‬                       ‫ا وى ا‬
                      ‫‪A‬‬    ‫‪A‬‬                                                  ‫‪A‬‬     ‫‪A‬‬                    ‫ل‬       ‫ا ط رة ا‬                                                                ‫ا‬
             ‫‪A‬‬        ‫‪A‬‬                                           ‫‪A‬‬           ‫‪A‬‬
                                                                                                                 ‫9-01 . 5.2‬                                                     ‫ا‬
                                                                                                                  ‫8-01 . 2‬                     ‫ر ‪Escherichia Coli‬‬
‫…..………… = ‪f(A) = p‬‬                             ‫.……..……… = ‪f(A) = p‬‬                                               ‫4-01 . 9.2‬                                     ‫ا ذرة‬
‫…..………… = ‪f(a) = q‬‬                              ‫.……..……… = ‪f(a) = q‬‬
                                                                                                                 ‫5-01 . 6.2‬                                  ‫ذ ا ل‬

         ‫وا ط ا ط رات‬                            ‫ت دا ل ا‬                      ‫ر ردد ا‬           ‫دا، ن‬                            ‫ا ط رات‬   ‫ظ أن‬
    ‫دد‬                                        ‫دودة، ر أ‬                           ‫نأ‬               ‫ل ا رة ا‬                       ‫دا‬      ‫ررة ون‬                                ‫ا‬
                                                                                                                                               ‫ل.‬                               ‫ا‬
             ‫ا ط رة ن ‪ A‬و ‪ a‬ص‬    ‫ا ط رة ن ل‬      ‫دد‬                                                                               ‫ون ا ط رات د ، و‬
             ‫ا ط رة ن ‪ A‬و ‪ a‬ص ا ط رة ن ‪a‬‬    ‫ا ط رة ھ‬                                                                            ‫ن ‪ a‬و ‪).A‬‬        ‫ا ط رة ا‬
                                                                                                                                                 ‫و‪.(A‬‬
          ‫ر ا ورا‬              ‫درا‬            ‫ت د دة، و د ذ ك‬                            ‫ن ن ظ ور‬                           ‫أن ا ط رة ھ ظ ھرة‬
                                                                                                                                       ‫.‬      ‫دا ل ا‬
                          ‫ذ: و فا د‬                 ‫ا‬                                                                                    ‫: - 351 -‬                ‫ا‬
                                                                ‫‪.La sélection naturelle‬‬                             ‫ءاط‬         ‫ا‬
‫ا و ــــــــــ 8‬                                              ‫ء ا ط . أ ظر ا و 2 و 8‬                                ‫وم ا‬    ‫أ–‬
                         ‫ء‬     ‫ا‬           ‫أ رز ا وا ل ا د‬          ‫ھذه ا و‬        ‫ل‬     ‫رج ن‬    ‫ا‬         ‫ءاط‬       ‫2 : ض ظ ھر ا‬        ‫او‬
                                                                                                ‫اط‬




      ‫ن‬  ‫و‬          ‫م ء‬      ‫را ركا‬                         ‫ب–ا‬
       ‫رد .‬      ‫ط ا ورا‬ ‫ر ط‬    ‫تا‬                         ‫ا‬
  ‫ز ر ش د ذ ر ا ط ووس (‬      ‫راض زاھ‬                       ‫)ا‬                 ‫ة‬   ‫ء دا‬    ‫ا‬            ‫ت ا ؤھ ت‬        ‫فا‬       ‫س‬   ‫أ-‬


                        ‫ن طرف ‪ Hardy – weinberg‬دة ن وا ا‬                                        ‫ر‬       ‫ا‬       ‫ا‬          ‫تا‬        ‫د‬
                        ‫ا ش.‬     ‫إ ط ء ف در‬         ‫ا درة‬                                           ‫أ راد ھذه ا‬            ‫، س‬       ‫اط‬
           ‫ف‬             ‫س‬            ‫وا ت و‬              ‫راس‬             ‫وم ا وا ت ا ر‬                              ‫ل 1 : دا ل‬
                                     ‫ا ش(‬                             ‫د ا ة.) ا درة ا‬   ‫ء‬                            ‫ت ا ؤھ ت‬            ‫ا‬
                             ‫رد.‬           ‫ط ا ورا‬            ‫ت ر ط‬                    ‫ر ط‬              ‫را ركا‬             ‫ل2:ا‬
                                                                                       ‫زواج (‬              ‫را‬              ‫)ا‬
          ‫ل ھو‬      ‫لأ‬         ‫ا وا د‬  ‫ا شو‬       ‫أن أ در ا راد‬     ‫ج: ن نا ط تا‬                                                    ‫ا‬
  ‫ر‬                ‫رب‬         ‫ل ا وا ، ا ء ا ذي‬              ‫ل‬       ‫ھم ا ل ا وى ا‬                                                  ‫ا ذي‬
                             ‫ء اط .‬       ‫ل‬     ‫ت را‬        ‫ر ردد ا‬      ‫.‬     ‫ا ورا‬                                                ‫ا‬

‫ا و ــــــــــ 8‬                                   ‫8‬        ‫3 و‬          ‫. أ ظر ا و‬           ‫ءاط‬           ‫ل‬          ‫ب – درا‬
                                                                    ‫3 : ر ردد أر ا در ب ا ون‬             ‫او‬
      ‫ر‬ ‫ا‬     ‫ر‬         ‫أر ا در ‪ Biston betularia‬را‬
‫ت‬    ‫. ن د ذك أ‬     ‫ا رى ذه ا را ت ذات ون‬            ‫ر، ت ا‬         ‫ف ا رن ا‬        ‫ا را وإ‬     ‫ن ا در.‬     ‫أ‬
         ‫أ ر ا را ا ر ف.‬        ‫ظ ت ا را ت ذات ا ون ا‬     ‫،‬      ‫ا را ت ذات ا ون ا دا ن أ ر رددا رب ا طق ا‬
  ‫ن: ط‬        ‫ط ن‬         ‫ء وأط‬     ‫ن را ت ا ر ا وداء وا‬       ‫و‬     ‫م‬    ‫5591 م ا ث ‪Kettlewell‬‬
‫‪Mélanisme‬‬           ‫زم ا‬      ‫ل ا وث ) ا‬        ‫ن دا‬    ‫أ ر ذات أ‬         ‫وي‬       ‫ر ھم ‪ Birmingham‬ا‬
‫ب ب‬          ‫ا ط دھ ن د د‬       ‫أ ر ر و . دذك ل‬               ‫وي‬       ‫‪ ،( industrielle‬و ط دو ‪ Doset‬ا‬
                                                                    ‫ھذه ا درا :‬          ‫رددھ . ص ا دول أ‬
                                                             ‫ھذه ا را ؟‬         ‫ص وز‬         ‫ظ‬     ‫ذا‬   ‫1(‬
   ‫ك ن طرف ض ا ط ور.‬        ‫ل ن ا ط ن ا درو ن إذا ت أن ھذه ا را ت‬            ‫را ردد ا را ن‬        ‫2( أو د‬



      ‫ھم‬    ‫ر‬                  ‫دو‬

                   ‫دا‬                 ‫دا‬
                                               ‫ت‬    ‫را‬    ‫دد ا‬
      ‫46‬     ‫451‬         ‫694‬        ‫474‬
                                            ‫ررة‬    ‫وا‬       ‫ا و و‬
                                               ‫ت‬    ‫را‬    ‫دد ا‬
      ‫61‬        ‫28‬       ‫26‬         ‫03‬
                                            ‫ط دة‬     ‫ا‬      ‫ا و و‬
      ‫%‬      ‫%‬    ‫%‬                 ‫%‬          ‫ت‬   ‫را‬    ‫ا‬
      ‫52‬    ‫5.21 2.35‬               ‫3.6‬     ‫ط دة‬     ‫ا‬      ‫ا و و‬
                        ‫ذ: و فا د‬            ‫ا‬                                                              ‫: - 451 -‬       ‫ا‬
         ‫أ ر ن ردد ا را ت‬    ‫ون ردد ا را ت ا‬                                   ‫را و‬          ‫ط دو‬     ‫ظ‬     ‫1(‬
           ‫ون ردد ا را ت ا دا أ ر ن ردد‬                                        ‫ر ھم ا‬        ‫ط‬       ‫ا دا .‬
                                                                                               ‫.‬  ‫ا را ت ا‬
                           ‫ر :‬        ‫ر ا ط ور ا‬        ‫نا ط ن‬                 ‫2( ر ا ف ردد ا ظ ھر ا ر‬
‫ا و ــــــــــ 9‬                                                                      ‫أ ظر ا و 1 و 9‬
                                                                                                                            ‫1‬       ‫او‬




            ‫ل رؤ ا را ت ا‬                     ‫ل نا‬         ‫،‬    ‫ر دا‬      ‫ت ذوع ا‬ ‫أ‬      ‫ا ط ا‬
                                                 ‫رة.‬           ‫راس‬        ‫ا ون ن طرف ا ط ور ا ر ، رض‬
           ‫ر‬       ‫ا ط ور ا‬           ‫ل‬        ‫، ون ن ا‬   ‫ر‬               ‫ت ذوع ا‬              ‫را‬     ‫ا ط‬
                                              ‫أ ر.‬    ‫راس‬               ‫رض ھذه ا‬         ‫رؤ ا را ت ا دا ، وھذا‬
   ‫ل‬     ‫ود إذن وز ا را ت ھذه ا طق إ ا ف ؤھ ت ا ء د ھذه ا را ت، وھو‬
       ‫ا ء‬    ‫ن ون د م ا ل أ ر‬      ‫ء ا ط . ث أن أ رادا ظ ر ورا‬ ‫ن وا ل ا‬
                                      ‫ل ا وا .‬          ‫ل ور م ل‬        ‫و‬

‫ا و ــــــــــ 9‬                  ‫9‬   ‫2 و‬          ‫ت. أ ظر ا و‬         ‫ردد ا‬            ‫ءاط‬               ‫ر‬       ‫ج–‬
                                                                   ‫ت د أر ا در‬    ‫ردد ا‬    ‫ء‬   ‫2: را‬     ‫او‬
        ‫ا دا ن‬     ‫ن:ا ظ را ر‬                  ‫ون را ا ر‬   ‫م‬
                                              ‫‪.c‬‬     ‫ر وز وا ط ا ل ا‬    ‫ر وز وا ط ا ل ا د ‪ .C‬وا ظ ر ا ر ا‬
                       ‫.‬      ‫ل 001‬           ‫ر ‪Manchester‬‬           ‫أر ا در ا ط ا‬         ‫ردد‬   ‫ط ا نأ‬
                                                        ‫.‬    ‫ت ھذه ا‬   ‫ردد ا‬     ‫ءاط‬     ‫را‬      ‫ل ا ن وا‬
 ‫00,1‬
 ‫09,0‬
        ‫ا ردد‬




 ‫08,0‬

 ‫07,0‬
 ‫06,0‬                                                                                                         ‫ل ‪ C‬ـــــــــــــــ‬   ‫ا‬
 ‫05,0‬
 ‫04,0‬                                                                                                         ‫ل‪----- c‬‬              ‫ا‬
 ‫03,0‬

 ‫02,0‬
 ‫01,0‬
 ‫00,0‬
    ‫8481‬                   ‫8681‬                 ‫8881‬           ‫8091‬             ‫8291‬
                                                                                       ‫وات‬     ‫ا‬   ‫8491‬




  ‫أن‬      ‫،إ‬         ‫‪ c‬ا ذي ر ز ظ ر ا‬        ‫ردد ا ل ا‬     ‫ا ض در‬    ‫ا ط ا‬
          ‫ل‬        ‫زد د ردد ا‬        ‫ردد ا ل ا‬   ‫ن‬     ‫ل وض ھذا ا‬  ‫8491.‬       ‫ا دم‬
                            ‫1 ) 1 = ‪.( p‬‬    ‫ا د ‪ C‬ا ذي و ا ظ ر ا ر ا دا ن، إ أن ا‬
                    ‫ذ: و فا د‬             ‫ا‬                                                   ‫: - 551 -‬              ‫ا‬
         ‫ل،‬   ‫وا ا‬                                           ‫ت‬                     ‫ردد ا‬                             ‫ؤر‬             ‫ء اط‬   ‫ظ ت أن ظ ھرة ا‬ ‫ن ھذه ا‬
        ‫ن ص أ رى‬                                                   ‫،‬                   ‫ا ء‬                                      ‫راد ا‬    ‫ت ط‬         ‫ضا‬     ‫رو‬    ‫وذك‬
                                                                                                                ‫.‬                  ‫ا ورا‬  ‫ن ل ھذا ر ا‬         ‫و رض. و‬

‫ا و ــــــــــ 9‬                                                                                                                ‫9‬       ‫3 و‬          ‫. أ ظر ا و‬                       ‫ا‬                 ‫د–ا‬
                                                                                                                                                                                                              ‫ا‬   ‫3:ا‬         ‫او‬

                    ‫إ ا ل ا وا . و ز ن:‬      ‫ل‬        ‫)‪ (Valeur sélective‬ر ن درة رد ن‬      ‫ا‬                                                                                                                                   ‫ا‬
           ‫م ا دل ل رد ل ذا ا ط ا ورا ،‬       ‫ن : ھ دد ا راد ا ذ ن‬ ‫ط ورا‬   ‫ا ط‬      ‫ا‬    ‫• ا‬
                          ‫:‬  ‫ا‬          ‫م إ ا ل ا وا . و ن ا ر‬      ‫ل‬    ‫ا شو‬      ‫وا در ن‬

                                             ‫ل 1‪G‬‬               ‫دا‬                 ‫ا ط ا ورا‬
                                            ‫ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ‬   ‫=‬   ‫ا ط‬             ‫ا‬      ‫ا‬
                                             ‫ل 0‪G‬‬               ‫دا‬                 ‫ا ط ا ورا‬

         ‫ط ا ورا ا رى،‬                                                      ‫ط .أ‬                                    ‫ا‬            ‫ذو أ‬        ‫1 ط ا ورا‬                  ‫: ط ا‬              ‫ا‬              ‫ا‬       ‫ا‬       ‫•‬
        ‫.‬   ‫ط ا ورا ا ر ار‬                                                ‫ا ط‬    ‫ا‬                                   ‫ا‬          ‫و‬               ‫ط ا ورا ا‬                 ‫ا ط‬                  ‫ا‬        ‫وي ا‬

               ‫:‬               ‫لا‬           ‫ا‬                          ‫ءت ا‬                 ‫د ن‬                   ‫ر ن‬                   ‫وا‬          ‫ء دد ل ن ا را ت ا‬                              ‫مإ‬                 ‫ط‬

                                                                                                  ‫ا را ت‬                                ‫دد ا را ت‬                   ‫دد ا را ت‬
                       ‫ا‬            ‫ا‬                                ‫ا‬              ‫ا‬
                                                                                                 ‫ا ش‬      ‫ا درة‬                               ‫ة‬             ‫ا‬       ‫دا‬   ‫ة‬    ‫ا‬
                           ‫ا‬                                        ‫ا ط‬
                                                                                                    ‫وا وا د‬                                 ‫ا درا‬                       ‫ا درا‬
                                                                                                                                              ‫61‬                              ‫46‬                           ‫ا را ت ا‬

                                                                                                                                              ‫28‬                             ‫451‬                        ‫ا را ت ا دا‬

    ‫،‬              ‫ا‬       ‫ھذه ا ط‬                                 ‫وا دا‬                    ‫ا‬         ‫ل ن ا را‬                          ‫با ما‬        ‫ه، أ‬       ‫أ‬        ‫او‬          ‫ا ر ف ا در‬    ‫دك‬
                                                                                                                                                       ‫.‬            ‫ل‬         ‫ا‬       ‫ا‬    ‫ا دول، م ق‬                         ‫وا‬

        ‫إ ا ل ا وا ، دو أن‬    ‫ل‬   ‫ر ن درة رد ن‬    ‫ا‬                                                                                                                                                ‫ا‬        ‫ا‬   ‫ء‬
                   ‫.‬     ‫إ ا ف ا ط ا‬      ‫ل‬    ‫درة رة‬                                                                                                                                                   ‫ا را ت ا دا‬
‫ا و ــــــــــ 01‬                                                                                       ‫01.‬                 ‫1 و‬             ‫. أ ظر ا و‬              ‫ءاط‬              ‫ھـ – أ واع ا‬
                       ‫ا‬                ‫ا‬        ‫وز‬           ‫ط‬          ‫ا‬                  ‫، وا‬                    ‫ا ظ ھر دا ل‬         ‫ا وا ل وز‬                       ‫لا‬             ‫ءاط‬               ‫1: أ واع ا‬           ‫او‬
                                                                     ‫ا ردد‬
‫ا ردد‬




                                                                                                                                    ‫ا ردد‬




                                                                                                                                                                                   ‫ا ردد‬




                       ‫أ‬                                                                ‫ھ‬           ‫ءا‬                ‫ا‬                        ‫ت‬     ‫ءا‬         ‫ا‬                                  ‫دي‬     ‫ءا‬          ‫ا‬

          ‫وز‬                    ‫لا‬                                ‫.......................... .......................... ..........................‬
               ‫ط دا ل ا‬                      ‫ا‬                    ‫.......................... .......................... ..........................‬
                                                                  ‫.......................... .......................... ..........................‬
                                                                            ‫.......‬                    ‫.......‬                    ‫.......‬
          ‫دي.‬                   ‫ت أو‬                         ‫ھ ، أو‬                         ‫ا‬               ‫ء اط‬                ‫ب وع ا‬                          ‫دا ل ا‬              ‫وزع ا ظ ھر ا ر‬
                                ‫ذ: و فا د‬                                     ‫ا‬                                                                                               ‫: - 651 -‬                   ‫ا‬
                                                                               ‫‪:Dérive génétique‬‬                       ‫راف ا‬         ‫ا‬
‫ا و ــــــــــ 01‬                                                ‫01.‬   ‫2 و‬       ‫. أ ظر ا و‬       ‫راف ا‬            ‫وم ا‬        ‫أ–‬
‫‪ ،Les Huttérites‬ق‬    ‫د‬    ‫لاد و‬     ‫ر ط ردد ا‬  ‫م ‪ Steinberg‬درا‬       ‫وم ا راف ا‬                                                      ‫2:‬  ‫او‬
‫ن‬      ‫ث ون‬       ‫0881 إ أ ر ا‬      ‫دي » ‪ ، « Secte‬ھ ر ن و را إ رو و ن م ل‬                                                              ‫ا ر‬
‫و ل إ ‪Steinberg‬‬    ‫ا‬   ‫ا‬   ‫ن دا. ل ا ل أ ن ا و‬     ‫‪ Docota‬و ‪ Montana‬و أ زاء ر‬                                                       ‫رات‬   ‫ا‬

                                 ‫لأ‬   ‫ا‬                                                      ‫؟‬     ‫رن ن ط ت ا دول. ذا‬          ‫1(‬
          ‫‪A‬‬                  ‫‪O‬‬                      ‫اد و‬        ‫ا‬               ‫‪Les Huttérites‬‬            ‫ا ورا‬  ‫ر ‪ Steinberg‬ا‬
                                                      ‫د أ راد ا‬                   ‫. رف ھذه ا ظ ھرة‬     ‫ا راف ا‬       ‫ظ ھرة‬      ‫ر‬
       ‫% 54‬           ‫رب % 92‬
                                                     ‫ا دي‬                       ‫ر‬        ‫، وا ذي ل وذ‬      ‫رح ك ا ر م ا ط ط أ‬
    ‫% 03 - %‬                                      ‫ت‬    ‫دأ با‬                                                           ‫ذه ا ظ ھرة.‬
                          ‫وق % 04‬
       ‫04‬                                           ‫ا ور وا ر‬
                                                                                ‫ت.‬     ‫ھذه ا‬      ‫ف ا ظ ھر ا ر‬     ‫أ ب ردد‬                 ‫2(‬
                                                ‫.‬  ‫راف ا‬                     ‫ظ ھرة ا‬              ‫و‬    ‫ط ت ھذه ا و‬      ‫ق‬                  ‫3(‬
 ‫=]‪[a‬‬               ‫=]‪[A‬‬          ‫‪. Les Huttérites‬‬     ‫د‬                           ‫ا‬   ‫ا ورا‬   ‫وء ھذه ا ط ت ر أ ل ا‬                        ‫4(‬

                                      ‫...…… = ]‪f[A‬‬                                                                                 ‫…… = ]‪f[A‬‬
                                                                                                                                   ‫...…………‬
                                          ‫....................‬
                                                                                                                                   ‫…… = ]‪f[a‬‬
                                                    ‫ن‬                                                                              ‫..…………‬
                                                                 ‫ا‬     ‫…………… = ]‪f[A‬‬
                                                 ‫وا د‬
                                                                       ‫…………… = ]‪f[a‬‬                    ‫1‬       ‫ؤ‬

                                                                         ‫د‬       ‫ن‬             ‫طور ا‬

                                                    ‫ن‬                  ‫…………… = ]‪f[A‬‬
                                                                 ‫ا‬                                                                 ‫…… = ]‪f[A‬‬
                                                                       ‫…………… = ]‪f[a‬‬
                                                 ‫وا د‬                                                                              ‫...…………‬

                                                                                                                                   ‫…… = ]‪f[a‬‬
                                      ‫...…… = ]‪f[a‬‬
                                                                                                                                   ‫..…………‬
                                          ‫....................‬
      ‫م‬   ‫رة ا‬      ‫أ ل‬                                                                                    ‫2‬   ‫ؤ‬



         ‫ت ا ور‬                  ‫ن اد و ن ‪A‬و ‪ O‬ن أ ب ا‬        ‫ا‬           ‫1( ھ ك ا ف وا‬
       ‫اد و ‪O‬‬                  ‫ا دي، ث د د ھذا ا ر ردد ا‬          ‫و ن أ راد ا‬     ‫وا ر‬
                                                    ‫اد و ‪ A‬ر .‬            ‫ض و ردد ا‬
          ‫وا ر‬            ‫ت ا ور‬      ‫ا‬  ‫ف ن‬     ‫‪Les huttérites‬‬         ‫ن ھذا أن‬
                                                             ‫(.‬ ‫س ا وى ا‬           ‫) س‬
                                                                                                                   ‫.‬      ‫2( أ ظر ا و‬
         ‫ن ر‬    ‫، و ظرا‬   ‫ا‬       ‫رة ن ا‬        ‫و‬    ‫1 ن ھ رة‬        ‫تا‬                                                             ‫3( ا‬
  ‫نا ظ ر‬     ‫و رد ن ط‬       ‫ت ھذه ا‬      ‫د ( ‪Echantillonnage aléatoire‬‬                                                             ‫)‬
     ‫. د‬      ‫ا‬      ‫ا‬  ‫ر‬           ‫ذه ا‬  ‫ا ورا‬    ‫ب را ا‬           ‫و ش‬                                                             ‫ا‬
      ‫ا ط رة دث إ ء ا ظ ر ا و ش ا ل ا‬              ‫ا زاوج ن أ راد ل ا‬                                                              ‫و‬
                                                      ‫.‬     ‫تا ظ را‬
                    ‫ذ: و فا د‬               ‫ا‬                                                              ‫: - 751 -‬           ‫ا‬
          ‫ذا‬                ‫.و‬    ‫أ‬    ‫رة ا ط ت ن‬     ‫ت‬     ‫‪ Les huttérites‬ن‬    ‫4( و دت‬
                             ‫ف ن ا وى ا‬          ‫وى‬       ‫و‬    ‫ت ھذه ا‬       ‫ا نا ر‬
                                ‫.‬    ‫ر‬   ‫ت ظرا‬      ‫ردد ا‬    ‫ت‬      ‫ا ل ر ت د ذك‬

‫ا و ــــــــــ 11‬
                            ‫11.‬          ‫1 و‬                 ‫. أ ظر ا و‬                       ‫وى ا‬        ‫ا‬        ‫راف‬           ‫ر ظ ھرة ا‬           ‫ب–‬
                                                                                                                                                            ‫1:‬        ‫او‬
          ‫ل‪a‬‬        ‫ردد ا‬
                                                                  ‫ل‪a‬‬        ‫تا‬
‫1‬                                                                                                 ‫دام ظ م ا و ت،‬                   ‫ة‬    ‫أ ،‬               ‫ط ار ما‬
                                                                                                  ‫رة‬  ‫ت‬     ‫د ث‬                  ‫ت ل دة أ ل،‬                ‫ب ردد ا‬
‫8.0‬                                                                    ‫1‬              ‫ا‬                                                                          ‫ا م.‬

‫6.0‬                                                                                                           ‫ن؟‬     ‫ھذا ا‬         ‫ر‬        ‫ھ ا ظ ھرة ا‬           ‫1(‬
                                                                   ‫2‬              ‫ا‬
‫4.0‬                                                                                               ‫ل ھذا ا ن، أ رز ظ ھر ھذه ا ظ ھرة،‬                  ‫ن ل‬          ‫2(‬
                                                                                                                 ‫.‬         ‫ا ورا‬  ‫ا‬                   ‫و رھ‬
‫2.0‬                                                          ‫3‬         ‫ا‬
                                                                             ‫ل‬            ‫ا‬
                                                                                                              ‫ن، وا و ت ا د‬              ‫ل ط تا‬            ‫ن‬      ‫3(‬
‫0‬
      ‫0‬                 ‫5‬                ‫01‬                  ‫51‬   ‫ل‪a‬‬       ‫ءا‬             ‫إ‬           ‫.‬        ‫ظ ھرة ا راف ا‬            ‫،أ ط ر‬             ‫ا‬     ‫او‬



          ‫ن‬      ‫نا‬      ‫ن 0 و1 ا ن‬   ‫ت ا ث ل وا‬           ‫1( ب ردد ا ل ‪ a‬ا‬
               ‫أو آ وھ :‬        ‫ن‬    ‫ن دان‬    ‫ل ل. وھ ذا و د و‬       ‫ا د ن ردد‬
 ‫1.‬            ‫ا‬    ‫ت ا ل ‪:( q = 1 ) a‬‬     ‫3.‬     ‫ا‬     ‫إ ء ا ل ‪:( q = 0 ) a‬‬

                                                                                              ‫.‬       ‫راف ا‬              ‫وم ا‬       ‫:‬           ‫ج–‬
      ‫ؤدى‬               ‫ر‬        ‫ل‬       ‫ن‬                        ‫ردد ا‬
                                                             ‫ت دا ل‬         ‫إ ا ت ا وا‬           ‫ر ا راف ا‬
                                                                       ‫.‬      ‫دا ل ا‬     ‫لا‬    ‫إ ا ض دد ا‬
                                                                     ‫رة.‬      ‫تا‬      ‫دا ل ا‬    ‫دث ا راف ا‬
        ‫ت‬               ‫ا‬        ‫د ،‬                  ‫ء ا ط ، ل ود‬         ‫ر ا و ط، و‬        ‫ا راف ا‬
      ‫ا ل‬                       ‫تأ ر‬                    ‫ون ض ا‬       ‫ا وا د، و‬      ‫ا راد درون‬      ‫س‬      ‫اط‬
                                                                                                       ‫ا وا .‬

                                                                                                                         ‫رة ‪:La migration‬‬                  ‫ا‬
               ‫11‬               ‫2 و‬           ‫ه ‪ .Unidirectionnelle‬أ ظر ا و‬                                        ‫د ا‬          ‫رة ا‬    ‫ا‬        ‫أ–‬
 ‫ا و ــــــــــ 11‬
                                                                        ‫ه‬      ‫2 : ا رة ا د ا‬  ‫او‬
‫ن‬         ‫ن ل رد‬   ‫ري ا ذي ظل دا ا و ت ا دة ا ر‬       ‫زا‬    ‫ظرا‬
        ‫ت ا ه وا د ن ا ض و ا ود.‬     ‫ا وداء. و ذا م ل ا‬     ‫إ ا‬       ‫‪ ( Métis‬د‬           ‫ط)‬  ‫زواج‬
‫ط ور ردد ا ل ‪ Ro‬ظ م‬     ‫3591 درا‬   ‫ا وداء، م ‪ Gauss‬و ‪Li‬‬           ‫ا ورا‬      ‫ا‬    ‫رف ر ھ ذه ا رة‬
                       ‫ھذه ا درا .‬     ‫ا لأ ناو‬       ‫. و ص ا دول‬        ‫ر زوس ) ‪ ( Rhésus‬د ھذه ا‬
                                                                                                                     ‫.‬          ‫ط ت ا دول م ا‬        ‫رن ن‬        ‫1(‬
       ‫ل ب ن ھذه‬            ‫ا‬        ‫ل‬       ‫ھو‬         ‫ه،‬       ‫د ا‬       ‫رة ا‬           ‫ك وذج ا‬            ‫رأ لا‬
                                                                                                              ‫رح‬    ‫ود أ ر ،‬                 ‫ا ورا‬
                                                                                                                ‫او .‬
    ‫ا ز رة‬          ‫د‬       ‫ن‪A‬و‪a‬‬              ‫ا ل ج ن ا و ، أ ب ا د ق ا ري ‪ m‬و ردد ا‬       ‫لا و تا د‬            ‫2(‬
                                                                                                     ‫د ا رة.‬
                     ‫ا ز رة ؟‬                   ‫ا ورا‬   ‫صا‬           ‫رة، ذا‬    ‫ا رة ل‬          ‫ا ورا‬    ‫أن ا‬    ‫3(‬
                                                                     ‫ود أ ر ؟‬        ‫ا ورا‬   ‫4( ف ر إذن أ ل ا‬

                     ‫ذ: و فا د‬                    ‫ا‬                                                                               ‫: - 851 -‬           ‫ا‬
                          ‫لج‬        ‫ا‬                                                                          ‫لأ‬        ‫ا‬
      ‫ر ن ا ذ ن د ون‬          ‫ا د ق ا ري ‪ : m‬ھو‬
                               ‫ا‬                                               ‫ل‬     ‫ردد ا‬
                                                                                                              ‫ا ــــــ ــــــ ــــــــــــــــ ت‬
     ‫ب ط قا د ا‬              ‫ل‬‫ل، و‬           ‫ا‬    ‫ا‬                                 ‫‪Ro‬‬
                               ‫)‪m=n/(N+n‬‬                                                                  ‫ت‬  ‫ا وداء )ا‬        ‫ا‬      ‫دا‬
   ‫ر ن.‬    ‫، ‪ = n‬دد ا‬       ‫ا‬       ‫‪ = N‬دد أ راد ا‬                                 ‫36.0‬
                                                                                                                      ‫أ ل ا د(‬        ‫ا ر‬
‫ب ردد ل ن د ا رة ط ق‬              ‫‪ m‬ن‬          ‫نا‬                                                   ‫3591 د رة أ ل‬          ‫ا وداء‬       ‫ا‬
                 ‫‪p1=(1-m)p0=mpm‬‬             ‫ا د ا‬                                  ‫644.0‬
                                                                                                                         ‫ن ھدة ا د.‬
  ‫ا رة. و 0‪ p‬ردد‬       ‫ل ‪ : pm‬ردد ا ل ا د‬                                                                 ‫ء و ت ا دة‬          ‫ا‬      ‫دا‬
             ‫ا ز رة ل ا رة.‬        ‫ا لا د د‬                                        ‫820.0‬             ‫م ر ذ‬        ‫أورو ا‬        ‫و‬    ‫ا ر‬
                                                                                                                                  ‫ا رن 81‬
                                                              ‫ن(‬        ‫ا ز رة ) ‪N‬‬                                                                 ‫لب‬   ‫ا‬
       ‫ا رة‬                              ‫ت‬     ‫ردد ا‬
                                        ‫ا رة :‬                      ‫‪AA‬‬      ‫‪Aa‬‬
                                                                                      ‫‪aa‬‬                     ‫ت ا ل 0‪G‬‬          ‫ردد ا‬
                                   ‫7.0 = ‪f(A) = pm‬‬
     ‫‪Aa AA Aa‬‬                                                                                              ‫ا ز رة : 4.0 = 0‪f(A) = p‬‬
                                   ‫3.0 = ‪f(a) = qm‬‬            ‫‪aa‬‬    ‫‪aa‬‬      ‫‪Aa‬‬
                         ‫‪AA‬‬                                                              ‫‪Aa‬‬                ‫6.0 = 0‪f(a) = q‬‬
  ‫‪aa‬‬      ‫‪Aa‬‬
                ‫‪Aa‬‬                                                 ‫‪AA‬‬     ‫‪Aa‬‬        ‫‪aa‬‬
                          ‫‪AA‬‬
‫‪AA AA‬‬
               ‫‪AA AA‬‬                                                                           ‫‪Aa‬‬         ‫‪AA‬‬
                              ‫‪AA‬‬
‫‪AA‬‬        ‫‪Aa‬‬                                                                                                        ‫‪aa‬‬
                ‫‪Aa AA‬‬                                ‫ر‬         ‫‪n‬‬                         ‫‪AA‬‬    ‫‪aa‬‬     ‫‪AA‬‬
     ‫‪Aa‬‬                                                                                                                         ‫ت‬     ‫ردد ا‬
                                                                                                              ‫‪aa‬‬
‫‪aa‬‬           ‫‪Aa aa‬‬                                       ‫‪AA‬‬                                   ‫‪aa‬‬     ‫‪Aa‬‬
                                                                                                                     ‫‪Aa‬‬         ‫ا ل 1‪G‬‬
                                                ‫‪AA‬‬
       ‫‪AA‬‬                                                     ‫‪Aa‬‬
                                                                                    ‫‪Aa‬‬                                            ‫د ا رة:‬
               ‫‪AA‬‬                                    ‫‪AA‬‬
                                                                                                               ‫‪AA‬‬
  ‫‪Aa‬‬        ‫‪AA‬‬                                                                                 ‫‪Aa‬‬     ‫‪AA‬‬                     ‫...…… = 1‪f(A) = p‬‬
                                                                                                                             ‫...…… = 1‪f(a) = q‬‬


      ‫ا ر‬            ‫ا‬         ‫ر‬              ‫ض‬               ‫ر‬  ‫ا وداء‬    ‫ظ أن ردد ا ل 0‪ R‬د ا‬     ‫1(‬
     ‫ف د‬         ‫م‬             ‫وأن‬            ‫ء ر‬             ‫ا‬    ‫أ ل ا د. وأن ردد ھذا ا ل ذر د ا‬
                                                                          ‫أورو أ ل ض أ ر .‬
                ‫ا ورا‬          ‫ا‬              ‫رت،‬    ‫د‬         ‫ا وداء ر‬        ‫ا ورا‬  ‫ن ھذا أن ا‬
                                                                                         ‫ء م ر.‬      ‫ا‬
                               ‫‪n‬‬                            ‫4‬
                     ‫ري ‪ = 0.28 :m‬ــــــــــــــــــــــــ = ـــــــــــــــــــــ = ‪m‬‬                             ‫با دقا‬                          ‫2(‬
                           ‫)‪(N+n‬‬                   ‫) 01 + 4 (‬

                          ‫ا ز رة د ا رة ھو 1‪:f(A) = p‬‬        ‫ب ردد ا ل ‪ A‬د‬
                          ‫‪f(A) = p1 = ( 1 – m ) p0 + mpm‬‬
                                    ‫) 7.0 ‪= ( 1 – 0.28 ) x 0.4 + ( 0.28 x‬‬
                                   ‫484.0 =‬
                                        ‫84.0 = 1‪f(A) = p‬‬

                                   ‫ا ز رة د ا رة : 1‪f(a) = q‬‬       ‫ب ردد ا ل ‪ a‬د‬
  ‫1 = 1‪p1 + q‬‬                      ‫‪f(a) = q1 = ( 1 – m ) q0 + mqm‬‬
                                        ‫) 3.0 ‪= ( 1 – 0.28 ) x 0.6 + ( 0.28 x‬‬
                                        ‫615.0 =‬
                                     ‫25.0 = 1‪f(a) = q‬‬

                ‫ذ: و فا د‬                 ‫ا‬                                                                        ‫: - 951 -‬               ‫ا‬
      ‫ھذا‬         ‫رة‬       ‫ا ز رة د ا رة. إذا ا رت ا‬      ‫د‬                          ‫ل‪A‬‬         ‫ردد ا‬   ‫ظ ار ع‬    ‫3(‬
                           ‫ا رة.‬         ‫ا ورا‬ ‫ا ز رة و ا‬                                     ‫ا ورا‬   ‫ا‬    ‫ا وال،‬

              ‫ا وداء أ ر ظ ھرة ا رة. ك د ق ھ ري‬           ‫ا ورا‬  ‫4( ر ر ا‬
            ‫ت‬     ‫را‬     ‫ھذا‬   ‫.و ء‬      ‫ه ن ا ض و ا ود دون ھ رة‬    ‫أ دي ا‬
                     ‫أ ل ا رة.‬      ‫ا وداء دون ر ا ر ب ا ورا‬           ‫ا ورا‬

           ‫21.‬      ‫1 و‬        ‫ھ ت ‪ .Multidirectionnelle‬أ ظر ا و‬                     ‫ددة ا‬       ‫رة ا‬       ‫ا‬       ‫ب–‬
 ‫ا و ــــــــــ 21‬
                             ‫ل "ب"‬    ‫ا‬                                      ‫ل"أ"‬         ‫ا‬                                  ‫1‬    ‫او‬
                                                                                                                                        ‫:‬
           ‫ل‪A‬‬     ‫ردد ا‬
                                                                                 ‫1‬                          ‫وذج‬    ‫ل"أ"‬        ‫لا‬
‫0.1‬
                                                                                                            ‫ھت‬     ‫د ق ھ ري دد ا‬
                                                                                                    ‫2‬
‫8.0‬                                                                                                         ‫ت ط ن‬          ‫س‬     ‫ن‬
‫6.0‬                                                                                                         ‫.‬      ‫س ز رات أر‬
                                                                     ‫5‬
                                                                                                            ‫و ل ا ل "ب" طور ردد‬
‫4.0‬
                                                                                                            ‫ت‬      ‫ل ‪ A‬دى ھ ذه ا‬
‫2.0‬                                                                                                         ‫ر ھ ذه‬      ‫ت‬    ‫س‬      ‫ا‬
                                                          ‫ل‬    ‫ا‬
                                                                             ‫4‬
                                                                                                ‫3‬           ‫ل‬    ‫نا‬       ‫رة. ل‬     ‫ا‬
       ‫0‬          ‫01‬          ‫02‬          ‫03‬            ‫04‬                                                              ‫.‬    ‫"ب" م ا‬

  ‫ھو )‪f(A‬‬         ‫ن ا ردد‬       ‫ت،‬
                               ‫دا‬       ‫ف ن ھذه ا‬          ‫ن ردد ا ل ‪ A‬د‬      ‫ا دا‬
                    ‫ھو 0 = )‪.f(A‬‬           ‫ھو 5.0 = )‪ f(A‬و د ا‬          ‫1 =، و د ا‬
         ‫تا‬    ‫ل، دأت ص ا‬        ‫رور ا‬      ‫ھ ت، و‬      ‫ت ر ا د ق ا ري ا دد ا‬
   ‫رك ل دل‬           ‫إ ردد‬      ‫ت، ت‬            ‫ف ھذه ا‬      ‫ن‬     ‫ت در‬    ‫ردد ا‬
                                       ‫ت ) 5.0 = )‪.( f(A‬‬        ‫ت د ھذه ا‬       ‫ردد ا‬
  ‫ت وا د‬    ‫سا‬    ‫ھ ت ط ورا ؤدي إ‬            ‫إذن دث ت ر ا د ق ا ري ا دد ا‬
                                                                          ‫ن و .‬

                                                                                         ‫وم ا وع ‪: L'espèce‬‬                 ‫‪– VI‬‬
            ‫زة‬     ‫را‬         ‫وع، و ا‬                    ‫ذا‬    ‫ن س ا وع،‬                 ‫وع ا راد ا‬             ‫ھ‬          ‫تا‬    ‫إذا‬
                                                                                                                                   ‫؟‬
                                                                                              ‫ر ا زة وع‬    ‫أ–ا‬
                  ‫: ‪Morphologiques , Comportemental‬‬                          ‫و‬       ‫وا‬       ‫را ر وو‬   ‫‪–a‬ا‬

            ‫ز وع ن‬            ‫ر ن‬             ‫ن ھذا ا‬         ‫أي د‬       ‫ل، ن إ‬      ‫ا‬                 ‫لا‬ ‫ر ا ور و و‬
                                                                                                        ‫آ ر؟‬
                 ‫ل، ر‬      ‫ت: را‬     ‫س‬                              ‫وب رق آ و وزع‬            ‫را ر‬     ‫ل1 :‬
                         ‫ر .‬    ‫ص روو‬                               ‫ت‬    ‫، ر ا ن. ذه ا‬       ‫ر ، را دا‬
                               ‫س ا وع.‬                                ‫نا بإ أ‬          ‫ت روو‬    ‫ل2 : ھ ك ا‬
             ‫ن‬         ‫و‬         ‫ف‬                                 ‫روو‬         ‫ن دة أ واع‬       ‫ل3 : ط ر ا‬
                                                                           ‫را و .‬         ‫ر ا زة ل وع‬      ‫ا‬

                                                                                                        ‫21.‬     ‫2 و‬        ‫أ ظر ا و‬

                          ‫ذ: و فا د‬       ‫ا‬                                                             ‫: - 061 -‬      ‫ا‬
‫ا و ــــــــــ 21‬
      ‫ف‬                  ‫ر وو‬                    ‫ن دة أ واع د‬      ‫‪ La grive‬ط ر ن س " ‪" Catharus‬‬     ‫ا‬                                   ‫2‬       ‫او‬
  ‫أ واع ن ھذا‬         ‫ت أر‬          ‫ض‬              ‫ر( ا زة ل وع. و ط ا دول ا‬     ‫ت )ا‬    ‫نا‬    ‫و‬
                                                                                    ‫.‬    ‫ا ط ر طن أ ر ا‬
                                                              ‫ف ھذه ا ط ور.‬  ‫دة‬   ‫تا‬    ‫ل ھذه ا ط ت ن ا‬                              ‫ل‬       ‫ن‬




    ‫‪Catharus‬‬                        ‫‪Catharus‬‬                       ‫‪Catharus‬‬                  ‫‪Catharus‬‬
                                                                                                                            ‫ت‬        ‫ا‬
    ‫‪minimus‬‬                         ‫‪ustulatus‬‬                      ‫‪guttatus‬‬                ‫‪fuscescens‬‬
  ‫تا ور ر‬                                                                                  ‫رة ذات‬     ‫أراض‬
                                ‫روط ت‬                ‫تا‬        ‫روط ت‬         ‫را‬    ‫أ‬                                    ‫ن ا زواج‬
     ‫ا و‬                                                                                      ‫أد ل وا رة‬
                                                                                               ‫ا ر و‬
           ‫ا ر‬                  ‫ر‬        ‫ا‬                             ‫ا ر‬                                              ‫د‬       ‫نا‬       ‫أ‬
                                                                                                ‫ر‬     ‫ا‬
      ‫ر‬       ‫ا‬                     ‫ر‬            ‫ا‬                     ‫وق ا ر‬                   ‫وق ا ر‬                  ‫ءا ش‬
           ‫و ود‬                         ‫دم‬                             ‫دم‬                        ‫دم‬                 ‫ء أ ء ا ط ران‬


                                                           ‫د د ا وع.‬                   ‫ر ا ر وو‬      ‫ور ا‬                   ‫ن ن ھذه ا‬
                                                             ‫( : ‪Ecologique‬‬                ‫را وو )ا‬      ‫‪–b‬ا‬
           ‫،‬         ‫وا‬         ‫وا د‬         ‫وا وك ا ذا‬                      ‫زة‬             ‫ص‬        ‫و ر أ راد وع ن‬
                                                                                         ‫.‬   ‫رة إ‬ ‫ا د ج دا ل‬   ‫د‬
                              ‫21‬        ‫3 و‬               ‫: ‪ Morphologique‬أ ظر ا و‬                 ‫را زوو‬            ‫‪–c‬ا‬

          ‫ا و ــــــــــ 21‬                                                       ‫3:‬    ‫او‬
                                ‫ب‬        ‫ط رح 2‪CO‬‬            ‫ط ا دول ا‬
                                ‫س‬           ‫نإ‬     ‫رارة ا و ط ن ط رف و ن ن ا ط ور‬       ‫در‬
                                ‫ر‬       ‫(. ن ل ط ت ھ ذا ا دول دد ا‬      ‫‪ ) Emberiza‬ا ور أ‬
                                                         ‫ز و ط ر ا ر ور.‬      ‫د‬    ‫ا‬     ‫ا‬
                              ‫‪Emberiza‬‬                                            ‫‪Emberiza‬‬
                              ‫‪hortulana‬‬                                           ‫‪citrinella‬‬




                               ‫ر ور أرط ن‬                                          ‫ر‬     ‫ر ور أ‬

                                   ‫51 52‬              ‫50‬       ‫0‬    ‫5-‬                   ‫رارة ا و ط ) ° (‬
                                                                                           ‫‪C‬‬                   ‫در‬
                                                                                    ‫‪Eberiza‬‬       ‫2‪CO‬‬
                                   ‫70 50‬              ‫90‬    ‫5.01‬    ‫11‬
                                                                                  ‫‪hortulata‬‬       ‫ا طروح‬
                                                                                  ‫‪Emberiza‬‬        ‫ب‬
                                ‫60 5.4‬                ‫70‬    ‫5.70‬    ‫80‬
                                                                                   ‫‪citrinella‬‬     ‫‪(mg/mg)/h‬‬

            ‫رارة‬          ‫ب در‬          ‫طرح 2‪CO‬‬                    ‫ف ن ث‬                            ‫ط ور ا ر ور ر و و‬
                                        ‫ط ر ا ر ور‬                 ‫ن نا ز ن و‬                          ‫ر زوو‬     ‫ا و ط، وھذا‬
                    ‫ذ: و فا د‬                ‫ا‬                                                              ‫: - 161 -‬            ‫ا‬
                  ‫: ‪Biochimique Et génétique‬‬                 ‫وورا‬          ‫را و‬        ‫‪–d‬ا‬
                                                                              ‫21‬      ‫4 و‬            ‫أ ظر ا و‬
                      ‫ا و ــــــــــ 21‬
                                                                                                ‫4:‬    ‫او‬
                  ‫د‬      ‫ن ا درا ت‬      ‫و‬        ‫، أ زت‬       ‫دل ‪ Salamandre‬وان ر‬          ‫ا‬
                         ‫ن ن‬           ‫رو ن‬      ‫ل ا رو و را‬       ‫ا‬         ‫ا ز ن أ وا . ط ا دول أ‬
                       ‫ت ا را زة ل رو ن د ل وع.‬         ‫ن د د دد و ردد ا‬     ‫دل. ت ھذه ا درا‬     ‫أ واع ن ا‬
                                                                         ‫ت.‬    ‫ر ا م ن و ن ن ردد ا‬
                                   ‫دل.‬    ‫ز ھذه ا واع ن ا‬      ‫ر ا ذي ا د‬   ‫صا‬        ‫رن ن ھذه ا ط ت وا‬
                                           ‫‪Triton‬‬
                               ‫‪Triton‬‬                     ‫‪Triton‬‬
                                           ‫-‪marmo‬‬
                              ‫‪vulgaris‬‬                   ‫‪alpestris‬‬        ‫ا رو ن‬                ‫ا ور‬
                                            ‫‪ratus‬‬
                                                          ‫3‪(0.2) a‬‬                       ‫دد ‪a‬‬
                                  ‫6‪(1) a‬‬      ‫2‪(1) a‬‬                       ‫از ل‬
                                                          ‫4‪(0.8) a‬‬                       ‫ت7‬          ‫ا‬
                                                          ‫1‪(0.1) b‬‬
                                                         ‫3‪(0.55) b‬‬        ‫‪Lactose‬‬
                                                                                         ‫دد ‪b‬‬
                                  ‫1‪(1) b‬‬      ‫7‪(1)b‬‬                       ‫-‪déshyd‬‬
                                                                          ‫‪déshyd‬‬
                                                                                         ‫ت7‬          ‫ا‬
                                                         ‫4‪(0.35) b‬‬       ‫‪rogenase‬‬



‫إذن‬        ‫دل.‬   ‫ف د ل وع ن أ واع ا‬                    ‫ت ا را زة رو ن‬       ‫ظ أن دد و ردد ا‬
                              ‫ز ا واع.‬                  ‫د‬  ‫ن أن‬      ‫وا ورا‬        ‫أن ا ر ا و‬
                                                       ‫: ‪La fécondité‬‬     ‫و‬    ‫را‬  ‫‪–e‬‬
      ‫ز ا وع.‬     ‫دة‬          ‫ا‬      ‫ر ا وو‬       ‫ب ن أھم ا‬          ‫ف‬    ‫ا زاوج إ ط ء‬                    ‫إن‬
                                                                            ‫ب – ر ف ا وع :‬
       ‫، أو ون درة‬                 ‫زوا‬          ‫زاوج‬  ‫ت اط‬ ‫ا‬                  ‫وع ا‬   ‫ون ا وع ن‬
                                         ‫.‬             ‫تا‬‫رى ا‬              ‫نا‬         ‫ذ ك، وا زو‬
       ‫، زوو ،‬        ‫، را‬         ‫ت ا ر : روو‬      ‫نا‬    ‫و‬                  ‫ن أ راد س ا وع‬
      ‫نا ز ن‬            ‫نا‬           ‫با‬    ‫ب ا دل وا ف ا‬                   ‫، وورا . و د ا‬     ‫و‬
                                                                                            ‫وع.‬




            ‫ذ: و فا د‬        ‫ا‬                                               ‫: - 261 -‬           ‫ا‬
                                                                        ‫ا و دة ا‬
                                    ‫ﻋﻠﻢ اﻟﻤﻨﺎﻋﺔ .‬
                                                                 ‫ـــــ م :‬        ‫ـــ ـــ‬
‫ن ھ ذه‬         ‫، و ل ا را م زءا ھ‬   ‫رأ‬         ‫دة‬    ‫ء‬   ‫و ط‬    ‫رار‬     ‫ن‬   ‫شا‬
             ‫ت‬      ‫إ ا م إ ردود ل د ا‬              ‫را‬     ‫ر. ؤدي د ول ض ا‬        ‫ا‬
                 ‫‪. Son intégrité‬‬  ‫م د ع ن‬      ‫ا‬     ‫‪ ،Les réponses immunitaires‬وم‬




                                               ‫:‬     ‫تا‬       ‫ن طرح ا‬        ‫نھ‬        ‫اط‬

              ‫؟ ) ‪( Le soi et le non soi‬‬‫ف ز ا م ن ھو ذا و ھو ر ذا‬                    ‫1(‬
                                           ‫ا م ا ه ھو ر ذا ؟‬          ‫ھ ا‬            ‫2(‬
         ‫؟‬        ‫تا‬      ‫ا‬        ‫را د‬     ‫فا‬    ‫ھو وع ا وا ل ا ذي ر ط ن‬            ‫3(‬
         ‫د‬          ‫طرا ت ا‬     ‫را‬    ‫ن‬       ‫ا‬     ‫إ أي د ن ر آ ت ا‬                 ‫4(‬
                                           ‫ا رب.‬       ‫وضا زا‬          ‫ا ر‬




                ‫ذ: و فا د‬   ‫ا‬                                  ‫: - 361 -‬      ‫ا‬
                                                                                    ‫ل ا ول‬          ‫ا‬
                            ‫ﺗﻌﺮف اﻟﺠﺴﻢ ﻣﺎ ﻫﻮ ذاﺗﻲ وﻣﺎ ﻫﻮ ﻏﻴﺮ ذاﺗﻲ .‬
      ‫ھذه‬               ‫م‬           ‫رف ا‬                 ‫ف‬             ‫ما ر‬            ‫دا‬               ‫د‬       ‫د : وم ا م ردود أ ل ط‬
                                                                      ‫ھو ذا ؟‬         ‫زھ ن‬              ‫و‬    ‫ر ا ر أو ا ر ا ذا‬   ‫ا‬

                                                                                       ‫:‬            ‫ؤم ن ا‬              ‫نا‬               ‫ر‬       ‫فا‬          ‫‪–Ι‬ا‬
                                                                                                                             ‫رب و ظ ت:‬                       ‫1‬
 ‫ا و ــــــــــ 1‬                                                 ‫1‬        ‫2 و‬        ‫1 او‬         ‫ن: أ ظر ا و‬              ‫أ– ط ما د دا‬
                                                                                                                                ‫ن‬       ‫دا‬     ‫1: ط ما د‬           ‫او‬
                                                                          ‫دي ن ط ‪ A‬و ق ‪،B‬‬           ‫ط م‬          ‫نأ‬      ‫دا‬     ‫ظتا رر‬        ‫تا‬
                                                                            ‫د ) ا ل 1 (، إ‬            ‫ه‬    ‫ل دو ر‬           ‫و دا ل ا ط م روق د و‬
                                                                                                        ‫أ د ر د 21 و ) ر ض ا ط م ( ) ا ل 2 (.‬
                                                                                               ‫را رد ل ا م ا ه ا ط م.‬        ‫ل ھذه ا ط ت م ا رح‬
      ‫لب‬        ‫ا‬                           ‫لأ‬       ‫ا‬

 ‫د‬                  ‫رف‬              ‫م‬        ‫أن ا‬                 ‫ن ن ا و 1 و 1 أن ا ط م ر ض د 21 و ، ھذا‬                                                    ‫•‬
 ‫ا و ــــــــــ 1‬
                                                                             ‫را ر ذا .‬    ‫ره‬   ‫س ا م،‬
                                                                                                             ‫:‬          ‫ت‬           ‫ءاط م‬            ‫2 : طور‬           ‫او‬
           ‫ءاط م‬            ‫%‬
                                                                                               ‫د‬    ‫روق‬        ‫أ ب ث أط ل‬    ‫د ا ط م ا در‬    ‫د‬
‫001‬                                                           ‫1‬             ‫ا‬
                                                                                                     ‫:‬          ‫ت ا را ا‬  ‫ت أ زت ا‬     ‫ھذه ا‬                            ‫و‬
‫08‬                                                            ‫2‬             ‫ا‬                ‫1(.‬            ‫د أ ا وأم ) ا‬    ‫ط ل ا ول م ط‬                               ‫-‬
‫06‬                                                                                            ‫2(.‬             ‫دأ دأو )ا‬      ‫م ط‬     ‫طلا‬                                ‫-‬
‫04‬                                                                                  ‫ر ط ط ل أي را‬            ‫د ص رع‬          ‫طلا ث م ط‬                                  ‫-‬
                                                                                                                                             ‫و .‬                        ‫د‬
‫02‬              ‫3‬               ‫ا‬
  ‫0‬                                                                   ‫وات‬       ‫ا‬                  ‫ول أو ر ض ا ط م ؟‬   ‫د ون ا ل ا دد‬                              ‫1(‬
            ‫1‬       ‫2‬       ‫3‬       ‫4‬       ‫5‬    ‫6‬        ‫7‬       ‫8‬                                                ‫ظت؟‬   ‫ن ھذه ا‬     ‫ذا‬                           ‫2(‬


      ‫ون‬            ‫د‬      ‫ول ا ط م )‪ (Greffon‬ل إ % 001‬     ‫• ن ن ا و 2 و 1 أن‬
                         ‫إ أن دم‬    ‫ض ھذه ا‬       ‫،‬     ‫ھ ك را د و و ن ا ط وا‬
                                                          ‫.‬    ‫ب ا را ن ا ط وا‬
  ‫ل اد و ،‬                          ‫رار ا‬     ‫‪groupes tissulaires‬‬                                                 ‫ل‬         ‫و ود‬               ‫و ھذه ا‬
                                       ‫د ا ط م، أي ھ ا ددة ذا .‬                                                  ‫ؤم ا‬       ‫دد دى‬                ‫أي و ود ھ ا‬

 ‫ا و ــــــــــ 1‬                                                               ‫3 و 1.‬         ‫د ا ر: أ ظر ا و‬               ‫رب ا ط م‬               ‫ب–‬
           ‫.‬            ‫، ما‬            ‫ر‬       ‫ط تا‬          ‫د ا ران. أول ھذه ا‬        ‫ف‬      ‫وا ط م ا‬          ‫رب ا ط م ا ذا‬               ‫ط ھذه ا و‬       ‫3:‬        ‫او‬
                                                                          ‫لب‬                                                                                      ‫لأ‬
                                                         ‫ط م ذا‬                                                         ‫طم‬
                                                                                      ‫رضاط م‬                                             ‫ف‬        ‫ط م‬
      ‫ول ا ط م‬                          ‫د‬                                                                          ‫د‬
                                         ‫أ‬                                                                          ‫أ‬


                                                 ‫طو ق‬                 ‫ر‬                                                     ‫ق‬       ‫ر‬                    ‫ط‬    ‫ر‬
                         ‫ذ: و فا د‬                        ‫ا‬                                                                     ‫: - 461 -‬            ‫ا‬
‫م م ول ا ط م، ن إذا ن‬                        ‫ھو س ا‬        ‫ا ط م د ا ر أ إذا ن ا ط وا‬                  ‫ن ر‬
        ‫)ا‬       ‫ھذه ا‬                      ‫م ر ض ا ط م. و‬      ‫ن،‬     ‫ن‬     ‫ن‬                       ‫ا ط وا‬
                                                       ‫‪.réponse immunitaire‬‬     ‫ا‬                     ‫ا ر ض( ا‬
                                 ‫.‬        ‫ط وا‬       ‫ا دة ا ورا‬   ‫ول أو ر ض ا ط م ق ط‬                 ‫أن‬

‫ا و ــــــــــ 1‬                              ‫4 و 1.‬      ‫ل ا د و : أ ظر ا و‬         ‫ؤم ن ا‬          ‫ج–ا‬
                                                                          ‫لاد و‬    ‫ؤم ن ا‬    ‫ف نا‬        ‫4:ا‬    ‫او‬
                                                   ‫ن دم‬    ‫ن ‪ Landois‬و‪ Muller‬أن ط دم ا‬       ‫3781 ن ا‬
                                                   ‫ا ما د‬        ‫ن ا ردة أط ق‬     ‫ون د ت ظ ر‬      ‫وان ؤدي إ‬
                                                                                                ‫أ ظر ا ور أ .‬
                                                   ‫ره، م‬        ‫ت ن دم وظ‬      ‫1091 أ ذ ‪Landsteiner‬‬          ‫و‬
                                                   ‫،و د ط ل‬          ‫ل‬        ‫زل ا ل ن ا ر ت ا د و ا راء‬
                                                   ‫دة ر ت ا راء ا زو ن دم ل وظف ظ دوث ا د‬                ‫ل‬
 ‫ن‬     ‫طد ن‬                  ‫ن‬         ‫طد ن ر‬                                               ‫ض ا ت ط.‬
  ‫دم دوث ا د‬                         ‫دوث ا د‬       ‫ن ا دم،‬    ‫رج ا روط ا ز أ ء‬         ‫ن ھ ذه ا ط ت ا‬      ‫اط‬
                                                                                 ‫ل ا طرو ا ر دم ا را .‬      ‫وا‬

       ‫.و‬  ‫ا ط وا‬    ‫زم و ود ؤم ن‬    ‫ن ا دم‬                                  ‫أن‬     ‫ن ن ط ت ھذه ا و‬
     ‫، ا ء ا ذي رض ة ھذا ا ر طر.‬  ‫وى دم ا‬                                         ‫ب ا ؤم دث د‬

                                                                                            ‫ت:‬           ‫ا‬
   ‫ن‬                ‫ؤم ا‬      ‫لا‬        ‫ا ر أن ا‬
                                        ‫ورا‬      ‫ف نا‬     ‫در ا‬            ‫ن‬                  ‫ق أن‬
                           ‫وى ا‬       ‫ت را د و و‬
                                      ‫، رب ا‬             ‫ون ر‬         ‫ا ط وا‬
                                        ‫.‬   ‫ض ا ور ت ون را د أ راد س ا‬
       ‫،‬    ‫ن طرف ا‬      ‫د د وع ا رو ت ا‬             ‫ةا‬      ‫و أن دور ا ور ت‬
         ‫اط م‬       ‫ا رو ت ا و‬    ‫ط‬          ‫ن ا ول أن ر ض ا ط م وا ره ر ذا‬

           ‫ا و ودة وق ط ا‬                     ‫إذن ن ل وع ن ا ز ت ا رو‬      ‫ءا‬  ‫دد ا‬
       ‫أو ‪. ( HLA ) CMH‬‬                        ‫ؤم ا‬     ‫و رو ت( ت ھذه ا ز ت ر ب ا ر‬                             ‫)‬

                                                             ‫و :‬     ‫وا‬           ‫تار‬        ‫‪ – IΙ‬رف ا وا‬
                                                                                  ‫:‬       ‫1 ا وا ت ا ر‬
‫ا و ــــــــــ 1‬
                                              ‫1.‬   ‫5 و‬     ‫ذا : أ ظر ا و‬          ‫ددات ا ز‬      ‫‪–a‬ا‬
                                                              ‫:‬       ‫ؤم ا‬        ‫ر بار‬        ‫ا ز‬       ‫5:اط‬       ‫او‬
 ‫ءا ر ت‬       ‫ا واة‬       ‫ا‬    ‫ء‬      ‫إ ا ف ض ا ز ت ) رو ت (‬                 ‫لا‬     ‫ث ول و ود ا‬    ‫أدت ا‬
‫د‬      ‫ت أو ب ‪ ،(Human Leucocyte Antigen ) HLA‬م أط ق‬           ‫.‬     ‫لا‬       ‫ا راء. و دد ھذه ا رو ت ا‬
 ‫و رو ت‬      ‫‪ .(Complexe Majeur d’histocompatibilité) CMH‬وھ‬             ‫ؤم ا‬          ‫ذك ط ا ر بار‬
‫ط‬         ‫ا م ا واة. وا ف ‪ ( CMH-II ) II‬و د أ‬              ‫ط‬     ‫ن: ا ف ‪ ( CMH-I ) :I‬و د‬            ‫و د‬
                                                            ‫1 و 2(‬     ‫. ) أ ظر ا و‬      ‫ا زا‬      ‫ض‬
                  ‫و ن ر ض ا ط م.‬         ‫ر ھذه ا و ، رن ن ز ت ‪ CMH-I‬و ‪ CMH-II‬وار ط ا‬           ‫دإ طء‬

      ‫ا واة. و دد ھذه‬                 ‫ا‬       ‫ء‬      ‫و د‬    ‫رة ن رو ت ط‬          ‫وا ت ا ذا ھ‬
     ‫‪: CMH‬‬         ‫ؤم ا‬                     ‫ط ا ر ب ار‬         ‫، دى ط ق‬       ‫لا‬    ‫ا رو ت ا‬
                                                       ‫) ‪.( Complexe majeur d histocompatibilité‬‬

                   ‫ذ: و فا د‬          ‫ا‬                                            ‫: - 561 -‬         ‫ا‬
 ‫ا و ــــــــــ 2‬
  ‫‪CMH-I‬‬                               ‫‪CMH-II‬‬                                                                                 ‫ذا .‬        ‫تار‬       ‫1 : ا وا‬   ‫او‬
                                                                         ‫و ز‬        ‫ءا‬           ‫ا ز‬   ‫أ وذج ا‬
                                                                                                            ‫3‬
‫2‪α‬‬                ‫1‪α‬‬            ‫1‪α‬‬                      ‫1‪β‬‬
                                                                                  ‫رج ا‬

‫3‪α‬‬                             ‫2‪α‬‬                       ‫2‪β‬‬                ‫4‬

           ‫‪β2m‬‬
                         ‫ء‬



                                                                                                                                         ‫ء‬             ‫ر‬
                         ‫و ز‬




                                                                                                                                  ‫1‬

                                                                             ‫و زم‬        ‫ا‬                                    ‫2‬
      ‫ــــــــ ـــــــ ــــــــو ــــــــ زم‬

                                                            ‫2.‬           ‫2 و‬             ‫ر ب ‪ :CMH‬أ ظر ا و‬                   ‫ل ا ورا‬     ‫‪–b‬ا‬
 ‫ا و ــــــــــ 2‬
                                                    ‫6‬                ‫ا‬                       ‫ن‬    ‫ر ب رو ت ‪ CMH‬د ا‬              ‫م‬          ‫2:‬    ‫او‬
                                                                                               ‫6 .و ر‬        ‫ا‬      ‫و‬     ‫أر ور ت‬
                         ‫ور ـــ ت ‪CMH‬‬
                                                                                                 ‫صأ‬        ‫روف : ‪ . D , B , C , A‬و ذه ا ور ت ث‬
          ‫‪CMH-II‬‬                                        ‫‪CMH-I‬‬
                                                                                                                        ‫ت:‬      ‫ل دة‬      ‫• و د‬
     ‫‪DP‬‬        ‫‪DQ‬‬           ‫‪DR‬‬                  ‫‪B‬‬            ‫‪C‬‬            ‫‪A‬‬                  ‫) ‪.(72 DP , 49 DQ , 199 DR , 188 B , 63 C , 82 A‬‬
                                                                                                                      ‫و ا دة .‬        ‫ت‬   ‫• ھذه ا‬
                                                                                                       ‫(‬   ‫ري أ‬    ‫• ا ور ت ر ط . ) أ ظر ا ر م ا‬
                                                ‫‪β‬‬            ‫‪β‬‬           ‫‪β‬‬                                 ‫ر ب ‪ CMH-I‬ا ور ت ‪ A‬و ‪ B‬و ‪. C‬‬         ‫م‬
     ‫‪βα‬‬        ‫‪βα‬‬           ‫‪βα‬‬                          ‫‪α‬‬        ‫‪α‬‬            ‫‪α‬‬
                                                                                   ‫ء‬




                                                                                                     ‫ر ب ‪ CMH-II‬ا ور ت ‪ DP‬و ‪ DQ‬و ‪. DR‬‬           ‫م‬
                                                                                   ‫و ز‬




                                                                                             ‫ز ت ‪CMH‬‬            ‫ر‬   ‫ر أ ل ا وع ا‬       ‫ط ت‬     ‫ن ھذه ا‬     ‫اط‬
                      ‫51‬              ‫ا‬                                                                                                             ‫ن ا راد.‬


              ‫ن. و ز ن‬                         ‫دا‬           ‫رم6‬                          ‫ر‬       ‫ن ا ذراع ا‬          ‫وا‬     ‫ل ور ت ‪ CMH‬ط‬
                                                                                                                          ‫ن ن ور ت ‪:CMH‬‬

                                                            ‫روف ‪.A, B, C‬‬     ‫رإ‬                              ‫ون ن ث ور ت‬                     ‫ف‪: I‬‬             ‫ا‬
                                                                ‫ب ‪ DQ ،DP‬و ‪.DR‬‬                              ‫م ث ور ت ر ز‬                     ‫ف ‪: II‬‬           ‫ا‬

      ‫.و ر ز‬                 ‫د ون ر دة ن و‬                                ‫ت‬              ‫ن8‬        ‫و‬    ‫ت‬           ‫نا‬            ‫إن ل ص ل ر‬
                                                                                                                                   ‫ا لا :‬
                                                                                                         ‫‪AXByCtDz‬‬
                                                                                                       ‫ـــــــــــــــــــ‬
                                                                                                       ‫ـــــــــــــــــــ‬
                                                                                                         ‫‪AXByCtDz‬‬


 ‫ل‬            ‫ت ن ا م، وا ف ا ر ن ا ب، و ظرا دد ا‬
                 ‫تا‬                                      ‫فا‬        ‫ل ص‬
   ‫د‬     ‫ر.‬      ‫دة‬  ‫لإ‬        ‫ن دد ا و ت ا ورا أي ا ط ا ورا ا‬      ‫ل ور‬
 ‫ن‬   ‫ء ا وأ ن ا‬     ‫ن س ‪CMH‬‬            ‫ن‬        ‫، أي ر‬     ‫ا وى ا‬     ‫و د‬
                                              ‫خ(.‬      ‫ا‬      ‫)أو ا در ن ن‬
                     ‫.‬          ‫ت ار‬            ‫وا‬                        ‫ل رد، ذ ك‬                     ‫ن ھذا أن ز ت ‪ CMH‬ون‬

                         ‫ذ: و فا د‬                  ‫ا‬                                                                        ‫: - 661 -‬         ‫ا‬
                                                                        ‫2.‬       ‫3 و‬         ‫و : أ ظر ا و‬     ‫تا‬       ‫2 ا وا‬
    ‫ا و ــــــــــ 2‬
                                                                                                       ‫ذا .‬   ‫تا و‬         ‫3 : ا وا‬          ‫او‬
                                                                                                   ‫)‬
‫د‬          ‫ر‬           ‫ا‬           ‫د‬   ‫ر‬       ‫ا‬         ‫د‬    ‫ا ر‬                                              ‫ا ر ت‬          ‫لأ‬
                                                                                 ‫ا‬       ‫ا‬         ‫دات‬
               ‫‪B‬‬                           ‫‪A‬‬                  ‫‪AB‬‬                                               ‫ت‬        ‫راء ز‬         ‫ا‬
                                                                                                   ‫م(‬     ‫أ‬
                                                                                                               ‫ف‬        ‫،‬    ‫و رو‬
                                                                                                               ‫وى‬
                                                                                         ‫‪A‬‬         ‫د‪B‬‬
                                                                                                               ‫ت‬               ‫ا زء ا‬
                                                                             ‫‪A‬‬                                 ‫ل ھ ذا‬      ‫ر .و‬       ‫ا‬
                                                                                                                  ‫ا زء ا وا م ا و‬
                                                                                                               ‫ا د و . و ؤدي‬
                                                                                                                    ‫تا‬      ‫ا و رو‬
                                                                                                  ‫د‪A‬‬           ‫ل ا وا ت ‪ A‬أو ‪B‬‬
                                                                                         ‫‪H‬‬        ‫د‪B‬‬      ‫و‬            ‫د، و‬     ‫ا‬     ‫إ‬
                                                                          ‫‪O‬‬                                             ‫د.‬   ‫و دات ا‬
                                                                                                                     ‫ط ا دول أ‬
                                                                                                               ‫ل‬       ‫د دا‬         ‫طر‬
                                                                                                               ‫د‬      ‫‪ABO‬‬         ‫اد و‬
                                                                                         ‫‪B‬‬         ‫د‪A‬‬          ‫لأ ل‬            ‫ن‬      ‫ا‬
                                                                             ‫‪B‬‬                                                ‫ر.‬      ‫ا‬

                                                                                                               ‫ن ط ت‬                     ‫اط‬
                                                                                                               ‫رج‬     ‫أ‬                  ‫او‬
                                                                                        ‫‪A‬و‪B‬‬                    ‫ت‬    ‫ت وا‬
                                                                                                               ‫راء‬    ‫تا‬                ‫ا ر‬
                                                                        ‫‪AB‬‬                         ‫ء‬
                                                                                                               ‫ت‬   ‫وا‬                   ‫وأھ‬
                                                                                                                         ‫ذا‬             ‫و‬

                   ‫ل ا د و ‪. ABO‬‬                        ‫ظما‬         ‫أ رى و‬           ‫ظ‬             ‫لا‬         ‫ددا‬

                                                          ‫ت وھ :‬    ‫زب3‬      ‫ا ظ م ‪ : ABO‬ر ط ور‬
                            ‫‪. (A‬‬            ‫ء ا ر ت ا راء ن ا‬   ‫) ز‬     ‫د‬    ‫-ا ل ‪ : A‬ر ز إ ود‬
                           ‫‪.( B‬‬            ‫ء ا ر ت ا راء ن ا‬   ‫) ز‬      ‫د‬    ‫-ا ل ‪ : B‬ر ز إ ود‬
                                                            ‫‪.(O‬‬     ‫د)ا‬   ‫- ا ل ‪ : O‬ر ب أي و د‬

        ‫ت‬        ‫ظأ ءا‬       ‫در ا د ) ا ر ض ( ا‬  ‫د ‪ A‬و ‪ B‬ط ون‬                                             ‫إذن أن و دات ا‬
                        ‫ل اد و .‬    ‫، ؤو ن د د ا‬        ‫وا ت‬                                             ‫ا د و . وھ ز ت د‬
               ‫ت س ز ت ‪CMH‬‬             ‫ن ور وا دة دد دود ن ا‬                                               ‫ظ أن ا ظ م ‪ABO‬‬
                 ‫ن ا راد، ذ ك‬     ‫و‬     ‫ن‬   ‫أن ون ر‬          ‫و ،‬                                         ‫ل اد‬     ‫دد ا‬   ‫ر‬
                                                                                                            ‫وا ت و ذا .‬

                                                                                     ‫ز ا ذا :‬              ‫‪ – IIΙ‬دور‬
                                                                                                              ‫‪CMH‬‬
                                                               ‫3.‬   ‫1 و‬          ‫وم ا ذا و ر ا ذا : أ ظر ا و‬    ‫1‬
                                                                                                                                      ‫ا ذا‬
       ‫م‬           ‫ا‬          ‫وع‬                       ‫و .و‬    ‫ر‬    ‫ن‬            ‫رد ا‬         ‫تا ز‬            ‫وع ا‬    ‫ھو‬
                                                                                                              ‫ون ا ذا .‬

                             ‫ذ: و فا د‬             ‫ا‬                                                   ‫: - 761 -‬       ‫ا‬
‫ا و ــــــــــ 3‬
                               ‫ر ا ذا .‬      ‫ر‬        ‫ف‬        ‫و ر ا ذا ، م‬       ‫ز ن ا ذا‬        ‫ط ت ھذه ا و‬   ‫ن‬    ‫اط‬      ‫1:‬         ‫او‬

‫‪Virus de la poliomyélite C‬‬                                                                            ‫داء ا ل‬       ‫ت وخ ا‬              ‫‪A‬‬




                                                           ‫ر‬      ‫ن رزه ض ا‬             ‫‪B‬‬
            ‫لا ط ل‬     ‫روس‬                                      ‫م ا دم‬ ‫و ب‬

      ‫ـــ‬    ‫‪ ...." F‬د أن ا‬                      ‫‪Trypanosome‬‬                  ‫‪E‬‬
     ‫وم دور را‬            ‫ا‬
 ‫د ا رط ن ... د‬
 ‫رار‬                 ‫رض أ‬
 ‫رط ن . إ أن‬            ‫ر‬
 ‫درا‬    ‫دث إ‬       ‫ھ ذا ا رض‬
     ‫ا‬       ‫كر ض ط ق‬
           ‫رط ن ..."‬     ‫أ ت‬
        ‫ن‬       ‫‪B.R. Bloom‬‬                                                           ‫‪Candidas‬‬              ‫ب طر‬      ‫ري‬      ‫‪ D‬طر‬
    ‫‪ La recherche‬رف‬                                                                                                       ‫‪albicans‬‬
                                         ‫ت‬        ‫ا‬        ‫ب‬         ‫وان أو‬




                       ‫زل‬    ‫را‬      ‫و‬       ‫ا راد ا‬       ‫‪H‬‬                  ‫رب‬             ‫‪ Sarcoptes scabiei‬ا راد ا‬             ‫‪G‬‬


                                                                                                                                            ‫‪I‬‬
                                                                                                  ‫‪K‬‬
                                                                                                                                        ‫ر‬
                                                                                                  ‫ر‬
                                                                                                                                  ‫راء‬
                                                                                              ‫ء‬



                                                                                                                                    ‫‪J‬‬


                                                                                                                                   ‫ح‬
            ‫ء‬      ‫د زرع ا د أو ا‬   ‫اط م‬               ‫‪M‬‬
                                                                                              ‫‪L‬‬


                   ‫ذ: و فا د‬         ‫ا‬                                                                 ‫: - 861 -‬      ‫ا‬
                                                                                                                  ‫ر ا ذا‬
‫ر‬    ‫ن أن ون‬            ‫.و‬             ‫رد ل‬           ‫م ؤدي إ‬       ‫إذا د ت ا‬    ‫را‬       ‫وع ا‬       ‫ھو‬
                                                                         ‫:‬         ‫ر‬        ‫ر‬        ‫ا ذا‬
                                   ‫ن:‬             ‫رن‬              ‫ا ر ت: ‪ Bactéries‬و ز در ا ر‬
                                                                     ‫ا وا د و ا ر.‬       ‫- در ا ر‬
             ‫.‬      ‫ھ‬     ‫م و ؤدي إ‬               ‫ا‬      ‫ر‬         ‫وم و‬   ‫ت ‪ Toxines‬و ھ‬      ‫- إ ج‬
                                                                              ‫ل : ر ا زاز.....‬
             ‫ا‬          ‫رج ا‬    ‫ا ر‬      ‫ر درة‬      ‫ثأ‬  ‫ت و‬                            ‫ة ‪:Virus‬و ھم ط‬                 ‫ا‬
                                ‫رض ا ز م .‬       ‫از م ا‬  ‫ل:‬                        ‫‪Cellules Hôtes‬‬
                                             ‫رض ا ب ا د .‬                              ‫‪ VHC‬ا‬
         ‫ا د أو‬           ‫ب‬    ‫ا‬               ‫ر ‪ Champignons microscopiques‬و ط ل‬                   ‫ا طر ت ا‬
                                                ‫.‬     ‫ا طق ا‬     ‫ط ر ‪Mycoses‬‬                          ‫ا طت‬
    ‫او ط‬        ‫طلإ‬     ‫ر و دة ا‬    ‫ت‬        ‫ا وا ت ا و ‪ Protozoaires‬و ھ‬
    ‫ا د‬     ‫أ راض ل ا ر ‪ Paludisme‬أو ا ر ‪ Bilharziose‬أو ط ل‬                ‫ا دا‬
        ‫وب ا ح، ا ر ت ا راء ا د و ،‬      ‫ر رض،‬         ‫‪ .amibe‬أو ر‬      ‫لا‬
                                                                   ‫ا ط م، ... ا‬
                                                                                                          ‫ر‬       ‫ا‬       ‫ا ذا‬
         ‫.‬       ‫ا رط‬          ‫ا‬                ‫ر ذا .‬       ‫رت‬       ‫ر‬    ‫ت‬           ‫ر ذا‬          ‫ھ‬

                                                             ‫4.‬     ‫1 و‬    ‫دور ز ت ‪ : CMH‬أ ظر ا و‬

    ‫دات،‬  ‫و زم إ‬               ‫ن ا رو ت ا و ودة ا‬                                ‫زئ أ ز ت‬    ‫ا‬
      ‫، وھ ذا رض‬               ‫ط ا‬    ‫ر ا ر ب د ـ ‪ CMH‬إ‬                          ‫ر ط ل د ز ‪ CMH‬و‬
                                     ‫:‬         ‫ن ن را‬                           ‫رار واھ ا دي‬     ‫ا‬
‫دث ار ط‬                                    ‫د‬     ‫درة ن رو ت‬                ‫رو‬     ‫إذا ت ا دات ا‬
                          ‫.‬            ‫ا‬           ‫با‬       ‫و‬                   ‫ا‬      ‫وا‬  ‫نا‬
     ‫ذ‬   ‫) رو ن‬                 ‫درة ن رو ت ر د‬     ‫ت ا دات ا رو‬                                     ‫إذا‬
         ‫ا‬     ‫وا‬              ‫دث ار ط ن ا‬  ‫أو رو ن رو (‬      ‫رط‬
                                             ‫.‬   ‫ا‬       ‫دث ا‬                                        ‫و‬

      ‫رض و دات‬         ‫ب، ل ل‬     ‫ر ض ا ط م أو و‬    ‫ر إذن وظ ‪CMH‬‬
     ‫ر‬     ‫د د ا د ا روض وا ط )‪ (CMH‬ھ ا‬       ‫. وھ ذا و‬     ‫ط ا‬     ‫د‬                                                        ‫ا‬
     ‫دد‬     ‫د‬    ‫ھذا ا زء ن و د ا‬  ‫أو د ، دى‬    ‫ا ر‬      ‫دا‬      ‫ا‬                                                           ‫ا‬
        ‫م.‬    ‫ا ر ا و و دات ا‬       ‫ا د رف‬              ‫دي، وا ذي ز‬                                                          ‫ا‬




                 ‫ذ: و فا د‬         ‫ا‬                                                    ‫: - 961 -‬             ‫ا‬
                                                ‫و ـــــ‬    ‫ر ـــــ‬                                                  ‫و ـــــ‬       ‫ر ـــــ‬                            ‫و ـــــ‬        ‫ر ـــــ‬
                                                                                                                                                                                                                                                                   ‫ا و ــــــــــ 4‬



                   ‫ر ــب‬                                       ‫ھ وم‬                                                                                       ‫ر ــب‬
                                                                                            ‫ــــــــد ر ــب‬  ‫د ــــــــد‬                                        ‫ــــــــد‬          ‫د ــــــــد‬
                          ‫ــــــــد‬       ‫د ــــــــد‬                                                                                                   ‫‪- CMH‬‬                      ‫دي‬
                ‫‪- CMH‬‬               ‫ـــ ر ذا ـــ‬                                        ‫ــ ر ــ دي ‪- CMH‬‬
                                                                 ‫ــــــ روس‬                                                                          ‫ــــــــــــد‬
                                                                                                                                                                                                                           ‫.‬



            ‫ــــــــــــد‬                ‫‪CMH‬‬                                        ‫ــــــــــــد‬           ‫‪CMH‬‬                        ‫ھ وم‬                                        ‫‪CMH‬‬
                                                                       ‫8‬
                                                                                                                                                                                                                           ‫ل‬




‫ذ: و فا د‬
                                                        ‫‪ARNm‬‬
                                                                                                                                                                                                             ‫1‬




‫ا‬
                                                                                                     ‫7‬                                                                ‫5‬
                                                                           ‫9‬
                                                                                                                                                                                                       ‫2‬
                                                                                                           ‫6‬                                                              ‫4‬
                                                                                                                                                                                                                            ‫دات ا ذا و ر ا ذا .‬




                                                   ‫ــواة‬                                                             ‫‪ARNm‬‬                                                          ‫‪ARNm‬‬
                                                                                                                                                                                                     ‫3‬
                                                                                                                                                                                                                                                ‫رض‬
                                                                                                                                                                                                                           ‫ھذه ا ط ت رزا دور ز ت ‪CMH‬‬




                                                                                             ‫ور ـــ طـــ رة‬                                                   ‫د ـــ‬            ‫ور ـــ‬
                   ‫ـــــ‬            ‫ـــــ ر‬    ‫ــــ 3: ذا ـــــ‬                ‫ا‬             ‫ــــ ر‬         ‫ــــ 2: ذا ــــ‬               ‫ا‬
                                                                                                                                                                     ‫ـــ دي‬         ‫ــــ 1: ذا ـــ‬       ‫ا‬
                                    ‫ـــــــرب رو ـــــــ‬                                              ‫ـــــ ط ـــــرة‬
                                                                                                                                                                                                                                                      ‫راو ، ق‬
                                                                                                                                                                                                                                                     ‫دور ز ت ‪CMH‬‬




                                                ‫ــــــ و ــــــ دور ز ــــــ ت ‪CMH‬‬                                            ‫ا و ـــــــــ 6: ط طــــــ ر‬
            ‫............................................................................................................................................................................................................‬
                                                                                                                                                                                                                           ‫و‬
                                                                                                                                                                                                                           ‫ف‬




            ‫............................................................................................................................................................................................................‬




‫: - 071 -‬
            ‫............................................................................................................................................................................................................‬
                                                                                                                                                                                                                           ‫د دد‬




‫ا‬
                                                                                                                                                                                                                           ‫طط ر‬




            ‫............................................................................................................................................................................................................‬
                                                                                                                                                                                                                                             ‫1:‬




            ‫............................................................................................................................................................................................................‬
                                                                                                                                                                                                                                             ‫او‬
                                                                                              ‫لا‬            ‫ا‬
                                               ‫وﺳﺎﺋﻞ دﻓـﺎع اﻟﺠﺴﻢ ﻋﻤﺎ ﻫﻮ ذاﺗﻲ .‬
     ‫ھو ذا و زه ن ھو ر ذا ،‬                                                                   ‫ط ا رف‬        ‫ا‬     ‫م أن ا‬                                                        ‫د :‬
     ‫د إ د وإ ط ل و ، وذ ك ن طر ق‬                                                               ‫ت‬      ‫دى ذا ا ر‬        ‫ث‬
                                                                                                          ‫:‬       ‫طن نا‬
     ‫ر ذا .‬                    ‫ھو‬          ‫د ل‬  ‫س ا طر‬                                     ‫: ون و‬    ‫أو ط‬   ‫ر و‬
                                            ‫ب و .‬      ‫ر ذا‬                                ‫د ھو‬     ‫: ون و‬      ‫و‬
                                                                                             ‫را و ؟‬           ‫ھ آ تا‬

                                                                                                                      ‫:‬           ‫را و‬                 ‫لاد ع‬                     ‫‪–Ι‬و‬
                                                                                  ‫‪:Réaction inflammatoire‬‬      ‫ا‬                                                                ‫1ا‬
‫ا و ــــــــــ 1‬                                                                 ‫رح أو و ز ا د: أ ظر ا و 1 و 1.‬                                                               ‫أ–‬
                                                                                                                                  ‫:‬               ‫ا‬               ‫1 : ظ ھر ا‬           ‫او‬
         ‫ا‬                 ‫ا‬     ‫داث ؤدي إ‬             ‫نا‬             ‫إ‬      ‫ن‬    ‫،‬
                                                                            ‫ض ا ت ن را م أن رق ا وا ز ا ط‬
                                                                                          ‫ا و ط ا دا‬
                                                                       ‫‪. La phagocytose‬‬          ‫د ذ ك ظ ھرة ا‬       ‫،‬
     ‫س‬       ‫إ‬            ‫رار‬        ‫وب‬     ‫،‬     ‫وى و ا‬      ‫و ز إ رة. و ظ ا خ ا د‬         ‫،ارإ‬        ‫دع‬     ‫أ ب ص‬
                                                                                           ‫در ا رارة.‬          ‫م وار ع‬
                                                          ‫.‬    ‫ا‬        ‫زا‬       ‫ك ص أھم ا راض ا‬         ‫1( دد ن ل‬
 ‫،‬           ‫ا‬       ‫وى و‬                ‫دث‬     ‫ف ا رات ا‬   ‫دع ن ) رح، و ز، ... ( و د م‬           ‫درا رد ل ا د د ر‬
                                                                                                  ‫:‬    ‫نأوبأ‬        ‫رح ا‬
                                                                                 ‫أ ه.‬    ‫ر ماو‬          ‫ءا‬     ‫2( أ ط ا‬
                                       ‫.‬      ‫ا‬      ‫ا د لا‬     ‫طرأ‬   ‫ف ا رات ا‬       ‫ن، ا رج‬        ‫3( ن ل ر ك‬
                                                                                                                                                                                   ‫1‬
                           ‫9‬                                      ‫8‬                                 ‫3‬
                                                                                                                                                                                   ‫2‬
                                                                                                    ‫4‬

                                                                                                    ‫5‬

                                                                                                    ‫6‬


                                                                                                    ‫7‬



                 ‫.........................................................‬   ‫لب:‬      ‫ا‬                             ‫.........................................................‬   ‫لأ:‬    ‫ا‬


                      ‫ا‬                ‫ا‬       ‫داث، ؤدي إ‬                        ‫نا‬             ‫م‬
                                                                                       ‫ن ا را م إ ر د و‬ ‫ا‬       ‫إ‬
                                                                                                                ‫1(‬
                                                                                  ‫:‬     ‫ا راض ا‬
                                                                        ‫.‬     ‫ا‬      ‫تا‬     ‫ا‬      ‫ن‬       ‫ا م:‬
                                                                                      ‫در ا رارة.‬          ‫ار ع‬
                                                                 ‫.‬    ‫ن ز دة د ق ا دم و ا ط ا‬         ‫ا رار :‬
     ‫رة‬              ‫ز تا‬                        ‫ذ‬        ‫ن طط دار ا و ا د و ، وز دة‬            ‫خ أو أود :‬    ‫ا‬
                                                             ‫ب؟‬           ‫ھ ا وا ل ا‬              ‫ا ز .‬         ‫ا ذا‬
                               ‫ذ: و فا د‬                    ‫ا‬                                                                               ‫: - 171 -‬                     ‫ا‬
                ‫و‬          ‫ء‬             ‫ا ر تا‬                           ‫رات ا د و ،‬                             ‫خا‬           ‫ا‬   ‫إ‬                       ‫2(‬
                                                                                                                                 ‫ب.‬    ‫ا‬
                                             ‫؟‬           ‫را و‬                        ‫ا‬           ‫ا‬     ‫ء‬                   ‫دور ا ر ت ا‬

                                                                                                                ‫ب:‬                      ‫تا‬      ‫ب–‬
                                                                                 ‫2 و 1.‬              ‫ن: أ ظر ا و‬                        ‫‪ – a‬دور ا‬
‫ا و ــــــــــ 1‬
                 ‫د إ‬            ‫ر م وع‬                                    ‫ب ون‬          ‫6291 أن أ راض ا‬             ‫ظ ‪Loewi‬‬       ‫ن‬       ‫2 : دور ا‬      ‫او‬
                  ‫ا ر و وا رح ا م‬      ‫و ا‬                                         ‫ن ر ر واد‬                 ‫ب‬     ‫ا راض ن ا‬
  ‫د ؛‬           ‫ا‬      ‫=ا‬   ‫ا د‬   ‫ا‬      ‫ء‬                               ‫و د م ا ف وع ن ا ر ت ا‬                       ‫ن ‪ L’histamine‬ذه ا دة ا‬            ‫ا‬
                                                                                                            ‫ا م و د ل ردود ا ل‬          ‫رة أ‬         ‫ون‬
     ‫ــــــ رن ــــــن ا ــــــ ن‬                   ‫ا ـــــ ل "ب"‬                  ‫ا ـــــ ل "أ"‬                                                ‫.‬        ‫ا‬
                                                 ‫ــــد ا ــــزو ا ــــر و‬      ‫ـــــل ا ـــــزو ا ـــــر و‬
                                                                                                              ‫ل زو ر و‬         ‫د‬             ‫ن‬      ‫لا‬
                                                                                 ‫1‬
                                                                                                           ‫ن‬       ‫6391 دة ا‬      ‫ص ‪Werle‬‬         ‫و ده. ا‬
                                                                                                             ‫ت ا د ؤدي إ‬          ‫ب و ن أن‬             ‫ن‬
                                                                                                                         ‫ن ا ن.‬      ‫ب‬    ‫ظ ور أ راض ا‬

                                                                                                                  ‫رب ؟‬         ‫ظ ت وا‬    ‫ص ن ل ھذه ا‬                   ‫ذا‬
                                                                                 ‫2‬




     ‫ب‬               ‫ن. ا‬     ‫ا د ، رغ ھذه ا رة دة ا‬    ‫ق‬                                                   ‫د إ ا م،‬     ‫د رب و دات ا‬
                    ‫ب.‬    ‫دوث ا‬      ‫ذ ھذه ا رة ز ت ا رة،‬                                                 ‫دد دران ا رات ا د و وز دة‬

                                                         ‫1‬            ‫3 و‬        ‫د ن: ا ظر ا و‬                         ‫ن وا رو‬          ‫‪ – b‬دور ا‬
‫ا و ــــــــــ 1‬
                                                                                             ‫ا‬            ‫ا‬                ‫ا د‬          ‫طا‬     ‫ضاو‬         ‫3:‬         ‫او‬

                                     ‫ا‬       ‫ا‬                                                 ‫را‬      ‫ا‬                                          ‫ا‬           ‫ا‬
     ‫ذ‬      ‫ا‬       ‫دة‬      ‫وا‬           ‫ا‬     ‫ار ا و‬             ‫د‬                  ‫ات‬    ‫ت وا‬      ‫وا‬                ‫ا‬       ‫ا‬                                            ‫ا‬
                                             ‫ا‬      ‫ا‬                 ‫و‬                                           ‫تا‬           ‫ا‬                                            ‫ا‬
                                 ‫ا‬       ‫ذ ا و‬               ‫دة‬       ‫ا‬                               ‫ا‬                ‫ا‬       ‫ا‬                                      ‫ا و‬

                             ‫ات‬                      ‫اب ا‬             ‫ا‬                                       ‫ا‬            ‫ز‬                              ‫‪C5a . C3a‬‬



          ‫دنا‬       ‫أ رى رو‬    ‫و طا‬        ‫ا‬     ‫ن، رر د ا‬     ‫إ ا‬
           ‫. وا ن ا ھ‬    ‫إ و ا‬        ‫ا‬   ‫ذب ا‬     ‫ل‬    ‫ن،‬     ‫س را‬
         ‫د د ول ا را م (‬    ‫ل ر ) 02 إ 03‬      ‫رة ن د دات ا د ظ ر ا ز‬
         ‫ت ر أ ز م ط وا ط ا را م. و ن س رات‬          ‫ن ا ط ر رو ن ز‬  ‫اط‬
                                                                 ‫ن.‬   ‫ا‬

                                                                            ‫‪:Facteur du complément‬‬                                      ‫لا‬        ‫‪–c‬‬

 ‫،‬               ‫وم ا‬          ‫ون ر ب ا‬                                    ‫لا‬            ‫1 و 2 رزا دور رو ت‬                                  ‫او‬           ‫ق‬
                                                                                                     ‫ا دف.‬ ‫ا‬                                  ‫ء‬       ‫ا‬           ‫و‬

                         ‫ذ: و فا د‬                   ‫ا‬                                                                             ‫: - 271 -‬          ‫ا‬
 ‫ا و ــــــــــ 2‬
                                                                                                      ‫وم ا‬     ‫1: ر ب ا‬                   ‫او‬
              ‫‪Ba‬‬                                                            ‫د‬       ‫ودا‬
                                 ‫‪Ba‬‬         ‫‪Bb‬‬        ‫‪C3b‬‬     ‫‪C3a‬‬       ‫+‬
                                 ‫‪B‬‬      ‫ل‬    ‫ا‬                 ‫3‪C‬‬                                                           ‫ح:‬        ‫ا‬

                                             ‫‪C3b‬‬                    ‫‪C3a‬‬                                      ‫= ا طر‬
       ‫‪C3 Bb‬‬                                                                                                  ‫ط‬             ‫=‬    ‫+‬
        ‫‪b‬‬
‫‪C3 Convertase‬‬                ‫+‬     ‫‪C3b‬‬       ‫‪C3a‬‬                                              ‫ن رو ت‬     ‫ون ل ا‬
                                                 ‫3‪C‬‬                      ‫ا ذاب‬                ‫ل % 01 ن ا ر و ت‬
‫ل‪D‬‬        ‫ا‬                                                                                   ‫ط 1‪C‬‬     ‫9‬    ‫ا ز ،‬
                                                                    ‫ت‬
                                                                                                             ‫إ 9‪.C‬‬
                             ‫‪C3b‬‬                   ‫‪C3a‬‬
               ‫+‬
    ‫‪C3 Bb‬‬              ‫3‪C‬‬                                                                                                        ‫ةا‬
                                   ‫ل‬                                            ‫6‬        ‫7‬    ‫9 8‬
     ‫‪b‬‬
‫‪C5 Convertase‬‬          ‫‪b‬‬
                                        ‫ا‬

               ‫+‬                                                                ‫‪C5b‬‬
                                             ‫‪C5b‬‬
  ‫5‪C‬‬                                                                                ‫6‬     ‫9‬     ‫9‬




                                                                                                                                 ‫ا دف‬
                                                                                                                                  ‫ءا‬
                                                                                        ‫9 7‬     ‫9‬
                     ‫ا ذاب‬             ‫‪C5a‬‬                                               ‫98‬     ‫9‬
                ‫ت‬
                                                  ‫‪Complexe d'attaque membranaire CMA‬‬                         ‫وم ا‬       ‫ربا‬


    ‫) ا ظ ر ا وي , ا د,‬                         ‫دا ل أ‬ ‫ن دة رو ت م ر‬     ‫ون ل ا‬
      ‫ط طر ن:‬       ‫ز .و م‬                   ‫ا ط ل ( و ل ھذه ا رو ت وا %01 ن رو ت ا‬
                                 ‫د.‬      ‫( : ود ا‬            ‫) ا را م‬      ‫را‬                  ‫رة وا ط ا‬
                                       ‫ما ل .‬               ‫دا‬     ‫د ) ا را م (‬                ‫د ار ط و د ا‬
 ‫ل ‪ Réactions en cascades‬أي‬   ‫وھ ا‬                        ‫أ‬          ‫ط ھذه ا رو ت‬                    ‫ز‬        ‫ن‬   ‫و ا‬
      ‫:‬      ‫ا‬        ‫دة أدوار ا‬                        ‫لا‬        ‫.و‬  ‫ز ا ل ا وا‬                    ‫ل‬         ‫أن وج ل‬
                                                        ‫‪.action cytolytique‬‬     ‫دور ل‬
     ‫.‬          ‫ر ب ا وم ا‬               ‫ل ة‬     ‫ا دف‬     ‫ءا‬              ‫ض أ زاء ل ا‬       ‫د‬
                ‫ا دف، أو ت‬              ‫‪ . complexe d'attaque membranaire‬ر ھذه ا ة ذ ا ء إ ا‬
                                                                  ‫.‬     ‫بإ‬          ‫ا وى ا دا‬
                                        ‫رات ا د و و ددھ ‪.Vasodilatation‬‬                         ‫ذ ا‬       ‫ن‬             ‫ر‬
     ‫2.‬       ‫2 و‬       ‫ب ‪ .chimiotactisme‬أ ظر و‬              ‫ا‬    ‫و و‬          ‫ء‬        ‫ط ا ذاب ا ر ت ا‬
    ‫ب م ن ظ ھرة‬              ‫رات ا د و ا ورة و ا‬            ‫ا دران ا دا‬     ‫ء‬    ‫ق ضا ر تا‬
   ‫ء و‬      ‫ا ر تا‬                 ‫ل. د ا‬      ‫ا رات ا د و ، م ن ظ ھرة ا‬          ‫ش، در ھذه ا‬    ‫ا‬
                                                          ‫.‬       ‫ل ظ ھرة ا ذاب ا‬     ‫د‬   ‫و ود ا‬
         ‫‪ C3a‬و‪.C5a‬‬            ‫د ن وأ د أ زاء ل ا‬      ‫ت ر ا رو‬            ‫ل وا ذاب ا‬      ‫م ل نا‬
                    ‫ذ: و فا د‬      ‫ا‬                                                          ‫: - 371 -‬             ‫ا‬
‫ا و ــــــــــ 2‬
                 ‫ا ذاب‬              ‫لا‬        ‫ت‬    ‫ط ت رزا دور رو‬     ‫ھذه ا‬       ‫م ق‬     ‫أ م ھذه ا و‬                     ‫2:‬         ‫او‬
                                                                    ‫ب.‬      ‫ا‬    ‫ء و و‬      ‫ا ر تا‬

                                                                                                 ‫)ج‬
                                                                                           ‫اﻝوﺜﻴﻘ ـ ـ ـ ـ ـ ـ ـ ـ ـ ــﺔ 8 ﺸ ـ ـ ــﻜل )ج(:‬
   ‫ﻤوﻗـ ـ ــﻊ‬                  ‫)ج(.......................‬
                               ‫+ (.......................‬                       ‫‪C5a‬‬
 ‫اﻻﻝﺘﻬ ـ ـ ـ ـ ــﺎب‬                                                                                           ‫ر‬
                                                                                          ‫ﺘﻔﺼـ ـ ـ ـ ـ ــﻴل ظـ ـ ـ ـ ـ ــﺎﻫ ة اﻻﻝﺘﻬـ ـ ـ ـ ـ ــﺎب‬
                                                                                 ‫+‬
                                                                                           ‫)‬
                                                                  ‫)ب(.......................‬

                                                                                              ‫)أ(........................‬
                                                                                              ‫(........................‬
                          ‫1‬



                      ‫2‬




                                      ‫3‬




                                                                    ‫3.‬     ‫1 و‬        ‫: أ ظر ا و‬             ‫ا‬             ‫ل‬
‫ا و ــــــــــ 3‬
                                                                                                                                          ‫1:‬        ‫او‬
                                                                                                        ‫1‬


                                                                                                        ‫2‬                                           ‫5‬




                                                                                                        ‫3‬


                                                                                                                                                    ‫6‬
                                                                                                        ‫4‬



‫...…………… ...…………… ...…………… …...……..…‬
               ‫…‬        ‫…‬        ‫…‬
        ‫ل ذ ك ار ط و د‬                    ‫.‬         ‫را‬         ‫ا را م وا‬          ‫) ‪( C3b‬‬            ‫لا‬           ‫ت ض أ زاء‬
                      ‫(.‬                  ‫أ‬       ‫ك ط‬      ‫ا‬      ‫ا ورات ‪S‬‬            ‫ذر ذ ك. )‬                            ‫ا‬         ‫د‬         ‫ا‬

                                                                                                              ‫:‬                ‫ج–‬

            ‫ط‬             ‫را‬    ‫ا‬         ‫و‬       ‫ھ رد ل ا م ا ه ن ر و ، و دف إ‬                                                ‫ا‬               ‫ا‬
                                                              ‫ب (.‬ ‫ن ا ن ) ؤرة ا‬ ‫إ‬                                                 ‫زا‬
                          ‫ذ: و فا د‬           ‫ا‬                                                      ‫: - 471 -‬                 ‫ا‬
                                                          ‫3.‬       ‫2 و‬       ‫‪ :La phagocytose‬أ ظر ا و‬                                      ‫2ا‬
‫ا و ــــــــــ 3‬
                                                                                                                                               ‫2:‬      ‫او‬
 ‫1‬                                                                                         ‫ف را ل‬                    ‫ط ت ھذه ا و‬               ‫ن‬       ‫اط‬
                                                                                                                                                    ‫.‬   ‫ا‬
                                                                                         ‫= ...............................................‬            ‫ا ر‬
                                                                                         ‫= ...............................................‬            ‫ا ر‬
                                                                         ‫4‬               ‫...............................................‬ ‫=‬            ‫ا ر‬
                                                                                         ‫= ...............................................‬            ‫ا ر‬

 ‫2‬


 ‫3‬
                                                                         ‫5‬



                                                                         ‫6‬

                                                 ‫را ل ا‬    ‫طط‬       ‫لب:ر م‬       ‫ا‬           ‫ظ ھرة ا‬            ‫ورة ا رو و را‬                  ‫لأ:‬         ‫ا‬

                                                                                                         ‫:‬            ‫أ– رفا‬
                   ‫ا‬     ‫ا‬                 ‫ر ر ذا ، و م وا ط‬       ‫ا ع‬         ‫ھ درة ا‬                                                                 ‫ا‬
     ‫أي‬         ‫ط ب ھذه ا‬          ‫ت ا رة ‪ Les macrophages‬وا د ت ‪ ،Les neutrophiles‬و‬
                                      ‫ر و .‬        ‫ط‬     ‫د‬    ‫ف و‬     ‫د، ذا‬  ‫ود ا‬      ‫ل‬                                                               ‫ا‬
                                                                                                     ‫:‬             ‫ب – را ل ا‬
 ‫ن‬                  ‫أ ط‬      ‫ر و‬                     ‫ت‬       ‫ر ا ت: لا د ت‬
                                                               ‫ن‬             ‫ت‬
                                                       ‫.‬    ‫د وأ زاء ل ا‬  ‫و دات ا‬
 ‫ن‬      ‫ا‬   ‫نا‬                  ‫ع : د ر ا ت، ط ظ م ا ن- وز ن ا ذي‬          ‫ر ا‬
‫ورا دا ل وة‬                       ‫، ا ذي‬    ‫را‬    ‫د أر ل ذ ‪ Les pseudopodes‬ول ا‬
                                                                 ‫‪.phagosome‬‬
           ‫واھ ا‬             ‫و رغ‬                   ‫وة ا‬           ‫م ا زوز ت ‪Lysosomes‬‬                          ‫م:‬             ‫ا‬           ‫ر‬
                                                                  ‫.‬  ‫ا‬    ‫را‬     ‫ا ل‬       ‫ز ت‬
            ‫.‬         ‫رج ا‬     ‫د‬             ‫ود ا‬              ‫، طرح‬   ‫وا‬    ‫ر إ راج ا ط م : د ھ‬

                                                                                     ‫3‬       ‫3 و‬               ‫وظ : أ ظر ا و‬

 ‫ددة‬       ‫ب‬          ‫ل‬      ‫و ن ن أن‬      ‫ا‬     ‫را‬     ‫لا‬          ‫ا‬   ‫ن‬    ‫أ با‬
       ‫ت‬        ‫ا‬             ‫أ‬   ‫ون ا ر ل ا ذ ، أو و ر‬       ‫: ر ت رز واد‬     ‫ذر ن‬
                                      ‫، ز أ ز ...‬        ‫، أو در ا وة ا‬   ‫تا‬
          ‫د را‬        ‫ؤدي إ‬              ‫د‬         ‫دة ن ا ز ن، أو ر و د ا‬                              ‫ن ھذا: ء ا ر‬
                    ‫ا و .‬                    ‫ا‬            ‫د ل آ ت أ رى رف‬                              ‫. و ھذه ا‬  ‫را‬                                 ‫وا‬

                    ‫ذ: و فا د‬        ‫ا‬                                                                   ‫: - 571 -‬                    ‫ا‬
‫ا و ــــــــــ 3‬
                                                                                                                    ‫.‬           ‫د را ل ا‬                   ‫تا‬          ‫فا‬                 ‫3:‬           ‫او‬

 ‫1‬                                             ‫3‬
                                                                                                                                                                                               ‫5‬


 ‫2‬
                                           ‫4‬

     ‫ر‬      ‫ا‬         ‫طرح‬                                                                                                                                              ‫3‬              ‫ا‬

                                             ‫1‬            ‫ا‬                                                                                                                                        ‫6‬
                                                                                                               ‫2‬            ‫ا‬
                                                                                                                                         ‫8‬
                                                                                                                                                                                                   ‫7‬


     ‫..................................................‬                ‫..................................................‬               ‫..................................................‬



                                                                                                                                                                                  ‫:‬
              ‫ن وع‬       ‫وذ ك‬    ‫ب در ا‬                                                             ‫بوا‬     ‫ا‬    ‫د ل ل ن ا وا ز ا ط‬
            ‫:‬     ‫دة وا ل‬     ‫رھ‬   ‫ا ر وم‬                                                        ‫ء‬    ‫ر و (. ن ا‬               ‫ا ر وم )ا‬
              ‫ء ا م.‬        ‫ا ر تا‬     ‫م، و‬                                                     ‫ط دا ل ا‬      ‫م، ط‬     ‫وع ا ر وم ا رب‬
                                                                                                                      ‫أ ظر ا و 1 و 4.‬
‫ا و ــــــــــ 4‬
                                                              ‫.‬     ‫را و‬                  ‫ا‬               ‫ا‬                     ‫طط ر‬

                                                       ‫م، ب ا‬                      ‫د ا وا ز ا ط‬ ‫د ا راق و د ا‬
                                                         ‫ر و‬                      ‫د د‬     ‫ر ط ودا‬
                                                                                                                                                                                      ‫ط‬

         ‫ط وا ل ا‬               ‫زو‬                                     ‫ا د‬           ‫طا‬                                         ‫ن‬   ‫ا‬    ‫و‬         ‫ط‬


                                                                             ‫طا‬       ‫إ راز و‬
‫ت أ زاء ل‬
‫ود‬        ‫ا‬
   ‫د‬   ‫ا‬                                                                        ‫ن‬                ‫ا‬
                                                                               ‫دن‬              ‫وا رو‬                                                                                  ‫ب‬        ‫ا‬

 ‫ل رب‬                     ‫ل‬                 ‫ت‬                          ‫ا ذاب‬                      ‫ار ع ذ‬
  ‫ا وم‬                             ‫ا‬               ‫د‬              ‫و ودا‬                         ‫ا رات ا د و‬
      ‫ا‬                                                                                            ‫و ددھ‬



‫د‬      ‫ل ودا‬                      ‫د‬       ‫ل ودا‬                                                                                                                                       ‫ل‬        ‫ا‬
     ‫ل وات‬                             ‫لأز ت‬
           ‫ا‬                            ‫ا زوزوم‬

                        ‫ذ: و فا د‬                         ‫ا‬                                                                                     ‫: - 671 -‬                     ‫ا‬
                                                                                        ‫:‬      ‫لاد عا و‬                   ‫‪ – IΙ‬و‬
                                                                            ‫ا و‬      ‫ا‬       ‫تا‬                            ‫1‬
                                                                         ‫ا و :‬     ‫ا‬       ‫ا‬    ‫أ– و‬
                                                                       ‫‪ – a‬ر ن: أ ظر ا و 2 و 4.‬
   ‫ا و ــــــــــ 4‬
                                                                                                                             ‫او‬
                                                                                                                              ‫2:‬
       ‫ا د ر ‪ ، Bacille Diphtérique‬رز ا و ط ا دا‬                   ‫زاز ‪ Bacille Tétanique‬وا‬              ‫ا‬           ‫ضا ر ت‬
        ‫ت در ا ر‬                    ‫رارة وا ور ول د ھذه ا‬ ‫ا رض. و ت ر ض ا وا ل‬            ‫ن‬              ‫ؤو‬      ‫ت ‪Toxines‬‬
                                 ‫ن ا دو ن ‪. L’anatoxine‬‬      ‫م ھذه ا‬      ‫و .‬             ‫نا‬                     ‫ظ در‬     ‫ن‬
                                                                                 ‫.‬   ‫ا دول أ‬                      ‫رب ا‬    ‫ما م‬
                                                                         ‫ب.‬    ‫جا‬     ‫مأ طا‬              ‫ر‬     ‫ل‬       ‫1( ل‬
             ‫ا ــــ ـــ ــــ ـــــــــ ـــــــــــ ت‬                   ‫؟‬        ‫ا رب ا ر‬                 ‫ن‬     ‫ص‬       ‫2( ذا‬

‫.......................................................‬
‫.......................................................‬
‫.......................................................‬       ‫وت ا ر‬                                           ‫ن ا زاز‬        ‫ن‬
                                     ‫..................‬
‫.......................................................‬
‫.......................................................‬
‫.......................................................‬       ‫ا ر‬               ‫ن ا زاز‬        ‫ن‬               ‫ن دو ن ا زاز‬
                                     ‫..................‬
‫.......................................................‬
‫.......................................................‬
‫وت ا ر .......................................................‬                  ‫ر‬     ‫ناد‬      ‫ن‬               ‫ن دو ن ا زاز‬
                                     ‫..................‬
‫..............................‬     ‫ر 2‪S‬‬                    ‫ر 2‪S‬‬                ‫م 2‪S‬‬     ‫ر‬                      ‫م 1‪S‬‬       ‫ر‬
‫..............................‬
‫..............................‬
‫..............................‬        ‫ا ر‬               ‫ن ا زاز‬   ‫ن‬            ‫ل ا ر 1‪S‬‬        ‫ن‬               ‫ن دو ن ا زاز‬


                                                                                             ‫‪ – b‬ل ا ر ن:‬
                                                                                            ‫ل وا ج:‬       ‫1(‬
            ‫ن ا زاز .‬              ‫ر‬     ‫أن ا ران‬               ‫دل‬‫ھد د‬    ‫ن ا زاز‬                            ‫وت ا ر ا‬
       ‫د ا ن ا ذي‬                      ‫أن ا ذو ن م‬               ‫دل‬ ‫ر م‬    ‫ن ا زاز‬                              ‫ا ر‬
                                                                   ‫زاز.‬                                  ‫ا‬
         ‫ط‬       ‫أن ذو ن ا زاز‬   ‫دل‬      ‫ن اد ر‬          ‫د ا زاز د‬                                        ‫وت ا ر ا‬
                ‫‪Réponse Immunitaire spécifique‬‬     ‫و‬      ‫ر أي أن ھ ك‬                                    ‫د اد‬
    ‫دة‬           ‫ل ا ر 1‪ S‬وي‬      ‫أن‬    ‫دل‬       ‫ن ا زاز‬        ‫ر م‬                                      ‫ا ر 2‪S‬‬
                                            ‫ا ر 2‪ S‬ن ن ا زاز .‬                                               ‫ا درة‬

                      ‫ھذه ا‬       ‫م‬         ‫ا‬             ‫ا‬        ‫أن ا‬       ‫رب ا‬        ‫لا‬         ‫ن ن‬                  ‫2(‬
                                                                      ‫ا ن‬
            ‫ذا م ن ا‬      ‫( ا وان ا‬   ‫م وا ط دة و ودة أ ط ) ا و ط ا دا‬        ‫ا‬
    ‫أن ھذه‬      ‫ن طر ق و ط ط ‪Réponse Immunitaire médiation à humorale‬‬
   ‫إ ن ن‬            ‫ن ذو ن ا زاز‬      ‫‪ spécifique‬ن ا دة ا‬       ‫و‬    ‫ھ ا‬        ‫ا‬
       ‫د ‪ Antigène‬ث و د ا‬       ‫ا ن ھ ود ا‬           ‫ا زاز و س ن أي ن أ ر . ذ ك‬
                       ‫د ا م ‪.Anticorps‬‬            ‫ده م وا ط دة و د ا ل و‬
                      ‫ذ: و فا د‬         ‫ا‬                                                          ‫: - 771 -‬          ‫ا‬
                                                                          ‫‪–c‬‬                            ‫:‬
         ‫ا‬             ‫ا‬                     ‫م‬ ‫ر اد ، ا‬    ‫و‬   ‫دي‬         ‫د لا زا‬
   ‫و ، أو‬           ‫ا ر تا‬              ‫ر ا و . و ون ھذا ا دي ا و إ ن طر ق و ط وي ل‬
                       ‫م.‬              ‫دات ا‬       ‫دة ل ر ا ل‬     ‫ن طر ق و ط ط ،‬

                                                               ‫: ‪Mémoire immunitaire‬‬                   ‫ب – ا ذا رة ا‬
                                                                                ‫:‬         ‫‪ – a‬ا ف ن ا ذا رة ا‬

                                                                                           ‫5‬      ‫1 و‬                ‫ر ن 1 : أ ظر ا و‬
 ‫ا و ــــــــــ 5‬
                      ‫ر ‪ B‬و ‪ C‬س ‪.CMH‬‬                  ‫أن‬      ‫ر ،‬   ‫جا ص ل‬                ‫مأ طا‬        ‫ا‬         ‫ر‬       ‫ط تا‬    ‫لا‬   ‫1:‬    ‫او‬

‫...................................................‬    ‫21 و‬    ‫ر ض ا ط م د 01 إ‬                        ‫دي‬        ‫ط م‬




                                                                                                                                           ‫ا‬
‫...................................................‬




                                                                                                                                           ‫ر 1‬
‫...................................................‬             ‫ا ر‪B‬‬                      ‫ا ر‪B‬‬                              ‫ا ر‪A‬‬

‫...................................................‬                                                    ‫دي‬        ‫ط م‬
‫...................................................‬    ‫3أ م‬    ‫ر ضاط م د2إ‬                                   ‫د‬
                                                                                                                     ‫أ‬




                                                                                                                                           ‫ا‬
‫...................................................‬




                                                                                                                                           ‫ر 2‬
‫...................................................‬             ‫ا ر‪B‬‬                      ‫ا ر‪B‬‬                              ‫ا ر‪A‬‬

‫...................................................‬    ‫3أ م‬    ‫ر ضاط م د2إ‬                                  ‫دي‬       ‫ط م‬




                                                                                                                                           ‫ا‬
‫...................................................‬




                                                                                                                                           ‫ر 3‬
‫...................................................‬             ‫ا ر‪C‬‬                      ‫ا ر‪C‬‬              ‫ن و تا ر‪B‬‬
                                                                                                            ‫ر‪ C‬در ضاط م‬
‫...................................................‬


             ‫‪ B‬رف‬                    ‫ا ر ا و : م ر ض ا ط م ا دي ا ول ن ‪ A‬إ ‪ B‬ن م ا‬
             ‫ف ـ ‪CMH‬‬                   ‫ل ‪CMH‬‬      ‫و ذك‬   ‫با ص‬        ‫ر ر ذا‬    ‫اط م‬
                  ‫.‬                     ‫طو‬ ‫د دة ز‬  ‫ود ا‬   ‫‪ .B‬و ط ب آ ا رف‬       ‫ما‬

         ‫و ( ون أ ل ن‬     ‫)ا‬  ‫ارض ا ط م ا‬                                                       ‫ظ أن‬      ‫:‬  ‫ا ر ا‬
         ‫د.‬    ‫ود ا‬   ‫أو ( ن ا م ق أن رف‬                                                       ‫ا ر ض ا ط م ا ول ) ا‬

   ‫‪CMH‬‬                 ‫رة‬          ‫ا رف‬               ‫ر ‪ C‬درة‬               ‫و‬       ‫تا ر تا‬             ‫: دأ‬   ‫ا ر ا‬
                                                                        ‫.‬           ‫ق ا رف‬             ‫ا ر ا ط ‪ B‬ا ذي‬

         ‫و‬                           ‫ل لا‬                     ‫ل ذا رة‬                 ‫ا‬         ‫أن ا‬                 ‫رب ا‬        ‫نا‬
                                                                                                                                ‫ون ور .‬



                     ‫ذ: و فا د‬              ‫ا‬                                                              ‫: - 871 -‬             ‫ا‬
                                                                                                      ‫5‬    ‫2 و‬               ‫ر ن 2 : أ ظر ا و‬
 ‫ا و ــــــــــ 5‬
     ‫ن ھذا‬     ‫لأ‬   ‫زر ‪ ) Féroé‬ا دا رك (، و م‬  ‫‪Rougeole‬‬         ‫دوى ا‬                         ‫1871، ا رت‬             ‫2:‬   ‫او‬
‫ھ ذه‬      ‫% 57 إ % 97 ن‬       ‫أ ب‬        ‫. م ظ رت دوى‬       ‫ا‬     ‫ن‬                           ‫ا رض ل ا س و‬
‫ون زر ‪ ، Féroé‬وا ذ ن ق م أن أ وا رض‬           ‫ناذن‬       ‫صا‬   ‫ن نا‬                             ‫ا زر، و د ظ ا ط ب ‪ L.Panum‬أ‬
‫ون‬      ‫1871‬          ‫وا‬     ‫نا ذن م‬       ‫صا‬    ‫. و ظ ذ ك أن ا‬     ‫رة‬                         ‫م‬    ‫1871، م ب أ د‬          ‫ا‬
                                                                                                         ‫رض إذا ر وا دوى.‬
                   ‫.‬  ‫د ن‬             ‫س ودا‬              ‫ن‬       ‫ن‬   ‫ا دم ا ر‬    ‫ما و‬   ‫دات ا‬    ‫طور ر ز‬       ‫ط ا لأ ناو‬
          ‫.‬       ‫ول رض ا‬              ‫ظ ا ر‬              ‫را‬      ‫ا و . م وظف ھذه ا ط ت‬       ‫ا و وا‬          ‫1( رن ن ا‬
     ‫س دد‬         ‫ل ا دم‬   ‫تا‬               ‫ت‬            ‫د (، م ا‬        ‫ب دور ول ا‬   ‫ن ا ران ر ت راء روف ‪) GRM‬‬    ‫و‬   ‫ت‬
                                      ‫لب.‬           ‫نا‬                    ‫ا‬    ‫ا‬          ‫م ‪.Anti – GRM‬‬ ‫دات ا‬  ‫ا ز ت ا رزة‬

                                                ‫.‬         ‫ن ا ذا رة ا‬     ‫ؤو‬    ‫را‬    ‫ا‬            ‫ر وا‬    ‫ھذه ا‬        ‫ط ت ا واردة‬       ‫لا‬          ‫2(‬
                                      ‫لب‬    ‫ا‬                                                                           ‫لأ‬    ‫ا‬


      ‫ف(‬          ‫ه ‪) GRM‬‬         ‫ط‬        ‫دد ا ز ت ا‬                                                                                         ‫و‬                 ‫ا‬
‫009‬
‫008‬
‫007‬



                                                                                      ‫دات ا‬
‫006‬
‫005‬
                                                                                                          ‫أو‬            ‫ا‬
‫004‬
                                                                                      ‫م‬

‫003‬
                                                                                      ‫ا‬


‫002‬
                                                                                      ‫م‬




‫001‬                                                                                                                                                         ‫از ن‬
 ‫0‬                                                                                            ‫0‬       ‫1‬    ‫2‬        ‫3‬         ‫4‬       ‫5‬           ‫6‬         ‫7‬
      ‫0‬       ‫2‬   ‫4‬   ‫6‬    ‫01 8‬            ‫44 24 04 83 63 43 23 03‬
                                                                          ‫م‬    ‫از ن‬                 ‫ل ا ول‬  ‫ا‬                                  ‫لا‬   ‫ا‬
     ‫ن أول ـ ‪t0 GRM‬‬                        ‫ن ن ـ ‪t1 GRM‬‬                                           ‫د‬     ‫ودا‬                       ‫د‬           ‫س ودا‬



                   ‫.‬                   ‫م دم ا‬     ‫دات ا‬       ‫د ون‬                                        ‫1( د ا ن ا ول و د ا‬
          ‫د. إ أن ھذه‬             ‫م د ود ا‬      ‫دات ا‬    ‫وا ط‬                                                ‫و ود ا‬   ‫ر ھذه ا‬
             ‫ود‬                      ‫زا‬     ‫، دم ا رف ا وري‬     ‫ون د‬                                            ‫ا و‬   ‫ا‬       ‫ا‬
                                                                                                                         ‫د.‬   ‫ا‬

     ‫ز ر ع ر و وي‬                                   ‫و‬                         ‫د إ ظ ور ا‬     ‫س ود ا‬     ‫ؤدي ا ن ا‬
                                                                                  ‫ن ا ول.‬      ‫م ر‬   ‫دات ا‬
                    ‫ن ا رف ر‬                                            ‫ذا رة‬      ‫ور‬       ‫ون ا ز ا‬      ‫ر ھذه ا‬
      ‫.‬           ‫ول رض ا‬    ‫ظتا ر‬                                       ‫را‬        ‫ق أن و . وھذا‬     ‫دا‬     ‫و دات ا‬

                  ‫ل‬             ‫م ‪ Anti – GRM‬ون‬   ‫دات ا‬                                       ‫ظ أن دد ا ز ت ا رزة‬                                     ‫2(‬
                      ‫لا‬      ‫ن ھذه ا ط ت أ‬      ‫ا و .‬                                           ‫لا‬     ‫ا و ، ر‬                                         ‫ا‬
                       ‫و ذات ذا رة.‬         ‫ن ا ر ق ون‬                                               ‫و ف دة‬   ‫ا و‬                                       ‫ا‬



                      ‫ذ: و فا د‬                 ‫ا‬                                                                  ‫: - 971 -‬              ‫ا‬
                                                                                    ‫:‬             ‫ا ذا رة ا‬           ‫‪–b‬آ‬

    ‫و‬        ‫و ف دة‬   ‫ا و‬        ‫ا‬                                  ‫م‬      ‫ل ر ا‬                ‫ر ا ذا رة ا‬
   ‫ا ز ا دورا .‬     ‫طو‬      ‫ش ھذه ا‬                             ‫ول إ ر ت و ذات ذا رة. و‬            ‫نا رق‬
   ‫رة د ا را ا وا ز‬     ‫د‬     ‫ود ا‬                               ‫ا رف‬         ‫ا درة‬     ‫وھ ذا ون ذ رة ن ا‬
                         ‫ور و و .‬                               ‫ا و‬         ‫ا‬       ‫م. و ذ ك ون ا‬           ‫اط‬

     ‫85‬                                                                                 ‫ـــــ ل‬    ‫ا‬      ‫ـــــ‬
                       ‫ـ‬
                 ‫أول ا ـــــ ل‬                                                               ‫ـ‬
                                                                                        ‫ــــ د‬           ‫ـ‬
                                                                                                   ‫و ــــد ا‬
                     ‫ـ‬
                ‫ــــ د‬         ‫ـ‬
                         ‫و ــــد ا‬                                                                                      ‫ھ وم‬

                                                                                           ‫ھ وم‬                         ‫ھ وم‬

                                                          ‫ز ـــــــ ت‬                      ‫ھ وم‬                         ‫ھ وم‬

                                                                                           ‫ھ وم‬                         ‫ھ وم‬
                                                                        ‫ـــــــ ر‬                               ‫"أ"‬
                                                                        ‫و ــــــرق‬         ‫ھ وم‬                         ‫ھ وم‬

                                                                                                                        ‫ھ وم‬
                                                                        ‫ـــــــ ر‬
                                                                         ‫ـــــط‬                                         ‫ھ وم‬




                        ‫ــــــــ ط‬
                                 ‫ـ‬   ‫1-‬                ‫ـــ ذات ذا ـــرة‬                                         ‫"ب"‬
                                                      ‫) ـــدة ـــش طو ـــ (‬

                                                                                 ‫ـ‬
                                                                        ‫ــــــــ ط‬         ‫2-‬
           ‫ــــــ‬      ‫ــــــ ري‬    ‫ر ــــــم‬
   ‫ـــــ‬          ‫ـــــ ـــــ‬       ‫ا ـــــذا رة ا‬
                  ‫ـ‬
            ‫ا ط ـــــــ‬                ‫ـ‬
                                 ‫ا ـــــــ‬

                                                             ‫وا‬    ‫.‬‫ا‬    ‫2ا‬     ‫ا‬           ‫با‬
                                                               ‫ا‬   ‫أ–أ لا‬                    ‫:‬
                                                              ‫‪ –a‬ر :‬
                       ‫تا‬      ‫د رضا م ر و نا‬             ‫تا‬     ‫ا‬     ‫نإ ء‬
     ‫ا د‬                  ‫دد ا ر ت ا و‬         ‫ظا‬  ‫‪ .Rayons ionisants‬وازاة ذ ك‬
                    ‫رة ا ع ا ظ ‪.La moelle osseuse‬‬      ‫ت را‬      ‫ا و و وفا‬
   ‫ھذه‬               ‫،و ن‬       ‫ا‬   ‫ن ھذه ا ط ت و ط ت ا و 1 و 6، ن أ ل ا‬    ‫اط‬
                                                                         ‫.‬    ‫ا‬
‫ا و ــــــــــ 6‬
                                                                          ‫عا ظ‬          ‫ط ما‬                                       ‫1:‬     ‫او‬
‫إ جا و ت‬
  ‫‪ B‬و‪T‬‬


                                     ‫عا ظ‬        ‫ط ما‬
                                                                                                     ‫ا‬




‫إ جا و ت‬
   ‫‪ B‬ط‬
                                                                                                     ‫ل ا دة ا‬




                                     ‫ر‬       ‫ط م ا دة ا‬
   ‫دم إ ج‬
‫و ت ‪ B‬و‪T‬‬            ‫ا‬                                                                                                  ‫و ت‬     ‫دم إ ج ا‬
                                                                                                     ‫ر‬




                                                                                                                             ‫‪ B‬و ‪T‬‬


                        ‫ذ: و فا د‬        ‫ا‬                                                             ‫: - 081 -‬               ‫ا‬
                                                                                              ‫ج:‬    ‫ل وا‬ ‫‪–b‬‬
          ‫ت‬         ‫ا‬        ‫ا ر تا و ا د‬                                       ‫اد و‬          ‫دا عا ظ ا رأ لا‬
                          ‫ا و ودة‬ ‫ت ا رو‬                                     ‫با‬    ‫و‬         ‫.و ز و ن نا ر تا‬   ‫ا‬
                                                                                                              ‫ا ز‬

     ‫دا ل ا ع ا ظ )‪ ،(Bone‬و ل د ذ ك‬       ‫و‬    ‫و ‪ :B‬م إ‬                                                            ‫ا ـــــــر ت ا‬
      ‫ت‬      ‫و ‪ Ganglions lymphatiques‬وا ط ل ‪ .Rate‬و ك‬                                                             ‫ر ا دا‬
                        ‫ت ‪ B‬أو ‪.( B Cell Receptor ) BCR‬‬                                                              ‫ا‬      ‫و ،‬

          ‫ر‬  ‫دا ل ا ع ا ظ و ل د ذ ك إ ا دة ا‬   ‫ا ـــــــر ت ا و ‪ :T‬م إ‬
            ‫ت رف‬           ‫، ك‬    ‫و ول إ ر ت و ‪T‬‬          ‫)‪ ،(thymus‬ث‬
          ‫ت ‪ T‬أو ‪ .TCR‬د‬      ‫ا‬   ‫د (، و‬   ‫د ) ددات‬   ‫أ زاء د ن و د ا‬
                               ‫ر ا د ا و وا ط ل ث م ز .‬         ‫ذك ل‬

                                                                                             ‫:‬          ‫ا‬           ‫فا‬       ‫ب–أ‬
               ‫6.‬   ‫2، 3، و‬            ‫ض ا و ت. أ ظر ا و‬                                    ‫و‬          ‫ب‬                   ‫ا‬   ‫فا‬
 ‫ا و ــــــــــ 6‬                                                                                                                      ‫2:‬         ‫او‬
                                                             ‫أ لا ر تاد و‬
                        ‫أ ل‬                                                                                 ‫و‬      ‫أ ل‬




                ‫‪Erythroblaste‬‬                                                                                        ‫ل‪T‬‬                 ‫ل‪B‬‬
                                       ‫‪Myéloblaste‬‬                       ‫‪Monoblaste‬‬
‫‪Mégacaryocyte‬‬


                                      ‫ـــــــ ـــــــ ـــــــ ــــــ ت‬



     ‫ت‬              ‫ر ت‬
         ‫د و‬        ‫راء‬          ‫دة‬                                      ‫د‬       ‫و دة‬                               ‫و ‪T‬‬               ‫و ‪B‬‬

         ‫ء.‬    ‫ض ا و ت. ط ا دول أ ل أ واع ا ر ت ا‬                                ‫ب‬      ‫و‬        ‫ب‬     ‫ء‬         ‫فا ر تا‬               ‫3:‬         ‫او‬
                                                                 ‫ء ددة ا وى ‪Polynucléaires‬‬   ‫ر ت‬
     ‫ء و دة ا واة ‪Mononucléaires‬‬         ‫ر ت‬
                                                                       ‫ت ‪Granulocytes‬‬
                                                                                                                                           ‫وع ا‬
    ‫ر ت و‬                                                                     ‫ت‬
                        ‫ا و دات ‪Monocytes‬‬              ‫دات ‪Basophiles‬‬                      ‫د ت‪Neutrophiles‬‬
 ‫‪Lymphocytes‬‬                                                              ‫‪Eosinophiles‬‬
    ‫8 - 7‬                     ‫02 - 41‬                      ‫01 - 9‬            ‫21 – 01‬           ‫21 – 01‬                                ‫دھ ب‪mµ‬‬
      ‫0041- 0004‬              ‫001- 007‬                        ‫01- 05‬               ‫05- 003‬                  ‫0002- 0007‬
          ‫وا‬                     ‫وا‬                             ‫وا‬                    ‫وا‬                        ‫وا‬                          ‫دد ا‬
                                                                                                                                                 ‫3‬
     ‫%02 إ %54‬                ‫%3 إ %7‬                      ‫%0 إ %5.0‬              ‫%1 إ %3‬                   ‫%54 إ %07‬                ‫‪ mm‬ن ا دم‬
                                  ‫د♀‬   ‫ھو وا 0004 د ♂ و 00001‬                     ‫ا دد ا‬
                                            ‫ا ع ا ظ أو د ا ل‬                                                                                 ‫أ‬
 ‫ء‬   ‫ا دم وا ف وا‬         ‫ا دم و ا ف و ول إ‬    ‫ا دم و ا ف و ول إ‬
                                                                                      ‫ا دم و ا ف و ا‬            ‫ا دم و ا ف و ا‬        ‫ن وا دھ‬
   ‫ا و ا ط‬                     ‫ت ا‬                 ‫ا‬    ‫د‬
 ‫ت‬      ‫د ل ا‬               ‫ت وم‬      ‫ول إ‬       ‫ت‬     ‫ظما‬                                             ‫ر ت‬       ‫و د را‬
                                                                                 ‫ت‬      ‫د راط‬                                            ‫دورھ‬
    ‫ا و‬      ‫ا‬                 ‫راد‬   ‫ا‬                  ‫ا‬                                                           ‫اد‬

                    ‫ذ: و فا د‬           ‫ا‬                                                                    ‫: - 181 -‬           ‫ا‬
           ‫ل‬               ‫و ، وھ ا‬                 ‫ءا‬                             ‫ا‬             ‫ا‬         ‫ءا د‬    ‫فا‬
‫ا و ــــــــــ 7‬            ‫1 و 7.‬                  ‫. أ ظر ا و‬               ‫زا‬        ‫ءا‬              ‫ا ر تا‬   ‫ا ر تا و و‬
                   ‫1‬      ‫او‬
                   ‫زا‬      ‫ءا‬      ‫أ‬                      ‫إ :‬            ‫زا‬            ‫ءا‬            ‫و أو أ‬           ‫ءا‬            ‫ما‬        ‫ن‬     ‫و‬

                                                                                                        ‫ء و رز :‬                              ‫- أ‬
                                                                                            ‫ر .‬          ‫ع ا ظ وا دة ا‬                       ‫ھ ا‬
                                   ‫ا وز ن‬
                                       ‫ا دة ا ر‬
                                        ‫ا عا ظ‬
                                                                                  ‫ط :‬       ‫ء و‬      ‫- أ‬
                                                          ‫‪Peyer‬‬       ‫ھ ا ط ل و ا وز ن وا زا دة ا دود و‬
                                       ‫و‬       ‫د‬           ‫ن‬    ‫ءوا دا و و ور ما‬               ‫ءا‬
                                   ‫اط ل‬
                                                          ‫ك ا و وھ روق‬          ‫ا‬        ‫وز‬      ‫ت‬
                                                             ‫ء‬     ‫فا‬   ‫ا ف وض ا دم و ر ط‬           ‫ري‬
                                                                                                  ‫ا و .‬
                                   ‫ر‬
                                   ‫‪Peyer‬‬




                                                   ‫: ‪L'immunocompétence‬‬                                     ‫ا‬                ‫با‬        ‫ج–ا‬
                                                                                                                                     ‫ؤال :‬
     ‫. و دث‬          ‫ط‬                ‫و‬                ‫ت و‬                    ‫ر‬    ‫ت ا و ‪ B‬و‪T‬‬                                     ‫ا ر‬
       ‫دة‬            ‫س‬          ‫وا ط ا‬               ‫را د‬                 ‫ع ا ظ وا دة ا ر ، و‬                                      ‫ا‬       ‫ھذا ا‬
                                                                       ‫دة إ رات ز .‬        ‫ر. و‬                                       ‫ن ط ا‬
   ‫و ت.‬            ‫ن طرف ا‬                     ‫ا‬          ‫با‬          ‫2،3، 4 و 7 ن أ ن و ف م ا‬                                       ‫ن او‬    ‫اط‬

‫ا و ــــــــــ 7‬                                                  ‫2‬     ‫او‬
                                       ‫و ‪T‬‬                                              ‫و ‪B‬‬

                        ‫أ ل‬                                              ‫أ ل‬
                                                                  ‫ع ظ‬




                          ‫ا ذر‬                                             ‫ا ذر‬

                         ‫أ ل‬                                                      ‫و‬
                           ‫ر‬
                                                                                 ‫ل‪B‬‬
                                                                                                        ‫ع‬   ‫ا‬
                                                                                                                ‫ا ظ‬
                          ‫ر ا‬
                                                                                                                      ‫ا‬
                                                                  ‫دة‬




                                                                                                                      ‫عا ظ‬




                                                    ‫ر‬      ‫و‬                 ‫ل‬
                                                                  ‫ر‬




                                                                                 ‫7‪IL‬‬         ‫م‬    ‫دأ‬


                        ‫‪CMH - II‬‬                        ‫‪CMH - I‬‬                              ‫ر‬    ‫و ‪B‬‬

                                   ‫ت‪T‬‬


                                                                                                 ‫و ‪B‬‬

                            ‫و 4‪T‬‬                        ‫و 8‪T‬‬

                   ‫ذ: و فا د‬               ‫ا‬                                                                     ‫: - 281 -‬               ‫ا‬
     ‫ا و ــــــــــ 7‬                                                               ‫ل‪T‬‬        ‫ا‬     ‫و‬    ‫ط ت ول ط‬      ‫4:‬    ‫او‬

                            ‫رف‬   ‫و‬                                                 ‫د ن،‬       ‫ن‬ ‫ن‬      ‫ل‪T‬ا و‬       ‫ون ا‬
                            ‫د‬  ‫ودا‬                                                              ‫:‬          ‫وي ل وا دة‬
                                                                               ‫‪V‬‬    ‫زء ت ) ط ‪ ( C‬د دا ل ا ء‬
                                                                                                    ‫‪.T‬‬         ‫ا و ز‬
                                                                                     ‫و ا رج‬       ‫ر) ط ‪( V‬‬        ‫زء‬
                                                                                    ‫رو ن‬         ‫و ؤول ن ا رف ا‬
‫رة‬         ‫ط‬      ‫‪V‬‬                                                                         ‫دي.‬       ‫‪ CMH‬وا دد ا‬
                                                                          ‫‪C‬‬
                                                                                     ‫و ن ن‬         ‫ز‬        ‫ت دة ن‬     ‫د ت‬
                                                                                      ‫ود أو دم و ود‬     ‫و ‪ ،T‬ب و‬       ‫ا ر تا‬
                        ‫‪α‬‬




                                      ‫‪β‬‬
           ‫ط‬      ‫‪C‬‬
                                                                                            ‫ز ذ ك:‬        ‫.‬             ‫ز ت‬
                                                                                   ‫ل 4‪ CD‬و درة‬           ‫ت ا و 4‪:T‬‬     ‫ا ر‬
                                                                                   ‫ز ‪.CMH – II‬‬           ‫ا رف وا ر ط‬
 ‫ء‬                                                                                 ‫ل 8‪ CD‬و درة‬          ‫ت ا و 8‪: T‬‬     ‫ا ر‬
                                                                                    ‫ز ‪. CMH - I‬‬          ‫ا رف وا ر ط‬
                            ‫ل‪T‬‬              ‫و ت‪B‬‬   ‫لا‬          ‫=‬         ‫‪IgM‬‬


                                                                                                              ‫واب :‬

                ‫ت‬       ‫ا عا ظ ، ث ر ب‬           ‫ا‬   ‫با ر تا و ‪B‬‬
      ‫ن‬       ‫ن د ن‬        ‫ون ن‬   ‫) ا و 4 و 7(، وا‬    ‫ما‬     ‫دات ا‬     ‫د‬
             ‫مو‬   ‫دات ا‬       ‫د‬      ‫)‪(C‬‬      ‫م ط‬        ‫ن، ل‬      ‫ن‬   ‫و‬
                                        ‫د.‬ ‫رة ) ‪ ( V‬ر ب و دات ا‬      ‫ط‬

             ‫و تا‬           ‫ذف ا‬  ‫ء ل‬               ‫و ‪B‬‬                ‫ا ر تا‬      ‫،‬      ‫تا‬                   ‫د ر با‬
                            ‫ا عا ظ .‬               ‫ن طرف‬               ‫و‬  ‫د ا ذا ا‬   ‫و دات ا‬                   ‫ظ ر ار ط‬

            ‫د‬      ‫ت‬     ‫ا دة ا ر ، ث ر ب‬           ‫ا‬      ‫با ر تا و ‪T‬‬
              ‫د ن م ل وا دة: زء ت ) ط ‪ ( C‬د‬      ‫ن‬       ‫ون ن‬    ‫ت ‪ T‬وا‬     ‫ا‬
            ‫و ا رج و ؤول ن‬     ‫ر) ط ‪( V‬‬      ‫‪ . T‬و زء‬         ‫دا ل ا ء ا و ز‬
             ‫ط‬     ‫دات ر ط ز ‪،CMH‬‬        ‫ل‬       ‫ا رو ت ا رو‬           ‫ا رف ا‬
                                      ‫د ) ‪.( CPA‬‬    ‫ود ا‬    ‫ر‬      ‫د أو‬
              ‫وى ا ط‬                ‫م‬         ‫ا ء وا‬             ‫ا و ت ‪ T‬ول‬     ‫ت ‪،T‬‬                             ‫د ر با‬
            ‫و ، د أن:‬             ‫ر تا‬           ‫زة ذا‬         ‫ر ، ث م د م ز ت ‪ CMH‬ا‬                          ‫دة ا‬   ‫ا ر‬

     ‫4‪ CD‬و‪TCR‬‬                 ‫ز‬      ‫د ذك إ‬        ‫ل و ر ط ب ‪ CMH – II‬ن‬                            ‫ا ر تا و ا‬
                                                                   ‫و 4‪.T‬‬                          ‫ذك ر ت‬    ‫و‬

       ‫8‪ CD‬و‪TCR‬‬               ‫ز‬      ‫د ذك إ‬         ‫ل و ر ط ب ‪ CMH – I‬ن‬                            ‫ا ر تا و ا‬
                                                                   ‫و 8‪.T‬‬                          ‫ذك ر ت‬    ‫و‬

                                               ‫ذف و وت.‬            ‫‪CMH‬‬             ‫رف‬     ‫م‬        ‫و ا‬        ‫ا ر تا‬

           ‫ا ذا‬         ‫ل‬         ‫ظ ، وا ذي‬             ‫ا ذا‬       ‫ل‬      ‫ن ا ذي‬              ‫ءا‬          ‫ء‬     ‫ھذا ا‬
                                                                                                                     ‫وت.‬
                        ‫ذ: و فا د‬       ‫ا‬                                                         ‫: - 381 -‬      ‫ا‬
 ‫ر ،‬          ‫دة ا‬             ‫وى ا ط ا‬                     ‫ء‬                   ‫و‬   ‫ا ر تا‬       ‫ء ا ول‬ ‫دا‬
              ‫د أن:‬         ‫ا ر تا و ،‬                ‫ز ‪ CMH‬إ‬                       ‫رو‬   ‫ث م د م دات ا ذا‬

       ‫،‬      ‫ور ط‬          ‫دات ا ذا‬             ‫‪T‬‬                      ‫رف وا ط‬         ‫وف‬         ‫ا ر تا و ا‬
                                                                                                     ‫ذف و وت.‬

     ‫ل وف‬                 ‫دات ا ذا ، و‬                ‫‪T‬‬              ‫ن رف وا ط‬      ‫و ا‬                       ‫ا ر تا‬
                             ‫.‬         ‫و‬          ‫ر‬               ‫شو‬      ‫دات ر ا ذا ،‬                         ‫رف‬

             ‫ا ذا‬     ‫ل‬          ‫وت وا ذي‬             ‫ا ذا‬        ‫ل‬          ‫، ن ا ذي‬        ‫ءا‬         ‫ء‬      ‫ھذا ا‬   ‫و‬
                                                                                                                   ‫ظ .‬

                                           ‫وي. ‪Médiation cellulaire‬‬                ‫ك‬      ‫ذات‬    ‫ا‬                   ‫3ا‬
                                                             ‫8.‬       ‫1 و‬      ‫: أ ظر ا و‬     ‫لا‬   ‫ر‬            ‫أ–‬
‫ا و ــــــــــ 8‬
                                           ‫‪BK‬‬                                                            ‫لا‬   ‫1: ر‬        ‫او‬
     ‫وت‬                                                            ‫ھد‬    ‫و ي‬
                                                                                              ‫ن‬         ‫نو و‬        ‫با‬
                      ‫د 51 و‬                                                                     ‫ل ن طر ق ر‬          ‫ا د ت‬
                                                                                              ‫ت وخ ‪Bacille de‬‬
                                                                                              ‫‪ .(BK) koch‬إذ ط ور ھ ذه‬
                                           ‫‪BK‬‬                            ‫‪BCG‬‬                  ‫ا ر وا ظ م‬       ‫ا ر و دا ل‬
     ‫ء‬                                                            ‫و ي‪A‬‬                        ‫ن. و د ا ف ح د ھ ذا‬          ‫وا‬
                      ‫د 51 و‬                                                                  ‫ن‬       ‫ا رض ن ط رف ا ر‬
                                                                                                      ‫‪ Calmette‬و‪،Guérin‬‬
                                                                                              ‫دث‬      ‫ل ‪ .BCG‬وھ و‬     ‫ھ ذا ا‬
                                           ‫‪BK‬‬                                 ‫لا و ي‪A‬‬         ‫دون إ داث‬                      ‫ا‬
     ‫وت‬                                                           ‫و ي‪B‬‬                                               ‫ا رض.‬
                      ‫د 51 و‬                                                                  ‫و ت‪A‬‬           ‫رب‬     ‫ما م‬
                                                                                                  ‫س ‪ CMH‬أي أ‬         ‫و‪ B‬و‪C‬‬
                                                                                                          ‫.‬           ‫ت‬
                                                                              ‫و تا و ي‪A‬‬                 ‫ھذه ا رب وا‬      ‫ل‬
                                           ‫‪BK‬‬
     ‫ء‬                                                            ‫و ي‪C‬‬                                 ‫ھذه ا‬     ‫را د‬        ‫ا‬
                                                                                                                    ‫.‬        ‫ا‬
                      ‫د 51 و‬
                                                                                              ‫‪Le cobaye est un petit‬‬
                                                                                              ‫‪rongeur‬‬


 ‫ر‬         ‫دة، و‬      ‫ر‬         ‫ل، إذن ھ‬                      ‫ر ‪ ،BK‬وذ ك‬                 ‫وت ا و ي ا ھد د‬
                                                                                    ‫د (.‬   ‫را ر ذا ) و د ا‬
     ‫د‬       ‫أن ‪ BCG‬أ د ت‬                   ‫دل‬       ‫ب ‪،BK‬‬               ‫د‬          ‫ا و ي‪A‬‬              ‫د ن ‪BCG‬‬
                                                                                    ‫ر ‪.BK‬‬             ‫د‬      ‫ا و ي‪A‬‬
         ‫د ‪،BK‬‬                 ‫لا و ي‪A‬ا‬                       ‫ل‬         ‫ب ‪ ،BK‬ر م أ‬               ‫وت ا و ي ‪ B‬د‬
                                                             ‫ل.‬       ‫د ‪ BK‬و د ا‬                     ‫أن ا دة ا‬ ‫دل‬
            ‫أن‬         ‫دل‬       ‫ب ‪،BK‬‬             ‫د‬         ‫ا و ي‪C‬‬                  ‫و ت ا و ي ‪،A‬‬                     ‫د‬
                                                      ‫ا و ي د ‪.BK‬‬                   ‫و ھ ا ؤو ن‬                      ‫ا ر تا‬

                    ‫ذ: و فا د‬          ‫ا‬                                                          ‫: - 481 -‬     ‫ا‬
 ‫د ‪ ،BK‬وم‬                   ‫ود ا‬   ‫ا رف‬       ‫با ر تا و‬                                                                      ‫د ن ا وان ب ‪BCG‬‬
   ‫ھ‬   ‫لا‬                  ‫ن طر ق و ط وي، ن ا‬   ‫و‬                                                                                ‫ھذه ا‬  ‫د ره و‬
                                                                                                                                ‫ھ ا ر تا و .‬

                                         ‫8.‬            ‫2 و‬              ‫و ت ‪ :T‬أ ظر ا و‬                  ‫ف ن روط د ل ا‬                              ‫ب–ا‬
 ‫ا و ــــــــــ 8‬
                            ‫‪Les lymphocytes T cytotoxiques‬‬                                          ‫.‬     ‫و ت‪T‬ا‬                  ‫ف ن روط د ل ا‬                ‫2:ا‬       ‫او‬
 ‫ؤم‬    ‫ل ربا‬           ‫د ا ران )‬                 ‫وذة ن‬                   ‫أو ط زرع‬          ‫ر‬        ‫با‬   ‫أ‬        ‫ر‬          ‫،‬      ‫د د ظروف إ‬      ‫ء‬
                                                                                                                                 ‫‪.( H2k‬‬          ‫ا‬
                                     ‫.‬            ‫ر‬       ‫‪ ،B‬ا و ط ا ث‬                                 ‫:‬   ‫‪ ،A‬ا و ط ا‬                 ‫ا و ط ا ول :‬
 ‫‪A‬‬            ‫إ‬        ‫ق‬        ‫أو‬               ‫وذة ن ران ن س أ ل ا ذر ،‬                           ‫ر ت و ‪T‬‬          ‫ا و طا‬     ‫ا د‬          ‫ف‬
                                                                                                    ‫.‬    ‫ل‬   ‫ا‬      ‫ا‬   ‫‪ .B‬و ن ا دول أ‬          ‫أو‬
                   ‫أو ط ا زرع‬            ‫‪A‬‬             ‫دا‬          ‫ود‬     ‫‪B‬‬        ‫دا‬          ‫ود‬                 ‫ر‬                      ‫رب‬    ‫د إ دة س ا‬
                   ‫(‬        ‫)‬                                                                                                            ‫وذة‬     ‫د‬     ‫ل‬
                                                                                                                                         ‫ل ر ب ا ؤم‬    ‫ن ران‬
‫و ت‪T‬‬        ‫در ا‬                                                                                                                         ‫ط م‬     ‫‪،H2d‬‬        ‫ا‬
                                                                                                                                         ‫و ت‪T‬‬      ‫وا ط‬      ‫ا‬
                                                                                                                                             ‫وذة ن ران ن ا‬
                                                                                                                                                          ‫‪H2k‬‬
                                                        ‫‪LT‬‬                         ‫‪LT‬‬                        ‫‪LT‬‬
  ‫أ د ر ت‬                                                                                                                                   ‫لا ط تا ر‬
  ‫‪T‬‬  ‫و‬                ‫‪LT‬‬                         ‫طم‬         ‫دم ا‬              ‫طم‬    ‫دم ا‬                     ‫طم‬       ‫دم ا‬                  ‫وا رج روط ھ دم ا‬
                                                                                                                                         ‫ن ط رف ا و ت‬       ‫ا‬
                                                                                                                                                          ‫‪.T‬‬
  ‫نا‬
  ‫‪A‬‬
                                                        ‫‪LT‬‬                         ‫‪LT‬‬                        ‫‪LT‬‬                                         ‫‪A‬‬           ‫ا‬
‫أ ذا و ت‪ T‬د‬                ‫‪LT‬‬
                                                                                                                                            ‫د‬           ‫ددات‬
 ‫أ وع ن ا ن‬                                        ‫طم‬                          ‫طم‬       ‫دم ا‬                 ‫طم‬       ‫دم ا‬                              ‫‪A‬‬


  ‫نا‬                                                                                                                                                    ‫‪B‬‬           ‫ا‬
  ‫‪B‬‬
                                                        ‫‪LT‬‬                         ‫‪LT‬‬                        ‫‪LT‬‬                                 ‫د‬            ‫ددات‬
‫أ ذا و ت‪ T‬د‬                                                                                                                                         ‫‪B‬‬
 ‫أ وع ن ا ن‬                ‫‪LT‬‬                    ‫طم‬         ‫دم ا‬                   ‫طم‬                        ‫طم‬       ‫دم ا‬


       ‫ق‬          ‫م‬         ‫،‬                ‫ا‬               ‫طما‬               ‫و ‪LT‬‬                 ‫لا ر تا‬                      ‫م‬     ‫لا ر ا و‬
                                                                                                                                     ‫ھذه ا ت.‬  ‫ا رف‬
       ‫‪ A‬ط، وا‬                                     ‫ا‬               ‫طما‬              ‫و ‪LT‬‬                 ‫لا ر تا‬                            ‫لا ر ا‬
                                                                                                                                           ‫.‬   ‫ق ا رف‬
       ‫‪ B‬ط، وا‬                                     ‫ا‬               ‫طما‬              ‫و ‪LT‬‬                 ‫لا ر تا‬                            ‫لا ر ا‬
                                                                                                                                           ‫.‬   ‫ق ا رف‬
      ‫ن طرف‬                 ‫م د ر أي‬                               ‫‪،H2k‬‬             ‫ؤم ا‬        ‫ل س ر با‬                                         ‫ل‬    ‫دا‬
                                                                                                                                                 ‫و ت ‪.LT‬‬                ‫ا‬

                      ‫ذ: و فا د‬                    ‫ا‬                                                                                 ‫: - 581 -‬           ‫ا‬
               ‫، وذ ك ر‬    ‫ا‬                                 ‫ن ن ھذه ا رب أن ا ر ت ا و ‪ T‬رف و دم ا‬
         ‫وا ط رو ت ر ب‬                                     ‫ا‬     ‫ط ا‬        ‫ر ا ذا ا رو‬   ‫د‬      ‫ا ددات ا‬
          ‫د وا ه و د‬  ‫ود ا‬                                   ‫ا دف ا‬   ‫. إذن ھو رف زدوج : ا ه ا‬      ‫ا ؤم ا‬
                                                                                               ‫.‬     ‫د‬   ‫ا‬
     ‫9.‬             ‫1 و‬           ‫ت: أ ظر ا و‬              ‫ز و ن‬            ‫ت‬         ‫ورا ر تا و ‪T‬‬
‫ا و ــــــــــ 9‬
‫ا دف.‬               ‫طما‬           ‫دث‬       ‫تا‬       ‫أو ا‬        ‫8 ، دد ا‬     ‫2 و‬       ‫رب ا و‬                 ‫را‬             ‫لا‬              ‫لا‬             ‫1:‬       ‫او‬

                ‫و ت‬           ‫ا‬                     ‫و ت‬         ‫ا‬                      ‫و ت‬      ‫ا‬                                                    ‫ؤم ا‬      ‫ربا‬
                          ‫‪LT‬‬                                ‫‪LT‬‬                                  ‫‪LT‬‬


                                                                                                                              ‫د‬                  ‫ددات‬
            ‫‪c‬‬                                   ‫‪b‬‬                                  ‫‪a‬‬                               ‫ت رب‬                      ‫و‬
         ‫ا دف‬             ‫ا‬                     ‫ا دف‬        ‫ا‬                      ‫ا دف‬          ‫ا‬                                ‫ؤم ا‬           ‫ا‬
                                                                                                                   ‫دد‬       ‫تا‬               ‫و‬
                                                                                                                             ‫دي‬                  ‫ا‬          ‫ل‪T‬‬       ‫ا‬


                                                                                                ‫دي.‬                 ‫دد ا‬          ‫تا‬                        ‫و‬

                              ‫دي.‬          ‫دد ا‬                 ‫ا ر‬            ‫ا ص‬                       ‫ؤم ا‬       ‫ت ر با‬                                  ‫و‬
        ‫ل إ إذا ن‬                          ‫ا دف وا ذي‬ ‫ل ھذا ا ت ا زدوج ن ا ر ا و ‪ T‬وا‬  ‫إذا‬
         ‫ا‬    ‫د رت‬                         ‫ر ا ت، ون ا ر ا و‬   ‫ل وي ن وا ا ت وا‬       ‫ھ ك‬
                                                                     ‫ذ ا وم.‬      ‫ا دف دأ‬
‫ا و ــــــــــ 9‬
            ‫ا‬    ‫و ت ‪Tc‬‬                ‫أ رز ف رف ا‬            ‫ن ط ت ھذه ا و‬        ‫اط‬                ‫.‬                  ‫ا‬          ‫2 : رف آ ت ا‬                      ‫او‬
                 ‫و ت ‪.Tc‬‬                         ‫دف‬
                                        ‫وا 9.ن طرف ا‬                      ‫ر‬
                                                             ‫ا دف،: مأ ظر ا ا وھدم ا 2‬                    ‫ا‬                 ‫ج–آ تا‬




    ‫‪Tc‬‬          ‫و‬                                                                         ‫‪Tc‬‬         ‫و‬
                                       ‫ل‬    ‫طور ا‬                   ‫ل3‬   ‫ا‬                                                                                      ‫ل1‬       ‫ا‬
                                                                                       ‫ل‪T‬‬
                                                                                        ‫‪TCR‬‬                                              ‫‪CMH - I‬‬

                                                                                                                                         ‫د‬               ‫ودا‬



                                                                    ‫ل4‬   ‫ا‬                                                                                      ‫ل2‬       ‫ا‬

        ‫=‬       ‫وم‬        ‫ا‬                     ‫=‬   ‫ر ور ن‬                    ‫=‬        ‫ربأ و‬                            ‫=‬    ‫را ز م‬

                      ‫ذ: و فا د‬             ‫ا‬                                                                      ‫: - 681 -‬                         ‫ا‬
                                               ‫‪ – a‬طور ا ث: ‪Phase d induction‬‬
         ‫ا ر‬   ‫ن طرف ا‬    ‫( إ ا و ط ا دا ، م‬                           ‫د)‬      ‫د د ول و د ا‬
     ‫رض ا ددات‬     ‫د(ا‬  ‫‪Langerhans‬‬       ‫رة و‬                     ‫تا‬     ‫د ‪ ) CPA‬ا‬     ‫ود ا‬
      ‫ء‬   ‫ث ما‬    ‫لإ ا دا و‬   ‫ز ‪، CMH‬‬                             ‫د اد ل‬     ‫د ود ا‬         ‫ا‬
          ‫‪:CPA‬‬     ‫وا ط‬ ‫د ا رو‬       ‫ددات ا‬                         ‫ر تا و ‪T‬ا و‬             ‫ا‬

                 ‫دي ا روض ن طرف ‪. CMH-I‬‬                ‫دد ا‬   ‫ا‬       ‫رف‬    ‫و ت 8‪T‬‬         ‫ـا‬
                 ‫دي ا روض ن طرف ‪.CMH-II‬‬                ‫دد ا‬   ‫ا‬       ‫رف‬    ‫و ت 4‪T‬‬         ‫ـا‬

    ‫‪Médiateur immunitaire‬‬               ‫رز و ط‬ ‫‪ CPA‬ا‬      ‫ط‬      ‫ؤدي ھذا ا ر ط إ‬
         ‫دد‬     ‫4‪ T‬و 8‪ T‬ا و‬            ‫طا ر تا و‬     ‫ا ر و ن 1 وا ذي ؤدي إ‬
                                                                      ‫دي.‬        ‫ا‬

          ‫رو ن 2‬      ‫ھو ا‬       ‫رھ و إ رازھ و ط‬        ‫ط ا ر ت ا و 4‪ T‬إ‬         ‫ؤدي‬
                                                            ‫) 2‪ (IL‬و‪.( Interféron ) IFNγ‬‬

     ‫ر و ن 2، م‬                      ‫ت‬             ‫ط ا ر ت ا و 8‪ T‬إ ر‬      ‫ؤدي‬
                                                ‫ت وق ا ء ا و ز .‬      ‫ھذه ا‬    ‫و‬

                                     ‫م: ‪Phase d'Amplification‬‬              ‫‪ – b‬طور ا‬
                                                                          ‫ر ن:‬             ‫مإ‬
                                                 ‫ر: ‪Période de multiplication‬‬ ‫ا‬            ‫ر‬

‫رو ن 2‬                  ‫تا‬       ‫ا‬     ‫ط ا ر ت ا و 8‪ T‬ا و رة‬   ‫م‬      ‫ل ھذه ا ر‬
  ‫ن‬              ‫ون‬      ‫ت ‪ ،Des Clones‬ل‬       ‫و‬  ‫ر ھذه ا ر ت ا و‬      ‫وا ط 2‪.IL‬‬
                       ‫‪.Expansion clonale‬‬    ‫م ذك ن ر ا و ا‬       ‫و وا دة‬       ‫ر‬

                                               ‫ا ر ق: ‪Période de différenciation‬‬           ‫ر‬

      ‫‪( LTc ) Tc‬‬      ‫ا‬      ‫و‬           ‫ر ت‬      ‫و 8‪ T‬إ‬      ‫ول ا ر ت ا‬            ‫ل ھذه ا ر‬
         ‫ا ر ور ن ‪.La perforine‬‬                 ‫ز ت رو‬              ‫ت و‬            ‫و‬       ‫وي‬

                                               ‫ذ: ‪Phase effectrice‬‬         ‫‪ – c‬طور ا‬

‫م‬     ‫ا‬     ‫ر‬ ‫) ‪ ( LTc‬ا د ا و و‬     ‫ا‬      ‫ل ھذا ا طور در ا ر ت ا و 8‪T‬‬
         ‫د ا د ل وا ط ‪.CMH-I‬‬  ‫د ود ا‬         ‫ددات ا‬      ‫ا ما ر‬      ‫ن‬
     ‫دي ا روض‬       ‫ا دد ا‬   ‫‪،( TCR ) T‬‬            ‫رف ا ر ت ا و ‪ Tc‬وا ط‬
    ‫. ) ھم ھذا ا رف ا وا ت 8‪.( CD‬‬       ‫رف ا‬     ‫ھذا ا رف‬    ‫وا ط ‪ ،CMH-I‬و‬

      ‫ز ت ا ر ور ن‬    ‫وم ++‪ Ca‬د‬                ‫رر ‪ LTc‬ا ر ور ن وأ ز ت ا را ز م. و ود ا‬
    ‫طأز ت‬       ‫ا دف ر ا وب‬     ‫ا‬              ‫ا دف د و . رب ا را ز م إ‬            ‫ءا‬
                                                        ‫ا دف و و .‬     ‫ؤدي إ ھدم ‪ ADN‬ا‬
                ‫ذ: و فا د‬    ‫ا‬                                         ‫: - 781 -‬       ‫ا‬
                                              ‫ط . ‪Médiation humorale‬‬                                        ‫ك‬         ‫ذات‬         ‫ا‬               ‫4ا‬
 ‫ا و ــــــــــ 9‬        ‫9.‬         ‫3 و‬           ‫ا ط : أ ظر ا و‬                           ‫ا‬                     ‫نا‬          ‫ر‬   ‫فا‬         ‫أ–ا‬
 ‫، وذ ك ل و د ن وان دو ن‬                          ‫ر‬        ‫ض رو ت ا ل ا د وي ) ر و ت ( وا ط ا رة ا‬                                      ‫س‬         ‫3:‬    ‫او‬
‫ن ا زازي ا وھن.‬ ‫ن ر م‬                             ‫ن‬         ‫، وذ ك ل و د 51 و‬    ‫ل‬      ‫ا‬   ‫ن 1 و2 ا‬ ‫لا‬                                 ‫ا زاز.‬
                                                                                   ‫ن 1 و2 ؟‬   ‫ن ر ا‬                                      ‫كا‬    ‫ذا‬    ‫1(‬

         ‫ن دو ن ا زاز‬         ‫ل2: د‬       ‫ا‬                       ‫ن دو ن ا زاز‬            ‫ل2: ل‬              ‫ا‬             ‫د ا زاز‬        ‫م ن وان ر‬
                                ‫ز ل‬                                                            ‫ز ل‬                            ‫وا ط ا ر و ت ‪ γ‬د ز‬
‫ت‬     ‫ا رو‬             ‫رو ت‬                                  ‫ت‬    ‫ا رو‬                                                     ‫، م ن د‬          ‫ا‬    ‫وا ط ا‬
                                                                                                                               ‫ا ر‬      ‫ن ا زاز.‬     ‫ذ ك‬
                                                                                  ‫رو ت‬                                     ‫ل دم ا ر و ود ر و ت‬      ‫و ط‬
              ‫‪γ‬‬                                                                                                                    ‫ن ا زاز.‬            ‫‪γ‬‬
                         ‫1‪β α‬‬                                             ‫‪γ‬‬           ‫1‪β α‬‬         ‫2‪α‬‬                       ‫ذا ل ھذه ا ر و ت ‪γ‬‬   ‫2(‬
                                                                                                                                       ‫؟ و ھو دورھ ؟‬

 ‫-‬                                                ‫+‬           ‫-‬                                                   ‫+‬
                   ‫رة‬    ‫ها‬     ‫ا‬                                         ‫رة‬          ‫ها‬       ‫ا‬

              ‫ل‬       ‫ض رو ت ا‬        ‫ن ا زاز وھن ؤدي إ ار ع‬                                                               ‫ظ أن ن ا ر‬      ‫1(‬
     ‫ھ‬            ‫ھذه ا‬      ‫ا ر و ت ‪ .Globuline γ‬ر أن ا دة ا‬                                                              ‫ط ار ع‬     ‫ا د وي و‬
                                                                                                                            ‫رة ن ر و ن ‪. γ‬‬
            ‫أن ھذه ا ر و ت ‪ γ‬ھ‬         ‫ا ر ن ن ا زاز، وھذا دل‬        ‫2( وم ا ر و ت ‪γ‬‬
          ‫( دى‬   ‫) ا و ط ا دا‬        ‫ل ا وان ا‬        ‫، وھ دة و د‬   ‫ھذه ا‬        ‫ا دة ا‬
                                                 ‫ن طر ق و ط ط .‬              ‫م نا‬
     ‫و دات‬              ‫ار ط‬   ‫دورھ‬     ‫دات أ م ‪ .Les anticorps‬و‬    ‫ل ادن ا ر و ت ‪γ‬‬
      ‫رب‬                 ‫د"‬  ‫د أ م – ود ا‬      ‫ا ر ب"‬       ‫و‬    ‫طل‬       ‫د ) ا ن(‬    ‫ا‬
                                                                ‫‪.Complexe immun‬‬       ‫ا‬

                                                                                        ‫م:‬      ‫دات ا‬    ‫ف‬                        ‫وأ‬     ‫ب–‬
‫ا و ــــــــــ 01‬                                            ‫01‬         ‫1 و‬           ‫م: أ ظر ا و‬     ‫دات ا‬                             ‫‪–a‬‬
                                          ‫م‬           ‫دا‬      ‫ط‬     ‫ل‬    ‫ل3:‬          ‫ا‬                                                          ‫1:‬       ‫او‬
     ‫ت‬         ‫و‬
         ‫دد‬   ‫ا‬
                        ‫2‪NH‬‬                                ‫2‪NH‬‬
                                        ‫ر‬
‫2‪NH‬‬                                  ‫ا ر ور‬                                   ‫2‪NH‬‬                                                       ‫ل 1: ا ل ا‬            ‫ا‬
                                                                                                                                   ‫م‬   ‫دا‬
                                                                                                                                   ‫‪Anticorps‬‬
                                                                                                                                               ‫2‬
                                                                                                       ‫1‬
                                                                                                                                                  ‫‪Fv‬‬
                    ‫‪COOH‬‬                                   ‫‪COOH‬‬                                                                                               ‫4‬
                                                                                                       ‫‪Fv‬‬
                                                                   ‫ا ت‬        ‫و‬            ‫3‬                                                      ‫‪Fc‬‬
                                                                   ‫تا‬             ‫ا‬                    ‫‪Fc‬‬

                        ‫‪COOH‬‬                           ‫‪COOH‬‬                                                                                           ‫6‬
                                                                                                       ‫5‬
    ‫)‪(C‬‬            ‫ط‬                              ‫رة )‪(V‬‬           ‫ط‬
                                                                                                   ‫م‬        ‫دا‬         ‫ز‬    ‫ري‬         ‫طط‬   ‫ل 2: ر م‬      ‫ا‬
                        ‫ذ: و فا د‬             ‫ا‬                                                                             ‫: - 881 -‬        ‫ا‬
‫‪Les immunoglobulines Ig‬‬                              ‫ا رو تا‬                 ‫ا ر و ت ذا‬                        ‫و‬           ‫م‬        ‫دات ا‬
                                                                           ‫و ن:‬        ‫أ‬                           ‫م‬           ‫دا‬           ‫و ك ز‬

         ‫‪.L‬‬                        ‫ل‬                        ‫ضأ‬         ‫022‬              ‫ن وا‬             ‫و‬       ‫ن‬              ‫ن‬        ‫ن‬
         ‫‪.H‬‬                         ‫ل‬                       ‫ضأ‬              ‫044‬           ‫ن وا‬             ‫و‬       ‫ن‬            ‫ن‬        ‫ن‬

 ‫ل رف‬                                    ‫و‬         ‫ا ر ور و ون‬       ‫طر‬                                ‫وا ط‬             ‫لا ر‬            ‫و ر ط ھذه ا‬
                            ‫ط ن:‬                   ‫ل وي‬      ‫ن ھذه ا‬                                   ‫أن ل‬                ‫لا‬            ‫‪ .y‬و د ن ا‬
    ‫ف.‬            ‫سا‬              ‫ما‬           ‫دات ا‬                         ‫دى‬                   ‫) ‪Constante ( C‬‬                        ‫ط‬

              ‫و‬     ‫د أ م ر. و ل ھذه ا ط‬                                        ‫ن‬                 ‫رة ) ‪Variable ( V‬‬                      ‫ط‬
                   ‫د ن.‬      ‫ود‬   ‫د أي و‬                                         ‫ا‬         ‫دد إذن و‬                    ‫د، وھ ا‬           ‫ت ود ا‬

                                                   ‫01‬       ‫2 و‬              ‫م: أ ظر ا و‬                 ‫دات ا‬             ‫ف‬        ‫‪–b‬أ‬
‫ا و ــــــــــ 01‬
                                                                                                                                     ‫93‬
                                                                                                                                     ‫:2‬      ‫ا و ــــــــ‬
                                                                                                                                         ‫أ ــــ ف‬
                                                                                                                                         ‫ـــ دات‬
                    ‫‪Ig E‬‬                                                                                                                 ‫ــــ م‬       ‫ا‬
 ‫‪Ig D‬‬                                                 ‫‪Ig A‬‬                              ‫‪Ig M‬‬                   ‫‪Ig G‬‬
                                                                                                                                      ‫ــــــــــ‬      ‫%‬
  ‫آ ـــ ر‬           ‫آ ـــ ر‬                  ‫]02 -51[‬                          ‫01‬                          ‫]57 -07[‬                   ‫ـــوع ‪Ig‬‬
  ‫وا ــــرة‬          ‫ــــــت ــــــ‬   ‫* وا ـــــد أ ـــــ *‬      ‫ـــــــ‬        ‫ـــــــ رق ا‬      ‫ــــــ رق ا ــــــ *‬          ‫*‬
      ‫ـــ‬         ‫ـــــــ ا د ـــــــ‬   ‫ـــــ ا ـــــرازات ا‬                     ‫* ظ ـــور ـــر‬                ‫ـــون ـــرة‬      ‫*‬
‫ـــط ‪LB‬‬
                                                                                                                                    ‫ــــ ص‬              ‫ـ‬
                                                                                                                                                   ‫أھـــم ا‬
                           ‫ــــــــ ت‬ ‫ـــــ وا‬      ‫ـــــ‬ ‫*‬                ‫ـــــــ‬     ‫ـــــــل ا‬    ‫ـــــــت و ـــــــ ط‬       ‫*‬
‫ـــــــــ‬   ‫* دور ــــ ا ر ــــ ا‬
                                                                                 ‫ـــــــــ ت ا ـــــــــ رة‬    ‫ـــــــــ ط ا‬    ‫*‬




       ‫ن دد‬                   ‫د ،‬               ‫ا‬           ‫دد و‬         ‫مھ ا‬     ‫دا‬                                ‫ز‬    ‫إن ا ط ا رة‬
    ‫ف ب دل‬                     ‫م‬             ‫دات ا‬           ‫ف ن‬         ‫. و ز دة أ‬                                ‫ا ف ا ذي‬   ‫ا طق ا‬
                                                                       ‫.‬        ‫و ذك‬                               ‫ا ل، وأ ن‬    ‫ر زھ‬
            ‫لا‬         ‫و‬        ‫لا‬           ‫ت‬          ‫ز‬      ‫،و‬               ‫ل و رج ا‬                 ‫أ د ، و د ا‬     ‫‪: IgG‬‬
                                                                                      ‫ت.‬                 ‫ت و ول ا‬    ‫وإ ط ل ول ا‬
    ‫(.‬              ‫رة ا‬         ‫ب،ا‬           ‫ا رازات ) ا د وع ، ا‬                             ‫ا ل أو‬                           ‫أ د‬  ‫‪: IgA‬‬
                                                                 ‫ت.‬                        ‫ت وا‬     ‫ول ا‬                       ‫م ا ط ت و طل‬
         ‫د وا ل‬            ‫ا دم. و د ل‬                         ‫و ت ‪ (B‬أو‬                                  ‫ت‬              ‫أ د )‬              ‫‪: IgM‬‬
                                                                                                                                                ‫ا ن.‬
                                                            ‫و ‪.B‬‬               ‫ط ا ر تا‬                            ‫أ د ، و د‬                 ‫‪: IgD‬‬
       ‫ا رط ا ور .‬                            ‫دا‬      ‫ل، و د ل‬                   ‫ا‬       ‫ف‬            ‫أ د ، و د ر ز‬                          ‫‪: IgE‬‬

                    ‫ذ: و فا د‬            ‫ا‬                                                                             ‫: - 981 -‬             ‫ا‬
‫ا و ــــــــــ 01‬
                                                          ‫01‬       ‫3 و‬         ‫م: أ ظر ا و‬                ‫دات ا‬            ‫‪ - c‬أ ل وع‬
                                                                                                         ‫م.‬        ‫دات ا‬        ‫وع‬      ‫ل ا ورا‬       ‫3:ا‬       ‫او‬

  ‫.و مذك‬                ‫ا‬                            ‫وا رى‬    ‫ا‬                       ‫ور ن، وا دة‬   ‫ھو ت ر‬     ‫إن ر ب ا ر و ن ا‬
      ‫را‬            ‫و‬      ‫دا ر تا‬                   ‫د. إن ھذه ا ور ت ون‬           ‫و دات ا‬    ‫ا ر ت ا و ‪ B‬و ل أي س‬            ‫ل ر‬
                        ‫د .‬                            ‫د ق‬  ‫خ ب ر‬                    ‫لا‬         ‫. ث م‬    ‫طول ا‬         ‫ل أ زاء‬

                                                                                                                                 ‫ن‬  ‫ف ا ور ا ؤو‬
‫2‪V‬‬       ‫3‪V‬‬    ‫4‪V‬‬                       ‫001‪V‬‬      ‫2‪D‬‬      ‫2‪D‬‬         ‫4‪D‬‬       ‫1‪J‬‬   ‫2‪J‬‬            ‫6‪J‬‬           ‫‪C‬‬                 ‫ن أر‬      ‫ا‬      ‫ر با‬
                                                                                                                                   ‫روف‬       ‫أ زاء ر إ‬
                                                                                                                                         ‫‪ C,J,D,V‬و‬
                                ‫3‪V‬‬           ‫1‪D‬‬      ‫2‪J‬‬        ‫‪C‬‬                                                                              ‫41‬       ‫ا‬
                                                                                                                              ‫ف ا ور ا ؤو ن‬
              ‫41:‬                   ‫ا‬                                                                                              ‫ن‬      ‫ا‬      ‫ر با‬
                                                                                                                            ‫روف ‪C,J,V‬‬        ‫أ زاء ر إ‬
                                                                                                                                   ‫2.‬     ‫ا‬         ‫و‬
                                                                                                                             ‫ن ا ز اء ‪V‬‬      ‫ھ ك دة‬
              ‫2:‬                ‫ا‬                                                                                                ‫و ‪ D‬و ‪ .J‬وھذه ا ور ت ھ‬
                                        ‫2‪V‬‬      ‫1‪J‬‬        ‫‪C‬‬                                                                        ‫ا ؤو ن ر ب ا ط‬
                                                                                                                                                ‫رة.‬    ‫ا‬
                                                                                                                           ‫وا دة ن ا زء ‪،C‬‬       ‫ھ ك‬
                                                                                                                              ‫وھذه ا ور ھ ا ؤو ن‬
  ‫1‪V‬‬      ‫2‪V‬‬       ‫3‪V‬‬           ‫4‪V‬‬                   ‫003-001‪V‬‬       ‫1‪J‬‬    ‫2‪J‬‬       ‫5‪J‬‬                ‫‪C‬‬                                ‫.‬    ‫ر با ط ا‬


     ‫م‬        ‫دات ا‬  ‫ا وع ا ل‬                                      ‫ن، و‬        ‫د‬        ‫ود‬   ‫م ون و‬      ‫دات ا‬                                    ‫ل ط ن‬
                ‫ث ت ط تا د‬                                     ‫‪Réarrangement‬‬        ‫‪génétique‬‬   ‫إ دة ا ر ب ا ورا‬                                      ‫نآ‬
                                                                                                                                                  ‫ا ورا أن:‬
     ‫روف :‬                      ‫رإ‬             ‫‪Minigènes‬‬      ‫ن أر أ زاء‬      ‫اط‬     ‫‪ H‬م ر‬      ‫لا‬       ‫ا‬
                   ‫41.‬                       ‫ا‬     ‫و‬   ‫‪ variabilité V‬و‪ Constante C‬و ‪ Diversité D‬و‪jonction J‬‬

     ‫2.‬             ‫ا‬                    ‫و‬        ‫ھ :‪ C‬و‪ V‬و‪. J‬‬                 ‫ث أ زاء‬           ‫ن‬            ‫اط‬           ‫‪ L‬م ر‬             ‫لا‬             ‫ا‬
                                                               ‫11‬        ‫1 و‬       ‫م: أ ظر ا و‬                     ‫دات ا‬             ‫‪-d‬إ ج‬
‫ا و ــــــــــ 11‬
                                                                                                                           ‫م.‬        ‫دات ا‬    ‫1: إ ج‬            ‫او‬
                                                                                                              ‫إد ل‬‫دا ل و ط زرع و ت ر، ل‬
                                                                                                                ‫:‬     ‫ظتا‬        ‫لا‬     ‫ر ، م‬
                                                                                                          ‫.‬   ‫ار ع ر ز ‪ ARN‬و‪ ADN‬دا ل ا‬
                                                                                                                          ‫ا م ض ا و ت.‬
                                                                                                                           ‫م.‬     ‫دات ا‬    ‫إ راز‬
                                                                                             ‫.‬        ‫لأ‬    ‫ا‬   ‫ھو ن‬          ‫ر لا و ت‬
                        ‫ز‬                                          ‫و ‪B‬‬    ‫ر‬                          ‫؟‬   ‫ا ر‬      ‫ل ھذه ا‬      ‫ن‬        ‫ؤال : ذا‬

  ‫ز‬       ‫و‬                 ‫ا‬            ‫ا دا‬  ‫ا و ز‬        ‫ضا ت لا‬             ‫زداد م ا ر ت ا و و‬
                                                  ‫م.‬  ‫دات ا‬      ‫إ ج‬    ‫ز ت درة‬       ‫و ، و ذ ك رق إ‬
               ‫ز و‬                      ‫،‬         ‫و ز دا‬            ‫م م ور‬     ‫دات ا‬     ‫ن إذن أن ر ب‬
  ‫ل‬            ‫رب‬                        ‫م م س ا را ل ا‬       ‫دات ا‬    ‫أن ر ب‬     ‫ت ا راز . ھذا‬     ‫و و‬
                                                                              ‫خ وا ر .‬       ‫ا رو ت: ا‬
                        ‫ذ: و فا د‬                     ‫ا‬                                                                    ‫: - 091 -‬              ‫ا‬
                                                                         ‫ا ط :‬             ‫ج–آ تا‬
                                                                                                ‫ا‬
                                                                    ‫‪ – a‬طور ا ث: ‪Phase d induction‬‬

                            ‫د‬      ‫ر ط ددا ا‬
                                     ‫طر‬             ‫د إ ا و ط ا دا‬  ‫د د ول و د ا‬
  ‫س‬       ‫د. و‬    ‫ود ا‬     ‫ءا ر تا و ‪B‬ا و‬                 ‫ت‪ B‬ا و ا و ودة‬          ‫ا‬
 ‫د.‬     ‫د ود ا‬         ‫ت ا رة( رض ا ددات ا‬             ‫‪ ) CPA‬و ا‬           ‫ا و ت وم‬
        ‫د‬       ‫ددات ا‬    ‫د‬    ‫ود ا‬      ‫ت ‪ T‬ر ت ا و 4‪ T‬ا و‬             ‫و د ار ط ا‬
‫ت ا رة. رز ھذه ا رة ا ر و ن‬               ‫ا رو ، رز ا ر ت ا و 4‪ T‬ل ط‬
‫د، رز د ذ ا ر و ن 2 )2 ‪(IL‬‬           ‫ود ا‬     ‫1 )1‪ (IL‬ا ذي ط ا ر ت ا و 4‪ T‬ا و‬
   ‫د (.‬     ‫‪ B‬و ود ا‬          ‫و د ار ط ن‬        ‫)ا‬         ‫ا ذي ط ا ر ت ا و ‪ B‬ا‬

                                                      ‫م: ‪Phase d'Amplification‬‬                           ‫‪ – b‬طور ا‬

    ‫دات‬       ‫ز ت رزة‬     ‫ول إ‬   ‫رق‬               ‫را و ت‪B‬و‬                                                       ‫ل ھذه ا ر‬
           ‫ر ا ر و ت 4،5،6 ) 4‪ ( IL6 , IL5 , IL‬ا رزة ن طرف ا ر ت‬                                                 ‫م، ت‬      ‫ا‬
                                                                                                                      ‫ا و .‬

                                                                    ‫ذ: ‪Phase effectrice‬‬                  ‫‪ – c‬طور ا‬

‫ل‬         ‫دف،‬            ‫دي ا‬              ‫دد ا‬          ‫م و‬    ‫دات ا‬    ‫ل ھذا ا طور وم ا ز ت راز‬
           ‫إ‬            ‫ث مإ‬        ‫و ا ط‬                 ‫ءا‬     ‫وا ط ا دم وا ف ن ا‬      ‫ھذه ا ر و ت ا‬
      ‫،‬             ‫ا‬           ‫ب ھذه ا‬ ‫ن‬                 ‫وا ؤو‬     ‫د اد‬    ‫ن رھ ث ر ط و دات ا‬
                                                                                      ‫.‬    ‫و ر ت‬

                                                                               ‫م:‬         ‫دات ا‬          ‫د–آ ت د ل‬
                                                               ‫د:‬     ‫ودا‬               ‫م‬     ‫دا‬          ‫‪ – a‬رف‬

  ‫در ھو‬                                ‫، وھذا ا ر ط س‬      ‫ما و‬    ‫دات ا‬    ‫د‬  ‫ر ط و دات ا‬
 ‫دي،‬    ‫دد ا‬                  ‫د وا‬      ‫رف و د ا‬  ‫دث ن و‬        ‫ز‬       ‫وى ذ‬      ‫ار ط ط‬
                                                      ‫ا ر ب ا ــ .‬       ‫ل وي ون ن‬      ‫وھو‬

      ‫11.‬           ‫2 و‬         ‫د: أ ظر ا و‬           ‫ودا‬            ‫ء‬         ‫ا‬     ‫م‬          ‫دات ا‬      ‫‪ – b‬دور‬

          ‫،‬      ‫ا ذي ط ل ا‬     ‫لا ر با‬                                   ‫د،‬          ‫م و دات ا‬ ‫دات ا‬   ‫د ار ط‬
‫ب‬          ‫) ‪ ( C.A.M‬ا ذي‬   ‫ل ر ب ا وم ا‬                                            ‫ل زاء ل ا‬       ‫ن ھذا ا ط ا‬
                                                                                   ‫ا دف د أ وز .‬       ‫ا لا‬

                         ‫11‬          ‫3 و‬          ‫: أ ظر ا و‬         ‫لا‬                 ‫م‬       ‫دات ا‬      ‫‪ – c‬دور‬

‫ن‬               ‫ل‬         ‫د‬          ‫زاء ‪ C3b‬و د ا‬             ‫، ر طا‬              ‫لا‬       ‫ط‬       ‫،و‬     ‫د ون ا ر ب ا‬
                                                                                                             ‫ت.‬     ‫طرف ا‬



                ‫ذ: و فا د‬              ‫ا‬                                                             ‫: - 191 -‬       ‫ا‬
‫ا و ــــــــــ 11‬
              ‫م‬     ‫دأ‬                                                          ‫ود‬               ‫ء‬         ‫ا‬       ‫م‬       ‫دات ا‬      ‫2 : دور‬       ‫او‬
                                     ‫رب‬
                    ‫لا‬                                                                                                                          ‫ا ذاب‬
                                                        ‫2‪C‬‬                 ‫‪C3 C3b‬‬           ‫‪C3a‬‬                             ‫‪C3a‬‬                ‫ت‬      ‫ا‬
                            ‫‪C2a‬‬      ‫2‪C‬‬                 ‫‪b‬‬
                                     ‫‪b‬‬                                                      ‫+‬
                            ‫2‪C‬‬       ‫+‬
  ‫ودا‬




                                                                                                                           ‫‪C3b‬‬                 ‫ل‬
                  ‫1‪C‬‬                                ‫‪C2a‬‬     ‫4‪C‬‬                                                                                      ‫ا‬
                            ‫4‪C‬‬        ‫+‬                      ‫‪b‬‬
                                                    ‫‪C3 convertase‬‬               ‫‪C5 convertase‬‬
  ‫د‬




                           ‫‪C4a‬‬       ‫4‪C‬‬                                      ‫‪C2a‬‬            ‫4‪C‬‬           ‫3‪C‬‬
                                     ‫‪b‬‬                                                      ‫‪b‬‬            ‫‪b‬‬
                                                     ‫‪C4a‬‬
                                                                                                     ‫6‬          ‫7‬         ‫9 8‬
                                                                                                                                     ‫ر ب ا وم‬
                                 ‫+‬                      ‫‪C5b‬‬                                                                          ‫‪CMA‬‬      ‫ا‬
    ‫5‪C‬‬
                                                                                                     ‫‪C5b‬‬
                                                                                                         ‫6‬       ‫9‬           ‫9‬
                          ‫ا ذاب‬                                       ‫ا دف‬
                                                                       ‫ءا‬
                                              ‫‪C5a‬‬                                                              ‫9 7‬          ‫9‬
                         ‫ت‬      ‫ا‬
                                                                                                                ‫98‬          ‫9‬


‫ا و ــــــــــ 11‬
                                                                                ‫.‬           ‫لا‬                 ‫م‬          ‫دات ا‬      ‫3 : دور‬       ‫او‬
                                                ‫تا ط‬
                                                ‫دات‬               ‫ا‬                     ‫دات أ م و‬
                                                                                        ‫د‬   ‫ودا‬

                                                                                        ‫د‬            ‫ودا‬



          ‫ا‬         ‫ا‬          ‫تا ربا‬                                  ‫ون ا ر ب ا‬                                   ‫م و‬      ‫دات أ‬        ‫ا ذاب‬




‫زوزو ت‬


                             ‫عا ربا‬       ‫ا‬                                                          ‫طما ر با‬              ‫زل أو‬


                                                                       ‫:‬            ‫ا‬            ‫ون ا وي ن ا‬                   ‫‪ – IIΙ‬ا‬
                                                   ‫ن و ود ون ن ا‬
                                                    ‫:‬         ‫ا‬                                                           ‫1ا فا ر‬
                                      ‫أ – ر ‪ :( 1967 ) Mosier‬أ ظر ا و 1 و 21.‬
  ‫ت.‬              ‫و وا‬       ‫، د و ود ل ن ا ر ت ا‬   ‫ا‬    ‫ل ظر ط ا‬       ‫ا‬  ‫ظ أن‬
                     ‫م.‬        ‫دات ا‬  ‫ج‬   ‫ت ا رة وا و ت‬      ‫أن ھ ك ون ن ا‬    ‫دل ھذا‬
                    ‫ذ: و فا د‬         ‫ا‬                                                                        ‫: - 291 -‬              ‫ا‬
‫ا و ــــــــــ 21‬                                                                                ‫ر ‪.( 1967 ) Mosier‬‬                           ‫1:‬        ‫او‬

  ‫زل‬                                                                                                    ‫ء‬       ‫أ ذ ر ت‬
  ‫ا ر ت‬                                                                                                  ‫دي‬     ‫نط ل ر‬
  ‫ء‬   ‫ا‬


      ‫ر ت‬                           ‫‪CMH-I‬‬
       ‫و‬                             ‫ت‬                            ‫زرع و ط ت در‬
                                                                      ‫رارة ° 73‬
                                                                         ‫‪C‬‬

                                                                             ‫ء أو ط‬     ‫وز ا ر ت ا‬
                                                                             ‫د‬   ‫‪ GRM‬و د ا‬      ‫زرع، وإ‬
‫‪+ GRM‬‬
                                                   ‫‪+ GRM‬‬                        ‫‪+ GRM‬‬
                                                                                                                              ‫:‬           ‫ر‬   ‫ا ر با‬

                                                                                                    ‫دي ر ت‬         ‫ذ نط ل‬ ‫ر‬
                                                                                                                   ‫ءو‬             ‫د و‬
                                                                                                    ‫از ج‬      ‫ري. د ذ ك زرع‬
                                                                                                    ‫ا رة ) ر ت و (‬                   ‫ا‬
                                                                                                        ‫را‬                ‫ا‬        ‫وا‬
                                                                                                          ‫أو‬      ‫ت رة( إ‬           ‫)‬
                                                                                                    ‫روف‬     ‫راء‬    ‫ور ر ت‬
                                                                                                    ‫أ م در دة‬       ‫‪ .GRM‬د أر‬
                                                                                                    ‫ت‬    ‫داد‬            ‫ا‬            ‫ا‬
                                                                                                           ‫ب‬          ‫ا ل ا دم ا‬
                                                                                                     ‫م ) د-‪.(GRM‬‬            ‫دات ا‬

                                                                                                            ‫ل ھذه‬         ‫ن‬                    ‫ذا‬
                      ‫ل ا دم‬    ‫ا‬                                                                                     ‫.‬           ‫ر‬       ‫ا‬         ‫ا‬
        ‫1‬                                          ‫2‬                                ‫3‬


‫ا و ــــــــــ 21‬                                 ‫21.‬       ‫2 و‬          ‫ر ‪ :( 1967 ) Claman‬أ ظر ا و‬                              ‫ب–‬
                                                                  ‫ر ‪ Claman‬ا ف ن ا ون ا وي ن ا و ت.‬               ‫2:‬                                    ‫او‬
‫و ت ‪B‬و‪T‬‬          ‫نا‬       ‫و ت،‬           ‫لا‬                 ‫ع ا ران‬   ‫ل ا دة ا ر ، م إ‬           ‫ا ران ذه ا ر‬
                                                                             ‫(‬    ‫. ) أ ظر ا دول أ‬      ‫ر أو‬  ‫إ‬
                                                                 ‫ھذه ا ر .‬     ‫ف‬       ‫ون وا‬          ‫ا‬     ‫ا‬   ‫أ طا‬                                         ‫ا‬
                                    ‫ما‬        ‫ر‬        ‫ل ا دة ا‬      ‫ا‬                       ‫ھد (‬   ‫)‬               ‫دون‬               ‫وا ت‬          ‫ا‬
           ‫ن‬                                ‫ن‬                                  ‫ن‬
        ‫و ت‪B‬و‪T‬‬            ‫ا‬               ‫و ت‪B‬‬              ‫ا‬                ‫و ت‪T‬‬       ‫ا‬                                           ‫إ دة و ن ز‬
                                                                                                                                  ‫ز‬         ‫أو‬
                                                                                                                                  ‫ن طر ق‬     ‫ا‬
                                                                                                                                     ‫نا و ت‬


                        ‫روف (‬           ‫راء‬        ‫ن ‪ ) GRM‬ر ت‬                 ‫ا ران‬
                                                                                                                                  ‫ا رات د‬
                                                                                                                                  ‫ا راء‬     ‫ا ر ت‬
                                                                                                                                  ‫(‬     ‫)أ وع د ا‬
  ‫+‬         ‫و‬       ‫لا‬              ‫+‬              ‫و‬      ‫لا‬             ‫+‬      ‫و‬     ‫لا‬     ‫+‬          ‫و‬       ‫لا‬
                ‫‪ : GRM‬ا‬                                 ‫‪: GRM‬‬                       ‫‪: GRM‬‬                   ‫‪ : GRM‬ا‬
                    ‫ذ: و فا د‬                 ‫ا‬                                                         ‫: - 391 -‬                     ‫ا‬
          ‫و ‪ B‬و‪،t‬‬           ‫دث إ و ود ا ر ت ا‬  ‫(‬                                         ‫راء ) ا‬             ‫ظ أن د ا ر ت ا‬
                                ‫ون ھ ا ر ت ا و ‪ B‬و‪.T‬‬                                         ‫ا‬                 ‫ا‬   ‫إذن أن ا‬

                                                                                                                 ‫ج:‬             ‫ج–ا‬

      ‫د‬      ‫ود ا‬               ‫ط إ د ر‬          ‫ول، و‬                                        ‫و د لا ر تا و ‪B‬‬
          ‫د ‪CPA‬‬            ‫ود ا‬   ‫ا ر‬   ‫ن ا و ت ‪ B‬و‪ T‬وا‬                                     ‫ا و . و ط ب ھذا ا ط و‬
                                                                                                    ‫ت ا رة.‬

                                                                 ‫:‬             ‫ا‬      ‫2 و وآ ت ا ون ن ا‬
                                      ‫31.‬        ‫1 و‬      ‫: أ ظر ا و‬               ‫أ–ا ف ن د لاو طا‬
‫ا و ــــــــــ 31‬
                                                                                                      ‫طا‬        ‫ف ن د لاو‬                  ‫1: ا‬         ‫او‬
                                ‫و ت‬        ‫زرع‬
                                                                                              ‫.‬         ‫ا‬         ‫ا ون ن ا‬
                                      ‫ور‬
                                                                           ‫ور واد‬       ‫م،‬  ‫ص‬    ‫زرع و ت ‪ ،T‬وذة ن‬
                                                                           ‫زرع،‬      ‫د. ذ ا ل ا ط‬     ‫ب دور و دات ا‬
                                                                                 ‫و ت ‪ ،T‬وا‬      ‫إ و ط زرع، ا ول‬           ‫م‬
                                                                                                                  ‫و ت ‪.B‬‬
                                ‫أ ذا لاط‬                                          ‫ل ا ط ، و ود دة‬                ‫لا‬    ‫نا‬
                                ‫ن ا زرع‬                                    ‫و ت، أن‬       ‫ل ا وي‬    ‫نا‬         ‫)ا ر و ن 2(،‬
                                                                                   ‫رز ا ر و ن 2 ھ 4‪.T‬‬        ‫ا ر تا و ا‬
    ‫لإ و ط‬              ‫ا‬   ‫إ‬                    ‫لإ و ط‬       ‫ا‬    ‫إ‬
      ‫و ت‪T‬‬              ‫زرع‬                        ‫و ت‪B‬‬        ‫زرع‬                 ‫ون ن ا‬         ‫ا‬                   ‫ط تا‬            ‫ن ھ ذه ا‬          ‫اط‬
                                                                                                                                  ‫.‬       ‫ا د‬            ‫ا‬
                                                                              ‫..............................................................................‬

                                                                              ‫..............................................................................‬

                                                                              ‫..............................................................................‬

                                                                              ‫..............................................................................‬
           ‫وي‬       ‫ر‬                               ‫وي‬    ‫ر‬
                                                                              ‫..............................................................................‬


      ‫ك ا ول أن ر‬       ‫ر ھذا ا ط‬        ‫،‬           ‫با‬                                           ‫إن ر ا و ت ر ز إ‬
      ‫ن ا زرع. ھذه ا واد م إ رازھ ن طرف‬     ‫د ا ل اط‬                                          ‫و‬         ‫واد‬    ‫ا و ت‬
                                      ‫د.‬   ‫، وھو و د ا‬                                        ‫را‬     ‫و ود ا‬      ‫ا‬      ‫ا‬
       ‫ف‬    ‫ا وا ل ن‬            ‫، وھ أ‬       ‫ل او ط ا‬                                         ‫و ت‪B‬‬         ‫ھذه ا واد ا ط‬
                                                    ‫.‬                                           ‫ا‬        ‫ا‬   ‫ا د‬        ‫ا‬

            ‫ل ن‬    ‫ت ھم‬                           ‫ن دة‬              ‫ا ط‬    ‫ا‬     ‫ن ھذا ا ل أن ا‬
             ‫د (، و4‪ ) LT‬ر‬                          ‫ددا ا‬            ‫را ربو ر‬          ‫ت ا رة )‬                                                         ‫ا‬
                                                                       ‫(.‬     ‫( و‪ ) LB‬ذة‬       ‫طا‬                                                   ‫و‬

                                       ‫31.‬        ‫1 و‬         ‫: أ ظر ا و‬            ‫ا‬             ‫ون ن ا‬               ‫ا‬       ‫ب–آ‬
    ‫ا و ) أ ظر ا و‬                             ‫ن ا د وي وا وي، و ن ا ل ا‬  ‫ا‬                                           ‫را دا و‬
  ‫د )‪ (CPA‬أ رب د‬                               ‫ود ا‬   ‫ا ر‬    ‫ا ر ت ا و وا‬                                         ‫2 و 31 (. وھ ذا‬
                    ‫ذ: و فا د‬              ‫ا‬                                                              ‫: - 491 -‬                    ‫ا‬
       ‫د, )أ ظر ا و‬             ‫ود ا‬                ‫و ا و‬                ‫ر تا‬                   ‫ءا‬           ‫ا‬               ‫. م‬           ‫نا‬    ‫و‬
                                                                                                                                             ‫3 و 31(‬
‫ا و ــــــــــ 31‬
                                                                                                                                            ‫و‬        ‫2:ا دا‬               ‫او‬
     ‫و ت ‪ ،LB‬و م ر ت أو‬                                    ‫ر‬    ‫ط‬
 ‫ول ھ ذه ا ر ت‬   ‫د‬    ‫ل و دا‬                         ‫و ت ‪ .LB‬د ا‬
               ‫ر ا و ت ‪.LB‬‬                         ‫ث‬     ‫ر ت و‬    ‫إ‬                                                                    ‫رن‬
      ‫‪CPA‬‬        ‫ا ر‬      ‫و ت ‪ ،LT‬وا‬                            ‫ر‬    ‫ر‬        ‫ط‬                                                         ‫ور د‬
                                                                                                                                       ‫درة‬           ‫و‬        ‫ة‬
       ‫رة‬    ‫ت‬        ‫و ت ‪ LT‬و‬     ‫م و ت ‪ LB‬و‬                           ‫ط‬
                    ‫و ا درة.‬       ‫ا روق ا‬  ‫طق‬                       ‫و ز ت،‬
                                                                                                                                       ‫وردة‬          ‫و‬       ‫ة‬

‫ا و ــــــــــ 31‬
                                                                                                    ‫ا و‬             ‫ا‬           ‫لا‬              ‫ءا‬        ‫3:ا‬            ‫او‬
                                 ‫ـــــ د‬             ‫ـــــددات‬                        ‫ــ د‬         ‫و ــد‬
            ‫ـــــــ‬                                                                                                                                      ‫ـــــــــ ل ‪B‬‬
            ‫ـــــــ رة‬
                                                                                    ‫1‪CMH‬‬
                                    ‫2‪CMH‬‬                                                            ‫ـــــــــ ل ‪T‬‬                      ‫‪LB‬‬                        ‫‪LB‬‬
                                               ‫ـــــــــ ل ‪T‬‬                         ‫ــــ‬             ‫8‪LT‬‬
                                                                                   ‫ـــــ‬                                        ‫‪LB‬‬                   ‫‪LB‬‬
                                                  ‫4‪LT‬‬
                                                                                                           ‫8‪LT‬‬                             ‫‪LB‬‬                     ‫‪LB‬‬
                                                                                             ‫8‪LT‬‬
                                     ‫4‪LT‬‬            ‫4‪LT‬‬                                             ‫8‪LT‬‬

                                                     ‫4‪LT‬‬                           ‫8‪LT‬‬                      ‫8‪LT‬‬


              ‫4‪LT‬‬           ‫4‪LT‬‬                    ‫4‪LT‬‬                       ‫8‪LT‬‬             ‫8‪LT‬‬           ‫8‪LT‬‬               ‫‪LB‬‬            ‫‪LB‬‬                    ‫‪LB‬‬

                                                                                                                            ‫و ــــــ‬       ‫ر ــــــ ت‬
            ‫ـــــ ا و ـــــ‬                ‫ا‬            ‫ـــــ‬       ‫ـــــ ل ا‬          ‫ـــــ ء ا ـــــ‬                  ‫طـــــور ا‬             ‫ا و ــــــــ 45‬

        ‫م ا دات‬     ‫دات.‬     ‫إ‬                                           ‫ز‬       ‫ت ا رة ا‬      ‫د وا ط ا‬    ‫ود ا‬    ‫م‬
    ‫)‪ .(CPA‬رف 4‪LT‬‬      ‫ا ر‬                                               ‫ط ا‬         ‫د – ‪CMH-II‬‬   ‫‪ CMH-II‬و رض ا ر ب‬
   ‫رز ‪ CPA‬ا ر و ن 1-‪ IL‬ا ذي ث‬                                             ‫(.‬       ‫ر ) رف‬      ‫ھذا ا ر ب ن طر ق ا س ا‬
 ‫ن ا و ت ط ‪CPA‬‬         ‫و‬   ‫رة‬                                             ‫دة ‪ .TH‬رز ھذه ا‬       ‫و ت‬     ‫ا رقإ‬    ‫4‪LT‬‬
                                                                                                 ‫و‪ LB‬ا و و 8‪ LT‬ا و .‬


                                                                         ‫:‬            ‫ا‬                    ‫را ل ا‬                      ‫ر‬                    ‫‪– IV‬‬
                            ‫ا‬                   ‫ف را ل ا‬                      ‫ص‬             ‫ص‬         ‫41 إ‬              ‫1 و‬          ‫ط ت او‬                ‫أول‬


                    ‫ذ: و فا د‬              ‫ا‬