Poster Presentations.pdf

Document Sample
Poster Presentations.pdf Powered By Docstoc
					                                                                                                                              Poster Presentations




Poster Presentations                                                       icin B (AMB), fluconazole (FLU), itraconazole (ITR), and voriconazole
                                                                           (VOR) among Candida species and Cryptococcus neoformans isolates
                                                                           associated with deep-seated and disseminated infections during a
                                                                           24 month-period in patients from seven Croatian medical institutions.
                                                                           Methods: From January 2007 until December 2008 we were able to
                                                                           collect a total of 685 yeast isolates: 650 (95%) isolates of 13 Candida
P001                                                                       species and 35 (5%) isolates of C. neoformans from five tertiary care
In vitro activities of eight antifungal drugs against 275                  hospitals, one general hospital and the Croatian National Institute of
Cryptococcus gattii isolates                                               Public Health (CNIPH). The isolates were collected at the individual
F. Hagen1, M. T. Illnait-Zaragozi2, S. Eijkemans3, I. Curfs-Breuker3,      study sites and were sent to the National Reference Laboratory for
T. Boekhout1 and J. F. Meis3                                               systemic mycoses (in CNIPH) for identification and susceptibility
1
 CBS Fungal Biodiversity Centre, Utrecht, The Netherlands,                 testing. Yeast isolates were identified by ID 32 C (BioMerieux) and
2
 Tropical Medicine Institute ‘Pedro Kouri’, Havana, Cuba, 3Canisius        classical methods. Antifungal susceptibility profile of isolates was
Wilhelmina Hospital, Nijmegen, The Netherlands                             determined by ATB FUNGUS 3 (BioMerieux) microdilution methods
                                                                           following the manufacturer’s instructions. MIC readings were per-
                                                                           formed visually and the results were interpreted according to the CLSI
Background: Cryptococcus gattii can cause an invasive fungal
                                                                           recommendations.
infection but is more rarely encountered than Cryptococcus neoformans.
Both species consist of five serotypes: serotype A (C. neoformans var.
                                                                           Results: The collection included 115 (16.8%) bloodstream or CSF
                                                                           isolates of Candida species and C. neoformans and 570 (83.2%) isolates
grubii), serotype D (C. neoformans var. neoformans), serotype AD (a
                                                                           of Candida species from other clinical samples (BAL, sputum, urine,
hybrid of the former two serotypes), and serotypes B and C (C. gattii).
                                                                           aspirates, drainage swabs, stools). Candida species distribution was as
Patients with compromised immunity are most commonly infected
                                                                           follows: C. albicans 360 (55%), C. glabrata 110 (17%), C. parapsilosis
with serotypes A or D, while C. gattii (serotypes B and C) has recently
                                                                           63 (10%), C. krusei 35 (5%), C. tropicalis 25 (4%) and other Candida
gained attention because of invasive infections in patients with no
                                                                           species 57 (9%). Only 0.3% C. albicans and 8.6% C. krusei isolates were
known immunodeficiency, as illustrated by a large ongoing outbreak
                                                                           resistant to 5-FC. All Candida species and C. neoformans isolates
on Vancouver Island, Canada. While ample studies have been
                                                                           were sensitive to AMB. Isolates of C. albicans, C. tropicalis, and
published on the in vitro susceptibility of C. neoformans, large numbers
                                                                           C. neoformans < were all susceptible to FLU, whereas 82.5% C. glabrata,
of C. gattii (serotype B and C) have not been tested for antifungal
                                                                           88.9% C. parapsilosis, 0% C. krusei, and 97.8% of the other tested
susceptibility.
                                                                           Candida species isolates were susceptible to this antifungal agent.
Purpose: To measure the in vitro activities of existing and new
                                                                           Intermediate susceptibility and resistance against ITR were found for
antifungals against a worldwide collection of clinical and environmen-
                                                                           68.2% C. glabrata, 31.7% C. parapsilosis, 94.3% C. krusei, and 20% of
tal C. gattii isolates with different genotypes.
                                                                           the other tested Candida species isolates. Resistance to VOR was
Methods: A worldwide collection of 275 clinical (n = 171), veteri-         detected in four (11.4%) C. krusei isolates.
nary (n = 47), environmental (n = 52) and isolates with an unknown
                                                                           Conclusion: The results of the two years of Croatian antifungal
source (n = 5) from the CBS Fungal Biodiversity Centre, Utrecht, The
                                                                           susceptibility surveillance showed the existence of different frequency
Netherlands was used . MICs were determined for amphotericine B
                                                                           of isolation pattern and antifungal susceptibility profile in yeast isolates
(AmB), fluconazole (FLU), itraconazole (ITC), voriconazole (VOR),
                                                                           among institutions. C. albicans accounts for approximately one-half of
posaconazole (POS), isavuconazole (ISA), micafungin (MICA) and 5-
                                                                           all clinical isolates, and the most (99.7%) of our C. albicans isolates
flucytosine (5FC). Microdilution testing was done in accordance with
                                                                           remained susceptible to all antifungal drugs tested. We were able to
CLSI M27-A3 guidelines. Quality control was ensured by including
                                                                           demonstrate that in Croatia most non-albicans Candida species are
Paecilomyces variotii (ATCC 22319) and Candida krusei (ATCC 6258).
                                                                           represented by C. glabrata, C. parapsilosis, C. krusei, and C. tropicalis
Results: AFLP4 (n = 111), AFLP6B (n = 51), AFLP6 (n = 43) and              isolates still susceptible to 5-FC, AMB and VOR. Conversely, non-
AFLP6A (n = 34) were the most prevalent genotypes. There was no
                                                                           albicans Candida species isolates have higher intermediate and resis-
difference in MICs between the different origins, serotypes and AFLP
                                                                           tance rates to FLU and ITR, the second generation azoles. The overall
genotypes of the C. gattii isolates. The MIC ranges and MIC50 and
                                                                           susceptibility of C. neoformans isolates was 100% for all antifungals
MIC90 values (mg L-1) of the 275 isolates are shown in Table 1.
                                                                           tested. However, continuous surveillance programs are needed in order
                                                                           to identify possible changes in the species distribution and antifungal
Table 1 MIC values of eight antifungal agents.                             susceptibility patterns of yeasts, particularly after increasing the use of
                                                                           azoles in Croatian hospitals.




Conclusions: Amphotericine, itraconazole, voriconazole, posaco-
nazole and isavuconazole were the most active drugs in vitro against
C. gattii isolates. The new azole isavuconazole had at least as good       P004
activity as the other new triazoles whereas micafungin had no activity.    Effect of farnesol on susceptibility of Candida albicans to
Acknowledgements: We thank Karen Bartlett, Kathrin Tintelnot,              amphotericin B and fluconazole
     ¨                 ¸
Danielle Swinne, Francoise Dromer, Maria Teresa Montagna and Josep         L. Krivcikova, V. Buchta and M. Vejsova
Torres-Rodriguez for providing C. gattii strains. This study was partly    University Hospital, Hradec Kralove, Czech Republic
supported by Basilea Pharmaceutica, Basel, Switserland.

                                                                           Objectives: Farnesol is a quorum sensing compound, which consid-
P003                                                                       erably influences morphology of vegetative growth form of Candida
Species distribution and antifungal susceptibility profile of               albicans based on density of cell population. As some antifungals
Candida species and Cryptococcus neoformans isolates:                      displayed antimicrobial effect depending on fungal morphology, a
                                                                           possible effect of farnesol on antifungal susceptibility testing in this
2 years of Croatian surveillance
                                                                           yeast was studied.
E. Mlinaric-Missoni, V. Vazic-Babic and E. Missoni
                                                                           Methods: Microdilution broth method (M27-A2) and agar diffusion
Croatian Institute of Public Health, Zagreb, Croatia                       tests (Disk test, Etest) were used to evaluate the effect of farnesol on
                                                                           susceptibility testing of amphotericin B (AmB) and fluconazole (FLZ) in
Objectives: To conduct a prospective surveillance of species distri-       C. albicans (n = 5). In broth method, farnesol (10, 30, 50, 100, 250,
bution and in vitro susceptibility to 5-fluorocitosine (5-FC), amphoter-    500 mmol L-1) was tested in RPMI 1640 and ATB 3 medium, while in




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  29
Poster Presentations



both diffusion techniques, farnesol (3, 30, 300 mmol L-1) incorporated      P006
into Mueller-Hinton agar was used to evaluate antifungal susceptibil-       Comparison of two methods, disk diffusion and E-test, for
ity.                                                                        testing susceptibility of 102 filamentous fungi to
Results: There was no effect of farnesol concentrations tested on           amphotericin B, itraconazole, voriconazole, caspofungin
antifungal susceptibility determined with disk test and Etest. In           and posaconazole
microbroth dilution, the results were strain-dependent and influenced
                                                                            C. I. Colosi1, O. Faure2, C. Bourdon2, B. Dessaigne2, B Lebeau2 and
with farnesol concentration, e.g. in case of C. albicans ATCC 10321,
MIC values of AmB and FLZ was proportional in direct way to farnesol
                                                                            H. Pelloux2
                                                                            1
concentration. If farnesol influenced antifungal susceptibility test          University of Medicine and Pharmacy, Cluj-Napoca, Romania,
                                                                            2
results, it was almost always at lower concentration tested                  CHU, Grenoble, France
(£ 50 mmol L-1), at higher concentrations this effect was minimal.
The difference in susceptibility were less marked using ATB3 medium.        Objectives: Antifungal susceptibility testing of filamentous fungi
Conclusion: Effect of farnesol on susceptibility of C. albicans to AmB      (FF) is increasingly requested due to the large number of antifungal
and FLZ is concentration-dependent, strain variable and influenced           agents now available and the emergence of resistant isolates. Disk
with composition of medium.                                                 diffusion procedure with new identified guidelines for moulds seems
Acknowledgements: The study was supported by the Research                   reliable and easy to perform in routine laboratories. So we compared
Center LC521 of the Ministry of Education, Czech Republic.                  this method with E-test procedure by testing in parallel 102 FF
                                                                            consisting mainly of Aspergillus spp.
                                                                            Methods: We tested 102 FF (Aspergillus fumigatus 49%, other
                                                                            Aspergillus 31%, Fusarium sp. 5%, Mucorales 5%, Scedosporium sp.
                                                                            3%, and other FF 7%) from clinical samples (mainly sputum and
P005                                                                        bronchopulmonary aspirate) of Grenoble Hospital inpatients. Two
Yeast in vitro susceptibility testing and impact of their                   quality control strains (C. parapsilosis ATCC 22019, C. krusei ATCC
phylogenetic relationship                                                   6258) were included as controls. Disk diffusion method used Neo-
A. Schmalreck                                                               SensitabsÒ tablet assay (Rosco) for all antifungals (amphotericin B
MBS, Muenchen, Germany                                                      10 lg, itraconazole 8 lg, voriconazole 1 lg, caspofungin 5 lg) except
                                                                            posaconazole 5 lg for which sterile disks were impregnated. The newly
                                                                            identified guidelines for mould testing with nonsupplemented Mueller-
Objectives: Clinical important ascomycetous yeasts isolates (CAYI)                               ´
                                                                            Hinton agar (BioMerieux) were used. E-Test method (AB Biodisk) was
are grouped traditionally according to their species identification in       performed in accordance with the manufacturer’s instructions with
anamorphic (ANA) form genera, which are polyphyletic (e.g. Candida,         Etest strips for all antifungals and RPMI agar. Inoculum suspension
Geotrichum).The aim of this study was to evaluate whether grouping          was adapted according to species, between 6.104 and 9.5.104 CFU ml-
of CAYI in corresponding teleomorphic (TELE) genera or in phylo-            1
                                                                               and plates were incubated at 35 °C for 24–48 h. The following
genetic (PHYLO) groups results in a more coherent susceptibility            interpretative criteria were used (Espinel-Ingrofff J.Clin.Mycol. 2008):
pattern when comparing with their placement in the current used             susceptible (S): £ 1 lg ml-1 and ‡ 17 mm (triazoles and caspofungin)
ANA groups.                                                                 or 15 mm (amphotericin B).intermediate (I) /susceptible dose-depen-
Methods: In a recently performed German antifungal multicenter              dant (SDD): 2 lg ml-1 and 14–16 mm (triazoles and caspofungin) or
study the minimum inhibitory concentration (MIC) of voriconazole            13–14 mm (amphotericin B).
(VOR), itraconazole (ITR), fluconazole (FLC), and flucytosine (FCY)               Resistant (R): ‡ 4 lg ml-1 and £ 13 mm (triazoles and caspofungin)
for 9.893 CAYI had been determined in parallel by microdilution             or £ 12 mm (amphotericin B). We determined categorical agreement
(DIN 58940). Susceptibility pattern analysis was used for assessment        level between E-test MIC or MEC (caspofungin) and tablet end-points, as
of yeast susceptibility data when grouping anamorphic CYI in (i)            opposed to the following disagreement parameters: very major discrep-
corresponding TELE-groups (when existing) and in (ii) PHYLO-                ancies R to E-test and S to tablet; major discrepancies S to E-test and R to
groups. The latter were arranged according to recently published            tablet; minor discrepancies- shifts between S and SDD or SDD and R.
studies on inferring phylogenetic clades based upon multi-gene                  Statistical analysis was performed using linear regression analyses
analyses.                                                                   and computed Pearson’s correlation coefficients (R values) between the
Results: The CAYI studied had been classified into one anamorphic            log transforms of MICs/MEC and the inhibition zone diameters of the
genus (Candida spp.) comprising 33 different species. These isolates        five studied antifungal agents.
could be re-classified into 8013 strains (81.5%) froming one ANA-            Results: (Table 1) We obtained 95% (R = -0.821), 96% (R =
group (Candida spp. with no known teleomorphic designations so far),        -0.726), 96% (R = -0.790) and 95% (R = -0.743) of categorical
which could be assigned to seven major phylogenetic groups. The             agreement for caspofungin, itraconazole, voriconazole and posaconaz-
remaining 1820 strains (18.5%) with their corresponding teleomor-           ole respectively. Amphotericin B exhibited a lower degree of agreement
phic affiliates comprised 21 species of 12 genera, and could also            especially for Aspergillus sp. with 76% of categorical agreement (R =
assigned to the mentioned seven major phylogenetic groups. CAYI of          -0.672). In all cases above the computed R-values exhibited a high
TELE-groups showed significantly higher resistance rates than those          statistical significance (P < 0.001).
which could not be regrouped into the TELE-associated isolates (43.0%,
26.1%, 6.0% vs. 4.4%, 8.0%, 2.5% for FLC, ITR, and VOR,
respectively). The susceptibility patterns of the PHYLO-G group differed
significantly from the others. CAYI of PHYLO-G, B, and D (e.g. C.
guilliermondii, C. intermedia, C. lusitaniae, C. inconspicua, C. krusei)
showed consistently higher MICs for all triazoles tested when compared
to those of clade A (C. albicans complex, C. parapsilosis complex, C.
tropicalis), which encompasses the most frequently encountered clinical
isolates, frequently exhibiting low MICs.
Conclusions: Grouping of the ana-/telemorphic ascomycetous
yeasts into their phylogenetic clades thus reflecting their natural
relationship, is correlated with significant different MIC distributions,
and results in reliably more coherent susceptibility patterns, when
compared to grouping into anamorphic or teleomorphic genera,
which may be also sometimes polyphyletic (e.g. Pichia). Thus                Conclusion: The results of our study suggest a potential value of the
PHYLO-grouping may enhance and facilitate prediction of parallel            Neo-SensitabsÒ assay for testing itraconazole, voriconazole, caspofun-
and/or cross resistant isolates and results in a more reliable MIC-         gin and posaconazole, while amphotericin B exhibited an overall lower
assessment.                                                                 degree of agreement.




                                                                                                                              Ó 2009 The Authors
30                                                               Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



P007
In vitro activities of amphotericin B, fluconazole and
voriconazole against Taiwan surveillance of antimicrobial
resistance of Yeasts uncommon Candida by use of 2%
glucose medium
M.S. Tsai
Chang Gung Memorial Hospital - Kaohsiung Medical Center;
Chang Gung University, College of Medicine, Kaohsiung, Taiwan

Objectives: Taiwan Surveillance of Antimicrobial Resistance of
Yeasts (TSARY) is an island-wide surveillance project conducted by
National Health Research Institutes (NHRI) designed for monitoring
the trend of the in vitro susceptibilities of clinical yeast isolates to
antifungal agents in Taiwan. During the period between 1999 and
2006, a total of 2533 clinical yeast isolates were submitted to NHRI for
in vitro testing. Although Candida albicans, C. tropicalis, C. glabrata, C.
parapsilosis and C. krusei made up a substantial portion of TSARY             Conclusion: Amphotericin B has a good in vitro activity against 41
clinical yeast isolates; 41 (1.62%) isolates were Candida spp. which          TSARY uncommon Candida isolates. The in vitro antifungal suscepti-
were less frequently isolated. To better understand the in vitro activities   bility of C. guilliermondii to either fluconzole or voriconazole is slight
of antifungal agents against these infrequently isolated yeasts, minimal      higher than that of C. lusitaniae. However, MICs of both fluconazole and
inhibitory concentrations (MICs) of amphotericin B, fluconazole, and           voriconazole against C. lusitaniae and C. guilliermondii are within the
voriconazole were determined. To compare with the MICs obtained by            susceptible category. Antifungal susceptibility testing results obtained
CLSI M27-A2 reference methods, in vitro antifungal susceptibility             either at 24 or 48 h by CLSI M27-A2 methodology modified by a 2%
testing using a 2% glucose medium and MICs read at 24 and 48 h                glucose medium is comparable to the CLSI M27-A2 reference method.
were performed respectively.
Methods: TSARY clinical yeast isolates were differentiated to species
according to the instructions of API 32C and VITEK Yeast Biochemical
             ´
Card (BioMerieux, St. Louis, MI, USA). If both API 32C and YBC yielded
indistinguishable results, the internal transcribed spaces of yeast           P008
ribosomal DNA were sequenced and compared to those available in the           Oral candidiasis in patients with HIV/AIDS: identification of
GenBank (http://www.ncbi.nlm.nih.gov/BLAST) for species identifica-            species and evaluation of the profile of sensitivity and
tion. In vitro activities of amphotericin B, fluconazole, and voriconazole     resistance to antifungal drugs (preliminary results)
against clinical Candida isolates were determined by reading 48-hour          B.C.A. Zoppas1, A. P. Delamare2, L. M. Michelin3, J. F. Fracasso3,
yeasts growth in the RPMI-1640 microdilution broth according to CLSI          C. B. Boff3, F. C. Casal1, J. Z. Zacaria2, D. O. Stopiglia4,
M27-A2. The MICs of amphotericin B were read as the lowest drug               D. H. Heidrich4, J. Vieira4, M. L. Scroferneker4 and
concentration that resulted in a 95% reduction of yeasts growth. The          S.E. Echeverigaray2
MICs of fluconazole and voriconazole were read as the lowest                   1
                                                                               Center for Health Sciences, Caxias do Sul, Brazil, 2Institute of
concentration that inhibited approximately 50% yeasts growth. The             Biotechnology, UCS, Caxias do Sul, Brazil, 3Hospital/Clinic, UCS,
MICs of each antifungal agent against Candida spp. grown in a medium
                                                                              Caxias do Sul, Brazil, 4Institute of Basic and Health Sciences, Porto
with 2% glucose were read at 24 and 48 h respectively. Candida
albicans ATCCÒ 90028, C. krusei ATCCÒ 6258, and C. parapsilosis
                                                                              Alegre, Brazil
ATCCÒ 90018 were the control yeast strains. Agreement was defined
as discrepancies in MIC results of no more than ± 1 twofold dilution.         Yeasts of the genus Candida are opportunistic pathogens that are part of
Intraclass correlation coefficient (ICC) between the MICs of different         the human microbiota and are associated with high morbidity and
methodologies was also compared. The ICC was calculated using the             mortality in immunocompromised patients. The use of amphotericin B
formula ICC = (group mean square - error mean square)/(group mean             and azoles, which are administered for prolonged periods have shown
square + error mean square) and has a maximum value of 1 if there is          resistance to these antifungals. This study aims to identify Candida
perfect correlation and a minimum value of -1 if there is absence of          species that affect patients with Acquired Immunodeficiency Syndrome
correlation.                                                                  in Caxias do Sul and region as well as to determine the sensitivity and
Results: See Table 1 and Table 2.                                             resistance to antifungal agents. Samples were collected from patients
                                                                              with oral candidiasis at the Hospital and Clinic of the Universidade de
                                                                              Caxias do Sul, Rio Grande do Sul, Brazil. The primary isolation of
                                                                              Candida species was performed by culture on Sabouraud dextrose agar,
                                                                              and presumptive identification by cultivation on CHROMagar Can-
                                                                              didaÒ, and testing and germ tube microculture. For molecular
                                                                              characterization, the technique of RAPD was performed by using the
                                                                              sequences starting decameric OPX-03, OPX-07, OPX-06 and OPB-10.
                                                                              For the tests of susceptibility to antifungal agents (ketoconazole,
                                                                              fluconazole, itraconazole, terbinafine and nystatin) the technique
                                                                              recommended by the microdilution protocol M27-A2 of the Clinical
                                                                              and Laboratory Standards Institute (CLSI) was used. The minimum
                                                                              fungicidal concentration (MFC) was determined by transferring 100 ll
                                                                              of wells that showed 100% inhibition of growth in the microdilution
                                                                              technique into tubes containing 2 ml of Sabouraud dextrose broth. The
                                                                              tubes were incubated for 3 days at 35 °C and MFC was determined as
                                                                              the lowest concentration able to inhibit the fungal growth. To date 10
                                                                              samples were collected, yielding results as presumptive: nine isolates of
                                                                              Candida albicans and one of Candida tropicalis. The analysis by RAPD
                                                                              revealed a total of 59 amplicons, ranging from 10 to 19 bands per
                                                                              primer, and the amplicons showed a molecular weight between 300
                                                                              and 2100 pb. A comparison of electrophoretic profiles of isolates
                                                                              showed a large number of polymorphic bands (98%). Multivariate




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   31
Poster Presentations



analysis revealed clusters and the formation of two groups: one formed           Acknowledgement: The authors acknowledge the Fundacao para
                                                                                                                                   ¸˜
by eight isolates and another by two isolates. Similarly to the sensitivity          ˆ
                                                                                 a Ciencia e Tecnologia (FCT) for the post-doc grant attributed to L. A.
tests, results showed that all strains are susceptible or susceptible dose-      Vale-Silva (SFRH/BPD/29112/2006).
dependent, to itraconazole, however, with an MFC > 16 lg ml-1. As                References
for fluconazole, 50% of the strains are sensitive, but 100% MFC present           1. Clinical and Laboratory Standards Institute. Approved standard
in concentrations higher than those tested. As for nystatin, 60% of the             M27-A3, 3rd edn. Wayne, PA: Clinical and Laboratory Standards
strains showed MIC at the concentration of 2 lg ml-1 and 40%, 1 g ml-               Institute, 2008.
1
   and only 20% of the strains tested showed MFC than 16 g ml-1.                 2. Van Asbeck E, Clemons KV, Martinez M, Tong AJ, Stevens DA.
However, all other antifungal agents tested showed MFC higher                       Diagn Microbiol Infect Dis. 2008; 62:106–9.
concentrations tested, indicating a high resistance to commercially
available antifungal agents. Therefore, the identification of Candida
species that affect HIV/AIDS patients, as well as the verification of
sensitivity to antifungal drugs and establishment of resistant species
may contribute to better monitoring patients and taking action in                P010
relation to each appropriate therapy case. Support: CAPES and                    In vitro activity of amphotericin B and fluconazole in
FAPERGS.                                                                         combination with atorvastatin and moxifloxacin against
                                                                                 Candida albicans
                                                                                 S. Kustimur, S. J. Fadil, S. Kustimur and A. Kalkanci
                                                                                 Gazi University, Ankara, Turkey
P009
Antifungal susceptibility testing of Candida parapsilosis                        Objectives: Patients suffering from invasive mycoses often receive
against caspofungin and anidulafungin by the CLSI broth                          concomitant antifungal therapy and antibacterial agents. Assessment
microdilution protocol, Etest, and a flow cytometry-based                         of pharmacodynamic interactions between antifungal and antibacte-
method                                                                           rial agents is complicated by the absence of a common antifungal end
P. Pinto1, L. Vale-Silva2, V. Lopes1, H. Ramos1 and E. Pinto2                    point for both agents. Antifungal effect of non-antifungal compounds
1                                                                                such as quinolones and statins has been reported previously. The
 Centro Hospitalar do Porto, Porto, Portugal, 2University of Porto,
                                                                                 aim of this study was to investigate the in vitro interaction of
Porto, Portugal                                                                  moxifloxacin and atorvastatin with fluconazole and amphotericin B
                                                                                 against ten isolates of Candida albicans strains which were resistant to
Objectives: It is common knowledge that there has been an                        amphotericin B.
apparent shift in infections caused by Candida spp., with non-albicans           Methods: Drug interaction model was used to analyze the in vitro
Candida spp., like C. parapsilosis, assuming an increasing role in               interaction of antifungal drugs against various C.albicans strains using
pathogenesis of candidemia. Candida parapsilosis have shown variable             the microdilution checkerboard method. Drug interaction was classified
susceptibility patterns to the new antifungal agents, echinocandins. It          as synergistic, additive, indifferent or antagonistic on the basis of the
is advisable to determine the antifungal susceptibility patterns                 fractional inhibitory concentration (FIC) index. The FIC index is the sum
of clinical isolates, which may assist in making appropriate decisions           of the FICs for each drug; the FIC is defined as the MIC of each drug when
regarding the best therapeutic options. The objective of this study was          used in combination divided by the MIC of the drug when used alone.
to compare Etest and flow cytometry (FC) with the reference CLSI broth            The final concentrations of the antifungal agents ranged from 0.25 to
microdilution method (BMD) for antifungal susceptibility testing (AST)           128 lg ml-1 for fluconazole, 0.03 to 16 lg ml-1 for amphotericin B. The
of C. parapsilosis to caspofungin and anidulafungin.                             final concentrations of the non-antifungal drugs ranged from 1.25 to
Methods: Twenty C. parapsilosis isolates from relevant clinical                  6.25 lg ml-1 for atorvastatin, 3.5 to 1750 lg ml-1 for moxifloxacin.
samples in our Hospital were tested. The broth microdilution method              MIC endpoints were determined as the first concentration of the
was performed according to the reference CLSI protocol M27-A31.                  antifungal agent, either alone or in combination, at which the turbidity
Etest MICs were determined according to the instructions from the                in the well was less than 50% of that in the control well.
manufacturer (AB Biodisk, Solna, Sweden). The flow cytometry                      Results: Synergistic interactions         were      observed      between
method was based on a 4-h incubation of the yeast cells with two-                amphotericin B and atorvastatin against six of 10 C. albicans strains.
fold dilutions of the antifungals, followed by staining with acridine            Additive interaction was found in resting four strains. Synergy also was
orange. Quality control was performed using C. parapsilosis ATCC                 found between amphotericin B and moxifloxacin against three of 10
22019 and C. krusei ATCC 6258. Major errors were results of                      C. albicans strains. Additive interaction was found in resting seven
susceptibility by BMD and resistance by Etest or FC. Very major errors           strains. Some antagonistic interactions were observed between ator-
were results of resistance by BMD and susceptibility by Etest or FC.             vastatin and fluconazole against two of C. albicans strains. Synergistic
Results: The determined caspofungin BMD MICs were 1–2 lg ml-1                    interaction was observed between these two drugs against two of the
and all strains were thus considered as susceptible. There was a 100%            strains, while additive effect was found against resting six strains.
agreement within two log2 concentrations between the reference                   Additive effect was observed between fluconazole and moxifloxacin
method and both Etest and FC and a 95% agreement within one                      against six of C. albicans strains, tested. Synergy also was found
dilution for both methods, with one major error registered with FC.              between fluconazole and moxifloxacin against four of 10 C. albicans
Regarding anidulafungin, the BMD MICs ranged from 1 to 4 lg ml-1,                strains. In general, atorvastatin enhanced the activity of antifungal
with three non-susceptible strains (15%). The agreements within one              agents more than moxifloxacin against C. albicans.
and two dilutions were 100% for both methods, with one very major                Conclusion: In this study we analyzed the in vitro interactions
error (5%) for each method.                                                      between antifungal drugs with non-antifungal drugs. Four different
Conclusion: We have obtained very good correlations between MIC                  combinations, were used in this study to investigate the interactions
results for both echinocandins determined according to the reference             between amphotericin B and fluconazole each of moxifloxacin and
BMD method, Etest, and a new flow cytometry-based method. The                     atorvastatin. For the majority of strains, the combination tests
values were clustered around the 2 lg ml-1 breakpoint value for                  showed additive activity. Significant in vitro interactions were found
susceptibility, a typical finding for C. parapsilosis2, making it possible for    between antifungal agents and atorvastatin or moxifloxacin against
very good MIC value agreements obtained with different methods to                C. albicans. This particular analysis can provide a useful tool for the
admit classification errors. We have found very few of those cases,               assessment of interactions between antifungal agents and non-
however. Overall, these results appear to indicate that the three                antifungal compounds, which alone do not elicit any significant
methods could be appropriate for AST of caspofungin and anidulafun-              antifungal activity, and possibly of interactions against resistant
gin. The less time-consuming could so be employed in substitution of             isolates. Synergy would be the most suitable for routine empirical
the reference BMD protocol. The FC method could, in addition, allow              clinical use, based on clinically achievable drug concentrations with
single day result availability.                                                  commonly used dosage regimens.




                                                                                                                                   Ó 2009 The Authors
32                                                                    Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



P011                                                                        shown that caspofungin and micafungin are also able to interfere with
Differential interactions between azoles and echinocandins                  Candida biofilm growth on polystyrene and central venous catheter
against Candida spp. biofilms and planktonic cells                           sections, as well as to induce a significant and persistent reduction in
A. Chatzimoschou, M. Simitsopoulou, C. Antachopoulos and                    the yeast metabolic activity of biofilms when used as catheter lock
                                                                            solutions. The aim of this study was to investigate the in vitro activity of
E. Roilides
                                                                            anidulafungin on both planktonic and sessile growths of eighty isolates
Aristotle University Thessaloniki, Thessaloniki, Greece                     of Candida species (10 C. albicans, 40 C. parapsilosis, 10 C. tropicalis, 10
                                                                            C. glabrata, and 10 C. krusei) collected from blood infections.
Objectives: Candida spp. form biofilms (BF) on biological and inert          Susceptibilities of these isolates to caspofungin and fluconazole were
surfaces, such as intravascular catheters. Candida albicans (CA) and        also determined. Planktonic MIC90 values and sessile MIC90 values
Candida parapsilosis (CP) are currently the most prevalent species in       were 0.25 and 0.125, 1 and 2, and 8 and > 256 lg ml-1 for
causing invasive candidiasis. Resistance of Candida BF to conventional      anidulafungin, caspofungin, and fluconazole, respectively, suggesting
antifungal agents has been previously documented (Katragkou et al.,         that anidulafungin is more active than caspofungin against Candida
AAC, 2008). Given that BF-associated infections are very difficult to        biofilms.
cure without device removal, novel, more effective therapies are
needed. Antifungal triazoles have been previously shown to exert
antifungal activity against Candida BF only at very high concentra-
tions. In addition, triazoles are often administered concurrently with
echinocandins. We therefore studied the antifungal activity of voric-       P013
onazole (VRC) or posaconazole (PSC) against CA or CP BF or                  Candida species distribution and antifungal drugs
planktonic cells (PL) in combination with two echinocandins, caspo-         susceptibility evolutions: a 5 years study in a French
fungin (CAS) or anidulafungin (AND).                                        intensive care unit
Methods: Two well-documented BF-producing Candida species, CA-              P. Fournier1, D. Maubon1, A. Francais2, R. Hamidfar1,
                                                                                                              ¸
M61 and CP-A71 were used to produce BF by incubation on silicone            A. Bonadona1, O. Faure1, B. Lebeau1, J. F. Timsit3 and H. Pelloux1
elastomer disks in 96-well plates, under constant shaking, at 37 °C for     1
                                                                             CHU, Grenoble, France, 2Institut Albert Bonniot, Grenoble,
48 h and 72 h, respectively. PL cells were grown in YNB medium,
                                                                            France, 3CHU and INSERM U823, Grenoble, France
supplemented with 2% glucose at 37 °C C for 24 h. 5 · 105
blastoconidia/ml were plated in each well of a 96-well plate. PL and
BF were then incubated for 24 h with 2-fold dilutions of VRC or PSC         Objectives: The number of at risk patients for fungal infections in
(16–1024 mg L-1), and CAS or AND (0–16 mg L-1) alone or concur-             ICU is in constant raise. Widespread prophylactic and therapeutic
rently, VRC/PSC with CAS/AND in a checkerboard format. Fungal               antifungal use are commonly suspected to contribute to the modifica-
damage induced by antifungal agents to PL and BF was assessed by            tion of common fungal epidemiology or to the emergence of resistant
XTT assay. The interactions between VRC+AND, VRC+CAS,                       strains. A five year retrospective study of Candida species distribution
PSC+AND and PSC+CAS were analyzed using the Bliss model.                    and their related Minimum Inhibitory Concentration (MIC) for
Synergy, antagonism or indifference was concluded when the observed         antifungal drugs was achieved in an ICU, in order to precise these
fungal damage was significantly higher, lower or equal to the expected       phenomenons.
damage, respectively.                                                       Methods: From 2004 to 2008, 20611 biological samples (2817
Results: A synergistic interaction was observed between 32–                 patients) were analysed. All biological samples for which fungal
128 mg L-1 of PSC combined with 0.008–0.25 mg L-1 of CAS only               research was requested were taken into account. Samples were mainly
for CA PL. By contrast, antagonism was observed when either of the          blood culture, respiratory tract, mouth, urines, stools, drainage liquids
two triazoles was combined with AND at the following concentration          and surgical scars. Candida species were counted only one time for each
ranges: 128–1024 mg L-1 PSC with 0.03–0.5 mg L-1 AND, 16–                   patient. Everyday use identification procedure for Candida species was
512 mg L-1 VRC with 0.008–0.015 mg L-1 AND, 128–512 mg L-1                  performed. Antifungals susceptibilities were evaluated for deep local-
VRC with 0.03–0.25 mg L-1 AND for CA PL and 32–1024 mg L-1 VRC              isations or supposed sterile sites (n = 876), with the ATB FungusÒ
with 0.5–8 mg L-1 CAS for CP PL. All drug combinations demonstrated         (from 2004 to 2005) and the E-TestÒ methods (from 2006 to 2008).
indifferent interactions against BF of both species.                        Wilcoxon test and Chi square for trend test were used for the statistical
Conclusions: The antagonistic or indifferent interactions between           analysis.
triazoles and echinocandins against PLs and BFs suggest that                Results: Over the 5 years, 19% of the biological samples were
concurrent administration of these antifungal classes in cases of           positive (3832/20611) corresponding to 31% of patients (879/2817)
foreign body-associated infections due to C. albicans and C. parapsilosis   with no significant variation between years. The study of the
should be considered with caution.                                          repartition of Candida species showed that Candida albicans slowly
                                                                            decreased (from 51.6% in 2004 to 46.8% in 2008, average 47.4%), as
                                                                            Candida parapsilosis and Candida krusei increased (from 5.3% in 2004 to
                                                                            8.3% in 2008, average 6% and from 3.2% in 2004 to 6.8% in 2008,
                                                                            average 4.7%, respectively). We also observed the decrease of Candida
P012                                                                        glabrata since 2005 (from 18.4% in 2005 to 13.2% in 2008, average
                                                                            15.7%). However, these slow but constant modifications were not
In vitro activity of anidulafungin against biofilms formed by
                                                                            statistically significant on the studied period. In contrast, we found
bloodstream isolates of Candida species
                                                                            significant variations in MIC studies. The number of Fluconazole
B. Posteraro, B. Fiori, M. Sanguinetti and G. Fadda                         resistant or dose-dependant C. glabrata strains significantly increased
          `
Universita Cattolica del S. Cuore, Roma, Italy                              during that period (from 6.7% to 23.1%, average 16.1%) and
                                                                            corresponding MICs significantly increased between 2004–2006 vs.
Invasive fungal infections represent a relevant health problem due to       2007–2008 (P = 0.005). Importantly, strains susceptibility to Caspo-
their elevated rates of mortality and costs of care. Among these            fungin was significantly reduced from 2007 to 2008 (P = 0.005) for
infections, candidiasis can be associated with the formation of biofilms     all Candida sp. strains, even if no real resistance in vitro was described
on bioprosthetic surfaces. This Candida biofilm growth results in            during that period. This result need to be further explored in the light of
antifungal drug resistance and protection of the fungus from host           anti-fungal hospital and ICU consumptions. No others susceptibility
defenses, which carry important clinical repercussions. Echinocandins,      modifications were found, particularly C. albicans susceptibility to
namely caspofungin, micafungin, and anidulafungin, represent the            Fluconazole was not modified.
newest addition to the arsenal against fungal infections. Through the       Conclusion: In this study, the global yeast flora remains statistically
inhibition of the fungal (1,3)-beta-D-glucan synthase, these agents         stable in the ICU, C. albicans being the most frequent. Yet, slow but
have a broad spectrum of activity and are similar to each other with        constant increase of C. krusei and C. parapsilosis leads us to consider
respect to in vitro activity against Candida species. Recent studies have   them as emerging species for a near future. We report a significant




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                    33
Poster Presentations



increase in Caspofungin MIC for all Candida sp. in vitro. This                                                                           ´n
                                                                                  Gobierno Vasco) and PI061895/2006 (Fondo de Investigacio Sani-
observation also emphasizes that there is a high need to precise                                                                   ˜
                                                                                  taria del Ministerio de Sanidad y Consumo de Espana).
correlation of in vivo and in vitro susceptibility to echinocandins. Thus,
there is an essential need to continue antifungal drugs susceptibilities
testing for Candida strains from ICU patients.
                                                                                  P015
                                                                                  Influence of serum on in vitro susceptibility testing of
P014                                                                              echinocandins for Candida parapsilosis and Candida
In vitro activity of current and new antifungal agents                            guilliermondii
against Spanish clinical isolates of Candida parapsilosis,                        Z. Saribas, P. Yurdakul, G. Cetin and S. Arikan
Candida orthopsilosis, and Candida metapsilosis                                   Hacettepe University Medical School, Ankara, Turkey
I. Miranda Zapico1, E. Eraso1, J. L. Hernandez Almaraz2,
                                          ´
A. J. Carrillo Munoz3, J. M. Hernandez Molina4 and G. Guillermo
                   ˜               ´                                              Objectives: Candida guilliermondii and Candida parapsilosis are less
         1
Quindos´                                                                          susceptible to echinocandins (caspofungin-CAS, micafungin-MICA,
1
  Universidad del Paı´s Vasco, Leioa, Spain, 2Hospital de Cruces,                 and anidulafungin-ANID) in vitro, as compared to other Candida
Barakaldo, Spain, 3ACIA-Microbiologı´a, Barcelona, Spain, 4Hospital               species. The influence of serum on the results of in vitro echinocandin
Carlos Haya, Ma  ´laga, Spain                                                     susceptibility testing has been one of the recent areas of interest. The
                                                                                  purpose of this study is to evaluate and compare the effect of human
                                                                                  serum on the in vitro susceptibility testing of CAS, MICA, and ANID,
Candida parapsilosis is an emerging major human pathogen that has                 specifically against the less candin-susceptible Candida species, C.
dramatically increased in significance and prevalence. C. parapsilosis is          guilliermondii and C. parapsilosis.
now one of the leading causes of invasive candidiasis in Spain and                Methods: A total of 76 clinical isolates (64 C. parapsilosis and 12 C.
other Mediterranean countries. However, this species has been recently            guilliermondii) were included in the study. Broth microdilution
split in at least three different species Candida parapsilosis sensu stricto,     susceptibility testing was performed according to the CLSI M27-A3
Candida orthopsilosis, and Candida metapsilosis.                                  method and in absence and presence of 50% sterile human serum
Objective: To determine the in vitro activity of current and new                  (Sigma Aldrich, St. Louis, MO, USA). Based on the results of the
antifungal agents against C. parapsilosis, C. orthopsilosis, and                  preliminary studies, the final drug concentrations were selected in the
C. metapsilosis.                                                                  range of 512–1 lg ml-1 for CAS, 32–0.06 lg ml-1 for MICA, and 64–
Methods: In vitro activities of current (5-fluorocytosine, amphoter-               0.125 lg ml-1 for ANID. MICs were read after 24 and 48 h of
icin B, fluconazole and itraconazole) and new (anidulafungin, caspo-               incubation. Since the wells containing human serum were totally
fungin, micafungin, posaconazole and voriconazole) antifungals were               turbid and hard-to-read after agitation, two alternative methods of
assessed by Sensititre YeastOne 9 (Trek Diagnostics Systems, USA)                 visual reading without agitation (Dr Nathan Wiederhold and Dr
against 25 C. parapsilosis, 11 C. orthopsilosis, and eight C. metapsilosis.       Zekaver Odabasi, personal communication) were evaluated for all tests
MICs were determined at the recommended endpoints and time                        with and without serum. For this purpose, following the respective
intervals by manufacturers and CLSI M27-A3 document.                              incubation period, the turbidities of the corresponding pellets in the
Results: All antifungals tested were very active against most isolates            wells were graded (from one to four) either (i) directly after being taken
of C. parapsilosis, C. orthopsilosis, and C. metapsilosis. Only one isolate of    out of the incubator and as based on the density of the precipitate or (ii)
C. parapsilosis were inhibited by MICs of 16–32 lg ml-1 of fluconazole             after being centrifuged. Since these two methods of reading demon-
at 48 h. Echinocandins were more active against C. orthopsilosis and C.           strated identical MIC values (data not shown), direct reading (i) was
metapsilosis than against C. parapsilosis. However, differences were              chosen for the rest of the experiments and MICs were read at MIC-2
observed among echinocandins against C. parapsilosis. 5, 3 and 0                  endpoint for all tests. For comparison and where needed, MIC off-scale
isolates of C. parapsilosis were inhibited at 48 h by MIC > 2 lg ml-1 of          values were converted to the next highest dilution.
anidulafungin, caspofungin and micafungin, respectively. MIC50 and                Results: The 24 h MIC results are shown in the Table.
MIC90, MIC range and geometric mean values in microgram per
milliliter at 24 h were the following: C. parapsilosis, 5-fluorocytosine
(0.125/0.125/0.06–0.5/0.113), amphotericin B (0.5/0.5/0.25–0.5/
0.369), itraconazole (0.125/0.25/0.03–0.25/0.104), fluconazole (1/
2/0.5–4/0.973), posaconazole (0.06/0.125/0.008–0.25/0.042), vo-
riconazole (0.03/0.06/0.008–0.125/0.022), anidulafungin (1/2/
0.25–2/1.117), caspofungin (0.25/0.5/0.125–1/0.330), and mica-
fungin (0.5/1/0.125–1/0.529). C. metapsilosis, 5-fluorocytosine (0.06/
0.06/0.06–64/0.113), amphotericin B (0.5/1/0.25–1/0.500), itraco-
nazole (0.125/0.125/0.06–0.5/0.109), fluconazole (2/8/0.25–16/
1.763), posaconazole (0.06/0.125/0.008–0.125/0.037), voriconazole
(0.03/0.06/0.008–0.25/0.028), anidulafungin (0.125/0.5/0.03–0.5/
0.182), caspofungin (0.125/0.5/0.03–1/0.170) and micafungin,
(0.25/0.5/0.015–0.5/0.182). C. orthopsilosis, 5-fluorocytosine
(0.06/–/0.06–1/0.085), amphotericin B (0.25/–/0.25–0.5/0.273),
itraconazole (0.125/–/0.06–0.25/0.135), fluconazole (2/-/0.06–2/
0.973), posaconazole (0.03/-/0.015–0.125/0.039), voriconazole
(0.015/-/0.008–0.06/0.020), anidulafungin (0.5/–/0.125–1/0.386),
caspofungin (0.25/-/0.06–0.5/0.210) and micafungin, (0.125/-/0.06–
0.25/0.136).                                                                      Conclusions: (i) Presence of serum tends to alter the MICs of all
Conclusions: Current antifungals, posaconazole and voriconazole                   three echinocandins. This change is mostly towards generation of a
were very active against C. parapsilosis, C. orthopsilosis, and C.                higher MIC. (ii) The amount of increase in MIC in presence of serum is
metapsilosis. Echinocandins were more active against C. orthopsilosis,            variable. However, considering the results obtained for most of the
and C. metapsilosis. Anidulafungin, caspofungin and micafungin                    isolates and all three drugs, the MIC fold change range is 3–5 and 2–4
showed differences in their in vitro activities against C. parapsilosis           for C. parapsilosis and C. guilliermondii, respectively. (iii) The influence of
sensu stricto.                                                                    serum on MICs is in general similar for CAS, MICA, and ANID, with
Funding: Projects GIC07 123-IT-222–07 (Departamento de Educa-                     minor differences. The influence is highest with MICA for C. parapsilosis
   ´                                   ´
cion, Universidades e Investigacion, Gobierno Vasco), S-PE08UN35                  and with ANID for C. guilliermondii. (iv) Further studies are required for
(Saiotek 2008, Departamento de Industria, Comercio y Turismo,                     evaluation of these in vitro results.




                                                                                                                                    Ó 2009 The Authors
34                                                                     Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



P016                                                                          Methods: We studied a global of 55 isolates of Aspergillus spp. (21
Antifungal activity of chemical and physical agents against                   A. fumigatus, 17 A. terreus, 16 A. flavus and one A. glaucus) isolated
clinical and environmental strains of Candida parapsilosis                    from clinical specimens. The MD reference susceptibility testing was
A.P. Silva, C. Pina-Vaz and A. G. Rodrigues                                   performed following the CLSI M38-A2 document. Stock inoculum
                                                                              suspensions were prepared from 4-days-old cultures grown on potato
University of Porto, Porto, Portugal
                                                                              dextrose agar and adjusted spectrophotometrically with saline solution
                                                                              to ~80% transmittance. The Sensititre Yeast One was performed
Objective: There is limited information on the effectiveness of               following the manufacturer’s instructions, and read the minimum
chemical and physical agents vs. C. parapsilosis strains. Futhermore,         effective concentration (MEC), defined like the lowest concentration of
whether exist differences between clinical and environmental strains.         drugs causing abnormal hyphal growth, and MIC (80% of growth
The purpose of the present study was to evaluate the activity of              inhibition) at 48 h. Reference strains: A. fumigatus ATCC 204305 and
chemical and physical agents against clinical and environmental               A. flavus ATCC 204304 and QC: C. parapsilosis 22019 and C. krusei
strains of C. parapsilosis.                                                   6258 were included in each susceptibility test for quality control and
Material and Methods: Eight clinical and eight environmental                  assessment of reproducibility.
strains of C. parapsilosis were studied. All isolates were obtained either    Results: All strains were susceptible to three equinocandins tested.
                                                   ˜o,
from patients admitted at Hospital S. Joa Porto, or from the                  Excellent agreement was found with anidulafungin and micafungin as
environmental of the same hospital. The potential of different chemical       all isolates showed MICs/MECs £ 0.015 lg ml-1 with anidulafungin
(chlorhexidine, ethanol, sodium hypochlorite, phenol, hydrogen per-           and £ 0.008 lg ml-1 with micafungin by S but lower dilutions should
oxide and cupric sulphate) and physical agents (heating at 60 °C,             be tested as MICs were £ 0.03 lg ml-1 by MD for both antifungal
microwave and ultraviolet irradiation) to inactivate C. parapsilosis was      agents and we can not determine the concordance to low concentra-
evaluated. For chemical agents, susceptibility was determined using a         tions. However, lower agreement was obtained with caspofungin due
microdilution method (M27-A3 protocol from CLSI). Regarding                   to lower MECs by Sensititre Yeast One. Moreover, with caspofungin
physical agents, the kinetics of survival of blastoconidia during             MECs results were one or two dilution lower than MICs results obtained
treatment were studied. Additionally, the assessment of primary cell          by S.
membrane lesion was evaluated using a cytometric assay with                   Conclusions: (i) All strains of Aspergillus spp were susceptible by
propidium iodide.                                                             both methods, with excellent agreement with anidulafungin and
Results: The concentration of 0.06% of chlorhexidine, 10% of                  micafungin. (ii) Sensititre Yeast One could be an useful method for
ethanol, 25 ll ml-1 of sodium hypochlorite, 0.31% of phenol, 0.06%            testing susceptibility of echinocandins against Aspergillus spp
of hydrogen peroxide and 2 mg ml-1 of cupric sulphate, were lethal to         although additional studies are needed with other concentrations
all C. parapsilosis strains independently of its endogenous or exogenous      range.
origin. Regarding physical agents, following heating at 60 °C for
5 min, microwave irradiation for 60 s or ultraviolet irradiation for
10 min, a reduction of at least three log in C. parapsilosis growth was
registered. In ultraviolet irradiation and heating at 60 °C treatments,
the reduction in environmental strains were lowest than the reduction
in clinical strains. Propidium iodide staining demonstrated that              P018
treatment with chlorhexidine, sodium hypochlorite, cupric sulphate            Comparison of inhibitory and fungicidal activities of five
and heating at 60 °C (45 min) and microwave irradiation (90 s)                triazoles against clinical isolates of Trichosporon asahii
causes serious primary cell membrane lesions.                                 G. Cetin and S. Arikan
Conclusions: For disinfection of surfaces and hand washing,                   Hacettepe University Medical School, Ankara, Turkey
chlorhexidine proved to be very effective against C. parapsilosis. For
food and water treatment, heating at 60 °C and microwave irradiation
were found to be effective physical agents. Regarding the other               Objectives: Trichosporon asahii is a significant cause of morbidity
chemical and physical agents tested, its potential to reduce contam-          and mortality in immunocompromised patients and treatment of
ination was defined; such data might be of use in the formulation of           Trichosporon infections remains difficult. Trichosporon species are mostly
new products and protocols for hospital cleaning disinfection. Gener-         resistant to the fungicidal activity of amphotericin B and show primary
ally, the sensitivity of C. parapsilosis clinical and environmental strains   resistance to echinocandins. While triazoles remain as the current and
to chemical and physical agents did not varied significantly.                  main antifungal agents of choice for treatment of Trichosporon
Acknowledgement: A.P. Silva is supported by grant no. SFRH/BD/                infections, limited data are available comparing the activities of
29540/2006 from Science and Technology Foundation (FCT),                      different triazoles against this genus. The aim of this study is to
Portugal.                                                                     determine minimum inhibitory (MIC, lg ml-1) and minimum fungi-
                                                                              cidal concentrations (MFC, lg ml-1) of fluconazole (FLU), itraconazole
                                                                              (ITRA), voriconazole (VORI), posaconazole (POS), and isavuconazole
                                                                              (ISAVU), and compare the inhibitory and cidal activities of these
                                                                              triazoles against clinical isolates of T. asahii.
P017                                                                          Methods: Ninety clinical isolates were tested. MICs were deter-
Evaluation of Sensititre Yeast One in susceptibility testing                  mined using CLSI M27-A3 microdilution method. MIC-0 (complete
of echinocandins against Aspergillus spp.                                     inhibition of growth) and MIC-2 (~50% reduction in turbidity
                                                                              compared to the growth control well) endpoints were recorded.
M. Trinidad1, C. Castro2, A. I. Martos2, A. Romero2, E. Canton2
                                                                              MFCs were determined by the method reported by Canton et al.
and E. Martin-Mazuelos2
1                                                                             (DMID 2003; 45: 203–206), using 104 cfu ml-1 inoculum size and
 Hospital of Valme, Seville, Spain, 2Hospital la Fe, Valencia,                > 99.9% killing criterion. MIC and MFC results were read at both
Spain                                                                         24 and 48 h of incubation.
                                                                              Results: MICs and MFCs obtained at 48 h are shown in the Table.
Objectives: In the last years the resistance to established antifungal        Conclusions: (i) FLU exhibits highest MICs and MFCs and limited
agents has increased, so there remains the need for new agents and            or no in vitro activity against T. asahii. (ii) VORI, ISAVU, POS, and
susceptibility testing to know the resistance pattern. Echinocandins          ITRA show favorable and similar activities in vitro with minor
are new antifungal drugs that may promise for the treatment of                differences. MICs and MFCs of these four drugs are within a narrow
invasive fungal infections. We assessed the suitability of the                range of at most 3 two-fold dilutions of one another. (iii) VORI
colorimetric method Sensititre Yeast One (S) for testing the suscep-          exhibits the lowest MICs and MFCs of all drugs tested. (iv) MIC-2
tibility of different Aspergillus species to anidulafungin, caspofungin       endpoint yields 1–3 two-fold dilution lower MICs in general as
and micafungin by comparing with the reference method (MD) (CLSI,             compared to MIC-0. (v) These in vitro results warrant further
M38-A2).                                                                      evaluation and in vivo validation.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   35
Poster Presentations



Table 1 GM: geometric mean                                                   Conclusion: These results suggest that both methods provide good
                                                                             quantitative and qualitative correlation with the CLSI broth microdi-
                                                                             lution. VITEK 2 can also provide an automated method that allows the
                                                                             identification of most yeasts. This system offers a faster method for
                                                                             susceptibility testing than E-test and has the advantage of spectropho-
                                                                             tometrically reading.




                                                                             P020
                                                                             In Vitro Activities of Antifungal Agents Against Rhodotorula
                                                                             Species
                                                                                                        ˜
                                                                             T. Pelaez, B. Gama, P. Munoz, M. J. Ruiz-Serrano, J. Guinea,
                                                                             R. Flores, M. Pedromingo and E. Bouza
                                                                             Hospital Gregorio Maran ´n, Madrid, Spain
                                                                                                     ˜o

                                                                             Objective: Rhodotorula species has emerged as a pathogen that
                                                                             mainly infects immunosuppressed patients with or without a central
                                                                             venous catheter. Despite the increased incidence of invasive infection
                                                                             due to Rhodotorula species in the last decade, data on the antifungal
                                                                             susceptibility of this species are limited. This study reports the
                                                                             epidemiology and susceptibility data for the clinical isolates of
                                                                             Rhodotorula species in our institution.
                                                                             Methods: From 1988 to 2008, 252 isolates of Rhodotorula species
                                                                             were recovered from 250 patients. MICs were determined using the
                                                                             E-test. The antifungal agents tested were amphotericin B (AMB),
                                                                             fluconazole (FZ), itraconazole (IZ), voriconazole (VZ), posaconazole
                                                                             (POS), and caspofungin (CAS).
                                                                             Results: We divided the study into two periods: 1988–98 (86
                                                                             isolates/86 patients) and 1999–2008 (166 isolates/164 patients).
                                                                             Most of the isolates (173, 69%) were identified as Rhodotorula
P019                                                                         mucilaginosa (formerly R. rubra), 59 (23%) as Rhodotorula glutinis, 5
Voriconazole susceptibilities of Candida spp isolates as                     (2%) as Rhodotorula minuta, and 15 (6%) as Rhodotorula species on the
determined by the CLSI reference method (M27-A3) and two                     basis of morphological and biochemical features. Clinical isolates were
other commercial methods.                                                    obtained from a variety of clinical sources: skin (n = 64), nails
M. Trinidad1, A. Gonzales1, A. Romero1, E. Canton2, J. Peman2,               (n = 63), tissue biopsy specimen (n = 25), respiratory tract (n = 24),
                                                                             oropharynx (n = 24), abscesses (n = 16), urine (n = 10), CSF (n = 8),
G. Quindos3 and E. Martin-Mazuelos3
1                                                                            peritoneal fluid (n = 6), blood (n = 5), vagina (n = 5), and other sites
 Hospital of Valme, Seville, Spain, 2Hospital la Fe, Valencia, Spain,
3                                                                            (n = 2). The MIC ranges (lg ml-1) of all antifungal agents tested
 Universidad de; Pais Vasco, Bilbao, Spain                                   against the 41 available clinical isolates of Rhodotorula species from
                                                                             deep sites were as follows: AMB (0.5–2), FZ (8 to > 256), IZ (0.06–16),
Objectives: The evaluation of an automated commercial method                 VZ (0.03–8), POS (0.01–16), and CAS (4 to > 32). The geometric
AST-YS01 card (VITEK 2, bioMerieux) and an agar diffusion method             means (GMs) of the MICs and MICs90 were: AMB (1.6/2), FZ (44.1/
(E-test, AB BIODISK) for determining susceptibility to voriconazole by       > 256), IZ (0.6/16), VZ (0.5/8), POS (0.3/16), and CAS (12.2/> 32).
comparing the MICs obtained by these methods with those of the               Most of the isolates were inhibited by < 1lg ml-1 of amphotericin B,
M27-A3 broth microdilution method (BMD). Although there is a                 the most active drug in vitro against Rhodotorula species.
reference method for yeast susceptibility testing, it is not be the most     Conclusion: To our knowledge, this is the most extensive report of
convenient for use in routine in clinical laboratories, so it is             susceptibility data for Rhodotorula species, which is isolated with
important the performance of new methods. Recently has been                  increasing frequency in our institution. We show that most of the
incorporated a new card to use with the VITEK 2 system. This                 isloates were resistant in vitro to fluconazole and caspofungin.
automated method allows as the identification as the susceptibility           Amphotericin B showed the best in vitro activity against clinical
testing of most yeasts.                                                      isolates of Rhodotorula species.
Methods: A total of 99 yeast isolates were evaluated (73 Candida
albicans, 21 Candida glabrata and six Candida tropicalis). E-test and the
VITEK 2 system was performed in accordance with the manufacturer’s
instructions and read at 24 h. Broth microdilution method was
performed according to the CLSI document M27-A2. Discrepancies               P021
among MIC endpoints of +/- two dilutions were used to calculate the          Etest antifungals susceptibility testing directly from blood
percentage of agreement and categorical agreement (CA) was calcu-            culture
lated based on breakpoints published in the M27-A3 document. Major           S. Costa de Oliveira1, A. P. Silva1, F. Alves2, C. Correia2,
errors (ME) were defined as susceptible (S) by reference method and
                                                                             A. G. Rodrigues1 and C. Pina-Vaz2
resistant (R) by the other, while minor errors are considered when MIC       1
indicates S by a method and susceptible doses dependent (SDD) by the
                                                                              Porto Faculty of Medicine, Porto, Portugal, 2Hospital de Sa Joa
                                                                                                                                          ˜o ˜o,
other. Very major errors were identified when the result is R by              Porto, Portugal
reference procedure and S by the other method.
Results: The overall percentage of agreement between VITEK 2 and             Objective: Fungaemia is associated with high mortality rate. Blood
BMD was 97% and 96% when comparing E-test with BMD. Also                     cultures have become one of the most critically important tests in the
similar excellent categorical agreement was found in both compari-           clinical microbiology laboratory. Semi-automatic systems are used to
sons. The best agreement was found with VITEK 2 and C. tropicalis.           detect growth of microorganisms but subcultivation is mandatory for
Only one very major error was found as with VITEK 2 as with E-test.          identification or to perform susceptibility testing. This demands too
The same isolate was R by BMD and S by the other two methods.                much time for critically ill patients Antifungal susceptibility profile is




                                                                                                                               Ó 2009 The Authors
36                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                            Poster Presentations



important but still is a cumbersome and lengthy procedure. The                        voriconazole. Concerning the echinocandins elevated MICs were
purpose of this study was to evaluate Etest susceptibility to the main                observed for C. glabrata, C. parapsilosis, C. guilliermondii and C. lusitaniae.
antifungals directly from blood culture, as soon as growth is detected                However, only two strains of C. parapsilosis showed MICs > 2 mg L-1
by BACTEC system. Candida strains, with a known susceptibility profile,                against anidulafungin and micafungin thus indicating resistance.
were inoculated on blood culture bottles and Etest immediately                        Conclusion: Up to date our multicenter study reveals no evidence of
performed after growth detection by the automatic system. The results                 emerging azole or echinocandin resistance among invasive clinical
were compared with the reference method (CLSI, M27-A3).                               isolates of Candida spp.
Methods: An inoculum of five Candida cells per milliliter was
suspended on Myco/F Lytic medium and incubated in the Bactec
9000 system (Becton Dickinson, Sparks, Md.). A total of 40 Candida
strains (14 C. albicans, 13 C. parapsilosis, five C. glabrata, four C. krusei          P023
and four C. tropicalis) with different antifungal phenotypes determined               Deep rare mycoses in the broader area of Athens, Greece;
by microdilution method (CLSI, M27-A3 protocol) were evaluated.                       sensitivity to Amphotericin B, Posaconazole and
Whenever the automatic system gave a positive result, aliquots was                    Caspofungin alone and in combination using the
                                ´
plated in RPMI agar (BioMerieux, Paris) and MIC to six different                      checkerboard method
antifungals (amphotericin B, fluconazole, voriconazole, posaconazole,                  A. Skiada1, F. D. Mantopoulou1, M. Drogari-Apiranthitou1,
caspofungin and anidulafungin) was determined using Etest (ABiodisk,                  E. Cuenca-Estrella2, J. L. Rodriguez-Tudela2, K. Tzanetou3,
Sweden). Minimal inhibitory concentration (MIC) was registered after                  E. Petrikkou1, A. Mitroussia-Ziouva4, G. L. Daikos4 and
24 h of incubation at 37 °C and the results compared with values                      G.L. Petrikkos1
obtained following the microdilution method. Phenotypes were                          1
                                                                                       Laikon Hospital, University of Athens, Athens, Greece, 2Instituto
compared according to published CLSI breakpoints.                                     de Salud Carlos III, Madrid, Spain, 3Gennimatas General Hospital,
Results: Regarding amphotericin B no discrepant results were found                    Athens, Greece, 4University of Athens, Athens, Greece
for echinocandins, one discrepant result for caspofungin and four for
anidulafungin were found. Concerning azoles, a larger number of
discrepant results were found: for fluconazole in 19 cases (47.5%), for                Objectives: Fungi of the mucorales order (zygomycetes), previously
voriconazole in 15 cases (37.5%) and for posaconazole in 12 cases                     uncommon hyaline filamentous fungi as well as dematiaceous
(30%). The majority of the errors were found with C. albicans . Etest                 filamentous fungi are increasingly encountered as causing disease.
was able to detect all resistant phenotypes; most errors involved                     They are capable of causing a wide variety of infections, particularly
susceptible phenotypes that were reported as resistant.                               in immunocompromised hosts such as hematological patients and
Conclusion: Antifungal susceptibility testing with Etest directly                     stem-cell and solid-organ transplant recipients, and are difficult to
from blood culture is a quick and practical method to perform                         manage because of lack of specific therapeutic recommendations. All
susceptibility testing although it overestimates the resistance regarding             these emerging infections are associated with high morbidity and
azoles.                                                                               mortality, and with resistance to old antifungal agents. The aim of
Acknowledgments: S Costa de Oliveira and A P Silva are sup-                           this prospective study was the isolation of moulds causing these
ported by the grants SFRH/BD/27662/2006 and SFRH/BD/29540/                            infections, the identification of the isolates and the investigation of
2006, respectively, from Portuguese Science and Technology Founda-                    their in vitro susceptibility to Amphotericin B, Posaconazole and
tion (FCT).                                                                           Caspofungin.
                                                                                      Methods: During the period January 2005 to January 2009, 27
                                                                                      strains from equal number of patients with invasive infections were
                                                                                      isolated, including isolates from collaborating hospitals of the broader
P022                                                                                  Athens area. They were identified morphologically to genus and
In vitro susceptibilities of invasive Candida spp. isolated                           molecularly to species level. Some molecular results are pending. Of
from Austrian patients against echonocandins and the                                  the 27 isolates 20 (19 of the Rhizopus genus and 1 Mucor circinelloides)
commonly used azoles fluconazole and voriconazole                                      were tested for their sensitivity to antifungals. The MICs were determined
                                                                                      according to the methods proposed by the EUCAST with minor
B. Willinger, L. Sittenthaler, E. Steiner and A.M.H. Hirschl
                                                                                      modifications. Furthermore, antifungal combination testing was carried
Institute of Hygiene and Medical Microbiology, Vienna, Austria                        out by using the checkerboard broth microdilution method. Combina-
                                                                                      tions studied were: amphotericin B - posaconazole, amphotericin
Objective: The aim of the study was to determine the in vitro                         B - caspofungin and caspofungin - posaconazole. Results were inter-
susceptibilities of invasive Candida isolates collected since June 2008 by            preted by calculating the fractional inhibitory concentration indexes
20 different Austrian medical centres against commonly used azoles                    (FIC).
and echinocandins - caspofungin, anidulafungin and micafungin.                        Results: Of the 27 strains 10 were Rhizopus arrhizus, three Rhizo-
Methods: The clinical samples yielding the growth of Candida spp.                     pus microsporus, five Rhizopus spp., two Trichoderma spp., one Mucor
included blood cultures and other sterile specimens such as intravas-                 circinelloides, one Mucor spp., one Lichtheimia ramosa (former names
cular catheters, biopsies or aspirates, samples from the lower respira-               Absidia, Mycocladus), one Fusarium solani,one Fusarium spp, one
tory tract such as bronchoalveolar lavage (BAL), and swabs collected                  Paecilomyces lilacinus and one Bipolaris spp. Of the 20 isolates, 17
from infected wounds. Antifungal susceptibility was assessed using a                  were sensitive to Amphotericin B, with MICs ranging 0.25–1 lg ml-1,
broth microdilution method following the Clinical Laboratory Stan-                    median 0.5 lg ml-1. The three resistant were two of the genus
dards Institute M27-A2 guidelines.                                                    Rhizopus and one Mucor circinelloides. The MICs of posaconazole
Results: So far 365 isolates have been collected and tested. Of these                 ranged between 0.25–16 with a median value of 4 lg ml-1. Six out of
isolates, species distribution was 65% C. albicans, 16% C. glabrata, 7% C.            20 strains, all R. arrhizus had Posaconazole MICs lower or equal to
parapsilosis, 5.5% C. tropicalis, and 2.2% C. krusei. The remaining 4%                1 lg ml-1, indicative of susceptibility to this drug. All isolates tested
consisted of C. dubliniensis, C. lusitaniae, C. guilliermondii, C. kefyr, C. valida   were resistant to caspofungin (MIC range 32–64 lg ml-1). When
and C. pelliculosa. The MIC50 and MIC90 were 4 mg L-1 and 8 mg L-1 for                Amphotericin B and Posaconazole were combined, growth of 11 out of
fluconazole, 0.03 mg L-1 and 0.25 mg L-1 for voriconazole, 0.5 mg L-1                  20 strains was inhibited (FIC< 0.5, indicative of synergy). The
and 1.0 mg L-1 for caspofungin, 0.06 mg L-1 and 0.5 mg L-1 for                        combination amphotericin B - caspofungin resulted in growth
anidulafungin, 0.25 mg L-1 and 1 mg L-1 for micafungin, respectively.                 inhibition of nine strains and the combination caspofungin - posaco-
Thus, the agent with the best in vitro activities for the azoles was                  nazole inhibited the growth of 16 strains. Antagonism was in no case
voriconazole and for the echinocandins anidulafungin. Only a low                      observed.
incidence of resistance was evident. 2.7% of Candida isolates were resistent          Conclusions: Fungi causing rare infections are increasingly
to fluconazole, 1.9% to voriconazole, 1.4% to anidulafungin and 1.5% to                encountered in our area.Most of the strains tested were susceptible to
micafungin respectively. All strains were susceptible to caspofungin.                 Amphotericin B, the antifungal of choice for these infections, but
15.5% of C. glabrata strains were resistant to fluconazole, and 10.9% to               resistant to posaconazole or caspofungin. However, when these drugs




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                                37
Poster Presentations



were combined, synergy was observed. Clinical trials are needed to            the Candida species, the most prominent was C. albicans (65%) followed
confirm these encouraging in vitro results in the clinical practice.           by C. glabrata (15.3%) and C. parapsilosis (6.2%). Notably, the
Acknowledgements: This study was partially sponsored by the                   distribution of the more frequent candidemia strains over the period
‘Kapodistrias’Program of the National University of Athens.                   2006–2008 was: C. albicans 29.4%, C. glabrata 19.6% and C. parapsilosis
                                                                              33.3%, whereas the respective percentages in the previous years were
                                                                              63.2, 14.2 and 18.8. Of all yeasts tested, 87% were sensitive to
                                                                              fluconazole and 90% were sensitive to voriconazole. Of all strains
P024                                                                          resistant to fluconazole, 29.8% were sensitive to voriconazole. Of the
                                                                              Candida isolates, the most resistant were the C. krusei (80% and 30%
Survey of antifungal effects of Razak (humulus lupulus                        resistant to fluconazole and voriconazole respectively) but it represented
plant) on Fusarium sp.,penicillum sp. and Aspergillus sp.                     only 2.7% of all yeasts. Of the C. glabrata strains 16.5% were resistant to
using of in vitro method                                                      both antifungals. Isolates from skin/soft tissue and biliary tract gave the
N. Nasrollahi Omran1, B. Babakhani2, S. Mohammadi Nakhjiri1 and               highest sensitivity to both antifungals (100% of strains) whereas isolates
J. Hashemi3                                                                   from miscellaneous fluids, upper respiratory, lower gastrointestinal
1
 Islamic Azad University of Tonekabon branch, Tonekabon, Iran,                tract and blood gave the lowest (78.6%, 82.9%, 84.6%, 80.6% and
2
 Sciences of plant physilogy, Tonekabon, Jamaica, 3School of                  78.6%, 82.9%, 84.6%, 88.7% for fluconazole and voriconazole
Public Health Insite of Research, Tehran, Iran                                respectively). More resistant strains derived from the Internal Medicine
                                                                              Ward and the ICU, followed by the surgical department.
For this purpose,the hydroalcohlic extract of Razak were prepared by          Conclusions: Only a small proportion of yeasts isolated in our
use of microdulation method in propyleneglical as solvent. Then               hospital were resistant to fluconazole and even less were resistant to
sabauroud media (s) containg 1 mg ml, 2 mg ml, 3 mg ml, 4 mg ml,              voriconazole. A shift towards non-albicans and more resistant strains
5 mg ml, 6 mg ml, 7 mg ml, 10 mg ml of Razak extract were prepared.           were noted during the last 3 years compared to previous years when
The fungal were grown on at 25 c for 3 and 7 days in sabouraud agar           candidemia strains were analysed. These organisms could probably be
media. Six millimeter pluqs were cutout from fresly grown colonies by         a future threat to optimal antifungal therapy and this is why ongoing
use of puncher, and then placed on the above mentiond media at sterile        monitoring of the local epidemiology and susceptibility testing when
condition .Replicate culture were setup for each fungus.The mean              appropriate is so important.
colony diameters of each fungus was measures 3 and 7 days of
incubation at 25 c and percentage of growth reduction was calculated.
Discks contacting different concentration of Razak extract were placed
on the surface of agar the mean diameter of the Zone of inhibition
around each disck was measured after 3 and 7 days of incubation at            P026
25 c. The results showed that the growth of Fusarium solani, Fusarium         Susceptible patterns of Candida species isolates from a
oxysporum,penicillum marneffei was complet inhibited by 7 mg ml of            Portuguese oncology population - changing strategies?
Razak extract.While the total growth inhibition of Aspergillus spp(fumi-                                                      ˜
                                                                              C. Lameiras, F. Faria, P. Silva and M. A. Guimaraes
gates,flavus and niger) was observsed with 10 mg ml. Our findings               Portuguese Oncology Institute, Porto, Portugal
illustrate how membrane-active compounds can be effective fungicidals
and may pave the way to developing membrane-selective agents.
                                                                              Introduction: The emergence of non-Candida species infections with
                                                                              reduced susceptibilities to the fluconazol have emphasized the need for
                                                                              investigate laboratory data to guide clinicians in selecting appropriate
                                                                              antifungal therapy, particularly in patients with prior azoles exposure.
P025                                                                          Objectives: The aim of the present study was to determine the
Results from the ARTEMIS antifungal surveillance study in                     antifungal susceptibility of Candida spp. isolates from immunocompro-
Greece, 2001 to 2008: analysis of Yeast Species distribution                  mised and immunosuppressed cancer patients to new antifungal azoles
and susceptibilities.                                                         (Voriconazol and Posaconazol) and echinocandin agents (Anidulafun-
A. Skiada1, I. Anyfantis1, M. Drogari-Apiranthitou1,                          gin), in order to establish the best strategies for optimal management of
L. Hadjihannas1, L. Kanioura1, I. Stefanou2, A. Avlami2,                      patients with invasive candidiasis or Candida colonization within the
A. Mitroussia-Ziouva3 and G. L. Petrikkos1                                    critical setting.
1
 Laikon Hospital, University of Athens, Athens, Greece, 2Laikon               Methods: CLSI/NCCLS MICs of antifungal agents were determined
                                                                              for 94 Candida spp. isolates by the Etest using standard RPMI-1640. Six
Hospital, Athens, Greece, 3University of Athens, Athens, Greece
                                                                              Candida spp ATCC were used. Candida spp. clinical isolates were
                                                                              recovered from various sites of infection (blood cultures, deep or
Objectives: The objectives of the study were to monitor the                   superficial sites) from patient in intensive care unit, hematology
epidemiology and sensitivity of yeast isolates in our hospital using a        department, bone marrow transplant department and surgical depart-
low cost, reproducible and accurate standard susceptibility in vitro test.    ment during 2008.
Methods: The ARTEMIS Global Antifungal Susceptibility Program                 Results: In the sample studied, C. albicans was the most commonly
provides the collection of epidemiological data and the results of the        isolated species, accounting for 50% (47/94) of the isolates followed by
fluconazole and voriconazole susceptibility testing of yeast isolates          C. krusei (14.9%; 14/94), C. glabrata (13.8%; 13/94), C. parapsilosis
worldwide. Our laboratory, as part of this program, tested the in vitro       (11.7%; 11/94), C. tropicalis (7.4%; 7/94), C. lusitanea (1.1%; 1/94)
susceptibility of yeasts to these two antifungals using the CLSI disk         and C. guillermondi (1.1%; 1/94). All C. albicans isolates were sensitive
diffusion methodology. The BIOMIC System was used to electronically           to fluconazole, voriconazole, posaconazole and anidulafungin. Resis-
read the test plates and to collect well controlled quantitative data.        tance to fluconazole was detected in 53.8% of C. glabrata and in all C.
From January 2001 through December 2006, specimens of all types               krusei isolates. In 3.2% of C. glabrata cases voriconazole was detected
(blood, lower respiratory tract, skin/soft tissue, genital, urinary tract,    with a MICs of ‡ 4 lg ml-1 (n = 3) with the MIC50/90 of 0.25/25.6
miscellaneous fluids etc.) were collected and analysed. To examine             (range 0.008–32 lg ml-1). In seven cases of isolates (7.4%), posaco-
shifts in the strain distribution from cases with candidemia, 51              nazole (POS) was found with a higher MIC. In five C. glabrata isolates,
additional Candida strains isolated from blood cultures from January          POS MIC50/90 was of 1/32 (range 0.008–32), in one C. tropicalis POS
2006 to December 2008 were analysed and compared to previous                  MIC50/90 0,047/12(range 0.016–12) and in one C. guillermondi POS
years.                                                                        MIC = 1.5. C. parapsilosis was in 63,6% of the cases detected with a
Results: A total of 733 different species/organism groups were                MIC ‡ 2 for anidulafungin (MIC50/90 of 8/32; range 0.38–32).
isolated, of which 712 were Candida spp, (97.1%). The non-Candida             Anidulafungin was also observed with a MIC ‡ 2 in the only case of
yeasts were Saccharomyces cerevisiae (15 strains), three Rhodotorula spp.     C. guillermondi isolated (MIC = 32).
one Cryptococcus albidus, one Pichia spp. and one unidentified yeast. Of




                                                                                                                                Ó 2009 The Authors
38                                                                 Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



Conclusion: In our study, Etest method showed to be rapid and easy        (HAEPAL) on 11 fungal strains (Candida albicans ATCC64548, C. krusei
to perform and that can be used in our routine laboratory. Our results    ATCC6258, C. glabrata ATCC90030, C. lusitaniae ATCC200951,
demonstrated that fluconazole remains active against Candida albicans      C. parapsilosis ATCC22019, Saccharomyces cerevisiae ATCC9763, Rho-
and some C. glabrata showed to be less susceptible to Posaconazol.        dotorula mucilaginosa LMIPK0282, Trichosporom asahii LMIPK0293,
Anidulafungin show to be a good choice for treatment of invasive          Cryptococcus grubii LMIPK0291 and LMIPK0292). The antifungal
candidiasis in cases of C. glabrata and C. krusei infections.             effect against these species has not been reported before.
                                                                          Method: The in vitro antifungal activity of HAEPAL was evaluated
                                                                          by a dilution procedures. Final concentration of the strains in the
                                                                          medium (Sabouraud-dextrose broth plus HAEPAL at 0%, 0.5%, 2.5%,
P027                                                                      5%, 7.5% and 10%) was 0.5 · 103 cells ml-1. After 72 h of incubation
In vitro dynamic model for studying the effect of delay                   at 30 °C, dilutions (1/10, 1/100 and 1/1000) in distilled water were
exposure of antifungal drugs to Aspergillus flavus conidia                 made and 10 ll of each dilution per strain per HAEPAL concentration
and hyphae using growth curves analysis                                   were inoculated on Sabouraud-dextrose agar and incubated 24 h at
J. Meletiadis, K. Krompa, L. Zerva                                        30 °C and the number of colonies per milliliter was determined. The
Attikon University General Hospital, Athens, Greece                       minimal inhibitory concentration was defined as the lowest concen-
                                                                          tration of the extract that inhibited growth at least 50% compared with
                                                                          the growth control for each strain.
Background: Aspergillus flavus infections are the second most com-         Results: HAEPAL 10% completely inhibited all the studied strains
mon Aspergillus infections and they are associated with significant        except C. glabrata which was inhibited by 50%. Total inhibition in
morbidity and mortality in immunocompromised patients. Delay admin-       presence of the extract at 7.5% was achieved for C. lusitaniae, C.
istration and suboptimal exposure of antifungal drugs may be detrimen-    parapsilosis, S. cerevisiae, R. mucilaginosa and C. grubii. MIC50 for the
tal for infections caused by A. flavus. Therefore, we study the pharma-    last four species was reached with HAEPAL 5%. Inhibition activity of
codynamic characteristics of supra and sub MIC (minimal inhibitory        lower concentrations of the extract was very weak.
concentrations) concentrations of amphotericin B, voriconazole and        Conclusions: A significant inhibitory effect of P. alliacea extract on
caspofungin exposed to A. flavus conidia and hyphae of different growth    the studied yeasts was observed. These results suggest a potential use of
stages with and without delay using growth curves analysis.               the evaluated extract as antimycotic treatment.
Methods: Inocula of 104 CFU ml-1 from three clinical isolates of A.
flavus were prepared in 200 ll RPMI1640+MOPS and incubated inside
the wells of a 96-well flatbottom microplate at 37 °C for 96 h. The MIC
(complete visual growth inhibition) of amphotericin B and voriconazole    P029
was 1 and 0.25–1 mg L-1 for all three isolates, respectively. The         In vitro activities of eight antifungal drugs against 18
minimal effective concentrations (MEC) of caspofungin were 0.5–
                                                                          Apophysomyces elegans isolates
1 mg L-1 for all isolates. Drugs were added into corresponding wells at
                                                                          A. Chakrabarti1, M. R. Shivaprakash1, H. Badali2, I. Curfs-Breuker3,
final concentrations of 0.25 ·, 1 ·, and 4 · MIC (or MEC for
caspofungin) after 0 h, 24 h, 48 h and 72 h of incubation. The            C. H. Klaassen3 and J. F. Meis3
                                                                          1
turbidity of each well was monitored continuously by measuring the         Mycological Reference Centre, Chandigarh, India, 2CBS Fungal
optical density at 630 nm every 15 min. Growth curves were                Biodiversity Centre, Utrecht, The Netherlands, 3Canisius
constructed and fungal growth before and after addition of the drugs      Wilhelmina Hospital, Nijmegen, The Netherlands
was compared at each time point and for each concentration.
Results: Amphotericin B completely inhibited fungal growth at 4 ·         Objective: Invasive mould infections caused by zygomycetes are
and 1 · MIC but not at 0,25 · MIC when added at 0 h, as expected.         increasingly recognized. Most infections are opportunistic in patients
When 0.25 ·MIC of amphotericin B was added at any time point, there       with underlying disease, but the species Apophysomyces elegans is
was no significant change in fungal growth curves compared to that of      commonly isolated from immunocompetent patients. Though A.
drug-free control. At 1 ·and 4 ·MIC of AMB, fungal growth was             elegans was earlier believed to cause only cutaneous and subcutaneous
reduced by 7% (0%–16%) and 10% (4%–18%), respectively at any              infections, it has more recently frequently isolated from deep-seated
time-point. Notably, when amphotericin B was added after 24 h of          infections. Despite major surgical and antifungal therapy this infection
incubation, regrowth was observed 34 h and 13 h after addition of         is life-threatening for many patients. Antifungal therapy is based on
4 ·MIC and 1 · MIC of amphotericin B, respectively. When ampho-           the experience of isolated case reports of A. elegans infection mostly
tericin B was added at 48 h or 72 h, regrowth was observed < 5 h          involving amphotericin B (AmB). We aimed to test a selection of
after drug addition. Regrowth rates were 50% higher than growth           existing and new antifungal drugs against a collection of isolates of this
rates of drug-free control. Voriconazole completely inhibited fungal      rare primary pathogenic fungus.
growth at 4 · and 1 · MIC but not at 0.25 · MIC when added at 0 h,        Purpose: To determine the in vitro activity of eight existing and new
as expected. No significant change was observed when added at later        antifungal drugs against A. elegans.
time points. Caspofungin did not have any effect in A. flavus growth       Methods: A collection of 15 clinical isolates of A. elegans were
curves at any time-point and concentration except a slight reduction of   obtained from the Mycological reference Centre in Chandigarh, India
growth rates when 4 · MEC was added at 0 h.                               and three isolates (two environmental) from the Fungal Biodiversity
Conclusion: Growth curves analysis revealed important pharmaco-           Centre, Utrecht, The Netherlands. Identification of all isolates was
dynamic characteristics of amphotericin B, voriconazole and caspofun-     performed by ITS1,four sequencing. MICs were determined for AmB,
gin against A. flavus hyphae. Delay exposure of amphotericin B resulted    fluconazole (FLU), ITC, voriconazole (VOR), posaconazole (POS),
in regrowth at 1 · MIC and 4 · MIC of amphotericin B. Voriconazole        isavuconazole (ISA) or MECs for caspofungin (CAS) and anidulafungin
and caspofungin had a minimal effect against A. flavus hyphae.             (ANI). Microdilution testing was done in accordance with CLSI M38-
                                                                          A2 guidelines. Quality control was ensured by including Paecilomyces
                                                                          variotii (ATCC 22319) and Candida krusei (ATCC 6258).
P028                                                                      Results: A. elegans (n = 18) gave MIC ranges and MIC50 and MIC90
Evaluation of the antimycotic effect of Petiveria alliacea L              values (mg L-1) as shown in table.
M.T. Illnait-Zaragozı1, J. Illnait-Ferrer2 and A. Blanco Garcıa2
                    ´                                        ´
1
 Instituto Pedro Kouri, Havana, Cuba, 2National Center of Scientific
Research, Havana, Cuba                                                              AmB   FLU   ITC     VOR      POS      ISA         CAS   ANI

                                                                          Range 0.25–4 8–>64 0.25–2 0.5–>16 0.125–1 0.125–>2 2–>16 0.016–>8
Objective: Petiveria alliacea’s antibacterial and anthelmintic effect     MIC50 2      > 64  1      > 16    0.5     2        > 16  >8
has been reported by different authors. The aim of this work was to       MIC90 4      > 64  2      > 16    1       >2       > 16  >8
study the antifungal effect of a hydroalcoholic extract of this plant




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                 39
Poster Presentations



Conclusions: POS was the most active drug against these A.                     demonstrated potential in vitro activity, These drugs might be useful
elegans isolates followed by ITC and ISA. The new azole ISA had a              for treating a range of severe fungal infections particularly CNS
four-fold lower MIC compared to VOR whereas the echinocandins                  infections, either alone or as part of a combination therapy regimen.
had no activity. AmB exhibited relatively high MICs against                    However their clinical effectiveness in the treatment of cerebral
Apophysomyces.                                                                 infection remains to be determined.


P030                                                                           P031
Use of AFLP analysis for identification of 29 neurotrophic                      Microdilution in vitro susceptibility of agents of
Cladophialophora isolates with in vitro activities of eight                    chromoblastomycosis, Fonsecaea pedrosoi and Fonsecaea
antifungal drugs                                                               monophora, for eight antifungal agents
H. Badali1,2, G. S. de Hoog1, I. Curfs-Breuker3, C. H. Klaassen3 and           H. Badali1,2,3, M. J. Najafzadeh1,2, G. S. De Hoog1,2,
J. F. Meis3                                                                    I. Curfs-Breuker4 and J. F. Meis4
1                                                                              1
 CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands,                  CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands,
2                                                                              2
 School of Medicine, Mazandaran University of Medical Sciences,                  Insitute of Biodiversity and Ecosystem Dynamics, University of
Sari, India, 3Canisius Wilhelmina Hospital, Nijmegen, The                      Amsterdam, Amsterdam, The Netherlands, 3School of Medicine,
Netherlands                                                                    Mazandaran University of Medical Sciences, Sari, Iran, 4Canisius
                                                                               Wilhelmina Hospital, Nijmegen, The Netherlands
Objective: Invasive mould infections caused by dematiaceous fungi
are rare but increasingly recognized in human disease. The majority of         Objective: Chromoblastomycosis is a chronic, progressive disease of
cerebral infections are associated with Cladophialophora bantiana, which       cutaneous and subcutaneous tissues characterized by nodular and
are, despite surgical and antifungal therapy, still life-threatening           verrucous lesions. Proven causative agents include Cladophialophora
conditions. Cladophialophoraspecies show differences in levels of resis-       carrionii, Phialophora verrucosa, Rhinocladiella aquaspersa, Fonsecaea
tance to antimycotic agents and mortality. Therefore, it is important to       pedrosoi and F. monophora. The latter two fungi are the most common
be able to correctly identify the causative organism to the species level.     agents of chromoblastomycosis in patients residing in a humid climate.
Amplified fragment length polymorphism (AFLP) analysis as an                    As yet, limited standard therapy for chromoblastomycosis is available
identification method for medically important C. bantiana was investi-          and relapses are often observed. The aim of the present study was to
gated. Antifungal therapy is based on the experience of isolated case          test the in vitro activity of eight conventional and new generations of
reports which mostly involved amphotericin B (AmB), itraconazole (ITC)         antifungal agents against F. pedrosoi and F. monophora.
and 5-flucytosine.Therefore we have tested a total of eight new and             Methods: The collection has been obtained from the CBS-KNAW
established antifungal drugs against 29 clinical isolates of this rare         Fungal Biodiversity Centre, Utrecht, The Netherlands and consisted of
neurotropic fungus.                                                            the following isolates: 21 strains of F. pedrosoi and 28 isolates of F.
Methods: A collection of 24 clinical isolates of C. bantiana and five           monophora. MICs were determined for amphotericin B (AmB), fluco-
clinical strains of other neurotropic Cladophialophora spp. were obtained      nazole (FLU), itraconazole (ITC), voriconazole (VOR), posaconazole
from the CBS-KNAW Fungal Biodiversity Centre in Utrecht, The                   (POS), isavuconazole (ISA), caspofungin (CAS) and anidulafungin
Netherlands. MICs were determined for AmB, fluconazole (FLU), ITC,              (ANI). Susceptibility testing was done in accordance with CLSI M38-
voriconazole (VOR), posaconazole (POS), isavuconazole (ISA) or MECs            A2 guidelines adjusted spectrophotometrically at a 530 nm wave-
for caspofungin (CAS) and anidulafungin (ANI). Microdilution testing           length to optical densities that ranged from (68–71 T%) in RPMI 1640
was done in accordance with CLSI M38-A2 guidelines. Inoculum was               MOPS broth with L-glutamine without bicarbonate. Plates were
adjusted spectrophotometrically (530 nm) to optical densities that             incubated at 35 °C for 72 h. The MIC was determined visually as the
ranged from 0.17–0.15 in RPMI 1640 MOPS broth with L-glutamine                 lowest                 concentration               of             drug
without bicarbonate. Plates were incubated at 35 °C for 72 h. The MIC          (mg L-1) either showing absence of growth or ‡ 50% reduction of
was determined visually as the lowest concentration of drug showing            growth (only for fluconazole) compared with that of the growth
absence of growth or for fluconazole ‡ 50% reduction of growth                  control. For the echinocandins the MEC was microscopically deter-
compared with that of the growth control. For the echinocandins the            mined as the lowest concentration of drug that leads to the growth of
MEC was microscopically determined as the lowest concentration of              small, rounded, compact hyphal forms as compared with the long,
drug that leads to the growth of small, rounded, compact hyphal forms          unbranched hyphal clusters that were seen in the growth control (drug
as compared with the long, unbranched hyphal clusters that were seen           free). Quality control was performed by including Paecilomyces variotii
in the growth control (drug free). Drug and fungus free controls were          (ATCC 22319), Candida parapsilosis (ATCC 22019), and Candida krusei
included. Quality control was ensured by including Paecilomyces variotii       ATCC 6258.
(ATCC 22319) and Candida krusei (ATCC 6258).                                   Results: The most active drugs against were ITC, VOR, POS and ISA.
Results: AFLP patterns exhibited very clear differences between C.             Echinocandins exhibited high MIC’s against both F. pedrosoi and F.
bantiana and other neurotropic strains. C. bantiana (n = 24) gave the          monophora. No significant difference between the antifungal suscepti-
following MIC ranges, MIC50 and MIC90 values (mg L-1).                         bility of the two fungal species was recorded.

                                                                               F. pedrosoi AmB   FLU    ITC     VOR      POS         ISA       CAS ANI
      AmB     FLU   ITC          VOR     POS           ISA     CAS ANI
                                                                               Range     0.5–2 16–32 0.031–0.25 0.125–0.5 0.031–0.063 0.063–0.5 2–4 1–8
Range 0.125–2 16–64 < 0.016–0.125 0.125–2 < 0.016–0.125 0.008–1 1–8 0.016–4    MIC50     1     16    0.063      0.5       0.063       0.25      2   4
MIC50 1       32    0.063         1       0.063         0.25    2   0.063      MIC90     1     32    0.125      0.5       0.063       0.25      4   8
MIC90 1       64    0.125         4       0.125         0.5     8   2



   C. modesta (n = 1), C. devriesii (n = 3) and C. arxii (n = 1) gave
similar MIC’s compared with C. bantiana.                                       F. pedrosoi AmB    FLU   ITC      VOR     POS          ISA     CAS ANI
Conclusions: AFLP proved to be a reliable method for the identifi-
cation of C. bantiana against other neurotropic strains. Posaconazole,         Range      0.5–2 8–32 0.031–0.25 0.125–1 0.016–0.063 0.063–1 1–4    1–8
itraconazole and isavuconazole were the most active drugs with high in         MIC50      1     16   0.063      0.25    0.031       0.25    2      4
vitro activity against neurotropic C. bantiana with MIC90s of                  MIC90      2     32   0.125      0.5     0.063       0.25    2      8
£ 0.5 mg L-1. From the echinocandins tested anidulafungin also




                                                                                                                                 Ó 2009 The Authors
40                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                               Poster Presentations



Discussion: ITC, VOR, POS and ISA are in vitro the most active              Methods: Candidastrains were collected from patients entered into
drugs against Fonsecaea spp. Although we did not investigate the            clinical trials, including patients with invasive infections. All strains
relation between MIC and clinical response to treatment these new           were sent to a reference lab and stored at -70 °C. For susceptibility
triazoles seem to be promising agents for the treatment of chromo-          testing, strains were revived and re-identified using molecular tech-
blastomycosis.                                                              niques, including AFLP and ITS where appropriate. Microdilution
                                                                            testing of micafungin was performed following both the EUCAST
                                                                            method (EDef 7.1) and the CLSI M-27A method. The E-test was
                                                                            performed following instructions of the manufacturer and read after
                                                                            24 h and 48 h. To compare methods, MIC values for each strain were
P032                                                                        transformed by taking the two log and substracted. This then yields the
Susceptibility of micafungin in Candida strains isolated from               difference in two log dilution steps. The mean and standard deviation of
                                                                            differences were calculated both overall and by species to determine
patients with invasive Candida infections by EUCAST
                                                                            systematic differences between results as opposed to random differ-
methodology                                                                 ences.
J.W. Mouton, E. Geertsen, I. Curfs-Breuker, C. H. Claassen and              Results: In total, 349 strains were compared with each other, 100
J. F. Meis                                                                  C. albicans (CA), 36 C. glabrata (CG), 86 C. tropicalis (CT), 70 C.
Canisius Wilhelmina Hospital, Nijmegen, The Netherlands                     parapsilosis (CP) 11 C. krusei (CK) and 46 strains of various species
                                                                            (CV). In general, except for CT, the MICs obtained by the EUCAST
Objective: Micafungin is a new echinocandin recently approved in            method were one dilution higher than those obtained by CLSI method,
Europe. During various clinical trials, all Candidastrains were collected   0.9, 1.1, 2.2, 1.2, 1.3 and 0.8 twofold dilutions for CA, CG, CT, CP, CK
for identification and susceptibility testing. The EUCAST antifungal         and CV respectively. The E-test MICs were half a dilution higher than
susceptibility testing (AST) was recently finalized (EDef 7.1).We here       the EUCAST method (0.5 for 24 h and 0.7 for 48 h reading) for CA,
describe the MIC distributions of micafungin and caspofungin of these       but 1.5 and 1 dilution lower for all other species, indicating significant
clinical strains by species using EUCAST AST.                               differences between E-test readings and the EUCAST method by species.
Methods: Candidastrains were collected from patients entered into           Comparing the CLSI method with the E-test method, differences were
clinical trials, including patients with invasive infections. All strains   observed as well: for CA 1.4 and 1.6 dilution, while there were hardly
were sent to a reference lab and stored at -70 °C. For susceptibility       differences for all other species except CT, 1.0 and 1.3 dilution, for the
testing, strains were revived and reidentified using molecular tech-         24 and 48 h readings, respectively.
niques, including AFLP and ITS where appropriate. Microdilution             Conclusions: In contrast to azoles, there is a difference of approx-
testing was performed following the EUCAST method (EDef 7.1) for            imately one dilutionstep between MICs as obtained with the EUCAST
micafungin, caspofungin and amphotericin B. Drugs were obtained             method compared to the CLSI method. The E-test shows systematic
from the manufacturers.                                                     discrepancies with both methods and is species dependent. This
Results: 569 C. albicans (CA), 81 C. glabrata (CG), 28 C. krusei (CK),      warrants further investigation.
113 C. parapsilosis (CP) and 175 C. tropicalis (CT) strains were
identified. The MIC50 and MIC90 (mg L-1) for micafungin were
<0.008 and 0.16 (CA), 0.016 and 0.016 (CG), 0.125 and 25
(0.25??)_(CK), 1 and 2 (CP), 0.031 and 0.063 (CT) respectively. For         P034
caspofungin these were 0.5 and 0.5, 0.5 and 0.5, 1 and 1, 1 and 2, 0.5      Impact of correct identification on wild type distribution
and 1, respectively. The data suggest micafungin ECoff (voluit?)values      ranges of Candida spp
of 0.031 (CA), 0.031 (CG), 0.25 (CK), 2 (CP) and 0.125 (CT) mg L-1 to
                                                                            J.W. Mouton, I. Curfs-Breuker, E. Geertsen, C. H. Claassen and
delineate wildtype distributions.
                                                                            J. F. Meis
Conclusions: The activity of micafungin against clinical Candida
                                                                            Canisius Wilhelmina Hospital, Nijmegen, The Netherlands
strains was excellent, with the exception of C. parapsilosis, as has been
reported for all echinocandins. The MIC distributions obtained help to
define the wild type MIC distribution for micafungin and caspofungin         Objective: Micafungin is a new echinocandin recently approved in
and add in defining the ECoffs by EUCAST methodology from this large         Europe. During various clinical trials, all Candida strains were collected
collection for various species of Candida.                                  centrally for identification and susceptibility testing. Identification was
                                                                            originally performed using routine phenotypical techniques. However,
                                                                            MIC ranges for caspofungin and micafungin were relatively wide for
                                                                            some species. We hypothesized that, because routine phenotypic
P033                                                                        identification is not very reliable for some species, genotypic identifi-
                                                                            cation would better describe the Wild Type (WT) population.
Comparison of four different methods to determine MICs of
                                                                            Methods: Candida strains were collected from patients included into
micafungin of Candida strains isolated from patients with                   clinical trials, including patients with invasive infections. All strains
invasive infections                                                         were sent to a reference laboratory and stored at -70 °C. Identification
J.W. Mouton, I. Curfs-Breuker, E. Geertsen, C. H. Claassen and              was originally performed using phenotypic methods. For susceptibility
J. F. Meis                                                                  testing, strains were revived and re-identified using molecular tech-
Canisius Wilhelmina Hospital, Nijmegen, The Netherlands                     niques, including AFLP and ITS where appropriate. Microdilution
                                                                            testing of micafungin, caspofungin, posaconazole and amphotericin B
Objective: Micafungin is a new echinocandin recently approved in            was performed following by both the EUCAST method (EDef 7.1) and
Europe. During various clinical trials, all isolated Candida strains were   the CLSI M-27A method. The MIC ranges were determined by species
collected centrally for identification and susceptibility testing. For       as identified using either phenotypical or genotypical methods.
routine testing, the E-test is used by many laboratories. However,          Results: The original dataset consisted of 590 C. albicans (CA), 85 C.
there are little comparative data showing the validation of the E-test      glabrata (CG), 181 C. tropicalis (CT), 136 C. parapsilosis(CP) and 31 C.
against the CLSI method. In addition, the EUCAST recently published         krusei (CK) strains as determined by phenotypic methods. The ranges
the definitive version of the EUCAST method (EDef 7.1). We therefore         (mg L-1) for micafungin as determined by the EUCAST methods were
compared the results of E-test with both the CLSI method as well as         0.008–0.063 (CA), < 0.008–0.031 (CG), 0.016–1 (CT), 0.016–4 (CP)
the EUCAST method for micafungin. In particular, we were interested         and < 0.008–0.25 (CK), corresponding to three, two, five, eight and five
whether differences - if present - were species dependent. In addition,     twofold dilutions, respectively. After re-identification using genotypic
differences between EUCAST and CLSI methodology would impact the            methods, twofold dilution ranges were reduced to three (CT), three (CK)
selection of breakpoints.                                                   and two (CP). For caspofungin, similar results were obtained and effects




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  41
Poster Presentations



were also observed for posaconazole. For CA and CG ranges did not                  P042
change. Similar results were obtained with the CLSI method.                        Prospective utility of (1–3)-B-D-Glucan (BG), galactomannan
Conclusions: When determining WT ranges and Epidemiological                        (GM) and anti-Candida albicans germ tube antibodies
Cut-off values, it is essential to identify Candida spp. to the species level as   (CAGT) for the diagnosis of invasive fungal disease (IFD) in
this has a major impact hereon. For species other than C. albicans and C.          haemato-oncology adult patients
glabrata, this study showed that genotypic identification rather than               A. Alhambra1, M. S. Cuetara2, J. M. Moreno1, A. Del Palcio
                                                                                                            ´
phenotypic identification described the ranges more accurately. In
                                                                                   Perez-Medel1, I. Moragues3, J. Ponton3 and A. Del Palacio1
                                                                                                                       ´
routine practice one should be aware that unexpected MICs, even                    1
relatively mild deviations, may be due to a wrong identification rather
                                                                                    Hospital Universitario Doce de Octubre, MADRID, Spain, 2Hospital
than concluding the presence of a resistance mechanism.                            Universitario Severo Ochoa, LEGANES, Spain, 3Universidad del Pais
                                                                                   Vasco, BILBAO, Spain


P041                                                                               Objectives: BG (polysaccharide of the cell wall of all fungi), GM (cell
                                                                                   wall component of Aspergillus) and CAGT (antibodies against antigens
Prospective pilot study of Pneumocystis Jiroveci Pneumonia                         expressed by Candida albicans germ tube surface, non-C. albicans species
(PJP) with (1–3) b-D-Glucan (BG) Assay (FungitellÒ) among                          have cross reactivity) are non-invasive diagnostics tools that may help
patients with and without HIV infection with a confirmed                            to establish the diagnosis of IFD. Conventional diagnostic methods are
diagnosis of PJP                                                                   insensitive. The results of these biomarkers should be interpreted in the
M.S. Cuetara1, J. Llenas2, A. Alhambra2, F. Chaves2, I. Moragues3,
         ´                                                                         context of the presence of risk factors, signs, symptoms and radiologic
J. Ponton3 and A. Del Palacio2
       ´                                                                           imaging. The aims of this prospective study is to define the diagnositic
1
 Hospital Universitario Severo Ochoa, Leganes, Spain, 2Hospital                    efficiency [sensitivity (S), specificity (SP) and negative and positive
Universitario 12 de Octubre, Madrid, Spain, 3Universidad del Pais                  predictive values (PPV, NPV)] of the three biomarkers and the
Vasco, Bilbao, Spain                                                               relationship of IFD (proven/probable) with a risk stratification scheme
                                                                                   in adult haemato-oncology patients.
Objectives: To report the results of serum BG testing assay among                  Methods: Patients were prospectively stratified as proposed by
patients with and without HIV infection with a confirmed diagnosis of               PrenticeHG (Br J Haematol 2000; 110:273) as high, intermediate
PJP at our institutions. The diagnostic potential of BG test for the               (high and low) and low risk of developing IFD. IFD was defined
diagnosis of PJP was explored, including serial BG monitoring during               as proven and probable according to the guidelines of De Pauw B
the treatment course.                                                              (Clin Infect Dis 2008; 46:18). Bi-weekly BG (Fungitell Ò cutoff
                                                                                   ‡ 120pg ml-1), GM (PlateliaÒ Aspergillus cutoff ‡ 0.500) and CAGT
Methods: Patients with pneumonia and known risk of Pneumocystis
                                                                                   (C. albicans IFA IgGÒ, cutoff ‡ 1/160) were determined in serum.
jiroveci (PJ) (HIV patients with £ 200 CD4/mm3 or either patients at
risk with non PJ prophylaxis) and confirmed positive microscopy of                  Results: 93 patients (173 episodes) received cytotoxic chemotherapy
respiratory samples and/or a positive real-time PCR for PJ were index              and some of them stem cell transplantation. The S, SP, PPV and NPV
cases. Control cases were HIV patients with £ 200 CD4/mm3 and                      for BG (all IFD), GM and CAGT were 58%, 83%, 50%, 87% and 92%,
pneumonia due to different etiologies.                                             94%, 73%, 98% and 57%, 93%, 44%, 96% respectively. Table 1 shows
                                                                                   the relationship of IFD and risk.
Results: Eighteen patients were included in the study: 11 with PJP
(index cases) and seven control group patients. The index cases were:              Conclusions: For the diagnosis of IC, BG has a S, SP, PPV and NPV
eight patients with (i) new diagnosis of HIV infection, (ii) or non                of 77%, 86%, 39% and 97% respectively, with higher sensitivity when
compliant with antiretroviral therapy and PJP prophylaxis and three                compared with CAGT, sharing both high specificity and high negative
non HIV patients: one renal transplant patient, one with advanced                  predictive values. The diagnostic efficiency of GM and BG for the
follicular lymphoma and another patient with 81 CD4, diabetes and                  diagnosis of IA was 85% and 73% respectively. For the diagnosis of IA
renal function impairment. All 11 patients with PJP had baseline BG                BG has a S, SP, PPV and NPV of 57%, 84%, 42% and 91% respectively,
positive serum testing (‡ 80 pg ml-1) with a median BG value greater               with a higher sensitivity and specificity of GM when compared with BG,
than 1198 pg ml-1 (range, 150–4409 pg ml-1). The seven control                     sharing both high negative predictive values. The incidence of IFD
patients had Mycobacterium tuberculosis (three patients), Streptococ-              correlated directly and significantly (C2 P = 0.0005) with risk strat-
cus pneumoniae (two patients), Aspergillus fumigatus invasive proven               ification group, with the highest proportion (20.8%) in the high-risk
pneumonia (one patient) and a patient with a comatose condition and                group and the percentage falling directly and significantly as the risk
bronchoaspirative pneumonia. Two patients in the control group had                 declined.
positive BG baseline serum levels (one with a S. pneumoniae positive
blood culture and another one with proven invasive A. fumigatus
pulmonary infection. The sensitivity, specificity and positive and
negative predictive values for BG were 100%, 71%, 85% and 100%,
respectively. Serial monitoring during the treatment course showed
declining levels of BG in patients with a favourable response and rising
levels in patients with treatment failure.
Conclusion: The diagnostic efficiency for BG in our population was
89%. BG assay in serum is a non invasive diagnostic marker useful as
an adjunct for the diagnosis of PJP with a 100% sensitivity and a 100%
negative predictive value in patients at risk for PJP and a valuable tool
for monitoring treatment course.
Acknowledgments: This investigation was supported by grants
                        ´n
Fondo de Investigacio Sanitaria, Instituto de Salud Carlos III,
Proyecto Investigacion PI 070134 (to MSC), PI 070107 (to A d P)
and PI 070376 (to JP), grant IT-26407 of Departamento de Educacio     ´n,          Acknowledgments: This investigation was supported by grants
                             ´n
Universidades e Investigacio del Gobierno Vasco (to JP) and Saiotek                                      ´n
                                                                                   Fondo de Investigacio Sanitaria, Instituto de Salud Carlos III,
from Departamento de Industria, Comercio y Turismo del Gobierno                    Proyecto Investigacion PI 070134 (to MSC), PI 070107 (to A d P)
Vasco (to JP) and an Educational grant from Pfizer (to A d P) and                                                                                    ´
                                                                                   and PI 070376 (to JP), grant IT-26407 of Departamento de Educacion,
         ´                  ´n ´
Fundacion MM Investigacio Medica (to A d P).                                                                   ´
                                                                                   Universidades e Investigacion del Gobierno Vasco (to JP) and Saiotek
                                                                                   from Departamento de Industria, Comercio y Turismo del Gobierno
                                                                                   Vasco (to JP) and an Educational grant from Pfizer (to A d P) and
                                                                                           ´n                 ´    ´
                                                                                   Fundacio MM Investigacion Medica (to A d P).




                                                                                                                                     Ó 2009 The Authors
42                                                                      Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                  Poster Presentations



P043                                                                           Methods: During a period of thirteen months blood samples taken
False positivity of 1,3-beta-D-Glucan in patients with gram                    from patients were cultured simultaneously in Bactec mycosis and
negative bacilli bacteraemia: presentation of two cases from                   Bact/ALERT systems. The two systems were compared for culture
a tertiary care hospital                                                       positivity and time to detection (TDT). In total 3100 blood culture
                                                                               triplicates, i.e. Bactec mycosis, Bact/ALERT aerobic and anaerobic
M. Metan and A. N. Koc
                                                                               vials, taken simultaneously from 958 patients were analyzed.
Erciyes University, Kayseri, Turkey
                                                                               Results: In total 117 sample triplicates from 38 patients signalled
                                                                               positive for Candida spp. The mycosis vials from Bactec were positive in
Objectives: Invasive pulmonary aspergillosis (IPA) is an important             89/117 samples (76.06%). The aerobic vials from Bact/ALERT were
problem for patients with haematological malignancies. Detection of            positive in 99/117 samples (84.62%). The difference between aerobic
galactomannan (GM) and1,3-Beta-D-glucan (BDG) are promising tools              and mycosis vials were not significant (P = 0.10). When paired
for diagnosis. Since, antifungal treatment could be based on the results       comparison for TTD were made, no significant difference were observed
of these tests, it is good to know the potential causes of false positivity.   between Bactec mycosis and Bact/ALERT aerobic blood culture vials
We want to report two cases with false positive BDG due to Escherichia         (P = 0.08). None of the anaerobic vials from Bact/ALERT signalled
coli and Salmonella enteritidis bacteraemia who were recovered without         positive for Candida spp. Growth of Candida spp. in blood culture vials
any antifungal therapy.                                                        drawn before the initiation of therapy was analysed in 27 patients.
Case 1: A 79-year old man with myelodysplastic syndrome was                    There were no difference in detection of Candida positivity between the
admitted to emergency department with fever and cough. Physical                two systems. When TTD was taken into account Bactec mycosis vials
examination was unremarkable except crepitant rales on the left                signalled positive significantly faster than Bact/ALERT vials
thorax Bilateral ground-glass appearance was detected at the lower             (P = 0.01). Median TTD was 22 h for Bactec mycosis and 30 h for
lobes in the high-resolution chest tomography (HRCT). Serum GM                 Bact/ALERT aerobic vials. In 30 triplicates with polymicrobial growth,
(Platelia Aspergillus EIA, BioRad) and BDG (Fungitell, Associates of Cape      (i.e. growth of another yeast or bacteria together with Candida spp.),
Cod) tests were ordered to rule out IPA. Moxifloxacin 400 mg day-1 iv           detection of Candida spp was significantly higher in Bactec mycosis vials
was started. Serum GM index was 0.37 (normal value £ 0.5) and BDG              than BacT/ALERT aerobic vials (P = 0.009). Growth was observed in
was 239 pg ml-1 (normal value £ 80 pg ml-1) which was performed at             29/30 (96.66%) Bactec mycosis vials while BacT/ALERT aerobic vials
the day of admission. HRCT was repeated and there was no difference            detected 21/30 (70%).
when compared with the previous one. Echerichia coli growth was                Conclusion: The present study shows that Bactec and BacT/ALERT
reported in the blood cultures. The antibiotic treatment was changed to        have different characteristics in detection of candidemia. Both systems
imipenem 500 mg q6h iv based on the antimicrobial susceptibility               were able to detect monomicrobial candidemia similarly. Bactec
report. Serum GM index was 0.11 and BDG was 21 pg ml-1 which                   mycosis vials were superior to Bact/ALERT aerobic vials in time to
were repeated one week later. The patient was discharged in good               detection of candidemia in samples drawn prior to systemic antifungal
condition after 14-days of imipenem treatment.                                 therapy. Similar difference was also observed in detection of candide-
Case 2: A 54-year old woman with aplastic anemia was admitted to               mia with polymicrobial sepsis where Bactec mycosis vials signalled
emergency department with fever and diarrhea. She was treated for              significantly faster than Bact/ALERT aerobic vials.
febril neutropenia with piperacillin/tazobactam for 10 days and
discharged from heamotology clinic one month ago. Physical exam-
ination was unremarkable except fever of 38.6 °C. White blood cell
count 1.45–109 L-1 and absolute neutrophil count was 420 mm-3.
                                                                               P045
_
Imipenem 500 mg q6h was initiated with a diagnoss of febril                    Diagnostic and therapeutical aspects in a dog chronic
neutropenia. The day after results of serum GM and BDG tests were              rhinitis caused by Aspergillus Fumigatus and Cryptococcus
available. GM index was 0.18 and BDG was 108 pg ml-1. The patient              Laurentii
was still febrile and HRCT was performed to rule out IPA. There was no         F. Agnetti1, M. B. Conti2, A. Moretti3, M. C. Marchesi2,
evidence of fungal pneumonia on HRCT. At the forth day fever resolved          S. Busechian2, L. Anzalone1, R. Cari1, I. Moretta3 and F. Rueca2
                                                                               1
and S. enteritidis growth was reported from blood cultures. The                  Istituto Zooprofilattico Sperimentale Umbria e Marche, Terni,
antibiotic treatment was changed to ciprofloxacin 200 mg q12h iv                Italy, 2Diagnostica e Clinica Veterinaria, Perugia, Italy,
                                                                               3
based on the antimicrobial susceptibility report. The therapy was                Dipartimento di Scienze Biopatologiche ed Igiene delle Produzioni
completed to 14 days and she didn’t have any evidence of IPA during            Animali e Alim, Perugia, Italy
follow-up visits.
Conclusion: BDG positivity without evidence of fungal infection was
                                                                               Objectives: Mold Aspergillus spp. is a common contaminant of the
reported in several clinical circumstances such as hemodialysis using
                                                                               nasal mucosa in several animals and is the etiological agent of dog
cellulose membranes, intravenous administration of albumin and
                                                                               mycotic rhinitis. This disease, relatively recurrent in middle-aged
immunoglobulin, gauze packing of serosal surfaces and patients
                                                                               dolicocephalic breeds, shows complicated and not always evident
receving amoxicillin/clavulanci acid. When we evaluated the potential
                                                                               pathogenetic features; besides this, it evolves in chronic shape and
interfering factors that caused BDG positivity in our patients, E. coli and
                                                                               sometimes it is associated to progressive osteolysis phenomena of the
S. enteritidis bacteraemia was the only possible causative factor in the
                                                                               surrounding bone structure. The present work describes a particular
lights of the current literature. However, the interaction between gram
                                                                               clinical case, due to the young age of the dog and the fungal agents
negative bacilli bacteraemia and BDG is still conflicting further studies
                                                                               involved.
are needed to evaluate potential BDG reactivity in patients with gram
negative bacilli bacteraemia.
                                                                               Methods: An Epagneul Breton female one year old dog showed for
                                                                               several months sneezes attacks and muco-purulent discharge, some-
                                                                               times with blood tracks, by the left nostril; it was treated unsuccessfully
                                                                               with antibiotics and non-steroid anti-inflammatory drugs. After the
                                                                               clinical examination, an endoscopy of the upper airways was
P044                                                                           performed, and through it was visualized and removed a vegetal
Clinical comparison of the two blood culture systems for the                   foreign body in the lower meatus of the left nostril. Furthermore, the
detection of candidemia                                                        endoscope showed a marked disarchitecture of the turbinates and a
E. L. Ericson, L. Klingspor, M. Ullberg and V. Ozenci                          conchal atrophy, associated with yellow-greenish and simil-caseous
Karolinska University Hospital Huddinge, STOCKHOLM, Sweden                     consistency plaques on the mucosa, probably traceable to fungal
                                                                               colonies. Specimens of this material were collected for bacteriological
                                                                               (standard culture media) and mycological (culture on Sabouraud
Objectives: To compare the performance of Bactec mycosis and                   dextrose agar and CAFC media, biochemical identification by API
Bact/ALERT aerobic and anaerobic blood culture vials in detection of           ID32C system) tests, together with bioptic samples of the mucosa for
candidemia in patients.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                      43
Poster Presentations



histo-pathological examinations. A radiographic study of the skull, to          Through the observation of the mycelia on the culture plate and the
confirm the bone integrity, was also realized.                                   ultra structure of the mold, it was successively possible to classify it as
Results: Bacteriological examination was positive for Staphylococcus            Penicillium marneffei. Results reported were obtained from all examined
intermedius, while mycological examination showed the development               fishes.
of two fungal species, the mold Aspergillus fumigatus and the yeast             Conclusions: Skin lesions are a frequent drawback in discus
Cryptococcus laurentii, respectively; branching septate hyphae were             farming. In addition to the tissue damage, they represent an
demonstrated on histologic samples. Therefore, a systemic therapy               antiaesthetic injury, with consequent impairment of the fish and
with itraconazole (5 mg kg-1 BID per os) was prescribed; than, the              troubles for the farmer or the owner. In many cases, the main
dog was submitted to a topic application of 1% solution of                      aetiological agent is a protozoan, Hexamita/Spyronucleus spp., cause of
clotrimazole after general anesthesia. Progressive resolution of the            the so called ‘hole in the head’syndrome. In the case described, the co-
clinical findings was noticed, and an endoscopic investigation was               presence of two other agents, bacteria and fungi respectively, was
performed after 3 weeks, showing the absence of fungal colonies.                demonstrated. A. hydrophila and A. sobria, as well as P. marneffei, are
Moreover, a second topic treatment was made, while the itraconaz-               common aquatic micro-organisms, that probably find favourable
ole was suspended. One month after the end of the therapy, there                pathogenetic conditions to affect skin damages caused by the
were no relapses.                                                               protozoan. In particular, it is important to point out that P. marneffei
Conclusions: The young age of the dog, as well as the positive                  is able to cause systemic mycoses in human and other animals, while
response to the therapy, allow to hypothesize that the pathogenicity of         no data are available concerning ornamental fish.
A. fumigatus is related to the irritant action of the vegetal body, that has
also brought the animal to cause a trauma to itself in the nostril region
involved; this aspect could explain the fact that C. laurentii, a non
pathogen yeast normally detectable on the mucosa of the first                    P047
respiratory tract, found the way to grow and produce colonies. In               Identification of human pathogenic Candida species by
the absence of hard tissue lesions, the persistent inflammatory stimulus         MALDI-TOF mass spectrometry
expired with the extraction of the foreign body, increasing the                 O. Petrini, C. Fragoso, S. De Respinis, M. Tonolla and C. Benagli
effectiveness of the therapeutic protocol. Furthermore, the combinated          Cant. institute of Microbiology, Bellinzona, Switzerland
systemic-topic treatment was useful to shortening the time of
itraconazole administration (normally 6–7 months) and therefore to
avoid its collateral effects.                                                   Objectives: Candida spp. have emerged as causal agents of human
                                                                                infections particularly among immunocompromised patients. In
                                                                                addition to C. albicans, several other species, including C. parapsilosis,
                                                                                C. krusei, C. glabrata, C. tropicalis and C. guilliermondii can be human
                                                                                pathogens. Species identification relied traditionally on morpholog-
                                                                                ical, physiological and biochemical characters. More recently molec-
P046
                                                                                ular methods, including RFLP, internal transcribed spacer (ITS)
Skin lesions in symphysodon discus: a case of protozoan,                        analysis and multilocus sequence typing, have been used for the
bacterial and fungal agents co-presence.                                        identification of clinical and non-clinical isolates. All these methods
F. Agnetti1, L. Anzalone1, S. Borgami2, I. Moretta3, M. Latini1,                are relatively costly and time-consuming. We have therefore
A. Moretti3 and C. Ghittino1                                                    compared molecular genetic methods to the more rapid and
1
  Istituto Zooprofilattico Sperimentale Umbria e Marche, Terni,                  inexpensive matrix-assisted laser desorption/ionisation-time of flight
Italy, 2Veterinarian, Terni, Italy, 3Dipartimento di Scienze                    mass spectrometry (MALDI-TOF MS) for the identification of Candida
Biopatologiche ed Igiene delle Produzioni Animali e Alim, Perugia,              isolates from human samples.
Italy                                                                           Methods: More than 200 isolates of several Candida species were
                                                                                submitted to MALDI-TOF MS analysis after identification by biochem-
Objectives: Ulcers, as other skin lesions, can be caused in fish by              ical and genetic (ITS sequencing) methods. MALDI-TOF mass spectra
different factors, including infectious agents, toxins, physical or             were obtained with an AXIMA-Confidence Linear instrument (Shima-
immunological causes, nutritional or metabolic perturbations. Patho-            dzu) in the linear mode. Spectra were analysed with SARAMIS
genic or contaminant microorganisms are often associated with a                 (spectral archive and microbial identification system; Anagnostec,
variety of skin disease in fish, as well as in other animals. In this study      Germany).
we describe a syndrome observed in discus (Symphysodon discus),                 Results: Preliminary results of the taxonomic analysis are shown in
characterized by the presence of skin ulcers, that was caused by the            Fig. 1. MALDI-TOF allowed to reliably identify C. albicans, C.
contemporary presence of protozoa, bacteria and fungi.                          parapsilosis, C. glabrata, C. krusei, C. lusitanica and C. tropicalis. The
Methods: A group of 10 adult discus specimens, about 2 years old,               results were confirmed by genetic analysis. The identification by
was sent to our Fish Disease Lab for the presence of skin lesions located       MALDI-TOF mass spectrometry was fast (approximately 2–3 min per
on the head region. Fishes belonged to a breeding farm located in               sample), with minimal sample preparation time.
Central Italy, supplied by water well, at a constant temperature of 24-         Discussion: Clustering of Candida species obtained by MALDI-TOF
26 °C; they were normally fed with a commercial feed, kept into                 was almost identical with that seen with sequence data. MALDI-TOF
aquarium of 500 L of capability and reared for the production of                MS separates Candida species as well as DNA sequencing. Thanks to its
juveniles for pet shops. The observed lesions were distributed around           robustness, simplicity, speed, and reliability, MALDI-TOF represents a
the periocular and the nasal region, and, in some cases, along the              valid alternative to single or multi gene sequencing for taxonomic
junction of the dorsal fin. They were ascribable to ulcers and                   studies of Candida. The big advantage of MALDI is the speed by which
characterized by: absence of scales, irregular perimeter and hypera-            identifications can be made; thus, diagnostic results produced by
emia. Moderate anorexia and lethargy were also observed in the above-           MALDI-TOF can be made available to clinicians almost immediately
mentioned fishes. Specimens were sacrificed and scrapings were carried            after growth of the pathogen in pure culture. We are currently
out on the skin lesions, for light microscope observation and                   investigating the use of MALDI-TOF on native samples.
bacteriological and mycological examinations.
Results: Light microscope observation allowed to notice the presence
of flagellated and oval shaped protozoa, presumably belonging to
family Hexamitidae (genus Hexamita/Spyronucleus). Bacteriological
exam was positive for Aeromonas hydrophila and Aeromonas sobria,
while mycological exam was positive for a Penicillium spp. mold.




                                                                                                                                  Ó 2009 The Authors
44                                                                   Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                  Poster Presentations



Figure 1. Denddrogram, MALDI-TOF identifications                                The S, SP, PPV and NPV for BG and GM were 100%, 38%, 24%, 100%
                                                                               and 75%, 80%, 27%, 97% respectively. The table shows the
                                                                               relationship of IFD and risk.




                                                                               Conclusions: Both BG and GM are non-invasive tools for the
                                                                               diagnosis of IFD and IA in LTR patients at risk, but although GM has
                                                                               a higher SP for the diagnosis of IA, the advantage of BG is that it is a
                                                                               panfungal marker. Since Mucorales have a low amount of BG,
                                                                               mucormycoses currently should be diagnosed with conventional
                                                                               invasive techniques. Both BG and GM share high NPV and can
                                                                               exclude reasonably IFD in populations at risk. A limitation of our work
                                                                               is the low number of patients included in the study; consequently the
                                                                               validation of BG and GM in LTR populations requires a sound and
                                                                               definitive prospective clinical study in which necropsies should be the
                                                                               cornerstone.
                                                                               Acknowledgments: This investigation was supported by grants
                                                                                                    ´
                                                                               Fondo de Investigacion Sanitaria, Instituto de Salud Carlos III, Proyecto
                                                                               Investigacion PI 070134 (to MSC), PI 070107 (to A d P) and PI 070376
                                                                                                                                    ´n,
                                                                               (to JP), grant IT-26407 of Departamento de Educacio Universidades e
                                                                                           ´n
                                                                               Investigacio del Gobierno Vasco (to JP) and Saiotek from Departa-
                                                                               mento de Industria, Comercio y Turismo del Gobierno Vasco (to JP) and
                                                                               an Educational grant from Pfizer (to A d P) and Fundacio MM        ´n
                                                                                           ´n ´
                                                                               Investigacio Medica (to A d P).



                                                                               P049
                                                                               Piperasilin-tazobactam treatment does not cause
P048                                                                           false-positivite result in < i Aspergillus galactomannan
Prospective pilot study in ICU adult liver transplant                          antigen detection of animal models
recipients (LTR): utility of (1–3)-B-D Glucan (BG) and                         A. Kalkanci, K. Hizel, A. Kalkanci, M. Dizbay, O. Guzel Tunckan,
galactomannan (GM) for the diagnosis of invasive fungal                        D. Arman and S. Kustimur
disease (IFD)                                                                  Gazi University, Ankara, Turkey
A. Del Palacio1, M. E. Alvarez1, A. Alhambra1, M. S. Cuetara2,
                                                        ´
M. Catalan1, J. C. Montejo1, I. Moragues3 and J. Ponton3
         ´                                            ´
1                                                                              Objectives: The availability of the Platelia Aspergillus (Bio-Rad
 Hospital Universitario Doce de Octubre, Madrid, Spain, 2Hospital
                                                                               Laboratories, Marnes, France) has been a major advance in the
Universitario Severo Ochoa, Legane Spain, 3Universidad del Paı´s
                                    ´s,
                                                                               diagnosis of aspergillosis because of the early detection of antigen. But,
Vasco, Bilbao, Spain                                                           galactomannan may be detected in several drugs that originated from
                                                                               fungal organisms, including piperacillin/tazobactam. The aim of this
Objectives: BG (polysaccharide of the cell wall of all fungi, Mucorales        study is the demonstration of galactomannan false positivity in
however have a lower content of BG) and GM (cell wall component of             neutropenic rats with aspergillosis receiving voriconazole or/with
Aspergillus) are non invasive diagnostic tools that may help to establish      piperasilin-tazobactam treatment.
the diagnosis of IFD. Conventional diagnostic methods are insensitive          Methods: Fourthy female Wistar albino rats, weighing initially
for this purpose. The serological blood results with these biomarkers          (200 ± 15 g) and 4 weeks of age, were obtained from Gazi University
should be interpreted in the context of the presence of risk factors, signs,   School of Medicine Experimental Animal Research center and divided
symptoms and radiologic imaging. The aim of this prospective study is to       into five groups 8 rats in each; healthy control group, neutropenic
define the sensitivity (S), specificity (SP) and positive and negative           control group, neutropenic aspergillosis group, neutropenic aspergil-
predictive values (PPV and NPV) of both biomarkers and the                     losis and treated with voriconazole group, neutropenic and treated
relationship of IFD (proven/probable) with a risk stratification scheme         with piperasilin - tazobactam prophylaxy group. Neutropenia was
in ICU adult LTR.                                                              achieved by the intraperitoneal administration of 10 mg of 5-
Methods: Patients were prospectively stratified (with modifications)             fluorourasil per kilogram before infection of the animals. Aspergillosis
as proposed by Hellinger WC (Liver Transpl 2005;11:656–662) as                 was performed with the inhalation of Aspergillus conidia in a
high, intermediate and low risk for IFD. IFD was defined as proven and          respiration chamber. Voriconazole and piperasilin - tazobactactam
probable according to the guidelines of De Pauw B (Clin Infect Dis             treatments were performed intraperitonealy. Aspergillosis was con-
2008;46:48). Bi-weekly BG (FungitellÒ, cutoff ‡ 120 pg ml-1) and GM            firmed by Real Time PCR assay using using the LightCycler instrument
(PlateliaÒ Aspergillus, cutoff ‡ 0.500) were determined in serum.              (Roche Diagnostics, Tenay, Turkey) and primers were derived from
Results: 43 LTR patients were assessed prospectively: 20 patients              sequences of the A. fumigatus 18S rRNA gene. Two internal
died and there were nine necropsies. The rate of false antigenemia on          hybridization probes specific to A. fumigatus were used; the first was
the first week posttransplantation was (34%) (three false positive per          labeled at the 5¢end with LC Red 640 (5¢-TGA GGT TCC CCA GAA GGA
eight patients) and 59% (13 false positive per 22 patients) for GM (for        AAG GTC CAG C) and at the 3¢end (5¢-GTT CCC CCC ACA GCC AGT
invasive aspergillosis) and BG (all IFD except Mucorales) respectively.        GAA GGC). The galactomannan antigen test was performed using the




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                     45
Poster Presentations



Platelia Aspergillus sandwich enzymelinked immunosorbent assay (Bio-         P051
Rad). A GM test was positive when the index was higher than 0.5.             Diagnostic PCR assay for Microsporum and Trichophyton
Results: Neither Aspergillus DNA nor galactomannan antigen was               infections
detected in healthy control and neutropenia control groups. Rats of the      A. Brillowska-Dabrowska1, A. Swierkowska2, D. M. Saunte1 and
neutropenic aspergillosis and treated with voriconazole group were all       M. C. Arendrup1
positive for Aspergillus DNA and 37% positive for galactomannan              1
                                                                              Statens Serum Institut, Copehagen, Denmark, 2Gdansk University
antigen. No antigen positivity was found in neutropenic rats treated
                                                                             of Technology, Gdansk, Poland
with piperasilin - tazobactam. The level of galactomannan antigen was
determined for piperasilin-tazobactam by Platelia Aspergillus and it was
not in the range of positivity. Galactomannan index was estimated            Objectives: We have previously described a highly sensitive 5-hour
with the ratio to cut-off value and evaluated as positive when index         PCR test for the rapid diagnosis of onychomycosis which detects any
was found > 0.5.                                                             dermatophyte and species-identify T. rubrum from patient specimens.
Conclusion: Galactomannan antigen detection is a valuable meth-              We have subsequently developed and evaluated new PCR tests for
od for early diagnosis of aspergillosis. The reasons for the variation in    detection of Trichophyton and Microsporum canis per audouinii infec-
performance are multifactorial. In the literature it was published that      tions.
piperasilin - tazobactam treatment caused false positive result in           Methods: Fifty-eight dermatophyte isolates (21) Microsporum spp.
galactomannan antigen test. But in our study, piperasilin-tazobactam         (four different species), 35 Trichophyton spp (10 different species) and
treatment did not cause false-positivite results in galactomannan            two were E. floccosum) and 10 yeast, mould or human DNA controls
antigen detection in rat models of aspergillosis. With the respect of our    samples were included. Twenty-five patient specimens randomly
results, it was thought that the knowledge of false positivity of            selected among routine samples, 10 hair specimens from guinea pig
galactomannan antigen test in the literature should be evaluated             experimentally infected with M. canis and two from un-infected control
again.                                                                       animals were included. The isolates were identified by microscopy and
                                                                             culture observation. DNA was prepared by a 10-min procedure from
                                                                             patient specimens, guinea pig specimens and fragments of dermato-
P050                                                                         phyte colonies as previously described (1). Two pairs of primers were
Evaluation of two serologic test for diagnosis invasive                      designed based on the alignment (VectorNTI, Informax) of dermato-
Aspergillosis                                                                phytes rDNA sequences: Trich302for 5¢ TTG CTA AAC GCT CAG ACT
                                                    ´
C. Castro, A. Romero, A. Aller, T. Gonzalez, A. Gonzalez and                 GAC AGC 3¢ and Trich302rev 5¢ CGG AAG GAT CAT TAA CGC GCA
       ´
E. Martın-Mazuelos                                                           GGC C 3¢ specific for any Trichophytos spp and Micr279for 5¢ CCT AAG
H. U. Valme, Sevilla, Spain                                                  CGG TGG GTG GTT ACT G 3¢ and Micr279rev 5¢ TGA AAG AAC ATA
                                                                             CCG TCT GAG CG 3¢ specific for M. canis and M. audouinii. PCR
                                                                             mixtures consisted of 10 ll of PCR Ready Mix (Sigma, Germany),
Objective: Early diagnosis of invasive fungal infections (IFIs) is           0.2 ll of each primer at 100 lmol L-1, and 2 ll of DNA in a volume of
essential, however diagnosis of most IFIs (especially of invasive            20 ll. PCR was performed in an Eppendorf thermal cycler. The time-
aspergillosis (IA)) is difficult because classic test have low sensitivity    temperature profile for PCR was 35 cycles of 45 s at 94 °C, 45 s at
and specificity. In our study new assays, detection of galactomannan          70 °C, and 45 s at 72 °C, preceded by initial denaturation for 10 min
(GM) by PlateliaÒ Aspergillus and the ‘panfungal’antigen 1,3-beta-D-         at 95 °C for the Trichophyton PCR and 35 cycles of 45 s at 94 °C, 45 s
glucan (BG) by FungitellÒ test are used for early diagnosis of invasive      at 55 °C, and 45 s at 72 °C, preceded by initial denaturation for
aspergillosis (IA).                                                          10 min at 95 °C for the other. The presence of specific PCR products of
Methods: A total of 236 sera from 51 patients in risk of IA were             approximately 302 bp and 279 bp, respectively, was examined using
tested for GM using PlateliaÒ Aspergillus kit (Bio-Rad, France) which 36     electrophoresis on a 2% and 1% agarose gel stained with ethidium
sera (10 patients) were tested for BG also using FungitellÒ kit              bromide.
(Associates of Cape Cod., USA). Patients were attended at the                Results: Using DNA prepared from dermatophytes cultures the
University Hospital of Valme from Seville from January of 2008 to            302 bp PCR product was obtained for 35/35 Trichophyton isolates
December 2008. Patients with GM index ‡ 0.5 in two consecutive               (Fig 1) and the 279 bp for 3/3 M. canis and 4/4 M. audouinii samples.
samples have been marked as GM positive and samples with results             None of the two E. floccosum, 14 Microsporum spp. other than M. canis
‡ 80pg ml-1 were marked as BG positive. Antigens detection were              and M. audouinii or control samples was positive with any of the two
performed to according to the manufacturer’s instructions. Other             PCR tests. Among the patient specimens seven were T. rubrum positive,
samples as blood culture, bronchoalveolar lavage, bronchoalveolar            two T. mentagrophytes positive, one T. tonsurans positive and 15
aspirates or others were taken following clinical criteria. Culture of       dermatophyte negative by routine investigation. The PCR results were
these samples were carried out following the usual techniques of a           in agreement with this. Finally, the Microsporum PCR was positive for
mycological laboratory. All GM positive patients were classified              10/10 guinea pig hair specimens from infected animals but for 0/2 of
according to EORTC/MSG criteria (2008) for probability of IA.                the control animal samples.
Results: From 51 patient studied, 16 of them showed at least one             Discussion: The evaluation of the two PCR tests indicated excellent
GM positive specimen (33 sera). Only six patients showed two                 sensitivity and specificity. Based upon the local epidemiology algo-
consecutive positive results (‡ 0.5 GM test) and they show clinical          rithms can now be designed for rapid and easy PCR-detection of
signs or microbiological criteria for AI proven (three patients) and         dermatophytosis with a genus identification allowing optimal selection
probable (three patients). The BG assay were used in parallel with GM        of antifungal treatment.
in 36 sera which 26 showed positive result from nine patients, (three
with AI proven and six AI probable). Three patients showed positive
results before for BG test (3.5 days) and 6 patients presented
simultaneously both antigens. Never the GM test was the first
serological test to show a positive result.
                                                                             P052
Conclusion: Calculating significant sensitivity for both detection            Optimised 5-hour multiplex PCR test for the detection of
methods was not feasible due to a low number of proven/probable AI.          Tinea ungium: performance in a routine PCR laboratory
BG detection showed positive results before GM test and present the          A. Brillowska-Dabrowska, H. V. Nielsen, S. S. Nielsen and
great advantage to be a ‘panfungal’antigen. BG detection should be           M. C. Arendrup
used with other techniques for detection of invasive Aspergillosis           Statens Serum Institut, Copenhagen, Denmark
infections.
                                                                             Objectives: We recently published the development of a 5-hour
                                                                             multiplex PCR test for the detection of dermatophyte nail infection. We
                                                                             have optimized this test by inclusion of an inhibition control and




                                                                                                                               Ó 2009 The Authors
46                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



evaluated the test in a routine laboratory when compared to the             colonies at first white turned black. Fungal DNA was amplified and
conventional microscopy and culture.                                        sequenced using the MicroSeq D2LSU rDNA Fungal PCR Kit and the
Methods: A total of 109 clinical samples received at the mycology           MicroSeq D2LSU rDNA Fungal Sequencing Kit from Applied Biosys-
reference lab at Statens Serum Institute were included. The samples         tems. The consensus sequence was analysed using Blast program of
were divided equally and tested by microscopy & culture and PCR. For        NCBI and a 97% homology to S. schenckii was obtained. A test for
PCR evaluation DNA from nail specimens was released by a 10-min             antifungals susceptibility pattern was also performed and the strain
incubation of the nail sample in 100 ll of extraction buffer in 95 °C       exhibited in vitro resistance to Fluconazol, Voriconazol and Itraconazol.
and subsequent addition of 100 ll anti-inhibition buffer. After vortex
mixing, 4 ll of this DNA-containing solution was used for the
multiplex PCR with: panDerm1 (5¢ GAAGAAGATTGTCGTTT-
GCATCGTCTC 3¢), panDerm2 (5¢ CTCGAGGTCAAAAGCACGCCAGAG
                                                                            P054
3¢) detecting dermatophyte DNA and Trubrum-for (5¢ TCTTTGAACG-              Direct detection of multi-azole resistant Aspergillus
CACATTGCGCC 3¢) and Trubrum-rev (5¢ CGGTCCTGAGGGCGCTGAA                     fumigatus in brain tissue
3¢) detecting Trichophyton rubrum DNA, 1 ll of inhibition control,          S.M.T. Camps1, J.W.M. Van der Linden1, E. Snelders1,
10 ll of PCR Ready Mix in a volume of 20 ll. The presence of specific        J. P. Arends2, S. M. Daenen2, W.J.G. Melchers1 and P. E. Verweij1
                                                                            1
PCR products of approximately 366 bp (dermatophyte band), 203 bp             Radboud University Medical Center, Nijmegen, The Netherlands,
                                                                            2
(T. rubrum band) or 500 bp (inhibition control band) was examined.           UMC Groningen, Groningen, The Netherlands
Results: The performance of the multiplex PCR with inhibition
control was tested prospectively in a PCR routine laboratory. In total      Objectives: Aspergillus fumigatus is an opportunistic fungal patho-
22 (20.2%) specimens grew a dermatophyte (16 of which were T.               gen causing severe disease in immunocompromised patients. Aspergil-
rubrum. Additionally 15 samples were microscopy positive but culture        lus infections are often treated with azole antifungal agents but patients
negative. Thus, 46.8% of the microscopy positive samples were               infected with a resistant strain may not respond to the azole therapy.
negative by culture. By PCR using 4 ll DNA solution 35 of the               Recently, multi-azole resistance has emerged in The Netherlands and
samples were positive for either T. rubrum or a dermatophyte other than     in our hospital up to 6% of patients harbor a multi-azole resistant A.
T. rubrum, 68 samples were negative and six samples were inhibited.         fumigatus isolate. The resistance was mainly caused by a point
Repeating these samples with 2 ll DNA allowed for detection                 mutation at t364a in the cyp51A gene (the target for azoles) leading
dermatophyte DNA in two samples (both microscopy positive) and              to a substitution of leucine for histidine at codon 98 (L98H), in
confirmed negative results of conventional diagnosis for the remaining       combination with a tandem repeat (TR) in the promoter region of this
four specimens. Thus in total 37 samples (33.9%) were PCR positive. T.      gene. The detection of azole-resistance delays the start of appropriate
rubrum was detected in 27 (73.0% of the PCR positive samples) and a         antifungal therapy due to time-consuming laboratory investigations
dermatophyte other than T. rubrum in 10 samples (27.0% of the PCR           (i.e. culturing and susceptibility testing), or even culture-negativity.
positive samples). In five (4.6%) cases the PCR was positive for T.          This diagnostic delay should be reduced and therefore we investigated
rubrum despite negative microscopy and culture, and in two (1.8%)           whether molecular tools can be applied to detect resistance in A.
cases the PCR was negative despite positive culture. In the majority of     fumigatus directly in clinical specimens such as brain tissue.
cases of positive PCR and negative culture the microscopy was positive
                                                                            Methods: In a 60-year old man suffering from graft-versus-host
(11/16, 68.8%). Only 5/72 culture and microscopy negative samples           disease after allogeneic stem cell transplantation for myelodysplastic
were positive by PCR (6.7%) while the PCR positive rate was much
                                                                            syndrome which developed into acute myeloid leukemia, multiple
higher among microscopy positive but culture negative samples 11/15         nodular pulmonary infiltrates and multiple brain lesions were
(73.3%)                                                                     detected. Aspergillus fumigatus was cultured from the sputum and in
Discussion: The present study demonstrates that in a routine                serum circulating galactomannan was detected. Histological exami-
setting the PCR test is as sensitive as traditional diagnostics performed   nation showed septate hyphae from a brain biopsy, but cultures
in a mycology reference lab if microscopy positive but culture negative     remained negative. The isolate cultured from the sputum showed
samples are considered positive and far more sensitive if only culture      high minimum inhibitory concentrations (MICs) for itraconazole,
positive samples are considered true positives. The introduction of an      posaconazole and voriconazole. The resistance mechanism was
internal control demonstrated that 5% of the samples contained PCR          determined by polymerase chain reaction (PCR) amplification and
inhibitors but this was overcome by re-running the samples with a           sequencing of the cyp51A gene and its promoter region. The paraffin-
50% reduction of sample DNA solution.                                       embedded brain tissue sections prepared from the biopsy were used to
                                                                            demonstrate Aspergillus infection as well as azole resistance directly.
                                                                            DNA was extracted using proteinase K and the Qiagen EZ1 robot. A
P053                                                                        real-time 28S PCR assay was used to detect Aspergillus and two real-
                                                                            time PCR assays were used to detect the TR and the L98H
Sporotrix schenckii - clinical laboratory case                              substitution, respectively. A 160 base pair (bp) fragment of the
          ´                                                   ˜
C.M. Verıssimo, H. Parada, A. C. Pinheiro, R. Sabino, J. Brandao            cyp51A gene was sequenced as additional confirmation for the L98H
and L. Rosado                                                               substitution.
                        ´de
Instituto Nacional de Sau Dr Ricardo Jorge, Lisbon, Portugal                Results: The resistant A. fumigatus isolate from the sputum con-
                                                                            tained the TR/L98H mutations as was determined by sequencing.
Sporothrix schenckii is a dimorphic fungus usually found in soil and        From the paraffin-embedded brain biopsy tissue, Aspergillus was
plant debris. It is the cause of sporotrichosis and can cause cutaneous     detected by a real-time 28S PCR assay. In addition, the resistance
or subcutaneous infection, usually following trauma of the skin with        mechanism was detected by the two real-time PCR assays was the TR/
plant material or by contaminated animals. Although it’s more often         L98H. The L98H substitution was confirmed by sequencing of a
reported from Central and South America, it has worldwide distribu-         160 bp fragment.
tion and it is the most frequent subcutaneous mycosis reported in           Conclusion: The real-time PCR method described here is a reliable
Portugal. We describe a laboratory case of S. schenckii isolated from a     and rapid method to detect TR/L98H mutations in resistant A.
skin lesion of the right hand of an immunocompetent patient with            fumigatus. To our knowledge, it is shown for the first time that it can
localized linphocutaneous sporothrichosis. The laboratory procedures        be used for the direct detection of azole resistance in patient material
included direct microscopic examination and culture of the skin biopsy      such as brain tissue. This increases the possibility to detect azole
on Sabouraud cloranphenicol agar. After 5 days at 35 °C yeast form          resistance in case of culture negativity. In addition, diagnostic delay can
culture consistent with S. schenckii were observed. Cultures were tested    be reduced as it is not necessary to wait until cultures are positive and in
for dimorphism and converted to filamentous form at 27 °C, the               vitro susceptibility testing is performed.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                    47
Poster Presentations



P055                                                                       propagation of AFRS has been reported and these lesions may be
Histopathological diagnosis of onychomycosis using                         mistaken for pituitary tumors.
calcofluor white (CW) stain: comparison with PAS staining                   Objectives: We describe the histology and mycology findings of S.
of nail sections                                                           commune AFRS followed by massive sellar propagation hyperprolac-
N. Dias1, F. Garcez1, M. Teixeira1, F. Ferreira1 and N. Lima2              tinemia and diplopia. A 44-year-old immunocompetent male presented
1
                             ¸ ˜o
 CITS - Centro de Investigaca em Tecnologias da Sau    ´de, Paredes,       with symptoms of nasal obstruction, diplopia and headache. Endocri-
                                                                           nological evaluation of the pituitary function revealed normal pituitary
Portugal, 2IBB - Institute for Biotechnology and Bioengineering,
                                                                           function and hyperprolactinemia. The patient underwent transnasal
Braga, Portugal                                                            transsphenoidal operation and the functional endoscopic sinus sur-
                                                                           gery.
Objective: The aim of this work is to compare results from PAS             Methods: Histology examination of formalin-fixed and paraffin-
routine staining and CW stain on histopathological evaluation of           embedded tissue and mucin sample were performed staining by
onychomycosis.                                                             Hematoxylin and eosin (H&E) and Gomoris methenamine silver
Methods: Ninety six nail clippings from patients clinically suspected      (GMS). For mycology examination the tissue was homogenized for
of having onychomycosis were used. All patients were attending the         direct Blankofor smear preparation and culturing. Sabouraud dextrose
Podology Service in the Hospital of Guimaraes (Centro Hospitalar do
                                              ˜                            agar plates were incubated on 28 °C and 37 °C and followed daily for
Alto Ave) between January and October 2008. Nail clippings were            fungal growth. Subcultivation was done on Potato dextrose and
obtained by non-invasive means and were fixed with 10% formalin,            Chapek agar.
embedded in liquid paraffin at 60 °C, cut into 5–6 thin slices (3 lm) of    Results: Histologicaly pituitary gland adenoma was not detected but
the paraffin blocks and dried onto slides. A fully automated embedding      revealed clusters of eosinophilic granulocytes (H&E) and septate fungal
process provided histological slides within 24 h. After deparaffination     hyphae within the allergic mucin (GMS). The hyphae seemed to be
and hydratation in descending alcohol solutions (100% · 2, 95% · 2,        impacted or embedded within the clusters of eosinophils, proliferates as
80%, 70%, 50%) half of the slides were stained with periodic acid-Shiff    septate hyphae 2.5–4.5 lm in diameter with characteristic branching
(PAS) reagent for 10 min, washed in deionized water and stained with       dichotomy (approximately 45 °C angle), suggesting Aspergillus infec-
Shiff Reagent for another 5 min. Slides were washed with three             tion but a fungal invasion of the tissue was not observed. Tissue
exchanges of deionized water and dehydrated in ascending alcohol           Blankophor staining revealed hyphae and on the plate the growing
solutions (50%, 70%, 80%, 95% · 2, 100% · 2) before mounting in            was observed after 3 days on both temperatures as white cottony mold
an organic mounting medium. The remaining slides were stained with         colony with a yellow reverse and strong and disagreeable smell,
one drop of Calcofluor White Stain 1% (CW) for 3–5 min, followed by         reaching a diameter of 4 cm in 7 days labeled as ‘sterile mycelium’.
washing in deionized water to remove excess fluorochrome. Slides were       Subcultivation on Potato dextrose and Chapek agar microscopically
covered with Vectashield mounting medium for delay fluorescence             demonstrated hyphae with clamp connections and fruiting bodies
quenching. Histological diagnosis was performed using conventional         suggesting S. commune. Identity of fungal strain was confirmed by
methods. Samples were first screened with a low magnification                sequencing analyze in the Centraalbuerau voor Schimmelcultures,
objective (10 ·). Upon localization of a site suspicious of fungal         Utrecht, The Nitherlands.
infection a high magnification (40 · or 100 ·) was used to confirm the       Conclusion: This is the first case of AFRS caused by S. commune in
diagnosis. All randomized samples were observed twice in a blind           immunocompetent patient, complicated with formation of the large
assay.                                                                     pseudotumor and its propagation to the sellar region followed with
Results: Calcofluor white (CW) stain is a fluorescent brightener,            hyperprolactinemia and diplopia documented by histology, mycology
with a high affinity for chitin and cellulose, which are major              and strain sequencing analyze. It is likely that AFRS caused by S.
components in the cell walls of fungi, so is particularly useful in the    commune is not rear but are usually misdiagnosed or not recognized
detection of fungal elements in specimens. CW was used as an               because of the lack familiarity of doctors with this fungus.
alternative of PAS staining in histological nail sections. On 96
samples analysed and stained with PAS, a percentage of 34.4% nails
were found positive for fungi, 62.5% were negative and 3.1% gave
an inconclusive diagnosis. Results from CW staining showed 46.9%           P057
of positive cases, 52.1% of negative cases, and it was not possible to     Evaluation of Conda Candida chromogenic agar for the
establish a conclusive diagnosis in 1.0% of cases.                         isolation and presumptive identification of Candida albicans
Conclusion: Results of the present study indicate that the histolog-       and other clinically relevant yeasts
ical examination of nail clipping specimens with CW stain is an easily     E. Eraso, C. Marcos-Arias, I. Miranda-Zapico, M. Ortega-Riveros,
and rapid performed procedure that represents an alternative to            A. Varona, J. M. Aguirre and G. Quindos  ´
routine periodic acid-Shiff (PAS) staining of nail clipping sections,      Universidad del Paı´s Vasco, Leioa, Spain
principally in non-massive infection cases where fungal elements are
scarce.
                                                                           Introduction: Candida Chromogenic Agar (Conda, Spain) is a
                                                                           chromogenic medium for the selective isolation of yeasts and the
                                                                           direct identification of Candida albicans (green colonies) and presump-
P056                                                                       tive identification of some other Candida species, such as Candida
Schizophyllum commune allergic fungal rhinosinusitis                       tropicalis (dark blue) and Candida krusei (purple-pink).
with sellar propagation and hyperprolactinemia in                          Objective: To evaluate the performance of the Candida Chromogenic
                                                                           Agar for the isolation and identification of Candida albicans and other
immunocompetent man - histology and mycology findings
                                                                           clinically important Candida species.
V. Arsic Arsenijevic1, S. Pekic2, M. Skender Gazibara3, A. Dzamic1,
                                                                           Patients and methods: Two hundred and sixty four stock strains
E. Ratkov1 and V. Popovic2
1                                                                                                         ´
                                                                           from the Universidad del Paıs Vasco and other culture collections
 Institute of Microbiology and Immunology, Belgrade, Serbia,               (Table 1) and 112 fresh oral specimens were evaluated. The usefulness
2
 Institute of Endocrinology University Clinical Center, Belgrade,          of Candida Chromogenic Agar with clinical specimens was compared
Serbia, 3University of Belgrade, Belgrade, Serbia                                                         ´
                                                                           with ChromID Candida (bioMerieux, France). The identity of clinical
                                                                           isolates was confirmed by conventional mycological methods, such as
Allergic fungal rhinosinusitis (AFRS) represents a hypersensitivity        the germ tube test in serum, microscopic morphology and chlamy-
response in the sinus cavity usually caused with Aspergillus, Culvu-       conidia formation in corn meal agar (Oxoid, UK) with Tween 80, and
laria, Bipolaris or zygomycetes. Only in few cases Schizophyllum                                                             ´
                                                                           carbon source assimilation by ID 32C (bioMerieux). If necessary,
commune was reported manly because of difficultly to detect them with       identification was confirmed by PCR with specific primers. Stock
conventional mycological examinations. In rare case intracranial           collection strains were grown on Sabouraud glucose agar plates (Difco,
                                                                           USA) at 37 °C for 24–48 h, prior to inoculation onto chromogenic




                                                                                                                             Ó 2009 The Authors
48                                                              Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                     Poster Presentations



media. Oral swabs were directly streaked onto chromogenic media agar            of Candida spp. were done using VITEK 2 Compact system (Bio-Merieux).
plates. Media were incubated up to 10 days at 37 °C (temperature                During the 4 years between January 2005 and December 2008, there
recommended by manufacturers). Plates were checked daily for growth             was growth of candida in 508 of 36.330 blood cultures. 315 (62%) were
and read independently by two investigators.                                    Candida albicans, 157 (31%) were non-albicans Candida and 36 (7%) were
Results: Most yeast isolates grew well on both media after 24 h of              nontypeable. Among the non-albicans Candida the most frequent isolates
incubation. However, colonies grew earlier with a faster and stronger           were C. parapsilosis (104), C. tropicalis (17) and C. glabrata (12). Mean
colour on ChromID Candida. Table shows the main characteristics of              time to detect positivity in C. albicans was 1:14:00 days:hours:minutes
yeast colonies grown on Candida Chromogenic Agar. Seventy two                   (max: 5:14:03 and min: 00:02:11). In non-albicans Candida it was
positive oral specimens yielded 91 isolates of different yeast species. The     2:00:56 (max: 5:05:40 and min: 00:03:22). 21.2% of Candida displayed
recovery rates were equivalent on both media. Candida albicans was the          growth alarm after 48 h. Mean isolation time was > 48 h in C. glabrata
most frequent species isolated (65 isolates, 71.4%), followed by Candida        (12) and C. famata (6). Mean duration for positivity is higher in non-
glabrata (11 isolates, 12.1%), Candida parapsilosis (six isolates, 6.6%), C.    albicans Candida. Even in C. albicans the time to positivity is still high to
tropicalis (three isolates, 3.3%), Candida dubliniensis and Candida             manage appropriate therapy. The subcultures and identification
guilliermondii (two isolates each, 2.2%), and Candida lusitaniae and            procedures will require at least 48 more hours. In each hospital there
Candida rugosa (one isolate each, 1.1%). In 17 specimens grew two or            should be 24 h coordination of information between laboratory and
more yeast species. Candida Chromogenic Agar had excellent sensitivity          clinics in term of early management of systemic Candida infections.
and specificity values (100%) for the identification of germ tube positive        Faster methods of detection is required for laboratory dependent
species (C. albicans or C. dubliniensis). When colonies of C. tropicalis were   therapy.
observed, the colour of the colonies was gray-green, distinct from the
referred by manufacturers but clearly distinguishable from that
observed in colonies from other species. The differentiation of C. krusei
was easy by the colour pink and downy appearance of colonies, with a            P059
sensitivity and specificity of 100%. However, C. parapsilosis and C.
                                                                                Differentiation of intra-Section Aspergillus species with
glabrata were not clearly differentiated from other species, such as C.
                                                                                MALDI-TOF Mass Spectrometry in comparison to multi-locus
guilliermondii, C. lusitaniae or Candida famata.
                                                                                sequencing
                                                                                A.A. Alanio1, J.L.B. Beretti1, B. D. Dauphin1, E. M. Mellado2,
                                                                                G. Q. Quesnes1, A. A. Amara1, X. N. Nassif1 and M.E.B. Bougnoux1
                                                                                1
                                                                                 Hopital Necker-Enfants Malades, Paris, France, 2Centro Nacional
                                                                                de Microbiologia, Instituto de S. Carlo, Madrid, Spain

                                                                                Objectives: Based on phylogenetical studies, the taxonomy of
                                                                                Aspergilli has been considerably modified using a multi-locus sequenc-
                                                                                ing (MLS) approach, allowing better correlation between species and
                                                                                natural phenotype resistance. As a consequence, emerging species of
                                                                                Aspergillus causing invasive diseases, such as Aspergillus lentulus
                                                                                within section Fumigati, have been isolated in immunocompromised
                                                                                humans. Currently, MLS is recommended for identification of recently
                                                                                described Aspergillus species. We postulated that MALDI-TOF Mass
                                                                                Spectrometry (MS) can also discriminate intra-section species of
                                                                                Aspergillus, as in bacterial species identification.
Conclusion: Candida Chromogenic Agar allows the easy and rapid                  Methods: A set of reference strains belonging to 24 clinically
identification and differentiation of C. albicans, C. tropicalis and C. krusei   relevant species from five sections was used to build a reference
at 24–48h and clearly shows the presence of mixed cultures.                     database, as previously described (Carbonnelle E., J.Clinical.Microbiol.,
Funding: Projects GIC07 123-IT-222-07 (from the Departamento de                 45, 2156). To identify discriminating peaks, the profile of early
        ´
Educacion, Universidades e Investigacio      ´n, Gobierno Vasco) and            (< 2 days) and late (> 4 days) spores obtained from 10 passages were
                                                          ´
PI061895/2006 (from the Fondo de Investigacion Sanitaria del                    analyzed for each referenced strain. The spectra of 112 clinical and 16
Ministerio de Sanidad y Consumo de Espana).   ˜                                 environmental isolates, identified with MLS (beta-tubulin and/or
                                                                                calmodulin) were then compared to those of each of the 24 reference
                                                                                strains including: 50 A. fumigatus, seven A. lentulus, five Neosartorya
                                                                                pseudofischeri, two A. viridinutans and A. hiratsukae, A. fumigatiaffinis,
P058                                                                            one A. fumisynnematus, N. fischeri and N. udagawae (section Fumigati);
                                                                                11 A. flavus, two A. tamarii, one A. parvisclerotigenus (section Flavi),
Time to blood culture positivity of Candida species                             nine A. niger, two A. foetidus, one A. tubengensis (section Nigri); four
O.A. Akan1 and S. Kilicel2                                                      Emericella nidulans, one E. quadrilineata, seven A. sydowii, three A.
1
 Ankara University Medical School, Ankara, Turkey, 2Ankara                      versicolor (section Nidulantes); 10 A. calidoustus, one A. pseudodeflectus,
University, Ankara, Turkey                                                      one A. insuetus (section Usti).
                                                                                Results: Using our database, correct identification was obtained for
Since mortality is higher with delayed treatment (more than 48 h) in            126 of 128 isolates (98,4%) including 69 of 71 (99%) from section
systemic Candida infections, early diagnosis is vitally important. The          Fumigati, 14 of 14 (100%) from Flavi, 12 of 12 (100%) from Nigri, 17
gold standard for the diagnosis of candidemia is a positive blood culture.      of 17 (94%) from Nidulantes, and 12 of 12 (100%) from Usti.
Despite the availability of improved detection systems, time is still           Conclusion: These data demonstrate that MALDI-TOF-MS is a
required to obatin a positive result. This study is performed to observe        powerful and promising tool to discriminate clinically relevant intra-
the time to detect positivity in the blood cultures in which Candida spp.       section species of Aspergillus. As MALDI-TOF fingerprint is species-
were isolated. The retrospective analysis of records of blood cultures          specific, this technology could become a powerful tool for the
were done using Epi-Center (BD Diagnostics). The time of blood culture          description of new species within sections.
(BACTEC Plus + Aerobic/F) bottles loaded into the BACTEC 9240 (BD
Diagnostics) systems and the time of positive alarm were recorded. All of
the bottles were incubated for 5 days. The mean duration of incubation
until positivity was calculated for both all Candida spp. and for different
species individually. The isolation of the microorganisms were done
according to the standard microbiological procedures and identification




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                        49
Poster Presentations



P060                                                                                CHROMagar, morphology at corn meal agar and assimilation pattern
MycArray Yeast ID - A Novel Assay for Identifying Candida                           (ID32C), were tested by PCR-RFLP and PNA-FISH.
Species                                                                             Results: The three species have nearly the same size of 26SrDNA
D.S. Tuckwell1, S. Cui1, D. Ireland1, A. Moody1 and C. B. Moore2                    (about 500 base pair (bp) by our primer) and ITS2 (about 430 bp), but
1
 Myconostica Ltd, Manchester, UK, 2Wythenshawe Hospital,                            both C. nivariensis and C. bracarensis can be differentiated from Candida
                                                                                    glabrata by sizing of ITS1 (about 400 bp for the first two species and
Manchester, UK
                                                                                    490 bp for latter). RFLP with the restriction enzyme TatI allowed us to
                                                                                    easily differentiate the three species from each other. The RFLP
Objectives: It is recognised that patient mortality from fungal                     fragments were about 280, 180 and 50 base pair for C. glabrata, 225,
infections such as candidaemia can be reduced by early treatment.                   200 and 80 base pair for C. nivariensis and 280 and 220 base pair for
However, choice of antifungal may often be influenced by the species of              C. bracarensis. The results were confirmed by sequencing and PNA-
fungus causing the infection. Thus there is a need for a rapid and                  FISH. One hundred and thirty-three yeasts strains isolated from Danish
accurate means of identifying fungal species from patient samples, to               patients with candidemia which already identified by phenotypical and
inform treatment.                                                                   physiological methods as C. glabrata were screened by ITS-PCR-RFLP
Methods: The ‘MycArray Yeast ID’kit, can detect 18 Candida and                      and PNA-FISH methods, none were C. nivariensis or C. bracarensis.
yeast species [C. albicans, C. dubliniensis, C. famata (Debaryomyces                Conclusion: We recommend PCR-RFLP of ITS1-5.8S rDNA-TS2
hansenii), C. glabrata, C. guilliermondii, C. kefyr (Kluyveromyces                  region to differentiate the species within to Candida glabrata group.
marxianus), C. krusei (Issatchenkia orientalis), C. metapsilosis, C.                C. bracarensis and C. nivariensis are rare among Danish C. glabrata
orthopsilosis, C. parapsilosis, C. pelliculosa (Pichia anomala), C. rugosa,         isolates blood isolates.
C. tropicalis, C. utilis, Saccharomyces sensu stricto, Histoplasma
capsulatum, Cryptococcus neoformans, Rhodotorula mucilaginosa]
from blood culture or culture plates. For most species multiple probes
are present on the array covering observed intra-species genetic
variation and ensuring sensitivity. The bound products are visualized
                                                                                    P062
by a colourimetric assay, and the assay can be completed in under 4 h.              Multiplexed molecular detection of Aspergillus fumigatus
Results: PCR and hybridization conditions were established using                    from BAL fluid in a guinea pig model of invasive
multiple isolates of each species. The array was then further tested and            aspergillosis
optimised using 20 clinical isolates each of the five major Candida                  L.K. Najvar1, R. Bocanegra1, R. Janeczko2, F. Merante2, P. Pitsakis2,
species: C. albicans, C. glabrata, C. krusei, C. parapsilosis, and C. tropicalis,   D. Himsworth2, W. R. Kirkpatrick1, N. P. Wiederhold1 and
using colonies picked from agar plates. Conditions were established                 T. F. Patterson1
                                                                                    1
which led to the successful identification of approximately 95% of                    University TX Health Science Center @ San Antonio, San Antonio,
isolates. In addition, one C. parapsilosis isolate was further classified as         TX, USA, 2Luminex Molecular Diagnostics, Toronto, Canada
C. metapsilosis using the array. The sensitivity and specificity of the
array was subsequently tested using spiked blood cultures, using the
                                                                                    Objectives: Invasive aspergillosis is a leading cause of morbidity and
five main Candida species and the performance was comparable to
                                                                                    mortality in immunocompromised patients. Early diagnosis of invasive
culture plates. Preliminary studies indicated that mixed cultures can be
                                                                                    aspergillosis in these patients can improve outcomes when coupled
successfully identified and the technique can be routinely applied to
                                                                                    with appropriate therapy.
clinical samples where yeasts have been seen by Gram stain.
                                                                                    Methods: We examined bronchoalveolar lavage fluid (BAL) in a
Conclusion: MycArray Yeast ID is able to identify yeast species from                standardized guinea pig model of invasive aspergillosis as a means of
colonies on agar plates and blood cultures with a rapid turnaround.
                                                                                    detecting early signal of infection using an enhanced PCR methodol-
This will assist in the clinical identification of yeasts and the
                                                                                    ogy. Male Hartley Guinea pigs were immunosuppressed with cortisone
prescription of appropriate anti-fungal therapy.                                    acetate and cyclophosphamide 2 days prior to and 3 days post
                                                                                    infection. The animals were challenged with 108 conidia of Aspergillus
                                                                                    fumigatus AF293 in an acrylic inhalation chamber. BAL samples were
                                                                                    obtained from anaesthetized guinea pigs at days 0, 3, 5, and 7 post
P061                                                                                infection prior to termination. CFU from lung homogenates were
Differentiating of Candida glabrata, C. bracarensis and                             obtained at the same time points for comparison. One milliliter BAL
C. nivariensis based on fragment length polymorphism of                             fluid was mixed with 105 cells ml-1 Tremella, and was beaten twice for
ITS1-ITS2 and restriction fragment length polymorphism                              30 s with 450 mg 1 mm glass beads prior to a 25-plex multiplex hot
(RFLP) of 26SrDNA(D1D2) regions                                                     start PCR including internal controls and run controls. Fluorescence
H. Mirhendi1 and M. C. Arendrup2                                                    signal of the PCR product was expressed as mean fluorescence units
1
 Tehran University of Medical Sciences, Tehran, Iran, 2SSI,                         (mfi). Negatives by the assay showed < 150 mfi and positive assays
Copenhagen, Denmark                                                                 showed > 300 mfi.
                                                                                    Results: PCR of the controls showed a low level, non-specific
                                                                                    detection of signal. Samples containing either Tremella or Aspergillus
Objectives: To evaluate different methods for the identification and                 AF293 showed an approximate 100-fold signal increase over their
discrimination of C. glabrata, C. bracarensis and C. nivariensis.
Furthermore to investigate the prevalence of C. bracarensis and
C. nivariensis among Danish blood isolates of C. glabrata. The recently
described fungal species Candida nivariensis and C. bracarensis differ
somewhat from each other and from other known species C. glabrata.
However, simple and reliable identification methods are still needed to
correctly identify these pathogenic yeasts in clinical specimens.
Materials and methods: Nine reference strains (C. nivariensis CBS
9904, CBS 10161, CBS 9903, CBS 10154 and CBS 9985) were
included to established and evaluate the following molecular methods
fragment length polymorphism and restriction fragment length
polymorphism (RFLP) in internal transcribed spacer 1 (ITS1), ITS2
and 26SrDNA(D1/D2) regions in rDNA. The results were evaluated in
comparison with sequencing and peptide nucleic acid- fluorescent in
situ hybridization (PNA-FISH). Subsequently, 133 Danish blood
isolates, all had been identified as C. glabrata using colony-colour at




                                                                                                                                      Ó 2009 The Authors
50                                                                       Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                 Poster Presentations



respective mock controls. Aspergillus CFU from BAL samples on day            P064
zero, taken at 1 h post-infection indicated consistent infection had         Deep candidiasis and Intravenous Drug addiction; report of
occurred, which was substantiated by PCR data. CFU data from BAL             2 cases
taken over days three, five and seven showed a uniform, steady                E. Justinien1, Y. El Samad2, C. Damiani1, A. Smail3, S. Sid Idris3,
infection, which compared favorably to the matched PCR results for the
                                                                             J. Sudzinski4, C. Da costa1, S. Milazzo4, J.-L. Schmit2 and
same time frame, as shown.
                                                                             T. Chouaki1
Conclusions: Multiplexed PCR of BAL samples from our guinea pig              1
model showed rapid, specific detection of Aspergillus conidia at day
                                                                              Medical Mycology, 2Infectious and tropical diseases, 3Internal
zero, and detected hyphal forms at later time points. The multiplexed        Medicine, 4Ophthalmology, CHU Amiens (France)
PCR methodology may be useful in early detection of invasive
aspergillosis in a clinical setting.                                         The deep localizations are exceptional at the time of the systemic
                                                                             candidiasis,. They occur 2 to 3 months after the septicaemia. The
                                                                             Intravenous Drug users constitute the main target and the contamina-
                                                                             tion makes itself by the yeasts of the oral flora at the time of the
P063                                                                         preparation of the injection.
                                                                                 Mr. L. aged 43 years, IV drug abuse treated by SubutexÒ and the
Misidentification of the emerging pathogenic yeast species
                                                                             patient’s history included right ankle’s fracture having justified the
Candida nivariensis as Zygosaccharomyces sp.
                                                                             pose of osteosynthesis material, consulted for right ankle arthritis and
F. Grenouillet1, A. Richelet1, E. Scherer1, A. P. Bellanger1,                myodesopsia of the left eye. The puncture fluid from the joint and a
J. B. Murat1, F. Poncet2 and L. Millon1                                      blood culture revealed a numerous strains of Candida albicans. The
1
 CHU Jean Minjoz, Besancon, France, 2Universite de ´                         ophtalmologic examination showed a decrease of the visual acuteness
               ´,
Franche-Comte IFR 133, Besancon, France                                      (6/10), a previous uveitis associated to a hyalitis. Secondarily, he
                                                                             presented a inguinal right pain with effusion’s joint of the hip, whose
Objectives: Development of nucleic acid-based techniques leds to             analysis showed the presence of yeasts to the direct examination.
description of previously unrecognized ‘cryptic’species in medical           Evolution was favourable with an antifungal therapy (Amphotericine B
mycology. Candida nivariensis, a yeast species closely related to Candida    in eyewash and Fluconazole 600mg/jr during 3 months) and a
glabrata with multidrug resistance to antifungal agents, were described      reduction of the fungal inoculums by washing of the two joints and
in 2005. This species yielded white colonies on CHROMagar’ medium.           ablation of pins. A vitrectomy of the left eye was necessary because of
As its identification requires molecular techniques, we retrospectively       the intervening of a retina detachment.
analyzed yeast isolates showing poor assimilation of carbohydrates,              Mr. D… 29 years, IV abuse teated by SubutexÒ, was referred to us
and identified as Zygosaccharomyces sp. by phenotypic methods.                for loss of vision acuity in the left eye back pain not relieved by NSAIDS
Methods: We performed a 5-year retrospective study (April 2004 -             leading and the corticotherapy. Because of the persistence of the pain,
April 2009) including clinical isolates identified as Zygosaccharomyces       MRI was performed and this demonstrated infectious spondylodiscitis
sp. using ID32 auxanogram (Bio Merieux, Marcy l’Etoile, France).             of two disc spaces (T8-T9 & T9-T10) without epiduritis or neurological
Moreover, atypical white C. glabrata isolates on CHROMagar’ medium           lesions, associated with extensive aseptic osteonecrosis of the femoral
(Becton Dickinson, Le Pont de Claix, France) were also included since        heads undoubtedly worsened by the corticosteroids.
August 2005 (date of first C. nivariensis description). Morphology of             The funduscopic examination showed a vast subretinal focus
colonies on CHROMagar’ medium was assessed after 48 h at 30 °C and           occupying the whole posterior pole associated with uveitis.
37 °C. Carbohydrate assimilation profile using ID32 strips was also re-           Direct examination of the puncture fluid from the vitreous body
assessed. Isolates yielding white colonies at the two temperatures were      demonstrated numerous yeasts and numerous Candida albicans colonies
further identified using a modified C. nivariensis-specific PCR and             were isolated after culture. Evaluation of the in vitro sensitivity by Etest
sequencing of D1/D2 region of large subunit rDNA.                            methods showed that the strain was sensitive to azole derivatives, 5
Results: Fifty-four isolates were reanalyzed. Twenty out of them did         fluorocytosine and caspofungin (confirmed by the liquid medium
not yield white colonies on CHROMagar’ medium; none of them gave             method, Eucast Paris Pasteur Institute). Control examination after 5
positive C. nivariensis specific-PCR and they were not assessed by            days of treatment showed a clearing of the vitreous body, a regression
sequencing. The 34 remaining isolates presented with white colonies          of the inflammation with, however, the persistence of a whitish focus in
on CHROMagar’ medium. Twenty-two isolates out of these 34,                   the upper pole. The vision of the left eye was limited to CFV (count-
originating from 12 different patients, were identified as C. nivariensis     finger vision) at 50 cm.
by species-specific PCR and confirmed by sequencing. Only one C.                   TriflucanÒ was continued during 6 months by the oral route.
nivariensis isolate was able to assimilate trehalose, showing assimila-          These two atypical observations show us the diversity in the clinical
tion profile identical to C. glabrata, whereas all except one had the         presentation of the heroin addict syndrome. The hold in charge must
ability to assimilate only glucose. One strain was isolated from deep site   associate an antifungal therapy and a reduction of the fungal
(peritoneal fluid) whereas the others originated from mucosa. Among           inoculums. The choice of antifungal must hold account of the
yeast isolates presenting with white colonies and assimilating only a        pharmacokinetics properties of the antimycotic and the existence of
few carbohydrates, other identified species were mainly Candida               fungicidal activity. Theses localizations must be systematically
bracarensis (three isolates, originating from two patients) and Kazachs-     researched especially at the drug addicts under SubutexÒ because of
tania bovina (five isolates, originating from three patients).                risk of the intravenous injection of crushed and diluted Subutex tablets.
Conclusions: Candida nivariensis is underidentified in laboratory
routine. Most isolates were unable to assimilate trehalose and were
misidentified as Zygosaccharomyces sp. Our study underscore the utility
of molecular techniques as a reference adjunct to conventional               P065
methods of yeast identification, especially for identification of clinically   Bench to bedside: development and implementation of a
important emerging pathogenic fungi. Species-specific PCR should be           clinical protocol for the early molecular detection for the
considered for rapid diagnosis of C. nivariensis among yeast isolates        improved diagnosis of invasive pulmonary aspergillosis and
assimilating only glucose.                                                   zygomycosis
                                                                             T.J. Walsh, V. Pyrgos, M. Kasai, S. M. Harrington, W. W. Hope,
                                                                             R. Wubneh, R. Petraitiene, V. Petraitis, L. Greene, T. Aghamolla,
                                                                             A. F. Suffredini, A. S. Wayne, J. Gea-Banacloche, S. M. Holland,
                                                                             H. L. Malech, R. Childs, G. Fahle, M. Kemp, Y. Shea and
                                                                             P. R. Murray
                                                                             National Cancer Institute and National Institutes of Health,
                                                                             Bethesda, MD, USA




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                     51
Poster Presentations



Invasive fungal infections are an important cause of infectious                fluconazole was only given in five patients for a total time of 65 days.
morbidity and mortality in immunocompromised patients with cancer,             After implementation of the antifungal restriction policy, the overall
hematopoietic stem cell transplantation and aplastic anemia. Amongst           use of empiric antifungal treatment was significantly reduced in the
the more lethal of these infections are invasive pulmonary aspergillosis       ICU population (P = 0.004), and fluconazole was administered as
and zygomycosis. Diagnosis remains difficult for these infections, as           initial antifungal treatment in the majority of patients (27 out of 107
clinical symptoms are non-specific, culture of respiratory and blood            patients for a total time of 451 days), followed by caspofungin in seven
samples are often negative and radiologic findings are only suggestive.         patients for a total time of 131 days. In the second study period
The Immunocompromised Host Section has developed and validated, in             candidemia due to Candida albicans in four patients and Candida
vitro and in vivo, a series of sensitive and highly specific qPCR assays for    lusitaniae in one patient was detected in 4.7% of the ICU patients and
the detection of invasive pulmonary aspergillosis and zygomycosis.             the overall mortality rate was 20.6%. Costs of antifungals were reduced
Following development of the light cycler PCR systems, including               to 50% after implementation of the restriction program.
sensitivity and specificity for detection of Aspergillus fumigatus and the      Conclusion: Similar mortality rates were found in the cardiotho-
key pathogens causing zygomycosis (Rhizopus oryzae, Rhizopus mi-               racic ICU population before and after restriction of systemic antifungal
crosporus, and Mucor spp.), a series of studies were conducted in              treatment. Fluconazole was still effective as early antifungal empiric
clinically applicable animal models of pulmonary aspergillosis and             and preemptive treatment in the ICU population because Candida
pulmonary zygomycosis. These studies showed that the qPCR assays               albicans was the predominant species in candidemia and superficial
for detection of Aspergillus and Zygomycetes were more sensitive than          sites.
culture of bronchoalveolar lavage fluid and correlated with tissue
burden in the lungs. The qPCR system was the first to detect circulating
biomarkers for pulmonary zygomycosis. This new diagnostic system
represents an important clinical opportunity for early detection of            P067
zygomycosis in its earlier stages. In parallel with development of these       Pulmonary lesions as first computed-tomography
molecular diagnostic systems, we have also developed an experimental           presentation of invasive candidiasis in neutropenic patients
foundation for detection of plasma galactomannan and (1 fi 3)-b-D-              F. Tissot, F. L. Lamoth, S. S. Schmidt, L. S. Senn, V. E. Erard,
glucan in both serum and bronchoalveolar lavage (BAL) fluid. These              J. B. Bille, B. D. Duvoisin, T. C. Calandra and O. M. Marchetti
markers in serum of early clinical studies have, correlated well with          Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne,
early detection and therapeutic response. The more recent data                 Switzerland
identifying these markers in BAL fluid further increased sensitivity.
Instrumental to proceeding from bench-to-bedside, has been establish-
ing validation between the Immunocompromised Host Section’s                    Objectives: Whereas pulmonary lesions have been described in
research and laboratory procedures and the CLIA certified procedures            neutropenic patients with invasive aspergillosis (IA), invasive candidi-
in the clinical microbiology department of laboratory medicine.                asis (IC) is associated with typical hepatosplenic CT features detected
Proceeding from ‘Bench to Bedside’has been a multistep process                 after recovery from neutropenia. In contrast, pulmonary manifesta-
including initial design of the assays, in vitro and in vivo validation of     tions of IC are not well defined. The goal of the present study was to
the assays and technological transfer of laboratory-developed method-          assess the CT presentation of IC pulmonary lesions in neutropenic
ologies to a CLIA-certified clinical microbiology laboratory. This              patients.
process has culminated in the design, development and implementa-              Methods: Twenty-nine neutropenic patients with possible, probable
tion of an NIH IRB-approved Clinical Center protocol with the ultimate         or proven IC or IA according to 2008 EORTC-MSG criteria were
objective of bringing these technological advances for earlier and more        retrospectively studied. CT findings, size and number of lesions, as well
accurate detection of invasive pulmonary fungal infections in immu-            as timing of appearance in IC and IA were compared.
nocompromised patients.                                                        Results: Patients characteristics were: median age 58 years (range
                                                                               28–77), males/females 76%/24%, acute myeloid/lymphoblastic leu-
                                                                               kemia 96.5%/3.5%, median duration of neutropenia 26 days (12–
                                                                               71). Invasive fungal infections included 15 IC (three proven, seven
                                                                               probable, five possible), 12 IA (five proven, seven probable) and two
P066                                                                           mixed IC/IA. Median number of CT per patient was 3 (1–6). Median
Prudent use of antifungals and incidence of candidemia and                     time between start of fever and first CT was 2 days (0–31). In follow-
outcome at a cardiothoracic intensive care unit                                up, the median interval between CTs was 10 days (4–83). Number
C.H.R. Kratzer, A. Lassnigg, S. Tobudic, W. Graninger and                      and time sequence of CTs were similar for IC and IA. CT findings of IC
E. Presterl                                                                    and IA are summarized in the Table.
Medical University of Vienna, Wien, Austria

Objectives: In recent years echinocandines were increasingly used
for empiric antifungal therapy in intensive care patients. However to
reduce costs, the prescription of antifungal agents had to be authorized
by infectious diseases specialists in the hospital. To compare the effect
of antifungal restriction on the mortality rate and incidence of
candidemia, a prospective study was performed at the cardiothoracic
intensive care unit (ICU).
Methods: All patients admitted at the cardiothoracic ICU between
December 2006 and 2008 for at least 4 days were enrolled. Before the
25th of October 2007 the choice of any antifungal treatment was left
to the discretion of the treating physicians at the cardiothoracic ICU.
Thereafter the use of systemic antifungal treatment except for
fluconazole was restricted to the guidance by a specialist for infectious       Conclusions: In invasive candidiasis pulmonary signs are as fre-
diseases. The outcome of the ICU patients and the incidence of                 quent as and appear significantly earlier than hepatosplenic lesions,
candidemia were analyzed.                                                      before recovery from neutropenia. Major signs classically associated
Results: In the first study period 23 (27.7%) and 4 (4.8%) out of 83            with aspergillosis are also observed in one fourth of patients with
patients died or developed candidemia caused by Candida albicans in two        candidiasis. Nodules are the most common pulmonary findings in
patients and Candida parapsilosis in three patients during admittance at       candidiasis: smaller size and higher number differentiate lesions from
the ICU. Caspofungin was administered as predominant antifungal                those of aspergillosis. Lung CT may thus contribute to the early
treatment in 42 patients for a total time of 669 days, whereas                 diagnosis of invasive candidiasis.




                                                                                                                                 Ó 2009 The Authors
52                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                        Poster Presentations



P068                                                                               processing area so that to elucidate allergenic isolates, gardens, farms
Evaluation of nested-PCR and real-time PCR assays for the                          and processing houses were samplified by sattle plates and isolated
diagnosis of candidemia                                                            species were conducted conventional mycological laboratory rules.
K. Mohamed, H. Sellami, A. Sellami, S. Neji, F. Cheikhrouhou,                      Amongst totally more than 2240 mould colonies involving many
                                                                                   species, randomly, practiced for conventional taxonomic and proteo-
F. Makni and A. Ayadi
                                                                                   mic laboratory examinations. Finaly, some fully identified species;
HU Habib Bourguiba Sfax, Sfax, Tunisia                                             Acremonium spp., A. butryi, A. strictum, Alternaria spp., Al. alternaria, Al.
                                                                                   alternate, Cladosporium spp., C. herbarum, C. macrocarpum, C. cladospo-
PCR assays have a very low theoretical detection threshold and are                 rioides, Paecilomyces spp., Pa. varioti, Phialophora spp., P. fastigiata,
therefore advocated for the diagnosis of fungemia. However, their                  Scopulariopsis spp., S. brevicaulis, S. fusca, Trichoderma spp., T. roseum-
effectiveness in this setting remains to be assessed. This study compared          detected fairly at first time report for Iran and so the all for such
real-time PCR (Can-G) and nested-PCR assays with blood culture for                 ecological niche mycobioms responsible for cultivation yards and food
the diagnosis of Candida spp. blood stream infections.                             processing areas of the provinces.Of isolates many are in concern for
    A total of 200 clinical blood sample specimens obtained from 110               food microbiology, some are in attention for a variety of matters
patients at risk to develop systemic fungal infection hospitalized in the          spoilage and deterioration, any may play a role in consumer hazardus
University Hospital of Sfax (Tunisia) were submitted to culture, nested-           and infections in animals, man or plants., At last the prepared fungi
PCR and real-time PCR. Blood culture was positive in 36 patients.                  profiles are the greatest standard whole mycobiom patterns charac-
When compared to culture, the Can-G assay (81% sensitivity, 96%                    terization for a variety and a large number genera and the number for
specificity) performed better than the nested-PCR assay (86%                        every species in the state or could be in the Caspian sea region to date,
sensitivity, 54% specificity).                                                      in our concerns.
Conclusion: The real-time PCR assay, which avoids both contam-
ination hazard with amplicons that cause false positive results and the
use of time-consuming post PCR steps, appears more suitable than the
nested-PCR assay for the laboratory diagnosis of yeast blood stream                P073
infections. In this study, real-time PCR did not enhance the sensitivity
                                                                                   A Report On Uncommon And Rare Genera – Species Of
of the diagnosis of Candida spp. blood stream infection when compared
to the conventional blood culture; however, it might lead to earlier
                                                                                   Aerial Mycoflora From Iranian Northern States(II); Some
implementation of an adequately targeted antifungal treatment.                     New Allied For Iranian Caspian Region Fungi
                                                                                   A.C. Nosrati
                                                                                   Islamic Azad University (I.A.U), Lahijan, Iran

P071                                                                               Respecting to public health importance of fungal hazards and to
Isolation and identification of Aspergillus species from tea                        determine aerial pollution of the Iranian cultivation yards and
gardens air in the north of Iran; the first report of some new                      processing area so that to elucidate allergenic isolates, gardens, farms
Aspergillus species for Iran                                                       and processing houses were samplified by sattle plates and isolated
A.R.A.S.H. Chaichi Nosrati                                                         species were conducted conventional mycological laboratory rules.
Islamic Azad University, Lahijan, Iran                                             Amongst totally more than 2240 mould colonies involving many
                                                                                   species, randomly, practiced for conventional taxonomic and proteo-
                                                                                   mic laboratory examinations. Finaly, some fully identified species;
Respecting to public health importance of fungal hazards as food borns             Botrytis spp., B. aclada, B. cinerea, Chaetomium spp., C. bglobosum,
and to determine aerial pollution of the Iranian Tea (Camellia sinesis)            Chrysonilia spp., Ch. crassa, Ch. sitophila, Geomycess spp., Gm. pannorum,
cultivation and processing area so that to find allergenic Aspergillus              Geotrichum spp., Gt. candidum, Memnoniella spp., Me. echinata, Monascus
isolates, Tea gardens were samplified by sattle plates. Amongst totally             spp., Mo. ruber, Phoma spp., Ph. glumerata, Ph. macrostoma, Stachybotrys
more than 600 mould colonies involving by 300 Aspergilli, 150                      spp., St. Chartarum, Wallemia spp., W. Sebi, Xeromyces spp., X. bisporus,
isolates, randomly, practiced for conventional taxonomic laboratory                Syncephalastrum spp., Sy. racemosum, Conninghamella spp., Co. bertholle-
examinations due to ICPA and CBS rules. Finaly, 24 fully identified                 tia, Aureobasidium spp., Au. pullulans detected fairly at first time report
species; A. fumigatus, S. ornata, A. unguis, A. terreus, A. niveus, A. wentii,     for Iran and so the all for such ecological niche mycobioms responsible
A. flavus, A. sojae, A. parasiticus, A. alliaceus, A. niger, A. awamori, A.         for cultivation yards and food processing areas of the provinces.Of
carbonarius, A. foetidus, A. ochraceus, A. ostianus, A. melleus, A. candidus,      isolates many are in concern for food microbiology, some are in
A. penicillioides, A. ustus, A. versicolor, A. oryzae, A. nidulans, A. japonicus   attention for a variety of matters spoilage and deterioration, any may
and VII isolates suspected as Aspergillus species reflecting to the                 play a role in consumer hazardus and infections in animals, man or
prospective area were obtaind including 11 isolate as the first reports;            plants., At last the prepared fungi profiles are the greatest standard
S. ornate (4), A. Wentii (2), A. Sojae (4), A. Awamori (3), A. carbonarius         whole mycobiom patterns characterization for a variety and a large
(3), A. Foetidus (1), A. ostianus (5), A. Penicillioides (7), A. ustus (4),        number genera and the number for every species in the state or could
A. unguis (6), A. Japonicus (5) for Iran and so the all for such ecological        be in the Caspian sea region to date, in our concerns.
niche mycobioms responsible for Tea plant (Camellia sinesis) cultiva-
tion and its processing areas of the northern state’s provinces and even
the Caspian sea area.We recommend the area for more common and
fastidious aspergilli to be notified as a risk factor.                              P074
                                                                                   A qualitative investigation on tea garden air fungal
                                                                                   pollution in the north of Iran, gilan province western region
                                                                                   A.C. Nosrati
P072                                                                               Islamic Azad University (I.A.U), Lahijan, Iran
A report on identification of uncommon and rare
genera – species as aerial Mycoflora of tea gardens and tea                         Fungi are obiquitous and infact account for at least 25% of the earth’s
processing houses air in the north of Iran (I); some new                           biomass so abundant in many area or spaces serving optimum
allied for Iran and Caspian region fungi                                           temprature and humidity. Fungi have long been know to affect human
A.C. Nosrati                                                                       life status in various efforts including soil habitation, plant/animal
Islamic Azad University (I.A.U), Lahijan, Iran                                     parasitism and food / drink decaying, with possible concomitant
                                                                                   production of mycotoxins, tissue infections and immune stimulation or
                                                                                   combat. Ecologic microbiota of fungi can grow in initial area even the
Respecting to public health importance of fungal hazards and to                    region may play more improtant role than climatic forces such as
determine aerial pollution of the Iranian cultivation yards and




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                           53
Poster Presentations



seasonal fluctuations on fungal flora. It must be pointed out that             was seasonal with one peak in summer and one in autumn (Figure);
outdoor fungi concentrations are in relation to indoor counts but in         the level of this contamination in each ward was influenced by the
different genera so the taxa identified is much more important than the       meteorology: a high outdoor temperature increased the FF load in all
absolute number of colony – forming units. Occupational and                  three wards. However, outdoor factors more readily explain the
environmental health professionals are confronted with issues con-           variations of fungal load in hematology than in the conventional ward.
cerning bioaerosol harmness regarding investigation both indoor and
outdoor fungi in complaint and noncomplaint area. In this respect
totally 62 regional typical tea gardens dust bioaerosols were sampe-
lified and 1005 mold colonies were isolated due to driect microscopy
and culture – based inspective conventional mycologic methods,
during May to August 2005. Finaly 26 different genera of habitate
fungi were collected and confirmed from 194 conducted plates. Of
defined geographic location, this is the largest study of air borne
outdoor fungal species with rutine protocol to date. Related to
nouniformity of any specific guide lines measuring outdoor environ-
mental fungi and determine potentially outcoming deseases due to
exposure making interpretation of existing data difficult, air testing
methodology must be expanded and evaluated. To build a model to
clarify determinants of airborne fungal populations and health
assessment in public area within a defined geographic location and
labor, additional studies are needed to document any suspected
relations prospectivly as well as retrospectivly.



P075
Haematology wards: influence of internal and outdoor
factors on filamentous fungal flora in the environment
M.P. Brenier-Pinchart1, B. Lebau1, J. L. Quesada1, M. R. Mallaret1,
J. L. Borel2, A. Mollard1, F. Garban1, J. P. Brion1, L. Molina1,
J. L. Bosson1, A. Thiebaut-Bertrand1, R. Grillot1 and H. Pelloux1
1                                                                            Conclusion: In a conventional ward, the level of FF flora is
 Centre Hospitalier Universitaire (CHU), Grenoble, France,
2                                                                            influenced by both internal and outdoor factors. The specific preventive
           ´
 Universite J Fourier, Grenoble, France
                                                                             measures, already performed in haematology wards, participate
                                                                             significantly to decreasing the fungal load and in the control of the
A significant relationship between the degree of fungal contamination         internal factors. This study draws attention to the utility of partial air
in haematology wards and the incidence of Invasive Nosocomial                control associated with specific preventive measures to obtain low
Aspergillosis has been demonstrated and, also, a causal effect between       levels of fungal contamination. However, outdoor factors cannot be
the environmental fungal contamination and INA in non-epidemic               controlled by these measures, emphasizing the importance of HEPA
situations (Alberti et al, 2001). However, the factors involved in           filtration and LAF in high-risk wards.
environmental fungal contamination are not totally known.
Objectives: The aim of our study was to evaluate which factors,
both internal (administrative figures for activity, parameters of
behavioral practices and cleaning work) and outdoor factors (meteo-
rological parameters and outdoor fungal spores) could influence the           P076
level of filamentous fungi (FF) in the environment of medical wards and       Environmental isolates of Cryptococcus neoformans in Saint
if preventive measures were effective enough to reduce environmental         Petersburg, Russia
fungal contamination.                                                        N.V. Vasilyeva, I. A. Bosak, T. S. Bogomolova and I. V. Vybornova
Methods: Three wards (with 85% opacimetric air filtration) were               Kashkin Research Institute of Medical Mycology SPb MAPE,
prospectively studied during 30 month: two haematology wards (WA &           St. Petersburg, Russia
WB) with patients at risk of IFFI and one infectious disease ward (WCC).
The general preventive measures differed from one ward to another. The
                                                                             Objective: To investigate natural sources of Cryptococcus neoformans
FF load was evaluated every 15 days: six surface samples were performed
                                                                             in Saint Petersburg and to characterize biological properties of the
in four rooms of each ward using countact plates (Merck, Germany). Air
                                                                             environmental isolates.
samples (1 m3) were collected using Air Ideal (bioMerieux, France) and
                                                      ´
                                                                             Methods: Isolation. Samples of pigeon droppings (picked in garrets
incubated at 27 °C during 7 days. Outdoor factors were the meteoro-
                                                                             of houses), soil, plant debris, contents of the intestine of dead urban
logical parameters (temperature, humidity, pluviometry, speed, direction
                                                                             wild birds (crows Corvus cornix, magpieses Pica pica, sparrows Passer
wind) and the number of fungi spores in the outer air (Burkard air spores
                                                                             domesticus, blue tits Parus major, bullfinches Pyrrhula pyrrhula),
sampler). Moreover, the internal factors were the presence or not of
                                                                             materials from mucous membranes of oral and nasal cavities of
agranulocytosis patient in the room, the administrative figures for
                                                                             domestic animals (cats, dogs) were cultured on Sabouraud agar
activity, the parameters of behavioral practices (cleaning work) and
                                                                             supplemented with chloramphenicol and gentamicin and incubated at
several descriptive characteristics reported at the moment of sampling.
                                                                             37 °C for 10 days. Identification of yeast colonies was based on
Results: Filamentous fungi were found in 3083/6224 samples, the              morphological and biochemical features (‘AuxacolorÒ2’test). Suscep-
surfaces being significantly less contaminated than air (P < 0.001).
                                                                             tibility of C. neoformans isolates to fluconazole and voriconazole was
The haematology wards with filamentous fungi preventive measures
                                                                             determined according to CLSI M44-A document. Virulence of C.
were significantly less contaminated than a conventional ward without
                                                                             neoformans isolates was studied on an animal model. Outbred mice
specific measures. The influence of internal factors was greater in the
                                                                             were inoculated intravenously with different doses of yeast cells and
conventional ward than in haematology wards: in the WA & WB, no
                                                                             observed for mortality during 28 days, then LD 50 of each strain was
correlation was found between administrative figures for activity and
                                                                             calculated. Urease, phenoloxidase and phospholipase activities of the
the intensity of FF flora, whereas in WC there was a positive correlation
                                                                             environmental C. neoformans isolates were studied by plate methods on
between the FF on surface and in air and the occupancy rate (P = 0.02
                                                                             Christensen’s urea agar, L-DOPA agar and egg-yolk agar accordingly.
and rho = 0.41). The variation of flora in the hospital environment
                                                                             Cell diameter and capsule size of yeast cells of each isolate were




                                                                                                                               Ó 2009 The Authors
54                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                    Poster Presentations



measured under the light microscope. Ability of C. neoformans                    the anatomical origin of the strains. Biofilm formation was higher in
environmental isolates to grow at elevated temperatures was also                 rough strains of C. parapsilosis.
determined.                                                                      Funding: Projects GIC07 123-IT-222-07 (Departamento de Educa-
Results: We have investigated 124 samples of pigeon droppings, 18                  ´                               ´
                                                                                 cion, Universidades e Investigacion, Gobierno Vasco), S-PE08UN35
samples of soil and plant debris, 63 samples of materials from the               (Saiotek 2008, Departamento de Industria, Comercio y Turismo,
intestine of dead birds and 47 samples from oral and nasal cavities of                                                                       ´n
                                                                                 Gobierno Vasco) and PI061895/2006 (Fondo de Investigacio Sani-
cats and dogs. C. neoformans isolates were obtained only from 4 (3.2%)                                                             ˜
                                                                                 taria del Ministerio de Sanidad y Consumo de Espana).
samples of pigeon droppings. Cultures of other natural materials were
negative for this yeast. All environmental isolates were susceptible to
fluconazole and voriconazole. Diameter of yeast cells of the C.
neoformans environmental isolates on Sabouraud agar ranged from                  P078
5.2 to 5.7 lm, capsule width in Indian ink preparation varied from 0.6
                                                                                 Molecular characterization of environmental Cryptococcus
to 0.8 lm. All four isolates grew on Sabouraud agar after incubation
for 3 days at 40 °C and failed to grow at 42 °C. Environmental isolates          isolates from Cuba
produced urease and melanin on corresponding media, the enzymatic                M.T. Illnait-Zaragozı1, G. F. Martınez-Machın1,
                                                                                                     ´             ´        ´
activity was more expressed at 37 °C in comparison with incubation at            C. M. Fernandez-Andreu1, M. R. Perurena-Lancha1, T. Boekhout2,
                                                                                             ´
28 °C. Phospholipase activity of the isolates after 3 days of incubation         J. F. Meis3 and C. H. Klaassen3
                                                                                 1
at 37 °C varied from Pz 0.54 to Pz 0.62. LD50 of the C. neoformans                Instituto Pedro Kouri, Havana, Cuba, 2CBS Fungal Biodiversity
environmental isolates ranged from 1 million to 10 millions of yeast             Centre, Utrecht, The Netherlands, 3Canisius Wilhelmina Hospital,
cells per mice, so virulence of the isolates was estimated as low.               Nijmegen, The Netherlands
Conclusions: (i) Frequency of C. neoformans isolation from pigeon
droppings in Saint Petersburg was 3.2%. (ii) Environmental isolates of           Background: The genus Cryptococcuscontains at least 34 species, but
C. neoformans were low virulent on an animal model.                              Cryptococcus neoformans complex has been associated most with human
                                                                                 and animal diseases. Within this complex, C. neoformans var. grubii and C.
                                                                                 gattii are most often found. Cryptococcusgrowth is associated with
P077                                                                             decaying wood and plants. We conducted an environmental survey for
Biodiversity, virulence factors and antifungal susceptibility                    Cryptococcuson various trees in Cuba.
of clinical isolates of Candida parapsilosis sensu lato                          Methods: One hundred and eighty seven Isolates were collected
                                                           ´
M. Ortega-Riveros, I. Miranda-Zapico, E. Eraso and G. Quindos                    from Ficus retusa (Indian Laurel tree), Termalia catappa (Indian Almond
                                                                                 tree), Casuarina equisetifolia (Casuarina tree) and Delonix regia
Universidad del Paı´s Vasco, Leioa, Spain
                                                                                 (Flamboyant tree) from Havana, Cuba. Initial selection of the isolates
                                                                                 involved growth on CAA medium. Further tests involved growth on
Candida parapsilosis is an increasing cause of invasive candidiasis.             CGB medium at 37 °C, urease production and characteristic pheno-
However, this species has been recently split in at least three different        types. All isolates were analyzed using molecular techniques. DNA was
species Candida parapsilosis sensu stricto, and the closely related Candida      isolated from freshly grown cultures by a MagNA Lyser/MagNA Pure
orthopsilosis, and Candida metapsilosis. Differences have been reported          protocol. AFLP analysis was performed using established procedures
among these species in antifungal susceptibility and virulence charac-           using restriction enzymes EcoRI and MseI. DNA sequence analysis was
teristics.                                                                       performed on the ITS1-5.8S-ITS2 region and the D1-D2 region using
Objectives: To study the biodiversity, virulence factors and antifun-            standard procedures.
gal susceptibility patterns in clinical isolates of Candida parapsilosis sensu   Results: In this collection, 21 different clusters of species were
lato.                                                                            recognized, the most prevalent species being C. heveanensis (33%). Only
Methods: Twenty-two clinical isolates randomly selected from our                 one isolate involved C. neoformans serotype A. No C. gattii isolates were
stock collection including 14 C. parapsilosis sensu stricto, five C.              recovered. No less than 53 unidentifiable isolates were found that
metapsilosis and three C. orthopsilosis were studied. The clinical origins       segregate into seven potentially novel cryptococcal species. None of the
of isolates were blood (12 isolates), oral mucosa (three isolates), vagina       isolates were obtained from Ficus retusa.
(three isolates) and other different specimens (four isolates). In addition,     Conclusion: CAA and CGB medium are poor selective media for C.
C. parapsilosis ATCC 90018 and ATCC 22019, C. metapsilosis ATCC                  neoformans and/or C. gattii from environmental sources. Numerous
96143 and ATCC 96144 and C. orthopsilosis ATCC 96139 and ATCC                    molecular and biochemical unidentifiable isolates are found when
96141 were included as reference strains. Phenotypic switching was               sampling environmental sources. Molecular analyses need to be
evaluated onto a Lee’s medium with phloxine B and only three                     applied to confirm identification of environmental isolates as such.
aminoacids (lysine, valine and alanine) agar, biofilm formation on                Further studies are necessary to identify the environmental origin of
polystyrene by a colorimetric method (tetrazolium salt reduction),               human Cryptococcus infections in Cuba.
proteinase and phospholipase production by a plate agar method and
antifungal susceptibility by Sensititre YeastOne 9 (Trek Diagnostics
Systems, USA).
Results: Only two strains of C. parapsilosis showed a phenotype
switching in the texture and morphology of colonies. Of them, one
remained morphological stable in successive subcultures. This strain,
                                                                                 P081
with smooth phenotype, produced a poor biofilm and showed a                       Occupational fungal contamination in the professionals of
decreased susceptibility to caspofungin (MIC 48 h = 8 lg ml-1). Five             gymnasiums with swimming pool
out of 14 C. parapsilosis (four with rough phenotype) were moderately            C.V. Viegas1, C. V. Alves2, E. Carolino3, L. Rosado2 and
producers of biofilm on polystyrene. The rest of C. parapsilosis produce a        C. S. Santos4
                                                                                 1
poor biofilm. Moreover, all isolates of C. metapsilosis and C. orthopsilosis       ESTeSL, Lisbon, Portugal, 2National Institute of Health Dr. Ricardo
were poor biofilm producers. Most isolates were susceptible to the all            Jorge, Lisbon, Portugal, 3Higher School of Health Technologies of
antifungal agents tested, but five isolates of C. parapsilosis (four with         Lisbon – Polytechnic Institute of Lisbon, Lisbon, Portugal, 4School
smooth phenotype) had a decreased susceptibility to anidulafungin                of Public Health – New University of Lisbon, Lisbon, Portugal
(MIC 48 h = 4 lg ml-1). However micafungin was active against all C.
parapsilosis isolates. Phospholipase and proteinase activities were not
                                                                                 Objectives: To describe the occupational fungal contamination
detected in any of the tested isolates.
                                                                                 phenomenon in the feet of professionals of gymnasiums with
Conclusions: The smooth phenotype of C. parapsilosis was less                    swimming pools.
susceptible in vitro to anidulafungin. Micafungin was active against
                                                                                 Methods: Two hundred and fifty-eight samples were collected from
C. parapsilosis. There was no relationship between virulence factors and
                                                                                 the feet of 124 professionals in order to asses the degree of fungal




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                       55
Poster Presentations



contamination. The samples were taken with a sterile scalpel in cases             61 cases (23.92%) in Surgical Wards (including General Surgery Units
where individuals had visible injuries, and with a swab where there               and Orthopedics) and 27 cases (10.6%) in adult ICU. Susceptibility data
were no macroscopically lesions were visible. Simultaneously, a grid              showed that all strains were sensitive to amphotericin B. The highest
with information on the injured part of the foot was filled out.                   resistance rates were observed to azoles, especially itraconazole, fluco-
Results: From the 124 professionals tested, 58 (47%) had visible                  nazole and ketoconazole. C. glabrata and C. tropicalis demonstrated the
injuries. Of those 24 (41.4%.) had injuries on the nails, 16 (27.6%) had          higher resistance rates to azoles among all Candida.
injuries in the interstices of the toes, and the remaining 18 (31%)
showed injuries in other locations of the feet. In 143 isolates, the
frequency of isolation for yeasts and fungi was 58.7% and 41.3%,
respectively. Yeasts were the most isolated in the 58 professionals with
visible injuries (41.4%), followed by dermatophytes (24.1%) and other
filamentous fungi (6.9%). There were also mixed infections (8.6%) and
negative results (19.0%) from the same individuals. Candida parapsilosis
and Rhodotorula sp. were yeasts most frequently isolated (20.2% for
each species), from dermatophytes Trichophyton rubrum was the most
frequently isolated (55.5%) and from other filamentous fungi besides
dermatophytes Penicillium sp. were the most frequent ones (15.6%).
There was significant associations (P < 0.05) between visible injury
and fungal species and between time of occupation and visible injury.
Conclusion: The prevalence of tinea pedis and onychomycosis was
similar to other international studies developed in athletes, swimmers,
marathoners and judo players. Physical activity enhances the trauma
of the nail, and probably is one of the justifications for the greater
frequency of injury in the nail. Studies have demonstrated the
importance of moisture for the penetration of fungi and yeasts in skin.           Conclusions: Candidemia is predominantly caused by C. albicans
The fact that the skin of athletes and sports professionals remain wet            (64%).The frequency of candidemia due to Candida non-albicans is
for long periods can cause damage in that area and facilitated the                quite high (36%). Parenteral alimentation and use of central venous
fungal penetration. Prevention of cutaneous mycoses is crucial,                   catheters at low-birth infants seems to be associated with high
especially because in some occupational groups, such as professionals             incidence of C. parapsilosis in Neonatal ICU. C. glabrata is the third
of gymnasiums with swimming pool, the dermatomycosis and other                    more often Candida isolated and its identification is clinically important
mycoses can be considered work-related illnesses. Occupational                    due to high resistance to azoles. All Candida isolates remain susceptible
exposure to fungi may hence be considered as risk factor for fungal               to amphotericin B, whereas, the highest degree of resistance was
infections.                                                                       observed to itraconazole, fluconazole and ketoconazole.


                                                                                  P083
P082                                                                              Fungal pathogens in the air at the Wroclaw Department of
Candidemia: retrospective analysis of eleven year                                 Dermatology, Venereology and Allergology
experience                                                                        R. Bialynicki-Birula1, E. Baran1, J. Szepietowski1, C. Lukaszuk2,
M. Christofidou, A. Spiliopoulou, S. Vamvacopoulou, C. Bartzavali,                 E. Krajewska-Kulak2, W. Kulak2, H. Rolka2 and E. Oksiejczuk3
L. Picoula, E. D. Anastassiou and M. Christofidou                                  1
                                                                                   Wroclaw Medical University, Wroclaw, Poland, 2Medical
University of Patras, Patras, Greece                                              University of Bialystok, Bialystok, Poland, 3Bialystok Technical
                                                                                  University, Hajnowka, Poland
Objectives: To investigate the isolation and distribution rate of
Candida spp. in blood cultures and to evaluate antifungal susceptibility
                                                                                  Objectives: Analysis of incidence of fungal pathogens in the air at
during an 11-year period (1998–2008) at a tertiary care hospital.
                                                                                  the Wroclaw Department of Dermatology, Venereology and Allergol-
Methods: Positive blood cultures (BacT/Alert, Organon Teknika)                    ogy, Medical University of Wroclaw, Poland. Materials and methods:
were examined microscopically directly for yeasts or pseudohyphae
                                                                                  Materials for the tests were: the air samples in front of the building, the
and subcultured on Sabouraud dextrose agar (Difco). Candida isolates
                                                                                  corridors, the library, the lecture hall, and the mycological laboratory.
were screened by germ tubes test and identified using API 20CAUX
                                                                                  The air pollution were determined using SAS SUPER 100. Humidity
(Biomerieux). Antifungal susceptibility was carried out by E-test (AB
                                                                                  and temperature were evaluated by a termohigrometr. Classification of
Biodisk) on RPMI – 2% glucose agar. MIC was evaluated according to
                                                                                  the isolated fungi was made with an accordance to the current
CLSI criteria for the following antifungal agents: amphotericin B (AM),
                                                                                  procedures.
5-fluorocytocin (FC), ketoconazole (KE), itraconazole (IT), fluconazole
                                                                                  Results: From the air were isolated: in the library – 69 colonies
(FL), voriconazole (VO), posaconazole (PO) and caspofungin (CF).
                                                                                  (mean CFU 138 ± 41.5), from the book-stands – 25 colonies (mean
According to European Organization for Research and Treatment of
                                                                                  CFU -125 ± 63.6), in the lecture hall – 119 colonies (mean CFU -
Cancer, an episode of candidaemia was defined as one or more positive
                                                                                  380 ± 98.8), in the mason room – 52 colonies (mean CFU -
blood cultures for Candida species isolated from patients with clinical
                                                                                  104 ± 21.9), in the mycological laboratory – 154 colonies (mean
signs of infection. Subsequent positive cultures from the same patient
                                                                                  CFU -513 ± 155.3). Temperature in the tested rooms ranged from
were defined as new episode, only if there was an interval of at least
                                                                                  24.5 °C (mason room) to 26.1 °C (library), humidity ranged from
12 weeks between the two episodes.
                                                                                  40.1% to 53.1%. Temperature outside of the building was 23.6 °C, and
Results: During the study period there were 255 candidemia cases. An              humidity 51.6%. Moulds Peniciullim citricum and Aspergillus niger and
increasing frequency of Candida bloodstream isolates during eleven-year
                                                                                  the yeasts Candida albicans were isolated more frequently.
analysis varying from 1.33% (eight cases) of all positive blood cultures in
                                                                                  Conclusions: The highest number of fungi colonies were isolated
1998 to 4.4% (47 cases) in 2008 was observed. All patients with fungemia
                                                                                  from the air sampled at the lecture hall and the mycological laboratory.
were immunocompromised. The causative species were: C. albicans 163
                                                                                  Moulds were the most common airborne fungi. Temperature and
strains (64%), C. parapsilosis 35 (13.7%) C. glabrata 25 (9.8%), C. tropicalis
                                                                                  huimidity in the tested rooms seems be a good conditions for the
19 (7.4%), other Candida spp 13 (5.1%). One hundred and six (106)
                                                                                  development of fungi.
candidemia cases (41.6%) were identified in Medical Wards (including
Internal Medicine Ward, Haematology-Oncology Unit and Transplanta-
tion Center), 61 cases (23.92%) in Neonatal Intensive Care Unit (NICU),




                                                                                                                                    Ó 2009 The Authors
56                                                                     Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                               Poster Presentations



P084                                                                         P085
Evaluation of oral fungus diversity from patients with                       The occurrence of the primary pathogenic yeast
Anorexia Nervosa and Bulimia Nervosa by culture and                          Cryptococcus gattii in Europe
molecular methods                                                            F. Hagen1, A. G. Burggraaf1, A. Kamermans1, J. Sweere1,
G.N. Back-Brito, A. J. Mota, S. S. Takamune, L.A.S. Bernardes,               K. Tintelnot2, D. Swinne3, F. Dromer4, R. Iatta5, M. T. Montagna5,
                                        ´
I. Balducci, E.F.G.B. Prado, T. A. Cordas, F. G. Nobrega and                 J. M. Torres-Rodriguez6, M. A. Viviani7, A. Velegraki8, M. F. Colom
C. Y. Koga-Ito                                                               Valiente9, M. Gari-Toussaint10 and T. Boekhout1
                                                                             1
   ˜o                                 ˜o     ´
Sa Paulo State University/UNESP, Sa Jose dos Campos – Sa     ˜o               CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Robert
Paulo State, Brazil                                                          Koch-Institut, Berlin, Germany, 3Institute of Public Health, Brussels,
                                                                             Belgium, 4Institut Pasteur, Paris, France, 5Universita degli Studi di
                                                                                                                                   `
Eating disorders (ED) as Anorexia Nervosa (AN) and Bulimia Nervosa           Bari, Bari, Italy, 6IMIM Autonomous University of Barcelona,
                                                                                                  7
(BN) can cause several systemic and oral alterations related to poor                                       `
                                                                             Barcelona, Spain, Universita degli Studi di Milano, Milan, Italy,
                                                                             8
nutrition and induced-vomiting, although, no previous studies on the          University of Athens, Athens, Greece, 9Universidad Miguel
oral microflora of these patients are available in the literature. In this    Herna `ndez, Alicante, Spain, 10Centre Hospitalier Universitaire,
way, the aim of this study was to evaluate fungal microflora in the oral      Nice, France
cavity of these patients by culture-dependent (CD) and culture-
independent (CI) methods. Fifty-six female and three male patients,          Cryptococcosis is caused by the basidiomycetous yeasts Cryptococcus
aged from 19 to 58 (median = 26 years), with eating disorders (32            gattii (serotype B and C) and C. neoformans (serotype A, D and AD).
anorexic and 27 bulimic) were included in the study. These patients          Infections with C. gattii occur almost only in immunocompetent
were under initial treatment at the Department and Institute of              individuals, while C. neoformans var. grubii and var. neoformans have a
                                                  ˜
Psychiatry, Faculty of Medicine, University of Sao Paulo. Control group      predilection for immunodeficient humans. Another major epidemio-
was constituted by 59 individuals, matched to the test group in relation     logical difference between both species is the apparent restriction of C.
to age (median = 26 years), gender and oral conditions. Patients with        gattii to tropical and sub-tropical regions, whereas both varieties of C.
diabetes mellitus or other systemic diseases, pregnant women, total          neoformans can be found worldwide. However, the distribution pattern
denture users and individuals under treatment with antibiotics/              of C. gattii has changed by an outbreak in the temperate climate of
antifungals/oral rinses during the last 45 days that preceded the            Vancouver Island (British Columbia, Canada). Recently, several case
sampling were excluded. Oral rinses and supragingival biofilm samples         reports were published which suggests that C. gattii is becoming more
were collected. Investigation by CD method was performed by plating          prevalent in the temperate climate of Europe as well. This prompted
oral rinses samples on Sabouraud dextrose agar with chloramphenicol,         us to set up an epidemiological study, in collaboration with the ECMM
for evaluation of prevalence and phenotypic identification. Species of        Cryptococcus and cryptococcosis workgroup, to investigate the occur-
                                   ´
yeast were identified by Biomerieux API systems (API 20 C Aux).               rence of C. gattii in Europe. Amplified Fragment Length Polymorphism
Identification of C. dubliniensis was confirmed by multiplex polymerase        (AFLP) analysis was carried to genotype the C. gattii isolates and the
chain reaction (PCR) with a universal primer for Candida genus and a         mating- and serotype were determined using C. gattii specific primers
pair of C. dubliniensis-specific primers was used. Results expressed in cfu   for both the mating-type a and a STE12 locus. Also, seven loci were
per millilitre were compared by ANOVA/Mann–Whitney test (5%). Five           (partly) sequenced, namely the capsule related gene CAP10, glycer-
oral samples and dental biofilm representative of each group of patients      aldehyde-3-phosphate dehydrogenase (GPD1), Intergenic Spacer
were selected for evaluation by CI method. Investigation CI method           (IGS1), laccase (LAC1), mannitol-1-phosphate dehydrogenase
was performed by ribotyping analysis by sequencing of D1/D2 region of        (MPD1), phospholipase B (PLB1), and translation elongation factor
28S rRNA. The region was amplified by PCR with universal primers,             1a (TEF1a). We have investigated 97 C. gattii isolates, from which 62
cloned and sequenced. About 1300 clones for ED group and 650 clones          were of clinical origin while 12 were isolated from the environment
for control group were analyzed. The sequences obtained with at least        (water, soil and trees) and 23 had a veterinary origin (birds, camel,
200 base-pairs were used to determine species identity matched to the        squirrel). Nine isolates showed phenotypic switching and harboured
GenBank database. More individuals from ED group were positive for           two phenotypic different colonies after pure culturing. Fifty-eight
yeast (74.6%) than to control group (47.45%). Candida genus yeasts           isolates were identified as genotype AFLP4/VGI, while the remaining
were detected in significantly higher number in the oral cavity of ED         isolates belongs to AFLP5/VGIII (n = 3), AFLP6/VGII (n = 26),
patients in relation to the controls (p-valor = 0.00001), and more           AFLP7/VGIV (n = 2) and AFLP8 (n = 6). Two isolates belonged to
species of Candida were identify in this group. C. albicans (total =         a novel genotype, AFLP10. The majority of isolates was mating-type
81.42%) was the prevalent specie in both groups, followed by                 a (n = 66), 19 isolates were mating-type a, and 5 isolates harboured
C. dubliniensis (total = 5.23%). Molecular method demonstrated more          both mating-types. From seven isolates, the mating-type could not be
diversity of genus and species for the groups studied. ED group had          determined. Fifteen mating-type a isolates fell into genotype AFLP4/
more different genus and species (n = 16) than control group (n = 1),        VGI, one in AFLP6/VGII and the remaining two isolates in AFLP10.
only seven species were common to both groups (Pichia guilliermondii,        Phylogenetic analyses, based on ten sequenced loci, confirmed the
C. albicans, C. parapsilosis, C. dubliniensis, C. glabrata, Issatchenkia     presence of five different haploid AFLP genotypes of C. gattii in
orientalis and Saccharomyces cerevisiae). It could be conclude, that ED      Europe. Most of the clinical cases were caused by isolates belonging to
group showed a higher prevalence of yeast and more Candida species           genotype AFLP4/VGI and AFLP6/VGII. It is possible that most of the
than control group. The investigation by the culture-independent             patients acquired the infection with C. gattii during their stay in
method revealed a higher fungal diversity, some of these uncultured,         (subtropical and tropical) regions outside Europe. However, infections
besides species of Candida in the groups studied.                            were also reported in patients who never travelled outside Europe.
                                                                             This indicates that C. gattii isolates of genotype AFLP4/VGI and
                                                                             AFLP6/VGII occur in the Mediterranean area.


                                                                             P086
                                                                             Invasive mold infections complicating acute falciparum
                                                                             malaria
                                                                             A.H. Groll1, J. Dabritz1, D. Holzinger1 and G. Just-Nubling2
                                                                                              ¨                                    ¨
                                                                             1
                                                                              Children’s University Hospital, Mu ¨nster, Germany, 2University
                                                                             Hospital, Frankfurt/Main, Germany

                                                                             Objectives: Malaria is the most important parasitic infection in
                                                                             people, affecting 5–10% of the world’s population with more than two




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  57
Poster Presentations



million deaths a year. Whereas invasive bacterial infections are not         observed for the mean of aflatoxigenic fungi colony count in summer
uncommon during severe Plasmodium falciparum malaria, only a few             and winter seasons.
cases of opportunistic fungal infections have been reported.                 Conclusion: The present study tested the hypothesis that differences
Methods: We report a fatal case of pulmonary and disseminated                exist between fresh forages used in summer and the ensiled form used
mould infection in a patient recovering from complicated P. falciparum       in winter in terms of contamination with aflatoxigenic fungi. Although
malaria, review the cases reported in the literature and discuss factors     the detection of toxigenic fungi in a substrate does not necessarily
that put patients with imported malaria tropica at risk to develop           indicate that mycotoxins are naturally occurring in the feed, it alerts to
invasive mycoses.                                                            the potential risk of contamination.
Results: Including the case presented here, invasive pulmonary
mould infections have been reported in sufficient detail in five non-
immune patients with severe imported P. falciparum malaria, including        P088
one case with concomitant isolation of Absidia spp. and four cases with      ECMM-FIMUA survey of Candida deep-seated infections in
dissemination beyond the respiratory tract. Although diagnosed and           ICU patients: use of the DiversiLab for C. parapsilosis
treated during lifetime in three patients, the infection was ultimately
                                                                             characterization in an outbreak setting
fatal in all. At presentation, the parasite count ranged from 15% to
                                                                             A.M. Tortorano1, G. Lo Cascio2, M. C. Esposto1, M. Ligozzi3,
100%, and all patients had clinical signs and symptoms associated with
hyperparasitemia and multiorgan failure; pulmonary infiltrates were           V. Cusumano4 and A. David5
                                                                             1
present in three patients. All patients were previously healthy individ-       University of Milan, Milano, Italy, 2Servizio Microbiologia Azienda
uals and between 26 to 54 years. None was neutropenic, and only two          Ospedaliera Verona, Verona, Italy, 3Universita di Verona, Verona,
                                                                                                                              `
patients had received a short course of corticosteroids. All patients had    Italy, 4Universita di Messina, Messina, Italy, 5D.A.I. Anestesia,
                                                                                               `
marked hemolysis, three were reported to have metabolic acidosis, and        Rianimazione ed Emergenze Medico-Chirurgiche, Universita di    `
three developed acute respiratory distress syndrome during hospitaliza-      Messina, Messina, Italy
tion. The majority of patients had cleared the parasites from the
bloodstream within 72 h. Clinical signs and symptoms associated with         During the 2-year ECMM-FIMUA survey of Candida deep-seated
development of invasive mould infection were persisting or new fever         infections in Intensive Care Unit (ICU) patients, a participating centre
despite parasite clearance, new or changing pulmonary infiltrates, and        emerged among the others because of the high rate of candidemia
persistent, worsening or new neurological signs.                             (70.40 per 1000 admissions compared to a median of 10.08) and an
Conclusions: While larger epidemiological data are lacking, anec-            abnormal frequency of C. parapsilosis as cause of bloodstream infection
dotal evidence suggests that non-immune patients with severe P.              (BSI), namely in 28 out of 42 episodes (66%) compared to 15.5% of the
falciparum malaria are susceptible to opportunistic fungal infections.       other participating 26 centres. This induced to suspect an outbreak of
The availability of free iron, tissue damage and acidosis through the        C. parapsilosis BSIs.
interaction of the parasite with the microcirculation, measures of           Objectives: The aims of the present study were to review the epidemi-
advanced life support, as well as the organism’s interference with           ological data concerning the BSI episodes occurred in this centre and to
innate cellular and specific cell-mediated immunity all provide a             assess the genetic relatedness among C. parapsilosis isolates in order to
plausible foundation for an association between severe P. falciparum         distinguish a true outbreak from a pseudo-epidemic.
malaria and the occurrence of invasive mould infections.                     Methods: Blood isolates from 25 patients were available for the
                                                                             analysis. The ITS1-5,8S-ITS2 region was sequenced to differentiate
                                                                             among the three closely related distinct species, C. metapsilosis,
P087                                                                         C. orthopsilosis, C. parapsilosis, and the DiversiLab semiauthomated
Fungal population and distribution of aflatoxigenic                           rep-PCR was performed to type C. parapsilosis isolates.
aspergilii in feeds in Iran                                                  Results: C. parapsilosis BSI occurred in 13 medical and 15 surgical
S. Ghiasian and A. H. Maghsood                                               adult (mean age 60.2 years, range 23–85) patients and all episodes
UMSHA, Hamadan, Iran                                                         were considered ICU acquired as diagnosed after a median of 21 days
                                                                             (range 8–113) of stay in the ward. All the isolates were identified as C.
Background: Aflatoxins (AF) are secondary toxic metabolites pro-              parapsilosis. Three different genotypes were distinguished among 24
duced mainly by Aspergillus flavus and A. parasiticus that contaminate        typed isolates. One genotype caused eight episodes of BSIs that were
food and feed. Aflatoxins cause aflatoxicosis which primarily results in       diagnosed from July 2006 to November 2007, another genotype
liver damage, immunosuppression, reduced milk and egg production,            caused only two episodes that occurred 1 year apart. Other two highly
embryo toxicity and abortions.                                               related genotypes (>95% of homology) were responsible for a total of
Objectives: As the high incidence of AFM1 in milk of Hamadan                 14 episodes and they circulated in the ICU mainly in a 7 month period,
district was seen, identification of cow feed mycoflora with special           from August 2007 to February 2008.
respect to aflatoxigenic fungi (A. flavus and A. parasiticus) in order to      Conclusions: The DiversiLab System resulted useful in this epide-
make aware of aflatoxin hazards in livestock in this area was                 miological investigation supplying evidence of the circulation of three
investigated.                                                                genotypes in the ICU. The conclusion that most of the BSIs were caused
Methods: One hundred and eighty six cow feed samples (wheat                  by epidemic strains justified the exclusion of the data concerning this
bran, dried bread, alfalfa, straw, molasses, barley and concentrate feed)    centre from the analysis of Candida species causing infections in ICU
from traditional and industrial dairy farms of Hamadan district were         patients in Italy and to stress recommendations for control measures
examined in summer and winter seasons. The dilution plating                  focused on improving hand hygiene compliance.
technique a precise, rapid and reproducible method was used. Results
were obtained as colony forming units (cfu) per gram based on average
count of triplicate set.                                                     P089
Results: The predominant fungi isolated were Aspergillus spp. (flavus,        Comparative study of samples of Candida sp isolated from
parasiticus, fumigatus, niger, ochraceous, nidulans, terreus) followed by    vaginal secretion from two states in Brazil: Sao Paulo and
species of Penicillium, Fusarium, Alternaria and Rhizopus. The concen-       Rondonia
trate feed was the most contaminated feed with aflatoxigenic Aspergilli,      F. Aparecida Fonseca, G.C.M. Carla Matuura de Batista,
which the mean colony count for A. flavus and A. parasiticus were,                               ´
                                                                             F. M. Marques Americo, D. Moreira and C. R. Rodrigues Paula
7.25–100 and 7.50–100 cfu g-1, respectively. The most contaminated                             ˜o        ˜o
                                                                             Universidade de Sa Paulo, Sa Paulo, Brazil
feed with these two Aspergilli in summer were mollases and dried bread
and in winter was concentrate feed. The mean colony count of
aflatoxigenic fungi in industrial dairy farms (8.19–100 cfu g-1) was          Background: Candida vaginitis is one of the most frequent infection
significantly different (P < 0.03) from traditional dairy farms (4.33–        of the female genital tract with a high incidence present in sexually
100 cfu g-1). Statistically significant differences (P < 0.00001) were        active women.




                                                                                                                               Ó 2009 The Authors
58                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



Objectives: The aim of this study was to compare the prevalence of                   The medico-surgical intensive care unit was the main hospitaliza-
species of Candida, the enzyme profile and sensitivity to antifungal               tion service (34 patients = 32%), followed by pneumology (19 pa-
agents produced by strains isolated from vaginal secretion of women in            tients = 16%), hematology (13 patients = 11%), surgery (10 pa-
two regions of the country.                                                       tients = 9%). In vitro susceptibility to amphotericin B, fluconazole and
Materials and methods: Samples of Candida sp were diag-                           5-flurocytosine were determined for all 120 isolates, in vitro
nosed according to traditional methods of identification by Kurtzman               susceptibility to voriconazole and caspofungine respectively for 101
& Fell (1998) and proteinase activity by Ruchel et al. (1982), Price              and 83 strains. The rate of fluconazole-resistant or sensible-dose
et al. (1982) and phospholipase according to Price et al. (1982). For             dependent Candida was 23% (27 of 120 isolates), 3% (2 for 67) for C.
susceptibility of drugs in vitro we applied diffusion agar method                 albicans, 74% (14 for 19) for C. glabrata, 8% (1 for 13) for C.
(ETESTÒ), using RPMI 1640+MOPS medium.                                            parapsilosis, and 50% (10 for 20) for all other species.
Results: In Sao Paulo, 68% of the samples were C. albicans, Candida
                 ˜                                                                Conclusion: From this preliminary study, the following points must
glabrata 16%, 6% of C. kefyr, 4% of C. guilliermondii and C. krusei and           be retained. The majority of candidemias is mainly detected out of the
2% of C. tropicalis. In Rondonia were 66% of C. albicans, 12% of C.               intensive care unit. The percentage of C. albicans in candidemia seems
krusei, 10% of C. tropicalis and 2% of C. guilliermondii. Regarding               to increase since last few years. It is an a anusual data, compared with
enzymatic activity of yeasts, phospholipase was observed in 38% of                recent international trends. The susceptibility to fluconazole is under
samples from Rondonia and in 78% of the samples from Sao Paulo, the
                                                          ˜                       80%, quiet low. This data justifies using caspofungine as the first
production of proteinase was observed in 80% of the isolates from Sao ˜           antifungal therapy, which is a recent recommandation of IDSA
                                         ˆ
Paulo and in 58% of samples from Rondonia. Samples from Sao Paulo
                                                               ˜                  guidelines.
had demonstrated to be more sensible than samples from Rondonia.
Conclusions: Although C. albicans is the specie of higher prevalence
in both regions studied, the diversity of species was greater in Sao  ˜
Paulo. The data show that the samples from Sao Paulo and Rondo
                                                ˜                   ˆnia          P091
have distinct phenotypic profiles. Fact that can be associated with                Fungal strains isolated from clinical specimens of patents
different social and environmental conditions experienced by women in             with total parenteral nutrition (TPN)
these two regions.
                                                                                  M. Sikora1, E. Swoboda-Kopec1, S. Blachnio1, I. Netsvyetayeva1,
                                                                                  D. Kociszewska2, M. Pertkiewicz2 and G. Mlynarczyk1
                                                                                  1
                                                                                   Medical University of Warsaw, Warsaw, Poland, 2W. Orlowski
P090                                                                              Clinical Hospital, Warsaw, Poland
Candidemia in a French tertiary care hospital: frequency of
different species and antifungal susceptibility                                   Introduction: Infectious complication as well bacterial as fungal
E. Mazars1, A. Panaque-Zulueta1, C. Cattoen1, F. Canis1 and                       concern all groups of patients with immune system deficiency. Patients
N. Seguy2
    ´                                                                             who receive total parenteral nutrition form group with high risk of
1
 Hospital, Valenciennes, France, 2University of Burgundy, Dijon,                  infection. Fungal infection have a serious clinical importance in group
France                                                                            of patients with parenteral nutrition support (TPN).
                                                                                  Objective: Identification and occurrence analysis of fungal strains
Objectives: Invasive Candida infections are associated with high                  isolated from patients subjected for treatment of total parenteral (TPN)
mortality, especially in intensive care units. The changes in epidemi-            hospitalized in Department of Nutrition and Surgery in W. Orlowski
ology and the emergence of antifungal resistance lead to permanent                Hospital in Warsaw.
changes in medical practice. The knowledge of recent local epidemi-               Materials and methods: Fungal strains were isolated from clinical
ologic trends and susceptibility to antifungals is critical in this context.      samples of: blood, sputum, urea, bronchial discharge and swabs of: oral
Therefore, we reported preliminary epidemiologic characteristics of               cavity, stoma, anus and cervix. Strains were cultured on Sabourauda
candidemia during 6 years.                                                        agar plates (bioMerieux) with chloramphenicol addition. Identification
Methods: Our study is a retrospective, local, observational survey,               of the isolates was performed on chromogenic agar ChromAgar
from January 2003 to December 2008. All patients admitted in the                  (Becton Dickinson) and with use of microtest ID 32C (bioMerieux).
tertiary hospital of Valenciennes, with candidemia, were included. It is a        Results: Fifty-five yeastlike fungal strains were isolated from 37
1850-bed centre with an intensive care unit (19 beds), and haematol-              patients. The most numerable group of isolates was Candida glabrata-
ogy-oncology units. Clinical data is the current hospitalization.                 31 strains (56.4% out of all cultures) mainly from urea samples- 9
Mycological data are the identification and in vitro antifungal suscep-            (29%), anus- 7 (22.6%), stoma- 6 (19.4%), and from other samples- 9
tibility of Candida isolates. The identification process was performed             (29%). The other cultured species were Candida albicans- 13 isolates
with a latex test, AuxacolorR test and chromogenic medium. The                    (23.6%), Candida tropicalis- 3 (5.5%), Candida parapsilosis- 3 (5.5%),
antifungal susceptibility testing were evaluated with E-testR for five             Candida krusei- 2 (3.6%), Candida lusitaniae- 2 (3.6%) and Candida
antifungal molecules (amphotericin B, fluconazole, 5-flurocytosine,                 inconspicua- 1 (1.8%). C. albicans was the most often isolated from
voriconazole and caspofungine).                                                   blood- three strains (23%), sputum- 3 (23%) and from other
Results: During these 6 years, 117 candidemia were detected in our                specimens- 7 (54%). Strains of C. parapsilosis were cultured from
tertiary hospital. Three patients (2.5%) developed a fungemia with two            catheter blood- 3 isolates and C. tropicalis from blood and stoma- three
yeats : two with C. albicans and C. glabrata, one with C. albicans and            isolates.
Geotrichum capitatum. The numbers of candidemia and the C. albicans               Conclusion: (i) The most often isolated strain from Candida genus
isolates are described for each year in the following table.                      was C. glabrata- 56.4% from all isolates, and Candida albicans- 23.6% of
                                                                                  isolates. (ii) Fungal strains were cultured mostly from urea samples- 12
Years          2003     2004     2005      2006     2007      2008      Total
                                                                                  isolates, stoma- 10, anus- 9, blood samples- 8, sputum- 8 and from
                                                                                  other specimens- 8.
Number of      15       13       19        15       20        35        117       Acknowledgment: Supported by Polish State Committee for Scien-
candidemia                                                                        tific Research (grant No. N N404 093735).
N of C.        7 (47)   6 (46)   11 (58)   8 (53)   12 (57)   23 (62)   67 (57)
albicans (%)



   C. albicans was the most common pathogen (n = 67; 57%), followed
by C. glabrata (n = 19; 16%), then C. parapsilosis (n = 14; 11%), C.
tropicalis (n = 9; 7.5%), C. krusei (n = 5; 4%), etc.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                      59
Poster Presentations



                                                                               Methods: Environmental samples are collected prospectively over a
P092                                                                           12 month period once a week inside (hematological wards) and outside
Fungal microbiota in sickle cell anemia patients under                         the UHC. Samples are incubated and fungal colonies identified and
antibiotic prophylaxis                                                         quantified. At the same time, patients are screened for nasal
C.Y. Koga-Ito1, M. S. Figueiredo2, J.A.P. Braga2, G. N. Back-Brito1,           colonization with Aspergillus spp. via nasal swab sampling. We aim
A. J. Mota1 and B. M. Matos1                                                   to determine frequency and distribution of these fungi and demonstrate
1
 Sa Paulo State University, Sa Jose dos Campos, Brazil, 2Paulista
   ˜o                         ˜o     ´                                         any relationship of their epidemiology with seasonal conditions.
                  ˜o
Medical School, Sa Paulo, Brazil                                               Genotyping of A. terreus isolates will be performed to demonstrate
                                                                               whether there is a strain similarity or rather a genomic diversity of A.
Objective: Sickle cell anemia is the most frequently observed                  terreus.
hereditary disease in Brazil. A total of 3500 new cases are registered         Results: A total of 4919 air samples were collected over a 12 month
every year, and prevalence studies reported that 2.1% of the blacks            period, 2707 from inside and 2212 from outside the UHC. The outdoor
and their descendents are affected by the disease. Nowadays, early             density of Aspergillus spp. ranged from 4.4 CFU m-3 to 37.4 CFU m-3
diagnosis is frequent due to neonatal trial exams. Because there is            (mean 17.5 CFU m-3), reaching its’ peak in November. Nine A. terreus
high susceptibility to infections and high mortality/morbidity rates           strains were detected; three strains from outside and six from inside the
associated to septicemia or secondary meningitis, these children               hospital. Inside the UHC, an average of 4.6 CFU m-3 was measured. A.
receive prophylactic antibiotic therapy with penicillin, started just          fumigatus (92.9%) was predominant both inside and outside of the
after the diagnosis. Antibacterials are cited as a predisposing factor to      hospital, followed by A. niger (5.3%), A. flavus (2.1%), and A. terreus
the development of oral candidosis, however no previous studies on             (0.2%). A total of 855 nasal swabs from 240 patients have been
the effect of this treatment on the oral fungal microbiota are found in        analyzed, a single one was positive for Aspergillus spp.
the literature. Moreover, the oral mucosal tissues can be considered a         Conclusions: Aspergillus spp. are routinely detected in samples from
primary entry portal for all opportunistic pathogens and, particularly         the environment of the University Hospital of Cologne. The most
in immunocompromised hosts, these infections may lead to life-                 frequently detected fungus was A. fumigatus. A. terreus was rare. These
threatening systemic disease. The aim of this study was to evaluate            findings differ from other hospitals, possibly caused by different
the fungal microbiota in the oral cavity of sickle cell anemia children.       seasonal and environmental conditions. The average of 4.6 CFU m-3
Methods: Twenty-five children, 13 female and 12 male, with ages                 inside the hospital may be of concern, but was much lower than the
between 4 to 11 years with sickle cell anemia (genotype SS) and under          outdoor density of Aspergillus spp. at all times. Nasal swabs are not
antibiotic therapy with penicillin for at least 6 months were included in      helpful in identifying patients with Aspergillus spp. colonization of the
the study. Age/sex/oral conditions paired-control group were com-              upper respiratory tract.
posed by 25 healthy children with no oral or systemic diseases.
Exclusion criteria were use of orthodontic appliances, pacifiers or
mouthrinses and diabetic patients. Oral rinses were collected and the
identification was performed by API 20 AUX. The confirmation of C.               P094
dubliniensis identification was performed using a validated multiplex           Yeasts from mygratory birds and birds of prey as marker of
PCR assay. The results were expressed as values of colony-forming              environmental fungi
units per milliliter (cfu/ml).                                                 P. Danesi1, L. Biasion1, R. De Nardi1, C. Salvatore1, C. Cafarchia2,
Results: Salivary levels of yeasts were significantly higher among              A. Peano3 and G. Capelli1
sickle-cell anemia patients in relation to controls (median values 1455        1
                                                                                 Istituto Zooprofilattico Sperimentale delle Venezie, Legnaro (PD),
and 5, respectively; P = 0.017). A total of 117 isolates were identified.       Italy, 2Faculty of Veterinary Medicine, University of Bari, Bari, Italy,
Candida albicans was the most frequently isolated species in both              3
                                                                                 Faculty of Veterinary Medicine University of Torino, TORINO, Italy
groups. In the sickle cell anemia group, C. dubliniensis, C. famata, C.
rugosa, C. sphaerica, and C. tropicalis were also detected. In the control
group, C. albicans, C. famata, C. parapsilosis, C. tropicalis and Saccharo-    Objectives: The aim of this work was to study the prevalence of
myces cerevisiae we additionally identified. All the five isolates identified     yeast flora in the upper respiratory tract and in the cloaca of different
as C. dubliniensis by API 20C AUX were confirmed by PCR.                        species of migratory birds and birds of pray as marker of environmental
Conclusions: Fungal oral levels were significantly higher among                 fungi and to evaluate their possible role as carriers of pathogens for
patients with sickle cell anemia in relation to controls. This result          humans and animals.
suggests that more attention should be given to the risk of the                Methods: Birds representing 19 species of Anseriformes, Pelecani-
development of fungal infections among these patients.                         formes, Strigiformes and Falconiformes orders were sampled. Cloacal
                                                                               and pharyngeal swabs were obtained from each bird. Swabs were
                                                                               cultivated in Sabouraud agar and incubated at 25 and 37 °C. Yeasts
                                                                               identification was made by macroscopic observations, microscopic
P093                                                                           morphology and API ID32C (Biomerieux). Differences in yeast
One year Aspergillus spp. Surveillance study at the                            frequency were tested by the Chi-square test (v2).
University Hospital of Cologne                                                 Results: Yeasts were isolated from 187 (33%) out of 557 sampled
S. Gerlach1, J. J. Vehreschild1, M.J.G.T. Ruping1, P. Hartmann1,
                                            ¨                                  birds with the highest percentage in Strigiformes (52.6%) and
C. Lass-Florl2, K. Grif2, G. Fischer3 and O.A. Cornely1
          ¨                                                                    Falconiformes (47.2%). A total of 239 yeasts belonging to Candida
1
 Uniklinik Ko Ko Germany, 2Medizinische Universita
             ¨ln, ¨ln,                                    ¨t                   spp. (45.2%), Cryptococcus spp.(25.9%), Rhodotorula spp. (28%) and
Innsbruck, Innsbruck, Austria, 3RWTH-Aachen, Aachen, Germany                   Geotrichum spp. (0.80%) were isolated both from cloaca and pharynx as
                                                                               reported in Table 1. Eleven Candida species and three Cryptococcus
                                                                               species were identified. Among Candida species, C. famata (44.4%), C.
Objectives: Environmental contamination with Aspergillus spp.                  albicans (17.6%) and C. guilliermondii (15.7%) were the most frequently
plays a key role in infection transmission of invasive aspergillosis           isolated ones. Among Cryptococcus species, Cryptococcus laurentii
(IA). High environmental conidia loads have been associated with               (14.7%) and C. uniguttulatus (16.4%) were the most frequently isolated
outbreaks of IA. High-efficiency particulate air (HEPA) filtration was           from pharynx and cloaca respectively. Yeasts were isolated only from
shown to reduce incidence of the disease. Still, the relation between          cloaca in 94 (16.9%) birds and only from respiratory tract in 118
environmental contamination and patient colonization with these                (21.2%) (Table 2). Cloacal and pharyngeal prevalence of yeasts were
pathogenic fungi remains uncertain. In this study, we evaluate the             significantly different in Anseriformes, Pelecaniformes and Strigiformes
epidemiology of A. terreus, A. fumigatus, A. niger, and A. flavus strains       orders (P < 0.05) but not in Falconiformes (Table 2). Comparison
collected from air samples at the University Hospital of Cologne (UHC),        between Anseriformes prevalence (30.9%) and the others three orders
and correlate findings with colonization of the upper respiratory tract         of birds indicated that there was a tendency towards a lower
of inpatients.                                                                 prevalence in Anseriformes yeast isolates (P = 0.052).




                                                                                                                                 Ó 2009 The Authors
60                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                             Poster Presentations



Conclusions: Our data confirm the presence of Cryptococcus non-
neoformans species in cloaca and upper respiratory tract of wild and
domestic birds as reported by different authors (Cafarchia et al., 2006,
Rosario, 2005). C. uniguttulatus and C. laurentii are generally
considered relative thermotolerant and unable to multiply in birds
digestive tract. Their presence in the cloaca is probably due to the
survival of a limited number of cryptococci coming from the crop. In
general the number of isolates from pharynx was higher than cloacal
isolates. In particular we found a higher prevalence of Candida famata in
comparison to C. albicans and the other Candida species reported in
literature. According to Garcia et al. (2007) nocturnal and diurnal
birds of prey (Strigiformes and Falconiformes) seem to be more efficient
carriers of yeasts compared with other orders of birds, likely due to the
different physiology of feeding characterized by regurgitation of
undigest part of pray like bones, feathers etc. Birds may be host and
possibly long-range carriers of different types of pathogens and their
implication from an epidemiological point of view is very important.
Furthermore, there is the need of improving our diagnostic techniques
considering that a large number of yeast isolated from wild species are
still unknown and very difficult to identify.



P095
Prevalence of candidaemia in University College Hospital
Ibadan
R.O. Oladele1, M. A. Petrou2 and R. A. Bakare1
1
 University College Hospital Ibadan, Ibadan, Nigeria,
2
 Hammersmith Hospital, London, United Kingdom

Objectives: Candidaemia is a widely studied and reviewed in the
developed world, however there is lack of information on nosocomial
                                                                            Conclusion: These findings prove that Candidaemia may be the
                                                                            cause of persistent fever in immunosuppressed patients that are not on
candidaemia in Nigeria despite the increasing use of more therapeutic
                                                                            prophylaxis or empiric antifungal therapy. The high mortality rate
modalities in patient management and the increasing incidence of
                                                                            which must be directly related to the delay in commencing treatment
immunosuppression due to HIV/AIDS, neoplastic disease and use of
                                                                            should facilitate development of rational approaches for prevention,
immunosuppressive agents. The objective of this study was to
                                                                            early identification and appropriate management of those patients at
determine the prevalence of candidaemia, estimate the mortality rates
                                                                            risk of developing this life-threatening condition. Furthermore it
and identify factors associated with candidaemia amongst immuno-
                                                                            highlights the importance of prompt antifungal treatment and the
suppressed patients with persistent fever admitted in University College
                                                                            availability of new oral and intravenous drug in hospital pharmacies,
Hospital, Ibadan.
                                                                            as at present our patients can only be treated with oral Fluconazole as
Methods: Venous blood was collected following standard protocols
                                                                            no other drug is available, and the need for further studies in these
from 230 immunosuppressed patients with persistent fever while
                                                                            susceptible populations
receiving adequate antibacterial coverage and incubated at 37 °C
using BACTEC 9050. Positive samples were examined microscopically
using direct gram staining; those showing yeasts were cultured onto
Sabourauds agar and CHROMagar Candida. Germ tube was performed
on all yeasts for the presumptive identification of C. albicans and all      P096
isolates were identified to species level using API20AUX and API32C.         Evaluation of species distribution and risk factors of
The susceptibility of all isolates to Amphotericin B, Flucytosine,          candidemia: a multicenter case-control study
Fluconazole, Itraconazole, Voriconazole, Posaconazole and Caspofun-         N. Yapar1, H. Pullukcu2, V. Avkan-Oguz3, S. Sayin-Kutlu4,
gin was performed by both the CLSI and EUCAST method. Clinical              B. Ertugrul5, S. Sacar4, B. Cetin6 and O. Kaya7
                                                                            1
details of the patients were entered into a semi-structured pro-forma        Dokuz Eylul University Medical School, Izmir, Turkey, 2Ege
form incorporating socio-demographic data, medical/surgical history of      University, Izmir, Turkey, 3Dokuz Eylul University, Izmir, Turkey,
known risk factors for candidaemia and other laboratory findings for         4
                                                                             Pamukkale University, Denizli, Turkey, 5Adnan Menderes
Candida and analysed using SPSS 13.0 software.                              University, Aydin, Turkey, 6Celal Bayar University, Manisa, Turkey,
Results: Candidaemia, the 3rd most common isolate recovered from            7
                                                                             Suleyman Demirel University, Isparta, Turkey
blood was detected in twelve patients, a prevalence of 5.2%. Time to
positive culture was 1–7 (mean 3.5) days. The species isolated were C.
parapsilosis4 (33.3%); C. tropicalis 6 (50.0%); C. albicans 1 (8.3%); and   Objectives: In recent years, an increase in the frequency of candi-
mixed infection of C. albicans and C. tropicalis 1 (8.3%). CHROMagar        demia, especially due to more resistant non-albicans Candida, has been
Candida failed to identify all the species whereas both API20AUX and        observed. This multicenter study was planned to determine the risk
API32C gave the same result. The susceptibility data were similar           factors of candidemia, and the mostly encountered Candida species
between the two methods and in accordance to published data for each        causing to bloodstream infections.
drug and species. Multivariate analysis using logistic regression and       Methods: A case-control study at six university hospitals was
correlation revealed that apart from blood and stool Candida spp            conducted in 1 year period. Candidemia was defined as isolation of
isolated from intravenous cut down (P = 0.040), mucositis                   any species of Candida from at least one blood culture of patients older
(P = 0.019) and diarrhoea (P = 0.017) were significantly associated          than 16 years. At least two controls were randomly selected per cases
with increased risk of development of candidaemia, while univariate         from patients without candidemia matching according to the age
analysis showed that old age, multiple surgeries and long term              groups and gender and hospitalized in the same department of hospital
hospitalisation were significant contributing factors. There was 91.7%       during the same period. For cases and controls, demographic and
crude (11/12 patients) and 50% attributable mortality.                      clinical data were collected Eastern Cooperative Oncology Group




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                61
Poster Presentations



(ECOG) Performance Status was used for asses how the disease affects         Results: In the study period, 83 candidemia episodes were identified.
the daily living abilities of the patient. For statistical analyses, chi-    Of the cases 36 (43.4%) were female and 47 (56.6%) were male. Mean
square, chi-square for trend and Fisher’s Exact tests were used and p        age was 55.0 ± 17.12 (min. 18–max. 84) in case group and
values of <0.05 were considered as significant. All statistical analyses      55.8 ± 16.58 (min.17–max.90) in control group. Patient character-
were performed with Statistical Package for the Social Sciences (SPSS,       istics and risk factors for candidemia were shown in Table 1. Candida
Version 15.0, Chicago, IL, USA) and CDC software EPI INFO (version           albicans was the most common species among isolates (38 of the
6.0, Atlanta, GA, USA).                                                      patients-45.8%) followed by C. tropicalis (20 of the patients-24.1%) and
                                                                             C. parapsilosis (12 of the patients-14.5%). Candida glabrata was isolated
                                                                             only from four (4.8%) patients. Risk factors of candidemia due to
                                                                             albicans and non-albicans Candida spp were given in Table 2.
                                                                             Conclusions: In this study, we observed that non-albicans Candida
                                                                             strains were common in our patient group. But strains known to be
                                                                             more resistant to antifungal agents such as C. glabrata were rare. For
                                                                             that reason fluconazole is still a good choice for non-neutropenic
                                                                             patients. Important risk factors for candidemia were length of
                                                                             hospitalization, urinary and central venous catheterization, thoracic,
                                                                             central nervous system or abdominal surgery, erythrocyte transfusion,
                                                                             total parenteral nutrition and use of systemic antibiotics or antifungals.
                                                                             Neutropenia, intubation and mechanical ventilation were identified as
                                                                             additional risk factors for C. albicans candidemia. Most of the risk
                                                                             factors were invasive procedures and medications. We concluded that a
                                                                             great number of candidemias were preventable infections by reducing
                                                                             of unnecessary invasive procedures or antimicrobials.



                                                                             P097
                                                                             Tinea capitis in central tunisia: prevalence and etiologic
                                                                             agents over a 30 years period
                                                                             A. Fathallah Mili1,2, S. Gaied Meksi2, A. Yaakoub2, F. Saghrouni2,
                                                                             S. Ghaith2, I. Bougmiza2, N. Berrjab2, N. Ben Hassine2 and
                                                                             M. Ben Said2
                                                                             1
                                                                              Institut Pasteur de Tunis, Tunis, Tunisia, 2CHU Farhat Hached,
                                                                             Tunisia Faculty of Medicine of Sousse, Sousse, Tunisia

                                                                             Background: The aim of this study was to determine the prevalence
                                                                             of tinea capitis, to identify the causative agents of dermatophytosis and
                                                                             to study their evolution over time.
                                                                             Materials and methods: Our study was conducted retrospectively
                                                                             from 1979 to 2008 (30 years). During this period, we analysed 10902
                                                                             scalps from suspected individuals. All samples were submitted to both
                                                                             direct examination and culture onto Sabouraud medium. The results
                                                                             were analyzed according to age, sex and etiological agent.
                                                                             Results: Out of 10 902 patients examined, 5858 (53.7%) were
                                                                             affected by tinea capitis. The age varied from 1 to 86 years. Trichophytic
                                                                             tinea was observed in 3894 (35.9%) patients including 2313 (59.4%)
                                                                             female and 1581 (40.6%) male. The age varied from 1 to 74 years. The
                                                                             1–10 years was the most susceptible age group with a median of
                                                                             7 years. The agents isolated were Trichophyton violaceum in 3884
                                                                             (99.7%) cases and Trichophyton tonsurans in 10 (0.3%) cases. Microsp-
                                                                             oric tinea was reported in 1670 patients including 1059 (63.4%) male
                                                                             and 611 (36.6%) female. The age ranged between 1 and 56 years, most
                                                                             cases occuring between 1 and 10 years (median: 6 years). The main
                                                                             etiologic agents were: Microsporum canis in 1666 (99.7%); whereas
                                                                             Microsporum audouinii occurred in 3 (0.17%) cases and Microsporum
                                                                             nanum in 1 (0.03%) case. Favus tinea was recorded in 100 patients,
                                                                             among them, they were 56 (56%) were male and 44 (44%) female.The
                                                                             age varied from 3 to 45 years with a median of 10 years. 18 were
                                                                             observed in adults. Inflammatory tinea capitis : During the study period,
                                                                             106 (0.9%) inflammatory tinea capitis were detected in 70 (66%) male
                                                                             and 36 (34%) female.The distribution of cases according the causative
                                                                             species was as follows: 65 (61.3%) Trichophyton mentagrophytes, 35
                                                                             (33%)Trichophyton ochraceum and 6 (5.7%) Microsporum gypseum.
                                                                             Trichophyton rubrum tinea capitis was identified in 11(0.1%) cases: 6
                                                                             (54.5%) male and 5 (45.5%) female, aged between 2 and 47 years and a
                                                                             median of 13 years.
                                                                             Conclusion: The incidence of tinea capitis varied over the 30 years
                                                                             period with an obvious decrease from the beginning of the 1990 s. The
                                                                             decrease was more significant in trichophytic tinea caused by
                                                                             antropophilic dermatophytes and favus tinea which became excep-
                                                                             tional since1998. In the meanwhile an increase in incidence of the




                                                                                                                               Ó 2009 The Authors
62                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



zoophilic M. canis was observed, and tended to exceed that of T.                C. albicans, 16 C. tropicalis, 13 C. glabrata and 10 C. krusei. Two
violaceum.                                                                      reference strains, C. albicans ATCC 90028 and C. glabrata ATCC 90030,
                                                                                were used as quality controls. At first, DNA from all cultures was
                                                                                isolated as intact chromosomes in agarose plugs. Furthermore, DNA
                                                                                from nine isolates of C. krusei and eight of C. tropicalis were then
                                                                                subjected to restriction using Sfi I and BssH II endonucleases,
P098                                                                            respectively. The chromosomes were separated using the CHEF Mapper
Paracoccidioidomycosis: a case report                                           system (Bio-Rad Laboratories) in 0.8–1.0% agarose under conditions
B.C.A. Zoppas, G. S. Spader, M. De Liz, H. O. Oliveira and                      specific for each species. The karyotypes were compared using the
J.C.B. Bertotto                                                                 GelCompar II software (Applied Maths). Simpson’s diversity index (D)
Universidade de Caxias do Sul, Caxias do Sul, Brazil                            was applied to evaluate the discriminatory power of karyotyping for all
                                                                                species tested.
                                                                                Results and discussion: Thirty-eight karyotypes were defined
Paracoccidioidomycosis, caused by Paracoccidioides brasiliensis, is the
                                                                                among 65 isolates of C. parapsilosis (D = 0.945), 44 among 53
most common systemic mycosis in Latin America. Brazil accounts for
                                                                                C. albicans (D = 0.994), 9 among 16 C. tropicalis (D = 0.806), 12
about 70% of cases reported worldwide and the disease is the eighth
                                                                                among 13 C. glabrata (D = 1.000) and three karyotypes among 10
leading cause of death among predominantly chronic infectious and
                                                                                isolates of C. krusei (D = 0.667). A combination of PFGE and
parasitic diseases. The profile of the disease features a high prevalence
                                                                                restriction analysis (PFGE-REA) markedly increased the discrimina-
and morbidity and affects the proportion of the population with less
                                                                                tory power of C. tropicalis and C. krusei karyotyping. Moreover, two
ability to have medical care. The clinical manifestation is the most
                                                                                strains of a new species, C. orthopsilosis, were distinguished in the
common chronic disease in males, the proportion of 10 men to one
                                                                                group of C. parapsilosis isolates based on the lowest degree of
woman, between 30 and 50 years of age, smokers and/or nutritional
                                                                                similarity. Moderate changes in karyotypes of subsequent isolates of
conditions of chronic alcoholism and poor socioeconomic, as the low
                                                                                the same species obtained from the same patients suggest frequent
immunity promotes the advancement of the disease. The disease is
                                                                                microevolutionary changes of strains in the course of infection. No
acquired by inhalation of conidia, causing a primary pulmonary
                                                                                specific karyotypes were found related to the patients’ sex, age group
infection that can spread to the oropharyngeal mucosa, suprarenal
                                                                                or diagnosis or type of the ward. Some C. albicans isolates obtained
gland, central nervous system, testicles and prostate, among other
                                                                                from patients in the same hospital tend to generate groups with
tissues. The delay in diagnosis determines the depletion of the general
                                                                                slightly higher degrees of relationship suggesting potential geograph-
state of the patient. This paper aims to report a case of Paracoccidioid-
                                                                                ical differences. Eight C. parapsilosis isolates obtained from eight
omycosis as a chronic form, adult type of a 50-year-old male patient
                                                                                patients in the Military Hospital Olomouc over a 5-month period had
helped at the Central Clinic of the Universidade de Caxias, Caucasian,
                                                                                very high degrees of relationship (70–100%), suggesting a possible
mechanical turner, smoker, living in Flores da Cunha, RS, Brazil, he
                                                                                nosocomial source of infection.
sought medical care due to painful lesions present in the oral mucosa
and ear, about 4 months ago. The clinical examination presented
                                                                                Conclusion: Our results demonstrate that karyotyping of whole
                                                                                chromosomes has high discriminatory power for C. albicans, C. glabrata
erosive lesions, erythematous, with bleeding points, diffusely distributed
                                                                                and C. parapsilosis strains. For C. tropicalis and C. krusei, a combination
in the oral cavity, especially on the right side, invading the upper and
                                                                                of PFGE and restriction analysis has markedly higher inter-strain
lower lip, median sulcus of the tongue, sublingual mucosa ulceration in
                                                                                discrimination. High karyotype variability is in agreement with the
addition to apex of left external ear. The tests requested included: direct
                                                                                expectation that the source of bloodstream infections is usually
and mycological culture, chest X-ray and histological examination. The
                                                                                endogenous.
results found by direct mycological examination and culture were
consistent with Paracoccidioides brasiliensis, and histopathological            Acknowledgement: This work was supported by the Czech Minis-
examination revealed chronic inflammation with giant-cell reaction.              try of Education (research grant MSM6198959233).
The X-ray showed no changes. Itraconazole 100 mg 12/12 h was
given. The lesions regressed in about 2 months. The patient is being
monitored. The epidemiology, clinical signs and symptoms, diagnosis             P100
and treatment of this mycosis are presented and discussed.                      Unusual risk factors in emerging clinical entity of primary
                                                                                cutaneous zygomycosis in tertiary care health services
                                                                                J. Chander, N. Gulati, A. Attri and H. Mohan
                                                                                Government Medical College Hospital, Chandigarh, India
P099
Karyotyping of Candida bloodstream isolates: an                                 Background: Zygomycosis (mucormycosis) is extensively invasive
epidemiologic study                                                             fungal infection with high mortality rate if not detected and treated
P. Hamal1, A. Jedlickova2, S. Dobiasova3, V. Buchta4, N. Mallatova5             well in time. Various clinical types of infections caused by this group
and V. Raclavsky6                                                               of fungi i.e. zygomycetes belonging to order Mucorales, are
1
 Palacky University, Olomouc, Czech Republic, 2General Teaching                 becoming increasingly common. The chances of survival of patients
Hospital, Prague, Czech Republic, 3Institute of Public Health,                  remain grim, when full-fledged infections are established. In most of
Ostrava, Czech Republic, 4Charles University, Hradec Kralove,                   patients suffering from zygomycetes, diabetes mellitus may be
Czech Republic, 5Regional Hospital, Ceske Budejovice, Czech                     underlying factor but in primary cutaneous zygomycosis, clinical
Republic, 6University Hospital, Olomouc, Czech Republic                         presentation may be without it.
                                                                                Objectives: To increase awareness among medical/surgical staff of
                                                                                this group of emerging infections and to emphasize importance of an
Background and objectives: Systemic Candida infections are of
                                                                                early diagnosis and treatment of primary cutaneous zygomycosis.
increasing medical importance. Although the source is usually
                                                                                Patients: The patients diagnosed with primary cutaneous zygomy-
endogenous, nosocomial patient-to-patient transmission is also possi-
                                                                                cosis at the tertiary care hospital between 2001 and 2009 are being
ble, mostly by the hands of hospital staff. At present, molecular genetic
                                                                                reviewed. These patients presented with diagnosis of necrotizing
methods are usually used for determining the identity or diversity of
                                                                                fasciitis. The patients, who presented with bacterial causes of
strains. This study aimed at karyotyping of bloodstream isolates
                                                                                necrotising fasciitis like Streptococcus pyogenes and Pseudomonas
belonging to the five most frequent Candida species using pulsed-field
                                                                                aeruginosa, were not included in this study.
gel electrophoresis (PFGE). The following criteria were evaluated: (i)
discriminatory power of the method, (ii) rate of relationship of the
                                                                                Methods: Detailed history of each patient was taken, clinical presen-
isolates and (iii) patient data related to the genetic profile of the strains.   tation, site of involvement, underlying illness and risk factor, if any,
                                                                                were noted. The diagnosis was established by direct microscopic
Materials and methods: One hundred and fifty-seven isolates
                                                                                evidence of broad, aseptate or sparsely septate ribbon-like hyphae with
from 123 patients were included in the study: 65 C. parapsilosis, 53




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                       63
Poster Presentations



right angle branching in KOH wet mount and histopathological                P101
examination of stained sections with H&E, PAS and GMS stainings.            Molecular typing of Malassezia spp. isolated from ear canal
Fungal cultures were put up on standard media like Sabouraud dextrose       of dogs and cats with and without otitis using PFGE, RFLP
agar for isolation and species identification. In case there was no          and RAPD
sporulation on routine cultures, agar floatation technique was used for
                                                                            S.D. Coutinho1, M. C. Melhem2, M. A. Martins2 and G. H. Nardi1
induction of spores. Molecular techniques were used in case there was       1
no sporulation even by floatation method particularly in case of
                                                                             Paulista University – UNIP, Sa Paulo, Brazil, 2Instituto Adolfo Lutz,
                                                                                                           ˜o
Apophysomyces elegans and Saksenaea vasiformis. An extensive                  ˜o
                                                                            Sa Paulo, Brazil
debridement of the infected wound was done, which was followed by
systemic amphotericin B and topical liposomal amphotericin B. The           Malassezia pachydermatis is an aetiological agent of superficial mycosis
outcome of medical and/or surgical therapy was analysed in all these        in animals, causing otitis and dermatitis. Since M. pachydermatis is the
patients.                                                                   only non-lipodependent species in the genus, veterinary laboratories
Results: Out of ten patients reviewed, underlying illness i.e.              usually employ mycological culture medium without lipids to isolate
diabetes mellitus was present only in two. The commonest risk               this microrganism. Nevertheless, at the research level, lipodependent
factor was found to be injection abscess i.e. among four patients. In       Malassezia species have been isolated from both healthy and diseased
one case plaster of Paris (POP) cast was the precipitating factor.          animals. The objective of this work was to determine the presence of
Apophysomyces elegans was isolated in five cases, Saksenaea                  lipo-and-non-lipodependent Malassezia species in the external ear
vasiformis in one and Absidia corymbifera (Mycocladus corymbiferus)         canal of dogs and cats with and without otitis, characterizing strains
in one. The fungal culture turned out to be sterile in three cases          using phenotypic and genotypic techniques. Fifty dogs, 25 with and
despite the fact that direct findings of KOH wet mount and stainings         25 without otitis, and 71 cats, 28 with and 43 without otitis were
being positive. Mortality rate was very high as only four patients          studied. A total of 242 samples were studied – 104 of otic secretion
responded well to medical and/or surgical treatment.                        (otitis) and 138 of cerumen (without otitis). Samples were harvested
                                                                            on Mycosel agar supplemented with glycerol, malt extract and olive
                                                                            oil. Isolates were characterized phenotypically by means of macro-and
                                                                            micromorphology, catalase and esculin tests, and growth on Tween
                                                                            20, 40, 60 and 80, and Cremophor-EL. Cariotyping was performed via
                                                                            PFGE and RFLP, genetic diversity was researched by RAPD. Malassezia
                                                                            spp. were isolated respectively from 28/52 (54%) and 33/48 (69%) of
                                                                            the cerumen and otic secretion samples originated in dogs. M.
                                                                            pachydermatis was the most prevalent species, having been isolated
                                                                            from 100% and 89% of the strains obtained from cerumen and otic
                                                                            secretion. Four lipodependent M. pachydermatis strains (4/33–11%)
                                                                            were isolated from dogs with otitis. Malassezia spp. were isolated
                                                                            respectively from 19/86 (22%) and 42/56 (75%) of the cerumen and
                                                                            otic secretion in cats. M. pachydermatis was the most prevalent species
                                                                            isolated in cats, having been isolated from 65% (13/20) and 51% (22/
                                                                            43) of the strains’ originated from cerumen and otic secretion.
                                                                            Lipodependent species (M. furfur and M. sympodialis) were isolated
                                                                            respectively from 21/43 (49%) and 7/20 (35%) of the cats with and
                                                                            without otitis; percentual of isolation of M. pachydermatis and
                                                                            Malasssezia lipodependent in cats with otitis was similar. Through
                                                                            both genetic molecular methods employed in this research (PFGE and
                                                                            RFLP), strains were identified as M. pachydermatis, M. furfur and M.
                                                                            sympodialis. Concordance between phenotypical and genotypical
                                                                            techniques was 89%. It concludes that phenotypic methods permit
                                                                            an acceptable identification scheme for Malassezia spp., but if
                                                                            commercial veterinary laboratories do not use media with the addition
                                                                            of lipids for isolation of these yeasts, it might yield false-negative
                                                                            results in veterinary clinical samples. By means of RAPD were
                                                                            observed 29 and 22 different profiles, respectively for dogs and cats.
                                                                            The most prevalent profiles for M. pachydermatis were III (77%) and II
                                                                            (73%), respectively in dogs with and without otitis; in cats the most
                                                                            prevalent profile was I, in animals with (68%) and without otitis
                                                                            (42%). In M. sympodialis strains isolated from cats, profile XV was
                                                                            predominant (35%). These results confirm that there is genetic
                                                                            diversity among Malassezia spp. strains, and it is important to research
                                                                            if any of these subpopulations could express some genes related with
                                                                            virulence factors and pathogenicity. Grant: FAPESP-2006/61171-3;
                                                                            Capes-Prosup.

Figure 1 Primary cutaneous zygomycosis of right abdomen.
                                                                            P102
Conclusion: There is an urgent need for high index of clinical                                                          ˜
                                                                            Marine birds Malassezia isolation from Sao Paulo south cost,
suspicion of zygomycosis thereby taking early biopsy of affected site so    Brazil
that benefits of prompt diagnosis and therapy may be achieved.               F.C. Viani1, M. C. Di Gregorio2, G.C.M. Batista1,
Injection abscess is one of the significant precipitating factors in the     C.C.N. Nascimento2 and C.R.P. Paula1
                                                                            1
development of primary cutaneous zygomycosis. The key to survival            Biomedical Science Institute-USP, Sa Paulo, Brazil, 2Universidade
                                                                                                                 ˜o
among these patients is establishment of an early diagnosis, correction     Monte Serrat, Santos, Brazil
of underlying disease process and prompt antifungal therapy combined
with extensive surgical debridement of infected site including the          The genus Malassezia include lipofilic and lipodependent yeasts
healthy areas.                                                              where the only exception is M. pachydermatis. The taxonomic of the
                                                                            genus Malassezia was revised recently, being recognized seven




                                                                                                                              Ó 2009 The Authors
64                                                               Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                              Poster Presentations



species: M. furfur, M. pachydermatis, M. sympodialis, M. globosa, M.         mortality rate was 13.2% in 10 days, 34.5% in 30 days, 43.6% in
obtuse, M. restricta and M. slooffiae. Species of lipodependent               180 days.
Malassezia, considered previously exclusive of the man, they have
been found in domestic and wild animals. It is known that the
genus Malassezia can be found in wild animals and it is not limited
the occurrence in tecidual lesions, being considered part of the
microbiota of several species. It was objective of this work to isolate
                                                        ˜
yeasts of marine birds found in the south coast of Sao Paulo, Brazil.
After the imobilization of each bird, it was collected samples of the
skin of the birds’ legs. They were analyzed three species of birds with
a total of seven animals. They were isolated the following species of
Malassezia for each animal species: Sula leucogaster, Malassezia
sympodialis and M. furfur; Larus dominicanus, Malassezia sympodialis;
Spheniscus magellanicus, Malassezia sympodialis. It is the first isolation
of yeasts of the genus Malassezia of these birds. The genus Malassezia
can be found thoroughly distributed between mammals and wild
birds besides the domestic animals and the man, being part of the
normal microbiota. Its importance as pathogen should be discussed
showing that ecological alterations of the host should be the main
cause of the tecidual alterations associated to Malassezia species.




P103
Epidemiologic analysis and antifungal susceptibility of                      Figure 1 Candidemia in TWMU 2004–2007.
septicaemia due to Candida parapsilosis
Y. Hirai, A. Y. Ainoda, T. S. Shoji and K. T. Totsuka
Tokyo Women’s Medical University, Tokyo, Japan

Objectives: The availability of immunosuppressive and aggressive
chemotherapeutic agents as well as broad-spectrum antimicrobacterial
agents has created a large population of patients with fungal organisms
such as Candida species.We analyzed nosocomial candidemia from
2004 to 2007 in Tokyo Women’s Medical University Hospital. Notably
Candida parapsilosis is the second pathogen of candidemia.We evaluate
the epidemiologic analysis and antifungal susceptibility include
micafungin of C. parapsilosis in the patients with candidemia.
Methods: We merged two databases with electric medical record
and microbacterial laboratory for enrollment of patients with nosoco-
mial candidemia. All of C. parapsilosis isolates from blood culture were
identified by routine microbacterial techniques with Walk Away 96SI
plus (Siemens, German). Additionally they were measured antifungal
susceptibility to amphotericin B, fluconazole, voriconazole, micafungin
by ASTY (Kyokuto Pharmaceutical Industrial Co.,Ltd) colorimetric
microdilution system, adopted with CLSI method. We estimated the
correlation of antifungal MICs between voriconazole and fluconazole,
micafungin and fluconazole, micafungin and amphotericin B. We                 Figure 2 Antifungal susceptibility.
reviewed the background of patients, such as underlying disease and
antibiotic use, vascular catheterization, parental nutrition at diagnosis,
from electric medical chart. And we plot the survival curve in 30 and
180 days by Kaplan-Meier method. Statistic analysis was performed
with the R (freeware version 2.8.1).
Results: In our result of surveillance from 2004 to 2007,All the
189 episodes of candidemia had the following distribution: Candida
albicans (43%), C. parapsilosis (26%), C. grabrata (13%), C. tropicalis
(6%), C. guilliemondii (3%), C. lusitaniae (2%), C. krusei (1%). We
enrolled total 46 episodes of C. parapsilosis nosocomial candidemia. All
the 38 Candida parapsilosis isolates were identified.Resistance to
amphotericin B and fluconazole and voriconazole was not detected.
Resistant to micafungin was detected in one of 38 isolates. But C.
parapsilosis has wide range of antifungal susceptibility to micafungin
(MIC 0.5–16 mcg ml-1).S-DD(MIC 2 mcg ml-1) were detected in 3 of
38 isolates. The correlations of antifungal MICs was detected between
fluconazole and voriconazole by spearman’s rank correlation coeffi-
cient (P = 0.01,R = 0.819). On the other hand, no correrations was
detected in micafungin. Risk factors for septicaemia due to C. parapsi-
losis were broad spectrum antibiotic use at septicaemia (98%),
vascular catheterization (98%), parental nutrition (93%), cancer
(57%), diabetes (39%), corticosteroid (24%), prothetic valve (15%),
pancreatitis (11%), inflammatory bowel disease (9%). The overall
                                                                             Figure 3 MIC correration of antifungal agents.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                              65
Poster Presentations



                                                                                nase) gene was amplified, and digested with BanI. C. parapsilosis, C.
                                                                                metapsilosis, and C. orthopsilosis SADH amplicons contained, respectively,
                                                                                one, three, and zero BanI restriction sites.
                                                                                Results: One hundred and seventy-nine isolates were C. parapsilosis
                                                                                sensu stricto (92.27%), 10 C. metapsilosis (5.15%) and five C. orthopsilosis
                                                                                (2.58%). Two isolates of C. metapsilosis were from genitalia (7.69% of the
                                                                                total isolates from genitalia), one from blood (1.22% of total isolates from
                                                                                blood and other from sterile fluids), three from skin (27.27% of the total
                                                                                isolates from skin), and four from other unknown clinical specimens
                                                                                (17.39% of the total isolates from unknown clinical specimens). C.
                                                                                metapsilosis was significantly isolated with major frequency in skin than
                                                                                other different anatomic origin (P = 0.0003). C. orthopsilosis was
                                                                                isolated in one specimen from genitalia (3.85% of the total isolates from
                                                                                genitalia), one from blood (1.22% of total isolates from blood and other
                                                                                from sterile fluids), one from oral-pharynx mucosa (1.92% of the total
                                                                                isolates from mucosa), and two from other unknown clinical specimens
                                                                                (8.70% of the total isolates from unknown clinical specimens).
                                                                                Conclusion: C. metapsilosis and C. orthopsilosis were identified as
                                                                                the cause of 2.44% (1.22% and 1.22%, respectively) of the invasive
                                                                                candidiasis previously attributed to C. parapsilosis. C. metapsilosis and C.
                                                                                orthopsilosis were also implicated in cases of superficial candidiasis,
Figure 4 Survival curve.
                                                                                with a significant association of C. metapsilosis to skin infections.
                                                                                Funding: Projects GIC07 123-IT-222-07 (Departamento de
Conclusion: C. parapsilosis is the second or third pathogen of candi-           Educacio ´n, Universidades e Investigacio     ´n, Gobierno Vasco), S-
demia in the world. In our investigation, it was responsible for 26% of all     PE08UN35 (Saiotek 2008, Departamento de Industria, Comercio y
candidemia as same as previous report from Spain(Benito et al. JCM              Turismo, Gobierno Vasco) and PI061895/2006 (Fondo de Investigacion         ´
44;5:1681–1685,2006). We conrirmed that antifungal susceptibility to            Sanitaria del Ministerio de Sanidad y Consumo de Espana). ˜
micafungin was almost favorable but extended.We found 2% of resistant
to micafungin. C. parapsilosis is frequently transmitted horizontally via
contaminated external sources such as medical devices and the hands of
health care workers. Major risk factors for septicaemia due to C.
parapsilosis were broad spectrum antibiotic use, vascular catheterization,
                                                                                P105
parental nutrition in hospital environments.We emphasized that the              Candidemia in Norway: a 5 year follow-up of a nationwide
standard precaution such as hand hygiene is effective for prevention            study
against septicaemia due to C. parapsilosis. Because we suspect that C.          I. Nordøy1, P. Gaustad1,2, P. Sandven3 and Norwegian Yeast Study
parapsilosis is responsible for nosocomial infection.                           Group
                                                                                1
                                                                                  Institute of Microbiology, Oslo University Hospital, Rikshospitalet,
                                                                                Oslo, Norway, 2University of Oslo, Oslo, Norway, 3Norwegian
                                                                                Institue of Public Health, Oslo, Norway
P104
Prevalence of Candida metapsilosis and Candida                                  Objectives: A nationwide, prospective candidemia study has been
orthopsilosis among Candida parapsilosis clinical isolates                      ongoing in Norway since 1991. The specific objectives of the study are:
                                                                                (i) to define the incidence of Candida bloodstream infections in Norway;
from a Spanish yeast stock collection during 12 years
                                                                                (ii) to identify the spectrum of pathogens causing Candida bloodstream
I. Miranda Zapico1, E. Eraso1, J. L. Hernandez Almaraz2,
                                          ´
                                                                                infections; and (iii) to obtain antifungal susceptibility data for Norwe-
A. J. Carrillo Munoz3, J. M. Hernandez Molina4 and
                   ˜               ´
                                                                                gian bloodstream isolates. The results for the years 1991–2003 have
G. Guillermo Quindos1  ´                                                        been published previously. This report presents the data for the period
1
  Universidad del Paı´s Vasco, Leioa, Spain, 2Hospital de Cruces,               2004–2008.
                     3
Barakaldo, Spain, ACIA-Microbiologı´a, Barcelona, Spain, 4Hospital              Methods: Candida blood culture isolates from all microbiological
Carlos Haya, Ma  ´laga, Spain                                                   laboratories in Norway (population 4.74 million) have been sent to the
                                                                                national mycology reference laboratory for identification and, with
Candida metapsilosis and Candida orthopsilosis are newly described yeast        three exceptions susceptibility testing.
species closely related to Candida parapsilosis. These new species can not      Results: From 2004 to 2008 a total of 960 episodes of candidemia
be differentiated by conventional methods. There is an increasing               in 913 patients (43.5% women) were reported. The annual incidence
interest in knowing the etiological role of these species as C. parapsilosis    of candidemia increased from 2.5 episodes/100 000 inhabitants
is reported as the second most frequently Candida isolated from blood in        (1991) to 3 (2003) to 4 in 2008. The incidence was highest in
Spain.                                                                          patients <1 years of age and in patients ‡60 years of age. In patients
Objectives: To study the prevalence of Candida metapsilosis and                 ‡80 years the incidence has increased from an annual average of 7.5/
Candida orthopsilosis among clinical isolates previously identified as           100 000 (1991) to 15.6 (2003) to 17 in 2008. Also in the age group
Candida parapsilosis.                                                           ‡70–79 years a marked increase was observed from 6.4 (1991) to 17/
Methods: One hundred and ninety-four clinical isolates from our                 100 000 (2008). A total of 12 different Candida species were identified.
stock collection of yeasts (from 1996 to 2007) were studied, including 82       The dominant yeast species were:
from blood and other sterile fluids, 26 from genitalia, 52 from mucosa, 11
from skin and 23 from other clinical specimens. C. parapsilosis ATCC
22019 and ATCC 90018, C. metapsilosis ATCC 96143 and ATCC 96144                                         2004        2005        2006       2007        2008
and C. orthopsilosis ATCC 96139 and ATCC 96141, were included as                Species                 (%)         (%)         (%)        (%)         (%)
reference strains. Isolates were identified as C. parapsilosis by conven-
tional mycological methods. These species were differentiated by a two-         Candida albicans        67.8        63.7        64.5       73.8        66
step DNA-based identification test and AFLP described by Tavanti et al.          Candida glabrata        11.7        19.2        16.5       11.9        15.7
(Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida    Candida tropicalis      7.7         5.6         8.5        5.7         6.7
parapsilosis groups II and III. J. Clin. Microbiol. 2005; 43: 284–292).         Candida parapsilosis    3.9         2           4          4.3         5.6
Briefly, a 716-bp fragment of the SADH (secondary alcohol dehydroge-




                                                                                                                                  Ó 2009 The Authors
66                                                                   Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



Conclusion: The candidemia incidence in Norway has increased                   P107
from 3 to 4 episodes/100 000 inhabitants from 2003 to 2008. The                Survival frequency after treatment of invasive candida and
species distribution seems stable over all. C. glabrata is still common in     Aspergillus infections in hospitalised patients in Germany,
the elderly, but now occur more frequently in younger age groups. We           Austria and Switzerland (DACH-region) in 2006
have not seen an increase of strains with reduced susceptibility to
                                                                               M.H. Wernitz1, F. W. Leverkus1, C. Lenz1 and U. Gross2
antifungal drugs.                                                              1
                                                                                Pfizer Pharma GmbH, Berlin, Germany, 2National Reference
                                                                               Centre for Systemic Mycosis, Go¨ttingen, Germany


P106                                                                           Objectives: Official statistics about the diagnosis of acute hospital
                                                                               inpatients seems to be more valid to reflect the public health impact of
Oral and denture colonization by Candida and
                                                                               invasive fungal infections compared to official statistics about the
Staphylococcus in denture wearers                                              reasons for death for many reasons. We used the statistics about the
                                            ´                 ´
C. Marcos-Arias, A. Varona, E. Eraso, J. Lopez-Vicente, A. Eguıa,              diagnosis of hospital inpatients from Germany, Austria and Switzerland
A. De Juan, J. M. Aguirre and G. Quindos  ´                                    (DACH-region) to calculate the frequency of acute hospital inpatients
Universidad del Paı´s Vasco, Leioa, Spain                                      with invasive Candida or Aspergillus infections that would have
                                                                               hypothetically survived in the after treatment with either conventional
Introduction: Denture stomatitis (DS) is a common recurring oral               Amphotericin B or Fluconazole as standard antimycotic drugs or with
disease, observed in many denture wearers (DW). The aetiology of the           voriconazole or echinocandins as new generation antimycotic drugs.
disease is multifactorial (denture, smoking, dietary factors, pH) but          Methods: Frequency of inpatients with invasive fungal infections
Candida is a relevant cofactor. Candida adheres and colonizes oral             were multiplied with survival rates of the systemic antimycotic drugs
surfaces including mucosa and acrylic dentures and co-aggregate with           which were observed in prospective double-blinded or open-label
oral bacteria, developing biofilms, which can resist antimicrobials and         randomized clinical trials about the treatment of proven/probable
immune system. This resistance is higher in mixed biofilms of Candida           invasive Candida or Aspergillus infections (extrapolation). Trials were
and Staphylococcus.                                                            identified by systematic MEDLINE and EMBASE literature search using
Objective: To describe the frequency of oral Candida and Staphylo-             the key words ‘survival’, ‘mortality’, ‘lethality’ and ‘death’ in
coccus colonization in DW.                                                     combination with the international nonproprietary names of the
Patients and methods: One hundred DW were randomly recruited                   systemic drugs respectively. Literature search was done in the 50th
from our Odontology Clinics, 45 of them were suffering from DS. Swabs          week of 2008 and last updated on December 30, 2008. Inverse
were taken from the denture and the underlying mucosa. Microbio-               variance method was used to pool survival data if there was more than
logical cultures were performed in Columbia blood agar, and ChromID            one study for one drug available and to calculate 95% confidence
Candida and ChromID S. aureus chromogenic agar plates (Biomerieux,             intervals for all survival frequencies. Calculations were performed
France). Clinical isolates were identified by conventional methods.             using SAS version 9.1 and RevMan 5.0. Frequencies of hospital
Identification of Candida dubliniensis was confirmed by PCR with specific         inpatients with invasive fungal infections were provided by the federal
primers. Slidex MRSA detection test (Biomerieux) was used for the              statistical offices of the corresponding countries. For this, special
evaluation of methicillin resistance (MR).
Results: Seventy nine isolates were yielded from 40 patients suffering
from DS. C. albicans was the most frequent species (58 isolates, 73.4%),
followed by C. glabrata and C. tropicalis (seven isolates each, 8.9%), C.
parapsilosis (2, 2.5%), Saccharomyces cerevisiae (2, 2.5%), and one isolate
(1.3%) each of C. dubliniensis, C. guilliermondii and C. krusei. 55
Staphylococci isolates were yielded from 21 patients suffering from DS.
Staphylococcus aureus was isolated from three patients, S. epidermidis from
14 (two isolates were MR) and S. warneri from 8 (one was MR). In 19
patients with DS there was a mixed colonization by Candida and
Staphylococcus. The most frequent combination was C. albicans with S.
epidermidis (four patients), followed by C. albicans with S. warneri (three
patients). One patient was colonized by C. dubliniensis, C. krusei and S.
aureus. Seventy three Candida isolates were recovered from 38 DW
without DS. C. albicans was the predominant species (43 isolates, 58.9%),
followed by C. tropicalis (11, 15.1%), C. guilliermondii (10, 13.7%), C.
glabrata (7, 9.6%), and C. parapsilosis (2, 2.7%). From 25 DW without DS,
59 Staphylococci isolates were recovered: S. aureus from four patients, S.
epidermidis from 10, S. warneri from 11, and S. capitis and S. saprophyticus
from two each. Thirteen patients were colonized by Candida and
Staphylococcus. C. albicans was most frequently isolated from DS patients
(P = 0.0016) and was present in all patients with type III DS. Conversely,
C. guilliermondii was associated to DW without DS (P = 0.0444).
Conclusions: There is a high colonization with Candida and Staphy-
lococci in DW. There is a close association between C. albicans and DS. DS
could be a potential reservoir for MR Staphylococci as one S. epidermidis
and two S. warneri isolates were MR.
Funding: Projects GIC07 123-IT-222-07 (Departamento de Educa-
  ´                                 ´
cion, Universidades e Investigacion, Gobierno Vasco), and PI061895/
                                ´
2006 (Fondo de Investigacion Sanitaria del Ministerio de Sanidad y
Consumo de Espana). ˜




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  67
Poster Presentations



analysis were performed using the ICD-10 codes B37.1 and B37.5–               this study was to analyze the epidemiological characteristics, the
B37.7 for systemic Candida infections and B44 for systemic aspergil-          microbiology, treatment practices and outcome of zygomycosis in
losis. As the survival frequency depends on the follow-up period, only        Greece. The study is part of the on-going European Zygomycosis Study,
studies with follow-up period of 6–8 weeks were considered for primary        which is under the auspices of ECMM.
analysis whenever possible.                                                   Methods: Each case of zygomycosis is prospectively recorded in a
Results: In 2006, there was a total of 65 494 inpatients with invasive        Case Report Form and sent, either by mail or e-mail, to the department
Candida infection and 6864 inpatients with invasive Aspergillus               of the study co-ordinator (Prof. G. Petrikkos). Data collected include
infection. There were 19 056 hits in the literature search and 13 studies     demographic, clinical and microbiological characteristics. Identifica-
were found to be relevant. For Candida infections, six studies were           tion of zygomycetes is performed by culture, molecular sequencing
excluded from primary analysis as the timeframe of follow-up period was       and/or histology. We present here the results of the first 5 years.
too different compared to the other studies. For aspergillosis, there were    Results: In 5 years, starting from January 2001, 45 cases were
only studies with a follow-up period of 12 weeks available and therefore      reported. Mean age of the patients was 55 years (range 1–87) and 24
all studies were considered for primary analysis. As only adults and          (53%) were male. The most common (80%) underlying diseases and
adolescents were included in the clinical trials for Candida infections,      predisposing factors were hematological malignancies (38%), trauma
2339 inpatients £15 years of age with invasive Candida infection in the       (24%) and diabetes mellitus (18%). The other 20% included other
DACH region were excluded from the basis for extrapolation. For invasive      malignancies, autoimmune diseases and use of deferroxamine. The
aspergillosis, survival frequency was 3707 (CI95% 3266–4187, Amh-             clinical presentation was soft tissue infection in 16, rhinocerebral in 11
otericin B) to 4873 (CI95% 4324–5354, Voriconazole). For invasive             patients, sinusitis in 9, pulmonary in 6 and disseminated in 3. The large
candidosis, survival frequency was 41 682 (CI95% 37 893–44 840,               number of soft tissue infections was mainly due to an outbreak of surgical
Amphotericin B) to 48 629 (CI95% 44 209–53 050, Anidulafungin).               infections which occurred in a single hospital. Cultures were positive in
Considering of excluded studies (sensitivity analysis) would reduce the       31 (69%) cases (Rhizopus sp 58%, Mucor sp. 30%, Rhizomucor 3%,
lower bound of survival frequency in patients with Candida infections by      Apophysomyces elegans 3%, Myocladus ramosus 3%, Sakseanae vasiformis
631 patients to 41 051 patients (CI95% 37 261–44 209, Voriconaz-              3%). Most cultures were also confirmed by molecular methods. Histology
ole).                                                                         was performed in 26 (58%) cases. Medical treatment was given in 38
Conclusions: Our analysis demonstrates the public health impact of            patients (84%) and 18 of these also received surgical treatment. The
invasive Candida and Aspergillus infections in acute hospital inpatients      drugs used were predominantly liposomal amphotericin B either alone or
in 2006 in the DACH region.                                                   in combination with posaconazole. Mortality was 55%.
                                                                              Conclusions: Zygomycosis in Greece is reported to be mainly due to
                                                                              Rhizopus and Mucor spp. The percentage of positive cultures is
                                                                              relatively high, though this may be due to reporting bias. Mortality
P108                                                                          is above 50%. The index of suspicion should remain high in order to
                                                                              diagnose all cases as soon and as accurately as possible in order to
Identification of Malassezia species isolated from scalp skin
                                                                              increase the chance of survival.
of patients with seborrhoeic dermatitis and healthy subjects
                                                                              Acknowledgement: This study was partially supported by the
A. Prohic, E. Kasumagic-Halilovic and N. Hadzigrahic                          ‘Kapodistrias’National Program.
University Clinical center, Sarajevo, Bosnia-Herzegovina

Malassezia yeasts are the causative agents of pityriasis versicolor and
are implicated in the pathogenesis of various dermatoses including            P110
seborrhoeic dermatitis (SD). With the recent taxonomic revisions of the
                                                                              Is invasive fungal infection changing? Epidemiological
genus Malassezia identification of the species are needed to clarify the
involvement of each individual species in the aetiology of disease. The
                                                                              portrait from a portuguese oncology hospital
aim of our study was to analyse the distribution of Malassezia species in                                                        ˜
                                                                              C. Lameiras, A. Martins, P. Silva and M. A. Guimaraes
lesions of SD and in skin of healthy subjects. Forty SD patients with         Portuguese Institute Oncology of Porto, Porto, Portugal
scalp involvement and the same number of clinically healthy
individuals were included in the study. The samples were obtained             Introduction: Progress in the management of invasive mycoses in
by scraping the skin surface of the scalp of all subjects and then            cancer patients will be achieved from a better knowledge of the
incubated on modified Dixon agar. The yeasts isolated were identified           epidemiology of fungal infections, awareness of risk factors for fungal
by their morphological and physiological properties according to              infections in certain sub settings of patients, availability of improved
Guillot et al. method. The most common isolated species from SD               diagnostic tools and a more comprehensive approach to combination
lesions was M. restricta (27.5%), followed by M. globosa (17.5%) and M.       antifungal treatment.
slooffiae (15%). The predominant species from healthy scalp skin was           Objectives: To survey epidemiological changes regarding systemic
M. rrestricta, found in 12 (30%) patients and the prevalence of other         fungal infection agents in cancer patients, due to the introduction of
species was 17.5% for M. globosa, 10% for M. sympodialis, 5% for M.           new azole and candine antifungal treatment in our hospital during the
slooffiae, and 2.5% for M. furfur. We found no significant difference in        last 5 years.
the distribution of Malassezia species between lesional skin in patients      Methods: Epidemiological data of fungal blood isolates from cancer
with SD and healthy skin.                                                     patients admitted at the Oncology Institute of Oporto (IPO-OPORTO)
                                                                              (300 beds) was reviewed from January 2004 to December 2008.
                                                                              Clinical isolates were identified by use of Vitek 1 (Biomerieux), and
                                                                              Microscan (Dade Behringer). Clinical data from patients admitted at
P109                                                                          different departments and the respective underlying diseases were also
Zygomycosis in Greece: report of 45 cases                                     investigated.
A. Skiada1, A. Mitroussia-Ziouva2, A. Antoniadou3,                            Results: From January 2004 to December 2008 a total of 6953 blood
E. Trikka-Graphakos4, N. Sypsas1, M. Aggelopoulou2,                           specimens were received at the Microbiology laboratory: 185 fungaemia
L. Hadjihannas1, J. L. Rodriguez-Tudela5 and G. L. Petrikkos1                 episodes (2.7% of total positive blood cultures) were diagnosed. From
1
 Laikon Hospital, Athens, Greece, 2University of Athens, Athens,              these, 98.9% were identified as yeast and 1.1% due to filamentous fungi.
Greece, 3Attikon Hospital, University of Athens, Athens, Greece,              Candida albicans was the major pathogen (45%) followed by C.
4
 Thriassion Hospital, Athens, Greece, 5Instituto de Salud Carlos III,         parapsilosis, accounting for 40% of the episodes; C. krusei, C. glabrata, C.
Madrid, Spain                                                                 famata and C. tropicalis were less prevalent, corresponding to 3.8%, 3.2%,
                                                                              2.2% and 1.1%, respectively.
Objectives: Zygomycosis has emerged as an important pathogen,                 Conclusion: Our results show a decrease in the incidence of
resulting in systemic fungal infections with a high mortality. The aim of     systemic fungal infection over the past 4 years. The most common




                                                                                                                                Ó 2009 The Authors
68                                                                 Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



non-albicans species was C. parapsilosis, particularly in patients with      diagnosed at the interval of 1 year in an endemic area and discuss the
central intravenous catheter and receiving large-spectrum antibiotics.       climatic anomalies associated with this occurrence.
Very few mould pathogens were responsible for fungaemia cases: two           Methods and results: The endemic area of Botucatu study area is
single strains, one of Acremonium spp and other of Fusarium spp. grew                                                      ˜
                                                                             located in the central-western region of Sao Paulo State, Brazil. From
from blood culture. In spite of the decrease of incidence of haemato-        1966 to 2006, 96 cases presenting the AF PCM were registered. We
geneous infections, in general fungi have increased in the hospital,         then performed a cluster detection test to verify if an excess of cases in
especially non-albicans yeasts and non-Aspergillus moulds, mainly            time and/or space occurred. Calculations were performed with the
from respiratory infections. During the last 5 years, C. albicans and C.     software SaTScan’ v7.0.3. Cluster analysis results include temporal
parapsilosis were the main fungal pathogens responsible for fungal           and space-time clusters with no geographic overlap of clusters allowed
haematogeneous infection; most patients were admitted at the                 and a maximum allowable cluster size of 50% of the population. The
Hematology Unit, Pediatric Unit and Intensive Care Unit. This data           scan test was set to find clusters for the maximum temporal period of
provides epidemiological knowledge supporting the application of             1 year. Mean cases by year was 2.37 (SD: 1.74) for the entire series;
enhanced infection control measures, like improvement of staff hygiene       mean incidence was 0.4 annual cases/100 000 inhabitants. The
protocols, monitoring of catheters and other medical indwelling              temporal test indicated a significant cluster in 1985 (P < 0.005). This
devices, and monitoring of potential sources of fungal contamination.        cluster comprised 10 cases when 2.19 were expected for this year, with
Moreover, it can help in therapeutic strategy for antifungal treatment       a relative risk of 4.98. Their clinical presentation was typical of the AF
of invasive infections in cancer patients.                                   PCM. The space-time cluster included eight cases when 0.89 was
                                                                             expected for that location, with a relative risk of 9.77. The cluster
                                                                             suggests that some particularities took place in the antecedent years in
                                                                             those localities. Diagnostic or reporting methods of PCM could explain
                                                                             variation in incidence. However, practices of the UH were reviewed and
P111                                                                         it was not detected any modification in the diagnostic methods or
Fungus ball sinusitis due to Fusarium proliferatum. Report                   reporting methodology. Evolution of land use showed that no abrupt
of a case and review of the literature                                       change occurred which could also explain this cluster. Instead, we
D.C. Damiani, T. Chouaki, B. Guichard, Y. El Samad, S. Sid Idris,            observed a significant close relationship of climatic factors with
S. Blanpain, S. Testelin and C. Hennequin                                    incidence of AF in the entire series of data. Previous modeling study
CHU D’Amiens, Amiens, France                                                 showed that the most significant required climatic factors are increase
                                                                             of soil water storage 2 years before the probable year of infection
Fungus balls are the predominant clinical form of non-invasive sinusitis.    combined with higher absolute air humidity in the year of infection.
Typically, they occur in immunocompetent patients with an unilateral         Soil water storage was atypically high in the years of 1982/83 (~2.11
involvement of a maxillary sinus, Aspergillus fumigatus being the most       and 2.5 above mean), especially in the cluster area, and the absolute
frequent etiologic agent. We report the clinical case of a 47-year old       air humidity in 1984, the year preceding the cluster, was much higher
immunocompetent female who was diagnosed with a left maxillary               than normal (~1.6 standard deviations above mean), conditions that
sinusitis due to F. proliferatum. Four years ago she had received a root     favored, respectively, antecedent fungal growth in the soil and conidia
canal therapy. CT-scan showed a granulomatous and heterogeneous              liberation in 1984, the probable year of exposure.
thickness of the mucosa organized around a foreign body. Fusarium was        Discussion: PCM still poses several challenges especially regarding
demonstrated in the direct microscopic examination and isolated in           the identification of P. brasiliensis ecological niche. Identifying clusters
heavy growth from the materials collected during a Caldwell-Luc              of PCM in different geographical areas is important because it may help
operation. Morphologic characteristics and TEF1 gene sequence identi-        to clarify the conditions that favor P. brasiliensis survival and growth
fied the strain as F. proliferatum. In vitro susceptibility testing (EUCAST   in the environment and enhance human exposure, thus allowing the
                                                ´´
method performed at the Centre National de Reference des Mycoses et des      development of preventive measures.
Antifongiques, Pasteur Institute, Paris) revealed high MIC against           Acknowledgement: Financial support, FAPESP, CNPQ, LIM.
                             -1
amphotericin B (‡8 lg ml ), Flucytosine (‡64 lg ml-1), Voriconazole
(8 lg ml-1), Itraconazole (‡8 lg ml-1) and Caspofungin (‡8 lg ml-1).
The patient was successfully treated with oral ketoconazole
(200 mg day-1) for 2 weeks. Review of the literature reveals six             P113
additional cases of Fusarium sinusitis. Two immunocmpromised patients        Molecular diversity of Cryptococcus neoformans var. grubii
died with an uncontrolled infection. Characteristics imaging features and    in patients with recurrent cryptococcosis from central to
direct examination demonstrating fungal elements associated with             west London
negative cultures are common features of fungal sinusitis. However,          M.A. Petrou1, J. F. Meis2 and C. H. Klaassen2
identification of the etiologic agent is important for therapeutic            1
                                                                              Imperial College Healthcare NHS Trust, London, United Kingdom,
adaptation. New antifungal agents should be tested as they could             2
                                                                              Canisius Wilhelmina Hospital, Nijmegen, The Netherlands
represented alternative therapeutic strategies.

                                                                             Objectives: Cryptococcosis in immunocompromized patients usually
                                                                             involves Cryptococcus neoformans var. grubii. Even after treatment,
                                                                             recurrent cryptococcosis may occur as the result of unsuccessful
P112                                                                         treatment (possibly as the result of acquired resistance) or by
First description of a cluster of acute/subacute                             reinfection with another isolate. We examined C. neoformans var. grubii
                                                                             isolates from HIV patients from central to west London who suffered
paracoccidioidomycosis cases and its association with a
                                                                             from recurrent cryptococcosis.
climatic anomaly
                                                                             Materials and methods: A total of 32 clinical isolates from 10
G. Benard1, L.V.B. Vizeu Barrozo2, M. E. Siqueira Silva2,                    patients were included in the analysis. The time interval between the
E. Bagagli3, S. A. Alencar Marques3 and R. P. Poncio Mendes3                 episodes was >2 months. DNA was isolated from freshly grown cells
1
                                                          ˜o
 Laboratory of Dermatology and Immunodeficiencies, Sa Paulo,                  using a MagNA Lyser/MagNA Pure protocol. MLVA typing was
Brazil, 2University of Sa Paulo, Sa Paulo, Brazil, 3Sa Paulo State
                         ˜o        ˜o                 ˜o                     performed using a previously reported panel of nine species specific
University, Botucatu, Brazil                                                 microsatellite markers. Amplification products were analyzed on a
                                                                             MegaBACE 500 using established procedures. Data was analyzed using
Introduction: PCM is the most important endemic deep mycosis in              the multistate categorical similarity coefficient.
Latin America. Differently from most endemic mycoses (e.g., blastomy-        Results: In eight patients, the obtained genotypes from different
cosis, coccidioidomycosis, and histoplasmosis), there are no published       episodes were very different from each other. In two patients, identical
reports on outbreaks of PCM. We describe here a cluster of AF PCM cases      or very similar genotype were found in more than one episode.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                    69
Poster Presentations



Interestingly, within an episode (five episodes involving four patients)         Hedi Chaker Hospital. Suspected Invasive aspergillosis cases were
the patients were infected by more than one genotype. In two cases,             classified using the EORTC criteria. We collected weekly environmental
this could be the result of genotypic microvariations as the result of          samples (patient’s rooms, tables and acclimatisers) and clinical samples
microsatellite instability, but in the other cases, the genotypes were too      from each patient (nasal, expectoration and auricular). A total of seven
different from each other to be considered related. A similar observa-          microsatellites markers were selected. Primers were designed with the
tion was made in several patients with a single episode of cryptococ-           software Primer 3, and their specificity was verified by BLASTn.
cosis.                                                                          Results: One hundred and sixty-three neutropenic patients were
Conclusions: Our results show that recurrent cryptococcosis usu-                hospitalized. One proven, 31 probable and 15 possible IA were
ally is the result of reinfection of the patient by a different isolate.        diagnosed. Clinical sampling revealed that A. flavus was the most
Within an episode, immunocompromized patients may be infected by                frequent species (79.2%). From 690 environnemental samples, A.
more than one isolate.                                                          flavus was isolated in the forth rang after Penicillium, Cladosporium and
                                                                                Alternaria. The molecular study of 48 A. flavus isolates detected from
                                                                                clinical and environmental samples confirmed the mycological
                                                                                identification. For the typing of A. flavus isolates, we found a variation
                                                                                from 2 to 7 alleles for each marker. The combination of five markers
P114                                                                            yielded a Simpson’s diversity index of 0.952 and using 12
Mucormycosis: about 11 cases in Sfax (Tunisia)                                  microsatellites this index was 0.97.
S. Neji, F. Cheikhrouhou, F. Makni, A. Sellami, H. Sellami and                  Conclusion: Our findings underline the importance of environ-
                                                                                mental surveillance and strict application of preventive measures. The
A. Ayadi
                                                                                microsatellites approach is very suitable tool for large scale
HU Habib Bourguiba Sfax, Sfax, Tunisia                                          epidemiological studies.

Introduction: Mucormycosis is a potentially fatal, rapidly destruc-
tive, opportunistic infection. It is rarely described in Tunisia in spite of
the conjunction of various supporting factors.                                  P121
Methods and results: We report 11 cases of mucormycosis during                  Fungemia with Saccharomyces cerevisiae – three cases
1998–2009. The patterns of mucormycosis were rhinocerebral (eight
                                                                                A. Gloeckner1, P. Abel2 and K. Zimmermann3
cases) and pulmonary (three cases). The mean age was 51.1 years                 1
(range: 14–76 years). Sex ratio was 2.67. All patients were diabetics.
                                                                                 BDH Klinik Greifswald, Greifswald, Germany, 2University of
For rhinocerebral cases, symptoms were dominated by a facial (50%)              Greifswald, Greifswald, Germany, 3Friedrich-Loeffler-Institute for
or periorbital (37.5%) swelling, a fever (50%), an exophtalmia (12.5%).         Medical Microbiology, University of Greifswald, Greifswald,
Ophtalmoplegia was present in three cases. Hemiplegia was noted in              Germany
two cases. The radiological investigation showed a cellulitis with
sinusal and ethmoidal attack (six cases) with an extension of necrotic          Background: Invasive mycoses in intensive care patients are com-
lesions towards the base of cranium and orbital area in five cases. The          monly due to yeasts. During the past years, fungemia with non-
parotid gland was affected in one case. For pulmonary mucormycosis,             albicans species and uncommon yeasts has gained importance.
clinical findings were non-specific with cough and chest pain. On                 Saccharomyces cerevisiae, a supposedly apathogenic yeast used in
imaging, an excavated opacity was seen in the three cases. For all ours         human food production is indistinguishable from Saccharomyces
patients, the diagnosis of mucormycosis was confirmed by anatomo-                boulardii which has a role in the treatment of persistent diarrhea. We
pathologic and mycologic investigation. Culture was positive for five            present three cases of fungemia with Saccharomyces cerevisiae. Two of
cases (Rhizopus oryzae). All the patients were treated with Amphoter-           these cases occurred during treatment with Saccharomyces boulardii.
icine B (1 mg/kg/day). A surgical excision was associated for                   Cases: (i) A 61 years old male was treated with Saccharomyces
rhinocerebral cases.                                                            boulardii for diarrhea because of complicated hemicolectomy. On day
Conclusions: Mucormycosis is a fulminant affection, concerning                  24, a septic shock with acute renal failure occurred. On this same day,
the vital prognosis. It is due in majority of cases to the Rhizopus. The        Saccharomyces cerevisiae was isolated from three arterial blood cultures.
prognosis depends mainly on the precocity of anatomopathologic and              Therapy with fluconazole for 13 days was successful. (ii) A 69 years
mycologic diagnosis, enabling appropriate treatment. It is important to         old female who had been admitted for septic agranulocytosis, was
suspect mucormycosis in immunocompromised host suffering from                   treated with Saccharomyces boulardii for diarrhea. On day 15 of this
non-specific lesions.                                                            therapy, a sepsis occurred and Saccharomyces cerevisiae was cultured
                                                                                from several blood specimens. Therapy with fluconazole led to
                                                                                defervescence and stabilisation. (iii) Seven days after the onset of
                                                                                Saccharomyces sepsis in the second case, a 76 years old female who was
                                                                                in intensive care after cardiopulmonary resuscitation, became septic.
P115                                                                            As the causal agent, Saccharomyces cerevisiae was identified in a blood
Aspergillus flavus: epidemiological study and molecular                          culture and from the central venous line. This patient had not been
typing in invasive aspergillosis patients                                       treated with Saccharomyces boulardii. After initial application of
I. Hadrich1, F. Makni1, S. Neji1, F. Cheikhrouhou1, A. Sellami1,                fluconazole which turned out to have an increased MIC, therapy was
H. Sellami1, M. Elloumi2 and A. Ayadi1                                          changed to voriconazole and the patient improved.
1
  Laboratory of Parasitology-Mycology, HU Habib Bourguiba Sfax,                 Conclusions: In each case, a bloodstream infection with Saccharo-
Sfax, Tunisia, 2HU Hedi-Chaker Sfax, Sfax, Tunisia                              myces cerevisiae was proven by several cultures. A causal relation to the
                                                                                therapy with Saccharomyces boulardi i is plausible in two cases. In the
                                                                                third case, there must have been another source of infection. Given the
Introduction: Invasive aspergillosis (IA) is a major opportunistic              temporal association with the second case, a transmission by health care
infection in haematology patients. Preventive measures are important to         personnel appears possible. Susceptibility testing of Saccharomyces
control IA because diagnosis is difficult and the outcome of treatment is        cerevisiae seems necessary. The use of probiotic agents in critically ill
poor.                                                                           patients should be considered carefully.
Objectives: We prospectively and evaluate the prevalence of invasive
aspergillosis in the protect unit of haematology and examined the
environmental contamination by Aspergillus. We describe a new panel
of microsatellites for typing A. flavus isolates.
Materials and methods: Three year prospective study (September
2004–September 2007) were carried out in the haematology ward of




                                                                                                                                  Ó 2009 The Authors
70                                                                   Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



P122                                                                           same genotypic profile; i.e., a single strain was the causative agent of
Fungal hospital-acquired infections etiological factors in                     10 cases of fungemia over a short period of time in different patients in
intensive care unit                                                            the same hospital unit.
E. Swoboda-Kopec1, I. Netsvyetayeva1, B. Sulik-Tyszka2,                        Conclusion: Thus, the findings suggest that an outbreak of C. par-
E. Stelmach1, M. Sikora1, S. Blachnio1, M. Dabkowska1,                         apsilosis occurred in the neonatal ICU during the period cited.
M. Dabkowska1 and G. Mlynarczyk1
1
 Medical University of Warsaw, Warsaw, Poland, 2Central Clinical
Hospital, Warsaw, Poland                                                       P124
                                                                               Fungal pathogen epidemiology and susceptibility to seven
The aim of study was to assess species distribution and antifungal             antifungals in West London Hospital’s ICU patients
susceptibility Candida and Candida-related strains isolated from a             M.A. Petrou
group of non-neutropenic adult critically ill patients.                        Imperial College Healthcare NHS Trust, London, United Kingdom
Materials and methods: The study was conducted prospectively
from January 2008 to December 2008 in the Central Clinical Hospital            Candida infections are the fourth most common cause of bloodstream
in Warsaw, Poland. Candida and Candida -related isolates were                  infection whereas in ICU bloodstream yeast infections have been reported
detected from blood, intravascular catheter, bronchoalveolar lavage,           to rank third. There is no general consensus regarding the clinical
tracheal aspirate, swabs taken from mouth lesions, throat swabs, urine         symptoms, the ideal method for proving a fungal infection or the best
and fecal samples. Candida species were identified using API ID 32              antifungal to use in ICU, thus identification and susceptibility of fungi
System. Susceptibility testing was done for amfotericin B, fluconosole,         recovered from ICU patients as early as possible will permit an efficient and
itraconasole, voriconazole, posaconasole and caspofungin using E-test.         safe treatment to commence without delay as it is acknowledged that
The significance of results (MIC values) has been evaluated according           when a patient is treated with life support procedures, immunosuppres-
to CLSI recommendations.                                                       sive drugs and depending on the underlying disease the otherwise
Results: There were 1726 clinical samples analyses and among them              harmless fungi can cause severe and fatal infections. Specimens routinely
77 (4.46%) were positive for fungi. Candida albicans was the predominant       received for microbiological investigation from ICU patients were also
species and accounted for 50.6% (39/77 isolates), followed by Candida          plated onto Sabourauds Dextrose Agar at 30 and 37 °C; a 45 °C plate was
parapsilosis 18.18% (14/77), Candida glabrata 16.88% (13/77), Candida          included for fluids and respiratory samples which were concentrated by
krusei 9.09% (7/77), Candida tropicalis 7.79% (6/77 isolates). Candida         centrifugation. The first yeast for each patient, yeasts suspected or proven
parapsilosis was significantly more common as etiological agent of              to be the cause of infection as well as all filamentous fungi, 1849 isolates
fungemia and catheter-related fungemia (8/10 cases). All strains               from 1128 patients during their stay in ICU were identified to species level;
Candida albicans, Candida parapsilosis, Candida tropicalis were susceptible    these were 1695 yeasts, 255 from blood [Candida albicans (40%),
to fluconasole. The percent of resistance varied as follow: 0% for              C. glabrata (29%), C. tropicalis (11%) and C. parapsilosis (8%), 13 other
amfotericin B, posaconasole and caspofungin; 25.97% for fluconasole;            Candida spp. and nine other Yeast spp] and 154 filamentous fungi (FF)
16.88% for itraconasole. Three isolates of Candida glabrata were resistant     from 11% of patients [Aspergillus fumigatus (77%), five other Aspergillus
to voriconasole.                                                               spp. and six other types of FF]. The MICs of these isolates were performed
Conclusions: (i) This study has shown a significantly higher                    according to CLSI for Amphotericin B (AB), Flucytosine (FC), Fluconazole
presence of non-albicans Candida as fungemia etiological agents in             (FZ), Itraconazole (IZ), Posaconazole (PZ), Voriconazole (VZ) and
non-neutropenic critically ill patients. (ii) Naturally resistance for         Caspofungin (CF). A total of 28 different fungal species were recovered
fluconasole non-albicans Candida species reach almost one fourth of the         from these patients. The MICs of all isolates were £1 mg L-1 for AB.
Candida and Candida-related isolates.                                          Applying the published break-points the activity of the other drugs was:
Acknowledgement: Supported by Polish State Committee for Sci-                  FC- extremely active against all the yeasts with very few resistant, most
entific Research (grant No. N N404 093735).                                     but not all FF had MICs >32 mg L-1; FZ- very active against most yeasts
                                                                               but not C. glabrata, C. krusei, Rhodotorula and Trichosporon and the FF; IZ,
                                                                               PZ and VZ- extremely active against the yeasts and FF, FZ yeast resistance
                                                                               was not necessarily seen with IZ, PZ and VZ; overall CF was the most active
P123                                                                           drug against Candida spp. but not the other yeasts, no activity against
                                                                               Cryptococcus, Trichosporon and with the exception of A. versicolor,
Fungemia by Candida parapsilosis: outbreak in a neonatal                       Fusarium, Fonseca and Mucor it showed good activity against FF, however
intensive care unit of the public hospital in Botucatu, Sao    ˜               no isolate was fully inhibited at 8 mg L-1. PZ activity was the mirror image
Paulo, Brazil                                                                  to that of IZ except for Aspergillus spp. where PZ was the most active drug.
C.R.P Paula1, L. S. Ruiz2, G.C.M. Batista2, E. G. Da Silva1,                   In conclusion the ICU patient is colonised or infected by a large number of
M. de F. Sugizaki1 and A. C. Montelli3                                         opportunistic fungi. Candida spp. and other yeasts were found to be the
1
 Biomedical Science Institute-USP, Sa Paulo, Brazil, 2Universidade
                                     ˜o                                        cause of severe infections however 11% of these patients were either
de Sa Paulo, Sa Paulo, Brazil, 3Universidade Estadual Paulista,
     ˜o          ˜o                                                            colonised or infected with A. fumigatus and other FF, most of which
Botucatu, Brazil                                                               required treatment. All seven drugs showed excellent activity against
                                                                               most of these potentially lethal pathogens however only the activity
Background: Nosocomial infections by Candida albicans, have be-                spectrum of AB covered 100% of the isolates recovered and tested.
come the major cause of mortality in neonates admitted to neonatal
intensive care units (ICUs). C. parapsilosis is the second most frequently
isolated yeast species in neonatal ICUs, is frequently the cause of clusters
and a common source of outbreaks in these units. To determine hospital         P125
outbreaks, the use of phenotypic or molecular markers has become an            Acute respiratory distress syndrome caused by disseminated
important epidemiological tool. In the Neonatal ICU of the Public              acute aracoccidioidomycosis: first case report
Hospital in Botucatu, SP, during the period from 21/09/1998 to 03/11/          G. Benard1, A. N. Costa2, J. Ravanini2, S. G. Goulart3
1998, a total of 11 patients admitted to the unit developed fungemia and       and L. F. Ferraz da Silva2
the etiological agent in all cases was C. parapsilosis.                        1
                                                                                                                                      ˜o
                                                                                Laboratory of Dermatology and Immunodeficiencies, Sa Paulo,
Objective: The objective of this work was to detect the presence of a          Brazil, 2University of Sa Paulo Medical School, Sa Paulo, Brazil,
                                                                                                        ˜o                       ˜o
possible outbreak of hospital infection by C. parapsilosis in this unit. To    3
                                                                                                 ˜o        ˜o
                                                                                University of Sa Paulo, Sa Paulo, Brazil
achieve this, the microsatelite technique was used as a molecular
marker.
Results: Comparison of the genotypes of the 11 samples of C. par-              Introduction: Paracoccidioidomycosis (PCM) is a systemic mycosis
apsilosis obtained by molecular technique revealed that 10 showed the          endemic in South America. This infection may appear in acute-




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                       71
Poster Presentations



subacute or chronic forms. Acute-subacute presentations shows                     P127
reticuloendothelial system involvement but spares the lungs. Acute                Abstract withdrawn.
respiratory distress syndrome (ARDS), has occasionally been described
in other endemic mycoses. We describe the first patient with acute PCM
who developed fatal ARDS accompanied by multiple organ injuries.
The basis of the rarity of this entity in patients with PCM, as well as the
reasons that may have lead to the development of ARDS in this patient
are discussed.
Case report: A previously healthy 22 years old men presented with a
5-months history of weakness, myalgia, adenopathy, night sweats,
weight loss and cough. On admission he was febrile and tachycardic,
with normal blood pressure and generalized superficial adenopathy and
hepatosplenomegaly. Lungs x-ray was normal, but a chest CT showed                 P131
inconspicuous diffuse ground glass micronodular infiltrate and septal
thickening, mediastinal and axilar adenomegaly, and several lytic bone
                                                                                  Occurrence of fungi in a neonatal intensive care unit
lesions; abdominal CT scan revealed hepatosplenomegaly, multiple                  G.C.M. Carla Matuura de Batista1, V.L.J. Lucia Jornada Krebs2,
                                                                                                                                 ´
adenopathy and several lytic bone lesions. A cervical lymph node biopsy           L. S. Silva Ruiz1, E. H. Helena Silva1, E. G. Goncalves da Silva1,
                                                                                                                                     ¸
demonstrated a chronic granulomatous process but no specific agent on              D. Moreira1 and C. R. Rodrigues Paula1
                                                                                  1
usual stains. He evolved with rapidly progressive dyspnea, which                   Instituto de Cieˆncias Biome ´dicas, University of Sa Paulo, Sa
                                                                                                                                        ˜o        ˜o
progressed to respiratory insufficiency that required mechanical venti-            Paulo, Brazil, 2Instituto da Crianca, Sa Paulo, Brazil
                                                                                                                     ¸    ˜o
lation, with a PaO2/FIO2 ratio of 152 and diffuse bilateral infiltrates at
ICU admission. Rare Paracoccidioides brasiliensis yeast cells were identified      Objectives: The study investigated the presence of fungi in the
in a sputum sample. Other infectious agents were discarded by blood and                                                                            ˜
                                                                                  neonatal intensive care unit (NICU) at a Tertiary Hospital in Sao Paulo,
sputum cultures, serology or anamnesis. Pulmonary artery catheteriza-             Brazil.
tion ruled out cardiac dysfunction. The diagnosis of ARDS secondary to            Methods: Samples were collected from the hands of medical staff,
PCM was made, and amphotericin B was initiated. He evolved with                   hospital materials and equipment and the physical environment.
respiratory failure followed by refractory shock and, despite vasoactive          Samples were also collected from insertions in the neonates, such as
drugs administration and ventilation protective strategy, he died on the          catheters and urinary and gastric probes. The samples of Candida
4th day of ICU. Autopsy showed vast areas of necrosis and massive                 isolated from the hands of the medical staff were analyzed molecularly
infiltration of P. brasiliensis of the reticuloendothelial system. Liver           using the PFGE technique.
hystopathology showed granulomatous inflammation mainly in portal-                 Results: Positivity for fungi occurred in 22.2% (14/63) of the
tract, and numerous yeast cells and large areas of necrosis with large            samples. The anemophilous species were Aspergillus sp. and Penicillium
amount of inflammatory cells. In the lungs there were granulomas with              (100%); Cladosporium (62.5%), Mycelia sterilia (25%). Samples taken
rare yeast cells and a miliary distribution,. In addition, there was a diffuse    from the medical staff yielded Candida albicans from the hand of one of
alveolar damage consisting of edema, intra-alveolar hemorrhage, fibrin             the six participants (16.7%); while the samples from medical equip-
deposition, hyaline membrane formation and diffuse interstitial poli-             ment yielded C. glabrata from the extension of an aspirator linked to the
morphonuclear infiltrate and reactive type II pneumocytes, character-              respirator of a neonate. During sample collection, two neonates were
istic of the exsudative phase of ARDS. Foci of bronchopneumonia were              isolated due to fungemia (one by Candida albicans, the other by C.
absent and active search for other infectious etiologic agents in the lung        parapsilosis associated with C. tropicalis). From the hands of a nurse, C.
were negative.                                                                    albicans was isolated prior to washing and after drying demonstrated
Discussion: The contrast between the massive infestation of P.                    from PFGE techinique.
brasiliensis with its consequences to the reticuloendothelial system and          Conclusions: PFGE typing can discriminate species of Candida and
the small and apparently controlled inflammatory response to the                   assist in the investigation of sources of hospital outbreaks. This study
scarce fungal elements in the lung suggests that the ARDS was                     environmental indicate the need for elementary prophylactic measures
triggered by the systemic inflammatory response rather than by the                 to be undertaken in NICUs before outbreaks such as wash hands and
lung infection itself, opposite to the ARDS described in other deep               reduce the dissemination of fungal particles in the air.
endemic mycoses. Studies are needed to better understand the local
and systemic response in severe and disseminated PCM cases, and the
possible correlation with the inflammatory status that potentially leads
to ALI/ARDS. This would provide means to alert for the possibility of
developing such lethal outcome. Financial support, FAPESP, CNPQ,
LIM                                                                               P132
                                                                                  Candida albicans isolated from human fungemia induce
                                                                                  apoptosis in experimental endocarditis
                                                                                  O.F.J.K. Olague1, D.H.M.A. Domınguez-Hernandez1,
                                                                                                                  ´           ´
                                                                                  H.C.I. Hernandez Canaveral1, P.H.A. Plascencia Hernandez1,
                                                                                              ´        ˜                               ´
P126                                                                                             2
                                                                                  O. M. Meilhac and V.R.F. Velarde Rivera  1

Abstract withdrawn.                                                               1
                                                                                   University of Guadalajara, Guadalajara, Mexico, 2Inserm, Paris,
                                                                                  France

                                                                                  Objective: To determine the ability of a C. albicans isolated from a
                                                                                  pediatric patient to induce myocardial tissue apoptosis.
                                                                                  Methods and results: Nonbacterial thrombotic endocarditis was
                                                                                  induced using a catheter left indwelling through the aortic or tricuspid
                                                                                  valve, and animals were injected with a fungi inoculum. 1.56 CFU of C.
                                                                                  albicans (HO7/116), in 1 ml 0.9% saline. Histological and immuno-
                                                                                  histochemical investigations were performed 5 days later. Representa-
                                                                                  tive samples of left sided endocarditis vegetations in rats, including
                                                                                  aortic tissue, aortic valves, and left ventricles were fixed in parafor-
                                                                                  maldehyde for 24 h, embedded in paraffin for morphological analysis.
                                                                                  In the present study, Alcian blue staining revealed the presence of large
                                                                                  positive areas of mucoide substance in the valvular, aortic, and




                                                                                                                                    Ó 2009 The Authors
72                                                                     Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                           Poster Presentations



myocardial tissue in close contact with the vegetations. These areas
were the site in which TUNEL positivity was localized suggesting that
mesenchymatous cell disappearance was topographically linked to
vegetation activities.




                                                                          Picture 3.




Picture 1.
                                                                          Picture 4.


                                                                          Conclusions: In endocarditis, apoptosis could be linked to the ability
                                                                          of intrinsic host and yeast factors. Further studies are needed to
                                                                          determine the role of proteases released by septic vegetation to induce
                                                                          detachment and death of myocytes.



                                                                          P133
                                                                          Tinea capitis in a newborn infected by Trichophyton
                                                                          soudanense
                                                                                                  ´
                                                                          A. Rezusta, M. P. Palacian, M. L. Zubiri, M. J. Hernandez,
                                                                                    ´
                                                                          M. L. Garcıa and M. J. Revillo
                                                                          Hospital Universitario Miguel Servet, Zaragoza, Spain

                                                                          Objectives: To describe the case report of a 12 days old black boy,
                                                                          born in Spain and seemingly healthy who presented a lesion in the
                                                                          scalp, with some hair loss and pustules.
                                                                          Methods: Clinical examination revealed a lesion of three circular
                                                                          eczematous lesions in scalp and face. Skin scrapings and hair samples
Picture 2.                                                                were obtained after cleaning the lesions. Laboratory contacted the rest
                                                                          of the family and samples of hair and scales were taken. The material
                                                                          collected was microscopically examined in 20% KOH and Calcoflour
                                                                          whithe stain for the presence of fungal hyphae and arthrospores, and
                                                                          inoculated on Sabouraud glucose agar (SDA) and potato dextrose agar




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                             73
Poster Presentations



(PDA) both added with chloramphenicol, and dermatophyte test                 P135
medium (DTM). Identification of fungal cultures was made on the basis         Trichophyton yaoundei in Italy: report of a case
of both macroscopic and microscopic appearance according to Sum-                          `
                                                                             C.G. Calabro Gabriella, G. L. Gallo and F. E. Fiammenghi
merbell 2007.                                                                University of Naples Federico II, Naples, Italy
Results: Microscopic and cultural examination were positive for T.
soudanense. The family members showed positive culture for the same
dermatophyte fungus. Previously, the mother and one brother were             We report the case of a 7-year-old boy from an Ivory Coast family who
studied in 2003, and T. soudanense was isolated in both patients.            lives in a little industrialized village in the suburbs of Caserta
Conclusions: When the dermatophyte isolated is antropophilic, like           (Campania, Southern Italy) who went to our observation in December
T. soudanense, all family members need to be diagnosed and treated if it     2008 for the occurrence of multiple, sharply circumscribed, scaling,
was necessary – Its necessary to insist in the correct treatment and         crusting and itching lesions of the scalp and erythematous and scaling
control to avoid relapses and dissemination specially in the groups of       plaques of the trunk. He went on a journey, with his family, to Ivory
people with a difficult following.                                            Coast for a month in August 2008. The patient’s mother referred the
                                                                             appearance of one erythematous and scaling lesion of the scalp in
                                                                             October 2008. He was treated by a dermatologist with oral fluconazole
                                                                             and topical bifonazole for 2 weeks with worsening of the lesions.
                                                                             Fungal cultures analysis on Sabouraud’s dextrose agar had shown the
P134                                                                         development of Trichophyton yaoundei, an anthropophilic dermatophyte
Cumulative diagnostic value of galactomannan and                             which is endemic in Africa. The patient was treated systemically with
                                                                             griseofulvin and locally with econazole for 6 weeks. Complete healing,
anti-aspergillus antibodies detection in children with
                                                                             confirmed by micological examination, was obtained. The growing
haematooncology diseases                                                     racial mixing related to migratory movements is favoring, also in Italy,
V. Arsic Arsenijevic1, E. Ratkov1, S. Mitrovic1, I. Colovic1 and             the integration of this strain with the species which are most
D. Janic2                                                                    commonly responsible for dermatophytoses. To our knowledge, this
1
 Institute of Microbiology and Immunology, Belgrade, Serbia,                 is the first case of not endemic infection by T. yaoundei reported in Italy.
2
 University Children’s Clinic, Belgrade, Serbia                              Increased international migration and tourism is likely to result in
                                                                             more cases of this kind: this pathogen should be considered in the
Invasive aspergillosis (IA) is a serious life-threatening complication in    differential diagnosis of tinea of scalp and body.
immunocompromised children. The incidence of (IA) has increased
significantly in recent decades in parallel with the increasing number
and improved survival of patients. IA in adults has been well
characterized; however, only a few small studies of IA in children
have been reported. Because early diagnosis and treatment are critical
                                                                             P136
to the patient’s outcome, a high index of suspicion should be                Scalp pseudomycetoma caused by Microsporum canis in an
maintained in children with hematologic malignancies who are                 immunocompetent pediatric patient
neutropenic and have prolonged fever that is unresponsive to systemic        R.G. Vitale1, M. Larralde1, A. Castillo1, M. E. Abad1, P. Boggio1,
antibacterials. Detection of circulating antigens, such as galactoman-       M. Label1, M. C. Corbella1, J. Afeltra1, J. F. Meis2 and R. G. Vitale1
                                                                             1
nan (GM), soluble antigen released during hyphal growth in tissues,           Ramos Mejı´a Hospital, Buenos Aires, Caba, Argentina,
                                                                             2
appears promising in aiding in the diagnosis but frequently gives false       Canisius-Wilhelmina Hospital, Nijmegen, The Netherlands
positive results. In high risk children these methods are valuable for
serial screening and early detection of Aspergillus infection. The           Introduction: Pseudomycetoma is an extremely infrequent deep
clinical manifestations are heterogeneous and many organ systems can         skin and subcutaneous tissue infection due to dermatophytes that
be involved. Diagnosis based on the clinical presentation alone is           mainly affect the scalp of children and is commonly preceded by a long-
cumbersome.                                                                  term tinea capitis.
Objectives: The aim of this study was to investigate clinical                Clinical case: A 13-year-old girl presented with a 6 months
usefulness of ELISA tests, for detection of GM and Aspergillus specific       history of two asymptomatic nodules on her scalp. Physical
antibodies in pediatric patients, in the early diagnosis of IA.              examination revealed diffuse white scale and alopecia suggestive of
Methods: From November 2007 until February 2009, serum sam-                  tinea capitis. Two erythematous firm nodules, 1–1.5 cm of diameter
ples obtained from 16 children hospitalized in University Children’s         were also observed that were initially interpreted as inflammatory
Clinic, Belgrade, Serbia were tested for presence of GM and anti-            pilomatrixomas. The patient started oral griseofulvin at a daily dose of
Aspergillus antibodies. All the children had haematological malignan-        20 mg kg-1. After 3 months of treatment, scalp desquamation and
cies and were clinically highly suspected for developing IA. Measuring of    alopecia resolved, but the nodules persisted and increased in size and
GM level was performed by a sandwich ELISA test (Platelia Aspergillus        number. One of them was surgically removed and was sent for
EIA, Bio-Rad, France) while anti-Aspergillus antibodies classes IgA, IgM     histological and mycological evaluation. Histopathology showed a
and IgG were detected at the same time by ELISA test (Serion Elisa           normal epidermis and the presence of aggregates of fine basophilic
classic, Virion/Serion, Germany).                                            granules embedded in a homogeneous eosinophilic matrix sur-
Results: A total of 79 serum samples from 16 children were tested            rounded by a giant cell granulomatous reaction in the deep dermis.
for the presence of GM and anti-Aspergillus antibodies. The group            Periodic Acid Schiff (PAS) stain revealed that those granules consisted
consisted of nine girls and seven boys. Ages of children ranged from         of hyphal aggregates. Direct mycological examination showed hyaline
3 months to 17 years (mean 7.96 years). GM was found positive in             hyphae, but culture on SGA, DTM after 3 weeks of incubation and
25% (4/16) patients without anti-Aspergillus antbody detection. Only         several subcultures to different media, with extended incubation
anti-Aspergillus antbody were detected in 18.75% (3/16) patients,            periods, developed only sterile mycelia. Then, with this criterion, since
while GM was negative. Two patients were both IgM and IgG positive,          the fungus could not be identified, molecular methods were employed.
one patient was IgG positive. In almost half of screened children            The obtained ITS sequence of the isolate proved to be 100% identical
(56.25%) results were negative.                                              to Microsporum canis sequences. Therefore, diagnosis of scalp
Conclusion: Since one of the disadvantages of GM is high preva-              pseudomycetoma caused by Microsporum canis was confirmed.
lence of false positive results in children, further investigations are      Acquired immunodeficiency was discarded. The remaining nodules
needed for evaluating diagnostic value of cumulative detection of GM         were all surgically excided, and medical treatment was rotated to oral
and specific humoral immune response. The implementation of                   terbinafine, 10 mg kg-1 per daily, during 7 months. After 5 months
accurate diagnostic criteria and standardized protocols in children at       of follow-up the girl is free of lesions.
risk is elementary for definite, well-timed early diagnosis and sufficient     Discussion: Fungal mycetoma is chronic infection of the skin and
therapy for a successful outcome of IA in children.                          subcutaneous tissues characterized by tumefactive and indurated




                                                                                                                               Ó 2009 The Authors
74                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



nodular growth, draining sinus tracts and macroscopically visible          Comments: Congenital candidiasis, and especially meningitis is very
granules. Mycetoma of the scalp due to dermatophytes is called             uncommon. As in our case, the low pathogen load has been previously
‘pseudomycetoma’and is an extremely infrequent entity in humans. It        described to cause false negative results at the beginning of Candida
clinically differs from eumycotic mycetomas in that there are larger       congenital infections. The diagnosis of Candida congenital meningitis
lesions, may affect other sites of the body than hands and feet, and do    was made on bases of mother’s obstetric history and response of
not have fistulae. Additional features include the presence of pseudo-      persistent CSF abnormal findings from birth to anti- fungal treatment,
granules as well as different histopathological findings. However, direct   as well as clinical and microbiological response to antifungal treat-
self-inoculation of the microorganism through scratches may also play      ment.
a role in the pathogenesis of this disease. We herein report an
additional case of pseudomycetoma due to Microsporum canis in an
immunocompetent girl, associated with tinea capitis with a good
response to combined surgical and medical antifungal treatment. To         P139
our knowledge, only four pediatric cases of pseudomycetoma attribut-
able to Microsporum canis have been described in the literature.
                                                                           Ventriculitis due to Aspergillus fumigatus in a child with
                                                                           central nervous system tuberculosis
                                                                           C. Antachopoulos1, T. Stergiopoulou1, M. Simitsopoulou1,
                                                                           E. Georgiadou1, S. Kottas1, D. Marinopoulos1, A. Anastasiou2 and
                                                                           E. Roilides1
                                                                           1
P137                                                                        Aristotle University, Thessaloniki, Greece, 2Hippokration Hospital,
Systemic paheohyphomysis due to Exophiala (Wangiella) in                   Thessaloniki, Greece
an immunocompromised child
D. Alabaz1, F. Kibar1, M. D. Sancak2, M. D. Arikan1, M. D. Celik1,         Objectives: Central nervous system (CNS) aspergillosis in immuno-
N. Aksaray1 and M. D. Turgut1                                              compromised patients usually presents with brain lesions (abscesses)
1
 Cukurova University, Adana, Turkey, 2Hacettep University, Adana,
  ¸                                                                        and carries a poor prognosis. Reports of Aspergillus meningitis/
Turkey                                                                     ventriculitis are rare. We present a case of ventriculitis due to A.
                                                                           fumigatus to highlight its features and outcome and we report the
                                                                           results of the intraventricular antifungal activity on systemic antifun-
We report a rare pediatric case of systemic lymphadenitis and hepatic
                                                                           gal therapy.
involvement due to Exophiala (Wangiella) dermatitidis. An 8-year-old
                                                                           Methods: Case report and ex vivo evaluation of antifungal activity of
immunocompetent boy with chronic fever was investigated by
                                                                           cerebrospinal fluid (CSF) against A. fumigatus isolate. The antifungal
sonography and CT scan, demonstrating cervical and mesenteric
                                                                           effect of CSF was studied by incubating undiluted CSF samples for 1/2,
lymph node enlargement and numerous small hepatic lesions. The
                                                                           1, 2 or 4 h with pre-grown hyphae of the patient’s Aspergillus isolate
etiologic agent was isolated from lymph node aspiration culture. The
                                                                           and assessing hyphal damage using a modified XTT assay.
isolate was identified by its morphological characteristics and DNA
sequencing of the internal transcribed spacer region of r DNA. Despite
                                                                           Case and results: We present a case of ventriculitis due to A.
                                                                           fumigatus in a 5-year old girl with refractory CNS tuberculosis. At the time
initial amphotericin B and variconazole therapy, the child’s jaundince
subsided and died 7 months later. In addition to pathogenic aspects of     of presentation she was on isoniazid, rifampin, pyrazinamide, levoflox-
                                                                           acin and high-dose dexamethasone (0.8 mg kg-1 day-1) started 4 weeks
to Exophiala dermatitidis, the diagnostic approaches and relevant
therapeutic strategies are discussed.                                      ago due to neurological complications of tuberculosis. She also had a
                                                                           ventriculoperitoneal shunt due to hydrocephalus. A febrile episode of
                                                                           shunt infection led to removal of the device; cultures of both the valve and
                                                                           catheter revealed A. fumigatus. The patient was started on liposomal
                                                                           amphotericin B (LAMB) at 7 mg kg-1 day-1. Dexamethasone dose was
P138                                                                       gradually reduced. MICs of A. fumigatus isolate to both amphotericin B
Candida congenital meningitis in a preterm neonate                         and voriconazole were £ 0.25 lg ml-1 by CLSI method. Fevers persisted
S. Tadros1, H. Ntouganioti1, A. Mitroussia2, M. Kimouli1,                  and CSF examination revealed neutrophilic pleocytosis with negative
A. Bakossi1, M. Theodoraki1, D. Petropoulou1 and A. Tsakris2               bacterial and fungal cultures. Aspergillus PCR in the CSF was positive as
1
 General Hospital of Nikea, Nikea, Greece, 2Medical School,                well as galactomannan index (5.5). An MRI brain scan revealed no new
University of Athens, Athens, Greece                                       parenchymal lesions; however, areas of increased signaling in the
                                                                           ventricles suggested ventriculitis. Voriconazole (8 mg kg-1 day-1) was
                                                                           added while rifampin was discontinued to avoid interference with
Introduction: Candida congenital meningitis in neonates is very            voriconazole metabolism. Intraventricular administration of amphoter-
rare.                                                                      icin B deoxycholate (DAMB) was also commenced at a dose of 5 mg,
Case: A set of female dizygotic twins, were born 32 weeks of               followed by 2.5 mg every other day for 1 month. Fevers subsided and CSF
gestation. Twin A died within few hours, while twin ‘was transfered        galactomannan ratios gradually decreased, becoming persistently
to our NICU. Their mother was treated for cervical incompetence and        negative after 3 months of antifungal treatment. Duration of therapy
vaginal candidiasis during the second trimester of her pregnancy. Baby     with LAMB and voriconazole was 4 and 5 months respectively. During
‘was started on empiric antibiotic therapy, because of elevated CRP,       the first month of combined systemic and intraventricular antifungal
and very low CSF glucose level. Blood and CSF cultures were negative.      treatment CSF was collected after intraventricular DAMB administra-
On day eight, the neonate looked slightly unwell, LP was repeated. CSF     tion, at 2 h as well as at 48 h (i.e. before the next intraventricular dose).
glucose remained very low, protein level was high with pleiocytosis        The mean hyphal damage (two separate experiments) caused by CSF
(478 cells mm3, and lymphocyte predominance), indicating chronic           samples obtained 2 h post-DAMB administration was 78%, 93%, 97%
meningitis. Blood and urine cultures were sterile. PCR for bacterial       and 96% for 1/2, 1, 2 or 4 h incubation periods respectively.
genomes, HSV, CMV, enteroviruses, ureaplasma, and Candida albicans         Corresponding hyphal damage values obtained with CSF collected
were negative. Stool cultures grew Candida albicans. U/S and MRI brain     48 h post-DAMB administration were 28%, 57%, 57% and 71%
showed mild signs of ventriculitis, while ophthalmologic and cardio-       (P < 0.01 by two-way ANOVA).
logic screenings were normal. Wide spectrum antibiotics were initiated.    Conclusion: Aspergillus fumigatus ventriculitis appears to be suc-
On day 40 (fourth week of antibiotic), LP showed the same findings as       cessfully managed using combined systemic (LAMB, voriconazole) and
above, but this time CSF culture was positive for Candida albicans.        intraventricular (DAMB) treatment. In particular, intraventricular
Antifungal therapy was given for 4 weeks. At the end of therapy, LP        DAMB administration appears to be well tolerated and significantly
and brain MRI findings were normal. The baby remained clinically well       augments antifungal activity against A. fumigatus hyphae.
throughout therapy.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   75
Poster Presentations



P140                                                                           and T. tonsurans – 13.7% and 5.9% respectively- and T. mentagrophytes
Early mannan detection in bronchoalveolar lavage fluid                          (1.9%).
reduces the incidence of invasive Candida infections in                        Conclusion: The toothbrush method appears a reliable painless and
high-risk preterm infants                                                      more expedient way to obtain positive cultures from children with
M.S. Sanguinetti, B. Posteraro, S. Boccia, E. De Feo, M. La Sorda,             tinea capitis so treatment and epidemiological surveillance can start
                                                                               earlier to the benefit of the patient and his environment.
M. Tana, C. Tirone, C. Aurilia, V. Vendettuoli, G. Fadda,
C. Romagnoli and G. Vento
          `
Universita Cattolica del S. Cuore, Roma, Italy
                                                                               P142
Objective: To investigate whether early detection of Candida man-              Malassezia furfur isolation from non-cutaneous clinical
nan in bronchoalveolar fluid (BAL) reduces invasive fungal infection
                                                                               samples
(IFI) and mortality among very low birth weight (VLBW) infants.
                                                                               V. Lopes1, P. Fernandes2 and H. Ramos1
Methods: We conducted an observational study of infants with birth             1
weight of <1275 g and gestational age of <28 weeks, where a
                                                                                Centro Hospitalar do Porto, Porto, Portugal, 2Neonatal and
retrospective cohort under surveillance with traditional culture               Paediatrics Intensive Care Unit, Porto, Portugal
methods was compared with a prospective group defined after the
initiation of routine use of Candida mannan detection in BAL fluid. In          Objective: Malassezia furfur, a skin colonizer is a lipophilic yeast
both groups the antifungal treatment with liposomal amphotericin B             capable of invading bloodstream and cause systemic disease in
was started based on positive microbiological (surveillance culture or         association with catheters and parenteral lipid nutrition. The purpose
mannan antigen) results. Data on several predictors of IFI and                 of this study is to report three cases of Malassezia furfur infections in
mortality were collected from both groups.                                     infants born prematurely.
Results: IFI was observed for 12 (32.4%) of 37 infants in the                  Methods: We report three cases of Malassezia furfur isolation in
retrospective group, and for 0 (0%) of 29 infants in the prospective BAL       blood samples and catheter tip of infants born prematurely and
mannan group (P = 0.001). Among 14 infants in the retrospective                presenting several complications: two first infants had serious bron-
group with surveillance culture positive, 12 (85.7%) developed IFI             chopulmonary dysplasia and the third one had intestinal disease and
(P < 0.0001). We observed no statistically significant difference in            was submitted to surgical intervention. They all were low birth weight
mortality rates (13 of 37 infants in the retrospective group vs. four of       prematures, had long ICU stay, vascular catheters and were in
29 infants in the BAL mannan group; P = 0.09), in spite of only two            parenteral lipid nutrition. The blood samples studied were whole blood
deaths (12.5%) among 16 infants with antigen positive results.                 in EDTA tubes and sediment of centrifuged bloodcultures for the first
Conclusions: This study suggests that Candida mannan detection in              two infants. For the third infant only the catheter tip was sampled and
BAL fluid may be useful for earlier identification and more accurate             we used the roll tip technique. Sabouraud agar overlaid with oil was
targeting of preterm NICU infants at high risk of IFI.                         the culture medium available for isolation and cultivation of Mala-
                                                                               ssezia.
                                                                               Results: The main clue of Malassezia detection was the observation
                                                                               of characteristic budding yeasts in peripheral blood smear in one of the
                                                                               cases. The fungus was then easily isolated from blood in Sabouraud
P141                                                                           agar overlaid with olive oil after day three of incubation. In the
Assessment of laboratory methods for the diagnosis of                          catheter tip case small colonies appeared in blood agar medium at day
tinea capitis in children in Athens, Greece                                    three. After Gram stain the typical yeasts were observed and then
V. Athassopoulou, H. Papadogeorgakis, G. Katsadiotis, P. Balkoui               cultivated in Sabouraud with olive oil. In the latter case Malassezia was
and E. Koumantakil                                                             recovered because of the remains of lipids in the catheter tip. We also
‘A. Sygros’ University Hospital, Athens, Greece                                used parallel cultures without olive oil in all cases to confirm there was
                                                                               no growth. Only one of the infants with Malassezia isolated from blood
                                                                               was treated with amphotericin B. The two patients with the yeasts in
Background: Tinea capitis is a common dermatophyte infection of                blood died but as far as we know the yeasts were not the direct cause.
the scalp of the children. Since clinical diagnosis can be challenging as      The third patient is still alive.
symptoms can greatly vary, laboratory confirmation is always needed.
                                                                               Conclusions: We concluded that Malassezia furfur infections can be
The traditional method of scraping scale and hairshafts can be a time
                                                                               misdiagnosed since the yeast requires special media for growth.
consuming method and sometimes a cumbersome process.
                                                                               Although in our case reports Malassezia, apparently could not be
Objective: The objective of this study was to compare and evaluate             implicated in the morbidity and mortality there are reports of serious
the classical method of scraping the scalp with scalp massaging by a           infections. It is though important to be aware and to recognise the risk
toothbrush and a cotton swab in order to increase the speed and                factors that can lead to serious infections and to include the
sensitivity of diagnosis of tinea capitis in symptomatic patients.             microbiological methods suitable to detect Malassezia in the set up
Children were examined at the Outpatient Department of the Peadiatric          work of the patients at great risk.
Dermatology Clinic of the ‘A.Sygros’ University Hospital for Skin and
Venereal Diseases in Athens, Greece and had a clinical diagnosis of
tinea capitis.
Methods: In 107 children aged 10 months to 16 years (mean age 7.3              P151
years) we had applied the above mentioned three different ways of              Cutaneous and pulmonary pheohyphomycosis (spp
collecting material for laboratory investigation. Collection of the samples    alternaria infectoria) at a non transplantanted patient
was done under the Wood’s light where this was helpful. We had used            M. Androulaki1, E. Andrikos1, A. Tsinta1, A. Saganas1, E. Pappas1,
duplicate series of 2% Sabouraud Glucose Agar supplemented with                M. Pappas1, V. Baka1 and A. Velegraki2
chloramphenicol and cycloheximide at 26–28°°C.                                 1
                                                                                General hospital of Ioannina G. Hatzikosta, Ioannina, Greece,
Results: Out of a total of 107 samples, 48 had microscopical findings           2
                                                                                Athens University, Athens, Greece
suggestive of dermatophyte infection whereas 51 gave positive
cultures. All methods revealed the aetiological agent. Cultures obtained
by the toothbrush method turned positive significantly faster with an           Objectives: We describe the case of systemic alternariosis due to
average of 4.5 days with the swab method coming next – average                 Alternaria Infectoria spp in a patient with membranous nephropathy.
6.5 days. The classical method became positive later – average                 This is the first case of such an infection reported in Greece.
10.2 days. The predominant dermatophyte was Microsporum canis                  Methods: Forty-eight year male was referred to our clinic with
(78.4%). Other dermatophytes were the anthropophilic T. violaceum              severe nephrotic syndrome and hypertension. Until the time of refer his
                                                                               medical history was free. Percutaneous kidney biopsy revealed




                                                                                                                                 Ó 2009 The Authors
76                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



membranous nephropathy and immunosupression was started with                 malities, and eradication or reduction of fungal burden recommended
prednisolone per os at a daily regime of 1 mg Kg-1 BW-1. Two months          by MSG/EORTC.
later and during the period of cortisone tapering, the patient developed     Results: A total of 204 patients with hematological diseases were
multiple reddish-brown nodules in both legs. At the time of the              retrospectively analyzed. For prophylaxic use of intaconazole, the
presentation this lesions were painless and the patient had no fever or      treatment success rate of oral solution was 75.8% (25/33) and that of
other symptoms. There was no history of trauma. Skin biopsy was              capsules was 62.8% (27/43). Treatment success rate of intravenous
provided as well as culture sample from the nodules. Within the next         itraconazle for IFI was 50.0% (7/14). No severe adverse effects of grade
days our patient developed productive cough without fever or dyspnea.        3 or 4 were observed.
Routine laboratory tests revealed a significant rise of the erythrocyte       Conclusions: Prophylaxis of fungal infection by itraconazole oral
sedimentation rate, CRP was above normal levels. During this period of       solution and treatment of IFI by intravenous itraconazle are effective
follow-up kidney function was normal and stable. Chest Xray revealed         for Japanese neutropenic or immunocompromised patients with
multiple infiltrates in both lungs that were absent 2 months previously.      hematological diseases, even for those who have received stem cell
CT scan revealed smaller infiltrates that were undetectable with the          transplantation, intensive chemotherapies or immunosuppressive
simple Xray. Our patient underwent FNA under CTscan control and              treatment. Prospective randomized studies are necessary to confirm
bioptic specimen after the direct examination was cultured in                the utility of itraconazole and to compare the effects of itraconazole
sabouraud dextrose agar. Within 10 days fungal growth was obtained           with those of other antifungal drugs.
in all cultures. Microscopic examination of the colonies revealed
multiple darkly pigmented conidia and the fungus was identified as
alternaria infectoria. Identification was performed at Athens University
Mycology Center. Fluconazole was started at a daily regime of 400 mg
during a period of 6 months and prednisolone dose was reduced.               P153
Results: Skin and pulmonary lesions regressed and by the time of             Incidence of fungal infection or colonization in a solid organ
12 months patient had a chest X-ray with no sign of infiltrates and           transplant recipients
only skin hyperpigmatation was present at the point of the nodules.          I. Netsvyetayeva, E. Swoboda-Kopec, M. Sikora, S. Blachnio,
Additionally cortisone therapy was stopped due to proteinuria                P. Fiedor, L. Paczek, A. Chmura and G. Mlynarczyk
management. It is important to underline that therapy plan did not
                                                                             Medical University of Warsaw, Warsaw, Poland
include surgical remove of the skin lesions. One year after our patient is
feeling well he has no signs of recidive.
Conclusions: Pheohyphomycosis refers to a subcutaneous and sys-              Objective: Evaluation of fungal infection frequency in patients
temic infection caused by dark- walled hyphae in culture and tissue.         undergoing solid organs transplantation and in group of organ donors
Pheohyphomycotic agents are culprits for severe infections at immu-          hospitalized in The Infant Jesus Clinical Hospital in Warsaw in 2008.
nocompromiced patients, mostly those who have undergone solid organ          Material and methods: The group of 147 liver, kidney, simulta-
transplantation. Until today more than 100 different species have been       neous kidney pancreas transplant recipients as well as 20 organ donors
isolated. The most common human pathogen of all is alternaria alternata      were analyzed. The study included specimens that contained strains
Spp. Alternaria infectoria has rarely been reported as culprit of severe     isolated from: urine, blood, specimens from respiratory and digestive
disease in humans. Correction of the predisposition factors along with       tracts and swabs from other sites of infection. In the group of organ
antimycotic agents leads to control of the infection and finally successful   donors strains were isolated from: respiratory tracts – 16 samples, urine
treatment.                                                                   – seven. The clinical materials from solid organs recipients consisted of:
                                                                             blood – six samples, bile – three, sputum – 12, urine – 119, tracheal
                                                                             aspirate – five, swabs from upper respiratory tract – 41, peroperative
                                                                             clinical material- 10, specimens from digestive tract – 12 and drain
P152                                                                         swabs – seven. The specimens, which were cultured using standard
Itraconazole oral solution and intravenous itraconazole for                  mycological procedures, had been inoculated into Sabouraud medium
fungal infections in patients with hematological diseases in                 with antibacterial protection using chloramphenicol and gentamicin
Japan                                                                        (bioMerieux, France). Isolated strains were identified by CHROMAgar
S. Hashino, J. Iwasaki, K. Okada, A. Shigematsu, M. Onozawa,                 medium (Becton Dickinson, USA) and biochemical test ID 32C
T. Kondo and M. Asaka                                                        (bioMerieux, France).
Hokkaido University, Sapporo, Japan                                          Results: From 244 clinical samples 268 yeast-like fungal strains and
                                                                             one mould strain were cultured. The most common isolates were yeast-
                                                                             like fungi of the genus Candida glabrata – 104 (38.6%), Candida albicans
Objectives: Itraconazole oral solution and intravenous itraconazole          – 101 (37.5%), Candida tropicalis – 19 (7%). The total number 25 yeast-
have been available for fungal infection since late 2006 in Japan.           like fungal strains were cultured from organ donors, the most often
However, there have been few clinical studies on the efficacy of those        Candida albicans – 64%. In the group of solid organs recipients
drugs in Japanese neutropenic or immunocompromised patients with             transplant 243 yeast-like strains and one strain of mould of the genus
hematological diseases. Therefore, we conducted a retrospective survey       Fusarium spp. were cultured. Among of these the main groups of
to determine the usefulness of prophylaxis with itraconazole oral            isolates were: Candida glabrata – 104 (42.6%), Candida albicans – 85
solution and to compare the efficacy of the drug with that of                 (34.8%), Candida tropicalis – 16 (6.5%) and others – 38 (15.5%). The
itraconazole capsules, and we also analyzed treatment success with           permanent colonization of urinary tract by fungal flora occurred in 12
intravenous itraconazole for invasive fungal infection (IFI).                patients among of recipients group. The invasive fungal infection were
Methods: The subjects of the study were patients with hematological          developed in 10 patients.
diseases who received stem cell transplantation, intensive chemother-        Conclusion: (i) Mycological cultures of the clinical specimens most
apies, or immunosuppressive treatment during the period from                 commonly showed strains of Candida glabrata – 38,6%, species
September 2006 to February 2009. Both itraconazole oral solution             naturally resistant to fluconazole. (ii) The developing of non-albicans
and capsules were administered at a dose of 200 mg once a day for            fungal infection may be correlated with long term colonization.
prophylaxis. Intravenous itraconazole administration was started at an
                                                                             Acknowledgement: Supported by Polish State Committee for Sci-
initial dose of 200 mg · 2 day-1 for 2 days followed by 200 mg day-1
                                                                             entific Research (grant No. N N404 093735).
for treatment of IFI. Treatment success of prophylaxis by itraconazole
oral solution and capsules was defined as the absence of proven,
probable or possible IFI until the end of administration. Treatment
success of IFI by intravenous itraconazle was defined as survival within
the prespecified period of observation, resolution or improvement of all
attributable symptoms and signs of disease and radiological abnor-




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   77
Poster Presentations



P154                                                                          related to the low fungus load. Real time PCR has been developed to
Screening for galactomannan and anti-Aspergillus                              provide sensitive and objective detection of Pneumocystis from respira-
antibodies in haematological patients suspected for                           tory specimens. Our purpose was to improve the diagnosis of Pneum-
developing invasive aspergillosis                                             ocytis Pneumonia (PCP) in immunocompromised patients. From
                                                                              January 2005 to Mai 2009, we prospectively investigated respiratory
E. Ratkov1, A. Vidovic2, N. Suvajdzic Vukovic2, A. Dzamic1 and
                                                                              specimens from immunocompromised patients either HIV infected
V. Arsic Arsenijevic1                                                         persons or HIV uninfected subjects (haematological malignancies,
1
 Institute of Microbiology and Immunology, Belgrade, Serbia,                  cancer, patients receiving prolonged corticosteroid therapy or intensive
2
 Institute of Hematology, Clinical Center of Serbia, Belgrade,                immunotherapy) with clinical or radiological suspicion of PCP. Samples
Serbia                                                                        were subjected to microscopic examination first. Real time PCR was
                                                                              performed when conventional stains were negative. Primers and probes
Invasive fungal infections (IFI) continue to cause considerable               used for Real time PCR assay were targeted on the MSG (Major Surface
morbidity and mortality in patients with haematological malignancies.         Glycoprotein) gene of P. jirovecii. Samples were treated with Uracyl DNA
Since late 1980s, the epidemiology of IFI has changed with a trend            Glycosylase to avoid samples contamination with DNA amplicons.
towards a reduction in invasive infections caused by opportunistic            Internal positive control has been included to assess PCR inhibition
yeasts and an increase in invasive mould infections, particularly             related to the respiratory samples. Positive BAL was used as control
caused by Aspergillus spp. Invasive aspergillosis (IA) can involve any        material. Negative BAL and water controls were included in each run as
organ, but most commonly involves sinopulmonary tract reflecting               contamination controls. Real time PCR assay was used in a qualitative
inhalation as the principal portal of entry. Survival of patients from        fashion: a sample is positive when an amplification curve is observed
such life-threatening disease depends on early diagnosis, but clinical        whatever the crossing point. To decrease PCR positive results due to
manifestations of IA and standard laboratory methods are often unable         colonization or asymptomatic carriage of Pneumocystis, PCR results
to diagnose the infection in its early stages. Therefore, serology tests      were interpreted in conjunction with clinical or radiological data to
present a good alternative for early diagnosis of IA. Glactomannan            assess significance for patients. 725 respiratory specimens, negative on
(GM) is a major aspergillus cell-wall constituent released during fungal      conventional stains, have been tested during the study. Diagnostic
growth, while antibodies are produced during fungal infection and             strategy consisted of Bronchoalveolar lavage fluids in 683 specimens,
both of them can be detected in human body fluids.                             bronchial aspiration in 16 samples, sputum in 15 specimens, induced
Objectives: The aim of this study was to investigate cumulative               sputum in 6 samples and pulmonary biopsy in 5 samples. Among the
diagnostic potential of screening for GM and anti-Aspergillus antibodies      specimens, 145 additional samples, corresponding to 142 patients, were
in adult hematological patients at high risk for developing IA.               positive on real time PCR assay corresponding to an increase of 20% in
Methods: From November 2007 through February 2009 serum GM                    the rate of PCP diagnosis. Non HIV immunocompromised patients were
and anti-Aspergillus antibody levels were measured in 150 adult               predominant (125 patients, 88%)/They suffered from hematologic
patients with heamatological malignancies hospitalized at Institute of        malignancies (42%); solid tumors (19.7%); solid organ transplants
Hematology, Clinical Center of Serbia. Circulating Aspergillus GM was         (6.3%)or received immunosuppressants for systemic diseases (16%). 117
detected using a sandwich ELISA test (Platelia Aspergillus EIA; Bio-          (82%) patients were treated with trimethoprim-sulfamethoxazole. In
Rad, France). The detection of anti-Aspergillus antibody was performed        conclusion, Real time PCR assay is a rapid method (less than 3 h
using ELISA test (Serion Elisa classic; Virion/Serion, Germany).              including DNA extraction, amplification and interpretation) compatible
Results: A total of 371 serum samples from 150 patients were                  for routine use in a Parasitology-Mycology laboratory increasing the
collected and analyzed for presence of GM and anti-Aspergillus antibodies.    detection of Pneumocystis jirovecii in respiratory specimens compared to
Both GM and anti-Aspergillus antibodies were negative in 79/150               conventional stains. Real time PCR assay is of interest in non-HIV
(52.66%). GM was found positive in 25.3% (38/150). The GM index in            immunocompromised patients who develop Pneumocystis pneumonia
positive serum samples ranged from 0.54 to 9.73 (mean 4.90). 36.8%            with lower fungus rates than AIDS patients.
(14/38) of GM positive patients was died as a result of IA, in the moment
of reporting results. In GM positive patients anti-Aspergillus antibodies
were detected in 47.37% (18/38). All three classes of antibodies were         P156
positive in 2.63% (1/38), both IgA and IgG were positive in 2.63% (1/         Effect of Candida tropicalis in planktonic and biofilm form
38), IgM and IgG in 13.16% (5/38), IgA in 2.63% (1/38), IgM in 7.89%          on urinary epithelial cells
(3/38) and IgG in 18.42% (7/38). Only anti-Aspergillus antibodies were        M. Henriques1, M. Negri1, L. M. Lopes1, T. Svidzinski2, J. Azeredo1
positive in 33/150 (22%).                                                     and R. Oliveira1
                                                                              1
Conclusion: In almost 1/4 haematological patients GM was posi-                 University of Minho, Braga, Portugal, 2Universidade Estadual de
tive, and half of GM positive patients also had detectible humoral                   ´,         ´,
                                                                              Maringa Maringa Brazil
immune response, while 1/5 of patients has only antibody without GM.
Early diagnosis of IA still presents a challenge. Combination of several
non-culture assays is necessary for laboratory diagnosis of IA in high        Candida tropicalis has been reported to be one of the Candida species
risk patients. No single test is sufficient for diagnosis. For better          which is most likely to cause bloodstream and urinary tract infections
correlation of laboratory findings with clinical diagnosis further             in hospitals being responsible for a high rate of patients’ mortality.
investigations are necessary and will lead to improved outcomes of            Adhesion to host surfaces (epithelial cells and medical devices), as well
IA in the future.                                                             as biofilm formation, are considered the first step to initiate Candida
                                                                              infection. Hence, the colonization of indwelling devices like urinary
                                                                              catheters by C. tropicalis poses a critical problem. Therefore, more
                                                                              knowledge has to be acquired in order to understand and prevent the
                                                                              formation of these biofilm infections.
P155                                                                          Aim: The aim of this study was to investigate the influence of
                                                                              C. tropicalis growth form (planktonic or biofilm) in its adhesion to TCC-
Real Time PCR for detection of Pneumocystis jirovecii from                    SUP cells (human urinary bladder).
respiratory specimens in Immunocompromised patients                           Materials and methods: This study was conducted with one
F. de Monbrison and S. P. Picot                                               isolate of C. tropicalis obtained from a patient with candiduria admitted
Hospices Civils de Lyon, Lyon Cedex 04, France                                to the intensive care unit at the University Hospital in Maringa,       ´
                                                                                     ´
                                                                              Parana, Brazil and C. tropicalis ATCC 750 was also used, as a control.
Pneumocystis jiroveci is an important cause of pneumonia in immuno-           Adhesion assays were performed incubating one silicone cupon with
compromised individuals. This fungus cannot be cultured by routine            pre-formed C. tropicalis 24 h biofilm or 1 ml of C. tropicalis cell
methods and the diagnosis, based on microscopic examination, requires         suspension (1.0 · 107 cells ml-1), at 37 °C, on a confluent layer of
expertise for accurate identification. Moreover, the sensitivity rate of       epithelial cells. The extent of adhesion was evaluated after 2 h of
staining techniques decreases in non-HIV immunocompromised patients           incubation using an adaptation of the crystal violet staining method.




                                                                                                                                Ó 2009 The Authors
78                                                                 Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                             Poster Presentations



                                                                            Case report: A 79-year-old woman presented with one-month
                                                                            history of ocular pain in her right eye without loss of visual acuity.
                                                                            Eighteen months prior to presentation she had undergone a bilateral
                                                                            pterygium excision. There was not other remarkable medical history.
                                                                            Ophthalmological examination with slit-lamp biomicroscopy showed a
                                                                            focal necrotic area in the nasal sclera of the right eye, no corneal
                                                                            infiltrates were present, no exudates in the anterior chamber were
                                                                            observed. Laboratory studies did not furnish evidence of any under-
                                                                            lying autoimmune systemic disorder. Because of the necrotizing
                                                                            scleritis, a scleral patch graft was performed and topical and oral
                                                                            steroids started, but the graft failed within 1 month of surgery and a
                                                                            second scleral patch graft was needed and azathioprine added.
                                                                            However, the second patch graft failed again and a third scleral patch
                                                                            graft was carried out. Cyclophosphamide was added to the immuno-
                                                                            suppressive therapy and oral voriconazole administrated for 2 weeks.
                                                                            Three months later, because of the progression of the illness,
                                                                            evisceration of the right eye was performed.
                                                                            Results: Microbiological cultures of the ocular samples collected
                                                                            during the three scleral grafting were negative and histopathological
                                                                            studies reported non-specific chronic inflammation and fibrosis.
                                                                            Pathologic sections of the eviscerated eye showed areas of acute and
                                                                            chronic inflammation with focal necrosis. Periodic acid-Schiff and
                                                                            Gomori methenamine silver stains revealed irregularly branched
                                                                            septate hyphae. Cultures of the eye samples revealed after 4 days the
                                                                            growth of numerous white cottony colonies that became brownish
                                                                            gray. Microscopic examination showed septate hyaline hyphae with
                                                                            brown ovoid unicellular conidia growing on a solitary conidiophore
                                                                            cell or laterally on hyphae. The fungus was morphologically identified
                                                                            as Scedosporium apiospermum, but sequence analysis of the ribosomal
                                                                            internal transcriber spacer region ITS1 and ITS2, showed a 99%
                                                                            homology with Pseudallescheria boydii (CBS 101724) and 98.6% with
                                                                            Scedosporium dehoogii (MUCL 20263).
                                                                            Discussion: Because recent molecular data have shown that the
                                                                            apparently single morphological species Pseudallescheria boydii includes
                                                                            eight different phylogenetic species and these species demonstrated
                                                                            different virulence in animals, morphological identification of these
                                                                            funguses will be confirmed by molecular methods, in order to know if
                                                                            the complex has different human virulence or antifungal resistance.
                                                                            The final characterization of our isolate needed the knowledge of the b-
Moreover, cell viability was also assessed, after contact with yeasts,      tubulin gene sequence. The probable final identification as S. dehoogii
either by trypan blue staining and using 3-(4,5-dimethylthiazol-2-yl)-      reinforces the experimental high virulence demonstrated for this
5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)           species.
viability assay. Samples were also observed under scanning electron
microscopy (SEM).
Results: From the results obtained it was possible to verify that, in
general, Candida cells adhered to epithelium (Fig 1). Furthermore, the
clinical isolate biofilm cells adhered in higher extent than planktonic      P158
cells. Nevertheless, comparing both strains, it can be highlighted that     Building work in a paediatric haematology/oncology unit:
the reference strain grown planktonically adhered significantly more         successful strategies to prevent invasive fungal infection in
(P < 0.05) to epithelial cells than C. tropicalis from candiduria, which
                                                                            immunocompromised patients during construction of
was confirmed through ultra structure analysis by SEM (Figure 1). C.
                                                                            HEPA-filtered cubicles
tropicalis in biofilm form caused higher epithelial cells death than their
planktonic counterparts (Figure 2). Moreover, epithelial cells showed       H. Kennedy, B. Gibson, P. Joannidis, B. McCormack and
less metabolic activity when in contact with biofilms.                       C. Williams
Conclusions: Thus, it is possible to conclude that C. tropicalis were       Royal Hospital for Sick Children, Glasgow, UK
able to cause more epithelial cell death when in biofilm form. This
highlights the importance of biofilm formation, associated to the use of     Background: Hospital building work has been identified as a risk
urinary catheters, on C. tropicalis virulence.                              factor for invasive fungal infection (particularly with Aspergillus
                                                                            species) in immunocompromised patients. In the paediatric haematol-
                                                                            ogy/oncology ward and bone marrow transplant (BMT) unit of the
                                                                            Royal Hospital for Sick Children, Glasgow, building work to upgrade
P157                                                                        two existing BMT HEPA-filtered cubicles and construct two new HEPA-
Exogenous Scedosporium endophthalmitis in necrotizing                       filtered cubicles started in September 2006. However, a lack of suitable
anterior scleritis                                                          alternative accommodation for patients necessitated the continued use
                                                                            of the remainder of the unit, including the four other existing HEPA-
    ´
F. Sanchez-Reus, M. A. Gil Arnal, N. Dominguez Agustin,
                                                                            filtered cubicles.
                                            ˜
Y. Gonzalez Atienza, R. M. Mocanu, M. Espanol Sabate and
                                                                            Objectives: Implementation and monitoring of protective strategies
P. Coll Figa                                                                to safeguard immunocompromised paediatric haematology/oncology
Hospital Sant Pau, Barcelona, Spain                                         patients and prevent the development of invasive fungal infection
                                                                            during a 4-month period of building work.
Objectives: To report a case of exogenous Scedosporium endoph-              Methods: Prior to the commencement of any work, a pre-emptive
thalmitis in a patient with a surgically induced necrotizing anterior       strategy was devised by the Infection Control Team. Impermeable
scleritis who underwent three scleral patch grafts.                         barriers constructed of polypropylene board were fitted and sealed from




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                79
Poster Presentations



floor to ceiling between the work site and remaining ward area.                    gangrenosum and T cell lymphoproliferative lesion. The diagnosis of
Visquine plastic sheeting was then used to line the polypropylene board           patient was evaluated as combined bacterial and fungal infection plus
on the work side and the work area was maintained under negative air              pyoderma gangrenosum. Thus, the patient was treated with itraco-
pressure. The building site was only accessible via an external flat-              nazole, sulbactam/ampicillin, metil prednizolon, topical naftifin and
roofed area of the hospital which was also used for removal of all                fucidic acid. Along with this treatment, the chemotherapy protocol was
rubble. Ward cleaning was increased. An antifungal prophylaxis policy             continued.
to cover the period of building work was implemented and an extensive             Conclusion: Although Acremonium spp. are rarely isolated from
programme of air sampling for fungi was commenced. Pressure                       superficial or subcutaneous skin infections, it was isolated from skin
differential readings were monitored and particle counting was                    lesion of our patient due to underlying malignancy. Therefore,
performed in the existing, in-use HEPA-filtered cubicles. Particle counts          mycologist should be alert about opportunistic fungal infections,
at other sites within the ward and in outside air were also measured.             especially hyaline hyphomycetes as in our case and apply an early
Results: Ninety-one percent of all samples collected in the existing              mycologic investigation.
HEPA-filtered cubicles yielded no fungal growth. Mean spore counts (in
cfu m-3 of air) of (a) total fungi and (b) Aspergillus spp. in these cubicles
were 0.23 and 0.09 respectively, in patient rooms with standard
filtration, 3.86 and 1.07, in the ward corridor at the clean side of the work
area, 2.84 and 1.16, at the ward site furthest away from the building             P160
work (the unit’s main entrance), 4.42 and 1.63 and outside, in the                Epidemiology of oral yeast carriage and candidiasis in
hospital grounds, 14.0 and 4.0. The fungal counts within the unit were            patients with haematological malignancies, solid tumors
acceptable relative to baseline data for this area. Aspergillus versicolor was    and head neck cancer
cultured from the air in 8.1% of total internal samples, Aspergillus              S. Schelenz1, S. Abdullah1, G. Gray1, H. Stubbings1, I. Gow1,
fumigatus from 2.3%, Aspergillus ustus from 1.2%, and Aspergillus niger           P. Baker1 and P. Hunter2
                                                                                  1
and Aspergillus flavus from 0.6%. In contrast, A. fumigatus was cultured            Norfolk and Norwich University Hospital, Norwich, UK, 2UEA,
from all external air samples and A. versicolor from 20% of these. The            Norwich, UK
mean decrease in particle counts in the existing, occupied HEPA-filtered
cubicles relative to outside air was 99.3%. During the period of building
and 6-months follow-up period there were no cases of invasive fungal              Objective: The aim of this study was to assess and compare the
infection.                                                                        incidence of oral yeast carriage and infection amongst cancer patients
                                                                                  at a large regional UK cancer center. The epidemiology, independent
Conclusion: The construction and renovation work within this
                                                                                  risk factors, yeast species distribution and anti-fungal susceptibility are
haematology/oncology unit has provided state-of-the-art accommoda-
                                                                                  being described.
tion and equipment for the treatment of paediatric patients with cancer
and the protective measures and extensive monitoring employed were                Methods: This prospective, observational study was undertaken in
successful in safeguarding this same patient group from invasive fungal           2005 at the Norfolk and Norwich University hospital, UK. Adult
infection.                                                                        patients (age ‡ 18) diagnosed with solid tumor, head-neck cancer or
                                                                                  haematological malignancy were recruited into the study. Demo-
                                                                                  graphic data on age, gender, type of cancer, reason for admission
                                                                                  (radiotherapy, chemotherapy, investigations, terminal care), treat-
                                                                                  ment with antibiotics and anti-fungal agents, preceding chemother-
P159                                                                              apy regimen, radiation, surgery and presence of dentures were
Isolation of Acremonium spp. from subcutaneous skin lesion                        recorded on admission. An oral examination was performed and
of a patient with chronic lymphocytic leukemiatext                                microbial swabs obtained for yeast culture (CHROMager), identifica-
                                        ¨
S.E.M.A. Keceli Ozcan, D. Dundar, A. Akturk Sikar and R. Kiran                    tion (API 20C AUX) and antifungal susceptibility testing (NCCLS
Kocaeli University, Kocaeli, Turkey                                               broth microdilution and disc diffusion assay). Full ethical approval
                                                                                  was obtained and all patients provided consent prior to entering the
                                                                                  study.
Objectives: Fungi of the genus Acremonium are environmental
                                                                                  Results: A total of 400 patients were recruited in to the study. There
saprophytes and rarely human pathogens. In immunocompetent
                                                                                  were 188 (47%) male and 212 (53%) female patients with a mean age
individuals, Acremonium spp. mainly cause foot mycetoma or corneal
                                                                                  of 61 years (range 18–90 years). Oral yeast carriage was prevalent in
infections after inoculation during penetrating injuries. Acremonium
                                                                                  56.8% (227/400) of all cancer patients and 18.9% (43/227) of those
spp. are being increasingly recognised as opportunistic pathogens.
                                                                                  had clinical and microbiological evidence of oral candidiasis. Patients
Here, we report a case of skin lesion of which Acremonium spp. isolated
                                                                                  with haematological malignancies had the highest incidence of oral
from a patient with chronic lymphocytic leukemia (CLL).
                                                                                  infection (13.5%) followed by head neck cancer (12.3%) and solid
Methods: The patient was 76 years old and CLL for 5 years. A wound                tumor patients (9.4%). The presence of white plaques correlated well
lesion on distal part of left lower leg was the first clinical manifestation of
                                                                                  with clinical signs and symptoms of oral candidiasis (P = £ 0.05;
the patient. Dermatological exam revealed an edematous, erythematous
                                                                                  OR = 14.7; 95% CI = 6.034–36). A logistic regression analysis of risk
and infiltrated 5 · 7 cm plaque with irregular borders and central ulcer
                                                                                  factors for yeast carriage and infection identified age and dentures as
surrounded by hemorragic crusts. There were no sinus tract or grains.
                                                                                  independent factors associated with oral yeast carriage whereas
Several swab and skin biopsy cultures were taken with a preliminary
                                                                                  gender, previous antibiotics or chemotherapy were statistically not
diagnosis of fungal skin infection, leukemic infiltration or pyoderma
                                                                                  significant. A total of 269 yeast isolates were recovered from 227
gangrenosum. Fungal cultures were performed on Sabouraud’s dextrose
                                                                                  patients. C. albicans was the dominant (74%) species causing coloni-
agar (SDA) and incubated at both 37 °C and 26 °C. Routin bacterial
                                                                                  zation and infection with an incidence of 497.5 per 1000 cancer
cultures and pathologic examination of the biopsy specimens were also
                                                                                  admissions. The remaining 26% of cases were due to non-C. abicans
performed.
                                                                                  strains consisting of 16 different yeast species. C. glabrata (11.5%) was
Results: After, one week of incubation, white fungal colonies were                the commonest non-C. albicans species followed by C. tropicalis (2.6%),
observed on SDA. On multiple passages at 26 °C, white tufted colonies             C. krusei (2.6%) C. parapsilosis (1.9%), C. cerevisiae (1.5%) and other
had formed. On microscopic examination, with lactophenol cotton                   yeasts (5.7%). The overall resistance to azoles was 28.2% (75/266).
blue, septate hyphae, conidiogenous cells and needle-shaped phialides             Highest resistance was noted for ketoconazole (11.3%), followed by
decorated with ellipsoidal conidia with rounded edges were seen.This              itraconazole (10.9%), fluconazole (4.5%) and caspofungin (4.5%)
fungus was identified as Acremonium spp.on the basis of its colony                 whereas resistance remained low for voriconazole (0.75%), nystatin
morphology and its morphology on microscopic observation of the                   and amphotericin B (0%, respectively).
lactophenol cotton blue preparations. On bacterial cultures, Enterococ-
                                                                                  Conclusion: Patients with haematological malignancies demon-
cus faecalis, E. cloacae Enterococcus faecalis, E. cloacae and Candida
                                                                                  strate a higher prevalence of oral candidiasis compared to other cancer
albicans were grown. Pathologic invastigation resulted as pyoderma
                                                                                  types. C. albicans remains the predominant strain followed by C.




                                                                                                                                    Ó 2009 The Authors
80                                                                     Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



glabrata. The overall anti-fungal drug resistance is low and flucoazole,       galactomannan, aspergillus PCR and panfungal PCR were negative.
nystatin or amphotericin B continue to be useful empirical agents.            Multiple blood cultures were negative for fungal etiology. The nodule
                                                                              on upper leg was removed surgically. However because of the
                                                                              anatomical localization the second nodule on distal tibia could not be
                                                                              removed by surgery. He is still on oral voriconasole treatment with
P161                                                                          partial response for noduler lesion on distal tibia.
A rare case of cutaneous hyalohyphomycosis                                    Conclusion: Every skin lesion in immunocompromised patients
                                                                              should be carefully examined for the possibility of infections. A rapidly
A. Rosmaninho, V. Lopes, G. C. Velho and M. Selores
                                                                              growing lesion with an area of central necrosis is the typical clinical
Centro Hospitalar do Porto-HSA, Porto, Portugal                               manifestation of cutaneous Aspergillosis involvement. These skin
                                                                              lesions might occur as the first clinical manifestation of disseminated
Paecilomyces lilacinus (P. lilacinus) is a ubiquous, saprophytic fungus of    disease. Early diagnosis and rapid initiation of systemic effective anti-
environments from decaying vegetation to contaminated medical                 fungal treatment for cutaneous aspergillosis is important for successful
materials. Although Paecilomyces spp rarely infect humans, they can           outcome in immunocompromised patients.
produce serious infections in immunocompromised hosts and are
becoming a prevalent source of infection in such individuals. We
report a case of a 63-year-old man that was under immunosupressive
treatment because he has been submitted to a renal transplant 1 year          P163
before; he presented to our consultation with several painful,
                                                                              variations in serum galactomannan level in patients with
violaceous nodules of the left foot with 5 months of evolution. Punch
biopsies of the skin lesions revealed a suppurative and granulomato-
                                                                              proven and probable aspergillosis
sus process and PAS staining demonstrated budding yeast and septate           U. Nawrot, K. Kalwak, M. Ussowicz, M. Pajaczkowska and
hypha. In tissue culture grew a lilac-colored cottony colony.                 A. Chybicka
Paecilomyces lilacinus was identified as the pathogen agent. Treating          Wroclaw Medical University, Wroclaw, Poland
P. lilacinus infections is also challenging due to discrepancies between
in vitro and in vivo data. At the present time there is no standard           Galactomannan (GM) is an accepted diagnostic marker of invasive
treatment for P. lilacinus infections, and can include surgery and/or         aspergillosis (IA) in immunocompromised patients. The study presents
antifungal therapy. When using antifungal therapy, systemic imidaz-           the variations of serum GM index (GMI) during the course of aspergillosis
oles seemed to be the best option. Our patient was succesfuly treated         treatment in five patients classified according to EORTC/MSG criterion to
with a long course of itraconazole. To our knowledge, only 16 cases           groups with either proven (PvA) (n = 2) or probable aspergillosis (PbA)
of Paecylomyces infections in solid organ transplant patients have            (n = 3). Patient A, 16-year-old girl with AML developed disseminated
been reported and only 10 cases were due to P. lilacinus.                     microabscesses in the brain during induction chemotherapy. The
                                                                              cerebrospinal fluid was positive for GM (0,7), however serum samples
                                                                              remained negative. Pathological findings in biopsy confirmed aspergil-
                                                                              losis, whereas mycological examinations were negative. Patient B (17-
P162                                                                          year-old girl with ALL after HSCT; lesions in lungs and liver), patient C
Cutaneous aspergillosis in an acute lymphoblastic leukemia                    (5 months old boy with SCID after HSCT; lesions in lungs), and patient D
patient after allogeneic hematopoietic stem cell                              (36 -year-old women with ALL and lungs involvement) showed high
transplantation                                                               GMI in the serum, ranging up to four. The values of GMI diminished
              ¸                                     ¨
G. Ozlem tunccan, A. Sahika Zeynep Aki, A. Nalan Akyurek,                     below 0.5 in patients B and C, which correlated with good clinical
    ¨
S. Gulsan Sucak and S. Esin                                                   response to antifungal therapy (L-AmB/voriconazol treatment in patient
Gazi University Faculty of Medicine, Ankara, Turkey                           B or L-AmB in patient C). Both pts B and C received subsequent secondary
                                                                              therapy with posaconazole. In patient D the serum GMI grew from 0.45,
Infections are one of the major causes of mobidity and mortality              when treatment was started, to 3.2, which was consistent with observed
after haematopoietic stem cell transplantation (HSCT). Opportunistic          clinical refractoriness to the therapy (L-AmB, voriconazole). Patient E, 3-
infections including Aspergillus species are the major pathogens in           year-old girl with AML, developed multiple pulmonary lesions during re-
HSCT recipients during severe immunosuppression. Despite efffective           induction chemotherapy. The samples obtained during thoracoscopic
anti-fungal treatment more than half of the transplant patients with          lung biopsy were negative for fungi, however significant clinical
invasive aspergillosis die because of infection. Although lung and            improvement was observed after combined therapy with caspofungin
sinuses are accepted as the primary portal of aspergillus hyphae,             and voriconazole. The progression of pulmonary lesions (bilateral
primary cutaneous aspergillosis (PCA) might be a rare form of                 disseminated abscesses and cavitations) was observed when patient
locally invasive disease in transplant patients under severe immu-            underwent hematopoietic stem cell transplantation. High serum GMI
nosuppression. Here we report a case with acute lymphoblastic                 (4.4–1) persisted for 4 weeks of antifungal therapy and subsequently
leukemia (ALL) who underwent allogeneic HSCT and developed PCA                diminished below 0.5. GMI values lower than 0.1 were observed during
during acute graft-vs.-host disease (aGvHD) associated severe                 next 5 months. Despite clinical improvement massive cavity in left lung
immunosuppression.                                                            was observed on CT and surgical resection was performed. Mycological
Case: A 26 year- old man with the diagnosis of T cell ALL underwent           examination revealed biomass of fungal hyphae typical for Aspergillus,
                                                                              but the culture was negative. Both GM testing as well as quantitative PCR
allogeneic HSCT in second complete remission. He received cyclosporin
A and long- term methotrexate as GvHD prophylaxis. He developed               from tissue homogenisate were positive for Aspergillus. One month after
acute overall grade II skin GvHD on day +28 after HSCT. Because of            surgery the serum GMI is still negative, patient is recovering well and
                                                                              remains on posaconazole therapy. Presented cases illustrate that
corticosteriod refractory skin GvHD he received mesenchymal stem
cells on day +94 after HSCT. On day +143, during steroid dose                 negative results of GM in serum do not preclude aspergillosis, especially
                                                                              if infection is localised out of the respiratory tract. Switching to negative
tappering after the resolution of skin GvHD findings, he developed fever
                                                                              GMI usually corresponds well with clinical outcome, however not always
unresponsive to antibacterial treatment and skin lesions including
1 · 2 cm ecchymotic nonulcerated nodular lesion on the upper third            means complete Aspergillus eradication. Comprehensive analysis of risk
                                                                              factors, clinical symptoms and laboratory data remain the only way to
of the left leg and 3 · 2 cm ecchymosis nonulcerated nodular lesion on
the distal third of the right tibia. Histological examination of the biopsy   diagnose invasive mycoses in immunocompromised patients.
specimen from the nodular lesion on the upper leg showed LPG positive
branched aspergillus hyphae in deep dermis and subcutaneous adipose
tissue consisting with cutaneous aspergillosis. Infections of sinuses and
pulmonary cavities were excluded by paranasal computerised tomog-
raphy (CT) and high resolution CT of lungs. Molecular analysis for




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                      81
Poster Presentations



P164                                                                         Microsporidia are opportunistic pathogens, recently categorized as
Distinctive ROS function induced by Aspergillus nidulans                     fungus, which cause localised or disseminated disease in immunocom-
and Aspergillus fumigatus during in vitro phagocytosis by                    promised patients. Only two cases of invasive Microsporidiosis, all fatal,
X-CGD monocytes                                                              have been previously reported in HSCTR (Table 1). We present here the
                                                                             first case of disseminated microsporidiosis in an allogenic HSCTR who
S.S.V. Henriet, A.J.M.M. Rijs, P. E. Verweij, P.W.M. Hermans and
                                                                             survived the infection.
A. Warris
                                                                             Methods: Retrospective analysis of clinical chart and microbiology
Radboud University Nijmegen Medical Center, Nijmegen,                        results.
The Netherlands                                                              Results: An allo-HSCT was performed in June 2008 to treat Hodgkin
                                                                             Lymphoma in a 49 year-old female patient. The patient presented
Objectives: The underlying mechanisms of the detrimental interac-            many infectious complications and received large spectrum antimicro-
tion between Aspergillus nidulans (AN) and children suffering from           bials. While being persistently neutropenic, and on treatment with
chronic granulomatous disease (CGD), compared to the more common             teicoplanine, meropenem, gancyclovir, atovaquone and voriconazole,
encountered mould Aspergillus fumigatus (AF) remains unsolved. In            she developed on Day +60 fever, diarrhoea, dyspnoea and confusion,
order to unravel the development of invasive aspergillosis (IA) in CGD       followed by symptoms suggestive of meningeal involvement. A cerebral
patients and to determine the background of more specific host-               CT scan was unremarkable. A pulmonary CT scan was non-specific,
immune reactions, susceptibility to phagocytosis, H2O2, and the              with interstitial infiltrates. A bronchoalveolar lavage (BAL) revealed
influence on human leucocyte oxidative response were studied.                 90 cells ml-1 with a mononuclear predominance. A lumbar puncture
Methods: Clinical AF and AN strains isolated from X-CGD patients             showed no cerebral spinal fluid (CSF) pleocytosis. The fungi-fluor stain
suffering IA, were used. Growth-rates and cell-free H2O2-induced             of the BAL (Table 1) showed small intracellular yeast-like structures
damage were determined by a spectrophotometer at 450 nm wave-                compatible with Microsporidia. The same microorganism was identified
length for 48 h. Oxidative burst activity, expressed as the relative         in peripheral blood and stools. Both BAL and CSF were positive for
fluorescence intensity (RFI) of dihydrorhodamine related fluorescence,         Microsporidia by PCR. The sequencing showed 99% (288/290 bp)
was analyzed by FACScalibur. Monocytic differentiation of the mye-           homology with Encephalitozoon cuniculli chromosome I. No other
lomonoblastic cell-line PLB-985 and its transgenic analogue gp91phox         pathogen was identified. The disease was successfully treated with oral
(X-CGD cell line) was induced by 100 nmol L-1 1,25(OH)2D for 4 days.         albendazole and donor lymphocyte infusions. Fumagillin treatment
Granulocytes from unrelated healthy donors were isolated by Ficoll           was not considerer after identification of Encephalitozoon cuniculli.
density gradient.
Results: Phagocytosis of AN conidia was significantly lower by
healthy and X-CGD monocytes compared to those ingesting conidia of
AF (both P < 0.05). Also the efficiency of uptake, which indicates the %
of internalized conidia from all cell-associated conidia, was found to be
significantly lower for AN compared to AF conidia by healthy and X-CGD
cells (both P < 0.01). As phagocytosis is associated with the generation
of ROS and activation of signaling pathways, influence on leucocyte
oxidative response was analysed after 30 min stimulation with resting
live conidia. A significantly higher ROS production was measured after
AN stimulation compared to AF, both in healthy as in X-CGD monocytes
(both P < 0.01). Even more, comparing the RFI of X-CGD monocytes
stimulated by either PMA or conidia, a significant higher ROS production
by AN stimulation compared to PMA was seen. In contrast, stimulation
by AF conidia was comparable to PMA stimulation. The higher ROS
stimulation of AN in monocytes is in line with the oxidative response
found in healthy granulocytes: live resting conidia of AN induce a
significant higher oxidative response in healthy granulocytes compared
to AF (P < 0.05). Fungicidal capacity of ROS was evaluated and the 10-
3
  mol L-1 H2O2-induced damage to swollen AF conidia was found to be
significantly greater than to AN and sustained up to 18 h (P < 0.01).
Growth-curves of AN at 10-3 mol L-1 H2O2 were even similar to their
negative controls, reflecting a complete H2O2-insusceptibility. No
differences in growth inhibition was found between resting conidia or
hyphae of both species at 10-3 mol L-1 H2O2.
Conclusion: Comparing AN and AF at their initial steps towards
host-invasion: AN showed to be more resistance to the phagocytic
capacities of mononuclear phagocytes compared to AF; Live AN
conidia induce a higher oxidative response of the phagocytic cells
compared to AF, while swollen AN conidia showed to be completely
resistant to direct H2O2-induced damage in a cell-free culture. These
results are strengthening the hypothesis that ROS play distinctive roles
                                                                             Conclusion: Microsporidiosis is     a    rare   complication    in
in the host-defense against AN compared AF.
                                                                             HSCTR, with non-specific presentation, difficult diagnosis and
                                                                             management. Fungal stains such as fungi-fluor are useful for early
                                                                             diagnosis but species identification requires molecular biology
                                                                             techniques. Albendazole is an active drug against Encephalitozoon
P165                                                                         genera while fumagillin is also active against Enterocytozoon, but
Systemic microsporidiosis in an allogenic haematopoietic                     extremely myelotoxic. Prognosis is poor. This is the first reported
stem cell transplant recipient (HSCTR)                                       case of disseminated microsporidiosis with meningeal involvement,
J. Ambrosioni, K. Bouchuiguir-Wafa, Y. Chalandon, J. Passweg                 successfully treated in a HSCTR.
and C. Van Delden
University Hospitals of Geneva, Geneva, Switzerland

Objectives: Invasive fungal infections are a substantial source of
morbidity and mortality among immunocompromised patients.




                                                                                                                               Ó 2009 The Authors
82                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                             Poster Presentations



P166                                                                        experienced pain in her left eye and visited the eye clinic. She
Efficacy outcomes in a randomized trial of liposomal                         presented with a red left eye, a decreased visual acuity of Hand
amphotericin B (L-AMB) based on Revised EORTC/MSG 2008                      Movements or 1/300, and high intraocular pressure (30 mmHg). In
definitions of invasive fungal disease (IFD)                                 addition, a hypopyon and fibrin was seen in the anterior chamber.
O.A. Cornely1, J. Maertens2, M. Bresnik3, R. Ebrahimi3, E. Dellow3,         Fundus examination was impossible due to a dense vitreous haze.
                                                                            There were no signs or symptoms of keratitis or systemic inflam-
R. Herbrecht4 and P. J. Donnelly5
1                                                                           mation. An intravitreal biopsy was performed and Gram staining
 University Hospital of Cologne, Cologne, Germany, 2University              showed leukocytosis without bacteria. Treatment according to the
Hospital Gasthuisberg, Leuven, Belgium, 3Gilead Sciences, Foster            endophthalmitis protocol was started with intravitreal, local and
City, CA, USA, 4University Hospital of Strasbourg, Strasbourg,              intravenous vancomycin and ceftazidime. Five days after the
France, 5University Medical Center St Radboud, Nijmegen, The                puncture Fusarium spp. was cultured and treatment was changed
Netherlands                                                                 in local amphotericin B and intravenous voriconazole, a loading
                                                                            dose of 400 mg twice a day, followed by 300 mg twice daily. In
Background: In 2008 EORTC/MSG published revised consensus                   addition, a complete pars plana vitrectomy with lense extraction was
definitions for diagnosis (Dx) of IFD with standardized inclusion criteria   performed, in an attempt to evacuate as much pus as possible. The
for clinical trials. A prospective trial of L-AMB in invasive mold          retina already showed severe ischemia, with necrosis and vessel
infections (AmBiLoad) used modified EORTC/MSG 2002 criteria. We              occlusions. Amphotericin B was left intravitreally. Unfortunately, we
reevaluated response and survival based on the 2008 revision.               were not able to perform a species differentiation, but the antifungal
Methods: Patients with allogeneic HSCT or absolute neutrophil               susceptibility test showed MIC voriconazole 4 mg L-1, amphotericine
count <500 ll-1 within 14 days of study entry with other hematolog-         B 2 mg L-1, posaconazole 2 mg L-1, caspofungin 16 mg L-1. There-
ical conditions were recruited on the basis of halo or air crescent sign    fore, we decided to treat her with local administration of amphot-
on chest CT. Cases were originally classified as probable IFD and were       ericine B and systemic voriconazole for 3 months. Despite this long
redefined as possible IFD using EORTC/MSG 2008 criteria. Patients            term treatment, the vision of her left eye showed no improvement.
received L-AMB 3 mg kg-1 day-1 (3 mg) or 10 mg kg-1 day-1 (10 mg)           This is the first report of Fusarium endophthalmitis associated with
for 14 day, followed by 3 mg kg-1 day-1 for all patients. Favorable         intravitreally administered bevacizumab and prednisolone. Fusarium
response at EOT, and 12 week survival results from the trial were           endophthalmitis may occur in immunocompetent individuals after
reclassified according to 2008 definitions.                                   ocular surgery, such as cataract extraction, or as a complication of
Results: 201 patients had IFD according to the trial definition of           advanced keratitis. In severely immunocompromised patients hae-
whom 118 (59%) had Dx based on chest CT halo signs and host factors         matogenous spread may result in disseminated fusariosis. In our
only: 3 mg: 62 (9 allo-HSCT, 60 neutropenia; 7 both), 10 mg: 56 (12         case, Fusarium endophthalmitis developed in a locally immunocom-
allo-HSCT, 50 neutropenia; 6 both).                                         promised eye, after intravitreal injection of bevacizumab and
                                                                            prednisolone. Bevacizumab, a recombinant humanized monoclonal
                                                                            IgG1 antibody, binds to and inhibits the biologic activity of vascular
                                                                            endothelial growth factor. This leads to less inflammation and
                                                                            improvement of vision by inhibition of new vessel formation and
                                                                            reduction of macular edema. However, suppression of the local
                                                                            inflammatory response by bevacizumab and prednisolone may also
                                                                            result in a diminished response to infection. This local immuno-
                                                                            compromised state facilitated a full-blown endophthalmitis. The
                                                                            treatment of Fusarium endophthalmitis is difficult: the penetration of
                                                                            iv amphotericin B formulations in the vitreous is lacking. Besides,
                                                                            many Fusarium isolates are voriconazole resistant, although
                                                                            breakpoints for filamentous fungi have not been established.
                                                                            Combination of pars plana vitrectomy and therapy of local
                                                                            amphotericin B and systemic voriconazole could not improve her
                                                                            vision.




Conclusions: With early initiation of L-AMB in patients with                P168
possible IFD (chest CT halo signs + host factors) based on EORTC/           Recurrent Paecilomyces lilacinus endocarditis in an
MSG 2008 criteria a higher proportion had improved response and             intravenous drug user. Case report and review
survival compared to those with probable/proven IFD. These data                                                     ¸
                                                                            J. Ambrosioni, K. Bouchuiguir-Wafa, I. Uckay and J. Garbino
suggest L-AMB is suitable for pre-emptive treatment of suspected mold       University Hospitals of Geneva, Geneva, Switzerland
infections in high-risk patients.
                                                                            Objective: Fungal intravascular infections are a well recognized,
                                                                            although rare, complication in intravenous drug users (IDUs).
                                                                            Paecilomyces lilacinus is a little-known mold that causes rare cases of
P167                                                                        invasive infections in humans regardless of their immune status. It
Fusarium endophthalmitis after intravitreal bevacuzimab                     shows low susceptibility to conventional antifungal drugs in vitro, and
injection                                                                   variable susceptibility to novel triazoles. Since 1963, seven cases of
A.M.L. Oude Lashof, F. H. Van Tiel and E. C. La Heij                        endocarditis due to Paecilomyces spp. were published in the medical
Maastricht University Medical Center, Maastricht, The Netherlands           literature and only one due to Paecilomyces lilacinus. The aim of this
                                                                            study was to describe the case of a recurrent endocarditis due to
                                                                            Paecilomyces lilacinus in an IDU patient and to discuss diagnosis and
A 75 year old woman with a history of diabetes and diabetic                 treatment.
retinopathy was seen at the outpatient eye clinic for worsening of          Methods: Description of the patient case and microbiology results.
her age-related macular degeneration. She was treated with
                                                                            Results: In November 2007 a 41 years old male patient was
intravitreal administration of bevacizumab (1.25 mg) and predniso-          admitted to our institution for acute abdominal pain followed by
lone (5 mg). The first injection in her left eye was without any
                                                                            intense pain in the right leg. Medical history was positive for active
complications, therefore a second injection in this eye was performed
                                                                            intravenous drug abuse and hepatitis C virus infection. The patient
1 month later. Unfortunately, 5 days after this second injection, she




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                               83
Poster Presentations



referred fatigue since 1 month and weight loss, but no fever or            Conclusion: Endocarditis due to Paecilomyces lilacinus is an extre-
chills. The angiography showed bilateral thigh arterial insufficiency       mely rare disease, but it must be considered active IDUs. Combination
compatible with bilateral septic emboli, more severe at the right side.    therapy must be considered while awaiting the sensitivity tests due to
A cardiac ultrasound showed a bicuspid aortic valve with images            the low susceptibility to conventional antifungal drugs. Voriconazole is
compatible with vegetations. Empiric treatment was started with            reported as the most active drug in vitro. Concomitant surgery is very
ceftrixone and gentamycin, and a cardiac valvular replacement with         important for diagnosis and for outcome improvement in case of
a mechanical prosthesis was performed. Bacterial cultures were             valvular involvement. Long antifungal treatment must be considered
negative, but a fungal growth was noted in the valve abscess and in        but treatment duration is not established.
an embolic cutaneous lesion. The fungus was identified by PCR and
sequenciation as Paecilomyces lilacinus. Antibiotic treatment was
stopped and liposomal amphotericin B plus oral voriconazole were
started. Clinical evolution was favourable. Sensitivity tests showed       P169
that Paecilomyces lilacinus was resistant to Amphotericin B, fluco-         Fungal infection in a neutropenic patient caused by
nazole, itraconazole, flucytosine and caspofungin and only sensitive        Alternaria alternata
to voriconazole and posaconazole. Oral voriconazole monotherapy                                                  ˜
                                                                           R.G. Vitale, J. Afeltra, M. Lluesma Gonalons, G. Rigada,
was continued with good clinical evolution. Patient was discharged         K. Andrade, F. Figueroa, M. Inmutabile, C. Carbia, A. Miroli,
on voriconazole treatment and follow up was lost. Two years later,         V. Ybarra and R. G. Vitale
the patient was readmitted in February 2009 with acute paraparesis         Ramos Mejia Hospital, Buenos Aires, Caba, Argentina
of unknown origin and during the hospitalisation he developed a
stroke followed by cardiac arrest. Cardiopulmonary resuscitation was
unsuccessful and the patient died. The autopsy findings showed a            Case report: Male patient 25 year old with a diagnostic of acute
recurrent fungal disease in the heart with a paravalvular abscess          lymphoblastic leukemia. He receives treatment for his disease within
and cerebral emboli. Cardiac tissues and blood cultures were positive      an induction of chemotherapy and consolidation treatment with
for Paecilomyces lilacinus. Figure 1 shows Paecilomyces plate              protocol GATLA during 2007. In 2008 he was hospitalized to receive
growth from blood. Figure 2 shows fungi-fluor stain from the                phase I Hyper-CVAD treatment because hematologic relapse. The
sample of the recurrent cardiac abscess.                                   patient develops fever and neutropenia, and piperazilin tazobactam was
                                                                           initiated empirically. He develops muget and yeast form was visualized
                                                                           in the direct microscopy examination from oral sample and C. albicans
                                                                           was isolated. Treatment with fluconazole was initiated, 200 mg day
                                                                           during 10 days with successful outcome. The patient had a total white
                                                                           cells of 600 mm3, and 10 days later he develops nasal pain, with
                                                                           ulceration. Biopsy was taken. In the direct examination hyaline septate
                                                                           hyphae was observed, thus, aspergilosis was suspected and voriconaz-
                                                                           ole treatment was started. Galactomanan antigen test was performed
                                                                           and being negative. CT scan showed ulceration of the nasal septum
                                                                           without compromise of the lung. A black fungi was cultured after
                                                                           7 days identified as Alternaria alternata. The treatment was switch to
                                                                           itraconazole at doses to 600 mg day-1 for 3 days and 400 mg day-1
                                                                           after. After 1 month, the patient recovers neutrophyl count and lesion
                                                                           in the nose disappears and CT scan revealed no lesions. He continues
                                                                           the treatment for 4 months without relapses up date.
                                                                           Conclusion: Leukemic patients are a population of high risk to
                                                                           develop fungal infections. This is and interesting case, since in the direct
                                                                           biopsy material hyaline hyphae was observed but the isolation was a
                                                                           black fungi, being important to identified the aetiologic agent, since
                                                                           treatment might be different. It is described that these fungi especially in
                                                                           biopsy, can be seen as hyaline, then miss diagnoses is possible and culture
                                                                           can be wrong interpretive as contaminant.
Figure 1.


                                                                           P170
                                                                           A fatal microascus cinereus (anamorph scopulariopsis) brain
                                                                           abscess in an allogeneic bone marrow transplant recipient
                                                                           K. Bouchuiguir-wafa, B. Mohty, J. Ambrosioni, C. Van Delden and
                                                                           Y. Chalandon
                                                                           University Hospitals of Geneva, Geneva, Switzerland

                                                                           Objectives: The ascomycetous mold Microascus cinereus is an
                                                                           uncommon human pathogen. We report the second case of brain
                                                                           abscess due to M. cinereus in an allogeneic bone marrow transplant
                                                                           recipient, and discuss the mycological findings.
                                                                           Methods: Retrospective analysis of clinical chart and microbiology
                                                                           results.
                                                                           Results: A 34-year-old allogeneic bone marrow transplant (allo-BMT)
                                                                           recipient for Hodgkin lymhoma was admitted 4 years post-transplant with
                                                                           right lateral homonym hemianopsia. At the time of this complication, he
                                                                           was treated with tacrolimus, glucocorticosteroids and mycophenolate for
                                                                           severe graft-vs.-host disease (GVHD), as well as ciprofloxacine, metroni-
Figure 2.                                                                  dazole and voriconazole. A magnetic resonance imaging scan (MRI) of the
                                                                           brainrevealeda1,5-by2-cmenhancedlesionintheposteriorpartoftheleft




                                                                                                                             Ó 2009 The Authors
84                                                              Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



internal capsula lobe. Liposomal amphotericin B was added to voriconaz-
ole, and a stereotactic brain biopsy performed. Initial bacterial and fungal
cultures were negative. Two weeks later, he developed a complete right
sensitivo-motricerighthemiplegia.AsecondMRIshowednochangeinthe
size of the lesion. The patient underwent a second steretoactic-guided
aspiration of the abscess cavity. Direct smear of this brain biopsy prepared
with Fungi-Fluor’ showed septate hyphae and oblong cells in short chain
(Figure 1). Biopsy material was inoculated onto potato dextrose, sabou-
raud’s dextrose, and brain heart infusion agar. Initially the colonies were
pale, but developed a grey-olive color over time (Figure 2). Microscopic
examination of potato dextrose agar slide cultures revealed catenulate,
dematiaceous annelloconidia (conidia formed from annellides and
occurring in chains), measuring 4 to 5.5 by 2.5 to 3 lm and arising from
either single or penicillate flask-shaped conidiophores attached to
dematiaceous, septate hyphae (Figure 3). These features were consistent
with a dematiaceous Scopulariopsis species. After 2 weeks of incubation,
small black fruiting structures were seen. Microscopic examination of
these structures revealed globose perithecia (100 by 350 lm) with a short
neck (Figure 4). Partial sequencing of the large ribosomal subunit 28S
identified the mold as Microascus cinereus, in accordance with the
morphological results. The patient was treated with liposomal amphot-          Figure 3.
ericine B and posaconazole, but died within a few days.




Figure 1.


                                                                               Figure 4.

                                                                               Conclusion: We describe the second case of brain abscess caused by
                                                                               M. cinereus after allo-BMT. Predisposing factors for infection with this
                                                                               organism included severe immunosuppression, GVHD, and exposure to
                                                                               broad-spectrum antibiotics. The isolation of this organism from brain
                                                                               abscess tissue extends the list of known neurotropic dematiaceous
                                                                               organisms capable of causing cerebral phaeohyphomycosis.



                                                                               P171
                                                                               Antifungal drug susceptibility of Aspergillus spp. strains
                                                                               isolated from cystic fibrosis patients and immune responses
                                                                               against them
                                                                               M. Simitsopoulou, E. Hatziagorou, E. Georgiadou, J. N. Tsanakas
                                                                               and E. Roilides
                                                                               Aristotle University of Thessaloniki, Thessaloniki, Greece

Figure 2.                                                                      Objectives: Aspergillus species can be isolated from respiratory
                                                                               secretions of cystic fibrosis (CF) patients. Phagocytes play a major role
                                                                               in the innate host immune response against Aspergillus by responding
                                                                               to and destroying the fungi locally. In this study we have analyzed A.
                                                                               fumigatus and Aspergillus flavus isolates from sputa of patients with CF
                                                                               in order to identify differences in drug susceptibilities and induced
                                                                               immune effector cell responses.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   85
Poster Presentations



Methods: Identification of A. fumigatus or A. flavus was performed by             Aspergillus spp. Product of primary PCR amplification was used as a
colony morphology and microscopic examination. Minimum inhibitory               template in the second reaction. A separate set of primers was used.
concentrations (MICs) for three azoles (itraconazole, voriconazole and          Products of the PCR reaction were visualized during elecrophoresis in
posaconazole) and deoxycholate amphotericin B as well as minimum                ethidium bromide stained 2% agarose gel. All diagnostic techniques
effective concentrations (MECs) for two echinocandins (caspofungin and          were performed simultaneously with clinical observations.
anidulafungin) were determined by broth microdilution method (CLSI).            Results: Of the 47 patients included in the study Aspergillus was
Superoxide anion production and antihyphal activity of neutrophils              grown on the Sabouraud agar plates only in three cases. Galactomannan
(PMNs) and/or monocytes (MNCs) were assessed spectrophotometrically             was detected in two serum and 1 BAL sample (6.3%). DNA, however, was
by superoxide anion release assay and XTT reduction assay. For the              detected in eight serum and 13 BAL samples (38.3%). Number of patients
conidiocidal activity, 2 · 105 conidia were mixed with 4 · 105 MNCs for         that were able to undergo biopsy was four. There were three patients
4 h at 37 °C and colony-forming units were counted. For the superoxide          representing proven Invasive Aspergillosis.
anion assay, 105 conidia were incubated for 12 h at 37 °C. Resulting            Conclusion: (i) Serological and molecular tests might be useful in
hyphae were opsonized with 50% human serum and incubated with 105               the early diagnosis of Invasive Aspergillosis, especially when the
PMNs and 75 lmol L-1 cytochrome-C for 1 h at 37 °C, 5%CO2. The                  culture of pathogen is hard to receive and there are contraindications
superoxide anion produced by PMNs was then quantitated. For the XTT             to perform biopsy or taking BAL sample. (ii) Examinations of biological
assay, 104< conidia were incubated for 12 h at 37 °C. Phagocytes were           markers of Aspergillus’ infection demonstrate diagnostic value only
added to hyphae at 20:1 effector-to-target (E:T) ratio and incubated for        when performed parallel and dynamically. (iii) In patients with
1 h at 37 °C, 5%CO2. Phagocytes were lysed and 0.25 mg ml-1 XTT                 hematological malignancies testing of galactomannan levels in serum
containing 40 lg ml-1 coenzyme-Q0 were added to the plates. Following           may give false negative results while full symptomatic Aspergillosis. (iv)
30 min incubation at 37 °C, percent hyphal damage was evaluated.                Detection of fungal DNA cannot be used as a routine laboratory tool for
Results: Six isolates of A. fumigatus and two isolates of A. flavus              diagnosing fungal infections. However in immunocompromised
isolates from sputa of eight patients with CF were studied. All isolates        patients with hematological malignancies may serve as a supplemen-
exhibited similar MICs/MECs for the antifungal agents tested compared           tary method in comparison with other accessible microbiological
to control strain, except for one isolate of A. fumigatus that showed           methods: culture, microscopy and serology. (v) In order to set proper
relatively higher MEC value for anidulafungin (1 lg ml-1) than control          diagnosis of Invasive Aspergillosis there is a need in simultaneous
strain (0.004 lg ml-1). Except for two strains, PMNs exhibited hyphal           cooperation between team of clinicians, radiologists, microbiologists,
activity against the fungal targets (24–55%) that was higher than that          histopatologists.
of MNCs (hyphal damage 16–29%). High amounts of superoxide anion
were released from PMNs (approximately 6nMO-2/105 PMN/h) when
challenged with each isolate. Both strains of A. flavus were very
susceptible to the conidiocidal activity of MNCs; the intracellular killing     P173
reached 66% and 75%, respectively. Except for three A. fumigatus
                                                                                Blastoschizomyces capitatus caspofungin-resistant:
strains, percent intracellular killing ranged from 51% to 66%
compared to control (13%).                                                      disseminated infection in a patient with acute myeloid
Conclusion: These preliminary data show that while there are                    leukaemia
generally no major differences in the susceptibility of Aspergillus isolates                                           ´          ´
                                                                                J. Alcoba-Florez, I. Gutierrez, I. Hernandez, R. Sanchez and J. Ode
from CF patients to antifungal agents, there are considerable variations        University Hospital Ntra. Sra. de Candelaria, Santa Cruz De
in their susceptibility to innate host immune responses.                        Tenerife, Spain

                                                                                Introduction and objective: Among opportunistic pathogenic
                                                                                yeast, Blastoschizomyces capitatus is an uncommon species. It produces
P172                                                                            serious systemic infections in immunocompromised patients, especially
Aspergillus spp. DNA and galactomannan testing in BAL and                       in those who suffer haematological malignancies. The aim of this study
serum of immunocompromised patients                                             is to describe a case of systemic infection caused by B. capitatus resistant
D.D. Dzierzanowska1, E. R. Romanowska1, P. N. Nadkowska1,                       to caspofungin in a patient with acute myeloid leukaemia (AML).
R. K. Krenke2, E.M.G. Grabczak2, T. D. Dzieciatkowski2,                         Materials and methods: We present a case of a female patient
                                                                                diagnosed with AML, on chemotherapy with cytostatics, who develops
M.P. Przybylski2 and A.K.L. Kolkowska-Lesniak3
1                                                                               a disseminated fungal infection with hepatic and splenic affection that
 The Children’s Memorial Health Institute, Warsaw, Poland,                      required splenectomy because of a splenic abscess. Blood cultures were
2
 Medical University, Warsaw, Poland, 3Institute of Haematology                  obtained and processed with the BACT-ALERT system (bioMerieux,       ´
and Transfusion Medicine, Warsaw, Poland                                        S.A.). Malt extract agar (Beckton Dickinson) was employed for the
                                                                                                                                            ´
                                                                                morphological characterization and API-ID 32C (bioMerieux, S.A.) for
Objectives: The study was designed to demonstrate the prevalence                its identification. Sensitivity testing against eight antifungal agents was
of Invasive Aspergillosis in a group of 47 immunocompromised patients           performed by broth microdilution, following CLSI (M27–2A) and
with haematological diseases (mainly malignancies) and claimed signs            Sensititre-Yeast-OneÒ (Trek Diagnostic System S.L.) indications.
of pulmonary infection. The control group consisted of 24 immuno-               Results: Creamy yeast-like colonies were isolated from blood cultures,
competent patients who underwent fiberoptic bronchoscopy. We                     and mycelium, arthroconidia and blastoconidia were observed, leading
sought to evaluate the optimal method of detecting the infection.               to the identification as Geotrichum capitatum (currently B. capitatus).
Fiberoptic bronchoscopy and BAL were performed to search for                    Sensitivity test revealed this isolate to be susceptible-dose-dependent (S-
potential pathogens involved in the pulmonary infection.                        DD) to fluconazole (MIC 32) and resistant to caspofungin (MIC 16). MIC
Methods: In both groups of patients BAL was performed through                   for the rest of the antifungal agents were as follows: 0.125 posaconazole,
flexible, fiberoptic bronchoscope. The bronchoscope was inserted in the           0.5 amphotericin B, 0.5 ketoconazole, 0.125 itraconazole, 0.125
specific lung region. Sterile 0.9% saline was instilled and then                 voriconazole and 32 for 5-flucitosin. Treatment with caspofungin was
withdrawn by a gentle suction. BALF was collected in a tube and                 started. Owing to the microbiological results observed, treatment was
immediately transferred to the laboratory. Samples were cultured on             changed to amphotericin B and it was maintained with voriconazole.
Sabouraud Dextrose Agar plates. Forceps biopsy was performed after              Conclusions: (i) As is true for many other opportunistic fungi, the
the BAL procedure. Galactomannan levels were determined both in                 number of infections due to B. capitatus has increased considerably in
serum and BAL by PLATELIA Aspergillus EIA Galactomannan test (Bio-              the last few decades, especially among patients surffering from
Rad) according to manufacturer’s description. The cut-off level for BAL         haematological malignancies and neutropenia. (ii) Sensitivity tests
and serum was 0.5. Aspergillus DNA was isolated from BAL and serum              confirm that fluconazole does not have good activity against B. capit-
using DNA Mini Kit (Qiagen, Syngen Biotech). Next DNA was amplified              atus, and that caspofungin do not have any activity al all. (iii) The best
using nested PCR technique with primers specific to 18S rRNA of                  treatment for B. capitatus infections is not well established yet, but




                                                                                                                                  Ó 2009 The Authors
86                                                                   Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                               Poster Presentations



recent studies agree with this work about the role that new azoles         developed extensively destructive necrotizing local invasion and died
(voriconazole, posaconazole) may play in this type of infection.           from septic shock on the 13th day of his hospitalization.
                                                                           2nd case: Zygomycosis from Mucor hiemalis, after trauma. A
                                                                           20 year-old patient,was admitted to ICU due to severe trauma after
                                                                           a car accident,with spleen,left kidney, urinary-bladder rapture and
P174                                                                       multiple fractures. She underwent splenectomy,removal of the left
                                                                           kidney,rehabilitation of the urinary-bladder and fracture reconstruc-
Mannose binding lectin deficiency does not increase usage
                                                                           tion. Five days after the accident, she developed a rapidly progressive
of antifungals during febrile neutropenia in children – a                  necrotizing lesion at the left limp. After receiving two specimens for
prospective single institution study                                       culture, antimycotic therapy (Liposomal Amphotericin B 600mg · 1
P. Mudry1, M. K. Kyr1, J. J. Jarkovsky2, J. S. Sterba1                     i.v. and Posaconazole 400 mg · 2 p.o) was initiated. Because of the
and J.Ch. Chumchalova2                                                     extensively necrotizing local invasion, the patient underwent a limp
1
 University Children’s Hospital Brno and Masaryk University Brno,          amputation. She continued receiving Amphotericin B for 15 days
Brno, Czech, 2University Hospital Brno, Brno, Czech                        after the amputation, while Posaconazole was administered for
                                                                           6 weeks totaly. Her clinical condition was stabilized. Due to combined
Objectives: Mannose binding lectin (MBL) is a plasma collectin, a          surgical and antimycotic therapy, the patient survived. Laboratory
substantial part of innate immunity. MBL immunodeficiency is defined         diagnosis was based on direct microscopy, histopathologic examina-
as such combination of haplotypes of MBL-2 gene which encodes a low        tion and culture. Exudates and necrotic tissues from the two patients
or intermediate plasma MBL level compared to high MBL level                were sent to the laboratory. On direct microscopy wide,coeno-
encoding haplotypes. Association of low level MBL (LLMBL) with             cytic,hyaline hyphae were present. Conventional culture revealed
longer duration of febrile neutropenia (FN) contrary to high level MBL     mixed bacterial flora. Minimally manipulated tissue samples were
(HLMBL) has been described. We analysed prescription of antifungals        cultured in Sabouraud dextrose agar with chloramphenicol at 25, 30
and incidence of invasive infections during FN in children with a          and 370C. Woolly, rapidly growing, zygomycotic colonies appeared in
malignancy and correlated them with LLMBL or HLMBL genotype.               24 h and covered the entire Petri dish in 48 h. The strain of the first
Methods: Prospective analysis of MBL-2 gene had been done during           case didn’t sporulate in malt extract and potato dextrose agars,so the
study period. Total of 47 patients were included and 152 episodes of FN    isolate was cultured in Czapek’s agar, 1% water agar and in saline
were analysed. MBL genotype was assessed by SSP-PCR method.                agar at 25, 30 and 370C but remained sterile for over 2 months.
Patients were included into the study when they had undergone at           Both strains were sent to the Microbiology Department of the Medical
least one episode of FN.                                                   School of Athens, where ITF-based sequencing was performed and
Results: Diagnoses were solid tumors and leukemias, median age at          99% homology was confirmed with those published for Saksenaea
diagnosis was 6.7 years, male to female ratio was 30:17. Total of 22       vasiformis (CBS 122520, GenBank Accession No Fj433876, first
and 25 patients with LLMBL and HLMBL respectively were assessed.           isolation in Greece), and Mucor hiemalis sequences, respectively. In
They underwent 87 and 65 episodes of FN, respectively. To avoid            both cases diagnosis was confirmed by the histopathologic examina-
diagnosis bias we analysed separately patients with acute lymphoblas-      tion.
tic leukemia (ALL) and other diagnoses (OD). In ALL group, antifungals     Conclusions: (i) Zygomycosis is rare, usually appearing in a
were given during 50% and 51.5% of FN in LLMBL and HLMBL                   sporadic form. (ii) In patients with predisposing factors, for favorable
patients, respectively, P = 1.0. In OD group, antifungals were given       prognosis, the relevance of a strong clinical suspicion, early laboratory
during 67.7% and 63% of FN in LLMBL and HLMBL patients,                    diagnosis and rapid initiation of antimycotic therapy can prevent the
respectively, P = 0.814. Invasive fungal infections were observed in       fatal outcome. (iii) Saksenaea vasiformis is an emerging human
two cases, both were candidemia in OD group in patients with HLMBL         pathogen, often associated with trauma. Laboratory identification may
genotype.                                                                  be difficult or delayed because of the mould’s failure.
Conclusions: Our results do not support hypothesis that LLMBL
genotype is associated with higher frequency of antifungal treatment
during febrile neutropenia in children. LLMBL genotype possessing
patients are not at higher risk of invasive fungal infection.              P176
                                                                           Fatal Saccharomyces fungemia with septic shock
                                                                           complicating S. boulardii prophylactic therapy in a burn
                                                                           patient
P175                                                                       P. Giannopoulou1, N. Charalambaki1, H. Stefanatou1,
Cutaneous zygomycosis in a general hospital in Greece                      A. Velegraki2, F. Tsidemiadou1 and E. Trikka-Graphakos1
                                                                           1
P. Giannopoulou1, N Charalambaki1, A. Kyratsa1, A. Velegraki2,              Thriassio General Hospital, Athens, Greece, 2University of Athens,
F. Klouva-Molyvda3 and E. Trikka-Graphakos1                                Athens, Greece
1
 Thriassio General Hospital, Athens, Greece, 2University of Athens,
Athens, Greece, 3Intencive Care Unit,Thriassio General Hospital,           The yeast S. boulardii (strain of S. cerevisiae)has been used as a probiotic
Athens, Greece                                                             for the prevention and treatment of antibiotic and enteral feeding-
                                                                           associated diarrhea. Although commercially available strains are
Introduction: Zygomycosis is an uncommon fungal infection                  regarded as safe,there are many reports implicating S. cerevisiae as a
which usually occurs in immunocompromised (mainly diabetes                 cause of invasive infection in immunosuppressed patients. We report a
mellitus, haematologic malignancy, transplantation) and rarely in          fatal case of Saccharomyces fungemia with septic shock in a burn
immunocompetent hosts, usually after trauma. We report two cases           patient,receiving S. boulardii prophylactic therapy. A 34 year-old
of cutaneous zygomycosis in our hospital, in a 2 year period.              woman was transferred suffering from extensive thermal burns
1st case: Fatal zygomycosis from Saksenaea vasiformis in a young           covered 60% of her TBSA and she received probiotic therapy S.
patient, after a car accident A 30-year old patient was admitted to our    boulardii (100 mg · 3/24 h) while she was on antibiotics. Two weeks
hospital due to mild cranial contusion. Three days after the accident at   after the last surgical debridment,she became febrile(39 °C),progres-
the left posterior thoracic and lumbar region a rapidly progressive        sively deteriorated, with septic shock,multiple organ failure and
necrotising lesion appeared. The patient was febrile(390C), while was      Amphotericin B was added. On direct microscopy of the positive blood
heamodynamical stable. He underwent extensively surgical debrid-           culture, yeast cells were observed,and slightly cream,smooth,uniform
ment and two specimens were taken for culture. Despite the                 flat colonies were isolated from sabouraud dextrose agar, after 48 h at
combination of the aggressive surgical debridement of the infected         30 °C. The isolate was purified by streaking in CHROMagar Can-
tissues and the systemic treatment with Liposomal Amphotericin B           dida(CHROMagar) and identified as S. cerevisiae by the API32C
(750 mg/24 h i.v.) and Posaconasole (400 mg · 2 p.o), the patient          (BioMerieux). Then it was checked for growth at 370C and ascospore




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   87
Poster Presentations



production on McClary acetate agar for 8 weeks. Fungal DNA from the          P178
clinical isolate and from S. boulardii grown from Ultralevure capsules       False-positive Aspergillus real-time PCR assay due to
was extracted and the whole Internal Transcribed Spacer region was           nutritional supplement in an allo-BMT recipient with GVH
amplified by PCR. The amplification products were sequenced (Macr-             disease
ogen,Korea)the sequences were aligned(BIOEDIT www.mbio.ncsuedu)
                                                                             L. Millon, F. Grenouillet, J. Crouzet, F. Larosa, S. Loewert,
and were compared to published fungal sequences (BLAST
www.ncbi.nlm.nih.gov). For comparison reasons,all S. boulardii
                                                                             A. P. Bellanger, E. Deconinck and F. Legrand
(n = 9)and S. cerevisiae (n = 158)sequences publicly available in            CHU Jean Minjoz, Besancon, France
GenBank, as well as representatives of close relatives S. bayanus
(n = 1) and S. paradoxus (n = 1) were used. In vitro susceptibility to       Objectives: Screening for circulating DNA by PCR has shown
antifungal agents was performed by E-test(AB Biodisk,Sweden) The             potential in the definitive diagnosis of invasive aspergillosis, especially
therapeutic use of probiotics should be carefully considered regarding       in combination with antigen testing. Occurrence of false-positives of
the risk-benefit potential. Saccharomyces organisms should be added to        Aspergillus real-time PCR has been described in several reports, but
the growing list of emerging fungal pathogens and special caution            source of fungal DNA contamination remain unclear. We report here a
should be taken regarding their use in the immunocompromised                 case of false-positive of both galactomannan antigenemia and Asper-
critically ill patients,including burn patients.                             gillus PCR due to nutritional supplement in a bone marrow transplant
                                                                             recipient.
                                                                             Case report: A 42 years old man received an allogenic hematopoi-
                                                                             etic stem cell transplantation acute myeloid leukemia on June 2006
                                                                             (day 0, D0). At D15, he presented a stade three (grade II) cutaneous
P177                                                                         acute graft-vs.-host disease (GVHD) and later developed a chronic
Candida spp. oral disease, colonization and fluconazole                       GVHD after D150, treated with a combination of corticosteroid and
resistance in HIV/AIDS patients using microbiological and                    tacrolimus. He developed severe diarrhea and denutrition. Since D178,
molecular detection methods in the era of antiretroviral                     he received a parenteral nutrition associated with an oral hypercaloric
therapy                                                                      supplementation : Scandishake Mix (Nutricia), one or two bags per
W.R. Kirkpatrick, J. E. Erlandsen, L. K. Najvar, A. C. Vallor,               day. At day 190, the patient was admitted for pulmonary syndrome
G. R. Thompson III, M. L. Herrera, B. L. Wickes, D. K. Berg,                 with productive cough and moderate dyspnea without fever. Serum
S. D. Westbrook, N. P. Wiederhold, S. W. Redding and                         was tested for galactomannan (GM) antigenemia (PlateliaÒ Aspergillus;
T. F. Patterson                                                              Biorad, Marnes-la-Coquette, France), using threshold of 0.5. Real-time
The University of Texas Health Science Center, San Antonio, TX,              PCR targeting to Aspergillus mitochondrial DNA was performed with
USA                                                                          44 cycles as positive threshold. PCR and GM positive results were
                                                                             obtained from serum samples, at D190 and D192. Disseminated
                                                                             aspergillosis with digestive origin was suspected, and nutritional
Objectives: The recent prevalence of symptomatic oropharyngeal               supplement was stopped. A probabilistic antifungal treatment (voric-
candidiasis (OPC), colonization, and rate of fluconazole (FLU) resistance     onazole-caspofungin combination) was immediately started. Thoracic
due to Candida in HIV/AIDS in patients receiving antiretroviral therapy      CT-scan revealed unilateral lung consolidation with pleural effusion,
(ART) has not been well described. This study was designed to detect         with Pseudomonas aeruginosa isolation from sputum. Anti-Pseudomonas
and identify the occurrence of oral Candida colonization/disease and         antibiotic therapy was rapidly implemented. GM detection on serum
FLU susceptibility in patients (pts) using standard microbiological and      became negative at D195, whereas PCR became negative at D201.
molecular techniques.                                                        Clinical improvement was progressively observed, voriconazole was
Methods: HIV/AIDS patients were eligible for enrollment with CD4+            stopped due to adverse events (D195) and antifungals were replaced by
count <200 and/or symptomatic OPC. Oral rinse samples were                   itraconazole monotherapy at D204. A Scandishake Mix bag from the
obtained from 215 patients over 311 visits. Yeast colonization was           batch taken by the patient were tested for GM detection and real-time
assessed microbiologically and by direct amplification of yeast DNA           PCR. Both assays were positive until dilution of 1/1000. Two other
from oral samples by standard PCR using Candida pan-fungal primers.          batches obtained from the manufacturer gave similar results. Fungal
Species ID was confirmed using CHROMagar Candida, germ tube                   cultures of all batches were negative. DNA extracted from two sera
assessment, API 20C, and molecular sequencing. FLU susceptibility            (D190, D192) and from the three batches of Scandishake Mix bag was
(MIC £8 lg ml-1) was assessed by CHROMagar dilution.                         amplified using another real-time PCR, targeting 18S A. fumigatus
Results: Of these 215 pts, the median CD4 cell count at enrollment           rDNA. PCR products were subsequently sequenced. Sequencing data
was 98 (range, 2–348). Within this group of 215 patients, there were         showed 100% identity with A. fumigatus rDNA for all tested specimens.
178/215 (83%) colonized with yeasts by traditional cultures or by            Conclusion: To our knowledge, this is the first described case of a
PCR. Of these 178 colonized patients, 59/178 (33%) had symptomatic           false-positive of both GM antigenemia and circulating Aspergillus DNA
oral infection and yeasts with elevated fluconazole MICs (>8 lg ml-1)         detection due to nutritional supplement intake in a bone marrow
were detected in 45 (25%) patients. 243 of 311 patient visits (78%)          transplant recipient with GVH disease. Passage of fungal DNA into the
were from patients on ART. Colonization was detected in 260 visits;          serum from the intestinal tract could occur in the same way as fungal
microbiology was positive in 250 and PCR in 217; 10 were positive            GM could. Clinicians should be aware of this possibility of false-
exclusively by PCR. Candida species were isolated and identified to the       positives of both tests to avoid prescription of unnecessary costly
molecular level from 341 total patient visits. Of these isolates, C.         antifungals.
albicans was detected in 54%. Other species noted were C. dubliniensis
(16%), C. glabrata (17%), C. tropicalis 5%, C. krusei 4%, C. parapsilosis
3% and C. guilliermondii and C. lusitaniae <1% each. Decreased FLU
susceptibility occurred in 110/341 (32%) isolates. 75/110 (68%)              P179
isolates with reduced susceptibility were non-albicans spp. 41/110           Comparison between voriconazole vs. caspofungin for
(37%) of these isolates with decreased susceptibility to FLU were            invasive aspergillosis among immunocompromised patients
obtained from OPC patients. Of 311 patient visits, colonized by multiple     R. Rabagliati, L. Siri, G. Fuentes, I. Aedo and J. Labarca
Candida species was detected in 106 (34%) and symptomatic OPC was            Pontificia Universidad Catolica De Chile, Santiago, Chile
present in 33/106 (31%) visits.
Conclusion: Even with antiretroviral therapy, oral yeast coloniza-           Voriconazole (V) has demonstrated superiority to amphotericin
tion and symptomatic OPC, including non-albicans yeasts and isolates
                                                                             deoxycholate, becoming the first line therapy for Invasive Aspergillosis
with reduced FLU susceptibility remain common in patients with
                                                                             (IA). Despite caspofungin (C) has shown favorable response in some IA
advanced HIV/AIDS.
                                                                             series, only has been approved for salvage therapy. To our knowledge
                                                                             there are not face-to-face studies comparing C vs. V among IA patients.




                                                                                                                               Ó 2009 The Authors
88                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                               Poster Presentations



Objective: To assess the efficacy of voriconazole when used as                load and a CD4 lymphocytes level of 15 mmc-1. He received HAART
primary therapy for invasive aspergillosis in immunocompromised              (Epivir + Zerit + low-boosted Atazanavir) and 800 mg day-1 Fluc-
subjects in our center and compare to a control group who received           onazol, with a clinical favorable course but a stationary CD4 level. The
caspofungine as primary therapy.                                             control lumbar puncture at 2 months showed six fungal cells per mmc
Patients and methods: Retrospective study including patients                 and seven mononuclear cells per mmc in CSF analysis; fungal
over 15 years-old with V prescription for IA therapy hospitalized in         susceptibility was diminished for Fluconazol (CMI 6) and the patient
             ´                       ´
‘Hospital Clınico Universidad Catolica’in Santiago – Chile from January      received Voriconazol 400 mg day-1 (CMI 0.064). He developed photo-
2005 to December 2008. A CRF was completed through clinical chart            sensitivity after the previous 2 weeks of Voriconazol therapy. The next
review. EORTC criteria were applied to classify the episode as possible,     lumbar puncture was performed after 1 month and revealed 10
probable or proven Aspergillosis. Treatment response was defined as           mononuclear cells per mmc, with fungal culture still positive for
failure (F), stable disease (SD) or favorable response (FR) including both   Cryptococcus neoformans and developed fluconazol-resistance (CMI
complete and partial response (CR en PR). Mortality analysis considers       32); the susceptibility at Voriconazol was preserved (CMI 0.125), so he
lost follow-up as a failure/dead. These responses were compared to a         continued the Voriconazol therapy. In a 6 months period his immune
cohort of consecutive IA subjects between 2001 and 2006 who had              status does not improve, the CD4 level oscillating between 18 and 50
received caspofungine as primary therapy using the same case and             mmc-1, with undetectable viral load. He was again admitted in Institute
response definitions.                                                         because of the reappearing of the headache, malaise and fever. A new
Results: Forty-six cases received V prescribed due to IA: possible 25        lumbar puncture was performed and that time the CSF analysis seamed
(54.3%), probable 19 (41.3%) and proven 2 (4.3%). Age was                    to be compatible with bacterial meningitis (900 cells mmc-1, 60%
47.4 ± 17. One years-old and 60.9% were male. The majority was               neutrophils, 15% polymorph lymphocytes and 25% monocytes; 275 mg
haemato-oncological patients (71.7%), followed steroids or immuno-           protein dl-1, 15 mg glucose dl-1), so he received antibacterial medica-
suppresors users (10.9%), HSCT (8.7%) and solid organ transplanta-           tion, besides Voriconazol. The latex agglutination was still positive for
tion receptors (8.7%). Twenty-one cases (45.6%) had neutropenia              Cryptococcus, as in the precedents exams but the fungal culture was
<500 mm-3. The controls were 51 patients who received C for IA               negative. The CD4 level was 34 mmc-1 with negative viral load.
therapy: possible 28 (55%), probable 17 (33%) and 6 (12%) proven;            Considering that the Voriconazol level is lowered by ritonavir (the IP
age was 48.1 ± 18. Six years-old; 29 (57%) were males; 87% hemato-           boosting agent), the patient received no longer this boosting agent,
oncological, 11% HSCT, 4% solid organ receptors and 49% had                  instead he received an increased doses of Atazanavir.
neutropenia <500 mm-3. V was prescribed as first line monotherapy in          Discussion: The patient developed Fluco-resistance during the
22/46 (47.8%) of the subjects, combined with another antifungal drug         treatment of the cryptococcal meningitis and he is in the way to
in 17 (36.2%) and as salvage therapy in 7 (14.9%). Considering 20            develop Vorico-resistance also. The therapeutical antiretroviral scheme
evaluable probable and proven cases, 16/20 (80%) were FR, 1/20(5%)           was the only one possible, because it consists in a combination of
SD and 3/20 (15%) were failure. Mortality at the end of hospitalization      INRT + low boosted IP and finally unboosted IP, that permits the
was 20% and 40% at twelve-week follow-up. On the other hand, C was           preserved high level of Voriconazol (Voriconazol shouldn’t be associ-
prescribed as first line monotherapy in 4 of 28 (14.3%) probable and          ated with INNRT or ritonavir) The outcome for this patient depends of
proven cases, in 13 (46.4%) associated to another antifungal drug in         the response at anticryptococcal agent and the developing triazole-
11 (39.3%) for salvage or intolerant to previous therapy. Comparing          resistance and also depends on the rate of the increasing CD4 level (the
results among V vs.C, FR and CR was more frequently observed in V            potence of HAART) The duration of Voriconazol therapy should be
(80% vs. 60.7%; P = 0.2 and 65% vs. 17.8%; P = 0.0009), less                 indefinite – probably till the level of CD4 will increase beyond the
mortalitity at the end of hospitalization in V group (20% vs. 32%;           200 mmc-1 or life-long.
P = 0.12) but no differences at 12 weeks mortality (40% vs. 42.8%).
Comparing only probable and proven cases who received V vs.C as first
line monotherapy, FR was similar in both group 71% vs. 75%, CR
42.8% vs. 50%, mortality 14.3% vs. 25% and twelve-week mortality             P181
42.8% vs. 25% respectively.                                                  Characterization of serial Cryptococcus neoformans isolates
Conclusions: V and C shown comparable efficacy considering FR                 from patients with recurrent cryptococcal meningitis
and mortality. However V was superior to C to reach CR. It is not clear if   M.T. Illnait-Zaragozı1, G. F. Martınez-Machın1,
                                                                                                 ´             ´        ´
combination therapy reach better results than monotherapy.                   C. M. Fernandez-Andreu1, M. R. Perurena-Lancha1,
                                                                                          ´
                                                                             C. H. Klaassen2 and J. F. Meis2
                                                                             1
                                                                              Instituto Pedro Kouri, Havana, Cuba, 2Canisius Wilhelmina
                                                                             Hospital, Nijmegen, The Netherlands
P180
Induced fluco-resistance in a cryptococcal meningitis at an                   Objectives: Cryptococcus neoformans is commonly associated with
immune-compromised patient                                                   meningoencephalitis in immunocompromised patients and occasion-
R. Moroti Constantinescu, A. Hristea, V. Arama, D. Munteanu,                 ally in apparently healthy individuals. To investigate whether recur-
O. Dorobat, I. Podea and V. Gheorghita                                       rences of 19 C. neoformans isolates from seven patients (six HIV positive
Matei Bals National Infectious Diseases Institute, Bucharest,                and one negative) with recurrent cryptococcal meningitis are due to
Romania                                                                      drug resistance, we tested the in vitro antifungal susceptibility and
                                                                             determined the genotypes of the isolates using MLVA.
                                                                             Methods: Isolates were recovered from cerebrospinal fluid (n = 16),
Introduction: Cryptococcal meningitis is one of the most frequent            blood, urine and sperm (one each). They were identified by conventional
indicatory SIDA stage in HIV infection, appearing at a level at CD4          and molecular techniques. Antifungal susceptibilities for amphotericin
lymphocytes below 50 mmc-1. Although most Cryptococcus neoformans            B, fluconazole, flucytosine, itraconazole, voriconazole, posaconazole and
strains are susceptible to fluconazole, isolates with high MICs have          isavuconazole were tested by CLSI M27A2 broth microdilution method.
been detected.                                                               Genotyping was done using a panel of nine microsatellite (STR) markers:
Case description: The case related here is about a lent-progressor           (CT)n, (CTA)n, (TG)n, (TCT)n, (TA)n and (CCA)n, (TTAT)n, (ATCC)n
HIV infected 20 years-old patient (high probability perinatal infection),    and (AATA)n using established procedures.
admitted in Infectious Diseases Institute for subacute meningitis and        Results: The average number of isolates per patient was 2.71. The
diagnosed in SIDA stage. The patient was hypotrophic, pale and accused       mean time between collection of any two isolates was 52.5 days. All
headache, malaise and nausea for 2 weeks and the medical examination         the strains were identified as C. neoformans var. grubii ser. Aa. None of
revealed a low-grade nuchal rigidity and absence of fever. The lumbar        the isolates were resistant to any of the tested drugs. Amphotericin and
puncture shows high pressure clear CSF, with 300 elements per mmc,           posaconazole MICs did not change more than twofold for any of the
100% round fungal cells, identified as C. neoformans, which a good azole      cases over time. STR patterns showed 14 distinctive profiles. Two
susceptibility. HIV serology was positive, with an 15800 c ml-1 viral        patients (two and three isolates respectively) had multiple genotypi-




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  89
Poster Presentations



cally identical isolates. The other patients (14 isolates) were infected by    assessment, genotyping and phylogenetic dentogram reconstructing.
more than one genotype.                                                        RAPD analysis is based on the PCR with primers of arbitrary sequence.
Conclusions: These results suggests that recurrences were not due              The aim of this study was to evaluate RAPD analysis efficiency with
to drug resistance but probably by initial co-infection with different         each of the five primers JWFF, R4, RP2, RP4–2 and R108 of the
strains.                                                                       medically important fungi in epidemiological studies.
                                                                               Methods: We studied strains of Candida spp., Trichoderma spp. and
                                                                               Penicillium spp. from the Russian pathogenic fungi collection of
P191                                                                           Kashkin Research Institute of Medical Mycology. The primers used in
Electrophoretic karyotype and gene mapping of Brazilian                        RAPD analysis were: JWFF (GGTCCGTGTTTCAAGACG), R4
strains of Sporothrix schenckii                                                (TGGTCGCGGC), RP2 (AAGGATCAGA), RP4–2 (CACATGCTTC) and
L. Santos Feitosa1, A. A. Sasaki2 and Z. P. Camargo2                           R108 (GTATTGCCCT). In RAPD patterns evaluation only bands
1
                                         ˜o
 Universidade Camilo Castelo Branco, Sa Paulo, Brazil,                         presence but not its intensity considered being significant. For
2
                            ˜o         ˆo
 Universidade Federal de Sa Paulo, Sa Paulo, Brazil                            increasing RADP analysis accuracy we made statistical analysis of
                                                                               results using soft Gel Compar II v. 5.10. Cluster analysis based on
                                                                               RAPD patterns was performed with UPGMA/Dice algorithm.
Objectives: In order to know differences in electrophoretic karyo-
                                                                               Results: We examined primers on theirs ability to discriminate isolates
type and gene mapping in Sporothrix schenckii strains, we analyzed 10
                                                                               from collection of strains and species Candida genus. Two primers, JWFF
Brazilian strains using pulsed field gel electrophoresis (PFGE) and
                                                                               and R4, gave the highest level of discrimination different species of C.
mapped ITS and b -tubulin genes in electrophoretic karyotype through
                                                                               albicans. Comparison of the RAPD patterns of the same strain in different
Southern blotting assay.
                                                                               repetition of analysis gave 95% of similarity for JWFF primer and 98% for
Methods: Ten S. schenckii strains isolated from patients or from soil          R4; similarity between different strains was 45–82% for JWFF and 60–
were cultured in Sabouraud agar slants at room temperature. After
                                                                               94% for R4; whereas Candida species revealed similarity not exceeded
10 days of incubation at 37 °C under gentle shaking, yeast cell were
                                                                               56% for JWFF and 60% for R4. It is important that major bands were
harvested. Cells were mixed with Zymolyase solution and Low Melting
                                                                               equal for all strains within same species and varied between different
Point Agar to reach a final concentration of 1 · 108 cell ml-1. Then,
                                                                               species. This allowed easily differentiate Candida species without running
cell suspension were pipetted into casting mold and agar allowed to
                                                                               statistical analysis (Figure 1). Then we tested efficiency of these primers in
solidify at 4 °C. Plugs were unmolded and spheroplast solution were
                                                                               epidemiological studies on several non-Candida genus. Two isolates from
added and the inserts were incubated overnight at 37 °C. Spheroplast
                                                                               genus Trichoderma and two from Penicillium were used in the exam. The
solution were replaced by NDSK buffer and then, the inserts were
                                                                               goal was to determine whether the isolates belong to the same population
washed three times with EDTA (50 mmol L-1), and incubated over-
                                                                               or not. RAPD typing with five primers revealed very low similarity level:
night at 50 °C. NDSK buffer were replaced by Stock solution after
                                                                               from 0% to 27% for Trichoderma spp. and from 6% to 35% for Penicillium
washing three times with EDTA (50 mmol L-1) and stocked at 4 °C
                                                                               spp. Also common major bands were not detected in RAPD patterns.
until use. Plugs were loaded into PFGE gel (0.8%) and chromosomal
                                                                               These results most probably indicated that this fungi might belong to
separation were carried out in a constant temperature at 10 °C, with
                                                                               different populations and moreover to different species. ITS1 and ITS2
homogeneous pulses and interpolation for 168 h at 42V (phase 1:
                                                                               rDNA loci were sequenced to verify this prior conclusion. Sequence
pulse time 900 sec/24 h; phase 2: 1800 sec/24 h; phase 3: 2700 sec/
                                                                               alignment confirmed that isolates belongs to the different species: T.
48 h; phase 4: 3600 sec/48 h; phase 5: 4500 sec/24 h). After
                                                                               citrinoviride and T. atroviride, P. chrysogenum and P. commune. Thus these
separation, chromosomes were transferred to nylon membrane by
                                                                               primers are useful to discriminate species as within Candida as within
capillarity and membranes were hybridized with probes from ITS
                                                                               other genus. But similarity of Trichoderma and Penicillium RAPD patterns
fragments and b-tubulin genes.
                                                                               exceeded similarity between species within these genus, so filogenetic
Results: The electrophoretic karyotype show five to seven chromo-               dentogram constructed in this case was incorrect (Figure 2). Therefore it
somal bands in S. schenckii Brazilians isolates. Genome size, calculated       is necessary to use other primers for intergeneric distinguishing.
through sum of all chromosomal bands, appeared to range from 27.7
to 36.6 Mpb. Four strains presented the same electrophoretic karyo-
type (EPM 03, EPM 05, EPM 18 and EPM19). EPM 14, EPM 10 and
EPM 20 show similar pattern of electrophoretic karyotype having
common bands of 8.0, 6.0, 3.5 and 3.0 Mpb. The band of 6.0 Mpb was
present in all isolates and only EPM 15 strain did not present the band
of 8.0 Mpb. ITS probe hybridized in the bands of 7.0 Mpb (EPM 03,
EPM 05, EPM 18, EPM 19, EPM 14, EPM 08); 8.0 Mpb (EPM 19, EPM
20); 5.6 Mpb (EPM 10); 3.2 Mpb (EPM 17 and EPM 15). b-tubulin
probe hybridized in the bands of 3.1 Mpb (EPM 03, EPM 05, EPM 18,
EPM 19, EPM 08); 4.7 Mpb (EPM 20); 3.5 Mpb (EPM 17); 3.2 Mpb
(EPM 15); 3.0 Mpb (EPM 14 and EPM 10).
Conclusion: Difference in electrophoretic karyotype among Brazil-              Figure 1 RAPD patterns with primer JWFF of Candida spp.
ian strains suggest chromosomal polymorphism in size and number of
chromosomal bands. ITS probe hybridized predominantly in large
chromosomes and the opposite happened with b-tubulin probe. These
findings show high degree of polymorphism among Brazilian S.
schenckii isolates.



P192
RAPD analysis efficiency of the medically important fungi in
epidemiological studies                                                        Figure 2 RAPD patterns with primer R4 of four fungi species.
D. Markozashvili, N. A. Smolina and S. M. Ignatieva
Kashkin Research Institute of Medical Mycology of SEI APE SPb                  Conclusion: RAPD analysis with JWFF, R4, RP2, RP4–2 and R108
MAPE, Saint Petersburg, Russia                                                 primers were useful for distinguishing species within Candida, Tricho-
                                                                               derma, Penicillium genus and most probably within other fungi genus.
Objectives: RAPD analysis is one of the most popular DNA-finger-                RAPD with JWFF primer is the best for Candida discriminating because
printing methods used for genetic variability detection, relationship          it allows easily differentiate species without applying software analysis.




                                                                                                                                 Ó 2009 The Authors
90                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



JWFF and R4 primers are more suitable for distinguishing C. albicans            P202
strains. Statistical treatment of RAPD results is essential for accuracy        Mixed Candida albicans and Candida krusei biofilm
increasing and avoidance of incorrect typing.                                   formation on stainless steel surface – evaluation of fungal
                                                                                killer toxin on two Candida species biofilms
                                                                                N. Seguy1 and E. Mazars2
                                                                                1
                                                                                 University of Burgundy, Dijon Cedex, France, 2Hospital, Medical
P201                                                                            biology laboratory, Valenciennes, France
Candida albicans uptake and escape from macrophages
C.G.J. McKenzie1, U. Koser1, L. E. Clift1, J. M. Bain1,                         Most of the studies on biofilm of Candida have so far used the silicone,
H. Mora-Montes2, R. N. Barker1, N.A.R. Gow2 and L. P. Erwig1                    the polyethylene, PVC, elastomeric supports. Nevertheless, other
1
 University of Aberdeen, Aberdeen, United Kingdom, 2School of                   biomaterials are also used for medical prosthetic implants (resins,
Medical Sciences, Aberdeen, United Kingdom                                      metals as the titanium). These devices can become colonized by micro-
                                                                                organisms which produce a biofilm. But, in that case, the data are very
                                                                                fragmented. Two Candida species were compared: Candida albicans and
Objectives: Candida albicans is the most common human fungal
                                                                                Candida krusei. Their differences are specifically obvious like, their
pathogen. In immunocompromised individuals, filamentous C. albicans
                                                                                morphological forms (hyphal forms only observed in C. albicans), their
penetrates the mucosal layers of the host, causing systemic candidiasis,
                                                                                habitats (commensal versus environmental), and their resistance to
with a high mortality rate. C. albicans pathogenicity depends on its
                                                                                antifungal drugs. Our study compared development of biofilm made up
ability to kill immunocompetent cells and escape destruction by the
                                                                                by single yeast (C. albicans versus C. krusei). Several parameters such as
host immune system. Our aim is to determine the role of specific C.
                                                                                temperature (25, 30 and 37 °C) and time course (2, 24, 48, 72 and
albicans cell wall components and corresponding pattern recognition
                                                                                96 h), were investigated to obtain monospecies biofilms. These
receptors (PRRs) for the ability of C. albicans uptake by and escape from
                                                                                parameters (temperature at 25 °C and time course: 2–72 h), were
macrophages.
                                                                                defined to obtain an optimal development on both species Candida in a
Methods: We have examined the world’s largest collection of                     mixed biofilm. The formation of biofilms elaborated with one Candida
genetically and phenotypically characterised isogenic mutants of C.             (C. albicans or C. krusei), had the same characteristics, especially in the
albicans, depleted in specific cell wall components, and conducted               early steps: adhesion and the colonization of the steel surface was
complimentary studies using monoclonal antibodies to Dectin-1,
                                                                                observed after 24 h growth for the two species whoever the
Mannose receptor (MR) and soluble inhibitors (laminarin, mannans).              temperatures may be. Nevertheless, after 48 h of incubation, we saw
Further experiments were conducted using mutants (hgc1D, efg1D,
                                                                                a maximum of development of these two yeasts ordered in biofilms. The
cph1D, efg1D/cph1D and clb2D) with intact cell walls but defects in
                                                                                hyphal/pseudo-hyphal forms are observed only with C. albicans biofilm
morphogenic switching from yeast to hyphal forms. Uptake was                    formation, and not on the C. krusei biofilm. With these experiments at
assessed by our standard phagocytosis assays using bone marrow
                                                                                25 and 30 °C, the number of C. albicans increased at least 4-fold more
derived (BMDM) and J774 macrophages at 30 min, 1, 2 and 3 h at C.               by comparison with C. krusei. Nevertheless, number of adherent cells
albicans:macrophage ratios of 1 : 1 and 3 : 1. The ability of C. albicans       (at 2 h of incubation) was the same for the two species. For the mixed
to kill macrophages was assessed by light microscopy using Trypan
                                                                                biofilms, in early steps (2 and 24 h of incubation), C. albicans was the
Blue and confirmed by scanning electron microscopy.                              most prevalent in the biofilm. But at 48 and 72 h, C. krusei colonized
Results: Uptake by BMDM and macrophage cell lines of C. albicans                widely the stainless steel surface (10-fold more). And the number of C.
glycosylation mutants with defects in phosphomannosylation (mnn4D               krusei was more important since 24 h of incubation in the mixed
and pmr1D) was significantly reduced, whereas uptake of mutants                  biofilm than in the biofilm constituted with only C. krusei. The mixed
deficient in O-linked mannosylation (mnt1/2D) was significantly                   biofilms of C. albicans and C. krusei were in favour of C. krusei
increased, compared with wild-type and genetically complemented                 development. Addition of killer toxin, secreted by Pichia anomala in the
controls. Despite significant differences in the rate of uptake, all             mixed biofilm induced significant reduction on both C. albicans and C.
glycosylation mutants exhibited a reduced ability to kill macrophages           krusei developments. From 24 h of incubation at 25 °C, only 28% of C.
in vitro. Complimentary experiments using wild-type C. albicans and             krusei and 47% of C. albicans were growth in the mixed biofilm to
blocking specific PRRs using antibodies or soluble inhibitors show               compare with the mixed biofilm without P. anomala secreted killer
delayed uptake when inhibiting Dectin-1, but not MR. Interestingly,             toxin. It is interesting to note that effect of killer toxin was more
despite their divergent effects on uptake, blocking Dectin-1 and MR             important on C. krusei. At 48 h, only 4% of C. krusei cells were alive
resulted in similar reductions in macrophage killing. Morphogenesis             against 17% of C. albicans in mixed biofilm with P. anomala. This effect
mutants with intact cells walls but unable to form true hyphae, showed          of killer toxin was quantity-dependent.
little difference in uptake, when compared to wild-type C. albicans, but
interestingly were unable to kill macrophages.
Conclusions: C. albicans uptake by macrophages is strongly influ-
enced by the glycolysation of the fungal cell wall, but not the
pathogen’s ability to switch from yeast to hyphal forms. Morphogenic            P203
switching however is essential for C. albicans ability to kill host cells and   The interaction of macrophages with different Cryptococcus
abrogated in mutants that are unable to form hyphae. Interestingly, all         neoformans isolates
glycosylation mutants despite normal hyphal formation exhibit a                 L.V. Filippova, N. V. Vasilyeva, E. P. Kiseleva, E. V. Frolova and A.
reduced ability to kill macrophages in vitro. Blocking PRRs known to
                                                                                E. Uchevatkina
recognise motifs on the C. albicans cell wall significantly reduces
                                                                                Kashkin Research Institute of Medical Mycology, St. Petersburg,
macrophage killing, regardless of whether they contribute to uptake.
This illustrates the complex interactions between the C. albicans cell          Russia
wall and macrophage PRRs. A better understanding of these interac-
tions is crucially important for therapeutic manipulation of the host’s         Objectives: The pathogenesis of cryptococcosis reflects the interac-
ability to ingest and process fungal pathogens.                                 tion between immune response to the infecting organism and the
                                                                                virulence potential of the Cryptococcus neoformans strains. The aim of
                                                                                this study was to investigate the ability of highly and weakly virulent
                                                                                C. neoformans strains to influence phagocytosis and nitric oxide (NO)
                                                                                production by murine peritoneal macrophages.
                                                                                Methods: Seven strains of C. neoformans were isolated from patients
                                                                                with AIDS or after renal transplantation. Range of virulence C.
                                                                                neoformans strains was study according to survival time of Balb/c male
                                                                                mice 8–12 weeks old after intravenous inoculation with 0.5 · 106




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                       91
Poster Presentations



cells per mice. The observation time was 65 days. Murine peritoneal           demonstrate that ROS are released prior to NET detection. Currently
macrophages (PM) obtained from Balb/c male mice were incubated                we aim to visualize NET formation in a murine in vivo infection model
during 18 h with and without LPS in glass Chamber Slides in 5% CO2            by 2-photon-microscopy. First results show NET like structures around
incubator. For phagosytosis of different C. neoformans strains with and       sources of infection in explanted lungs of fungi treated animals. To
without opsonization of fresh serum were added in ratio 1 : 2 and             summarize our data, we found rapid NET formation as a commonly
incubated for 2 h. The phagocytic index (PI) was determinated as a            observed immune response of neutrophil granulocytes contacting A.
number of attached and ingested cryptococci divided by macrophages            fumigatus in vitro and in vivo. Consistent with studies on different
number. For nitric oxide production PM were incubated during 48 h             pathogens this mechanism seems to be ROS-dependent. The time
with C. neoformans in ratio 10 : 1. The concentration of NO was               course of NET-formation and the ROS-dependency in vivo has to be
measure spectrofotometrically with Griess reagent.                            investigated by us in future. Furthermore we focus on establishing an
Results: Highly virulent strains have caused 50% mortality of mice            innovative infection model to perform intravital 2-photon-imaging in
on 14th day and 100% mortality on the day 25 after inoculation. Low           the respiratory organs of mice.
virulent strains have caused 50% mortality on the day 50th and there
was no 100% mortality after 65 days of observation. These two groups
of strains were used for investigation of interaction with PM in vitro. In
all variants of experiments PI of strains with low virulence was              P211
significantly higher than for strongly virulent strains. Opsonization
                                                                              Molecular diagnosis of Malassezia spp. by PCR-RFLP
have increased PI both highly (13.5 ± 2.1 vs. 8.8 ± 1.0% P 0.01) and
                                                                              M. Shams-Ghahfarokhi1, S. Amanloo1, M. H. Mirzahosseini2,
weakly virulent strains (24.3 ± 0.3 vs. 14.7 ± 0.9% P 0.01) in
comparison with control. Activation PM with LPS was resulted in               M. Foruzandeh-Moghadam1 and M. Razzaghi-Abyaneh2
                                                                              1
increase of PI more for highly virulent strains than weakly virulent           Tarbiat Modares University, Tehran, Iran, 2Pasteur Institute of Iran,
ones (20.3 ± 1.0 vs. 8.8 ± 1.0 P 0.01 and 25.7 ± 0.7 vs.                      Tehran, Iran
14.7 ± 0.9% P 0.01). We have found that nitric oxide synthesis of
LPS-activated PM after incubation with highly virulent strains was            Background: Lipophilic yeasts of the genus Malassezia are com-
decreased significantly in comparison with control (73.8 ± 19.7 vs.            mensals of the microbiota found on normal skin of many warm-
168.3 ± 18.8 nmol L-1 per 106 cells P 0.01). In contrast, incubation          blooded vertebrates, but they are also associated with several skin
with weakly virulent strains was resulted in markedly increased nitrite       diseases such as tinea versicolor, seborrehoeic dermatitis and even
generation (302.3 ± 45.9 vs. 168.3 ± 18.8 nmol L-1 per 106cells P             systemic infections. The genus Malassezia has recently been revised to
0.01). Therefore, highly virulent strains may cause a direct suppression      include 11 species by biochemical, morphological and molecular
of NO-mediated activity of LPS-stimulated macrophages and poorly              findings. Application of polymerase chain reaction (PCR) technology to
phagocytosed. On the contrary, low virulent strains induce an                 molecular diagnostics allows early and accurate identification of
activation of nitric oxide production and better phagocytosed in all          Malassezia spp.
variants of experiments in comparison with results for highly virulent        Methods: At the first, conventional identification methods based on
strains.                                                                      macroscopic, and microscopic features and physiological properties
Conclusion: All these data suggest that the degree of the virulence           was performed. All samples consisted of scales and scraping from the
C. neoformans depend on capability different strains to influence on           scalps of tinea versicolor patients. collected samples were divided into
phagocytosis and NO production by macrophages. Further studies are            two portions- one for culture and biochemical analysis, and the other
necessary to determine the exact mechanisms of such effect.                   for molecular examination. A specific and unique restriction pattern
                                                                              was determined for each of three currently recognized Malassezia
                                                                              species.
                                                                              Results: The primers ITS1/4 produced a large amplificon (about
P204                                                                          800 bp for M. furfur, and M. globosa) and the other amplificon is smaller
New insights into NET formation after contact of                              (about 600 bp for M. sympodialis). For further species distinction with
polymorphonuclear neutrophils to Aspergillus fumigatus                        this amplicon, one restriction endonuclease proved useful. Restriction
M. Hasenberg1, S. Wolke2,3, A. Brakhage2,3 and M. Gunzer1                     patterns obtained by ECOR1 digestion of amplified products from the ITS
1                                                                             region was distinguish. The PCR-RFLP results correlated well with those
 Institute for Molecular and Clinical Immunology,
Otto-von-Guericke-University, MAGDEBURG, Germany,                             obtained with traditional identification procedures. No intraspecific
2
 Leibniz Institute for Natural Product Research and Infection                 variation was detected.
Biology – Hans-Knoell-Institute (HKI), JENA, Germany,                         Conclusions: This study was aimed at the development of a DNA-
3                                                                             based procedure applicable to rapid laboratory confirmation and
 Friedrich-Schiller-University JENA, Germany
                                                                              identification of each Malassezia species.

Since their discovery in 2004 nucleic extracellular traps (NETs)
released by certain cell types including neutrophil and eosinophil
granulocytes were shown to play a crucial role in mediating innate
                                                                              P212
immune responses towards different bacterial und fungal pathogens.            Significance of allele state determination of MTL locus in
Recently it was found by us and others that neutrophil granulocytes           Candida albicans
release NETs also upon contact to the filamentous fungus Aspergillus           S.M. Ignatieva
fumigatus. In the present study we aimed to characterize this process in      Kashkin Research Institute of Medical Mycology, Saint-Petersburg,
more detail focusing on the kinetics of NET-formation as well as              Russia
clarifying the responsible cell-biological mechanisms. By the use of
several microscopic techniques (Scanning electron microscopy, fluor-           Introduction: Candida albicans being opportunistic pathogens rep-
escence widefield microscopy and confocal microscopy) we initially             resent unicellular organisms with the size of cell 6–10 l. These
demonstrated the generation of NET like structures after coincubation         organisms are known to exist in two morphological states – ‘white’and
of A. fumigatus germlings and freshly isolated murine or human PMN in         ‘opaque’. White-opaque switching is caused by high frequency
vitro. The analysis of our time lapse video microscopy data allowed us        genotype switching between different mating types. MTL locus is
to examine the exact time course from initial contact to the fungal           responsible for mating type and it is situated on fifth chromosome.
surface to explosive release of NETs up to 3 h later. Moreover, we            There are two mating types – type a and type a, which are carried out
investigated the dependency of this phenomenon on the induction of            as a result of loci become homozygous. Mating may take place only
an oxidative burst. Therefore we added the NADPH-oxidase inhibitor            between homozygous MTLa and homozygous MTLa strains. Cells
DPI to the cell coincubation and found clearly reduced NET formation.         possessing opaque phenotype are more pathogenic then that with
By fluorescence staining of reactive oxygen species we could                   white phenotype because of its higher invasive activity.




                                                                                                                                Ó 2009 The Authors
92                                                                 Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



Materials and methods: Cloning of C. albicans strains was con-                  components, DNA isolation reagents, and gel electrophoresis equip-
ducted on Saburo agar; goal was to get genetic uniformity of                    ment. Furthermore, no DNA probes or expensive analysis is needed.
descendants. Cloning was followed by distinguishing able and disable            The same MP65 specific primers used in Multiplex PCR could be used
to switching strains. In future studying, all strains were used. DNA            also to develop a Multiplex Real-Time PCR for detection and
extraction from liquid culture was held by previously optimized method          identification of Candida species in biological samples. The advantage
with using isoamyl and chloroform and glass beads. After extraction,            of the Multiplex Real-Time PCR over PCR is that it is simpler, less
PCR was carried out. Each strain was exposed two reactions varied in            expensive and consequently more readily adaptable to Candida
types of primers, the first one were for MTLa locus the other for MTLa           detection in clinical laboratories.
locus. For amplification results visualization agarous electrophoresis
was used. By evaluation of fragments, size concentration of gel was
chosen 1.2%.
Results and conclusion: Strains that were able for phenotype                    P214
switching had homozygous MTL loci and their genotype was MTLa/                  The CAMP65 gene is essential for cell wall integrity,
MTLa, or MTLa/MTLa. And on the other hand strains for which                     adhesion and biofilm formation
switching was not observed had heterozygous genotype. So that                   S. Sandini, A. Stringaro, S. Arancia, M. Colone, S. Murtas,
previous genotyping of C. albicans clinical isolates MTL loci and               N. Mastrangelo, A. Cassone and F. De Bernardis
determining allele state of fifth chromosome might have important                                            `,
                                                                                Istituto Superiore di Sanita Rome, Italy
diagnostic significance. Strains being homozygous tend to be more
pathogenic than heterozygous one.
                                                                                Objectives: We have previously shown that Camp65 is a putative b-
                                                                                glucanase mannoprotein adhesin of Candida albicans, required for
                                                                                hyphal morphogenesis and experimental pathogenicity and recognized
                                                                                as a major target of the human immune response against this fungus.
P213                                                                            The objectives of this study were to determine a possible role of
Multiplex PCR and real-time PCR identification of five                            Camp65 in cell wall integrity, adhesion and biofilm formation with the
medically important Candida species by using 65 kDa                             use of microbiological and molecular biological tools.
mannoprotein gene primers                                                       Methods: To determine the role of Camp65 on the cell wall integrity,
S. Arancia1, S. Sandini2, A. Cassone2 and F. De Bernardis2                      we grew the wild-type and Camp65 null mutant strains in YPD w/o
1
 Instituto Superiore di Sanita Roma, Italy, 2National Health
                              `,                                                different cell wall-perturbing agents. We then checked the sensitivity (by
Institute, Roma, Italy                                                          microdilution and spotting in solid medium), cell morphology (by light
                                                                                and scanning electron microscopy), the expression of some genes involved
                                                                                in cell damage response (by real-time PCR), the expression of MAPKs and
Objectives: Candidemia has been estimated as the fourth most
                                                                                P-gp-like protein (by Western-blot analysis), and the cell wall composition
common nosocomial infection with an attributable mortality rate of
                                                                                (by immunoelectron microscopy, flow cytometry and high-performance
about 50%. Early diagnosis is often difficult as most clinical signs are
                                                                                ionic chromatography). To investigate the role of Camp65 on the
non specific and cultures become positive too late for the initiation of
                                                                                adhesion, we tested the differences in adhesion of wild-type and Camp65
effective antifungal therapy. Blood cultures were reported to be
                                                                                null mutant strains using two target cell systems and evaluation methods:
negative in 56% of autopsy-proven disseminated candidiasis. Candida
                                                                                (i) exfoliated human buccal epithelial cells (BEC), where adhesion was
albicans is the most common and clinically relevant pathogen of the
                                                                                evaluated microscopically; and (ii) Caco-2 cell monolayer, adhesion
genus. However, there has been a significant trend in the emergence of
                                                                                evaluated by cfu count. In order to determine the role of Camp65 on
species other than C. albicans, with a particular increase in C. glabrata,
                                                                                biofilm formation, we performed an in vitro reduction assay with XTT and
C. krusei, C. parapsilosis and C. tropicalis frequency. In addition, given
                                                                                menadione, where the cells were added to 24-well plates and incubated for
that several non-C. albicans species are intrinsically resistant to
                                                                                2 days until they adhered to the surface, to permit the development of a
common antifungal agents, accurate identification of Candida species
                                                                                biofilm. To understand how CAMP65 is linked to adherence and
is crucial for the determination of appropriate antifungal therapy. For
                                                                                filamentation, we studied its expression by Northern-blot analysis in
these reasons there is an increasing interest in the development of new
                                                                                mutants defective of genes regulating hyphal morphogenesis and
technological tools for the diagnosis of invasive candidiasis. Polymerase
                                                                                adherence (efg1, efg1 cph1, cph1).
chain reaction (PCR) methods to detect fungal DNA from blood and
other biological samples are being developed in the research labora-            Results: More observations have supported the idea that CAMP65 is
tory. PCR has the potential to decrease the time required to diagnose           required for cell wall integrity: (i) the Camp65 null mutant is
fungal infections and therefore reduce the mortality associated with            hypersensitive to Congo red, calcofluor white, hydrogen peroxide,
disseminated disease.                                                           caspofungin, fluconazole, voriconazole, itraconazole, b 1-3 glucanase
                                                                                and weakly sensitive to SDS, tunicamycin and caffeine; (ii) interest-
Methods: In this work we describe the development and evaluation
                                                                                ingly, under the stress of Congo red, the Camp65 null mutant shows
of single-tube multiplex PCR and real-time PCR methods for the
                                                                                morphological changes, such as swelling and formation of pseudohyp-
detection of the five most common Candida species. Sequences of the
                                                                                hae and hyphae and an increase in the phosphorylation of Mkc1p,
MP65 gene of the five different Candida species were determined (C.
                                                                                Cek1p and Cek2p (p42–44 homologues), consistent with the increased
albicans, C. glabrat a, C. guilliermondii, C. tropicalis and C. parapsilosis)
                                                                                sensitivity to this substance; (iii) furthermore, the Camp65 null mutant
and six different primer pairs were used in the same PCR reaction with
                                                                                presents an expression of some genes involved in cell damage response,
the objective of producing different specific amplicons dependent on the
                                                                                such as DDR48, a decrease of P-gp-like protein expression and a
target present in the sample. Then we developed two types of PCR: in
                                                                                different cell wall composition. Compared to the wild-type, Camp65
the first, in each reaction tube we added a mix of five different Candida
                                                                                null mutant shows a reduced adherence and a defect in biofilm
species DNA and a single species-specific primer pair. In the second, in
                                                                                formation, highlighting the role of Camp65p adhesin. Furthermore,
each reaction tube we added a mix of five primer pairs and a single
                                                                                CAMP65 was under the differential control of several regulators of
Candida species DNA.
                                                                                filamentation; its expression was particularly enhanced in efg1 and efg1
Results: Both types of PCR assays detected the five Candida species
                                                                                cph1, but not in cph1 strains, suggesting that it is dependent on cAMP
tested. All the PCR assays were also performed with DNAs extracted
                                                                                pathway, but independent of the MAPK cascade.
from biological samples (urine and serum). At the time being, new
assays that make use of the same primers and samples are being
                                                                                Conclusion: Overall, our data demonstrate that Camp65 is involved
                                                                                in cell wall integrity, adhesion to host tissue and biofilm formation,
performed by Real Time PCR, thus allowing to reach specificity in a
                                                                                making it a promising therapeutic target.
short time.
Conclusions: In conclusion, we have drawn primers-pairs specific
for five Candida species and we developed different PCR methods using
them. The methods are cost-effective because they only require PCR




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                       93
Poster Presentations



P215                                                                        and the plates were left on ice for 15 min. After centrifugation at
Multilocus sequence typing of Cryptococcus neoformans                       2250 g for 20 min at 4 °C, 130 ll of supernatant was collected and
var. grubii Italian clinical isolates. Preliminary results of               transferred to new plates containing 20 lg of linear acrylamide as
three gene sequence analysis                                                carrier. 15 ll of 2.5 mol L-1 sodium acetate and 150 ll of absolute
M. Cogliati1, R. Zamfirova2, M.A. Viviani2 and FIMUA                         ethanol were added, the plates kept on ice for 15 min and then
                                                                            centrifuged for 15 min at 2250 g and 4 °C. The supernatant was
Cryptococcosis Network2
1                                                                           gently removed, the pellet was washed twice with 80% ethanol (5 min
 Public Health-Microbiology-Virology, Milano, Italy, 2Universita`
                                                                            at 2250 g at 4 °C), left to dry at room temperature and then
Degli Studi di Milano, Milano, Italy                                        redissolved in 30 ll of buffer TE/RNase (10 mmol L-1 TE, 10 lg ml-
                                                                            1
                                                                             RNAse, pH 7.5). To evaluate whether this method of DNA recovery
Objective: Cryptococcus neoformans var. grubii (serotype A) is the          was the most efficient, duplicates with 100 ng of plasmid DNA (~4 Kb)
major etiological agent of cryptococcal meningitis in both immuno-          were submitted to different protocols of precipitation and the result was
compromised and immunocompetent patients. Since this pathogenic             compared with known concentrations of the plasmid DNA, 20, 60 and
yeast is globally distributed and the PCR-based molecular methods are       100 ng (lanes 7, 8 e 9, respectively). The addition of Tween 20 to the
not sufficiently able to discriminate among the different populations, a     culture medium is important to avoid growth of fungus on the surface
multilocus sequence typing (MLST) approach has been applied in the          of the solution. In the absence of a refrigerated centrifuge there is no
present study to investigate the genotype of C. neoformans var. grubii      loss in processing the samples at room temperature. The precipitation
Italian clinical isolates.                                                  with linear acrylamide, sodium acetate and absolute ethanol did not
Methods: The analysis includes 53 isolates, each representative of a        promote greater recovery of DNA when compared with other
single case. Forty out of the 53 cases were previously reported in the      techniques widely used in molecular biology (Fig. 1A, 1B). However,
ECMM cryptococcosis survey (Viviani et al. 2002) whereas the                for the recovery of smaller molecules as plasmid DNA (~4 Kb) it was
additional 13 cases were recorded subsequently. Genotyping was              more efficient (Fig. 1C, 1D). With this methodology we managed to
performed by MLST analysis adopting the scheme recently established         extract genomic DNA from 192 samples in just three hours, free of
by the ISHAM Cryptococcus Working Group (Meyer et al. 2009) which           endonucleases and enough to provide material for different molecular
includes seven hypervariable housekeeping genes: IGS1, GPD1, LAC1,          biology procedures like PCR, RFLP, RAPD and real-time PCR.
URA5, SOD1, CAP59, and PLB1. In the present study, three (IGS1,
GPD1 and URA5) of the seven genes have been completely sequenced
and analysed for all the strains.
Results: URA5 and IGS1 produced five different genotypes each, and
GPD1 three. The combination of the three genes produced 11
genotypes and the most representative genotype grouped 16 isolates.
No correlation between genotypes and geographic distribution was
found. Interestingly, the five IGS1 genotypes were not included in the
list of genotypes previously identified by Litvintseva et al. (2006) and
therefore have been classified as new genotypes. In addition, all the five
genotypes presented a 13-bp insertion which was identified only in one
African isolate of the Litvintseva’s study. On the contrary, BLAST
analysis in GenBank database showed that this 13-bp insertion was
present in several IGS1 sequences, mostly from European isolates (The
Netherlands, Belgium, France, and Italy).
Conclusions: These preliminary results show that the genotypes of
Italian var. grubii isolates are different with respect to other strains
previously genotyped by MLST (Litvintseva 2006) and, comparing
IGS1 sequence, they appear to be correlated to few European isolates.
The heterogeneity of IGS1 genotypes presenting the 13-bp insertion          P217
suggests a possible origin of this genotype in Europe. The present study    Comparison of the efficiency of DNA extraction from
is ongoing with the aim of sequencing all the seven genes of the MLST       Aspergillus fumigatus spores using five commercial kits and
standard scheme.                                                            quantitative PCR
                                                                            U. Nawrot, K. Wlodarczyk, A. Wasik, A. Sadakierska-Chudy and
                                                                            T. Dobosz
                                                                            Wroclaw Medical University, Wroclaw, Poland
P216
A practical and rapid microplate method for yeast genomic
                                                                            Detection of fungal DNA in clinical samples requires the most sensitive
DNA extraction                                                              and specific methods. An extraction of fungal DNA represents a crucial
A.J. Mota, G. N. Back-Brito and F. G. Nobrega                               point in such procedures, as its poor efficiency and frequently occurred
University of Sao Paulo, Sao Paulo, Brazil                                  contaminations are regarded the most important reason of false
                                                                            negative and false positive results, respectively. Currently, most kits
In this work we established a practical and low cost protocol that          offered in the market are intended for isolation of human DNA from
allows rapid extraction of genomic DNA from multiple samples of             clinical samples, or for extraction of DNA from fungal cultures. In this
several yeast genera (Candida spp., Debaryomyces spp., Geotrichum spp.,     study we used the quantitative real-time PCR method (qPCR) for
Hansenula spp., Issatchenkia spp., Pichia spp., Saccharomyces spp.,         comparison an efficiency of DNA extraction from blood samples spiked
Trichosporon spp., Yarrowia spp.). Aliquots of rich yeast medium            with Aspergillus (10–107 spores ml-1) using five commercial kits:
(150 ll) with 0.001% v/v Tween 20 were distributed in two 96 wells          Qiamp DNA Micro (QMc) and Qiamp DNA Mini (QMn) from Qiagen, ZR
microplates. A small quantity of cells was inoculated with frog of 96       Fungal/Bacterial DNA (ZRF) and YeaStar Genomic DNA (YSG) from
pins and the plates where incubated at 30 °C overnight without              Zymo Research, and Dynabeads DNA Direct Blood (DYN) from Dynal
shaking. The plates were centrifuged at 2250 g for 5 min at 20 °C, the      Biotech. In all above methods the manufacturer’s procedures were
supernatant was removed and the cells resuspended in 100 ll of lyses        preceded by lysis of red and subsequently white blood cells and in case
buffer (100 mmol L-1 EDTA, 50 mmol L-1Tris–Cl, pH 7.5, 25 mmol L-           of both Qiagen kits additionally fungal cells destroying by vortexing
1
 DTT, 165 lg ml-1 de Zymolyaze) and incubated at 37 °C for 30 min.          with glass beads on Mini-BeadBeater-8 (Biospec) or enzymatic
SDS was added to a final concentration of 1%, followed by incubation         treatment with a lyticase (Loffler et al.1997; Metwally et al. 2008).
at 65 °C for 30 min. 40 ll of 5 mol L-1 ammonium acetate were added         The glass beads beating was added also to DYN protocol, whereas in




                                                                                                                              Ó 2009 The Authors
94                                                               Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                     Poster Presentations



kits of Zymo Research cell wall breaking is a part of manufacturer               P219
instruction, namely enzymatic lysis in YSG and mechanical in ZRF.                Cell cycle regulation in the pathogenic yeast Cryptococcus
qPCR was performed using previously described Aspergillus-specific                neoformans
primers and TaqMan probe targeting 28S rDNA (Williamson et al.                   S. Kawamoto1, V. Virtudazo1, M. O. Ohkusu1, Y. M. Miyagi2,
2000, White et.al 2006) on Rotor- Gene 6000 (Corbett Life Science). A            S. M. Miura3 and K. T. Takeo1
serially diluted genomic DNA of A. fumigatus (IHEM13934) was used as             1
                                                                                  Chiba University, Chiba, Japan, 2Kanagawa Cancer Center
standard. All examined DNA extraction methods were efficient enough
to detect the lowest tested number of fungi (10 spores), with CT values
                                                                                 Research Institute, Yokohama, Japan, 3Yokohama City University,
ranged between 34.1 ± 0.8 for ZRF, and 37.5 ± 1 for DYN. ZRF and                 Yokohama, Japan
YSG methods showed the highest yield. The use of beads beating
instead enzymatic lysis slightly enhanced the amount of extracted DNA            We have been involved in studies towards molecular understanding of cell
with both Qiagen tests. All examined methods seems to be suitable for            cycle regulation in the pathogenic yeast Cryptococcus neoformans. Our
the extraction of DNA from blood infected with Aspergillus spores. ZRF           group has reported the unique cell cycle pattern of C. neoformans, different
method, however, because of less complicated procedure and good                  from that of the model yeast Saccharomyces cerevisiae. In contrast to S.
efficiency seems to be more relevant for routine use.                             cerevisiae, very little is known about the molecular regulation of C.
                                                                                 neoformans cell cycle. To clarify C. neoformans cell cycle regulation at the
                                                                                 molecular level, cell cycle control genes in C. neoformans were cloned and
P218                                                                             analyzed, and further studies are currently being done to confirm their
Cloning, characterization and expression of the gene                             function in C. neoformans cell cycle. The homologues of CDC28/Cdc2, the
                                                                                 main cell cycle gene which regulates the major processes in eukaryotic cell
encoding a glicoprotein of 70 kDa (gp70) from
                                                                                 cycle, and its cyclin counterparts, known to interact with CDC28/Cdc2
Paracoccidioides brasiliensis
                                                                                 and activate it to carry out specific controls throughout different stages of
J.T.M. Maricato, L.S. Feitosa, E. S. Kioshima, R. Puccia,                        the cell cycle, were isolated and identified from C. neoformans. In addition
W. L. Batista, G. H. Goldman and J. D. Lopes                                     we have also cloned some other related gene candidates. Analysis of amino
                           ˜o           ˜o
Universidade Federal de Sa Paulo, Sa Paulo, Brazil                               acid sequences of the CDC28/Cdc2 homologue, CnCdk1, revealed that it
                                                                                 possesses the conserved motifs found in CDC28/Cdc2 homologues.
Objectives: Paracoccidioides brasiliensis is a thermodimorphic fungus            However, we found the difference in an amino acid residue in the well
that causes Paracocciodioidomycosis (PCM), human systemic granu-                 conserved PSTAIRE motif known to be involved in cyclin binding; in
lomatous disease prevalent in Latin America. Most of the genes                   CnCdk1 alanine is changed to serine to become PSTSIRE. In addition to
encoding and proteic sequences of relevant fungal antigens remain                CnCdk1, at least three cell-cycle related cyclin homologues were identified
uncharacterized. P. brasiliensis produces some important antigens like           in C. neoformans. Analysis of putative amino acid sequences of these cyclin
gp43 which has been fully characterized, and a 70 kDa glycoprotein               homologues showed that one is a G1 cyclin homologue, named CnCln1
(gp70) recognized by 96% PCM patients’ sera. It has been shown that              and two are B-type or G2/M cyclin homologues, named CnClb1 and
this purified antigen modulates murine peritoneal macrophages                     CnClb2. One of the features that were observed in CnCln1 is the occurrence
functions and that passive immunization of mice with specific anti-               of two upstream ORFs in the 5¢ leader of its mRNA. Short uORFs in the 5¢
gp70 mAbs before fungal infection, significantly inhibited lung                   leader sequence are known to affect translational efficiency of many
granuloma formation. The purpose of this work was molecular cloning              eukaryotic genes. We also identified CnCdc25, the Cdc25 homologue in C.
and characterization of the gene that encodes gp70 from P. brasiliensis          neoformans. Cdc25 is a phosphatase involved in the dephosphorylation of
followed by heterologous expression of the recombinant antigen to                the Cdk1 tyrosine residue that results to activation of the Cdk1-cyclin B
better understand the role of the gp70 in PCM.                                   complex. Analysis of the putative Cdc25 catalytic domain showed that
Methods: Using degenerated primers corresponding to peptides ob-                 CnCdc25 possesses the conserved motifs present in protein phosphatases
tained by microsequencing from gp70, recognized and isolated with                and the consensus sequences involved in tyrosyl phosphate substrate
specific mAB (C5F11), a 384-bp DNA fragment was amplified from the P.              binding. Further molecular analysis of cell cycle regulation in C.
brasiliensis genomic DNA (pbgp70). This fragment showed 97% of                   neoformans is underway.
similarity with one of the Expressed Sequence Tags (ESTs) in P. brasiliensis
EST databank. Specifc primers were synthetized attempting to obtain the
sequence and amplifying the genomic and cDNA sequences correspond-
ing to this EST. Using these specific primers, G2.154 pb products were            P220
obtained by PCR of the genomic DNA. These fragments were cloned and              Multiplex PCR for the detection of fungemia and
sequenced by primer walking.                                                     bacteriemia in the same run
Results: In preliminary sequence analysis it was found the open                  A. Kalkanci, M. Dizbay, A. Kalkanci, K. Hizel, K. Caglar, A. Fouad,
reading frame in a 2154 pb fragment, without introns. Deduced amino              D. Arman and S. Kustimur
acid sequence showed prevalence of hydrophilic regions which probably            Gazi University, Ankara, Turkey
contains B-cell epitopes, one putative T-cell mouse epitope and high
Jameson–Wolf Antigenic Index. BLAST analysis showed homology with
putative proteins from the fungus Coccidioides immitis, Aspergillus              Objectives: Fungi are emerging as important etiological agents of
fumigatus, Ajellomyces capsulatus, which are phylogenetically close to P.        bloodstream infections as much as bacteria. We performed a multiplex
brasiliensis. Oligonucleotides were synthesized to achieve the heterolo-         Real Time PCR based methodology to determine an accurate diagnostic
gous expression of the partial cDNA. A 35 kDa recombinant protein was            method for bloodstream infections. In the present study, detection of
obtained and recognized by mAB C5F11. Polyclonal antibodies anti-gp70            Aspergillus fumigatus, Candida albicans, Staphylococcus aureus and
recombinant protein, were rise in rabbits and these antibodies recognized        Escherichia coli were aimed.
the 70-kDa native protein in cellular extract from P. brasiliensis. Biological   Methods: The specific multiplex PCR method used in this study
assays using the partial recombinant protein and polyclonal antibodies           targets one Gram-positive species Staphylococcus aureus, one Gram-
were carrying on.                                                                negative species Escherichia coli, and two fungal species Aspergillus
Conclusion: The 2.7 kb genomic DNA cloned sequence and the                       fumigatus and Candida albicans. The designed primers and probe sets
partial expressed sequence presents some predicted characteristics of            were based on regions of identity within the 16S rRNA gene of
the P. brasiliensis native gp70 and may represent the gene of the gp70           bacteria. Fungal primers anneal within the ITS2 region. Primer ITS-R
antigen.                                                                         anneals to a highly conserved region of the 28S rRNA gene of fungi.
                                                                                 For the detection and differentiation of Aspergillus species from
                                                                                 Candida species, two different species-specific biprobes were designed.
                                                                                 For in vitro testing, EDTA-anticoagulated blood was inoculated with
                                                                                 S. aureus, E. coli, A. fumigatus and C. albicans. For in vivo testing, four
                                                                                 rabbits were used as the animal model of sepsis. They were inoculated




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                         95
Poster Presentations



with the microorganismas and on the fifth day, the blood was                      P222
collected. DNA was extracted from simulated blood samples as well as             A simple and inexpensive method for genomic DNA
from blood samples of the rabbits.                                               extraction from fungi using Whatman FTA? Elute filter paper
Results: The combination of a group-specific and a universal primers              for conventional and real-time PCR assays
for bacteria and fungi in one reaction mixture facilitated rapid                 R.L. Gorton1, T. A. Vyzantiadis2, S. Seaton1 and C. C. Kibbler1
screening and species differentiation by the characteristic peak melting         1
                                                                                  The Royal Free NHS Trust, Hampstead, London, United Kingdom,
temperatures of the probes. Both assays performed either as single               2
assays or simultaneously in the same LightCycler run. The analytical
                                                                                  Aristotle University, Thessaloniki, Greece
sensitivity using pure cultures and EDTA-anticoagulated blood was
shown to be at least 10 CFU per PCR, corresponding to 10–                        Objectives: DNA extraction using filter paper has become well
100 CFU ml-1 blood. All of the simulated blood samples were found                established and is suitable for conventional but not real time PCR
to be positive both for bacteria and fungi. A total of three rabbit              protocols. Whatman FTAÒ Elute paper offers a simplified method for
samples were found to be positive.                                               the extraction of DNA from fungal cultures. The extracted DNA is
Conclusion: Our data suggest that our PCR method may be                          eluted from the FTAÒ matrix into sterile water. Our objective was to
appropriate for use in clinical laboratories as simple and rapid                 evaluate the FTAÒ Elute paper’s ability to extract DNA from
screening tests for the most frequently encountered species causing              filamentous fungi and assess the performance of the DNA eluate with
bloodstream infections. Therefore, modern diagnostic tests for bacter-           conventional and real-time PCR.
emia and fungemia, including the multiplex PCR studied, deserve the              Methods: A total of 75 moulds and 10 yeasts were collected from
attention of clinicians and laboratory specialists as well as further study      clinical samples, of which 70 moulds were sub-cultured in glucose/yeast/
in clinical settings.                                                            peptone (GYP) broth and five moulds and 10 yeasts were taken directly
                                                                                 from Sabouraud agar. A pea-sized quantity of mycelium/yeast was
                                                                                 freeze/thawed and ribolysed in molecular grade water and then applied
                                                                                 to the FTAÒ Elute card. To inactivate the fungal mass, the card was dried
P221                                                                             at 80 °C for 20 min. Elution of the genomic DNA from a 3 mm punch of
                                                                                 FTAÒ Elute card into 50 ll of sterile water was achieved by heating at
Molecular typing of clinical and environmental Aspergillus
                                                                                 95 °C for 30 min. Elutions were performed at day 0, weeks 4 and 12 to
fumigatus isolates with random amplification of                                   evaluate the preservation of DNA on the paper. A pan-fungal ITS
polymorphic DNA                                                                  (internal transcribed spacer) rDNA PCR assay was used to amplify the
E. Sodja, T. Kavcic and T. Matos                                                 eluted DNA and the amplicons were sequenced to confirm the phenotypic
Institute of Microbiology and Immunology, Ljubljana, Slovenia                    identification of each fungus. By converting the conventional ITS rDNA
                                                                                 PCR the amplification of DNA from the eluate was evaluated with real-
Objectives: Aspergillus fumigatus is an opportunistic fungus respon-             time PCR on the Corbett Rotor-Gene 6000, and high resolution melt
sible for invasive aspergillosis in immunocompromised people. In                 (HRM) curve analysis was performed on the ITS rDNA amplicons.
nature, this fungal species grows on decaying vegetation and releases            Results: The Whatman FTAÒ Elute paper successfully extracted
large amounts of conidia in air. Patient infection is acquired upon              DNA from all the fungal cultures from GYP broth and Sabourauds agar
inhalation of conidia. Since treatment of invasive aspergillosis is              including Candida spp, Aspergillus spp, Fusarium spp, Scedosporium spp,
difficult and the outcome is often fatal, identification of infective strains      Acremonium spp and Zygomycetes (n = 85). Using a 3 mm punch of
and sources of infection is a major epidemiological concern in many              Whatman FTAÒ Elute paper the quantity of DNA eluted ranged
studies of nosocomial aspergillosis. Techniques of molecular biology             between 50 to 200 ng of DNA per punch. The ITS rDNA region was
have been extensively used for typing A. fumigatus isolates. The most            amplified from all the DNA extracts using the conventional PCR
popular technique for molecular typing of A. fumigatus isolates is based         (n = 85) and all isolates were identified genotypically using the NCBI
on random amplification of polymorphic DNA (RAPD). Here we report                 Blast Nucleotide database. Real-time PCR amplification of the ITS
genotyping analysis of clinical and environmental A. fumigatus strains           rDNA gene from the DNA elutions was successful. Furthermore the
to find out if cases of aspergillosis in an individual patient were caused        HRM analysis revealed a significant difference in the melting temper-
by hospital acquired strains of A. fumigatus.                                    atures of the ITS rDNA amplicons for the different fungal species
Methods: Three clinical and thirty-seven environmental isolates were             (complete real-time data will be presented in the poster). Re-elution of
included in this study. Clinical isolates of A. fumigatus were collected from    the DNA at weeks 4 and 12 were successful and quantification using a
patients with proven invasive aspergillosis of lung nursed in three              NanoDropÒ ND-1000 showed no evidence of degradation of DNA over
departments of University Medical Centre Ljubljana, Slovenia: Depart-            time.
ment of Intensive Internal Medicine, Department of Anaesthetics and              Conclusion: Whatman FTAÒ Elute paper provides a simple, inex-
Surgical Intensive Care and Department of Nephrology. Environmental              pensive and chemical free method of genomic DNA extraction from
isolates were collected with air sampling method in patients’ rooms and          yeasts and moulds. The ability to elute DNA enables this extraction
shared areas of the departments. After extraction of DNA with PureLink           method to be used with real-time PCR assays in place of laborious and
Genomic DNA Mini Kit (Invitrogen, Carlsbad, USA), each A. fumigatus              time-consuming post-PCR analysis for amplicon detection. The ability
isolate was genotyped using RAPD analysis. The primer used for RAPD              to archive the papers provides the user with an invaluable source of
typing was R108.                                                                 genomic DNA for future use.
Results: RAPD analysis of environmental and clinical isolates of A.
fumigatus allowed identification of thirteen distinct profiles among 40
isolates. All three strains isolated from patients have distinct profiles;
two of them were isolated only from patients and not from the
                                                                                 P223
environment. One strain isolated from patient nursed in Department of            Investigation of fungal DNA presence on atherosclerotic
Intensive Internal Medicine was found to be identical to environmental           plaques
strains collected from air of hallway and room of Department of                  Z. F. Otag1, A. Kalkanci2, N. Sucu1, Ph.D Direkel1 and
Nephrology. Some environmental strains with identical RAPD profiles               M. D. Ozden1
                                                                                 1
were collected from air of all three departments.                                 Mersin University, School of Medicine, Mersin, Turkey, 2School of
Conclusions: Thirteen distinct profiles were identified by RAPD                    Medicine, Gazi U, Ankara, Turkey
analysis, indicating great genetic diversity of A. fumigatus strains
isolated from infected patients and from their hospital environment. In          Objectives: Several studies have been suggested to investigate the
one case, a genetic similarity was noted between isolate obtained from           trigger factors in the inflammatory process of atherosclerosis in humans.
patient and isolates from the hospital environment.                              A possible role of some microorganisms has been proposed in the
                                                                                 pathogenesis of atherosclerosis, but it is still an unresolved issue.
                                                                                 Chlamydia pneumoniae and Helicobacter pylori are among the most




                                                                                                                                   Ó 2009 The Authors
96                                                                    Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                        Poster Presentations



commonly implicated microorganisms in the pathogenesis of athero-                  P226
sclerosis. But, we have limited data about the fungal signatures on the            Candidaemia: antifungal susceptibility and molecular typing
cardiovascular system. In the present study, the samples of human aortic           profiles of concomitant isolates from blood and other
wall and left internal mammary artery (LIMA) were examined for the                 biological products
presence of fungal DNA.
                                                                                   E. Ricardo1, S.C.O. Costa de Oliveira1, A. P. Silva1,
Methods: Fungal DNA was analyzed by real-time polymerase chain
                                                                                   T. G. Goncalves2, C. Pina-Vaz1 and A.G.R.G. Rodrigues1
                                                                                              ¸
reaction method in all biopsy samples. The specimens were obtained                 1
from 26 patients who underwent coronary artery bypass grafting.
                                                                                    University of Porto, Porto, Portugal, 2Center for Neurosciences
Biopsy samples were taken from proximal bypass punching areas of                   and Cell Biology, Coimbra, Portugal
aorta (Group A), and from the LIMA which is accepted as resistant to
the atherosclerosis (Group B). Primers and two probes bind to                      Objectives: Bloodstream fungal infections have increased worldwide
conserved regions of the fungal 18S rRNA gene. For amplicon                        during the last two decades and are considered a serious public health
detection, real-time PCR was performed with fluorescence resonance                  problem. A prospective, observational study was conducted at a
energy transfer (FRET) hybridization probes using the Light Cycler                 Portuguese University hospital, aiming to evaluate the susceptibility
DNA Master Hybridization Probes Kit and the Light Cycler instrument.               pattern of isolates from patients with bloodstream fungal infection and
Results: Fungal DNA was detected in 6 of 26 samples of group A                     to determine the degree of similitude between distinct isolates of the
(46.15%) and in 12 of 26 samples of Group(23.07%). Fungal DNA was                  same patient.
found in eight samples of four patients in both tissues.                           Methods: Yeasts isolated from blood cultures (89) and from other
Conclusion: Results demonstrate that fungal DNA could be detected                  body sites (40) of patients with fungaemia admitted at a university
in aortic wall and LIMA speciemens which do not support this                       hospital of Porto were collected and identified with VITEK 2. Minimal
hypothesis concerning the role of fungi in atherosclerosis etiology, but           Inhibitory Concentrations (MIC) to fluconazole, posaconazole vorico-
may be an independent risk factor in the pathophysiology of coronary               nazole, amphotericin B, Caspofungin and Anidulafungin were
hearth diseases. The overall presence of fungi in our natural                      determined according to the protocol M27-A3 from the Clinical
environment, the permanent fungal colonization of human microbial                  Laboratory for Standards Institute (CLSI). The strains were classified
communities and the contact with fungi through food components                     as S, R, susceptible-dose dependent (S-DD) or non susceptible
make it likely that fungi cross human barriers leading to temporary                accordingly the CLSI protocol. Sixty strains (C. albicans, C. glabrata
fungaemia in the cardiovascular system.                                            and C. parapsilosis) isolated from blood cultures (40) and other
                                                                                   biological products (20), from 16 patients were studied regarding the
                                                                                   presence of different restriction patterns after restriction endonuclease
                                                                                   analysis (REA) with HinfI enzyme. Restriction patterns were analyzed
P224                                                                               using the UVIDOC 12.6 software and compared among the distinct
Retrospective screening of 164 clinical isolates for                               groups of strains.
C. orthopsilosis, C. metapsilosis, C. nivariensis and                              Results: From a total of 89 strains isolated from blood cultures
C. bracarensis                                                                     during the first fungaemia episode 43% corresponded to C. albicans,
M. Arabatzis1, K. Kollia1, D. Ioannides2, T. Koussidou3,                           26% to C. parapsilosis, 13% to C. glabrata and 7% to C. tropicalis. C.
D. Devliotou-Panagiotidou2 and A. Velegraki1                                       albicans (28%), C. parapsilosis (24%), C. glabrata (18%) and C. krusei
1
 Mycology Laboratory, Medical School, University of Athens,                        (17%) were the most frequent yeasts isolated from other body sites.
Athens, Greece, 2Medical School, Aristotle University of                           Regarding the susceptibility profile, 8% of C. albicans, 17% of C.
                                                                                   parapsilosis, C. tropicalis and 58% of C. glabrata isolates were resistant to
Thessaloniki, Thessaloniki, Greece, 3Hospital for Skin and Venereal
                                                                                   fluconazole. Resistance to equinochandins was detected in 8% of C.
Diseases, National Health Service, Thessaloniki, Greece                            glabrata and 22% of C. parapsilosis. Regarding molecular typing, the
                                                                                   method did not provide satisfactory results for C. parapsilosis since the
Objectives: Recent reports indicate that a minority of clinical                    same pattern was obtained when comparing among different patients.
C. parapsilosis isolates should be correctly re-identified to discriminate          For the other tested Candida species the results obtained among the
C. orthopsilosis or C. metapsilosis. Similarly, a number of C. glabrata            different set of isolates for each patient were very heterogeneous. From
isolates resistant to antifungals are actually belonging to the new                one patient yielding C. albicans (n = 2) and C. parapsilosis n = (9)
species C. nivariensis and C. bracarensis. As the clinical significance and         strains, isolated both from blood cultures and other biological products,
respective susceptibilities of these new species are unclear, C. parapsilosis      the differences both in the restriction pattern and susceptibility profile
and C. glabrata local isolates of the last 10 years were molecularly               were only found at a interspecies level. Conversely, the C. albicans
re-identified and their antifungal susceptibilities determined.                     strains isolated only from the blood cultures of two patients (three
Methods: Ninety C. orthopsilosis isolates from blood (n = 67), skin                strains of each one), were all different within each patient; in one
(5), mucosa (10), chest (3) and nail (5) infections, conventionally                patient the susceptibility profiles were similar but in the other major
identified by the API 32C system, were re-identified by sequencing of                differences were registered.
the ITS and the sequences were deposited to the GenBank                            Conclusion: High resistance to azoles and equinochandins was
(www.ncbi.nlm.nih.gov). Seventy-four C. glabrata isolates from blood               observed. Differences in susceptibility pattern do not necessarily imply
(n = 44), mucosa (22), chest (6) and peritoneal (2) infections were                differences in restriction patterns, i.e. different strains. REA is a rapid
analysed by C. glabrata specific PCR. Voriconazole, posaconazole,                   and simple technique to be used for strains typing. This technique
itraconazole, amphotericin B, flucytosine, caspofungin, anidulafungin               could be of value in the follow up of patients under antifungal
and micafungin MICs were recorded by the CLSI M27-A3 microdilu-                    prophylaxis protocols to clarify strains relatedness in the case of
tion method.                                                                       emergence of fungal infection.
Results: Only one C. orthopsilosis isolate was recovered but no                    Acknowledgments: S Costa de Oliveira and A P Silva are sup-
C. metapsilosis, C. nivariensis or C. bracarensis isolates. The C. orthopsilosis   ported by the grants SFRH/BD/27662/2006 and SFRH/BD/29540/
isolate, from a bloodstream infection, was resistant to fluconazole.                2006, respectively, from Portuguese Science and Technology Founda-
C. parapsilosis exhibited rare resistance (MIC > 64) to fluconazole (13%)           tion (FCT).
while 23% of the C. glabrata isolates were resistant.
Conclusion: C. orthopsilosis comprise only a small fraction of the
C. parapsilosis Greek isolates. More clinical yeast isolates have to be
studied before drawing definite conclusions on the exact C. metapsilosis,
C. nivariensis and C. bracarensis incidence, although predictably low.
C. orthopsilosis resistance pattern to fluconazole has to be studied more
extensively.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                           97
Poster Presentations



P227                                                                          Innate host immune response against C. albicans (CA), a major
Expression of inflammatory cytokines and receptors in                          component of which are mononuclear phagocytes (MNCs), is a critical
human monocytes exposed to Aspergillus fumigatus                              factor of host defense against CA. Little is known about the
hyphae, amphotericin B and amphotericin B lipid complex                       immunomodulatory effects of antifungal agents such as deoxycholate
                                                                              amphotericin B (DAMB) and amphotericin B lipid complex (ABLC) on
M. Simitsopoulou1, E. Georgiadou1, T. J. Walsh2 and E. Roilides1
1                                                                             the expression profiles of multiple genes mediating the innate immune
 Aristotle University of Thessaloniki, Thessaloniki, Greece,                  response to CA. In this study, we used pathway-specific microarray
2
 National Cancer Institute, Bethesda, MD, USA                                 analysis to compare the effects of DAMB and ABLC on profile gene
                                                                              expression of immune molecules by MNCs exposed to CA.
Objectives: Innate immune response including monocytes (MNCs)                 Methods: THP1 human monocytic cell line was used as MNC source.
and various inflammation-related cytokines is critical in the host             MNCs were grown in RPMI plus 10% fetal calf serum at 37 °C/5% CO2.
defense against invasive aspergillosis. While antifungal agents such as       106 ml-1 MNCs were incubated with 105 CA blastoconidia, 1 lg ml-1
deoxycholate amphotericin B (DAMB) and amphotericin B lipid                   DAMB, 5 lg ml-1 ABLC or with the combinations CA+DAMB or
complex (ABLC) have immunomodulatory effects on the function of               CA+ABLC at 37 °C/5% CO2 for 4 h. Total RNA (4 lg) was converted
phagocytes (Dotis et al. AAC 50:868, 2006), their effects on the              to cRNA, labelled with biotin-16-dUTP and then hybridized to 124
expression of multiple genes mediating the innate immune response to          immobilized oligonucleotide probes of human immune response-related
A. fumigatus are yet to be resolved. In this study, we used a pathway-        cytokines, chemokines and their receptors. The labeled target bound at
specific microarray analysis to compare the effects of DAMB and ABLC           each gene-specific spot was detected using chemiluminescence (Oligo
on gene expression of immune molecules by MNCs exposed to A.                  GEArrays, Superarray). The average of two actin gene tetraspots were
fumigatus hyphae (AH).                                                        used as positive controls. Changes in gene expression were calculated as a
Methods: THP1 human monocytic cell line was used as MNC source.               ratio of those expressed by MNCs alone and to MNCs exposed to CA,
MNCs were grown in RPMI plus 10% fetal calf serum at 37 °C/5% CO2.            DAMB, ABLC, CA+DAMB and CA+ABLC. A >2.5-fold change was
106 ml-1 conidia were incubated at 37 °C for 12 h to germinate to AH.         considered significant.
MNCs were incubated with AH at effector:target ratio of 10 : 1, 1 lg ml-1     Results: Seventeen genes were up-regulated by CA while 25 and 6
DAMB, 5 lg ml-1 ABLC or with the combinations AH+DAMB or                      genes were up-regulated by DAMB and CA+DAMB, respectively. In
AH+ABLC at 37 °C/5% CO2 for 4 h. Total RNA (4 lg) was converted to            contrast, 5 and 21 genes were up-regulated by ABLC and CA+ABLC
cRNA, labelled with biotin-16-dUTP and then hybridized to 124                 treatments, respectively. A greater number of proinflammatory cyto-
immobilized oligonucleotide probes. The labeled target bound at each          kines, chemokines and their receptors were down-regulated in
gene-specific spot was detected using chemiluminescence (Oligo GEAr-           response to DAMB and CA alone than against ABLC alone, CA+DAMB
rays, Superarray). The average of two actin gene tetraspots were used as      or CA+ABLC. The genes encoding MIP-1-alpha, MIP-1-beta, MCP-1,
positive controls. Changes in gene expression were calculated as ratios of    TNF, IL10RA, IL10RB and IL8 were up-regulated in response to both
those expressed by MNCs alone and to MNCs exposed to AH, DAMB, ABLC,          CA and DAMB. ABLC up-regulated only genes corresponding to
AH+DAMB and AH+ABLC. A >2.5-fold change was considered signif-                chemokines. Exposure of MNCs to CA+ABLC resulted in significant
icant.                                                                        expression of CCR7-9, IL10, IL10RB, IL11 IL11RA, IL11RB1 and
Results: Fourteen genes were up-regulated by AH while 21 and 20               IL11RB2 genes. Expression of genes encoding IL16 and IL3 were
genes were up-regulated by DAMB and DAMB+AH, respectively. In                 significantly decreased in response to CA, DAMB and ABLC alone,
contrast, five and nine genes only were up-regulated by ABLC and               while TOLLIP, IL1R1 and IL2RB were significantly decreased in
ABLC+AH treatments, respectively. The genes encoding MCP-1 and                response to CA and CA+ABLC.
MIP-1-beta were up-regulated in response to AH, DAMB and                      Conclusion: DAMB treatment induces a more pronounced mRNA
AH+DAMB. IL1B was overexpressed after all treatments. The least               profile of gene expression in MNCs, followed by CA and CA+ABLC than
number of over-expressed genes was observed by MNCs stimulated                that observed with ABLC and CA+DAMB. Furthermore, by significantly
with ABLC alone. A greater number of inflammatory cytokines and                enhancing expression of TNF-alpha and IL8 in response to both CA and
receptor superfamilies, including IL12A, IL12B, IL17A, IFNA, IL2RB,           DAMB alone, MNCs maintain pro-inflammatory immune functions. In
IL10RA, LTB4R and TOLLIP, were enhanced in response to                        contrast, ABLC- and CA+ABLC-treated MNCs show a shift from a Th1 to
DAMB+AH than to DAMB or AH alone. Expression of genes encoding                a Th2 immune response.
IL13, IL18, IL2, and IL3 were significantly decreased in response to AH
and DAMB alone while MIF and TNFRSF1A were significantly
decreased in response to ABLC. When MNCs were treated with AH,
up-regulation of a cluster of chemokines was favoured while a cluster         P229
of interleukins was down-regulated. This profile expression was
                                                                              One-Enzyme PCR-RFLP Assay for differentiation of Candida
reversed when MNCs were incubated with DAMB+AH.
                                                                              nivariensis and Candida glabrata
Conclusion: AH induce mostly chemotactic factors and comple-
                                                                                                        ´          ´
                                                                              J. Alcoba-Florez, I. Hernandez, E. Perez-Roth and
ment components for monocyte recruitment. While ABLC with or
without AH causes mild gene expression, DAMB and DAMB+AH                            ´
                                                                              S. Mendez-Alvarez
treatments induce a more pronounced mRNA profile of inflammatory                University Hospital Ntra. Sra. de Candelaria, Santa Cruz de Tenerif,
gene expression in MNCs indicating different immunomodulatory                 Spain
effects of the amphotericin B formulations.
                                                                              Introduction: Candida nivariensis is a novel Candida spp. first
                                                                              described as a distinct taxon in 2006. Identification of Candida
                                                                              nivariensis still remains a problem in routine laboratories due to the
P228                                                                          high degree of phenotypic similarity between this species and Candida
Comparison of the effects of deoxycholate amphotericin B                      glabrata. Phenotype-based methods do not give completely reliable
and amphotericin B lipid complex on the gene exression of                     results. Hence, genotypic methods have been used to differentiate
                                                                              between these two species. The use of quick and reliable yeast
inflammatory cytokines and receptors in human monocytes
                                                                              identification methods, as well as the development of new antifungal
exposed to Candida albicans                                                   agents with more specific targets, will enable a more efficient treatment
M. Simitsopoulou1, E. Georgiadou1, T. J. Walsh2 and E. Roilides1              of mycoses.
1
 Aristotle University of Thessaloniki, Thessaloniki, Greece,                  Objective: The aim of this study is to use a single-enzyme PCR-
2
 National Cancer Institute, Bethesda, MD, USA                                 restriction fragment length polymorphism(RFLP) technique for differ-
                                                                              entiation between C. nivariensis and C. glabrata.
Objectives: Candida albicans is a frequent opportunistic fungus that          Materials and methods: In the present work, a total of 50 clinical
can cause invasive candidiasis in immunocompromised patients.                 isolates belonging to C. nivariensis and C. glabrata were identified by




                                                                                                                                Ó 2009 The Authors
98                                                                 Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



means of a rapid molecular method, PCR-RFLP. C. glabrata                      ranged from 0.25 to 2.0 and 1–2 mg L-1 for E. jeanselmei and E.
ATCC90030 was tested as quality control isolate. Primers were                 oligosperma, respectively. ITC (MIC50 0.125 mg L-1) and POS
selected to allow the amplification of ITS1-5.8S-ITS2 and 25S                  (MIC50 0.031 mg L-1) showed potent activity against all E. jeanselmei
ribosomal DNA regions in both species. After amplification and                 isolates.VOR and ISA had lower activity with an MIC50 (1 and
purification of products, they were treated with species-specific               2 mg L-1) against E. jeanselmei and MIC50 (both 1 mg L-1) against
restriction enzymes (Hinf I and SfiI). Digestion was performed by the          E. oligosperma. With regard to the echinocandins, CAS had no activity
incubation of 20 ll aliquots of PCR products with 10 U of enzymes in a        against both E. jeanselmei and E. oligosperma (MIC50 4 mg L-1),
final reaction volumen of 25 ll at different temperatures for 2.5 h.           whereas ANI demonstrated potential activity (MIC50 0.5 mg L-1).
Restriction fragments were separated by 2% agarose gel electrophoresis        Discussion: Considerable sequence differences were found among
in TBE buffer for 1 h at 100V, and the samples were stained with              the 17 selected isolates with nine strains confirmed as E. jeanselmei
ethidium bromide.                                                             originating from mycetoma or subcutaneous phaeohyphomycosis.
Results: DNA sequencing of the ITS region and the D1/D2 regions of            Strains with an identity of 99% with the ex-type strain of E. jeanselmei
the 28S rRNA gene confirmed the species-specific identification of C.            appeared to be very consistent in their clinical spectrum. Although
nivariensis and C. glabrata strains. The amplified ITS region of C.            different antifungal agents have been used in the treatment of
nivariensis and C. glabrata were digested twice using the enzyme Hinf I,      mycetoma, in this study POS and ITC exhibited the highest antifungal
but the length of them, were different. If we used the enzyme Sfi I all of     activity against E. jeanselmei and E. oligosperma. Both species had high
the isolates remained intact.                                                 MICs for CAS. Clinical effectiveness of these compounds in the
Conclusions: (i) The amplicon length of the intergenic spacer (ITS)           treatment of Exophiala infections remain to be determined.
was species-specific, and PCR-RFLP analyses region identified two
distinct species, which corresponded with the ITS region sequence
data. (ii) The enzyme investigated (Hinf I) demonstrated genetic
diversity between the two species. (iii) It can be concluded that PCR-        P231
RFLP method may be used for the differentiation of C. nivariensis and C.
                                                                              Induction of apoptosis by Paracoccidioides brasiliensis
glabrata isolates in clinical samples.
                                                                              correlate with pulmonary infection profile
                                                                              J. F. Julhiany de Fatima da Silva1, A. Del Vecchio1, G. Bernard2 and
                                                                              M.J.S. Mendes Giannini1
                                                                              1
                                                                               FCFAR – UNESP, Araraquara-SP, Brazil, 2USP, Sa Paulo – SP,
                                                                                                                                 ˜o
                                                                              Brazil
P230
The clinically important black yeast, Exophiala jeanselmei
                                                                              The programmed cell death is regulated by extracellular signals,
and its in vitro antifungal susceptibility
                                                                              which can activate or inhibited the apoptosis. These signal molecules
H. Badali1, M. J. Najafzadeh1, V. Vanesbroeck2, E. Van den                    act mainly regulating the levels or activity of Bcl-2 family members.
Enden2, J. F. Meis3 and G. S. De Hoog1                                        In mammals, apoptosis can be directed by the activation of groups of
1
 CBS-KNAW Fungal biodiversity Centre, Utrecht, The Netherlands,               proteases called caspases, which cleave specific substrates. P. brasil-
2
 Institute of Tropical Medicine, Antwerp, Belgium, 3Canisius                  iensis (Pb) yeast cells can enter in various cells types and probably
Wilhelmina, Nijmegen, The Netherlands                                         manipulate the host cell environment to favor their own growth and
                                                                              survival. The succession of events that may occur with P. brasiliensis
Introduction: Mycetoma is a localized, chronic, suppurative sub-              would be fungal adhesion, translocation to the cell cytoplasm,
cutaneous infection of tissue and contiguous bone after a traumatic           multiplication and the induction of apoptosis. The correlation with
inoculation of the causative organism. Exophiala jeanselmei is clinically     pathogenic mechanisms in vivo could elucidate the initial steps of the
redefined as a rare agent of subcutaneous lesions of traumatic origin,         infection. The phenomenon of apoptosis was described in several
eventually causing eumycetoma. The species has been described as              studies with P. brasiliensis and the ability of pathogens to induce
being common in the environment, but with molecular methods only              apoptosis of phagocytes might be an important virulence factor, for it
clinical strains were confirmed. Current diagnostics of E. jeanselmei is       would curtail the host’s defense mechanisms. P. brasiliensis and other
by using sequence data of the Internal Transcribed Spacer region of           fungi can exploit apoptosis to their own advantage, and their
ribosomal DNA, which reflects the taxonomy of this group sufficiently.          intracellular residence in epithelial cells could potentially elicit this
The first purpose of this study is the re-identification of all strains         type of cell death response. The invasion mechanisms of the host cells,
maintained under the name E. jeanselmei, and to establish clinical            persistence within them and subsequent induction of apoptosis may
preference of the species in its restricted sense. Given the high incidence   explain the spread ability of P. brasiliensis, however, the apoptotic
of eumycetoma in endemic areas, the second goal of this study is              mechanisms operating in alveolar epithelial cells remain largely
evaluation of in vitro susceptibility of eight antifungal drugs against E.    unexplored. Then, we investigated whether the pattern of infection to
jeanselmei.                                                                   epithelial cells could be associated with the apoptosis induction. For
Materials and methods: E. jeanselmei strains (n = 17) were                    this investigation, we treated human A549 cells with the different
obtained from the CBS Fungal Biodiversity Centre. The identification           isolates of P. brasiliensis and purified adhesins of this fungal (30 kDa
of 17 strains was verified with sequences of the internal transcriber          and gp43) in vitro and explore the expression of different pathways of
spacer regions (ITS) of the rDNA. MICs were determined for                    apoptosis induction in these cells. Then, we analyzed the expressions
amphotericin B (AmB), fluconazole (FLU), itraconazole (ITC), voric-            of Bcl-2, Bak, caspase 3, caspase 8, caspase 9 and DNA fragmentation
onazole (VOR), posaconazole (POS), isavuconazole (ISA) or MECs for            by flow citometry and TUNEL technique, respectively. It was found
caspofungin (CAS) and anidulafungin (ANI). Microdilution testing              that the apoptosis of human A549 cells could be induced by P.
was done in accordance with CLSI M38-A2 guidelines adjusted                   brasiliensis in a isolate and time-dependent manner. Our data
spectrophotometrically at 530 nm wavelength to optical densities              demonstrated that caspase-3, Bak, Bcl-2 and DNA fragmentation
that ranged from 0.17 to 0.15 in RPMI 1640 MOPS broth with L-                 mediating P. brasiliensis-induced pulmonary cell apoptosis and the
glutamine without bicarbonate. Microtitre plates were incubated at            overall mechanism is a complex process, which may involve a variety
35 °C for 96 h.                                                               of signal transduction pathways. These findings could explain the
Results: Nine out of 17 strains showed 98% similarity with ex-type            efficient behavior of this fungal to promote tissue infection and/or
strain of E. jeanselmei isolated from a true mycetoma-like infection. Five    blood dissemination. Supported by FAPESP, CNPq and CAPES.
strains were re-identified as E. oligosperma, and single isolates were
others. Strains confirmed to be E. jeanselmei all originated from
subcutaneous infections, whereas strains originating from environ-
mental samples like soil, wood or from clinical relevant sites were
considered to belong to E. oligosperma and E. xenobiotica. AmB MICs




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   99
Poster Presentations



P232                                                                              genotypically very heterogeneous isolates that represent multiple
Genotypic diversity of Cryptococcus neoformans var. grubii                        different and possibly novel Candida species.
isolates from central to west London as determined by
MLVA typing
C.H. Klaassen1, M. A. Petrou2 and J. F. Meis1
1
 Canisius Wilhelmina Hospital, Nijmegen, The Netherlands,                         P241
2
 Imperial College Healthcare NHS Trust, London, United Kingdom                    Pelvic mucormycosis refractory to amphotericin-B in a
                                                                                  young woman with good response to posoconazole
Objectives: Cryptococcus neoformans complex consists of C. neofor-                F. Abbasi, M. Mardani and S. Korooni Fardkhani
mans var. grubii, C. neoformans var. neoformans and C. gattii. Unlike C. gattii   Shaheed Beheshti Medical University, Tehran, Iran
which is a true pathogen, the opportunistic C. neoformans var. grubii is
most often found in immunocompromized patients. Relatively little                 Background: Mucormycosis is an aggressive fungal disease that
research has been done to determine the intraspecific genotypic diversity          involves the paranasal sinuses, orbit, central nervous system and other
of C. neoformans var. grubii. We used MLVA typing to determine the                organs. It may rapidly be fatal. This infection usually occurs secondary
genotypic diversity of C. neoformans var. grubii isolates from clinical           to immune suppression, diabetic ketoacidosis, and prolonged use of
samples in patients from central to west London.                                  antibiotics, steroids, and cytotoxic drugs. Management of the condition
Materials and methods: A total of 156 clinical isolates from 99                   consists of treatment of the underlying disease and surgical debride-
patients collected in the period of 1989–2001 were included in the                ment combined with intravenous antifungal agents.
analysis. DNA was isolated from freshly grown cells using a MagNA                 Patients: The patient was a young woman with fever after
Lyser/MagNA Pure protocol. MLVA typing was performed using a                      cesarean section. CT scan Evaluation showed a large mass in pelvic
previously reported panel of nine species specific microsatellite                  area. With diagnosis of malignancy the mass excised and the large
markers. Amplification products were analyzed on a MegaBACE 500                    black mass was sent to pathology department. Report of pathology
using established procedures. Data was analyzed using the multistate              showed fungal element in the mass. The mass re-evaluated and
categorical similarity coefficient. Clonal complexes were assigned to              hyphae of mucor was detected. Result of culture was positive for
groups of a minimum of two genotypes that differed by a maximum of                mucoral. Amphotericin-B was started with no response. Posoconazole
three markers.                                                                    started and the patient improved clinically.
Results: One hundred and forty eight Isolates yielded 82 different                Conclusion: Mocurmycosis should be in mind and considered in
genotypes. These segregated over 10 clonal complexes. Eight Isolates              every patient with pelvic mass specially if background of immunesup-
yielded no amplification products for any of the MLVA markers                      pression exist. Resistant to amphotericin-B is inceasing in mucoral
indicative of misidentified isolates.                                              agents.
Conclusions: A large variety of genotypes exists in C. neoformans                 Keywords: Mucormycosis, pelvic, amphitericin-B, posoconazole
var. grubii from the central to west London area. MLVA typing is an
excellent typing method to discriminate between C. neoformans var.
grubii from various origins
                                                                                  P242
                                                                                  In vitro photodynamic inactivation of Candida spp. using
                                                                                  phthalocyanines
P233                                                                              L. Ryskova1, V. Buchta1, M. Karaskova2 and J. Rakusan2
Genotypic diversity segregates Candida pelliculosa isolates                       1
                                                                                   University Hospital, Hradec Kralove, Czech Republic, 2Research
into distinct subgroups                                                           Institute for Organic Syntheses, JSC, Pardubice, Czech Republic
C.H. Klaassen, E. Geertsen, I. Curfs-Breuker, J. W. Mouton and
J. F. Meis
Canisius Wilhelmina Hospital, Nijmegen, The Netherlands                           Background: Phthalocyanines (Pc) represent a potential group of
                                                                                  photosensitisers, which have been proven to have a significant
                                                                                  antibacterial effect in photodynamic therapy (PDT). The aim of this
Objective: Candida pelliculosa is frequently reported as the cause of             paper is to evaluate the antifungal effect of fifteen Pc derivatives.
candidaemia. Differences in the susceptibility profiles of clinical isolates       Methods: Fifteen different Pc (with anionic, cationic and amphi-
that were routinely identified as C. pelliculosa prompted us to study              philic structure) were investigated. Their photokilling activity was
these isolates in more detail. AFLP analysis has been shown to be a               tested on Candida albicans strains and some of them also against
very powerful method to differentiate between Candida species. We                 Candida glabrata and Candida krusei. After treating yeast cells with
applied AFLP analysis to isolates routinely identified as C. pelliculosa.          Pc in the following concentrations: 1, 2, 4, 8 mg L-1 for 30 min, the
Materials and methods: Twelve clinical isolates from sterile sites                cultures were irradiated with low-power laser light (20 J cm2,
were included in the analysis. Routine identification was performed                40 J cm2). The effectiveness of photoinactivation was evaluated
using the API ID 32C System. Susceptibility testing was performed                 based on decrease of a number (log10) of viable yeasts in the tested
for amphotericin B, fluconazole, itraconazole, voriconazole, posaco-               and control samples (without Pc and irradiation).
nazole, caspofungin, anidulafungin and micafungin according to                    Results: Only two Pc showed some antifungal effect on C. albicans.
EUCAST produres. DNA was isolated from freshly grown cells using                  More effective was tetramethylenepyridinium chloride of hydroxyalu-
a MagNA Lyser/MagNA Pure protocol. AFLP typing was performed                      minum Pc–Pc1 (six logs decrease of viable cells). Sulphonated zinc Pc
using a combination of restriction enzymes HpyCH4IV and MseI.                     [(3-diethylammonium)-propylsulphonamide – Pc2 inactivated cells in
Reference isolates for the 22 most common Candida spp. were                       tested culture by four logs. The results of the antifungal testing of Pc
included in the analysis.                                                         against C. glabrata and C. krusei were similar.
Results: The 12 isolates were grouped into six clusters with very                 Conclusion: The most efficient phthalocyanines tested caused a
different fingerprint patterns. Only two isolates clustered together               significant decrease of viable counts of C. albicans, C. glabrata and C.
with the C. pelliculosa reference strain (CBS 605). Two isolates co-              krusei and represent promising drugs for potential use in the PDT of
clustered with C. guilliermondii (CBS 566) and C. pseudotropicalis (C.            fungal infections.
kefyr) (CBS 607), respectively. The remaining eight isolates                      Acknowledgement: The study was supported by the grant
segregated over three groups. This segregation was supported by                   No.2B06104 of the National Research Program of the Ministry of
the susceptibility profiles. None of the three non-pelliculosa groups              Education, Czech Republic.
represented any of the other reference strains that were included.
Conclusion: Routine methods fail to accurately identify C. pelliculosa
isolates. Isolates fenotypically identified as C. pelliculosa may consist of




                                                                                                                                    Ó 2009 The Authors
100                                                                    Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                   Poster Presentations



P243                                                                           polymer. To overcome this problem a functionalized quaternary
In vitro fungicidal activity of dihydroxyacetone against                       ammonium compound, [2-(methacryloyloxy) ethyl]trimethylammoni-
Candida sp                                                                     um chloride (MADQUAT), which copolymerizes with methacrylates and
M.L. Scroferneker, D. O. Stopiglia, G. Mondadori, J. Vieira and                could act as a fungal inhibitor, must be investigated.
P. Oppe                                                                        Objective: This study described the in vitro antifungal activity of
                                                                               MADQUAT against Candida sp.
Institute of Basic and Health Sciences, Porto Alegre, Brazil
                                                                               Methods: The minimum inhibitory concentrations (MIC) were
                                                                               determined using the Clinical Laboratory Standards Institute (CLSI)
Candida albicans is a yeast found in human endogenous microbiota               M27-A2 broth microdilution method. Nystatin was the standard
which may eventually become pathogenic. It is the most frequent                antifungal agent. The minimum fungicidal concentration (MFC) was
opportunistic pathogen in patients on prolonged use of broad-spectrum          determined by transferring 100 ll from the well that showed 100%
antibiotics or of feeding tubes, with autoimmune diseases, and in those        growth inhibition in the microdilution method into tubes with 2 ml of
who underwent organ transplantation or received prosthetic implants.           Sabouraud dextrose broth medium. The tubes were incubated for
The pathogenic behavior of Candida is primarily assigned to its great          3 days at 35 °C and the MFC was determined as the lowest
phenotypic diversity. Acquired invasive properties associated with             concentration at which fungal growth was inhibited.
changes in the host’s immune system promote the opportunistic                  Results: The concentrations at which MADQUAT had antifungal
behavior of this yeast, which may then become pathologically                   properties ranged from 0.00625 to 0.1 g ml-1, and fungicidal activity,
important. Clinical studies have demonstrated that any change in               from 0.025 g ml-1 to >0.1 g ml-1, whereas nystatin showed antifungal
the host’s immunological status may facilitate the proliferation of this       activity between 1 and 4 lg ml-1 and fungicidal activity between 2 and
saprophyte and that, according to the level of immunodepression,               8 lg ml-1.
infection may range from benign mucocutaneous candidiasis to                   Conclusion: Therefore, MADQUAT is a promising antifungal agent
systemic, usually fatal, invasion. Together with the virulence of              that can be used in acrylic resins, as its antifungal activity may be due
Candida sp., these characteristics have justified studies about its             to the presence of a much higher concentration, which is likely to
pathophysiology and improved treatment strategies. Dihydroxyacetone            prevent the proliferation of Candida on the surfaces of prosthetic
(1,3-dihydroxy-2-propanone) is a monosaccharide used in artificial              devices, barely interfering with the patient’s normal microbiota.
suntan lotions for the human skin. In addition to its cosmetic use, there
are reports of its use in the treatment of psoriasis, vitiligo and
piebaldism. The site of action of this substance is the interface between
the stratum corneum and the granular layers of the skin.                       P245
Objective: this study described the in vitro antifungal activity of            Antifungal activity of the phenolic essential oil of Thymus
DHA against Candida sp.                                                        viciosoi
Methods: The minimum inhibitory concentrations (MIC) were                      L.A. Vale-Silva1, E. Pinto1, M. J. Goncalves2, C. Cavaleiro2 and
                                                                                                                     ¸
determined using the Clinical Laboratory Standards Institute (CLSI)            L. Salgueiro2
                                                                               1
M27-A2 broth microdilution method. Nystatin was the standard                    Universidade do Porto, Porto, Portugal, 2Universidade de
antifungal agent. The minimum fungicidal concentration (MFC) was               Coimbra, Coimbra, Portugal
determined by transferring 100 ll from the well that showed 100%
growth inhibition in the microdilution method into tubes with 2 ml of
Sabouraud dextrose broth medium. The tubes were incubated for                  Objectives: The genus Thymus (Lamiaceae) is a complex group of
3 days at 35 °C and the MFC was determined as the lowest                       aromatic plants widely distributed across the Iberian Peninsula. Several
concentration at which fungal growth was inhibited.                            species have traditionally been used as medicinal plants, namely for
Results: The concentrations at which the substance had antifungal              their antiseptic properties (1). In this context, the objectives of the
properties ranged from 0.625% to 5%, and fungicidal activity, from             present work were to investigate the composition of the essential oil (EO)
2.5% to 10%, whereas the usual DHA concentration in cosmetic                   of Thymus x viciosoi and its antifungal activity on a range of
artificial suntan lotions is 3–5%.                                              representative human pathogenic Candida species.
Conclusion: DHA seems to be a promising substance for the treat-               Methods: The EO of T.x viciosoi was obtained from the flowering parts of
ment of candidiasis because it has antifungal properties at the                the plants by hydrodistillation and analysed by gas-chromatography and
concentration used in artificial suntan lotions. Therefore, it is a potential   gas-chromatography/mass spectroscopy. The antifungal activity was
low-toxicity antifungal agent that may be used as a topical fungicidal         evaluated against several strains from seven Candida spp. (C. albicans, C.
agent because of its penetration into the corneal layers of the skin.          glabrata, C. parapsilosis, C. krusei, C. tropicalis, C. dubliniensis, and C.
                                                                               guilliermondii) using the reference CLSI (formerly NCCLS) broth macro-
                                                                               dilution protocol M27-A3 (2). Minimum fungicidal concentrations
P244                                                                           (MFCs) were the lowest concentrations showing no growth after
                                                                               incubation of 20-ll samples from clear tubes in the macrodilution test in
In vitro antifungal activity of [2-(methacryloyl-
                                                                               Sabouraud dextrose agar at 35 °C.
oxy)ethyl]trimethylammonium chloride against Candida sp.
                                                                               Results: The oil showed high percentages of phenolic monoterpenes,
M. L. Scroferneker1, D. O. Stopiglia2, M. Collares2, A. Ogliari2,              thymol (18.0%) and carvacrol (30.0%), and their biogenetic precur-
J. Vieira1, G. Mondadori1, B.B. Fortes2 and M. W. Samuel2                      sors, c-terpinene (7.5%) and p-cymene (19.0%).
1
 Institute of Basic and Health Sciences, Porto Alegre, Brazil,                    Minimum inhibitory concentrations (MICs) of the EO and its major
2
 School of Dentistry, Porto Alegre, Brazil                                     components, carvacrol and thymol, were quite low, ranging from 0.08
                                                                               to 0.32 ll ml-1. For p-cymene, on the other hand, a markedly lower
Candida-associated denture stomatitis is the most common form of oral          activity was found. Furthermore, the EO, thymol, and carvacrol
candidal infection, of which Candida albicans is the principal etiologic       displayed a clear fungicidal activity, with MFCs equal to or just one
agent. Candida adheres directly or via an intermediate layer of plaque-        dilution above the respective MICs, including against isolates with
forming bacteria to the acrylic resin (polymethylmethacrylate) on the          decreased susceptibility to commercial antimycotic drugs.
denture. Although denture stomatitis is treated with antifungal therapy,       Conclusions: This work revealed a powerful antifungal activity of
infection recurs soon after treatment completion, suggesting that              the EO of T.x viciosoi against Candida spp., in line with previously
denture plaque may serve as a protected reservoir for C. albicans.             reported results for related Thymus oils (3), thereby supporting further,
Several antifungal substances have been incorporated into denture’s            more in depth, in vitro studies, as well as the potential of the EO of T.x
acrylic resin in order to avoid Candida proliferation on the surfaces of the   viciosoi for the clinical management of mucocutaneous candidiasis. The
prosthetic device, such as chlorhexidine, cetylpyridinium chloride and                                            ¸˜             ˆ
                                                                               authors acknowledge the Fundacao para a Ciencia e Tecnologia (FCT)
other quaternary ammonium compounds. However, incorporation of                 and FEDER for financial support through the research project POCI/
these substances into acrylic resin leads to long-term acrylic denture         QUI/59407/2004 and FCT for the post-doc grant attributed to L. A.
degradation due to the leaching of components from the bulk of the             Vale-Silva (SFRH/BPD/29112/2006).




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                     101
Poster Presentations



References                                                                       temperature of 80–85 °C for 10 min following a centrifugation at
1. Figueiredo AC, Barroso JG, Pedro LG et al. Curr Pharm Des 2008;               3000 rpm for 10 min, and then the tea extraction was filtered by
   14(29): 3120–3140.                                                            0.8 mM filter. Antifungal activity of the tea extractions and EGCG were
2. Clinical and Laboratory Standards Institute. Approved standard-               determined by the EUCAST antifungal MIC method (two fold dilutions,
   third edition M27-A3, Wayne, PA, USA, 2008.                                   final tea extract concentration range 5.0–0.039 mg ml-1) using
3. Pina-Vaz C, Rodrigues AG, Pinto E et al. J Eur Acad Dermatol                  fluconazole as comparator.
   Venereol. 2004; 18(1): 73–78.                                                 Results: All 23 tested teas exhibited potent antifungal activity
                                                                                 against C. glabrata (MIC range: 0.3125–0.078 mg ml-1). Six out of
                                                                                 nine green teas and three out of eight black teas had MIC of 0.078 mg of
P246                                                                             tea ml-1, one white tea had MIC of 0.156 mg of tea ml-1, and finally
                                                                                 three out of five oolong teas had MIC against of 0.156 mg of tea ml-1.
Inhibition of Sporothrix schenckii isolates by killer yeast
                                                                                 Three of the 23 teas exhibited activity against C. albicans (one green tea,
M.L. Scroferneker, D. O. Stopiglia, F. Landell, J.M.S. Sorrentino,               one black tea, and one oolong tea, MIC against 1.25 mg of tea ml-1).
H. D. Heidrich, J. Vieira, K. L. Kammler, G. Mondadori, I. A. Reis,              One green tea had MIC against C. parapsilosis of 1.25 mg of tea ml-1.
M. Madagnin and V. P. Valente                                                    None of the tested teas had effect on C. krusei, C. tropicalis, and A.
Institute of Basic and Health Sciences, Porto Alegre, Brazil                     fumigatus at the concentrations tested. EGCG had MIC against C. glabrata
                                                                                 of 0.3125 mg tea ml-1, and MIC against C. albicans and C. parapsilosis of
The dimorphic fungus Sporothrix schenckii is the etiologic agent of              5.0 mg ml-1. When the pH of the culture medium increased to 7.20, the
sporotrichosis, a widely distributed mycosis. It is the subcutaneous             antifungal effect of the teas was increased. For example, four tested teas
mycosis with the highest incidence in the state of Rio Grande do Sul,            had MIC against C. glabrata < 0.039 mg of tea ml-1 at pH 7.20.
Brazil. A saturated solution of potassium iodide is used as a therapy for
localized sporothrichosis. Other drugs commonly used are itraconazole
(ITC) for the treatment of lymphocutaneous infections and amphoter-
icin B (AMB) for severe infections or when ITC therapy fails. Although
these drugs are generally effective, the long duration of therapy and the
toxicity of AMB make it necessary to explore new alternatives for the
treatment of severe infections. Some yeasts possess antagonistic
property (killer activity) toward moulds and other yeasts by producing
killer toxins. This property has been exploited against several
pathogenic and phytopathogenic fungi, showing activity compared to
the conventional antifungal azole.
Objective: In the present study we have verified the action of 20
killer yeasts, isolated from cheese and milk, against 53 Sporothrix
schenckii clinical and environmental isolates.
Methods: Strains of S. schenckii were subcultured onto potato
dextrose agar at 25 °C for 7 days. Conidial suspensions were prepared
in sterile saline solution. The standard suspensions were adjusted by
spectrophotometry to show transmittance at 530 nm of 80–82%.
Aliquots of 1 ml of these conidial suspensions were spread into Petri
dishes containing cheese black starch agar (Minas cheese 33%, glucose
2%, peptone 1%, agar 1.5% and black starch 0.003%). Killer yeasts
were point-inoculated over the S. schenckii inoculum and incubated at
25 °C for 4 days. The killer activity was considered positive if there was
an evident zone of inhibition of the fungus around the inoculum of the
killer yeast.
Results: All S. schenckii strains were inhibited by at least 11 killer
yeasts, 96% were inhibited by more than 13 yeasts and 45% by more
than 15 yeasts. T. japonicum (QU139), K. lactis (QU30, QU73 and
QU99), T. insectorum (QU89), T. faecale (QU100) and K. marxianus
(QU103) inhibited all the S. schenckii isolates.
Conclusion: Killer yeasts seem promising as a source of new
antifungal agents aimed at controlling Sporothrix schenckii.
                                                                                 Conclusion: The results demonstrate that the four different groups
                                                                                 of teas and EGCG isolated from green tea have in vitro antifungal
                                                                                 activity against C. glabrata and some teas have more potent activity
                                                                                 than others. Several teas exhibited also in vitro antifungal activity
P247                                                                             against C. albicans and C. parapsilosis although higher concentrations
In vitro activity of twenty-three tea extractions and                            than those against C. glabrata were needed. These data indicate that
epigallocatechin gallate against Candida glabrata                                components of tea and EGCG might be useful particularly for the
M. Chen1, L. Zhai1 and M. C. Arendrup2                                           treatment of C. glabrata infections and warrants further investigations.
1
 Rigshospitalet, Copenhagen, Denmark, 2Statens Serum Institut,
Copenhagen, Denmark
                                                                                 P248
                                                                                 Antifungal activity of isavuconazole and 7 other drugs
Objectives: The purpose of this study was to investigate the
susceptibility of Candida albicans, C. glabrata, C. krusei, C. tropicalis, C.    against Cladophialophora spp., related to
parapsilosis, and Aspergillus fumigatus to different groups of tea and           chromoblastomycosis
epigallocatechin gallate (EGCG) isolated from green tea.                         H. Badali1, G. S. De Hoog1, I. Curfs-Breuker2 and J. F. Meis2
                                                                                 1
Methods: Twenty teas belonging to four different groups (green,                   CBS-KNAW Fungal biodiversity Centre, Utrecht, The Netherlands,
                                                                                 2
black, oolong, and white teas) were purchased from China and three                Canisius Wilhelmina Hospital, Nijmegen, The Netherlands
teas (green and black teas) were purchased in Denmark. Stock
concentrations of tea extract was prepared as follows: 1 g of tea were           Introduction: Cladophialophora is a genus of black yeast-like fungi
incubated with 10 ml of boiled water (100 mg of tea ml-1) at                     which are frequently encountered in human infections, ranging from




                                                                                                                                   Ó 2009 The Authors
102                                                                   Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                              Poster Presentations



mild cutaneous lesions to fatal encephalitis. The genus includes species     fungal action and avoiding amphotericin B interaction with human
causing chromoblastomycosis and other skin infections, as well as            cells resulting in toxicity minimization.
disseminated and cerebral infections, often in immunocompetent               Results: Animal experiments revealed that FUNGISOME is delivered
individuals. The type species of Cladophialophora, C. carrionii, is an       to lungs in higher quantity and the levels are comparatively much
agent of chromoblastomycosis, histologically characterized by muri-          lower in kidneys. In the following 24 h Amphotericin B, concentration
form cells in skin tissue. In addition C. samoensis was recently described   in lungs increases almost four folds while levels in kidneys are
as a new agent of chromoblastomycosis. Limited standard therapy is           maintained low indicating high efficacy and low nephrotoxicity. LD50
available and disease always requires extensive surgical excision            in commercial product is better than 60 mg kg-1 body wt (it could not
coupled with intense antifungal therapy to achieve cure for a long           be tested further as it is a ready suspension and furthermore volumes
period. Therefore, the purpose of this study was to evaluate the in vitro    could not be administered in animals). FUNGISOME has been in clinical
activity of eight existing and new antifungal drugs against clinical and     use in India since 2003 with more than 100 000 infusions been given
environmental strains.                                                       so far. Success rates of higher than 90% in patients with invasive
Methods: The collection has been obtained from the CBS-KNAW                  fungal infections (IFI) and less than 2% nephrotoxicity have been
Fungal Biodiversity Centre, Utrecht, The Netherlands and consisted of        recorded. The drug was well tolerated by patients and mild to moderate
the following isolates: 40 strains of C. carrionii and one isolate of C.     fever with rigors were observed in only 25% of the patients. In one
samoensis. MICs were determined for amphotericin B (AmB), fluconazole         patient FUNGISOME was given a total dose of 27 g and another given
(FLU), itraconazole (ITC), voriconazole (VOR), posaconazole (POS),           11.23 g of Amphotericin B and no significant rise in creatinine was
isavuconazole (ISA), caspofungin (CAS) and anidulafungin (ANI).              observed. Although the recommended daily dose is 1–3 mg kg-1 body
Susceptibility testing was done in accordance with CLSI M38-A2               wt day-1, less than 10% of the patients required dose escalation beyond
guidelines adjusted spectrophotometrically at a 530 nm wavelength to         1 mg kg-1 body wt day-1. Daily dose cost ranges from 1/6th to 1/10th
optical densities that ranged from (68–71 T %) in RPMI 1640 MOPS             of the only other liposomal amphotericin B available commercially,
broth with L-glutamine without bicarbonate. Plates were incubated at         making it the most economical treatment of IFI. In addition, being
35 °C for 72 h (insufficient growth was incubated at 96 h). The MIC           sugar free, it is best suited for treatment of IFI in diabetics.
was determined visually as the lowest concentration of drug showing          Conclusion: We present a new liposomal amphotericin B formula-
absence of growth or ‡50% reduction of growth (for fluconazole)               tion manufactured in India and used with success since 2003 for
compared with that of the growth control. For the echinocandins the          patients with IFI at moderate costs.
MEC was microscopically determined as the lowest concentration of
drug that leads to the growth of small, rounded, compact hyphal forms
as compared with the long, unbranched hyphal clusters that were seen
in the growth control (drug free). The concentrations of AmB, ITC, VOR,
and POS ranged 0.016–16 mg L-1, ISA, ANI and CAS ranged 0.008–
                                                                             P251
8 mg L-1, and FLU ranged from 0.063 to 64 mg L-1 Drug and fungus
free controls were included. Quality control was ensured by including
                                                                             Immune responses of mice infected with a Candida albicans
Paecilomyces variotii (ATCC 22319), Candida parapsilosis (ATCC               O-mannosylation mutant
22019), and Candida krusei ATCC 6258.                                        L. Castillo, A.J.P. Brown, A. R. Gow and F. C. Odds
Results: C. carrionii isolates (n = 40) gave MIC ranges and MIC50            University of Aberdeen, Aberdeen, United Kingdom
and MIC90 values (mg L-1): Overall, the triazoles ITC, VOR, POS and
ISA were active in vitro against these isolates. AmB and the                 The MNT1 and MNT2 Genes of Candida albicans are involved in
echinocandins demonstrated high MIC’s. The single C. samoensis               O-glycosylation of cell wall and secreted proteins. Elimination of both
isolate gave MICs ITC (0.25 mg L-1) and MICs POS (0.125 mg L-1) for          Mnt1p and Mnt2p results in truncation of O-linked glycans and
C. samoensis were higher than C. carrionii.                                  reduction in virulence, indicating that these enzymes are important for
                                                                             normal interactions with the host (1). In previous experiments, we
                                                                             showed that cytokine responses to the mnt1mnt2 double mutant were
                                                                             lower than to CAI-4, when they were infected with similar challenge
                                                                             inocula. To determine the role of glycosylation in stimulation of the
                                                                             innate immune response, we infected BALB/c mice intravenously with
                                                                             the C. albicans mnt1mnt2 double null mutant with a higher challenge
                                                                             to achieve the same pathological effects in 3 days as with CAI-4. We
Conclusions: ITC, POS and ISA are in vitro the most active drugs             studied the histology in the kidneys and gross sequence of production
against C. carrionii the agent of chromoblastomycosis. Echinocandins         of cytokines and measured chemokines in the serum, kidneys and
and AmB demonstrated low in vitro activity against C. carrionii. These       spleen at intervals up to 48 h post-challenge. No histopathological
in vitro results need to be clinically confirmed                              differences were found between CAI-4, the mnt1mnt2 mutant and
                                                                             mnt1mnt2 +MNT1 reintegrant strains, confirming that infection
                                                                             outcome was similar in all the mice infected. However, initial results
P249                                                                         show that the cytokine differed considerably, both in times of
FUNGISOME – a new liposomal amphotericin B preparation                       production and concentration. For example, by 12 h after challenge,
for treatment of invasive fungal infections developed in                     renal levels of TNF, G-CSF, IL-6 and MCP-1 were higher in mice
India                                                                        infected with the mnt1mnt2 mutant than in those challenged with CAI-
L. Verma and J. N. Verma                                                     4 and the MNT1 reintegrant. 24 h post-challenge, renal levels of IL-6,
Lifecare Innovations Pvt Ltd, Gurgaon, India                                 KC, MIP-1b, RANTES, TNF and MCP-1 at 24 h were lower in mice
                                                                             infected with the mnt1mnt2 mutant. Spleen levels of IL-10, TNF, MCP-
                                                                             1 and MIG at 12 h were higher than controls in mice challenged with
Objective: Development of FUNGISOME (a liposomal amphotericin B              the mutant while by 48 h spleen levels of KC and MCP-1 were lower in
formulation) was taken up in India in 1987 as part of a mission of the       the mutant-infected mice. These results demonstrate that an O-
Government of India to make India self-reliant for this critical life-       glycosylation defect in cell wall mannoproteins alters the mouse
saving drug, to address a national priority and a global need. The           cytokine response to C. albicans infection even when the size of the
perceived goal was to retain the broad-spectrum and anti-fungal              challenge is high enough to eliminate the gross attenuation in
potency of amphotericin B, remove dose related adverse reactions and         virulence associated with the mnt1mnt2 mutation.
nephro-toxicity and ensure that the new preparation remains afford-          Reference
able.                                                                        1. Munro C et al. J Biol Chem 2005; 280: 1051–1060.
Methods: FUNGISOME i.v. is designed to navigate amphotericin B
encapsulated in liposomes to target fungal cells resulting in high anti-




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                              103
Poster Presentations



                                                                               G-protein associated with opioid receptors (e.g., l opioid receptor –
P252                                                                           MOR) at the cellular membrane level has been known to modulate the
Exogenous administration of a cocktail mimicking Candida                       activity of some phospholipases (i.e., Cb and A2) (Pan YXDNA Cell Biol.
albicans autoregulatory alcohols affects the progression of                    2005; 24: 736–750). Endogenous opioid peptides, such as b -
hematogenously disseminated candidiasis in mice                                endorphin, have a high affinity with MOR and may affect multiple
M. Martins1, A.L.l. Lazzell2, M. Henriques1, J. Azeredo1,                      physiological functions in both the central nervous system and
J. L. Lopez-Ribot2 and R. Oliveira1                                            peripheral tissues (Slominski A. J Invest Dermatol 2003; 120: 1073–
1
 IBB-Institute for Biotechnology and Bioengineering, Braga,                    1080). It has been suggested that b -endorphin might play a role in
Portugal, 2South Texas Center for Emerging Infectious Diseases,                inducing M. pachydermatis cell differentiation towards the production
San Antonio, TX, USA                                                           or non-production of phospholipase (Cafarchia et al. Med Mycol. 2007;
                                                                               45:11–15). However, no information is currently available on the
                                                                               expression of MOR on M. pachydermatis cell membranes. Thus, the aim
Candida albicans is a polymorphic fungus that causes opportunistic
                                                                               of the present work was to study MOR expression on the membrane of
infections in humans. The ability of C. albicans to switch between
                                                                               M. pachydermatis cells and its role in modulating phospholipase activity
different morphologies is thought to underlie its success as a pathogen.
                                                                               in yeasts isolated from healthy dogs and dogs with skin lesions.
Recently our group demonstrated that culture supernatants of C.
albicans contain a mixture of autoregulatory alcohol molecules capable         Methods: Phospholipase Activity was assessed by means of the egg-
of inhibiting in vitro filamentous growth of planktonic C. albicans cells.      yolk plate method as previously reported (Cafarchia et al. Med Mycol.
Additionally, a cocktail solution containing isoamyl alcohol, 2-               2007; 45: 11–15) on 64 mol L-1. pachydermatis isolates using
phenylethanol, E-nerolidol and E,E-farnesol (simulating a 96-h culture         different concentrations of naloxone (Nx), a MOR antagonist. Isolates
supernatant) was shown to regulate C. albicans morphological                   were divided into Group A (i.e., 40 isolates from 26 dogs with
transition in a similar fashion.                                               dermatitis) and Group B (i.e., 24 isolates from 12 healthy dogs). The
                                                                               MOR expression was analyzed by Western blot and immunofluores-
Objectives: The aim of this study was to investigate whether the
                                                                               cence.
identified autoregulatory alcohols, through the exogenous administra-
tion of the cocktail solution, could affect the progression of infection in    Results: A statistically higher p.a. than that of the controls was
a murine model of hematogenously disseminated candidiasis.                     recorded in isolates from Group A at a Nx concentration of 10–
                                                                               6 mol L-1 (P < 0.05). No isolate in Group B displayed p.a. in either
Methods: For the disseminated candidiasis model, imunocompetent
                                                                               control samples or in the presence of any Nx concentration. Using
BALB/c female mice (age 6–8 weeks old) were infected by lateral vein
                                                                               Western blot analysis, a band corresponding to MOR protein (with a
injections with suspensions containing 3–105 C. albicans CAF-2 cells
                                                                               molecular weighting of about 65 kDa) was observed in the protein
(four to eight animals per group). Afterwards, animals were divided
                                                                               fraction obtained from both clones of Group A and Group B. An
into two groups for alcohols administration (1 ml, intraperitoneally):
                                                                               additional band of around 98 kDa was also detected, with a higher
one control group received vehicle solution alone (5% ethanol), and
                                                                               expression in the clone from Group B than that from Group A. MOR
the other group received the cocktail solution of autoregulatory alcohol
                                                                               expression and localization was also demonstrated by immunofluores-
molecules simulating a C. albicans 96-h supernatant (94 lmol L-1
                                                                               cence in isolates from Groups A and B.
isoamyl alcohol, 70 lmol L-1, 2-phenylethanol, 3.2 nmol L-1 E-nerol-
idol and 18 nmol L-1 E,E-farnesol). The effect on infection was                Conclusion: This study suggests that opioid receptors are present in
monitored by survival curves and by determining fungal organ burden            isolates of M. pachydermatis and may be involved in mediating the
at scheduleds times (days 1, 2 and 3) postinfection. For all animals,          effects of opioid agents. Their expression mechanisms might be strictly
upon death or sacrifice, brain, spleen, and kidneys were removed for            related to the chemical composition of the skin and may have a role to
the determination of fungal burden (total CFU per gram of tissue). All         play in influencing the pathogenic or commensal phenotype of
experiments were performed in accordance with institutional regula-            Malassezia. Further functional investigations of opioid receptors and
tions at the University of Texas at San Antonio. Survival data and             their expression mechanism could raise hypotheses about pathogenic
organ fungal burdens were analyzed using the Mantel–Cox log rank               processes in animals colonized by M. pachydermatis, thus opening new
test and Mann–Whitney test, respectively.                                      avenues for the topical control of Malassezia lesions.
Results: The median survival of control mice receiving the vehicle
alone was 6 days. The administration of the cocktail solution
significantly delayed the time of death to 9 days (P = 0.005). At days
1 and 2 post-infection fungal burden in organs retrieved from mice             P254
treated with the cocktail solution was similar to control mice. However,       Cell wall proteins profiles of non-Candida albicans Candida
on day three animals that received the cocktail solution displayed
                                                                               species
lower renal and brain fungal burden compared to control mice
                                                                               M. Henriques, S. Silva, A. R. Conde, J. Azeredo and R. Oliveira
receiving the vehicle solution alone (P = 0.03).
                                                                               University of Minho, Braga, Portugal
Conclusions: The cocktail solution containing autoregulatory alco-
hol molecules simulating a 96-h culture supernatant shows an in vivo
protective effect against disseminated candidiasis. These findings              The major components of the cell wall of opportunistic Candida
indicate that the autoregulatory molecules isoamyl alcohol, 2-pheny-           pathogens are polymers of mannose covalently associated with
lethanol, E-nerolidol and E,E-farnesol may play a role during C.               proteins or glycoproteins (mannoproteins), polymers of glucose (glu-
albicans pathogenesis.                                                         cans) and chitin. Proteins and glycoproteins exposed in the most
                                                                               external layers of the cell wall structure are involved in morphogenesis
                                                                               and pathohenecity-related aspects, e.g. adhesion to inert materials and
                                                                               animal tissues. Nevertheless, the total number of cell wall proteins and
                                                                               their functions are still poorly known, especially in the non-Candida
P253                                                                           albicans Candida (NCAC) species.
Opioid receptor on Malassezia pachydermatis cells                              Objectives: The aim of this study was to determine and compare the
C. Cafarchia, M. E. Dell’Aquila, M. Albrizio, L. Aguiar Figueredo,             cell wall protein profile of three NCAC species, C. tropicalis, C. glabrata
A. C. Guaricci, T. De Santis and D. Otranto                                    and C. parapsilosis.
University of Bari, Valenzano (Bari), Italy                                    Methods: In this study, one reference strain and one clinical isolate
                                                                               of C. tropicalis, C. glabrata and C. parapsilosis were used. Cell wall
                                                                               proteins were extracted by boiling cell walls with SDS (sodium
Objectives: Malassezia spp. may act as opportunistic skin pathogens
                                                                               dodecylsulphate) and DTT (dithiothreitol). The fractions obtained were
of humans and animals (Chen TA, Hill PB. Vet Dermatol 2005; 16: 4–
                                                                               precipitated with trichloroacetic acid/acetone and the total protein
26). Malassezia pachydermatis proliferation and phospholipase produc-
                                                                               quantified by bicinchonic acid (BCA) Kit. Candida cell wall proteins
tion may play a pathogenic role in the occurrence of skin lesions in
                                                                               were separated by 2 D electrophoresis using pH = 7–10 gradient strips
dogs (Cafarchia C, Otranto D. J Clin Microbiol 2004; 42: 4868–4869).




                                                                                                                                 Ó 2009 The Authors
104                                                                 Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                  Poster Presentations



and 10% SDS polyacrylamide gels. The gels were analyzed and                     P256
compared using PDQuest-2D analysis software.                                    Phospholipase production by Malassezia species in response
Results: The different electrophoretic profiles obtained, reveal dif-            to b-endorphin stimulation: a candidate virulence factor?
ferences between the species under study in terms of cell wall proteins         C. Vlachos1, G. Gaitanis1, E. C. Alexopoulos2, Ch. Papadopoulou1,
composition. It is possible to observe that C. tropicalis is the species        A. Velegraki3 and I. D. Bassukas1
that present higher similarity in terms of cell wall protein profile             1
                                                                                 Medical School, University of Ioannina, Ioannina, Greece,
when compared with the other species and C. glabrata is the species             2
that presents the lower similarity. Moreover, it is possible to observe
                                                                                 Medical School, University of Patras, Patras, Greece, 3Medical
that, while C. parapsilosis strains present a high homology, for the            School, Athens University, Athens, Greece
other two species the similarity was to much higher.
Conclusions: Hence, it is possible to conclude that there are several           Malassezia species are global skin commensals and pathogens causing
differences on the cell wall protein profiles among the different NCAC           pityriasis versicolor being implicated in the pathogenesis of seborrheic
species and also between different strains of the same species.                 dermatitis (SD), atopic dermatitis and psoriasis. The aims of our study
                                                                                were: (i) to study the distribution of the ‘anthropophilic’ Malassezia
                                                                                species within family members with SD; (ii) to assess phospholipase
                                                                                production as a potential virulence marker; and (iii) to study the effect
P255                                                                            of b-endorphin on phospholipase production by Malassezia isolates.
                                                                                Skin sampling and identification of Malassezia species were performed
Candida dubliniensis pathogenicity: comparison with other
                                                                                as previously described (1). Phospholipase activity was measured by
Candida species                                                                 the egg-yolk plate method as the rate of the maximum diameter of the
C.Y. Koga-Ito, C.A.P. Martins, T. C. Vasconcellos and                           colony to the total diameter of precipitation on egg yolk agar. For the
E. Y. Komiyama                                                                  assessment of the effect of b-endorphin on phospholipase activity b-
  ˜o                         ˜o    ´
Sa Paulo State University, Sa Jose dos Campos, Brazil                           endorphin (1 or 100 nmol) was added to Malassezia cultures for 4 days
                                                                                prior to the phospholipase activity assay. Statistical inference by means
Objectives: In vivo studies on virulence using murine models                    of the v2-square test and logistic regression analysis (SPSS). Forty-five
suggested that C. dubliniensis is less virulent than C. albicans. However,      volunteers (15 males/30 females) belonging to 18 families were
there are not previous studies on the comparative virulence of C.               sampled and a total of 48 Malassezia strains were isolated (7 M. globosa,
dubliniensis with non-albicans species. Also, C. dubliniensis infection         21 M. furfur, 16 M. sympodialis, 4 M. restricta). Fifteen out of the 45
kinetics is rarely discussed in the literature. This study aimed to             volunteers had SD. Samples from 13 SD patients, three pityriasis
compare the virulence and infection kinetics of C. dubliniensis with            versicolor and seven healthy unrelated individuals were also included
other non-albicans species, in particular C. tropicalis. Also, to               and 24 Malassezia strains (seven M. globosa, seven M. furfur, seven M.
investigate the virulence of C. dubliniensis in relation to C. albicans,        sympodialis, three M. restricta) were isolated from them. M. furfur
by using clinical isolates.                                                     clustered within families (P < 0.033). Phospolipase production was
Methods: Experimental pathogenicity was determined by using mice                observed in M. furfur CBS 6001, M. carpae CBS10434, M. pachyder-
in a model of systemic infection (Ethic Committee approval 056-PH/              matis CBS1879, M. dermatis CBS 9170, M. obtusa CBS 7876, as well as
CEP). Survival rate and behavioral changes were registered for                  in M. furfur (28/28), M. globosa (14/14), M. restricta (6/7) and M.
28 days. Results were compared by Kaplan–Meier survival analysis                sympodialis (20/22) strains. Quantitative production of phospholipase
(log-rank test, a = 5%). Infection kinetics was determined by using             was increased in M. furfur compared to the other Malassezia species
mice in a model of systemic infection and by microbiologic evaluations          (P < 0.05). Strains from SD patients tended to respond to b-endorphin
(expressed in values of colony-forming units per gram of organ-cfu per          stimulation with increased phospholipase production but this did not
gram) of each organ (liver, spleen, kidneys, lungs and brain).                  reach statistical significance in the population tested thus far. In
Results: The higher mortality rate was observed for C. albicans                 conclusion, our results show that: (i) M. furfur tends to cluster within
(9/20), followed by C. tropicalis (3/20), C. dubliniensis (1/20) and            families. (ii) All tested Malassezia species present some phospholipase
C. krusei (0/20) (P = 0.002). No animal inoculated with C. dubliniensis         activity, yet under the current assay conditions this activity is highest
showed behavioral or postural alterations. Animals inoculated with              in M. furfur. (iii) M. furfur responds to b-endorphin stimulation with
C. albicans and C. tropicalis showed inclination of the head that suggests      increased phospholipase activity compared to other Malassezia species.
involvement of the central nervous system. High number of                       Increasing the sample size, complementing conventional mycological
C. dubliniensis cells was isolated from the lung 6 h after the inoculation.     results with molecular typing methods and optimizing our phospho-
C. dubliniensis showed high capacity of dissemination to the kidney             lipase assay for species specific testing could highlight whether
when compared with other species. All the tested species were isolated          production of phospholipase by M. globosa, M. restricta and M.
from the spleen and total elimination was observed for C. tropicalis,           sympodialis as a virulence factor is altered by b-endorphin stimulation
C. krusei and C. dubliniensis, but not for C. albicans. C. dubliniensis was     following disease associated pattern.
also detected in the liver with slower clearance in relation to the other       Reference
species. A reduction of C. albicans, C. tropicalis and C. krusei counts was     1. Gaitanis G, Velegraki A, Alexopoulos EC. Malassezia furfur finger-
observed for all the organs during the experimental period. This                   prints as possible markers for human phylogeography. ISME J
reduction tendency of counts was observed for C. dubliniensis in lungs             2009; 3(4): 498–502.
and spleen. A continuous elevation of C. dubliniensis counts was
observed for kidney and brain even at day 21. C. albicans clinical
isolates (n = 4) were more virulent than C. dubliniensis ones (n = 4)
(P = 0.000).
Conclusions: C. dubliniensis was less virulent for mice in relation to          P257
C. albicans and C. tropicalis. C. dubliniensis caused persistent infection in   Detection of siderophore production of Aspergillus and
kidney and liver. C. dubliniensis clinical isolates were less virulent than     Candida species
C. albicans ones.                                                               A. Seyer, A. Kalkanci, A. Fouad and S. Kustimur
                                                                                Gazi University, Ankara, Turkey

                                                                                Objectives: Siderophore-mediated iron acquisition has been well
                                                                                studied in many bacterial pathogens because it contributes to
                                                                                virulence. In contrast, siderophore-mediated iron acquisition by fungi
                                                                                has received relatively little attention. A welsknown and widely used
                                                                                method for detection of siderophore production by microorganisms in
                                                                                solid medium is the universal chrome azurol S (CAS)-agar plate assay.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   105
Poster Presentations



This study proposes a molecular quantitative assay for the detection of         suggesting that this assay is more sensitive to the analysis of SAP
siderophores of Aspergillus fumigatus and Candida albicans strains.             activity regardless of the species studied.
Methods: Aspergillus fumigatus, Candida albicans strains and a                  Financial support: FAPEAM.
positive control Aspergillus niger strain were used for the detection of
siderophores in the CAS-agar plates. CAS-agar plates were preperad
according to Schwyn and Neilands protocol published in 1987. But, we
modified the original methodology by preparing CAS-blue agar plates              P259
overlaid with a layer of nutrient agar. A realtime reverse-transcription        Adhesion of clinical isolates of C. albicans and C. tropicalis to
(RT-PCR) protocol has been developed to analyse the expression pattern          immobilized extracellular matrix proteins
of the sidA gene of A. fumidatus and SIT1 gene of C. albicans in relation to    K.R.C. Costa, J. C. Ferreira, M. D. Baruffi and R. C. Candido
siderophore production. Fungal RNA was isolated and the RT-PCR was                                   ˜o
                                                                                FCFRP – USP, Ribeira Preto, Brazil
performed with cDNA of A. fumigatus and C. albicans strains. PCR was
conducted using the LightCycler 2.0 instrument (Roche Diagnostics,
                                                                                Extracellular matrix (ECM) proteins components form a complex
GmbH Mannheim, Germany). Reaction mixtures contained a total
                                                                                network which provides multiple binding sites for attachment of
volume of 20 ll consisting of; SYBR Green I PCR Master Mix (Roche
                                                                                microorganisms. Among ECM proteins, laminin and fibronectin could
Diagnostics, Germany) and corresponding primers.
                                                                                be involved in adherence in C. albicans.
Results: Siderophore producing microorganisms were detected by                  Objectives: The aim of this study was to evaluate the adhesion of C.
measuring the advance of the color-changes on the CAS-agar, from
                                                                                albicans and C. tropicalis to immobilized laminin and fibronectin.
blue to orange, purple or dark purplish-red. Relative transcript levels of
                                                                                Methods: A collection of 15 C. albicans and 15 C. tropicalis recovered
the SidA gene of A. fumigatus and SIT1 gene of C. albicans were
                                                                                from the oral cavity of patients with clinical signs of candidiasis were
quantified. Mean copy number of SidA gene was 2.25 · 103 and it was
                                                                                used in the study. The adhesion of Candida cells to the ECM proteins was
SIT1 gene was 2.62 · 103.
                                                                                evaluated by ELISA. Wells of polystyrene microtiter plates were coated
Conclusion: We describe a quantitative molecular assay compared                 with 100 ll of laminin or fibronectin (10 lg ml-1 in 0.2 mol L-1
to CAS-agar plate assay, which make it possible to select and evaluate
                                                                                bicarbonate buffer pH 9.4) by passive adsorption overnight at 4 °C.
the siderophore production by several microorganisms according to
                                                                                Non-specific binding was blocked by incubating the plates for 2 h with a
different culture conditions. Detection of sideophores by CAS-agar plate
                                                                                1% solution of gelatin and the inoculum used was 107 yeast cells per
method or by a quantitative PCR method would be usefull to
                                                                                well. The ELISA procedure was carried out using a mouse anti-Candida
understand the pathophysiological mechanisms were conducted by
                                                                                monoclonal antibody followed by addition of an anti-mouse IgG
fungal agents during human diseases.
                                                                                peroxidase conjugate with the respectives steps of washing and
                                                                                incubating period. The reaction was developed with the substrate O-
                                                                                phenylenediamine dihydrochloride (OPD) and the absorbance at
P258                                                                            490 nm (A490) was measured using an automated reader. Bovine
                                                                                serum albumin (BSA) was used as positive control. Each experiment was
Evaluation of the secreted aspartic proteinase activity of
                                                                                done in triplicate and the results were expressed as the relative adhesion
clinical isolates of C. albicans and C. tropicalis using two                    index for laminin and fibronectin calculated as A490 ECM protein/A490
different methods                                                               BSA.
K.R.C. Costa, J. C. Ferreira, M.A.S. Lavrador and R. C. Candido                 Results: All isolates of C. albicans and C. tropicalis presented an
                     ˜o
FCFRP – USP, Ribeira Preto, Brazil                                              adhesion index higher than 1.00, which suggests a positive binding to
                                                                                the immobilized extracellular matrix proteins laminin and fibronectin.
The role of secreted aspartic proteinase (SAP) as a virulence factor of         Conclusion: These findings indicates that C. albicans and C. tropicalis
Candida has been intensively investigated during the last decades. A            interact specifically with laminin and fibronectin.
traditional semi-quantitative plate method using albumin as the sole            Financial support: FAPEAM.
source of nitrogen is widely used to evaluate SAP activity, especially of
C. albicans. On the other hand, a quantitative assay using yeasts
cultured in broth medium followed by spectrophotometric analysis has
emerged as an interesting alternative for this purpose.                         P260
Objectives: The aim of this study was to determine if there is                  Response to macrophage infection by Candida parapsilosis
correlation in the in vitro SAP activity of C. albicans and C. tropicalis       sensu strictum isolates with different multilocus genotypes
isolates employing the two described methods.                                   R. Sabino1, P. Sampaio2, L. Rosado3 and C. Pais2
                                                                                1
Methods: A collection of 15 C. albicans and 15 C. tropicalis recovered                                                           ´de
                                                                                 Universidade do Minho/Instituto Nacional de Sau Dr. Ricardo
from the oral cavity of patients with clinical signs of candidiasis were        Jorge, Lisboa, Portugal, 2Universidade do Minho, Braga,
used in the research. The semi-quantitative method to determine SAP             Portugal, 3Instituto Nacional de Sau Dr. Ricardo Jorge, Lisboa,
                                                                                                                    ´de
activity was assessed according to Ruchel et al. (1982) and the
                                          ¨                                     Portugal
enzymatic activity was expressed as a precipitation zone (PZ), which is
the ratio between the diameter of the colony and the diameter of the
                                                                                Candida parapsilosis is the cause of serious nosocomial infections being
zone corresponding to degradation of substrates. The quantitative assay
                                                                                the second most common Candida species isolated from bloodstream
was carried out as described by Kuriyama et al. (2003) and one SAP
                                                                                infections in any regions of the world, including Portugal. Due to its
activity unit was defined as a 0.1 increase in the OD280/h. This value
                                                                                association with parenteral nutrition and central lines, C. parapsilosis
was related to cell number per millilitre to calculate final SAP activity.
                                                                                affects mainly critically ill neonates, cancer patients and surgical
All experiments were done in triplicate and the Pearson¢s correlation
                                                                                intensive care unit patients. Despite the growing importance of these
test followed by two-tailed permutation assay was applied.
                                                                                pathogens little is known about their virulence attributes. Given the
Results: In the semi-quantitative method, all C. albicans isolates              complexity of C. parapsilosis virulence and the critical role played by
presented moderate activity while 40% and 60% C. tropicalis isolates
                                                                                macrophages in balancing colonization/infection caused by this yeast,
had moderate and no activity, respectively. The quantitative assay
                                                                                the analysis of C. parapsilosis response to macrophage infection is
showed SAP activity of all C. albicans and C. tropicalis isolates. However,
                                                                                important to understand the virulence potential of different isolates of
the activity average was higher for C. tropicalis isolates. A low
                                                                                this species. Since the genetic background may influence the strain
correlation between these assays was revealed by the statistic test.
                                                                                virulence attributes, we identified new polymorphic microsatellite
Conclusion: The traditional semi-quantitative method is appropri-               markers, applied them in C. parapsilosis sensu strictum genotyping and
ate to characterize the production of SAP by all strains of C. albicans         selected isolates with different multilocus genotypes to access macro-
studied; however, when dealing with C. tropicalis isolates, this method         phage infection.
showed low sensitivity. Conversely, the quantitative method was able
to demonstrate the enzimatic activity of C. albicans and C. tropicalis,




                                                                                                                                  Ó 2009 The Authors
106                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                 Poster Presentations



Objectives: The main objective of this work was to analyze the               P262
behavior of strains with different multilocus genotypes, as determined       Biofilm production by isolates of Candida species and by
by microsatellite genotyping, upon contact and internalization by            mixed Candida species recovered from 100 denture wearers
macrophages.                                                                                                                      ´
                                                                             C. Marcos-Arias, E. Eraso, J. M. Aguirre and G. Quindos
Methods: Two hundred and thirty three C. parapsilosis sensu strictum         Universidad del Paı´s Vasco, Leioa, Spain
independent clinical isolates from European and American hospitals, as
well as environmental strains were genotyped using four polymorphic
microsatellite markers. Selected strains with different multilocus           Denture stomatitis (DS) is a lesion of the mucosa that has been
genotypes and origins were analyzed regarding their virulence                associated to Candida. Although its aetiology is multifactorial, it seems
attributes by accessing phagocytosis and intracellular killing using         to depend on the development of complex and poorly characterized
the macrophage-like cell line J774A.1. After growing in YEPD medium          biofilms. Candida albicans is the most frequently isolated yeast from DS,
overnight, yeast cells (2 · 107 cells ml-1) were added to the 24-well        but other species of Candida, are regularly isolated. Biofilm formation is
macrophage monolayer (4 · 105 cells ml) at an effector/target ratio of       a major virulence factor in the pathogenicity of Candida because of their
1 : 10 and incubation was performed at 37 °C, 5% CO2-95% air                 high antifungal resistance.
during 1 h. The number of viable C. parapsilosis yeast cells was             Objective: To examine the differences in biofilm production by
determined by CFU counting after 24 h at 37 °C on YEPD agar plates.          clinical isolates of different species of Candida from denture wearers,
Determination of macrophage death rate was also performed at 1, 2, 3,        as well as in biofilm production by two or more Candida species together
4, 6, 8 and 12 h after infection by iodium propide staining.                 (mixed biofilm).
Results: The percentage of phagocytosis after one hour of infection          Methods: One hundred and fifty-one Candida isolates recovered from
varied between 11.0% and 44.6%. Interestingly, the strain with the           the denture and/or the underlying mucosa from 100 patients were
lowest percentage of phagocytosis was an environmental isolate               studied (45 with different types of DS and 55 without DS). When two or
whereas the highest percentage was found in a bloodculture isolate.          more species were isolated from the same patient, these isolates were
   Microscopic examinations confirmed our previous findings and                grouped for the study of a mixed biofilm. Isolates included 101 Candida
showed that C. parapsilosis can develop pseudohyphae inside macro-           albicans, 18 Candida tropicalis, 13 Candida glabrata, 11 Candida guillier-
phages.                                                                      mondii, 4 Candida parapsilosis, 2 Saccharomyces cerevisiae, and 1 isolate
Conclusion: Our observations suggest that C. parapsilosis isolates           each of Candida dubliniensis and Candida krusei. C. albicans NCPF 3153 and
with different multilocus genotypes have distinct virulence potential        the hypha-deficient mutant C. albicans Ca2 were used as controls.
and studies are in progress to understand the mechanisms underlying              Biofilms were formed according to Ramage et al. and evaluated by a
this behavior.                                                               colorimetric method to monitor the metabolic activities of yeast cells.
   Raquel Sabino holds a PhD fellowship (SFRH/BD/22100/2005)                 Data were analysed using the Student’s t-test (P < 0.05).
             ¸˜            ˆ
from Fundacao para a Ciencia e Tecnologia (FCT).                             Results: Most isolates produced biofilm, being C. albicans and C.
                                                                             tropicalis the major producers, without significant differences between
                                                                             them. Among the isolates from patients with DS, C. albicans produced
                                                                             more biofilm than other species of Candida did. In the group of patients
                                                                             without DS, the same difference was found in 24 h biofilms. In relation
P261                                                                         to mixed species biofilm, C. albicans was present in most of them.
Comparison of biofilm formation ability among Candida                         Moreover, the most common combination was C. albicans and C.
clinical isolates                                                            tropicalis. The rank of mature biofilm production (48 h) was as follow:
A. Silva-Dias, I. Miranda, C. Pina-Vaz and A. G. Rodrigues                   C. tropicalis and C. glabrata > C. albicans and C. tropicalis > C. albicans,
University of Porto, Porto, Portugal                                         C. glabrata and C. tropicalis > C. albicans and C. glabrata > C. albicans
                                                                             and C. guilliermondii = C. albicans and C. parapsilosis. However, C.
Objectives: Candida albicans is the Candida species most associated          tropicalis and C. glabrata combination produced more biofilm at 24 h of
with mucocutaneous and systemic mycosis, but recently, non-albicans          incubation than the C. albicans and C. tropicalis combination. In all
species have been increasingly responsibility for such conditions. The       cases, no relationship was found within the origin of the isolates and
ability of Candida species to form biofilms has important clinical            biofilm production. Finally, those mixed biofilms in which C. albicans
repercussions since it results in a reservoir of cells with promoted         was present showed more biofilm production at 24 h of incubation
antifungal resistance. Our aim was to evaluate the biofilm formation by       than biofilm produced uniquely by C. albicans. Further studies are
distinct Candida clinical strains (isolated from patients admitted at        required in order to understand how the different species of fungi
Hospital S. Joao) regarding their metabolic activity and total biomass.
                ˜                                                            cooperate to biofilm formation.
Methods: Clinical isolates of Candida (n = 165), corresponding to C.         Conclusion: Mixed biofilm including C. albicans are more proliferant
albicans (n = 45), C. parapsilosis (n = 45), C. glabrata (n = 45) and C.     than those produce by C. albicans or other species of Candida separately.
tropicalis (n = 30), were obtained from different human samples. Biofilm      Funding: Projects GIC07 123-IT-222-07 (Departamento de
were quantified colorimetrically with a crystal violet assay and a XTT        Educacio ´n, Universidades e Investigacio        ´n, Gobierno Vasco),
assay after 24 and 48 h of incubation.                                       S-PE08UN35 (Saiotek 2008, Departamento de Industria, Comercio y
Results: Data obtained using the above methodologies were discrep-           Turismo, Gobierno Vasco) and PI061895/2006 (Fondo de Investiga-
ant: a lack of correspondence between biomass formation and metabolic          ´
                                                                             cion Sanitaria del Ministerio de Sanidad y Consumo de Espana).    ˜
activity was found. C. tropicalis showed the higher ability to form biofilm
followed by C. parapsilosis, C. glabrata and C. albicans when quantified by
crystal violet. However quantification with XTT assay showed that, C.         P263
albicans strains showed higher biofilm metabolic activity followed by C.      Glucans induce higher IL-8 and TNF-a mRNA production in
glabrata,C. parapsilosis and C. tropicalis .A marked variability intra and   Cystis Fibrosis Transmembrane conductance Regulator
inter species was noticed.
                                                                             (CFTR) deficient than in non-deficient respiratory epithelial
Conclusion: Candida albicans despite being the species with higher
                                                                             cells
metabolic activity displayed lower biomass formation comparing to
non-albicans species. For all species, biofilm formation showed to be
                                                                             Ph. Poirier1,2, A. Hinzpeter3, C. Farrugia1, F. Botterel1, P. Fanen3
strain or species dependent.                                                 and S. Bretagne1
                                                                             1
                                                                              Hoˆpital Henri Mondor, CRETEIL, France, 2Ho    ˆpital Gabriel
                                                                             Montpied, CLERMONT-FERRAND, France, 3Ho          ˆpital Henri Mondor,
                                                                             CRETEIL, France

                                                                             Objectives: Glucans are major structural components of the fungal
                                                                             cell wall and are known to activate invertebrate innate immune




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                   107
Poster Presentations



systems. These carbohydrates are also known to induce nuclear factor-           armadillos were virulent in the animal model. P. brasiliensis express
jB (NF-jB) and therefore inflammatory reactions in macrophages [1].              proteins that interact in various ways with the extracellular
Inflammatory effect of fungi can impact on several respiratory                   environment and generally involve ligands produced by the pathogen
pathologies such as cystic fibrosis (CF). Indeed, defective cells for CF         and is capable to adhere to extracellular matrix proteins (ECM). This
Transmembrane conductance Regulator (CFTR) are more sensitive to                approach has not been studied with the armadillo’s isolates. Then, we
inflammatory effects of lipo-polysaccharide from Pseudomonas aerugi-             studied the capacity P. brasiliensis armadillos isolates to infect to
nosa, which is the main pathogen involved in these patients [2]. In CF          pulmonary epithelial cells (A549), as well as the protein profile of these
patients, Aspergillus fumigatus is also responsible for inflammatory             isolates and ECM ligands. Our data confirmed previous studies that
injuries of the respiratory tract. We have already shown that fungal            more virulent P. brasiliensis isolates have greater adhesion and invasion
growth is the main stimulus for the production of inflammatory                   capacity epithelial cells. The comparative analysis of the different
mediators using A549 cell lines [3]. The aim of this study was to               extracts showed isolate T10 (more virulent) presented more than
investigate whether (i) glucans could be responsible for pro-                   double spots differentially expressed if compared with isolate T7
inflammatory effects on respiratory epithelium, and (ii) CFTR could              (intermediate virulence), which may be related to virulence. In addition,
be involved in this pro-inflammatory effect.                                     T10 presented remarkable difference with an elevated number of
Methods: Two in vitro models of respiratory epithelium were exposed             ligands collagen type I and similar to collagen type IV, fibronectin and
to 100 lg/mL of commercial glucans from Saccharomyces cerevisiae: the           laminin if comparated with other isolates. Therefore, one of the
A549 cells without CFTR expression, and the Calu3 cells with strong             armadillo isolate has additional ligands to three ECM proteins. The
expression of CFTR. Levels of mRNA of 3 inflammatory mediators                   isolates from armadillo presented more ligands to collagens compared to
[Interleukine 8 (IL-8), Tumor Necrosis Factor a (TNF-a) and                     the human isolates. The data presented here support the conclusion of
Granulocyte Macrophage Colony Stimulating Factor (GM-CSF)] were                 host-site-specific influences on protein expression and different profiles
quantified using quantitative real time PCR. The results were expressed          may be related to micro niche of the fungus in the host and this
as the N-fold difference in target gene expression relative to the TBP          difference may occur in the first contact with the human tissues.
gene as the reference gene (Ntarget = 2DCt sample).                             Supported by FAPESP, PADC-FCF-UNESP and CAPES.
Results: Glucans (4 h exposition, 100 lg/mL) induced a significant
higher expression of IL-8 mRNA and TNF-a in A549 than in Calu3
[NA549 = 18 vs. NCalu3 = 2 (P = 0.02); TNF-a: NA549 = 9 vs.
NCalu3 = 2 (P = 0.05), respectively). The addition of the specific CFTR          P271
inhibitor (CFTR(inh)172) on Calu3 cells did not lead to a higher IL-8           Disease severity influences pharmacokinetics of
and TNF-a induction by glucans by these cells. No significant difference
                                                                                voriconazole
in GM-CSF induction between the two cell lines was observed (GM-CSF
NA549 = 21 vs. NCalu3 = 17).
                                                                                J.W.C. Alffenaar, J.G.W. Kosterink, S.M.G.J. Daenen,
Conclusion: Our results suggest that glucans are involved in the                M.G.G. Rodgers, D.R.A. Uges and T. S. Van der Werf
inflammatory response of respiratory epithelium to fungi. In CF                  University Medical Center Groningen, Groningen, The Netherlands
patients, the absence of CFTR at the plasma membrane could be
responsible for an over expression of IL-8 and TNF-a. This could                Background: A standard loading dose of voriconazole might be too
explain at least in part the respiratory damages in CF patients colonized       low to reach steady state concentrations in some or all critically ill
with A. fumigatus.                                                              patients. This may be related to capillary leakage which is a hallmark
References                                                                      of sepsis. For several antimicrobial products, an increase in the volume
1. Kataoka K, Muta T, Yamazaki S, Takeshige K. Activation of                    of distribution has been reported. Patients with sepsis who are admitted
   macrophages by linear (1right-arrow3)-beta-D-glucans. Impliations            to an Intensive Care Unit (ICU) may have altered pharmacokinetics
   for the recognition of fungi by innate immunity. J Biol Chem 2002;           compared to healthy volunteers and less ill patients, in whom the
   277: 36825–31.                                                               loading dose was established. In this study we test the hypotheses that
2. Perez A, Issler AC, Cotton CU, Kelley TJ, Verkman AS, Davis PB.              1) the disease severity (according to validated scoring systems)
   CFTR inhibition mimics the cystic fibrosis inflammatory profile. Am             correlate with the volume of distribution; and that 2) the area under
   J Physiol Lung Cell Mol Physiol 2007; 292: L383–95.                          the concentration time curve (AUC) of voriconazole decreases with
3. Bellanger AP, Millon L, Khoufache K, Rivollet D, Bieche I,                   increased severity of disease.
   Laurendeau I, Vidaud M, Botterel F, Bretagne S. Aspergillus                  Methods: In a prospective observational pharmacokinetic study in
   fumigatus germ tube growth and not conidia ingestion induces                 patients, aged 18 years and older, suspected to have a fungal infection,
   expression of inflammatory mediator genes in the human lung                   voriconazole was started in a loading dose of 6 mg kg-1 followed by
   epithelial cell line A549. J Med Microbiol 2009; 58: 174–9.                  4 mg kg-1 IV or 400 mg respectively 200 mg PO. Blood samples were
                                                                                collected on day one and two at t = 0, 1, 2, 4, 8, 12 h after
                                                                                voriconazole administration; and on day 3, 5 and 8, samples were
                                                                                collected at t = 0, 1, 3 h after voriconazole administration. All samples
P264                                                                            were analyzed by LC/MS/MS. Disease severity was assessed by
                                                                                Simplified Acute Physiology Score (SAPSII) and Sequential Organ
Adhesion profiles and extracellular matrix ligands of
                                                                                Failure Assessment (SOFA) scoring systems. The study was approved
paracoccidioides brasiliensis isolates obtained from
                                                                                by the Ethics Committee of the University Medical Center Groningen,
armadillos (dasypus novemcinctus)                                               Groningen, The Netherlands, and written informed consent was given.
R. Peres da Silva1, R. Cordeiro Theodoro2, E. Bagagli2 and                      Results: Eighteen patients were included in this study, (ICU n = 8;
M.-J. Soares Mendes Giannini1                                                   ward n = 10). The median AUCday 1 voriconazole of 15.3 (IQR 10.3–
1
 Faculdade de Cie   ˆncias Farmace ˆuticas de Araraquara-UNESP,                 22.2 mg*h l-1) in patients admitted to the ICU was lower (but not
Brasil, 2Instituto de Biocieˆncias de Botucatu-UNESP, Brasil                    significantly; P = 0.07) compared to the median AUC of 29.3 (IQR
                                                                                27.1–37.4) mg*h l-1 in patients on the ward. The median AUCday 2 in
Paracoccidioidomycosis (PCM) is a systemic mycoses caused by                    patients admitted at the ICU (30.1; IQR 16.3–38.0) was significantly
P. brasiliensis, with a wide distribution in Latin America. The clinical        lower (P = 0.01) compared to the AUC of patients admitted at the
manifestations include cutaneous and systemic forms, and can attack             ward (median 51.5; IQR 42.3–63.9). The correlation (R) between the
various tissues, specially the lungs. Recently, P. brasiliensis strains with    two disease severity scores and the AUCday 1 was non-significant;
typical morphology have been isolated from Dasypus novemcinctus,                R = 0.1 (P = 0.7) for the SAPSII score and R = 0.36 (P = 0.14) for
confirming as the primary natural reservoir of this fungus. Its                  the SOFA score. There was a near significant correlation between
geographic distribution is similar to that of human PCM. Isolates from          AUCday 1 and SAPSII if voriconazole was administered intravenously




                                                                                                                                  Ó 2009 The Authors
108                                                                  Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                              Poster Presentations



(R 0.6; P = 0.077) or when the SAPSII score was ignored for the             activity and forms the basis for further investigations to isolate
parameters chronic diseases and type of admittance (R = 0.4;                active components, elucidated the structures and evaluate them
P = 0.1). A significant correlation was observed between Cmax 1              against wider range of microbial strains with the goal to find new
and SOFA score (R = 0.48; P = 0.044).                                       the therapeutic principles. Substitution of commonly used antifungal
Conclusions: A correlation between disease severity and pharma-             and inhibiting chemicals by natural extracts such as Myrtle is
cokinetics of voriconazole seems likely but remains presently unproven.     recommended.
Effect size may be smaller than initially expected, or more likely, case
mix may have been too large to reach statistical significance in the
present study. A larger study is warranted to explore the need for new
dosing strategies of voriconazole in critically ill patients.               P274
                                                                            Pharmacokinetic/pharmacodynamic (PKÆPD) analysis of
                                                                            Itraconazol against Aspergillus spp. in patients with fungal
                                                                            infection-investigation by using the Monte Carlo simulation
P272                                                                        K. Yonezu1, H. Kasai2, H. Igari1 and M. Nakano1
                                                                            1
                                                                             Janssen pharmaceutical K.K., Tokyo, Japan, 2Pharmacokinetics
Inhibitory effects of geranium (Pelargonium) oils on
                                                                            Analysis Group, Tokyo, Japan
Aspergillus flavus toxin productions
L. Modiri
Islamic Azad University(I.A.U), Lahijan, Iran                               Objectives: Since the 1990’s, in the area of antimicrobial
                                                                            research, rapid advances have been made in pharmacokinetic (PK)
                                                                            studies, including maximum blood concentration (Cmax), area under
Mycotoxins are metabolites formed by molds growing in food stuffs,
                                                                            the blood concentration–time curve (AUC), elimination half-life (T1/
fodder and organic waste materials. All molds produce specific
                                                                            2); and in pharmacodynamic (PD) studies, including minimum
mycotoxins and species can be characterized by their mycotoxin
                                                                            inhibitory concentration (MIC) and time–killing curve, greatly
spectra as well as natural habitation. To identify preventive
                                                                            contributing to development of proper therapies for infections and
maintenance procedures wich limit funal colonization, growth and
                                                                            development and marketing of novel antimicrobial agents. A notable
amplification/toxicogenesis of natural oils this studay was conducted
                                                                            achievement in this area was identification of the PKÆPD parameters
. Hens escential oil of geranium (pelargonium) was tested for
                                                                            correlated with in vivo bactericidal action of antimicrobial agents.
inhibitory activity against Aspergillus flavus isolated from corn bulks.
                                                                            This enabled prediction of the therapeutic effect of a certain
The disc diffusion method was used to evalute the zone of fungal
                                                                            antimicrobial agent to some degree, based on pharmacokinetic
growth inhibition at various concentrations of the oil so that the
                                                                            characteristics as represented by such parameters as Cmax, AUC,
minimal inhibitory corcentration (mic) and minimal fungicidal
                                                                            and T1/2, and pharmacodynamic characteristics as represented by
concentration (mfc) to be determined. It was found that geranium
                                                                            such parameters as breakpoint value, MIC50, and MIC90. On the
(pelargonium) oil has static effect at 1:4 dilution ratio as well as
                                                                            other hand, in the field of antifungal research, evaluation of the
fungicidal property at 1:2 ratio so on. The extent of inhibition of
                                                                            optimal dosage based on PKÆPD is not established enough. In this
fungal growth was dependent on used concentration of the essential
                                                                            analysis, we performed Monte Carlo simulation using these phar-
oil, so, substitution of currently used antifungal chemicals by natural
                                                                            macokinetic parameters of Itraconazole in Japanese patients with
compounds is recommended for animal and human food or for crope
                                                                            mold infection, and the susceptibility data of Itraconazole against
conservations.
                                                                            clinical isolates of Aspergillus spp. in Japan.
                                                                            Methods: Previously determined population pharmacokinetic (PK)
                                                                            parameters and plasma concentrations of itraconazole were used to
                                                                            postulate total clearance (CL) in individual patients. The area under the
P273                                                                        plasma concentration–time curve (AUC) at a dose of 200 mg was then
In vitro minimum inhibitory concentration (MFC) of Myrtus                   determined by 200/CL. Finally, the ratio of AUC to the minimum
communis oils in comparison to nystatin on clinical isolates                inhibitory concentration (MIC) against Aspergillus spp. (AUC/MIC) was
                                                                            determined to investigate its correlation with clinical efficacy. The
and standard strains of Candida albicans
                                                                            Monte Carlo simulation was performed with the distribution data of
L. Modiri
                                                                            MIC of Itraconazole against these clinical isolates to generate the MIC
Islamic Azad University (I.A.U), Lahijan, Iran                              data for n = 10 000. Based on the time-course of blood concentrations
                                                                            and MIC for n = 10 000, determined the probability of target
Use of plants as a source of medicine has been inherited and is an          attainment (TA%) for each range of AUC/MIC of these fungal infectious
important component of the health care system in Traditional                patients. Analyses were performed using NONMEM software (version
medicines. So, The objective of laboratory testing with plant               V, level 1.1) (GloboMax LLC, Hannover, USA).
antimicrobial extract is to obtain reproducible indications of the          Results: (i) The data of distribution of 11 isolated Aspergillus spp are
susceptibility of clinical Isolates of Candida albicans from Vulvovaginal   shown in Table 1. (ii) The pharmacokinetic pharmacodynamic (PKÆPD)
Candidiasis and Standard Strain of C. albicans against Myrtus               parameters obtained from the analyses are shown in Table 2. (iii) The
communis extract and nystatin. 45 isolates of Candida albicans              correlation between the probability of target attainment (TA%) and
originally obtained from clinical sources were included in the study.       AUC/MIC is shown in Figure 1. (iv) Using standard doses of
The plant extract was obtained from Barij essence co. The type              itraconazole against Aspergillus spp, it was demonstrated that AUC/
strain of C. albicans (ATCC90028) were prepared as control strain           MIC were smaller than 10, and 90% cases were included in 0.5–10
from Iranian Research Organization for science of technology                (Figure 1).
(IROST). In this research, A reference method for antifungal
susceptibility testing of yeasts used. Inbibitory effects of the extract
in comparison with nystatin analyzed by serial dilution broth
technique. Based on the data analysis the best MIC of M. Communis
extract on clinical isolates and type strain of C. albicans were
25 mg ml-1 and 2.5 mg ml-1, respectively . Also the best MIC of
nystatin on clinical Isolates and type strain of C. albicans were
36 mg ml-1 the obtained results showed that Myrtle extract has
inbibitory effect on clinical isolates and type strain of C. albicans in
lower concentrations than nystatin drug . The present study suggest
consideration of the plants extract with the highest antimicrobial




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                               109
Poster Presentations



Table 1 MIC distribution of itraconazole                                    P275
                                                                            Population pharmacokinetics of liposomal amphotericin B,
                                                                            caspofungin and the combination of both in allogeneic
                                                                            hematopoietic stem cell recipients
                                                                            A.H. Groll1, C. Young2, C. Lanvers-Kaminsky2, G. Silling2,
                                                                            G. Hempel2, J. Boos2 and G. Wurthwein2
                                                                                                             ¨
                                                                            1
                                                                             Children’s University Hospital, Mu¨nster, Germany, 2University
                                                                            Hospital, Mu ¨nster, Germany

                                                                            Background: Liposomal amphotericin           B (LAMB), caspofungin
                                                                            (CAS) and the combination of both (CASLAMB) are used for
                                                                            management of invasive fungal infections in allogeneic hematopoietic
                                                                            stem cell (aHSCT) recipients. Little is known, however, about the
                                                                            disposition of both agents and their combination in this special
                                                                            population.
                                                                            Methods: The population pharmacokinetics and interactions of
                                                                            LAMB and CAS were investigated within a risk-stratified, randomized,
                                                                            multicenter phase II trial in 53 adult, cyclosporine-immunosuppressed
                                                                            aHSCT patients in the setting of granulocytopenia and refractory fever
                                                                            (CASLAMB trial). Patients received either LAMB (3 mg kg-1 QD), CAS
                                                                            (50 mg QD; d1:70 mg) or the combination of both until defervescence
                                                                            and granulocyte recovery. Pharmacokinetic sampling was performed
                                                                            on days 1 and 4. Drug concentrations in plasma (LAMB: 405, CAS:
                                                                            458 samples) were quantified by HPLC and were analyzed using
                                                                            NONMEM version 5 and XPOSE 3.1.
                                                                            Results: CAS concentration data fitted best to a two-compartment
                                                                            model with proportional error model and interindividual variability
                                                                            (IIV) on clearance (CL) and central volume (V1) [CL: 0.426 L h-
                                                                            1
Table 2 AUC/MIC of Itraconazole in patients of mol                            ± 24%, V1: 9.25 L ± 29%, intercompartimental clearance (Q):
                                                                            0.823 L h-1, peripheral volume (V2): 3.06 L]. Concentration data of
                                                                            LAMB fitted best to a two-compartment model with combined error
                                                                            model and IIV on all parameters (CL: 0.786 L h-1 ± 69%, V1:
                                                                            18.6 L ± 42%, Q: 2.86 L h-1 ± 56%, V2: 81.7 L ± 60%). Internal
                                                                            validation showed that both models adequately described the observed
                                                                            data. None of the covariates tested (LAMB- or CAS- comedication,
                                                                            respectively, sex, weight, age, bilirubin, creatinine clearance) further
                                                                            improved the models.
                                                                            Conclusions: The disposition of LAMB and CAS was best described
                                                                            by two compartment models. Drugs exposures in aHSCT patients were
                                                                            comparable to those in other populations, and no pharmacokinetic
                                                                            interactions were observed between the two compounds.



                                                                            P276
                                                                            Effects of varying amounts of a liquid nutritional
                                                                            supplement on the pharmacokinetics of posaconazole in
                                                                            healthy volunteers
                                                                            G. Krishna1, L. Ma1, D. Vickery1, X. Yu1, I. Wu1, E. Power2,
                                                                            E. Beresford1 and S. Komjathy3
                                                                            1
                                                                             Schering-Plough, Kenilworth, NJ, USA, 2Cubist Pharmaceuticals,
                                                                            Lexington, MA, USA, 3PRA International, Raleigh, NC, USA

                                                                            Objective: To evaluate the pharmacokinetics (PK) of posaconazole
                                                                            (POS) when administered with varying amounts of an oral nutritional
                                                                            supplement (Boost PlusÒ).
                                                                            Methods: This was a single-dose, crossover, 5-treatment (Trt), 5-
                                                                            fixed sequence study in 30 healthy subjects who were randomized to
                                                                            receive the following Trts: Trt A, POS 400 mg orally (PO) alone under
Figure 1 AUC/MIC of itraconazole against aspergill.                         fasting conditions; Trt B, 1 oz Boost Plus followed by POS 400 mg PO;
                                                                            Trt C, 2 oz Boost Plus followed by POS 400 mg PO; Trt D, 4 oz Boost
                                                                            Plus followed by POS 400 mg PO; Trt E, 8 oz Boost Plus followed by POS
Conclusion: In this investigation, using standard dose of itraconaz-        400 mg PO. Blood samples were collected at predetermined time points
ole against Aspergillus spp, AUC/MIC were under 10, and thus, 90% of        to evaluate the plasma PK of POS. Log-transformed POS PK parameters
patients receiving administration of 200 mg day-1 itraconazole would        were analyzed using ANOVA.
be included from 0.15 to 10. To make sure of optimal AUC/MIC                Results: POS bioavailability increased almost linearly with increas-
parameter for mold infection in clinical practices, we need further more    ing amounts of the nutritional supplement, Boost Plus (Table). Based
investigation.                                                              on log-transformed data, the relative bioavailability (AUC) of POS was
                                                                            35% (fasting), 48% (1 oz), 60% (2 oz), and 77% (4 oz), compared with
                                                                            AUC of POS with 8 oz Boost Plus. Compared with fasting conditions,




                                                                                                                              Ó 2009 The Authors
110                                                              Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                               Poster Presentations



POS AUC and Cmax increased 2.9- and 3.5-fold, respectively, when            P278
given with 8 oz Boost Plus. These findings were in agreement with            Intracellular antifungal concentrations in peripheral blood
previous results (Sansone-Parsons et al. Antimicrob Agents Chemother.       mononuclear cells, polymorphonuclear leucocytes and
2006;50:1881–1883). Boost Plus increased the extent of absorption;          erythrocytes
however, Tmax was not affected.                                             F. Farowski
                                                                                        ¨ln, ¨ln,
                                                                            Uniklinik Ko Ko Germany
Table 1
                                                                            Introduction: Peripheral blood mononuclear cells (PBMC) and
                                                                            polymorphonuclear leucocytes (PMN), are important components of
                                                                            the host defense against invasive fungal infections (IFI). Information on
                                                                            the penetration and concentration of antifungal drugs in peripheral
                                                                            blood cells is, however, limited. Prior results from exclusively
                                                                            laboratory-based experiments on the interaction of fluconazole and
                                                                            voriconazole with PMN showed that both agents are characterized by
                                                                            rapid intracellular uptake and elution. While fluconazole concentra-
                                                                            tions were only twice as high as in the surrounding medium,(Ballesta
                                                                            et al., 2005) voriconazole concentrations were 8.5 fold.(Pascual et al.,
                                                                            1993) Experiments comparing the concentration of posaconazole in
                                                                            human plasma and alveolar cells yielded a 33 fold increased
                                                                            intracellular concentration, i.e. for Cmax as well as the area under
                                                                            the curve (AUC). (Conte et al., 2009) Even at lower posaconazole
                                                                            plasma concentrations breakthrough infections during prophylaxis are
Conclusion: Following a single-dose administration of 400 mg POS            rare.(Cornely et al., 2007) We suspect that the efficacy of antifungals
oral suspension, POS bioavailability increased almost linearly with         might correlate with their intracellular concentrations. Hence, we
increasing amounts of the nutritional supplement Boost Plus. Relative       developed a method to determine the intracellular concentrations of a
to administration of 400 mg POS with 8 oz of Boost Plus, POS AUC            number of antifungals, i.e. anidulafungin, caspofungin, isavuconazole,
was 77% with 4 oz of Boost Plus and 35% under fasting conditions.           micafungin, posaconazole, and voriconazole, by liquid chromatogra-
                                                                            phy tandem mass spectroscopy in the different compartments of the
                                                                            peripheral blood.
                                                                            Methods: Patient samples are being collected as part of the Cologne
P277                                                                        biobank protocol on Improving Diagnosis of Severe Infections in
In vitro interaction of voriconazole with imipenem/cilastatin               Immunocompromised Patients (ISI) (Cornely et al.). Whole blood,
and piperacillin/tazobactam against clinical Candida                        collected in EDTA treated tubes, was separated by double-discontinu-
albicans isolates                                                           ous Ficoll–Hypaque density gradient centrifugation into PBMC, PMN
                                                                            and red blood cells (RBC). The intracellular concentrations were
S.E.M.A. Keceli Ozcan and B. Mutlu
                                                                            determined by liquid chromatography tandem mass spectroscopy (LC-
Kocaeli University, Kocaeli, Turkey
                                                                            MS/MS).
                                                                            Preliminary results: The limit of quantification is sufficient for the
Objectives: Patients suffering from invasive mycoses often receive          expected concentrations. The accuracies of all concentrations above
concomitant antifungal therapy and antibacterial agents. Currently, in      the limit of quantification were within ± 15%. The correlation
our hospital, piperacillin/tazobactam (P/T) and imipenem/cilastatin         coefficients of calibration curves were 0.99 or better. Recently analyzed
(I/C) and as an antifungal agent, voriconazole are used especially for      blood samples of twelve patients receiving posaconazole showed that
the treatment of febrile neutropenic patients. These antibiotics was        the posaconazole concentrations within the PBMC and PMN fractions
previously observed to demonstrate the in vitro synergistic interactions    were significantly increased compared to plasma concentrations.
with an antifungal agent, caspofungin acetate. It was also previously       Conclusion: To our knowledge, we established the first method to
shown that fluoroquinolones enhanced the activity of caspofungin and         determine azole and echinocandin antifungals within one sample. The
voriconazole. However, the interaction between P/T and I/C antibiotics      accuracies of the method are expected to be sufficient for determination of
with voriconazole againstCandida albicans isolates is not clearly known     intracellular concentrations of these antifungals.
yet.
Methods: Totally 25 C. albicans isolates isolated from various clinical
sites were included into this study. In vitro interaction of voriconazole
with P/T and I/C antibiotics were tested by CLSI M27-A2 microdilution
                                                                            P279
chequerboard technique. The interaction was analyzed according to
values of fractional inhibitory concentration index (FICI). The break-
                                                                            Lack of pharmacokinetic drug interaction between oral
point of minumum inhibitory concentration value for voriconazole            posaconazole and caspofungin or micafungin
susceptibility was accepted as £4 microgram ml-1.                           G. Krishna1, D. Vickery1, L. Ma1, X. Yu1, E. Power2, E. Beresford1,
Results: Only in seven isolates synergistic interactions were ob-           C. Noren1 and M. Medlock3
                                                                            1
served (FICI £0.5); however, in 18 isolates additive or indifferent          Schering-Plough, Kenilworth, NJ, USA, 2Cubist Pharmaceuticals,
interactions were observed (FICI >0.5–2). There was no antogonism           Lexington, MA, USA, 3PPD Development, Austin, TX, USA
detected between all isolates.
Conclusion: These interactions should also be tested in animal              Objective: To determine the effect of posaconazole (POS) on caspo-
experiments and the results should be confirmed with clinical                fungin (CAS) and micafungin (MICA) PK.
experience. Although broad spectrum antibiotics were not expected           Methods: This was a phase 1, open-label, parallel, randomized PK
to have antifungal effect, the knowledge of the interaction between         drug-interaction study in healthy volunteers; 62 of 67 subjects
antifungals and antibiotics may guide to treat immunosuppresed              completed treatment. Cohort 1: Treatment arm (TA) 1 (n = 16)
patients who are under risk of invasive candidiasis.                        received CAS 70 mg day (d) 1 (QD; 1-h infusion), 50 mg (QD; 1-h
                                                                            infusion) d2–d14. TA 2 (n = 15) received CAS+POS oral suspension
                                                                            400 mg BID. Cohort 2: TA 1 (n = 15) received MICA 150 mg (QD; 1-h
                                                                            infusion) d1–d7. TA 2 (n = 16) received MICA+POS oral suspension
                                                                            400 mg BID d1–d7. Study drugs were taken after high-fat meals. CAS,




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                111
Poster Presentations



MICA, and POS plasma levels were evaluated at predetermined time             performed at a flow rate of 0.8 ml min-1 with injections of 40 ll for
points. Log-transformed PK parameters were analyzed using ANOVA.             each sample. The retention times were found to be approximately
Results: Mean PK parameters for CAS and MICA, alone and with                 3.01 min for posaconazole and 5.91 min for itraconazole. The
POS, are shown (Table). Median Tmax for all four arms was 1 h. Based         validation was assessed by running four core assays with the standards
on log-transformed data, CAS Cmax in the CAS+POS arm was ~90%                and samples in duplicate. The assay was compared with a standard
(d1, d14) of CAS alone. CAS AUC in the CAS+POS arm was 89% (d1)              posaconazole bioassay.
and 98% (d14) of CAS alone. MICA Cmax in the MICA + POS arm was              Results: All standard curves were found to be linear, for the specific
~111% (d1) and 104% (d7) of MICA alone. MICA AUC in the                      concentrations used (r = 0.996). The lowest limit of quantification was
MICA + POS arm was 109% (d1, d7) of MICA alone. Mean POS Cmax                determined at a concentration of 0.1 lg ml-1. The mean intra run
and AUC were not affected to a clinically relevant extent when given         precision (%CV) ranged from 2.34 to 7.40%, for the calibration
with CAS or MICA.                                                            standards and from 0.47 to 1.97% for the QC samples,. Spiked samples
                                                                             of plasma and serum presented relatively identical results
Table 1                                                                      (P = 0.999).The recovery of posaconazole ranged between 97–100%.
                                                                             Preliminary measurements of posaconazole levels were performed in
                                                                             serum samples from patients receiving the drug at 400 mg day-1 bd.
                                                                             The mean trough levels were determined to be 0.6 lg ml-1. Compar-
                                                                             ison with the bioassay will be presented in the poster.
                                                                             Conclusions: The results attained have shown that this method is
                                                                             linear, precise, accurate and easy to perform. Its use and further
                                                                             evaluation procedures to support dose adjustment and to ensure a
                                                                             more effective and safer use of posaconazole is recommended.



                                                                             P281
                                                                             In vitro interactions of antifungal agents with
                                                                             fluoroquinolones in the presence of cyclosporine or
                                                                             neutrophils against Candida albicans and Aspergillus
                                                                             fumigatus
                                                                             T. Stergiopoulou1, J Meletiadis2, T. J. Walsh3 and E. Roilides1
                                                                             1
                                                                              Aristotle University, Thessaloniki, Greece, 2University of Athens,
                                                                             Athens, Greece, 3National Cancer Institute, Bethesda, MD, USA
Conclusion: After repeated dosing, POS did not affect CAS or MICA
PK. In this healthy population, oral POS 400 mg BID was safe and well
tolerated when given with CAS or MICA.
                                                                             Objectives: Immunocompromised patients are at risk for both
                                                                             bacterial and fungal infections. These patients often receive immno-
                                                                             suppressive agents, such as cyclosporine A (CsA), and antifungal
                                                                             therapy concomitantly with antibacterial agents, such as fluoroqui-
                                                                             nolones. Both, antifungal agents and fluoroquinolones can exert
P280                                                                         immunomodulatory effects on human neutrophils. We, therefore,
A novel HPLC method for the measurement of posaconazole                      studied the in vitro interactions between antifungal agents and
levels in serum                                                              fluoroquinolones with or without CsA or neutrophils against C.
S. Seaton1, T. A. Vyzantiadis2, R. L. Gorton1 and C. C. Kibbler1             albicans and A. fumigatus.
1
 Royal Free Hampstead NHS Trust, London, UK, 2Aristotle                      Methods: Three clinical isolates of C. albicans and A. fumigatus were
University, Thessaloniki, Greece                                             studied in triplicate against (i) the combination of ciprofloxacin,
                                                                             levofloxacin and moxifloxacin with amphotericin B, caspofungin and
                                                                             voriconazole (or fluconazole for C. albicans) and (ii) the combination of
Objectives: Posaconazole is a comparatively new and potent triazole          ciprofloxacin with amphotericin B and CsA, using broth microdilution
antifungal with an extended broad spectrum activity. It has similar in       method. Neutrophils from healthy donors were added in the combi-
vitro activity but lower MICs against various fungi than itraconazole        nation of ciprofloxacin with amphotericin B against A. fumigatus. and
and has proved effective in cases when fungi were resistant to               hyphal damage was assessed by XTT colorimetric assay. The
itraconazole. It exhibits variable oral bioavailability and in certain       interactions were analyzed using (i) the isobolographic model for the
clinical settings, the drug concentrations in blood should be determined.    combinations of fluoroquinolones with antifungals (ii) the FIC index
The aim of this study was to develop and validate a HPLC method for          for ciprofloxacin, amphotericin B and CsA combination and (iii) the
determination of posaconazole levels in serum, for therapeutic drug          Bliss model for the combination of ciprofloxacin with amphotericin B
monitoring in a clinical mycology laboratory.                                in the presence of neutrophils.
Methods: An established HPLC method for the determination of                 Results: Synergistic interactions [interaction indices (Is) 0.69–0.83,
itraconazole levels in serum has been in service at the RFH Department       P < 0.05] were observed between amphotericin B (0.07–0.31 mg l-1)
of Microbiology for a number of years and this method was adapted for        and either ciprofloxacin (0.19–7.65 mg l-1) or levofloxacin
posaconazole measurement. The primary modification was the use of             (0.41–32.88 mg l-1) against C. albicans and A. fumigatus. Synergy (Is
itraconazole as the internal standard as posaconazole is very similar in     0.56–0.87, P < 0.05) was also found between voriconazole (0.09–
chemical structure to itraconazole. The two antifungals were prepared        0.14 mg l-1) and ciprofloxacin (0.22–11.41 mg l-1) and between
in DMSO/Methanol to obtain the respective stock solutions of 5 mg ml-        caspofungin (8.94–22.07 mg l-1) and levofloxacin (0.14–5.17 mg l-1)
1
  . Working solutions at concentrations of 10 lg ml-1 were prepared in       against A. fumigatus. Some antagonistic (Is 1.16–1.29, P < 0.05)
absolute methanol. A calibration curve with posaconazole concentra-          interactions were observed between moxifloxacin/levofloxacin and
tions of 0.1, 0.25, 0.5, 1.0, 2.5 and 4.0 lg ml-1 were used for the          fluconazole against C. albicans. Synergistic interactions against C.
analytical runs with quality control samples (QC) of 0.4, 2.0 and            albicans were observed at the combinations of amphotericin B and
5.0 lg ml-1 for the evaluation of the method. The chromatographic            ciprofloxacin and CsA. The MICs of amphotericin B were significantly
separations were achieved using a reverse phase C18 Hypersil column          decreased (FICmin = 0.13) from 0.25–0.5 to 0.15–0.03 mg l-1 at
and the HPLC system employed was an Agilent 1100 series consisting           0.095–3 mg l-1 of CsA and 0–8.5 mg l-1 of ciprofloxacin. For A.
of a binary pump, an auto-sampler and an UV detector set at 263 nm.          fumigatus, significant decreases of MICs (FICmin = 0.37 and
The mobile phase consisted of a solution of ammonium acetate buffer          FICmax = 0.52) were observed in the presence of 0.06–0.25 mg l-1,
(pH 8.0, 0.01 M) and acetonitrile (35:65 vv). Analytical runs were




                                                                                                                               Ó 2009 The Authors
112                                                               Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                             Poster Presentations



1.5–3 mg l-1 and 4.25–68 mg l-1 of amphotericin B, CsA and cipro-           P291
floxacin, respectively. Synergy was observed for the combination of          Utilization of probiotics for control the prevalence of oral
amphotericin B and PMNs against A. fumigatus growth at amphotericin         candida in patients complete dentures users
B concentrations 0.06 to 0.5 mg l-1. The triple combination of              K.H. Ishikawa, E. G. da Silva, C. R. Paula, V. H. Matsubara,
ciprofloxacin, ampothericin B and neutrophils was not more effective         D. Lopes and A.E.M. Nakamae
than the double combination of ciprofloxacin and amphotericin B.
                                                                                              ˜o           ˜o
                                                                            Universidade de Sa Paulo, Sa Paulo, Brazil
Conclusions: There are significant in vitro interactions (i) between
antifungal agents and fluoroquinolones, (ii) between amphotericin B,
ciprofloxacin and CsA against C. albicans and A. fumigatus. The              Background: The probiotic bacteria have the ability to modify the
selection of the best combination among the antifungal agents and           microbiological balance of the host and reduce the growth of
fluoroquinolones could potentially improve the outcome of a patient          pathogenic such as Candida. Elderly patients are very vulnerable to
with fungal infection. The combination of amphotericin B and                diseases caused by this yeast.
ciprofloxacin appears to be equally effective in the presence or absence     Objective: The objective of this study was demonstrated of the
of neutrophils suggesting equal efficacy in neutropenic and non-             behavior of these bacteria in humans in the control and elimination of
neutropenic patients.                                                       oral Candida in the elderly patients.
                                                                            Methods: Forty eight patients complete dentures users, uni or
                                                                            bimaxilares, were included in the research. The study was a
                                                                            randomized double-blind. In a first moment, the samples were collected
P282                                                                        by method SWAB in the region of the palate and in culture media
                                                                            Sabouraud Dextrose Agar with cloranfenicol, by 24 to 48 h, for
Efficacy of azoles against various clinical Aspergillus
                                                                            identification and quantification in colony forming units per ml (CFU/
fumigatus isolates with cyp51A mutations                                    ml) the presence of yeast. Subsequently the patients with positive
E.M. Mavridou1, R. J. Bruggemann1, W.J.G. Melchers1,
                        ¨                                                   Candida received the product A or B, A (probiotic) and B (placebo). New
J. W. Mouton2 and P. E. Verweij1                                            collections were performed the fifth and tenth weeks of product use.
1
 Radboud University Nijmegen Medical Center, Nijmegen,                      Results: The patient’s probiotic group had reduced 82% in CFU/ml
The Netherlands, 2Canisius Wilhelmina Hospital, Nijmegen,                   the presence of Candida. The results obtained with chi-square test,
The Netherlands                                                             suggested association statistical significance between the Candida and
                                                                            reduce the use of probiotics P = 0.005.
Introduction: Azole resistance in Aspergillus fumigatus (Af) has been       Conclusion: The use of probiotic may be effective in the control,
associated with substitutions in the cyp51A gene. These substitutions       prophylaxis and elimination of Candida in the oral cavity.
cause different susceptibility profiles and it is unclear if the in vitro
activity corresponds with in vivo efficacy. We investigated the
                                                                            P292
correlation between in vitro activity of posaconazole (POS) and
voriconazole (VCZ) against clinical Af isolates with L98H, G54W,            Posaconazole has superior clinical efficacy and
and M220I substitutions and in vivo survival.                               cost-effectiveness than itraconazole for antifungal
Methods: In vitro activity of VCZ and POS was determined based              prophylaxis in allogeneic stem cell transplant recipients:
on the CLSI M-38A method. A total of 36 groups (n = 11/group) of            a single-centre experience
CD-1 mice, were randomized into eight groups for the four different         R.F. Duarte1, B. Patino1, C. Munoz1, M. Arnan1, T. Peralta1,
                                                                                                 ˜           ˜
Af isolates and were infected i.v. Oral therapy with VCZ at 80, 40,         C. Gudiol1, I. Sanchez-Ortega1, R. Parody1, A. Clopes1,
                                                                                              ´                                 ´
and 10 mg kg-1 and with POS at 128, 64, 16 and 4 mg kg-1 once
                                                                                                  2
                                                                            J. L. Lopez-Belmonte , F. J. Sabater2 and A. F. de Sevilla1
                                                                                   ´
                                                                            1
daily was begun 24 h post challenge for 14 days. Control groups                             `
                                                                             Institut Catala d’Oncologia – Hospital Duran i Reynals, Barcelona,
received saline orally. Mortality data was analyzed by the long rank        Spain, 2Schering-Plough Espan Madrid, Spain
                                                                                                           ˜a,
test. Survival was determined on day 14. Additional 48 groups
(n = 3/group) have been used to determine the pharmacokinetics              Posaconazole (POSA) has shown to be superior to fluconazole and/or
(PK). PK index was determined in infected animals by collecting             itraconazole (ITRA) as antifungal prophylaxis in patients with
plasma at day 2 of treatment through the orbital vein at eight              prolonged neutropenia or GVHD. Here, we present our experience
different time points. Results were analyzed by survival curve analysis     with POSA prophylaxis during the neutropenic phase post-allogeneic
and plotting PD indices against survival and fitting the Hill equation       stem cell transplant (alloSCT). Forty nine consecutive recipients of a
with variable slope (HEVS) using Prism 5.0.                                 first alloSCT with no prior history of invasive fungal infection (IFI)
Results: The MICs of POS were: 0.031 mg l-1 (WT), 0.5 mg l-1                received either ITRA (n = 16; oral and/or iv; up to May 2007) or
(M220I and L98H) and >16 mg l-1 (G54W). For POS the AUC was                 POSA (n = 33; 200 mg 8 h-1 oral; from May 2007) for primary
strongly correlated with dose in a linear fashion from 1 to 16 mg kg-1      antifungal prophylaxis. Clinical outcome and total costs (including
(r2 = 0.99). However, higher dosages of 64 mg kg-1 resulted in a            medical resource use and drugs) were assessed for 100 days post-
slightly less linear relation (r2 = 0.92). Survival curves indicated that   alloSCT, our established antifungal prophylaxis period. Unit costs
exposure responses were obtained for all 4 strains, with increasing         were obtained from the hospital pharmacy and the Soikos database,
exposure needed to obtain the same result if the MIC was higher.            and are expressed in Euros 2008. Compared to the ITRA group, more
Survival best correlated with AUC/MIC ratio; an AUC/MIC – survival          patients in the POSA group were T-cell depleted (39% vs 0%;
plot of all four strains indicated a clear sigmoid exposure-response. The   P = 0.003), and had a trend towards an increased use of unrelated
HEVS fitted the data well with a R2 of 0.93. The ED50 was 321 (95%           donor grafts (39% vs 12%; P = 0.055) and reduced intensity
CI 222.1–573.8). The AUC – dose correlation of POS is linear for            conditioning (67% vs 37%; P = 0.053). Otherwise, age (50, 20–
dosages up to 16 mg kg-1. In case of VCZ the MICs were: 0.25 mg l-1         68), sex (61% men), disease (35 MDS-AML, 7 lymphoid, 4 CML, 3
(WT, M220I), 0.125 mg l-1 (G54W) and 2 mg l-1 (L98H).VCZ treat-             ALL), days to neutrophil engraftment (18.2 ± 7.9 days), and the
ment improved survival of the L98H M220I and G54W groups                    incidence of grade II–IV acute GVHD (33%) were similar in both
compared to controls (P < 0.001). However, compared to WT and               groups. ITRA patients received oral suspension or IV drug based on
M220I, the dose-response curve of mice infected with the G54W and           their tolerance. POSA patients had no significant problems with oral
L98H isolates were shifted to the right indicating that a higher dose       compliance or toxicity. The incidence of neutropenic fever (84%) and
was required to achieve maximum response against these strains (R2          prolonged (>72 h) neutropenic fever (27%) were comparable in both
of 0.5034, ED50 of 58, 71, Hillslope of 1, 338). Survival best correlated   groups, although the cumulative incidence of antifungal prophylaxis
with AUC/MIC ratio (R2 of 0.99, ED50 of 35.3).                              failure (i.e. change from prophylaxis to antifungal treatment) showed
Conclusion: There was a clear in vitro–in vivo correlation for POS          a trend towards a reduction in the POSA patients (15%) compared
and VCZ.                                                                    with their ITRA counterparts (31%; P = 0.144). In addition, patients
                                                                            in the POSA group had a lower cumulative incidence of proven or




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                             113
Poster Presentations



probable IFI (0% vs 13%; P = 0.036), which associated with a higher        that these fungi give rise to some diverse clinical presentations. The
probability of IFI-free survival (88% vs 56%; P = 0.002) and an            purpose of present study was to isolate and determine the causative fungi
improved probability of overall survival (88% vs 63%; P = 0.031)           of onychomycosis in the population in Tehran, Iran.
compared with ITRA patients. Total cost per patient up to day +100         Methods: Totally nail materials of 504 patients with prediagnosis of
were €46,562 in the POSA group (3% conditioning costs, 67%                 onychomycosis during 2005, were examined both with direct micros-
hospitalization and laboratory tests costs, 20% antifungal drug costs      copy observation of fungal elements in KOH preparations and culture to
and 10% other drug costs) and €45,079 in the ITRA group (6%                identify the causative agent. All samples were inoculated on (i)
conditioning costs, 73% hospitalization and laboratory tests costs,        Sabouraud dextrose agar (SDA, Merk) (ii) SDA with 5% chloramphenicol
11% antifungal drug costs and 10% other drug costs). Incremental           and cycloheximide in dublicate for dermatophyte and (iii) SDA with 5%
cost-effectiveness of POSA vs ITRA per IFI avoided was €11,858. In         chloramphenicol triplicate for mould isolation.
conclusion, our experience shows that in addition to neutropenia and       Results: Out of a total of 504 cases examined, 216 (42.8%), were
GVHD, as established by the registration trials, POSA may be superior      mycologically proven cases of onychomycosis (144 finger nails, 72 toe
to ITRA as primary antifungal prophylaxis during the early high-risk       nails). Among the positive results, dermatophytes were diagnosed in
neutropenic period after alloSCT in terms of clinical efficacy and cost-    46 (21.3%), yeasts in 129 (59.7%) and non dermatophytic mould in
effectiveness. In the absence of randomized trials with POSA in this       41(19%). Trichophyton mentagrophytes was the most common causative
indication, our single-centre study provides supporting evidence for       agent (n = 22), followed by Trichophyton rubrum (n = 13), Candida
the use of POSA for antifungal prophylaxis in this important clinical      albicans (n = 42), C. spp. (n = 56) and Aspergillus spp. (n = 21).
setting.                                                                   Conclusions: Near the half of clinical suspected fungal nail infec-
                                                                           tions is onychomycosis and yeast is responsible for most of the
                                                                           infections in Iran.
P293
Antifungal prophylaxis in acute myeloid leukemia and
high-risk myelodysplastic patients: a single centre
experience                                                                 P302
R.B. Bergantim1, I. Carvalhais1, F. Trigo1 and J. E. Guimaraes2
                                                           ˜               Epidemiological and aetiological survey of dermatophytosis
1
 Hospital S.Joa Porto, Portugal, 2Universidade do Porto, Porto,
               ˜o,                                                         over the last two decades
Portugal                                                                   M. Christofidou, S. Vamvacopoulou, E. Diaz, V. Stamouli,
                                                                           C. Bartzavali, S. Vamvakopoulou, G. Dimitracopoulos,
Invasive Fungal Infection (IFI) is an important cause of mortality and     E.D. Anastassiou and M. Christofidou
morbidity in leukemic patients undergoing intensive chemotherapy. IFI      University of Patras, Patras, Greece
prophylaxis emerges as a logical approach for these patients. From
December 2008 to date, either de novo or relapsed acute myeloid            Objectives: To determine the prevalence of dermatophytosis and
leukemia or high-risk myelodysplastic patients received primary            causal distribution in outpatients during a period of 18 years (1991–
prophylaxis with posaconazole (group 1). Before, those patients            2008).
received fluconazol (group 2) or no prophylaxis (group 3). Our aim          Methods: A total of 5971 patients with suspicion of dematophytosis
was to compare these three approaches over a 6 month period.               were examined for causative fungi. Skin scrapings, hair and nail
Patients started prophylaxis on day one of neutropenia (ANC                specimens were collected from relative anatomical sites with clinical
<500 mm3) until recovery (ANC >500 mm3 at least 3 days) and IFI            signs of infection. After a direct microscopy examination with 30%
was defined as possible/probable/proven according EORTC criteria. We        KOH, specimens were cultured on a Sabouraud Dextrose Agar with
analysed 40 patients (group 1, n = 20; group 2, n = 12; group 3 = 8)       chloramphenicol and cycloheximide and on Dermatophytes Test
with similar demographic [age, median 53 (17–73) years; 62.5%              Medium agar plates. Cultures were incubated at 25–280 °C for
female] and clinical characteristics (acute myeloid leukemia, 92.5%;       21 days. Identification of dermatophytes was based on microscopic
high risk myelodysplastic syndrome, 7.5%; de novo patients, 77.5%;         and macroscopic characteristics of colonies and on urea test.
relapsed patients 22.5%). Median duration of neutropenia was 27            Results: Analysis of all specimens examined (5971) was performed
(range 10–47) days on group 1, 19 (15–50) days on group 2 and 21           chronologically in two periods. More specifically, 2962 specimens
(10–58) days on group 3. Group 2 received filgastrim 10 ug kg-1 day-1       reflected the period 1991–1999, whereas, 3009 the period 2000–
until ANC recovery. The number of chemotherapy cycles (induction,          2008. A total of 769 specimens were found positive for dermatophytes,
consolidation and salvage) was 40 on group 1, 15 on group 2 and 24         480 (16, 2%) during the first period and 289 (9.6%) the second one.
on group 3. Possible/probable/proven IFI was diagnosed in 2/40 (5%)        During the first period Microsporum canis was isolated from 280
cycles on group 1, 5/15 (33%) cycles on group 2 and 2/24 (8%) cycles       specimens (59%), Trichophyton rubrum from 169 (35%), Trichophy-
on group3. Empyrical use of antifungal agent due to prolonged febrile      ton mentagrophytes from 19 (4%), whereas, 2% belonged to other
syndrome was necessary on 1/40 (2.5%) cycles on group 1, 1/15 (6%)         species. The respective dermatophytes isolated during the second
cycles on group 2 and 1/24 (4%) cycles on group 3. The possible/           period were: M. canis 132 (46%), T. rubrum 125 (43%), T. mentagro-
probable/proven IFI were candidemia (Candida albicans and parapsilosis)    phytes 28 (10%), whereas, 1% consisted of other species. Concerning
on group 1 and suggestive imagiologic pulmonary aspergilosis on            the sites of infection found that during the first period it was 321(67%)
groups 2 and 3. Two patients died of respiratory distress on group 3.      originated from skin scrapings, with predominant species M. canis (221
Although the small follow-up period and discrepancy on the number of       cases, 70%), 57 (12%) from hair, with predominant species M. canis
cycles by each group, these results suggest that posaconazole              (42 cases, 74%), whereas, 102 (21%) from nail scrapings, with
prophylaxis is effective in reducing the incidence of IFI in this          predominant species T. rubrum (86 cases, 84%). On the other hand,
population of patients.                                                    during the second period, there were 177 (61%) from skin scrapings
                                                                           with predominant species M. canis (104 cases, 59%), 36 (13%) from
                                                                           hair with predominant species M. canis (28 cases, 78%), and 76 (26%)
                                                                           from nail scrapings with predominant species T. rubrum (64 cases,
P301                                                                       84%). Of infected patients, 42 were children, 36 cases (86%) with tinea
Onychomycosis due to non dermatophytic mould in Tehran                     capitis due to M. canis and 6 cases with tinea corporis due to T. rubrum
J. Hashemi1, H. Hosseinjani2 and N. Nasrollahi3                            (4 cases, 9.5%) and T. mentagrophytes (2 cases, 4.5%).
1
 TUMS, Tehran, Iran, 2Pharmaco collage, Mashhad, Iran, 3Islamic            Conclusions: The prevalence of dermatophytosis seems to decreases
Azad University/tonekabon branch, Tonekabon, Iran                          during the last decade as compared to the previous one from 16.2% to
                                                                           9.6%. Isolation of M. canis also decreased from 59% to 46%, whereas,
Objectives: Onychomycosis, a common nail disorder results from             isolation of T. rubrum increased from 35% to 43%, findings that
invasion of the nail plate by a dermatophytes, yeasts or mould species     characterize developed countries. The most common form of dermat-




                                                                                                                             Ó 2009 The Authors
114                                                             Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                 Poster Presentations



ophytosis among the children remains tinea capitis due to M. canis             increasingly evident that other Non-C. albicans Candida (NCAC) spp
(100%). T. rubrum is the most frequent aetiological agent of tinea             such as C. parapsilosis are emerging as important human pathogens.
unguium (81%).                                                                 Despite the recognition of C. parapsilosis as an opportunistic pathogen
                                                                               the genetic and virulence factors that enable C. parapsilosis to cause
                                                                               disease remain poorly understood. Increased awareness of such factors
                                                                               is important to facilitate the development of more effective manage-
P304                                                                           ment strategies against this organism. Hence, the objectives of this
                                                                               study were to assess the invasive capability of C. parapsilosis in a
Stress vulnerability and life-contentedness in patient
                                                                               Reconstituted Human Oral Epithelium (RHOE) and to detect the
suffering from recurrent vulvovaginal discomfort of                            expression of SAPgenes during the invasion process.
Candida origin                                                                 Methods: Candida parapsilosis originally recovered from the oral
P. Jilek1, M. Pokorna1, L. Hajkova1, J. Spacek2, J. Kestranek2,                cavity (n = 2), vagina (n = 2), and urinary tract (n = 2) together with
V. Buchta2 and P. Klemera1                                                     C. parapsilosis ATCC 22019 were used to infect RHOE, which was
1
 Charles University, Hradec Kralove, Czech Republic, 2Charles                  incubated for 12 and 24 h. One half of the tissue was fixed in
University and University Hospital, Hradec Kralove, Czech Republic             paraformaldehyde and sectioned. The rehydrated sections (20 lm)
                                                                               were then stained with concanavalin A-Alex 594 and Hoechst nucleic
Objectives: Recurrent vulvovaginal discomfort (RVVD) caused by                 acid dye to assess C. parapsilosis colonization and invasion pattern
Candida is frequent reasons of gynecological interventions. The etiology       using Confocal Scanning Laser Microscopy (CSLM). The remaining half
of this disorder is so far ambiguous. The aim of study is to investigate       of unfixed tissue was used for RNA extraction. This RNA together with
the role of stress and life-contentedness in RVVD.                             broth culture extracts were subjected to RT-PCR targeting three
Methods: Data from women have been obtained through question-                  secreted aspartly proteinases genes (SAPP1-3).
naires with one part comprising a set of questions aimed at life               Results: CLSM revealed that all strains colonised the RHOE,
contentment and a degree of stress vulnerability. These questionnaires         although the extent was highly strain dependent as it was the
have been completed in relatively homogenous group of 329 university           morphology of the C. parapsilosis strains. After 12 h of incubation, C.
student (age 19–25 years,) with a return ratio was 82.7%. Women                parapsilosis invaded the upper three cell layers of the epithelium and it
were categorized by questionnaire data (symptoms frequency, reported           was evident some extensive epithelial damage after 24 h infection.
physician diagnosis and therapy) into three groups: obvious RVVD,              Expression of SAP genes was also strain dependent with differences
unclassable (not evaluated more) and control group without of any              found between infecting and planktonically cultured Candida. Reduced
signs of RVVD. Data were statistically analyzed by means of Student’s t-       expression of SAPP3, and increased expression of SAPP1 and SAPP2
test. The questionnaire of life satisfaction includes seven areas. Each        for infecting strains was detected.
area is evaluated by using seven questions.                                    Conclusion: This work confirmed the effectiveness of RHOE as an in
Results: The RVVD group includes 18.7% women highly vulnerable                 vitro model to study Candida virulence attributes and conclusively
to stress. There are 62.5% respondents who have displayed moderate             demonstrated that C. parapsilosis, whilst not highly invasive was able to
stress vulnerability. As for the control group, high vulnerability has been    induce significant damage to the tissue structure. SAPP1 and SAPP2
noticed in case of 12.9% respondents, whereas 68.8% respondents have           could be contributing factors in the invasion process and causing
clarified moderate vulnerability to stress. The average sum value of            RHOE damage.
responses according to the graded scale shows higher scoring for RVVD
category in comparison to the control group. This finding suggests higher
stress vulnerability of the RVVD category. Women from RVVD group are           P306
less satisfied with their life, their average value of score was 4.65 (out of   Fusarium onychomycosis: epidemiologcal and clinical
the 7-point scale) in comparison with the control group (average score         characteristics from a retrospective multicenter study
5.17). The maximal differences were found in the area that deals with          C. Hennequin1, C. Lacroix2, G. Buot3, G. Cremer1, F. Foulet3,
health. The differences were statistically significant in all seven items.      C. Viguie4, M. F. de Chauvin2, C. Bachmeyer5, O. Chosidow5 and
The most significant differences were in questions related to bodily health     C. Hennequin1
state, immunity, feelings of pain and the rate of illness. In descending       1
                                                                                         ˆpital St Antoine, Paris, France, 2APHP, Ho   ˆpital St Louis,
                                                                                APHP-Ho
order, leisure time, housing, financial situation, partnership and
                                                                               Paris, France, 3APHP, Ho   ˆpital Henri Mondor, Cre ´teil, France,
marriage, family and friends are the other areas with the biggest              4
differences we found out from data analyzed.                                    APHP, Ho  ˆpital Cochin, Paris, France, 5APHP, Hoˆpital Tenon, PARIS,
Conclusion: The results of the study revealed that women suffering             France
from recurrent vulvovaginal discomfort are more vulnerable to stress
and less well-content with various spheres of their lives. The findings         Objectives: Onychomycoses are one of the most frequent forms of
cannot prove whether reveal RVVD is the cause or the consequence of            fungal infections. They are mainly due to dermatophytes but molds
stress vulnerability.                                                          seem to be increasingly reported as causative agents, particularly
Acknowledgement: The study was supported by the Research                       Fusarium spp. However, available data on Fusarium onychomycoses
project LC531 of the Ministry of Education, Czech Republic.                    remain scarce. The aim of this study was to specify the incidence of
                                                                               Fusarium onychomycosis through a large multicenter study and to
                                                                               define their epidemiological and clinical characteristics.
P305                                                                           Methods: Dermato-mycologists from six Parisian centres were asked
Characterisation of Candida parapsilosis infection of an                       to review retrospectively data regarding the respective distribution of
in vitro reconstituted human oral epithelium                                   fungi isolated from ungual samples during the year 2006. Among
S. Silva1, M. Henriques1, R. Oliveira1, J. Azeredo1, S. Malic2 and             patients with positive culture for Fusarium, those having twice a
D. Williams2                                                                   positive pure culture were enrolled for epidemiological and clinical
1
 Minho University, Braga, Portugal, 2Cardiff University, Cardiff,              charts review.
United Kingdom                                                                 Results: Among 6355 patients seen in 2006 for suspected onycho-
                                                                               mycosis, the main etiologic agents were dermatophytes (n = 2557) and
                                                                               Candida spp (n = 141). Fusarium was isolated in 118 patients among
Objectives: A variety of Candida spp can colonise the oral mucosal             which, Fusarium onychomycosis was considered in 29 cases. There
surface and co-exist as harmless commensals. However, if the host              were 24 females and five males. The mean age was 52 ± 18 year-old.
becomes debilitated, as seen in individuals with HIV infection, diabetes       No particular predisposing factors were noted except corticosteroid
mellitus or those receiving drug therapy and broad spectrum                    therapy and diabetes mellitus found in one patient each. Three patients
antibiotics, candidosis can occur. Candida albicans is the most frequently     had a history of ungual dermatophytosis and four reported a local
isolated species from oral candidosis, although it is becoming                 traumatism. Four patients had involvement of two or more nails. Hand




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  115
Poster Presentations



and foot nails were involved in 3 and 32 cases, respectively. In the          was excellent for five isolates but one isolate was identified as Candida
latter, toe nail was involved in 21 cases. Main clinical forms included       holmii and for two isolates the profiles obtained were dubious and a
leuconychia, either superficial (n = 6) or sub-ungual (n = 11), ony-           molecular identification was necessary. Although resistance to itrac-
cholysis (n = 9) and hyperkeratosis (n = 5). Five patients had an             onazole or other azole antifungal was not observed, two isolates were
associated paronichia. The course of the disease was chronic in 17            dose-dependent susceptible to this drug (MIC = 0.25 lg ml-1). Theses
patients. The presence of irregular, vacuolated fungal elements               isolates were very susceptible in vitro to the rest of the eight antifungal
sometimes associated with chlamydospores was noted on sample                  tested, including the other four azole antifungal agents.
direct examination for all the cases. Identification of the causative          Conclusions: Saccharomyces cerevisiae vaginitis can have a difficult
species was only done for seven patients and retrieved Fusarium solani        aetiological diagnosis as conventional mycological methods and new
(n = 4) and Fusarium oxysporum (n = 3). At least six different                rapid DNA Affirm VPIII test can give results similar to those obtained
therapeutic regimens were found. They mainly included antifungal              for Candida infections.
treatment single or associated, local amphotericin B (n = 10), bifonaz-       Funding: Projects GIC07 123-IT-222-07 (Departamento de Educa-
ole (n = 3), econazole (n = 2), ciclopyroxolamine (n = 1) or systemic           ´                                ´n,
                                                                              cion, Universidades e Investigacio Gobierno Vasco), and PI061895/
terbinafine (n = 1), and chemical avulsion with urea (n = 7). Long-                                          ´n
                                                                              2006 (Fondo de Investigacio Sanitaria del Ministerio de Sanidad y
term follow-up was available for only 11 patients but failures appeared       Consumo de Espana).˜
in seven cases.
Conclusion: Fusarium onychomycoses only represent a fraction of
Fusarium isolated from nails. Careful direct examination of the nail
samples and clinical presentation may suggest the diagnosis. Further
prospective clinical trials are required regarding the high levels of         P308
therapeutic failures.                                                         Molecular analysis of cutaneus Malassezia load in Turkish
                                                                              patients with atopic dermatitis at/in different anatomical
                                                                              cites with different severities
                                                                              M. Onder1, A. Kalkanci1, C. Tevlekci1, M. A. Gurer1 and T. Sugita2
                                                                              1
                                                                               Gazi University, Ankara, Turkey, 2Meiji Pharmaceutical University,
P307
                                                                              Teikyo, Japan
Characteristics of vulvovaginitis caused by Saccharomyces
cerevisiae and antifungal susceptibility of clinical isolates
E. Echeverria-Irigoyen1, E. Eraso2, J. Cano3, M. Gomariz1,                    Objectives: Atopic dermatitis (AD) is a multifactorial disease in
J. Guarro3 and G. Quindos2                                                    which both hereditary and environmental factors play a role.
1
 Hospital Donostia, San Sebastian, Spain, 2Universidad del Paı´s              Malassezia species are also considered to be one of the factors that
Vasco, Bilbao, Spain, 3Universitat Rovira i Virgili, REUS, Spain              exacerbate AD, based on the finding that AD patients (but not healthy
                                                                              subjects) have specific serum immunoglobulin E (IgE) antibodies
                                                                              against Malassezia spp.
Vulvovaginitis caused by Saccharomyces cerevisiae has been reported           Methods: The diversity of Malassezia flora in Turkish patients with
but genital infections caused by fungi other than Candida are                 atopic dermatitis of three different clinical severities (mild, moderate, and
uncommon. At the Hospital Donostia, S. cerevisiae has been the                severe) were compared using quantitative real time polymerase chain
etiological agent of 0.23–1.16% of vulvovaginitis during the period           reaction (qRT-PCR) method. Fourthy-seven individuals with AD were
2005–2008, with an increasing trend since the first isolation in 2005.         sampled in this study. Seventy-five adult healthy individuals were also
Clinical presentation of these infections is indistinguishable from           enrolled in this study. The patients had been diagnosed with AD
vulvovaginitis caused by species of Candida and mycological diagnosis         according to the criteria of Hanifin and Rajka. The investigations were
can be difficult in a clinical laboratory.                                     conducted according to the Declaration of Helsinki Principles. OpSiteTM
Objective: To described eight episodes of acute vulvovaginitis caused         (3 · 7 cm; Smith and Nephew Medical, Hull, UK) was applied firmly to
by Saccharomyces cerevisiae and the difficulties found for a correct           lesion and non-lesion sites of the face including the neck in the AD
aetiological diagnosis.                                                       patients. The scale was weighed immediately and stored at -
Methods: Vaginal specimens were plated onto Sabouraud glucose                 20°C[[AUTHOR: 200C has been changed to -20°C. Please check.]] until
agar. Detection of microbial DNA (Candida, Gardnerella and Trichomon-         DNA extraction. DNA extraction was performed and purificated with
as) was assessed by the Affirm VPIII test (Becton-Dickinson, USA).             phenol-chloroform-isoamyl alcohol. Detection of Malassezia DNA by real-
Isolates were identified by conventional mycological methods, includ-          time PCR was conducted using the two sets of primers reported
ing growth in chromogenic agars, germ tube and chlamydoconidia                previously. Genus specific primers were designed in the internal
production, and carbohydrate assimilation using the API ATB ID32C             transcribed spacer 1 and IGS 1 regions of the rRNA gene. Fungal DNA
(Biomerieux, France). S. cerevisiae isolates identities were confirmed         were quantified using a real-time PCR assay with TaqMan probe, using
by DNA amplification with primers SC1d (5’-ACATATGAAGTAT-                      the ABI PRISM 7500 sequence detection system (Applied Biosystems,
GTTTCTATATAACGGGTG-3’) and SC1r (5’-TGGTGCTGGTGCGGATC-                        Foster City, CA, USA). We used Fischer’s exact test to compare the
TA-3’) and sequencing the large subunit (26s) ribosomal RNA gene              Malassezia DNA copy numbers between the groups. A P value of <0.05
with primers NL-1 (5’-GCATATCAATAAGCGGAGGAAAAG) and NL-4                      was considered statistically significant.
(5’GGTCCGTGTTTCAAGACGG) in a PCR assay. In vitro activities of                Results: The extent of total Malassezia colonization in the skin of 47
current (5-fluorocytosine, amphotericin B, fluconazole, itraconazole,           AD patients and 75 healthy subjects was determined using real-time
and ketoconazole) and new (caspofungin, posaconazole and vorico-              PCR. Total number of patients was 122, including 62 female, 60 male
nazole) antifungal agents were assessed by Sensititre YeastOne 8 (Trek        patients. Severity of AD was mild in nine patients, moderate in 26
Diagnostic Systems, USA). MICs were determined at the recommended             patients, and severe in 12 patients. Quantitative analysis of Malassezia
endpoints and time intervals by manufacturers and CLSI M27-A3                 colonization in the AD group and healthy control group was evaluated
document.                                                                     based on plasmid copy number in a real-time PCR assay. As for the
Results: Eight isolates of S. cerevisiae were yielded on Sabouraud            real-time PCR assay, the detection limit was between copy numbers 10
dextrose agar from seven patients with clinical diagnosis of vulvovag-        and 100. There was no statisticaly significant difference between the
initis. All patients have acute infections and one of them suffered from      AD and healthy control groups in terms of Malassezia colonization rate
three episodes by S. cerevisiae and one episode by Candida guilliermondii,    (t = 0.962, 2-tailed = 0.341). In patients with severe AD, Malassezia
during 2008 and from four previous episodes by S. cerevisiae, Candida         colonization was not different that in mild and moderate AD patients
albicans, Candida lusitaniae, and by a non identified Candida since 2004.      and healthy individuals, and the differences among them were not
Affirm VPIII test was positive with the Candida probe for all the vaginal      statisticaly significant (P = 0.409).
specimens. All isolates grew as white colonies on ChromID Candida             Conclusion: Althougt we hypothesized that the colonization rate of
(Biomerieux) and as violet colonies on Candida Chromogenic agar               Malassezia in AD patients were higher than that in healthy controls, we
(Laboratorios Conda, Spain). Identification based on API ATB ID32C             could not find any difference between the groups. Skin diseases should be




                                                                                                                                Ó 2009 The Authors
116                                                                Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                Poster Presentations



evaluated carefully in the near future for the presence of microorganisms    drugs administered to the patient. According the CLSI recommenda-
as an important factor of pathogenesis of the disease. In order to           tions for moulds (M38-A2), the following MICs were obtained:
determine the objective feature of the distribution and the character of     Voriconazole 0.5 ug ml-1, posoconazole 0.5 ug ml-1, caspofungin
Malassezia yeast on skin, more comprehensive quantitative studies            >8 ug ml-1 and anidulafungin >8 ug ml-1. The MICs for voriconazole
should be conducted by selecting subjects from various ethnic and            did not evidence a rise and, apparently, the fungus did not develop
geographical backgrounds.                                                    resistance in vitro over time. Despite these favorable findings in MIC,
                                                                             the results demonstrate that the fungus was not eradicated, a finding
                                                                             which contrasts with previous reports. Presently, the patient is being
                                                                             treated with topical and oral voriconazole and oral terbinafin and she is
                                                                             able to count fingers. The isolation of Paecilomyces lilacinus four times
P309                                                                         in the setting just described is unique in literature, as far as we know,
Report of two cases of tinea nigra in the city of Caxias do                  and does not appear to result from a change in the resistance pattern of
Sul, RS, Brazil                                                              the fungus. Rather, it suggests a peculiar relationship of the
                                                                             microorganism with the environment from where it was isolated.
B.C.A. Zoppas, F. C. Casal, C.U.T. Triaca and J. F. Fracasso
Universidade de Caxias do Sul, Caxias Do Sul, Brazil
                                                                             P311
Tinea nigra (TN) is a superficial fungal mycosis caused by a dematiaceous     Tinea pedis in patients with tinea unguium in the Athens
fungus, Hortae werneckii, which affects the palms, stratum corneum and       greater area during 2003–2008: a retrospective study
more occasionally, the soles and other body parts. It is characterized by    H. Papadogeorgakis1, K. Theodoridou1, E. Rallis2,
macules with clearly defined, brown to black, noninflammatory and              V. Athanasopoulou1, E. Frangoulis1 and E. Koumantaki1
asymptomatic hyperpigmentation. This dermatomycosis is also called           1
                                                                              ‘‘A. Sygros’’ University Hospital, Athens, Greece, 2Army General
epidermic keratomycosis, keratomicosis nigricans, pityriasis nigra and
                                                                             Hospital, Athens, Greece
microsporiosis nigra, being considered a rare fungal infection, and it
occurs most frequently in regions with tropical and subtropical climates.
This study describes two case reports of this mycosis in the palm region:    Background: Tinea pedis and tinea unguium are common in the
a 4-year-old boy who lives in the city of Caxias do Sul, RS and a female,    general population worldwide. Their clinical importance relies on the
23-year-old university student living in the city of Farroupilha, RS.        fact that they are a reservoir of chronic infection, produce esthetic
Epidemiologic and clinic issues are discussed. These are the only            disfigurement, secondary bacterial infections and usually therapeutic
described cases in the northeast region of the State of Rio Grande do Sul,   difficulties.
thus showing the rarity of the infection in this geographic area.            Objectives: The objective of this retrospective study was to specify
                                                                             the importance of tinea pedis as a risk factor of tinea unguium in
                                                                             patients in the greater Athens area during 2003–2008. All patients
                                                                             were reviewed from the records of the ‘A Sygros’ University Hospital for
P310                                                                         Skin and Venereal Diseases and the Army General Hospital in Athens,
                                                                             Greece. Both hospitals receive patients from Central Greece and the
Paecilomyces lilacinus keratitis: in vitro susceptibility and
                                                                             surrounding islands as well as from Athens.
clinical outcome
                                                                             Methods: Mycological diagnosis was based on both positive direct
M.D. Pinheiro1, R. Portugal1, J. Palmares1 and E. Pinto2                     microscopical examination with 20% potassium hydroxide and positive
1
 Hospital S. Joa Porto, Portugal, 2University of Porto, Porto,
                ˜o,                                                          culture of nail scrapings, subungal debris and skin samples from the toe
Portugal                                                                     web. A total of 705 patients with the clinical diagnosis of onychomy-
                                                                             cosis mean age 37.5 years non diabetic, non psoriatic and with no
Paecilomyces lilacinus is one of the two most common species of              obvious clinical orthopaedic disorder were studied retrospectively.
Paecilomyces genus. They occur worldwide as soil saprophytes, insect         Results: Tinea unguium was present in 41.2% of these patients.
parasites and agents of biodeterioration. In addition, they belong to a      Men were more affected (53.3%) than women. T. rubrum was the
heterogeneous group of filamentous fungi with hyaline hyphae when             prevailing cause (84.32%) with T. mentagrophytes var. interdigitale as
observed in tissue sections. This species is rarely pathogenic to            the second following agent (10.22%). E. floccosum was present in
humans, however Paecilomyces lilacinus is a well-documented agent            1.08% of the cases studied while moulds and yeasts consisted 4.38% of
of eye infection as we report in this case.                                  the aetiological agents. Tinea pedis was present in 85.9% of all studied
   A 53 year old school teacher was observed in the hospital in              cases.
February 2008, complaining of photophobia and pain in the right eye          Conclusions: The role of tinea pedis as a risk factor for tinea
for 3 months. She recalled a hit on the eye while walking in the school      unguium is obvious and in agreement with many studies worldwide.
courtyard before the symptoms began. At the hospital, a fungal               This indicates the need that patients with tinea unguium should be
keratitis was suspected and treatment with topical and oral fluconazol        screened for the presence of tinea pedis. More retrospective and
began. However, the diagnosis of fungal keratitis was established only       epidemiological studies are needed for Greece to establish the risk
in March 2008, when a sample of the cornea was cultured after the            factors in the different parts of the country with well evaluated
patient was submitted to penetrating keratoplasty for the first time.         methods for the diagnosis.
From February 2008 to March 2009, the patient was admitted to the
hospital five times and then followed up in an outpatient setting.
During this entire period of time, she was submitted three times to          P312
penetrating keratoplasty and treated with topical and oral fluconazol         Interdigital tinea pedis in the greater Athens area during
and voriconazole. Nevertheless, the same Paecilomyces lilacinus strain       2004–2008
was isolated four times from eye products (two corneas, one cornea           E. Koumantaki1, E. Rallis2, V. Athanassopolou1, K. Theodoridou1,
swab and an aquous humor sample) that had been sent to the                   E. Frangoulis1 and H. Papadogeorgakis1
microbiology laboratory. The fungus grew rapidly in chocolate and            1
                                                                              ‘‘A. Sygros’’ University Hospital, Athens, Greece, 2Army General
blood agar and Sabouraud-chloranphenicol-gentamicin as flocoose
                                                                             Hospital, Athens, Greece
white colonies, that became lilac as time passed. On microscopy, a
rough walled conidiphore, with metula densely clustered, bearing
whorls of two to four phialids, abruptly tapering to narrow necks was        Background: The prevalence of tinea pedis in the adult population
observed; the conidia were smooth and ellipsoidal. The four strains          has been rising steadily in the recent years. The most common clinical
isolated were tested for in vitro susceptibility to azoles and echinocan-    type is the interdigital type, affecting the interdigital spaces.
dins. The objective was to evaluate the hypothesis of a rise on MICs         Objectives: The objective of this study was to determine the aetiology
values and the presence or emergence of resistance to the antifungal         of tinea pedis in Greek patients in the greater Athens area during the last




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  117
Poster Presentations



five years 2004–2008. These patients were examined at the Outpatient         Conclusions: We found a high agreement of Candida isolates from
Departments of the ‘A. Sygros’ University Hospital for Skin and Venereal    sexual partners, suggesting the high possibility of sexual transmition of
Diseases and the Army General Hospital in Athens, Greece. Both              genital Candida infection. Concerning the timing of the partner visit,
hospitals receive patients from Athens and a large area from Central        partners presenting within 2 weeks after the index case seem to be
Greece and the surrounding islands.                                         more likely to test concordant. Restriction endonuclease analysis of
Methods: The assessment of these symptomatic patients was based             mitochondrial DNA is a method that provides interstrain differention
on the clinical evaluation and the microbiological analysis. As tinea       rapidly, efficiently and reproducibly. It is easy to perform, not very
pedis we had defined the presence of clinical symptoms combined with         expensive and is applicable to Candida spp other than C. albicans.
a positive direct microscopical examination and a positive culture of a
sample from the toe web and the surrounding skin collected by
scraping with a sterile scalpel.
Results: Out of 1655 symptomatic patients 640 (38.7%) were found            P314
to fulfill the above criteria. The prevalence was higher in men (58.5%)
                                                                            Oropharyngeal candidiasis: a 21-year study in a general
than in women. The aetiological agents were as follows: T. rubrum
                                                                            teaching hospital
(85.3%), T. mentagrophytes var.interdigitale (10.5%), T. tonsurans
(3.1%), E. floccosum (1.1%) and Fusarium spp. (1.0%). Corynobacterium                                   ˜          ´
                                                                            T. Pelaez, B. Gama, P. Munoz, L. Alcala, G. Ramos, R. Flores,
minutissimum was the prevailing bacterial pathogen, isolated in 160         J. Guinea and E. Bouza
cases (9.7%).                                                               Hospital Gregorio Maran ´n, Madrid, Spain
                                                                                                    ˜o
Conclusions: Dermatophytes seem to be the main cause in the
aetiology of tinea pedis interdigitalis in our study. Appropriate           Objective: Oropharyngeal candidiasis is not a life-threatening con-
therapeutic approach should be considered for these patients since          dition, however, as it can impair nutrition and progress to esophagitis,
tinea pedis is a dynamic infectious niche for tinea unguium whose           specific treatment is often required. Moreover, antifungal resistant
diagnosis and treatment present well known difficulties.                     strains have been frequently reported in adult patients. We aimed to
                                                                            evaluate the incidence, etiology and antifungal resistance patterns of
                                                                            oral candidiasis episodes over a 21-year period in a large teaching
P313                                                                        institution.
Typing of genital Candida isolates from couples using                       Methods: From 1988 to 2008, all episodes of oropharyngeal
                                                                            candidiasis were collected and divided into two periods: (P1) (1988–
mitochondrial DNA typing
                                                                            1997) and (P2) (1998–2008). Both adult and pediatric populations
C. Lisboa1, E. Ricardo1, F. Azevedo2, A. R. Costa2, T. Goncalves3,
                                                           ¸
                                                                            were analyzed. Antifungal susceptibility patterns of amphotericin B
A. G. Rodrigues3 and C. Pina-Vaz3                                           (AMB), fluconazole (FZ), itraconazole (IZ), ketoconazole (KZ), vorico-
1
 Faculty of Medicine Porto, Porto, Portugal, 2Hospital S.JoAo,
                                                             ˜
                                                                            nazole (VZ), flucytosine (FC), and caspofungin (CAS) were determined
Porto, Portugal, 3Faculty of Medicine, Coimbra, Portugal                    by Sensititre YeastOne and/or by the E-test.
                                                                            Results: A total of 3626 episodes from 3116 patients (2681 adult
Objectives: Genital candidosis is a common problem worldwide.               patients and 435 pediatric patients) were recorded. The distribution of
Despite therapeutic advances, the reservoir of infection isn’t yet fully    episodes and patients during the study period was as follows: P1(1920/
elucidated. Genital candidosis can be sexually transmitted; neverthless,    1650) and P2 (1706/1466). The incidence of oral candidiasis, in P1
its contribution to the pathogenesis of Candida spp infection remains       and P2 was, respectively, 3.12 and 2.01 cases per 1000 admissions.
unknown. Molecular strain typing is a key tool in investigation. This       The incidence of oral candidiasis in adult and pediatric patients during
study aims to compare Candida spp isolates recovered from couples           both periods was as follows: 1988–1997 (2.7/0.44) and 1998–2008
suffering from genital candidosis using mitochondrial DNA.                  (1.7/0.34). The distribution of species causing oral candidiasis in P1/
Patients and methods: Men and women attending STD clinic                    P2 was Candida albicans (77.6%/65.8%), non-albicans Candida(20.7%/
suffering from genital candidosis were recruited. The respective sexual     31.5%), and non-Candida yeasts (1.7%/2.7%). The MICs90 (lg ml-1) of
partners were offered clinical and microbiological evaluation. Partic-      460 available yeasts were as follows: AB (1), FZ (16), IZ (0.5), KZ (0.5),
ipants who had taken or applied antifungal therapy within 6 weeks           VZ (0.125), FC (0.25) and CS (0.125).
before enrollment were invariably excluded. Specimen collection             Conclusions: The global incidence of oral candidiasis decreased in
interval between the visit of the index case and the corresponding          our hospital during the study period, especially in the adult population
partner’s visit did not exceed 4 weeks. Specimens for yeast culture were    (the incedence of oral candidiasis in HIV-infected patients, during the
collected from the glans penis and inner preputial layer in men and         post-HAART period, has decreased).Most cases of oral candidiasis were
vaginal exsudate in women and cultured in CHROMagar Candida                 caused by C. albicans, although the incedence of other, more
(CHROMagar Company, Paris, France). API 20C AUX galleries                   antifungal-resistant yeasts increased during the second period. To
       ´
(BioMerieux) were additionally used to characterize Candida spp             our knowledge, this is the largest series of oral candidiasis reported to
isolates. In order to compare Candida strains a restriction endonuclease    date.
analysis of mitochondrial DNA (mtREA) with the restriction enzyme
HinfI followed by conventional electrophoresis was performed.
Results: From 44 heterosexual couples, the same Candida species
was recovered from the genital area just in 14 (31.8%). These 28
participants were aged between 16 and 51 years (mean age 32.7), all
of them assumed a single sexual partner during the last 6 months            P315
and reported sexual intercourse in the 6 days previous to specimen          Maxillary sinus fungus ball due to Rhizomucor pusillus : an
collection. All the men were uncircumcised. In seven couples both           uncommon clinical presentation of mucormycosis
members had genital candidosis and in the remaining couples just the        F. Grenouillet, C. Ridoux, F. Floret, G. Reboux, K. Bardonnet,
index case had signs and symptoms of candidosis. C. albicans was            L. Millon and L. Tavernier
isolated from 12 couples; C. glabrata and C. parapsilosis were isolated     CHU Jean Minjoz, Besancon, France
from a couple each. Comparing the mtREA patterns for Candida spp
isolates within sexual partners we found agreement of strain types in
11 couples (78.6%). C. glabrata and C. parapsilosis showed the same         Objectives: Mucormycosis are highly severe invasive infections
typing pattern. Different strain patterns of C. albicans were present in    occurring mostly in immunocompromised patients such as those with
3 couples; in such couples the timing of the partners visit had been        diabetes mellitus or with neutropenia. Non-invasive clinical manifes-
four weeks apart from the visit of the index cases. Interestingly, in       tations due to Mucorales are rarely described. Paranasal sinus fungus
concordant couples the specimen collection interval had never exceed        ball were mainly due to Aspergillus species, especially Aspergillus
2 weeks.                                                                    fumigatus. We described a case of maxillary sinus fungus ball due to




                                                                                                                              Ó 2009 The Authors
118                                                              Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                               Poster Presentations



Rhizomucor pusillus, diagnosed by PCR-sequencing of fungal rDNA             Conclusions: The prevalence of tinea pedis in Cuban top athletes is
performed on fresh ball specimen.                                           similar to those reported worldwide. Microscopy with blankophor
Case report: A 38 years-old-Caucasian woman was followed for                provides a more sensitive screening method. Isolation and identifica-
positional dizziness and headhaches. Ear and sinus computed tomo-           tion of the fungal agent is required for the diagnosis of dermatophy-
graphic was realized, showing fortuitously an isolated heterogeneous        tosis.
opacity, filing the left maxillary sinus with a tooth foreign body. She
described neither nose disorders (as obstruction, or rhinorea), nor sinus
pain or fever episodes. No immunodeficiency or diabetes mellitus was
reported. A endonasal endoscopic surgical treatment was undertaken          P321
with a head middle turbinectomy and a middle left meatotomy. The
                                                                            Rhinocerebral mucormycosis as the first presentation of
examination of the sinus showed purulent secretion and a fungus ball.
The fungus ball was removed and biopsy of the sinus mucous was              diabetes mellitus in a 48 year-old-woman
performed. The sinus was washed with physiological serum and an             F. Abbasi, M. Aghahasani, K. A. Sarhangipour and S. K. Fardkhani
Albertini drain was let in place. Microscopical direct examination of the   Shaheed Beheshti Medical University, Tehran, Iran
fungus ball showed broad, hyaline, wide-angled branching, paucisep-
tate irregular fungal hyphae and dehiscent sporangiae, without              Background: Rhinocerebral mucormycosis is a devastating, rapidly
apophyse. PCR-sequencing of D1 – D2 region of large subunit rDNA            progressive and often fatal opportunistic fungal infection predomi-
performed on fresh ball specimen culture revealed a 100% homology           nantly affecting individuals with underlying metabolic or immunolog-
with Rhizomucor pusillus. Culture on Sabouraud and Czapeck agar             ical compromise.
remained negative. The histology found an inflammatory recasting             Patients: We presented a case of rhinocerebral mucormycosis as first
mucous but no fungal invasion of mucosa. No antifungal agent was            presentation of diabetes mellitus. She had negative history of DM,
given and post-operative survey did not show any disorders, with            presentented with coryza, erythema and swelling of left periorbital area
endonasal secretions at day 23 negative for fungi by direct examina-        1 week before admission. Symptoms progressed quickly and she
tion and culture. Patient did not present precipitins against Rhizomucor    developed ptosis and chemosis and epistaxis. Paranasal CT scan showed
pusillus (only one arc with electrosyneresis). Biochemical analysis of      destrauction of left and right maxillary sinuses with exention to other
ball using atomic absorption spectrometry revealed high concentration       sinuses, nose, orbit and base of skull. Operation was done. Orbital
of zinc in ball (1.4% w/w).                                                 exenteration, debridment of intranasal mocus membrane and necrotic
Conclusion: Paranasal sinus fungus ball due to Mucorales are very           tissue was done. Despite extensive surgical debridment and medical
uncommon. Antifungal agents are not required for management of              therapy the patient expired.
patient, in absence of invasion of sinus mucosa. rDNA PCR-                  Conclusion: The diagnosis of rhinocerebral mucormycosis should
sequencing proved to be a highly sensitive and rapid method to              be considered in the clinical setting of necrotic sinusitis and acute
identify etiology of culture-negative sinus fungus ball. High levels of     neurologic deficit in diabetic patients. Early diagnosis and treatment
zinc determined in ball proved the role of tooth foreign body (zinc         are crucial factors leading to a good outcome.
eugenate) in pathogenesis of this maxillary fungus ball.                    Keywords: Mucormycosis, rhinocerebral, amphitericin-B, diabetes
                                                                            mellitus.


P316
Prevalence of tinea pedis in top athletes from Cuba                         P322
T. M. Iglesias-Hernandez1, G. F. Martınez-Machın2,
                    ´                  ´          ´                         Experimental systemic cryptococcosis in immunocompetent
M. R. Perurena-Lancha2, W. Carvajal-Veitıa1, M. Brito-Galloso3,
                                            ´                               animal model (BALB/c) and immunodeficient (BALB /c-SCID):
I. Curfs-Breuker4, J. F. Meis4 and M.T. Illnait-Zaragozı2
                                                       ´                    treatment with amphotericin B and fluconazole
1
  National Sports-Medicine Institute, Havana, Cuba, 2Instituto              E. G. da Silva, S. de Souza, C. Viani, G.C.M. Batista,
Pedro Kouri, Havana, Cuba, 3Enrique Cabrera Hospital, Havana,               V. K. Perinazzo, R. A. Prates, M. S. Ribeiro and C. R. Paula
Cuba, 4Canisius Wilhelmina Hospital, Nijmegen, The Netherlands                      ˜o
                                                                            IPEN, Sa Paulo, Brazil

Background: Tinea pedis is by far the most common fungal disease            Background: Cryptococcosis is a disseminated fungal disease that
of man. Because its high frequency, a prevalence study of this              occurs mainly in immunocompromised individuals, characterized by
pathology in high-performance athletes from Cuba was studied.               high mortality rates. This disease is caused by the yeast Cryptococcus
Method: A total of 411 sequential subjects from 30 sport disciplines        neoformans. Systemic spread from a primary focus of cryptococcal
of The National School for Athletes, Havana, Cuba were included.            infection commonly involves the central nervous system, manifested as
Clinical data and skin scrapings (feet’s free borders, soles and            meningitis or meningoencephalitis. The treatment of most infections is
interdigital region) were collected. All the specimens were examined        based on results of the sensitivity in vitro, these results may predict the
with KOH 20% and cultured on Sabouraud dextrose agar. Positive              clinical answer, and however, this answer depends on several factors
cultures were identified by conventional techniques. One hundred-            intrinsic to the antifungal the host as well as pathogen versus host
thirty skin samples were additionally microscopically examined with         interaction.
blankophor fluorescent staining.                                             Objective: This study was evaluate, the efficacy antifungal therapy
Results: The presence of fungal-like structures was detected in             of fluconazole associated with amphotericin B in experimental systemic
34.5% when samples were examined with KOH vs 37.7% when it                  cryptococcosis in immunocompetent (BALB/c) and immunodeficient
was done with blankophor. Culture was positive from 69 scrapings            (BALB/c-SCID).
(16.8%) and the identified species were Trichophyton rubrum (65.2%),         Methods: The animals were inoculated through into the tail vein.
Trichophyton mentagrophytes (15.9%), Epidermophyton floccosum (7.2%),        The treatment was initiated one day after infection, and animals were
Candida albicans, Candida krusei, Candida lusitaniae, (2.9% each one),      treated daily for fifteen days.
Rhodotorula sp. and Trichosporon beigelii (1.4% each one). Cases with       Results: The study demonstrated that immunocompetent and
signs and symptoms and/or positive direct examination when culture          immunodeficient animals, treated for thirteen days and fifteen days
was negative were considered as positive (29.4%). Cases without             respectively, survived the study period and brain tissue of these animals
clinical symptoms and signs but with positive culture, independently of     were free of Cryptococcus neoformans.
direct examination results, were considered as carriers (5.7%).             Conclusion: The present results suggest that the combination
Agreement among all the criteria was achieved in 50 cases (12.1%).          amphotericin B (1.5 lg kg-1 day-1) and fluconazole (30.0 lg kg-
Athletics and rowing were the sports with highest prevalence of tinea       1
                                                                              day-1) was effective in the treatment of cerebral cryptococcosis in
pedis (6% each).                                                            two models studied.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                 119
Poster Presentations



P323                                                                        reduce further the metabolic activity of the fungus with respect to
Effects of IL-6 on the efficacy of liposomal amphotericin B                  that observed with the most active single drug. AFG at 1 and
alone or with caspofungin for treatment of murine                           5 mg kg-1 day-1, AMB at 1 mg kg-1 day-1 and combination therapies
pulmonary Aspergillus fumigatus infection                                   prolonged the survival of neutropenic mice with invasive aspergillosis
J. Olson, D. Constable, T. Chang and J. Adler-Moore                         (P ranging from 0.0013 to 0.0165) (Figure 2). Additionally, AFG
                                                                            given at 5 mg kg-1 day-1, alone or combined with AMB, reduced the
Cal Poly Pomona, Pomona, CA, USA
                                                                            kidney fungal burden as measured by either CFU or qPCR
                                                                            (P = 0.0095). Again, the combination was not superior than the
Objectives: Cytokines of the innate immune response play a critical         most active single drug. Neither single drugs nor combinations were
role in controlling pulmonary aspergillosis and this response can be        active in brain tissues. Consistent with these data, a decreased
modulated by antifungal drugs. The present study was done to                number of fungal microabscesses was observed in kidney tissues, but
examine the immune effects of combining liposomal amphotericin B            not in brain tissues, of mice treated with AFG at 5 mg kg-1 day-1
(AmBisome, AmBi) with caspofungin (Cancidas, CS) or IL-6 for the            alone or combined with AMB. No differences in the number of fungal
treatment of Aspergillus fumigatus murine pulmonary infection.              microabscesses were observed when AMB and AFG were both given
Methods: Swiss Webster (SW, Study 1) or DBA/2 (DB, Study 2) mice            alone or in combination at 1 mg kg-1 day-1. Overall, our results
were immunosuppressed d - 3, d0, d + 2 with 6 mg kg-1 (Study 1) or          showed that the new echinocandin AFG has the potential to be used
2 mg kg-1 triamcinolone acetonide (Study 2) and challenged intrana-         as a therapeutical treatment against invasive aspergillosis. The
sally with 5.8 X 10ex7 (SW) or 7.0 X 10ex6 (DB) A. fumigatus conidia/       combination therapy of AFG with AMB did not improve the outcomes
mouse. IV dosing post-challenge was initiated at 2 h for SW and at          analysed in the present study, although antagonism was never
24 h for DB: Study 1 (treatments on d0–d5), 5% dextrose (D5W),              observed.
5 mg kg-1 AmBi, 5 mg kg-1 CS, 5 mg kg-1 AmBi + 5 mg kg-1 CS;
Study 2 (treatments on d1–d3), D5W, 10 mg kg-1 AmBi, 0.2 lg IL-6
or 10 mg kg-1 AmBi + 0.2 lg IL-6. In both studies, mice (n = 7/
group) were monitored for morbidity for 14 days. In Study 1, blood          P325
was collected (n = 5/group) 24 h after the last treatment for cytokine
                                                                            Posaconazole salvage treatment in pediatric patients: a
analysis including cIFN, IL1a, IL4, IL6, IL10, IL12, IL17, MIP1a and
TNFa. Lung tissue (n = 7/group) was collected for determination of          multicenter survey
Log10 CFU/g (CFU) 24 h after 6 treatments (Study 1) or 2 treatments         A.H. Groll1, A. Attarbaschi2, M. Duerken2, J. Garbino2, U. Kontny2,
(Study 2).                                                                  S. Luer2, R. Phillips2, J. Scholz2, T. Wiesel2, H. J. Wagner2,
Results: In Study 1, IL-6 and cIFN mean levels were significantly            B. Gruhn2 and T. Lehrnbecher2
                                                                            1
lower (P £ 0.05) for AmBi (12 ng ml-1 IL6; 52 ng ml-1 cIFN; 100%             Children’s University Hospital, Mu   ¨nster, Germany, 2Children’s
survival) or AmBi + CS (11 ng ml-1 IL6; 28 ng ml-1 cIFN; 100%               Hospital, Vienna, Austria
survival) vs CS (70 ng ml-1 IL6; 102 ng ml-1 cIFN; 0% survival). IL-6
and cIFN levels for AmBi (100% survival) and D5W (58% survival)             Background: While a pediatric dosage has not been defined,
were similar. There was also significantly lower lung fungal burden for      posaconazole is occasionally used in pediatric patients. We conducted
AmBi (2.1CFU) or AmBi + CS (2.6 CFU) vs CS (4.7 CFU) or D5W                 a multicenter retrospective survey to obtain data on pediatric patients
(4.5 CFU) (P £ 0.01). In Study 2, survival was better for AmBi (72%)        considered to require posaconazole salvage therapy.
vs D5W (0%) (P = 0.002), IL-6 treatment (14%) (P = 0.02) or IL-6 +          Methods: The survey identified 15 pts. (median age: 10 years;
AmBi (43%); there was also significantly lower lung fungal burden            range, 3.6–17.5; 9 female, 6 male) with hematologic malignancies
(P = 0.0006) for AmBi (4.1 CFU) vs IL-6 treatment (7.1 CFU), AmBi +         (10), marrow failure (one), solid tumor (one), soft tissue trauma (one),
IL-6 (6.9 CFU) or D5W (7.3 CFU).                                            CGD (one), and diabetes mellitus (one) who received posaconazole for
Conclusion: Compared to CS, AmBi generated significantly lower               proven (nine) or probable (six) invasive fungal infections [zygomycosis
proinflammatory IL-6 and cIFN levels and AmBi was more effective             (seven), mold infection (four), aspergillosis (two), chronic disseminated
than CS for treating steroid immunosuppressed A. fumigatus murine           candidiasis (two)]. Posaconazole was administered until intolerance or
pulmonary aspergillosis. The efficacy of AmBi was significantly               maximum efficacy at dosages individually determined by the respon-
decreased by the addition of exogenous IL-6.                                sible physician for refractory infection (eight), intolerance of other
                                                                            agents (one) or as best therapeutic option (six) following pretreatment
                                                                            for a median of 22 days (r, 4–319).
                                                                            Results: The 15 patients received posaconazole for a median of
P324                                                                        32 days (r, 4 to 262) as single agent (six) or in combination (nine).
Anidulafungin in combination with amphotericin B against
Aspergillus fumigatus
E. Spreghini, G. Scalise and F. Barchiesi
          `
Universita Politecnica delle Marche, Ancona, Italy

We investigated the in vitro and in vivo effects of anidulafungin (AFG)
alone and in combination with amphotericin B (AMB) against three
clinical isolates of Aspergillus fumigatus. The minimum effective
concentrations (MECs) of AFG ranged from 0.001 to 0.002 mg l-1
and were significantly lower than AMB MICs (P < 0.0001). When
the drugs where given in combination, the indifference (i.e.: fractional
inhibitory concentration index >0.50 and £4.0) was the only type of
interaction observed by the checkerboard method. MFCs values for
AFG were all >16 mg l-1, while AMB MFCs ranged from 0.5 to
2.0 mg l-1. Although the MFCs of the two drugs given in combination
were statistically lower than those yielded by AFG alone
(P < 0.0001), they were not lower than those observed for AMB
alone, indicating again an indifferent type of interaction. The
metabolic activity measured by the XTT assay (Figure 1) showed
that AFG was active, generally in a dose-dependent manner, against
conidia, but not against hyphae. The combination approach did not




                                                                                                                              Ó 2009 The Authors
120                                                              Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                 Poster Presentations



                                                                              Results: Caspofungin MICs for C. albicans and C. krusei isolates were
                                                                              0.06 and 0.25 mg l-1, respectively. PAFE for C. albicans isolates were
                                                                              >48 h. PAFE was never observed for C. krusei. Lethality of the control
                                                                              mice infected with C. albicans was >90% within 1–2 days. All used
                                                                              caspofungin regimens improved the survival (P < 0.0001). For isolates
                                                                              10920 and 4780, the most beneficial caspofungin doses were 1 mg kg-
                                                                              1
                                                                                day-1 and a single 5 mg kg-1, respectively. In case of isolate 4780
                                                                              10 mg kg-1 single caspofungin dose was the best regimen. Lethality of
                                                                              the control mice infected with C. krusei was 50–100%. The 1 mg kg-1
                                                                              daily dose significantly increased the survival for all three C. krusei
                                                                              isolates. In case of isolates 5029 and 4363 single doses of 5 and
                                                                              10 mg kg-1 caspofungin significantly increased the lethality (logrank
                                                                              test for trend: 0.0357 and 0.0034, respectively). In case of mice
                                                                              inoculated with C. krusei isolate 5029 but not with isolates 4363 and
                                                                              27393 the kidney tissue fungal burdens significantly decreased for all
                                                                              doses when compared to the untreated controls (P = 0.0204).
                                                                              Conclusions: Efficacy of the single high dose caspofungin treatment
                                                                              against Candida species may be species-dependent; long PAFE duration
                                                                              is a good predictor for efficacy.

The median daily dosage was 21 mg kg-1 (r, 4.8–33.3). In none of
patients was therapy discontinued due to adverse events. Clinical
adverse events were mostly mild to moderate and observed in 11 patients
(73%). Relevant increases in laboratory parameters to ·3 the baseline
                                                                              P327
value at end of treatment were limited to serum bilirubin (3 pts.) and        In vivo efficacy of amphotericin B, fluconazole, voriconazole
SGOT (1 pt). Complete or partial responses were observed 4/7 pts. with        and caspofungin against Candida orthopsilosis in a
zygomycosis, 3/4 pts. with invasive mold infections, 1/2 pts. with            neutropenic mouse model
invasive aspergillosis and 1/2 pts. with CDC. Altogether, 6 patients had a    L. Majoros1, J. Szilagyi1, S. Bayegan1, A. Tavanti2,
                                                                                                  ´
complete and 3 patients a partial response, accounting for an overall          ´
                                                                              A. Kemeny-Beke1, G. Kardos1, A. Adnan1 and R. Gesztelyi1
                                                                                       ´
                                                                              1
response rate of 60%. Overall survival at three months post start of            University of Debrecen, Debrecen, Hungary, 2Universita di Pisa,
                                                                                                                                      `
treatment was 73% (11/15).                                                    Pisa, Italy
Conclusion: Posaconazole displayed favorable safety and tolerance
and was useful for management of individual pediatric patients with           Objectives: Candida orthopsilosis is a newly described Candida spe-
invasive infections.                                                          cies. We determined the in vivo efficacy of amphotericin B, fluconazole,
                                                                              voriconazole and caspofungin against C. orthopsilosis.
                                                                              Methods: CP 85 and CP 25 C. orthopsilosis isolates were used in the in
                                                                              vivo experiments. BALB/c male mice were immunosuppressed with a
P326                                                                          single 200 mg kg-1 cyclophosphamide dose. In the tissue burden
Correlation between postantifungal effect and the efficacy                     experiments, mice were infected intravenously with 5–6 · 106 CFU/
of single 5 and 10 mg kg-1 caspofungin doses for treatment                    mice in a 0.2-ml volume. There were seven to eight animals in each control
of disseminated candidiasis in a neutropenic mouse model                      and treatment group. Intraperitoneal treatment with 1 mg kg-1 ampho-
                         ´     ´               ´
L. Majoros, S. Bayegan, A. Kemeny-Beke, J. Szilagyi, G. Kardos,               tericin B (Fungizone), 1, 5 and 10 mg kg-1 fluconazole (Mycosist),
A. Adnan and R. Gesztelyi                                                     6 mg kg-1 voriconazole (Vfend) and 1 mg kg-1 caspofungin (Cancidas)
University of Debrecen, Debrecen, Hungary                                     daily doses was started after 24 h after inoculation and continued for
                                                                              5 days. Drug efficacy was assessed by determining the number of CFUs per
                                                                              kidney pair. For statistical analysis we used Kruskal–Wallis test followed
Objectives: It was suggested that the efficacy of the same cumula-             by Dunn’s post testing.
tive dose echinocandins administered as a single dose is comparable to        Results: All mice survived in the experiments. Fluconazole at 1 and
the traditional regimen of smaller daily doses. This is supported by the      5 mg kg-1 doses was ineffective (P > 0.05) against both isolates (MIC
in vitro findings that echinocandins show long postantifungal effect           values were 8 mg l-1 for both). Fluconazole at 10 mg kg-1 dose,
(PAFE) duration against some Candida species.                                 voriconazole (MIC values for both isolates were 0.12 mg l-1) and
Methods: Three C. krusei (4363, 5029, 27393) and three C. albicans            amphotericin B (MIC values for CP 25 and CP 85 were 0.25 and
(17471, 10920 and 4780) clinical isolates were used in the in vitro and in    0.5 mg l-1, respectively) significantly decreased the kidney tissue
vivo experiments. MICs and PAFEs were determined for all isolates.            fungal burdens in case of both isolates (P < 0.05). Caspofungin was
BALB/c female mice were immunosuppressed with one (C. albicans) or            effective only in case of CP85 (MIC was 0.12 mg l-1 for both isolates)
two 200 mg kg-1 cyclophosphamide doses (C. krusei). In the lethality          (P < 0.001).
experiments mice were infected intravenously with 105 or 107 cfu/mice         Conclusions: C. orthopsilosis seems to possess decreased susceptibil-
in a 0.2-ml volume with C. albicans or C. krusei, respectively. Four groups   ity to fluconazole in vivo. Voriconazole and amphotericin B might be good
of ten mice for each isolate were assigned as follows: no treatment,          alternatives for invasive infections caused by C. orthopsilosis. To assess
1 mg kg-1 daily dose for 5 days, a single dose of 5, and 10 mg kg-1           the efficacy of caspofungin further studies are required.
caspofungin (Cancidas). Intraperitoneal caspofungin treatment against
C. albicans and C. krusei was started after 10 and 24 h after the
inoculation, respectively. Tissue burden experiments were performed
with C. krusei isolates, using seven to eight mice inoculated intravenously
with 1–2 · 106 CFU/mouse both in the treatment and the control                P328
group. Otherwise we used the same conditions as in the lethality              In vitro effectiveness of photodynamic therapy with low
experiments. Drug efficacy was assessed by determining the number of           potency ArGaAl laser for the elimination of Candida albicans
CFU per kidney pair. Survival of mice was described by Kaplan–Meier           in dental root canals
survival curve. To assess the efficacy of caspofungin, logrank test was        C.Y. Koga-Ito1, L. D. Oliveira1, L. P. Freitas1, C. T. Carvalho1,
performed on all groups as well as on the caspofungin treated groups          A. O. Jorge1, M. C. Valera1 and C. Silva2
                                                                              1
only. In tissue burden experiments control and treated groups were             Sa Paulo State University, Sa Jose Dos Campos, Brazil, 2Federal
                                                                                 ˜o                          ˜o      ´
compared with Kruskal–Wallis test followed by Dunn’s post testing.            University of Bahia, Vitoria Da Conquista, Brazil




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                  121
Poster Presentations



Objective: Candida albicans has been associated with refractory              tion except low dose corticosteroids (CS). Primary endpoint was global
endodontic infections. The several virulence factors of this species         success at 6 months (M6) defined as complete or partial radiological
associated to its ability to invade dentinal tubules and resistance to       response and mycological eradication. Diagnosis of CPA and response
commonly used intracanal medicaments, such as calcium hydroxide,             to VORI were confirmed by a data review committee.
may explain its association with cases of refractory root canal              Results: Forty-one of forty-eight included patients were confirmed
infections. Other factors, such as presence of Enterococcus faecalis or      CPA: 22 chronic cavitary pulmonary aspergillosis (CCPA) and 19
endotoxins, have been also related to failure of endodontic treatment.       chronic necrotizing pulmonary aspergillosis (CNPA) including 1 trache-
Antimicrobial photodynamic therapy has been cited as a promising             o-bronchial aspergillosis. A. fumigatus was isolated in all cases. Mean age
alternative for the treatment of some infections. No previous study on       was 58 (25–81) and BMI 19 (13–39). Prior underlying pulmonary
the effectiveness of this therapy on C. albicans in dental root canals is    disease was reported in 40 cases (18 COPD, 11 tuberculosis). 15 patients
found in the literature. The aim of this study was to evaluate the           received inhaled (12) and/or systemic (6) CS. By M6, global success was
effectiveness of antimicrobial photodynamic therapy (PDT) using              achieved in 13/41 (32%) (10 CNPA vs 3 CCPA, P = 0.01). Stability was
ArGaAl low potency laser with azulene in the elimination of intracanal       observed in 18 patients and progression in 1. At EOT, global success was
single-species biofilm of C. albicans ATCC18804 and multi-species             achieved in 18/41 (11 CNPA, 7 CCPA). 5 patients had died none related
biofilm (C. albicans, E. faecalis ATCC29212 and Escherichia coli              to CPA, 7 were withdrawn for safety, 1 was lost to follow-up, 3 have
ATCC25922).                                                                  relapsed.
Methods: (Ethic Committee approval 060/2005) Forty freshly                   Conclusions: VORI confirms to be an efficient drug for primary
extracted human dental roots standardized in 16 mm and properly              therapy of CPA especially in chronic necrotizing forms with an
prepared were used. The specimens were contaminated by microbial             acceptable safety profile. Chronic cavitary pulmonary aspergillosis
suspensions in vitro and incubated during 14 days. Culture medium            requires over 6 months of therapy.
was refreshed every 48 h. After the period of contamination, the
specimens were divided into two groups: PDT (n = 10 single species
biofilm, n = 10 multi-species) and control (n = 10 single species
biofilm, n = 10 multi-species). In the PDT group, teeth were instru-          P330
mented (Kerr #35–80) and then the root canal system was incubated            Caspofungin and liposomal amphotericin B used singly and
with 25% azulene gel for 5 min followed by exposure to 660-nm diode          in combination for the treatment of experimental cerebral
laser light delivered into the root canal via a 200-micro fiber.              aspergillosis
Specimens included in control group were only instrumented. Micro-           I. Ullmann, R. Strahm, S. L. Leib and S. Zimmerli
bial examination of the root canal content was performed after the end       University of Bern, Bern, Switzerland
of contamination period, immediately after the instrumentation/PDT
and after 7 days by plating method.
                                                                             Objectives: Central nervous system aspergillosis is an often fatal
Results: PDT resulted in significant lower counts of C. albicans in
                                                                             complication of invasive Aspergillus infection. Effective therapy is
relation to the control (P = 0.007) immediately after the therapy. After
                                                                             lacking. To evaluate the efficacy of antifungal drugs against Aspergillus
7 days of incubation, these counts increased in both PDT and control
                                                                             we used an established model of cerebral aspergillosis in non-
groups, with no significant difference between them (P = 0.071).
                                                                             immunosuppressed infant rats that is 100% lethal for untreated
Regarding the multi-species biofilm, the immediate effect was observed
                                                                             animals.
and evidenced by a significant reduction in relation to the control
(P = 0.044). After 7 days, the counts of C. albicans were significantly
                                                                             Methods: Eleven-day-old non-immunosuppressed male Wistar rats
                                                                             were infected by intracisternal injection of 10 ll of a conidial suspension
higher in PDT group in relation to the control (P = 0.001).
                                                                             containing 7.18 log10 colony-forming units (CFU) of Aspergillus fumig-
Conclusion: PDT was effective for immediate reduction of C. albicans
                                                                             atus. Treatment started 22 h after infection and was given once daily for
in root canals enhancing the effect of instrumentation both in single
                                                                             10 days. Regimens were Caspofungin (CAS) 1 mg kg-1 day-1 i.p.,
and multi-species biofilm testing. However, after 7 days the number of
                                                                             liposomal Amphotericin B (L-AmB) 5 mg kg-1 day-1 i.p. and both drugs
yeasts was equal to the control in both single and multi-species biofilm,
                                                                             combined at the same dosage. Infected controls were given NaCl 0.9% or
suggesting that the therapy has only superficial effect.
                                                                             glucose 5% i.p. Seriously ill animals were sacrificed for ethical reasons.
                                                                             Animals were sacrificed at predetermined time points by an overdose of
                                                                             Pentobarbital and brains were perfused with 20 ml PBS before
                                                                             homogenization and quantitative fungal culture. In survival experi-
P329                                                                         ments brains were examined at the time of death. To more closely
Voriconazole for primary therapy of proven chronic                           monitor cerebral fungal burdens, both treated and untreated animals
pulmonary aspergillosis: a prospective multicenter trial                     were sacrificed at 2, 3, 5, and 11 days after infection. Animals sacrificed
C. Hennequin1, J. Cadranel2, B. Philippe3, A. Bergeron4, E. Bergot5,         for ethical reasons were excluded from this part of the study.
P. Chanez6, V. Cottin7, T. Jeanfaivre8, C. Godet9, M. Pineau10 and           Results: (i) Survival experiments: All untreated controls (n = 14)
P. Germaud11                                                                 developed cerebral infection that resulted in death within 3–11 days.
1
 Hoˆpital Universitaire Saint-Antoine, Paris, France, 2Ho   ˆpital Tenon,    Median survival time was 4.4 days. Treatment with CAS (n = 20) alone
Paris, France, 3Ho  ˆpital Foch, Paris, France, 4Hoˆpital Saint-Louis,       and combined with L-AmB (n = 21) significantly increased survival time
                                                                             to 10.5 and 9.3 days, respectively. There was no significant difference
Paris, France, 5Ho  ˆpital Co de Nacre, Caen, France, 6Ho
                             ˆte                               ˆpital
                                                                             between treatment regimens. Cerebral fungal burden declined over time
Arnaud de Villeneuve, Montpellier, France, 7Ho      ˆpital Louis Pradel,
                                                                             in all animals including untreated ones; interestingly, there was no
Lyon, France, 8Ho   ˆpital Universitaire, Angers, France, 9Ho  ˆpital La     significant difference between controls and treated animals. (ii) Time
Miletrie, Poitiers, France, 10Pfizer Inc, Paris, France, 11Ho   ˆpital        course of cerebral fungal load: Untreated controls showed highest
Laennec, Nantes, France                                                      cerebral fungal burden on day 3 after infection (5.5 log10 CFU g-1,
                                                                             n = 6). No animals survived until day 5. In the treatment groups cerebral
Background: Antifungals are recommended for chronic pulmonary                fungal burden was highest on day 2 after infection (CAS: 5.7
aspergillosis (CPA), but prospective trials designed to evaluate the         log10 CFU g-1, n = 40; L-AmB: 5.8 log10 CFU g-1, n = 18; CAS + L-
efficacy of voriconazole (VORI) on CPA are lacking.                           AmB: 5.8 log10 CFU g-1, n = 23) and declined over time. After 10 days
Methods: From July 2005 to May 2007, a phase II open multicenter             of treatment, brain cultures were found sterile in 2/40 animals treated
trial evaluated VORI (200 mg BID) given for 6–12 months in CPA               with CAS, 1/18 animals treated with L-AmB and 2/23 animals of the
with 6 months follow-up after end of treatment (EOT). Inclusion              combination group. Again there was no significant difference in cerebral
criteria were compatible chest CT scan and/or endoscopic lesion, both        fungal burden between treated animals and controls.
positive culture of respiratory sample and serological testing for           Conclusions: CAS alone and in combination with L-AmB signifi-
Aspergillus and no antifungal within the past 6 months. Exclusion            cantly prevents mortality in a lethal model of cerebral aspergillosis.
criteria were simple aspergilloma, ABPA, immunocompromised condi-            Cerebral fungal burden, which was similar in treated and control




                                                                                                                               Ó 2009 The Authors
122                                                               Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123
                                                                                                                                  Poster Presentations



animals, does not correlate with mortality. The host’s immune reaction         Material and methods: We obtained yeast with resistance to
may thus be key in determining mortality. Experiments are ongoing to           fluconazol from pediatric patients from the hospital Fray Antonio
characterize the effects of antifungal drugs on the host’s local immune        Alcalde. The inoculum was standardized and the Minimal Inhibitory
response to cerebral aspergillosis.                                            Concentration was tested by microdilution method In RPMI medium.
                                                                               We use 20 rats of the wistar strain with a weight of 250–300 g
                                                                               previously anesthetized and catheterized at the arterial carotid 48 h
                                                                               after the rats were inoculated with a inoculum of 1.5 · 106 CFU. We
P331                                                                           evaluated two groups: one group with treatment of caspofungin and a
                                                                               second group without treatment they were sacrificed 6 days after
Resistant Candida glabrata involved in chronic vertebral
                                                                               inoculation in order to isolate vegetations for microbiological and
osteomyelitis; a case report with favorable outcome
                                                                               histological assays.
I. Anyfantis1, P. Tofas1, A. Toskas1, M. Drogari-Apiranthitou1,                Results: We got a MIC of 0.16 lg/ml for the strains obtained from
A. Stoupis2, G. L. Daikos1 and G. Petrikkos1                                   the hospital and we got a significative difference between the
1
  Research Laboratory for Infectious Diseases and Antimicrobial                hemocultures from the group without treatment and the group with
Chemotherapy ‘‘G.K. Daikos’’, National and Kapodistrian                        treatment (P < 0.05). With the culture of fibrinoids vegetations we
University of Athens, Athens, Greece, 2Athens Medical Center,                  observed a markedly difference between the groups. The group without
Athens, Greece                                                                 treatment had a mean of 5000 CFU and the rats with treatment was
                                                                               around of 25 CFU (P · 0.05), just a one rats observed some yeast by in
Introduction: Vertebral osteomyelitis due to Candida species is very           damage state.
rare. Risk factors include the presence of a central venous catheter,          Conclusion: Caspofungin has an inhibitory effect against C. albicans
antibiotic use, immunosuppression, and injection drug use. We present a        in fungal endocarditis and show the capacity of cross the barrier of the
case of a female patient with mild diabetes with chronic osteomyelitis of      vegetation.
the spinal column after spondylodesis surgery.
Case report: The patient, a 74 year old diabetic female, had under-
gone an extensive spondylodesia operation, due to degenerative
disorders of the spinal column, 3 years prior to admittance in our             P333
hospital. After having suffered several infections of the operated area        Experimental models of pulmonary aspergillosis in domestic
with MRSA and fungi, she was treated with surgical debridement and             birds
antimicrobial therapy. Despite several regimens of antifungal therapy                                                               ´ ´
                                                                               S. Thierry, G. Le Loch, E. Mazzola, A. Desouter, F. Femenia,
she developed multiple fluid collection cysts around the operated area                                                                  ´
                                                                               D. Huet, M. Deville, R. Chermette, J. Guillot and P. Arne
from which Candida glabrata was consistenly isolated. The C. glabrata          Afssa Lerpaz, Maisons-Alfort, France
strain was resistant to fluconazole, itraconazole and posaconazole and
sensitive to amphotericin B, voriconazole, caspofungin and 5-fluocyto-
sine. After complete removal of the metal parts of spondylodesis and           Aspergillosis has been described worldwide in a very large number of
treatment with liposomal amphotericinin B (L-ampB) in combination              avian species. Turkey poults in large confinement houses, quails,
with caspofongin for a month followed by a combination of L-ampB with          marine birds that are brought into rehabilitation, captive raptors, and
5- fluocytosine for over 4 months, the cysts decreased in size and cultures     penguins being maintained in zoological parks commonly die from
were negative. A new spondylodesis and drainage of the multiple cysts          aspergillosis. In turkey poults, aspergillosis leads to consequential
took place and the patient responded remarkably well after surgery. She        economic losses related to mortality, low productivity, and carcass
was released following a progressive mobilization program without any          condemnations at slaughter inspection. Aspergillosis occurs in
further antimicrobialor antifungal treatment.                                  immunocompromised birds or in birds exposed to overwhelming
Conclusions: Candida glabrata strains are usually refractory to                numbers of fungal spores. In most cases, the primary site of
several antifungals and infections are hard to treat. In our case, both        development is the respiratory tract (air sacs and lungs) but blood
surgery and antifungal therapy with L-amp B and caspofungin                    dissemination frequently occurs leading to macroscopic lesions in a
followed with combination with 5- fluocytosine proved to be a                   wide range of organs or tissues. The use of experimental models is
successful combination.                                                        required to better understand host–pathogen interactions and develop
                                                                               diagnostic and therapeutic tools. Experimental aspergillosis has already
                                                                               been described in various domestic species, especially chickens and
                                                                               turkeys. The aim of the present study was to develop avian
P332                                                                           experimental models. We tested several inoculation routes: injection
Evaluation of therapeutic effect of caspofungin in an animal                   of conidia into a thoracic air sac and inhalation of conidia. In the latter
model of infective endocarditis by candida albicans                            model, five-day-old chicks (SPF Leghorn PA12) were used and exposed
                                                                               to different concentrations of conidia. After inoculation, the number of
                                                        ´
G. Becerra, C. Rivera, A. Plascencia, F. Velarde, M. Domınguez and
                                                                               inhaled conidia was estimated by grinding of lungs and seeding onto
       ´        ´
I. Hernandez Ivan                                                              Malt medium. The number of conidia in lung was determinated
Departamento de Microbiologı´a y patologı´a, CUCS, Mexico                      immediately after inoculation and on each sacrified animals. During all
                                                                               the experimentation, the animals were maintained in filtering cages, in
Background: Candida albicans is the most isolated pathogen in                  a specific chamber in depression. All the chicks were weighed and
disseminated fungemies like endocarditis. The endocarditis involve the         examined daily from +6 to +168 hours post challenge. Observations
vegetation formation which is barrier to antimicotical to the access to        included the monitoring of clinical signs, feeding and drinking
target molecules yield fails in treatment, therefore, the endocarditis model   behaviour.
in a good systems to evaluate the efficacy of antimicrobians in adversals
conditions. Caspofungin has been proved in many disseminated
fungemias by not in endocarditis. The objective of the study was to
evaluate the inhibitory effect of caspofungin in an animal model of
infective endocarditis by C. albicans.




Ó 2009 The Authors
Journal compilation Ó 2009 Blackwell Verlag GmbH • Mycoses, 52 (Suppl. 1), 29–123                                                                    123

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:172
posted:6/11/2012
language:Latin
pages:95
liningnvp liningnvp http://
About