Docstoc

Rapid detection of causative agents of Malta Fever using .pdf

Document Sample
Rapid detection of causative agents of Malta Fever using .pdf Powered By Docstoc
					      ‫مقاله‬
     ‫نام‌نويسن ‌گان‬
        ‫د‬                                                                                                                                 ‫د‬
                                                                                                ‫مجله‌علمي‌پژوهشي‌ ‌انشگاه‌علوم‌پزشكي‌ارتش‌جمهوري‌اسالمي‌ايران‬
    ‫تحقيقاتي‬                                                                                         ‫سال‌هشتم‌‌ ‌‌شماره‌2‌‌ ‌‌صفحات‌‌58‌‌تا‌‌19‌‌ ‌‌تابستان‌9831‬




      ‫تشخيص سريع باکتريهاي مولد بيماري تب مالت با استفاده از واکنش زنجيرهاي پلي مراز‬
                        ‫4‬
                            ‫*دكتر كيوان مجيدزاده اردبيلي1، سيده زهره حسيني2، دكتر محمد سليماني3، دكتر آرش قليانچي لنگرودي‬


                ‫تاريخ‌اعالم‌قبولی‌مقاله:‌01/5/98‬                                                                  ‫8‬
                                                                                                                  ‫تاريخ‌اعالم‌وصول:‌6/4/9 ‌‬                                 ‫‌‬




                                                                                                                                                        ‫د‬
                                                                                                                                                       ‫چكي ‌ه‬
   ‫سابقه و هدف: تب مالت يك بيماري مشترک بين انسان و حيوانات مختلف است كه توسط گونههاي بروسال ايجاد ميشود.‬




                                                                                                ‫‪D‬‬
   ‫اگرچه اين بيماري بهندرت كشنده ميباشد، اما در صورت عدم تشخيص سريع و مناسب، در همه گيريها و استفاده عمدي در‬
   ‫جنگهاي بيولوژيك، صدمات شديدي به تسهيالت مراقبت پزشكي وارد ميكند. با توجه به محدوديتهايي مثل زمان طوالني،‬



                                                                                ‫‪SI‬‬
   ‫دقت پايين، حساسيت كم و نتايج مثبت و منفي كاذب در روشهاي تشخيص سنتي بروسالها، هدف از اين مطالعه طراحي روش‬
                                                                               ‫مولكولي ‪ PCR‬براي تشخيص سريع اين ارگانيسمها ميباشد.‬
   ‫مواد و روشها: ژن ‪ bcsp‬كه اختصاصي جنس بروسال ميباشد انتخاب و پرايمرهاي اختصاصي آن به كمك نرمافزار ‪Primer express‬‬
                                                              ‫‪of‬‬
   ‫0/3‪ v‬طراحي شد. براي تعيين ويژگي روش، ژنوم انواعي از باكتريهاي كنترل منفي استفاده گرديد. به منظور تعيين حساسيت و‬
                                                   ‫محاسبه حد تشخيص از كلونينگ محصوالت ‪ PCR‬در پالسميد ‪ pTZ57R/T‬استفاده شد.‬
   ‫باندي به اندازه 051 جفتباز‬          ‫‪ B.abortus‬و‪B.melitensis‬‬    ‫يافتهها: الكتروفورز محصول ‪ PCR‬ژن ‪ bcsp‬براي باكتريهاي استاندارد‬
                                           ‫‪ive‬‬

   ‫نشان داد. آزمايشات ‪ PCR‬با استفاده از ژنوم باكتريهاي كنترل منفي، هيچ باندي در ژل آگاروز ايجاد نكرد. كلونينگ محصوالت‬
                                                     ‫‪ PCR‬در وكتور ‪ pTZ57R/T‬به كمك واكنش زنجيرهاي پليمراز و توالييابي تاييد شد.‬
   ‫بحث و نتيجهگيري: پرايمر طراحي شده براي ژن اختصاصي جنس بروسال در اين روش ميتواند با حساسيت تشخيص 0051‬
                              ‫‪ch‬‬



          ‫كپي از ژنوم براي شناسايي اين ارگانيسم به كار رود و به اين ترتيب هزينه و زمان مورد نياز براي تشخيص را كاهش دهد.‬
                                                                               ‫کلمات کليدی: بروسال، تب مالت، واكنش زنجيرهاي پليمراز‬
            ‫‪Ar‬‬




‫در انسان، بروسلوزيس ميتواند به صورت طيف وسيعي از‬                                                                                                              ‫مقدمه‬
‫آلودگيهاي غيرقابل تشخيص بدون عالمت تا اندوكارديتهاي‬                             ‫جنس بروسال يك باكتري داخل سلولي اختياري و گرم منفي است‬
‫كشنده بروز پيدا كند. اگرچه عاليم بروسلوزيس انساني صرفنظر‬                        ‫كه ميتواند در گونههاي زيادي از حيوانات و در انسان بيماريزا‬
‫از سوية باكتريايي درگير مشابه هستند، شدت اين عاليم ميتواند‬                                                                                                ‫باشد (1).‬
‫بسيار متغير باشد، اغلب سويههاي ‪ B.melitensis‬عاليم شديدي توليد‬                   ‫تا كنون 6 گونة اصلي از بروسال (‪،B.suis ،B.abortus ،B.melitensis‬‬
‫ميكنند و بعد از آن شدت عاليم به ترتيب مربوط به سويههاي‬                          ‫‪ B.ovis ، B.canis‬و ‪ )B.neotomae‬و 2 گونة فرعي (‪ B.cetaceae‬و‬
‫و ‪ B.canis‬است. اغلب بيماري به صورت يك‬               ‫‪B.abortus ،B.suis‬‬           ‫‪ )B.pinnipediae‬متمايل به گونههاي جدا شده از پستانداران، در‬
‫ناتواني مزمن همراه با تب متناوب، احساس سرما، درد عضالني،‬                                                                    ‫بروسال شناسايي شده است (2).‬

                                                                                    ‫استاديار، ايران، تهران، دانشگاه علوم پزشكي آجا، دانشكده پزشكي (*نويسنده مسئول)‬     ‫1ـ‬
                                                                               ‫آدرس الكترونيك: ‪k-majidzadeh@armyums.ac.ir‬‬                 ‫تلفن: 04255958-120‬
                                                                                                                           ‫پژوهشگر، ايران، قم، دانشگاه آزاد اسالمي‬     ‫2ـ‬
                                                                        ‫استاديار، ايران، تهران، دانشگاه علوم پزشكي آجا، مركز تحقيقات بيوتكنولوژي، دكتري ميكروبيولوژي‬   ‫3ـ‬
                                                                                                         ‫پژوهشگر، ايران، تهران، مركز تحقيقات زيستفنآوري تسنيم‬          ‫4ـ‬


                                                                                                                                                     ‫‪www.SID.ir‬‬
‫سال‌هشتم‌‌ ‌‌شماره‌2‌‌ ‌‌تابستان‌9831‌ ‌شماره‌مسلسل‌03‬                                                                  ‫د‬
                                                                              ‫مجله‌علمي‌پژوهشي‌ ‌انشگاه‌علوم‌پزشكي‌ارتش‌جمهوري‌اسالمي‌ايران‬
                                                                                                                                              ‫68‬

‫آمادهسازي مراقبت براي شمار وسيعي از بيماران داراي تب مالت‬                                           ‫كسل بودن و بيقراري ظاهر ميشود (3).‬
‫ميتواند خيلي زيان بار و طاقت فرسا شود. سوم، درمان موفق‬                    ‫همچنين اغلب عفونتهاي درمان نشده ميتوانند منجر به ورمهاي‬
‫بروسلوزيس انساني نيازمند درمان آنتيبيوتيكي طوالني مدت (يعني‬               ‫چركي موضعي در اعضاي سيستم رتيكولواندوتليال و عفونت‬
‫دوكسيساكلين ‪ doxycycline‬و ريفامپين ‪ rifampin‬براي 6 هفته) است‬              ‫مفاصل شوند. بهندرت اندوكارديت (التهاب غشاي دروني قلب)،‬
‫(6) و احتمال 01-5 درصدي عود مجدد بعد از درمان وجود دارد‬                   ‫انسفاليت (التهاب مغز) و مننژيت هم اتفاق ميافتد و در موارد‬
‫(۷). در نهايت هيچ واكسن موثر و ايمني براي استفاده در انسان‬                ‫بسيار كمي (2 درصد يا كمتر) مرگ رخ ميدهد كه اغلب در اثر‬
                                               ‫در دسترس نيست (8).‬                                                        ‫اندوكارديت است (3).‬
‫به دليل شناخت عاليم باليني ضعيف، ناكافي و ناهمگون، تشخيص‬                  ‫شيوع بروسلوز در ايران هميشه باال بوده، ولي از سال 2831 به بعد‬
‫بروسلوزيس همواره نيازمند يك روش تشخيص حساس،‬                               ‫اپيدميهاي جديدي بروز كرده است. آمار ساليانه بروسلوز در ايران‬




                                                                                      ‫‪D‬‬
‫اختصاصي، سريع تكميل شونده، ارزان و ساده در طراحي و اجرا‬                   ‫با تغييراتي جزئي تا سال 8631 سير صعودي و پس از آن تا سال‬
‫هستند. اين روشها ميتوانند بسياري از محدوديتهاي روشهاي‬                     ‫3831سير نزولي طي نموده است. اين روند از سال 3831دوباره‬
‫سنتي را برطرف سازند (9). از اينرو هدف از اين تحقيق طراحي روش‬
  ‫مولكولي بر پاية ‪ PCR‬براي تشخيص گونههاي بروسال ميباشد.‬                   ‫‪SI‬‬                                       ‫رو به افزايش گذاشته است.‬
                                                                          ‫افزايش موارد تب مالت به 52هزار مورد طي سالهاي اخير در‬
                                                                          ‫كشور گزارش شده كه درنيمه نخست سال 6831، ماهيانه 3 هزار‬
                                                                 ‫‪of‬‬
                                                           ‫ش‬
                                                         ‫مواد‌و‌رو ‌ها‬    ‫مورد تب مالت به ثبت رسيده است. طبق آمار موجود در وزارت‬
 ‫باكتري‪Brucella‬‬    ‫استخراج ژنوم باکتري: در اين مطالعه از ژنوم‬             ‫بهداشت، درمان و آموزش پزشكي ميزان بروز تب مالت در سال‬
‫‪ abortus‬و ‪ Brucella melitensis‬به عنوان كنترل مثبت و از ژنوم چندين‬         ‫۷831 به 81 هزار وقوع در سال رسيده است. در سال ۷8 بيشترين‬
                                            ‫‪ive‬‬

‫باكتري منسوب و غيرمنسوب به عنوان كنترل منفي استفاده گرديد‬                 ‫بروز اين بيماري در استانهاي لرستان و آذربايجان حدود 88 تا 011‬
‫(جدول 1). ژنوم باكتريهاي مورد نظر با استفاده از كيت استخراج‬               ‫در صدهزار مورد و بعد در استانهاي مركزي، همدان و خراسان‬
               ‫‪ (CinnaGen DNA Purification kit) DNA‬استخراج شد.‬            ‫رضوي 66 تا 001 در صدهزار و كرمان، ايالم، كردستان، فارس،‬
                              ‫‪ch‬‬



‫طراحي پرايمر: ژن ‪ bcsp‬در اين مطالعه هدف گذاري شد. اين ژن‬                  ‫كرمانشاه، آذربايجان غربي و زنجان 22 تا 34 در صد هزار مورد‬
‫كروموزومي در سنتز پروتئين غشاي خارجي بروسال نقش دارد.‬                                                                       ‫ديده شده است (4).‬
‫‪Primer express‬‬    ‫پرايمرهاي ‪ rtbc F‬و ‪ rtbc R‬با استفاده از نرمافزار‬        ‫از آنجاييكه بروسال در منابع غذايي وجود دارد و موجب تب‬
              ‫‪Ar‬‬




‫0/3‪ v‬براي ژن ‪ bcsp‬بروسال طراحي شدند و به منظور بررسي نهايي‬                ‫مالت (يك بيماري ناتواني عمومي دراز مدت) در انسان ميشود،‬
‫پرايمرهاي طراحي شده و اطمينان از اختصاصي بودن آنها از سرويس‬               ‫گونههاي بروسال در گروه ‪ B‬عوامل بيوتروريسمي مركز پيشگيري‬
‫‪ BLAST‬سايت ‪(National center for biotechnology information) NCBI‬‬           ‫و كنترل بيماري قرار ميگيرند (2). بنابراين اگرچه بروسلوز انساني‬
                                                                          ‫به ندرت كشنده است و انتقال بيماري به صورت فرد به فرد نيست،‬
       ‫جدول 1- ليست باکتريهاي کنترل منفي مورد استفاده در اين تحقيق‬        ‫گونههاي بروسال به عنوان باكتري با قابليت استفاده در بيوتروريسم‬
      ‫ﻧﺎم ﻣﻴﻜﺮوارﮔﺎﻧﻴﺴﻢ‬           ‫ﺷﻤﺎره ﺳﻮﻳﻪ‬              ‫ﻣﺤﻞ ﺗﻬﻴﻪ‬                                                          ‫شناخته شدهاند (3).‬
  ‫‪Staphylococcus aureus‬‬         ‫32952 ‪ATCC‬‬                                ‫بروسال چند ويژگي پاتوژنيك و بيولوژيك دارد كه آن را به عامل‬
      ‫‪Bacillus subtilis‬‬          ‫1506 ‪ATCC‬‬                                ‫مفيدي براي جنگ ميكروبي تبديل ميكند. اول، بروسالها از طريق‬
      ‫‪Shigella sonnei‬‬            ‫0929 ‪ATCC‬‬         ‫اﻧﺴﺘﻴﺘﻮ ﭘﺎﺳﺘﻮر اﻳﺮان‬   ‫مسير تنفسي (آئروسل) بسيار مسري هستند، با يك دوز عفونتي در‬
      ‫‪Escherichia coli‬‬          ‫22952 ‪ATCC‬‬
                                                                          ‫حدود 001-01 ارگانيسم (5). دوم، بروسلوزيس انساني به طور‬
  ‫‪Klebsiella pneumoniae‬‬         ‫1887 ‪ATCC‬‬
                                                                          ‫قابل توجهي بيماري ناتوانكننده است (6)، در نتيجه تدارک و‬

                                                                                                                                    ‫‪www.SID.ir‬‬
        ‫دكتر‌كيوان‌مجيدزاده‌اردبيلي‌و‌همكاران‬                                    ‫ه‬                                                  ‫ي‬
                                                                      ‫تشخيص‌سريع‌باكتر ‌هاي‌مولد‌بيماري‌تب‌مالت‌با‌استفاده‌از‌واكنش‌زنجير ‌اي‌پلي‌مراز‬
  ‫78‬

‫‪ (Fermentase) X-gal‬باغلظت 04 ميكروگرم در ميلي ليتر، ايزوپروپيل‬                      ‫جدول 2- مشخصات پرايمرهاي مورد استفاده در اين مطالعه‬

‫با غلظت 4/83‬       ‫بتا دي تيوگاالكتوپيرانوزيد يا ‪(Fermentase) IPTG‬‬                                                           ‫ﻣﺤﺼﻮل‬
                                                                      ‫ﻧﺎم ﭘﺮاﻳﻤﺮ‬              ‫ﺗﻮاﻟﻲ )´3‪(5´‬‬                          ‫رﻓﺮﻧﺲ‬
                                                                                                                            ‫‪(bp) PCR‬‬
‫ميكروگرم در ميلي ليتر، آمپي سيلين باغلظت 001 ميكروگرم در‬
                                                                        ‫‪rtbc F‬‬     ‫‪GCTCGGTTGCCAATATCAATG‬‬
‫ميلي ليتر و تتراسيكلين باغلظت 02 ميكروگرم در ميلي ليتر كشت‬                                                                          ‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ 051‬
                                                                        ‫‪rtbc R‬‬        ‫‪GGGTAAAGCGTCGCCAGAA‬‬
                                                        ‫داده شدند.‬
‫ارزيابي اوليه كلونينگ بر اساس انتخاب كلنيهاي سفيد به عنوان‬            ‫استفاده شد. ساخت پرايمرها توسط شركت سيناژن انجام گرفت‬
‫موارد مثبت و كلنيهاي آبي به عنوان موارد كنترل منفي انجام گرفت.‬                                                                         ‫(جدول 2).‬
‫جهت تاييد موارد مثبت و منفي، پس از تهيه ماتريكس از كشتهاي‬             ‫براي‬   ‫‪rtbc R‬‬    ‫و‬   ‫‪rtbc F‬‬   ‫پرايمرهاي‬     ‫‪PCR‬‬    ‫واکنش ‪ :PCR‬واكنش‬
‫اوليه، واكنش ‪ Colony-PCR‬با شرايط ذكر شده در باال براي هر يك‬           ‫53 سيكل با برنامهي دناتوراسيون اوليه ‪ 94°C‬به مدت 2 دقيقه،‬




                                                                                     ‫‪D‬‬
‫از ژنها انجام شد. همچنين به منظور تاييد نهايي كلونهاي دريافت‬          ‫دناتوراسيون ‪ 94°C‬به مدت 54 ثانيه، دماي ‪ 66/8°C‬به مدت 54‬
‫كننده اينسرت، پس از استخراج پالسميد با استفاده از كيت ‪ACCU‬‬                            ‫ثانيه و دماي تكثير ‪ ۷2°C‬به مدت 54 ثانيه انجام شد.‬
‫،‪ Prep (Plasmid Mini extraction kit) BIONEER‬واكنش ‪ PCR‬بر روي‬
                                     ‫پالسميد استخراج شده انجام شد.‬
‫تعيين حساسيت و حد تشخيص )‪ :Limit of Detection (LOD‬پس‬
                                                                      ‫‪SI‬‬
                                                                      ‫همچنين يك واكنش 52 ميكروليتري با شرايط مشابه و استفاده از‬
                                                                       ‫آب ديونيزه به جاي ژنوم باكتري به عنوان كنترل منفي انجام شد.‬
                                                                      ‫پس از اتمام واكنش ‪ 5 ،PCR‬مايكروليتر از محصول واكنش بر روي‬
                                                           ‫‪of‬‬
‫از انجام كلونينگ قطعة مورد نظر از ژن ‪ bcsp‬ابتدا غلظت پالسميد‬          ‫ژل آگارز 1% در بافر ‪ 0/5 TBE X‬با ولتاژ 001 ولت، الكتروفورز‬
‫حاوي اينسرت با دستگاه اسپكتروفوتومتر /‪(Picodrop Microliter UV‬‬         ‫گرديد. در نهايت به منظور رويت باند مورد نظر، ژل آگاروز با‬
‫)‪ Vis Spectrophotometer‬مشخص شد، سپس جهت تعيين حساسيت‬                  ‫رنگ اتيديوم برومايد رنگ آميزي و با دستگاه ژل داک مشاهده شد.‬
                                                ‫‪ive‬‬

‫واكنش، حداقل تعداد كپي از قطعه مورد نظر كه بتواند در واكنش‬            ‫تعيين ويژگي: به منظور بررسي ويژگي پرايمرها، واكنش ‪ PCR‬با‬
‫‪ PCR‬باند واضحي ايجاد كند، مطابق روش ارائه شده توسط ‪chiang‬‬             ‫شرايط فوق بر روي ژنوم استخراج شده باكتريهاي كنترل منفي‬
                                                 ‫محاسبه گرديد (6).‬    ‫استخراج‬      ‫‪DNA‬‬     ‫انجام شد. همچنين به منظور اطمينان از قابليت‬
                               ‫‪ch‬‬



‫به اين ترتيب براي محاسبة حد تشخيص رقتهاي متوالي 1-01–‬                 ‫شده مورد استفاده در واكنش ‪ PCR‬و عدم وجود مهار كننده در‬
‫01-01 از پالسميد حاوي اينسرت با غلظت مشخص تهيه شد و پس‬                ‫آن، واكنش ‪ PCR‬بر روي ژن كروموزومي ‪ 16S rRNA‬كه در تمام‬
‫از انجام واكنش ‪ PCR‬روي رقتهاي متوالي پالسميد، كمترين رقتي‬                                                ‫باكتريها وجود دارد، انجام شد (6).‬
              ‫‪Ar‬‬




‫كه باند مشخص و واضحي را نشان داد، به عنوان حد تشخيص‬                   ‫کلونينگ محصوالت ‪ PCR‬و تهية کنترل مثبت: به منظور دستيابي به‬
                                                         ‫تعيين شد.‬    ‫يك روش تشخيص مولكولي مناسب و مطمئن، وجود كنترل مثبت‬
‫توالي يابي: پس از انجام ‪ ،PCR‬به منظور تاييد نهايي از ‪sequencing‬‬       ‫جزء مهمي محسوب ميگردد كه براي تهيه آن از روش كلونينگ‬
       ‫براي بهدست آوردن توالي محصول كلون شده استفاده شد.‬              ‫محصوالت ‪ PCR‬در وكتور مناسب استفاده شد. به اين منظور پس‬
                                                                       ‫از تكثير ژنهاي مورد نظر و خالص سازي با كيت خالص سازي‬
                                                             ‫ه‬
                                                           ‫يافت ‌ها‬   ‫)‪ ،Bioneer (AccuPrep® PCR Purification Kit‬واكنش اتصال آنها‬
‫نتايج ‪ :PCR‬الكتروفورز محصول ‪ PCR‬پرايمرهاي طراحي شده‬                    ‫‪(InsTAclone TM PCR‬‬           ‫مطابق با كيت‬           ‫‪pTZ57R/T‬‬      ‫به وكتور‬
       ‫براي ژن ‪ bcsp‬باند 051 جفتبازي را نشان داد. (تصوير 1)‬           ‫‪ Cloning Kit) Fermentase‬انجام گرفت. پس از آماده سازي باكتري‬
‫نتايج تعيين ويژگي: واكنش ‪ PCR‬مربوط به ژن ‪ ،bcsp‬در هيچ يك‬              ‫پذيراي ´‪ E. coli top 10 F‬ترانسفورماسيون انجام شد و در نهايت‬
‫از باكتريهاي كنترل منفي باندي را ايجاد نكرد، كه اين امر نشان‬          ‫باكتريهاي ترانسفورم شده در محيط ‪(QUELAB) Luria-Bertani agar‬‬

‫دهنده ويژگي واكنش ‪ PCR‬در اين مطالعه ميباشد. همچنين مثبت‬               ‫حاوي 5-برومو 4-كلرو 3-ايندوليل بتا دي گاالكتو پيرانوزيد يا‬

                                                                                                                                     ‫‪www.SID.ir‬‬
‫سال‌هشتم‌‌ ‌‌شماره‌2‌‌ ‌‌تابستان‌9831‌ ‌شماره‌مسلسل‌03‬                                                                        ‫د‬
                                                                                    ‫مجله‌علمي‌پژوهشي‌ ‌انشگاه‌علوم‌پزشكي‌ارتش‌جمهوري‌اسالمي‌ايران‬
                                                                                                                                                    ‫88‬




‫تصوير 3- نتايج واکنش ‪ PCR‬با رقتهاي متوالي پالسميد داراي اينسرت،‬
‫شماره 1 )‪ ،Ladder 100 bp (Fermentase‬شماره 11-2 رقتهاي 1-01 تا‬




                                                                                             ‫‪D‬‬
‫01- 01، شماره 21 کنترل منفي. رقت 5-01 کمترين رقتي از پالسميد داراي‬
‫اينسرت با غلظت اوليه ‪ 522 ng/µl‬ميباشد، که در واکنش 52 ميکروليتري‬
                                           ‫‪ PCR‬قابل تشخيص است.‬



‫نتايج تهيه كنترل مثبت: واكنش ‪ PCR‬بر روي پالسميد دريافت‬
‫كننده اينسرت (كنترل مثبت) در مورد ‪ bcsp‬مطابق انتظار يك باند‬
                                                                                ‫‪SI‬‬
                                                                    ‫‪of‬‬
                     ‫با طول 051 جفتباز در ژل آگارز ايجاد نمود.‬
‫نتايج تعيين حد تشخيص: آخرين رقتي از پالسميد دريافت كنندهي‬
‫اينسرت با غلظت اوليه ‪ 522ng/µl‬كه باند قابل تشخيصي ايجاد نمود،‬
                                            ‫‪ive‬‬

‫5-01 به دست آمد (تصوير 3). با توجه به نتايج حاصل و با استفاده‬
                                                                                ‫تصوير 1- نتايج واکنش ‪ PCR‬مربوط به ژن ‪ ،bcsp‬شماره 1 ‪Ladder 100 bp‬‬
‫از روش ارائه شده توسط ‪ chiang‬كمترين تعداد كپي قابل تشخيص‬                        ‫)‪ ،(Fermentase‬شماره 2 و 3 محصول ‪ PCR‬ژن ‪ ،bcsp‬شماره 4 کنترل منفي‬
‫براي ژن ‪ bcsp‬در يك واكنش 52 مايكروليتري ‪ PCR‬برابر 0051‬
                              ‫‪ch‬‬



                                                    ‫كپي تعيين شد (6).‬           ‫شدن واكنش ‪ PCR‬مربوط به ژن ‪ 16 S rRNA‬با طول 574‪ ،bp‬حضور‬
‫نتايج توالي يابي: با استفاده از مقايسه ترادف هدف بهدست آمده‬                               ‫ژنوم استخراج شده قابل ‪ PCR‬را تاييد نمود. (تصوير 2)‬
‫موجود، تطابق 001% با ترادف ژن‬             ‫‪database‬‬       ‫با‬   ‫‪sequencing‬‬   ‫از‬
              ‫‪Ar‬‬




                                                    ‫هدف مشاهده شد.‬


                                                                     ‫بحث‬
‫گونههاي بروسال باكتريهاي گرم منفي هستند كه به صورت‬
‫معمول باعث بيماري دامي ميشوند (01، 11، 21). ضربة اقتصادي‬
‫بروسلوزيس در غذاي دامها به دليل محدوديتهاي تجاري، هم‬
‫براي مالكان دام و هم براي كشورهايي كه دامها در آن قرار گرفتهاند،‬
                                             ‫اهميت زيادي دارد (31).‬
‫خون محيطي نمونة باليني اغلب روشهاي رايج براي جداسازي و‬                          ‫تصوير 2- نتايج واکنش ‪ PCR‬ژنوم باکتريهاي کنترل منفي با پرايمرهاي ‪rRNA‬‬

‫رديابي گونههاي بروسال است. در موارد حاد كه توسط ‪B.melitensis‬‬
                                                                                ‫61 ‪ ،s‬شماره 1 )‪ ،Ladder 100 bp (Fermentase‬شماره 2 کنترل منفي، شماره 7-3‬
                                                                                ‫به ترتيب نتايج ‪ PCR‬ژنوم باکتريهاي ‪Bacillus ،Staphylococcus aureus‬‬
‫ايجاد ميشوند، بازده كشت خون اغلب باال است، با كارايي كه به 0۷-‬                   ‫‪ Escherichia coli ،Shigella sonnei ،subtilis‬و ‪.Klebsiella pneumoniae‬‬

                                                                                                                                          ‫‪www.SID.ir‬‬
        ‫دكتر‌كيوان‌مجيدزاده‌اردبيلي‌و‌همكاران‬                                       ‫ه‬                                                  ‫ي‬
                                                                         ‫تشخيص‌سريع‌باكتر ‌هاي‌مولد‌بيماري‌تب‌مالت‌با‌استفاده‌از‌واكنش‌زنجير ‌اي‌پلي‌مراز‬
  ‫98‬

       ‫است كه بيماري در آن نواحي به صورت اندميك است.‬                     ‫08 درصد ميرسد (41). اما اين رقم بطور قابل مالحظهاي در موارد‬
‫6ـ عالوه بر اين موارد، واكنش متقابل با ديگر باكتريها نيز ميتواند‬         ‫مزمن بيماري كاهش مييابد، در بيماراني كه دچار عوارض جانبي‬
                                                         ‫رخ دهد.‬         ‫مثل مننژيت، اندوكارديت، التهاب مهرهها هستند و در عفونتهاي‬
‫به منظور غلبه بر برخي از محدوديتهاي تكنيكهاي معمول،‬                      ‫ايجاد شده توسط ‪ B.abortus‬و ‪ ،B.suis‬ميزان نتايج مثبت كشت در‬
‫سنجش براساس واكنش زنجيرهاي پليمراز )‪ (PCR‬به عنوان يك‬                                                           ‫نهايت 03-05 درصد است (51).‬
‫ابزار بسيار قدرتمند براي تشخيص بروسلوزيس انساني پيشنهاد‬                  ‫كمبودهاي ديگر اين روشها اين است كه كشتهاي خون يك‬
‫شدهاند. سنجش برپاية ‪ PCR‬حساس، اختصاصي، سريع تكميل‬                        ‫فرآيند زمانبر و نيازمند تمديد انكوباسيون هستند (61) و جابجايي‬
‫شونده، ارزان هنگام اجرا، ساده در طراحي و اجرا هستند و اغلب‬               ‫و كاركردن با آنها يك خطر قابل توجه براي كارمندان آزمايشگاهي‬
‫ميتوانند براي اصالح كردن نيروي كار كمتر و بازده بيشتر به‬                                                                               ‫ميباشد (۷1).‬




                                                                                        ‫‪D‬‬
‫صورت خودكار درآيند. از زمانيكه اين فنآوري براي اولين بار‬                 ‫از طرفي حساسيت تستهاي سرولوژيك از 56 درصد تا 59 درصد‬
‫گزارش شد، تستهاي ‪ PCR‬زيادي براي بروسال گسترش يافته‬                       ‫است، اما اختصاصي بودن آنها در نواحي اندميك به دليل نفوذ باالي‬
‫است. اين روشها ميتوانند بسياري از محدوديتهاي روشهاي‬
                                          ‫سنتي را برطرف سازند (01).‬
‫در سال 2991 ‪ Baily‬و همكاران براي شناسايي اختصاصي جنس،‬
                                                                         ‫‪SI‬‬                         ‫آنتيباديها در جمعيتهاي سالم كم است.‬
                                                                         ‫عالوه بر اين اغلب تستهاي سرولوژيكي به واكنش متقابل با‬
                                                                         ‫ديگر باكتريها حساس هستند، و محدوديتهاي مهمي در فاز‬
                                                              ‫‪of‬‬
‫براساس ژن رمزكنندة پروتئين 13 كيلودالوني ايمونوژن در‬                                                                          ‫ابتدايي بيماري دارند.‬
‫‪ ،B.abortus‬پرايمرهاي 4‪ B‬و 5‪ B‬را طراحي كردند. اين روش تنها‬                ‫همچنين تفسير و تعبير آنها در افرادي كه از طريق شغل در معرض‬
‫براي بروسلوزيس حيواني پيشنهاد شده بود، همچنين در اين مطالعه‬              ‫بروسال قرار گرفتهاند، در بيماراني با سابقة اخير بروسلوزيس و در‬
                                                ‫‪ive‬‬

‫‪B. abortus‬‬   ‫عليرغم حساسيت باال، تنها توانايي رديابي دوگونهي‬                                         ‫بيماري با عود مجدد بيماري سخت است.‬
‫و ‪ B. melitensis‬بررسي شده بود، پيشنهادي براي كنترل مثبت در‬               ‫در مورد بروسال شناسايي ارگانيسمهاي كشت داده شده مبتني بر‬
                                       ‫اين مطالعه ارائه نشده بود (91).‬   ‫52 ويژگي فنوتيپي، شامل سرولوژيكال تايپينگ آنتيژن ‪ A‬و ‪،M‬‬
                               ‫‪ch‬‬



‫در سال 5991 ‪ Romero‬و همكاران پرايمرهاي 4‪ F‬و 2‪ R‬را براي‬                   ‫باال، و فرآيندهاي‬       ‫2‪CO‬‬    ‫فاژ تايپينگ، نيازمندي به اتمسفر داراي‬
‫ژن ‪ 16 srRNA‬در ‪ B. abortus‬براي رديابي اختصاصي جنس بروسال‬                 ‫متابوليكي است. اما هنوز مشكالتي مرتبط با اين آزمونها وجود‬
‫‪Ochrobactrum‬‬     ‫طراحي كردند. اين روش قادر به توانايي تفكيك‬                                                                               ‫دارد، شامل:‬
              ‫‪Ar‬‬




‫‪ anthropi‬از گونههاي بروسال نبود، همچنين كنترل مثبتي براي آن‬              ‫1ـ زمان: زماني حدود 41-01روز براي كشت باكتري و تكميل‬
                                                  ‫ارائه نشده بود (01).‬                                                       ‫تستها نياز است.‬
‫در سال 5991 ‪ Leal-Klevezas‬و همكاران با استفاده از ژن پروتئين‬             ‫2ـ سالمت زيستي: براي اين آزمونها، ارگانيسمهاي زنده مورد‬
‫غشاي خارجي )2‪ (omp‬پرايمرهاي ‪ JPF‬و ‪ JPR‬را براي شناسايي‬                    ‫نياز هستند، همچنين قرار گرفتن كارمندان آزمايشگاه در معرض‬
‫بدست‬     ‫391 ‪bp‬‬     ‫اختصاصي جنس بروسال طراحي كردند، باند‬                                         ‫عوامل احتمال آلودگي را افزايش ميدهد.‬
‫آمده در اين روش نشان دهندة وجود بروسال در نمونه بود. حد‬                  ‫3ـ تعليم و تمرين: تستهاي افتراقي مورد استفاده پيچيده هستند‬
‫واكنش ‪PCR‬‬      ‫تشخيص در اين مطالعه برابر ‪ 2/5× 10 -10 µg‬در هر‬                                            ‫و به كارشناسهاي ماهر نياز دارند.‬
‫تعيين شد و ويژگي پرايمرهاي طراحي شده با انجام ‪ PCR‬بر روي‬                 ‫4ـ نتايج مبهم: شناسايي به تعيين و مشخصات ويژگيهاي‬
‫‪Yersinia ،Vibrio cholerae O1 ،Escherichia coli‬‬       ‫ژنوم باكتريهاي‬      ‫بيشماري وابسته است. كه بسياري از آنها مثل نرخ فعاليت‬
‫3:‪،Agrobacterium tumefaciens ،Rhizobiurn loti ،enterocolitica O‬‬                              ‫اورهآز در شرايط نسبي تعريف شدهاند (81).‬
‫‪ Ochrobactrum anthropi‬تاييد شد، در اين مطالعه هيچگونه كنترل‬              ‫5ـ تشخيصهاي سرولوژيكي فاقد اختصاصيبودن الزم در نواحي‬

                                                                                                                                        ‫‪www.SID.ir‬‬
‫سال‌هشتم‌‌ ‌‌شماره‌2‌‌ ‌‌تابستان‌9831‌ ‌شماره‌مسلسل‌03‬                                                                   ‫د‬
                                                                               ‫مجله‌علمي‌پژوهشي‌ ‌انشگاه‌علوم‌پزشكي‌ارتش‌جمهوري‌اسالمي‌ايران‬
                                                                                                                                               ‫09‬

                                                               ‫ه‬
                                                           ‫نتيج ‌گيري‬                        ‫مثبتي براي تاييد نمونهها ارائه نشده است (02).‬
‫باكتري ‪ Brucella‬يك مهم سالمت عمومي در نواحي جغرافيايي‬                     ‫‪ Matar‬و ديگران در سال 6991 براي اولين بار يك روش ‪ PCR‬با‬
‫است كه اين بيماري به صورت اندميك در آنها وجود دارد. همچنين‬                ‫حساسيت باال براي تشخيص بروسلوزيس انساني گزارش دادند.‬
‫ويژگيهاي زيستي بروسال و طبيعت بيماريزايي آن در انسان آن‬                   ‫اما در مطالعات آنها شمار بيماران كم و در نتيجه اطالعات باليني‬
‫را به تهديدي براي استفاده به عنوان عامل بيوتروريسمي تبديل‬                 ‫نادر بود و تنها در يكي از بيماران بروسلوزيس از نظر باكتريولوژي‬
                                                       ‫كرده است (2، 3).‬                                                            ‫تاييد شد (01).‬
‫به دليل تظاهرات باليني ضعيف و مشابه با ديگر بيماريها،‬                     ‫با توجه به اين ويژگي كه تمامي گونههاي بروسال كه بيماريزاي‬
‫محدويتهاي كشت و حساسيت كم روشهاي تشخيص‬                                    ‫انساني هستند، بيماري تب مالت را در انسان ايجاد ميكنند و‬
‫سرولوژي، وقت گير، پرخطر و پرهزينه بودن روشهاي معمول‬                       ‫همچنين از آنجاييكه بروسالها از نظر ژنتيكي بسيار مرتبط با هم‬




                                                                                       ‫‪D‬‬
‫تشخيصي و با توجه به ضرورت روشهاي تشخيصي سريع براي‬                         ‫هستند (91، 02)، شناسايي بروسال در سطح گونه براي درمان اوليه‬
‫بروسال و ماهيت بالقوه باكتري براي استفاده بيوتروريسمي، بررسي‬              ‫بروسلوزيس انساني ضروري نيست، در اين مطالعه از ژن اختصاصي‬
‫روشهاي تشخيص دقيق و سريع براي كنترل اين بيماري به‬
                           ‫خصوص در همهگيريها حياتي ميباشد.‬
‫ژن ‪ bcsp‬مورد هدف در اين مطالعه يك ژن كروموزومي ميباشد‬
                                                                          ‫‪SI‬‬         ‫جنس ‪ bcsp‬براي رديابي گونههاي بروسال استفاده شد.‬
                                                                          ‫ژن ‪ bcsp‬اختصاصي جنس ميباشد، در تمامي گونهها بروسال وجود‬
                                                                          ‫داشته و ميتواند براي رديابي و تشخيص سريع در نمونههاي‬
                                                                ‫‪of‬‬
‫(01). با توجه به رديابي ‪ 1/5 × 10-80 µg‬از ژنوم در هر واكنش ‪PCR‬‬            ‫حيواني و انساني استفاده شود. همچنين روش ارائه شده بسيار‬
‫و تاييد اختصاصي بودن پرايمرها با استفاده از ژنوم ديگر باكترها،‬            ‫كه از نظر‬    ‫‪Ochrobactrum anthropi‬‬        ‫اختصاصي بوده و با ژنوم‬
‫روش طراحي شده در مقايسه با مطالعات قبلي حساسيت و ويژگي‬                    ‫ژنتيكي بسيار مشابه گونههاي بروسال ميباشد، واكنش متقابل‬
                                            ‫‪ive‬‬

‫بااليي داشته و استفاده از آن ميتواند بر محدوديتهاي روشهاي‬                                                                          ‫نميدهد (12).‬
                  ‫رايج مورد استفاده در تشخيص بروسال غلبه كند.‬             ‫اختصاصي بودن پرايمرهاي طراحي شده، با انجام ‪ PCR‬بر روي‬
                                                                          ‫ژنوم باكتريهاي منسوب و غيرمنسوب در اين مطالعه تاييد شد.‬
                              ‫‪ch‬‬



                                                            ‫پيشنهادات‬     ‫ميزان حساسيت ‪ PCR‬حاضر كه با استفاده از روش ‪ Chiang‬بهدست‬
‫با توجه به محديتهاي روش ‪ PCR‬و زمانبر بودن آن در مقايسه با‬                 ‫آمده، توانايي رديابي 0051 كپي از ژنوم را در يك واكنش ‪ PCR‬دارد‬
‫‪ Real-time PCR‬و اهميت تشخيص سريع باكتري در موارد همهگيري‬                  ‫كه اين مقدار در مقايسه با ديگر روشهاي ارائه شده براي رديابي‬
              ‫‪Ar‬‬




‫و جنگهاي بيولوژيك، طراحي روش تشخيص بروسال با استفاده‬                                     ‫بروسال حساسيت باالي روش را تاييد ميكند (02).‬
                                  ‫از ‪ Real-time PCR‬پيشنهاد ميشود.‬


‫‪References‬‬
‫-1‬   ‫.‪Cloeckaert A, Grayon M, Grepinet O, Boumedine K‬‬                          ‫.6332 - 5232 :)22(253 ;5002 .‪N Engl J Med‬‬
     ‫‪Classification of Brucella strains isolated from marine‬‬              ‫-4‬   ‫16071=‪http://www.pezeshk.us/?p‬‬
     ‫‪mammals‬‬        ‫‪by‬‬    ‫‪infrequent‬‬     ‫‪restriction‬‬     ‫‪site-PCR‬‬   ‫‪and‬‬   ‫-5‬   ‫‪Kaufmann AF, Meltzer M and Schmid G P. The economic‬‬
     ‫‪development of specific PCR identification tests. Microbes‬‬                ‫-‪impact of a bioterrorist attack: are prevention and post‬‬
     ‫.206 - 395 :)7(5 ;3002 .‪Infect‬‬                                            ‫‪attack intervention programs justifiable? Emerg. Infect‬‬
‫-2‬   ‫‪Cloeckart A, Verger J M, Grayon M, et al. Classification‬‬                  ‫.49–38:3 ;7991.‪Dis‬‬
     ‫‪of Brucella spp. isolated from marine mammals by DNA‬‬                 ‫-6‬   ‫.‪Chiang, YCH, Yang CH, Ho YCH, Lin CH. Tsen H.Y‬‬
     ‫;1002.‪polymorphism at the omp2 locus, Microbes Infect‬‬                     ‫‪Identification of Bacillus spp, Escherichia coli, Salmonella‬‬
     ‫.837–927:3‬                                                                ‫‪spp. Staphylococcus spp. and Vibrio spp. with16S ribosomal‬‬
‫-3‬   ‫‪Pappas G, Akritidis N, Bosilkovski M, Tsianos E. Brucellosis‬‬              ‫‪DNA-based oligonucleotide array hybridization. International‬‬


                                                                                                                                     ‫‪www.SID.ir‬‬
          ‫دكتر‌كيوان‌مجيدزاده‌اردبيلي‌و‌همكاران‬                                 ‫ه‬                                                  ‫ي‬
                                                                     ‫تشخيص‌سريع‌باكتر ‌هاي‌مولد‌بيماري‌تب‌مالت‌با‌استفاده‌از‌واكنش‌زنجير ‌اي‌پلي‌مراز‬
     91
      Journal of Food Microbiology 2006;107, 131-137                      20:1241–1249.
7-    Boschiroli M L, Ouahrani-Bettache S, Foulongne V, et al.       15- Colmenero JD, Reguera JM, Martos F, Sanchez-Mora D,
      Type IV secretion and Brucella virulence, Vet. Microbiol.           Delgado M, Causse M, Martín Farfán A, and Juárez C.
      2002;90:341–348.                                                    Complications associated with Brucella melitensis infection:
8-    Hall WH.Modern chemotherapy for brucellosis in humans               A study of 530 cases. Medicine (Baltimore). 1996;75:195–
      Rev Infect. Dis.1990; 12:1060–1099.                                 211.
9-    Hall WH. History of Brucella as a human pathogen in            16- Yagupsky P. Detection of Brucellae in blood cultures. Jclin
      Brucellosis: Clinical and Laboratory Aspects (EJ Young and          Microbiol.1999; 37: 3437–3442.
      M J Corbel, eds) CRC Press, Boca Raton, FL 1989;1–9.           17- Yagupsky P, Peled N, Riesenberg K, and Bana M. Exposure
10- López-Goñi I, Moriyón I, Brucella Molecular and Cellular              of hospital personnel to Brucella melitensis and occurrence
      Biology, Universidad de Navarra, Pamplona, Spain, 2005.             of laboratory-acquired disease in an endemic area. Infect.
11- Chiang, Y.CH. Yang, CH. Ho, Y.CH. Lin, CH.K. Tsen, H.Y.               Dis;2000: 31–35.
      Identification of Bacillus spp., Escherchia Coli, Salmonella   18- Alton G, Jones LMand PietzDE. Laboratory techniques in
      spp. Staphylococcus spp. and Vibrio spp. with 16S                   brucellosis Monograph series. World Health Organization,




                                                                                    D
      Ribosomal DNA-Based Oligonucleotide Array Hybridization.            Geneva, Switzerland. 1975.
      International Journal of Food Microbiology 2006;107:           19- Rajashekara G, Eskra L, Mathison A, Petersen E, Yu Q,
      131–137.                                                            Harms J, Splitter G. Brucella functional genomics and host-
12- United States Department of Health and Human Services
      a 42 CFR Part 1003 Possession use and transfer of select
      agents and toxins Fed Reg.2002; 240:76886–76905.
13- Nicoletti P. Relationship between animals and human
      disease in Brucellosis: Clinical and Laboratory Aspects
                                                                     SI   pathogen interactions. Anim Health Res Rev. 2006; 7(1-2):
                                                                          1–11.
                                                                     20- Diana sara leal-klevezas et al, Single-Step PCR for
                                                                          Detection of Brucella spp. from Blood and Milk of Infected
                                                                          Animals, Journal of clinical microbiology.1995; 3087–3090.
                                                          of
      (Young EJand M J Corbel eds.) CRC Press, Boca Raton,           21- Falguni M, Jainendra J, Vipul P, Mrinalini N. Multiple genus-
      FL.1989;41–51.                                                      specific markers in PCR assays improve the specificity and
14- Ariza J, Correidora J, Pallarés P, Viladrich PF, Rufi G,              sensitivity of diagnosis of brucellosis in field animals. Journal
      Pujol M, and Gudiol F. Characteristics of and risk factors          of Medical Microbiology. 2007;56:1309–1316.
                                                  ive

      for relapse of brucellosis in human. Clin Infect Dis.1995;
                                 ch
                Ar




                                                                                                                                    www.SID.ir
                                                                           JAUMS        Volume 8      Number 2       Summer 2010
  15




       Rapid detection of causative agents of Malta Fever using
                     Polymerase Chain Reaction
                        Majidzadeh K; MD1, Hosseini SZ2, Soleimani M; MD3, Ghalyanchi A4


                       Received: 27 Jun 2010                                         Accepted: 1 Aug 2010


Abstract




                                                                                  D
   Background: Malta fever is a zoonosis that it’s causative agent is Brucella species. Although the disease
is rarely fatal, but in natural epidemics or probable biologic wars, it’s rapid and proper indiscrimination will




                                                                      SI
scathe medical supplies drastically. Drawbacks of traditional diagnostic methods are time consuming, less
accurate, less sensitive and contain false positive results. So the aim of this study is to design the PCR
method for rapid detection of the organism.
   Materials and Methods: Genus specific bcsp target gene was selected for primer designing using Primer
                                                        of
express v3.0 software. Specificity of the PCR tests was determined using reactions containing various
bacterial negative control genomes. For evaluation of sensitivity and limit of detection, the PCR products
were cloned in pTZ57R/T plasmid and used from their serial dilutions.
                                      ive

   Results: Electrophoresis of bcsp gene PCR product showed a single 150 bp band for B.abortus and
B.melitensis. PCR tests using negative control bacterial genomes were not showed detectable bands after
gel agarose electrophoresis. The cloning processes were confirmed by PCR and sequencing.
   Conclusion: This method can be used for genus detection of the pathogen Brucella. and, it reduces time
                         ch



and cost needed for the organisms detection.
   Keywords: Brucella spp., Malta Fever, PCR, bcsp
            Ar




1- (*Corresponding Author) Assistant Professor, Army University of Medical Sciences, Faculty of Medicine, Tehran, Iran.
   Tel: 021-85955240      E-mail: k_majidzadeh@armyums.ac.ir
2- Researcher, Azad University, Ghom, Iran.
3- Assistant Professor, Army University of Medical Sciences, Tehran, Iran.
4- Researcher, Tasnim Research Center, Tehran, Iran.


                                                                                                                          www.SID.ir

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:42
posted:5/23/2012
language:Arabic
pages:8
wangnuanzg wangnuanzg http://
About