En r�sum� by 84DjVq

VIEWS: 56 PAGES: 95

									 Génétique

               Cours 1 DCEM1
Brigitte Benzacken ; Cytogénétique GHU Nord
   Marion Gérard ; Génétique Robert Debré
Bénédicte Gérard; Biologie Moléculaire RDebré

                                                1
  Génétique DCEM1 2008


Généralités :   Modes de transmission

           Mucoviscidose
        Myopathie de Duchenne
              X Fragile
                                        2
   Maladie génétique...

 Recouvre    de nombreux aspects
   Chromosomique
        Rappel: sur un chromosome, il y a entre 400 et 10 000 gènes !!
   Mendélienne
        Rappel: il y a environ 4000 maladies mendéliennes
         monogéniques répertoriées
   Moléculaire
      Séquençage du génome terminé (90% euchromatine)
      Nombre de gènes estimés 26 000 à 31 000

                                                                     3
   Patrimoine génétique
 Dans    le noyau
   46   chromosomes
     Molécule       d ’ADN replié très serrée !!!
           Filament long +++
           Reployé en boucles resserrées, qui s’ouvrent au moment
            de la réplication de l’ADN
     Chromosomes         visibles dans le noyau pendant la
         mitose
             Initialement décondensés
                 Puis compactés


                                                                     4
5
6
   Chromosomes et gènes...
 46   chromosomes
   30   000 gènes
        Pour   un gène, deux allèles
           1 hérité du père
           1 hérité de la mère

        1300  en moyenne
         par chromosome…
   Bandes
        Sombres,   riches en gènes

                                        7
ADN reployé +++




                  8
   Mutations
 Bases   ATCG
   Séquence       normale
     CCCTTTTAAAGTGTGTCCCAAAA



   Séquence       mutée
     CCCTTTTAAAGTGAGTCCCAAAA
             Protéine ne fonctionne plus...




                                               9
   En résumé
 46 chromosomes
 30 000 gènes
 Plus de 1000 gènes par chromosomes
   Pas   la même résolution
        Étudedes chromosomes (caryotype)
        Recherche de maladie génétique




                                            10
      Impact des maladies génétiques
 Individus     atteints
   Malformation   majeure pour 2-3% de chaque grossesse
    (d’où surveillance échographique en France)
      Fentes labiales ou labiopalatines 1/600
      Malformation cardiaque             1/250
      Défaut de fermeture du tube neural 1/500

   Anomalies     chromosomiques 0.7%
      Majorée   par l ’âge maternel
 Majorité   d’enfants « normaux » !!, 96,3%
                                                   11
   Fardeau génétique
 Nous   sommes tous des hétérozygotes !!
   Porteurs    sains d’une ou plusieurs mutations
      Selon   les publications
            1,4 à 4-5 gènes mutés par individu
                Maladies rares 1/100

                1/25 mucoviscidose

                1/7 à 1/5 pour la Fièvre Méditerranéenne (Sous-groupe)

      Risque pour la descendance estimé à 1%
      (toutes maladies génétiques confondues)
 Éradiquer      les mutations ? impossible ...
                                                                   12
   Hérédité récessive
 Deux   parents hétérozygotes sains
   Un   gène normal, un gène muté


 Transmission   des deux gènes mutés à un
 enfant sur 4
   Homozygote    malade



                                             13
Hérédité récessive




                     14
Hérédité récessive




                     15
Hérédité récessive




                     16
 Exemples de maladies
 récessives

Mucoviscidose
Drépanocytose
Hyperplasiecongénitale des surrénales
Phénylcétonurie




                                         17
Histoire clinique




                    18
ATCD familiaux




                 19
   Exemple :
   Mucoviscidose

 Maladie      génétique fréquente
   Récessive
     1/2500 naissances
       1/25   hétérozygotes
   Maladierespiratoire et digestive
   Gène CFTR
       Chromosome     7, bras court, 27 Exons

                                                 20
             Mucoviscidose

   Affection génétique à transmission
         Autosomique récessive

  1 enfant atteint sur 2500 naissances
porteur hétérozygote: 1 individu sur 25

fréquence variable selon les populations:
         Bretagne celtique: 1/1600
        population d'Afrique du Nord: rare
         population asiatique: exceptionnel
                                              21
5'                                                                                               3'
     1 2 3 4 5 6a 6b 7 8 9 10 11 12       13        14a 14b 15 16 17a 17b 18 19 20 21 22 23 24




NH2
                                                                                         COOH

            domaines      NBF1         Domaine R               domaines          NBF2
        transmembranaires                                  transmembranaires


       Domaine
       extracellulaire

         Membrane                              N
         plasmique
                                      C      NBF2


        Cytoplasme
                                      NBF1          domaine R


                                                                                        22
CFTR glycoprotéine transmembranaire
               MUCOVISCIDOSE
  Enquête en France: 19 laboratoires: 3595 patients
                                       7190 allèles
            6700 allèles mutés identifiés
         300 mutations différentes (93,2%)

DF508: 67,21% (Bretagne 81%, Nord 70%, Sud: 61%)
                   G542X: 2,89%
                  N1303K: 2,05%
                1717-1G->A:,3,13%
                 2789+5G->A: 1%
            19 mutations: entre 0,1 et 1%
  153 mutations ne sont retrouvées qu'une seule fois

         HETEROGENEITE ALLELIQUE                 23
         Arbre généalogique
         ATCD mucoviscidose


Hétérozygotes                               1/2
obligatoires                       1/4


                               1/8       1/25
Enfant atteint de
mucoviscidose       1/8x1/25x1/4
                    = 1/800
                                            24
    Modes de révélation
 Prénatal
   Hyper-échogénéicité      du grêle
      1%   (chromosomique, viral , vasculaire, mucov)
             méconiale
   Péritonite
   Absence de vésicule bilaire

 Néonatal
   Occlusion    néonatale par iléus méconial

                                                         25
    Adresser en consultation de
    génétique
 Déterminer     risque ou non
   Etude   génétique proposée
      Mutations connues ou non
      31 mutations les plus fréquentes

      Couvre 80% des mutations (4/5)

 Surveillance     de grossesse
   Etude des deux parents
   Reste une incertitude faible
      Risque   résiduel 1/500 (1/125 x 1/4)
                                               26
Arbre généalogique
ATCD mucoviscidose



                      ?       1/125



          1 x 1/125 x 1/4 = 1/500

                                      27
Arbre généalogique
Hémochromatose

                        Malade
                        hémochromatose
                        (1/400)
        1/2      1/10

                     1/2x1/10x1/4
                     = 1/80


                                    28
    Maladie récessive


 Pasde DPN
 Diagnostic clinique
   Ferritine

 Dépistage     des hétérozygotes ??
   Non,   sauf conseil génétique


                                       29
   Hérédité dominante


 Critères   de reconnaissance,
   une  personne atteinte, transmet à un
    enfant sur 2




                                        30
Hérédité dominante




                     31
Hérédité dominante




                     32
Exemples de maladies
dominantes



Syndrome  de Marfan
Hypochondroplasie

Maladie de Stickler




                       33
   Hérédité Mendélienne

Autosomique   dominante
Autosomique Récessive
Dominante liée à l’X
Récessive liée à l’X
Holandrique (liée à l’Y)

                            34
Conductrice obligatoire
Par   définition
 Un frère et une fils atteints
 Deux fils atteints



Par   extension
   Un fils atteint ET une fille conductrice
   obligatoire
                                              35
Transmission Récessive liée à l ’X

                     Pas de transmission
                     Père-Fils

                    Notion de conductric
                    obligatoire
                     M >>> F
                    Transmission vertical
                                   36
                  Hérédité liée à l ’X


 Garçons   atteints !!!!!

 50  % des garçons
  atteints
 50 % des filles
  conductrices


                                         37
Hérédité liée à l ’X


        XY        XX




 XY    XX    XY        XX


                            38
Hérédité lié à l ’X




                      39
Hérédité liée à l ’X


 Hémophilie

 Daltonisme

 Myopathie   de Duchenne de Boulogne




                                        40
 Hérédité Liée à l ’X (1)

3   types de transmissions liées à l ’X
   Dominant   lié à l ’X létal chez le garçon
   dominant lié à l ’X avec paradoxe de Sherman
   Récessif lié à l ’X

 Transmission  en général par les filles si récessif
 Transmission par les pères si dominant non létal
 Jamais de transmission Père     Fils
                                                   41
Hérédité DLX (2)

 Incontinentiapigmenti
 Mutation du gène NEMO (Xq28)




                                 42
            Hérédité DLX (3)
       Syndrome  de l ’X fragile
       Amplification de triplet CGG (Xq28)
       Conseil génétique difficile
                                          100 CGG
      Pré mutation 59-230


            180                       450                   400
450



  450 450      180 180      1500   1500             1800   1200 550
                                                                      43
  Hérédité RLX (4)

 Myopathie  de Duchenne de Boulogne 1/3500
 Mutations dans le gène de la Dystrophine (Xp21)




                                             44
   Cas des filles atteintes


Monosomie    X
Biais d’inactivation
Mutation sur l’allèle homologue




                                   45
   Conseil génétique

50 % des garçons atteints
50 % des filles conductrices


Pour  les apparentés : risque modulé en
 fonction de la probabilité pour la mère
 d’être conductrice (Bayes, étude
 moléculaire)
                                           46
   Exemple :
   Syndrome de l’X fragile
 Naissance    de Baptiste
   Troubles précoces de la relation mère-enfant
   Inquiétude parentale ++ > 9 mois
   Retard de marche
   Pas de langage à 21 mois



 Naissance    d ’Alexis
   Troubles   précoces de la relation mère-enfant ...
                                                     47
48
  Clinique
 Beaux   garçons
   Grand front
   Grand PC
     + 1 DS à + 3 DS
      A la naissance, grand PC (35cm, 36cm, 37cm)

 Trouble   du contact Angoisse parentale
   Stéréotypies
   Évitement  du regard
   Pas de langage
                                                     49
   Génétique X fragile
 Gène   FMR1
   Chromosome    X
   Cassure de l’extrémité q28
   Expansion de triplets
      Pré-mutation

      Mutation   complète
          Retard mental et traits psychotiques du garçon
          Retard plus modéré chez la fille




                                                            50
51
   Mécanisme génétique
 Expansion        instable
   TripletCGG, dans le premier exon, non traduit,
    du gène FMR1
   Polymorphique
     6 à 50 répétitions + AGG (séquence impure)
      Mutations complètes = 230 à > 1000 CGG,
       méthylation anormale
             100% RM garçon, 60% RM chez les filles
      Prémutations      = 60 à 200 CGG, non méthylés
             Males normaux transmetteurs, femmes vectrices
      Fréquence      des mosaïques somatiques
                                                              52
   Prénatal
 Depuis   l’élucidation moléculaire, possible
   Ponction    de trophoblastes à 11 SA
   PCR
     Allèles   normaux et petites prémutations
   Southern    blot
     Analyse  l’ADN
     Taille des fragments

     Méthylation



                                                  53
    Dépistage précoce X fra

 Éviter   les récurrences
   DPN

 Prise   en charge précoce en CAMPS
         contre l’enfermement psychotique
   Lutter
   Guidance parentale




                                            54
      DYSTROPHIE MUSCULAIRE DE
           DUCHENNE (DMD)
                    (1860)



Fréquence: 1/3500 garçon né vivant
           quelque soit la population

Transmission: récessive liée à l’X

Physiopathologie:dégénérescence lente et
inéluctable
               des fibres musculaires
                                           55
         DYSTROPHIE MUSCULAIRE
             DE BECKER (BMD)

                       (1955)

Fréquence: 1/35000 garçon né vivant

Transmission: récessive liée à l’X

Forme plus tardive et d’évolution plus lente; elle ne
devient invalidante qu’au cours de la vie adulte

Variation allélique et hétérogéneité clinique:
DMD et BMD: 2 variantes phénotypiques d’une
pathologie affectant un seul et même gène.     56
                   LE GENE

Séquencé en 1987

Un très grand gène:
     - longueur: 2,4 Mb
     - 79 exons: taille moyenne des exons 180 pb
                  taille moyenne des introns 30 kb

Code pour une proteine: la Dystrophine (1988)
     - 3685 acides aminés
     - 427 kDaltons


                                                57
                     Le gène de la Dystrophine: 2400 Kb

5'                                                                          3'

     1                                                                     79


Pm       34 6 8   1213   17 19    43 454748 50 52   60
                                    44      51
     Les techniques:
        - Southern Blot (6 sondes cDNA)
        - PCR "multiplex" (18 exons)
        - Microsatellites (10; STR)
        - DGGE / PTT/ DHPLC
                  Les mutations:
                       - Délétions: 60 - 65 % (2 hot spots)
                       - Duplications: 10 %
                       - Mutations ponctuelles: 30 %
                                                     Les problèmes:
                                                        - Néomutations
                                                        - Mosaiques germinales
                                                                       58
                                                        - Recombinaisons (12%)
59
Mme M. demande un Conseil Génétique
Elle a 2 fils: Paul (10 ans) et Léo (8 ans) et une fille (6 ans).
Léo présente des difficultés à la marche (chutes).
Le diagnostic de myopathie de Duchenne évoqué
cliniquement a été confirmé par la biopsie musculaire.

                                     Définition
                                     Traitement - Gravité
                               Mme M Mode de transmission
                                     Gène – Mutation(s)
                                     DPN
            Paul       Léo      Lydie


                                                           60
       Recherche d ’antécédents familiaux




                                              DCD
                                    3
                                            à 9 ans
          Mme M                             Myopathie?




Paul    Léo     Lydie
                                                61
 Conseil génétique au terme de la consultation
 - risque génétique ?
 Risque pour Mme M: conductrice ou non?
 Risque pour Paul ?
 Risque pour Lydie ?

- Conduite à Tenir
Discussion du risque génétique
Analyse moléculaire pour Léo: diagnostic direct+++
Analyse moléculaire pour ?
                                                     62
information de la famille maternelle
Léo   Témoin normal




                3
                43

                50
                13

                6
                47

                60
                52



                      63
           Léo   Témoin normal




                                 3
                                 43

Délétion                         50
                                 13
3 -> 43
                                 6
                                 47

                                 60
                                 52



                                  64
         Résultats de biologie moléculaire

                 Conduite à tenir?




                                             DCD à 9 ans
                                     3
                                             Myopathie?
         Mme M.



Paul    Léo             Lydie
       Délétion 3->43                              65
 Hier, appréciation du statut de conductrice
 par diagnostic indirect
 Aujourd’hui, évaluation du statut de conductrice
 par diagnostic direct

                          ?

                                           DCD à 9 ans
            ?                  ?      3
                                           Myopathie?




Paul     Léo             ? Lydie

        Délétion 3->43                              66
 Diagnostic indirect: étude familiale, polymorphisme.

            S50      2                       2   1
            S49      1                       2   2
            S45      3
                                     ?       2   3
                                                      ?
            S44      3                       3   2
            Ex17     1             Mme F.    1   1    Mme A.
            Dys II   1                       2   2



                ?        2   2       1       ?         2   1
                         1   2       2                 1   2
       Mme M.            3   2       3       Mme D.    3   3
                         3   3       2                 3   2
                         1   1       1                 1   1
                         1   2       2                 1   2

                                                      Conductrice ou non?
Paul    2   Léo              2     ? Lydie            Mme D?
        1                    2
        3                    2
                                                      Mme M?
        3                    del                      Mme F?
        1                    del
        1                    2
                                                      Mme A?        67
 Diagnostic direct: PCR quantitative: S44 et Ex17

            S50      2                       2   1
            S49      1                       2   2
            S45      3
                                    N        2   3
                                                        N
            S44      3                       3   2
            Ex17     1             Mme F.    1   1     Mme A.
            Dys II   1                       2   2



                d        2   2       1      N            2   1
                         1   2       2                   1   2
       Mme M.            3   2       3       Mme D.      3   3
                         3   3       2                   3   2
                         1   1       1                   1   1
                         1   2       2                   1   2



Paul    2   Léo              2     ? Lydie
        1                    2                       Mme M. est conductrice:
        3                    2
        3                    del                     néomutation survenue
        1                    del                     chez elle        68
        1                    2
Mme D. et son mari vous consultent.
Ce couple envisage une grossesse et s ’inquiète
en raison d ’ATCD de myopathie de Duchenne
dans la famille de Mme D.:
chez son frère et chez un oncle décédé à l ’âge de 15 ans




              Mme D.    Léon

                                   Conduite à tenir?
                                                    69
Forme familiale de Myopathie de Duchenne

Mme D. a 50% de risque d ’être conductrice


            Analyse moléculaire:
- recherche d’une délétion dans le gène DMD
chez Léon: PCR multiplex


- prévoir les prélèvements familiaux
pour étude indirecte le cas échéant
                                              70
 II
      CA           1                2    3                   2   3
      TG15         4                1    2                   3   2
      S50          1                4    3                   2   3
      S49          1                3    2                   3   2
      S45          1                2    1                   1   1
      S44          2                1    1                   3   1
      Ex17         2                1    2                   4   2
      TG21         1                2    3                   1   3
      Dys II       1                1    2                   2   2



III
        1      2
                       Pas de délétion
                                             3
        4      1            2                2
        1      4            1                3
        1      3            4                2
        1      2            3                1   Conductrice ou non?
        2      1
        2      2
                            2                1   III2?
                            1                2
        1      3            1                3   II4?
        1      2            2                2                   71
                            1
 II
      CA           1                2    3                    2   3
      TG15         4                1    2                    3   2
      S50          1                4    3                    2   3
      S49          1                3    2                    3   2
      S45          1                2    1                    1   1
      S44          2                1    1                    3   1
      Ex17         2                1    2                    4   2
      TG21         1                2    3                    1   3
      Dys II       1                1    2                    2   2



III
        1      2
                       Pas de délétion
                                             3
        4      1            2                2
        1      4            1                3   Conductrice ou non?
        1      3            4                2
        1      2            3
                                                 II4?Non Conductrice
                                             1
        2      1            2                1          Pas de DPN ?!
        2      2            1                2
        1      3            1
                                                 III2? Pas de réponse:
                                             3
        1      2            2                2       RECOMBINAISON  72
                            1
 Etant donné la recombinaison intra génique
              retrouvée chez III2,
 le statut de conductrice ou non conductrice
                 reste incertain

              Un diagnostic direct
       (recherche de mutation ponctuelle)
doit être envisagé chez le cas index: Léon (III3)

      Après plusieurs mois de recherche:
  mise en évidence d ’une mutation ponctuelle
                dans l ’exon 45
(mutation non sens introduisant un codon stop)
                                                    73
                                                             N
 II                         M+
      CA           1        2    3                       2   3
      TG15         4        1    2                       3   2
      S50          1        4    3                       2   3
      S49          1        3    2                       3   2
      S45          1        2    1                       1   1
      S44          2        1    1                       3   1
      Ex17         2        1    2                       4   2
      TG21         1        2    3                       1   3
      Dys II       1        1    2                       2   2



III            M+
        1      2       M+            3
        4      1       2             2
                                         Conductrice ou non?
        1      4       1             3
        1      3       4             2   II4?Non Conductrice
        1      2
        2      1
                       3             1         Pas de DPN
                       2             1
        2      2       1             2
        1      3       1             3
                                         III2? Conductrice
        1      2       2             2          DPN possible74
                       1
                                                                         34

HÉRÉDITÉ MITOCHONDRIALE


√ Les maladies mitochondriales résultent de défauts au niveau des
mitochondries (présentes dans toutes les cellules du corps à l’exception
des globules rouges).




√   Les cellules les plus affectées sont celles du cerveau, du cœur, du
foie, des muscles, du rein et du système respiratoire (les tissus ayant le
plus grand besoin énergétique).




√ En fonction des cellules qui sont affectées, les symptômes peuvent
être très différents.

                                                                    75
                                                                  35




             Hérédité Mitochondriale



√ Les mitochondries sont exclusivement d‘origine maternelle. Si

l’ensemble des mitochondries d’une cellule sont anormales, on parle

d’homoplasmie. Si seules quelques mitochondries sont anormales dans

une cellule, on parlera d’hétéroplasmie.



√ L’âge de déclenchement de la pathologie, sa sévérité et les

symptômes observés dépendent du pourcentage de mitochondries

anormales dans un tissu donné.                               76
Hérédité mitochondriale




                          77
78
79
80
Conseil génétique en pratique




                                81
82
83
    Consultations de génétique
 Interrogatoire
 Généalogie
 Examen   Clinique
 Photographies avec le consentement des
  patients
 Examens Complémentaires



                                           84
Consanguinité




                85
                 36
A




B   C
        F




D
        G




E




            86
                        37
AD




AR    RLX
            Mito




DLX
            Mito




LY




                   87
Hérédité Chromosomique


Analyse dysmorphologique




                           88
89
   Microdélétion
   EX: Syndrome de Williams
 Mathieu
  1 an
   Retard discret des acquisitions
   Cardiopathie
      Sténose supravalvulaire de l ’aorte
      Sténose Artère pulmonaire

   Hypercalcémienéonatale
   Dysmorphie spécifique

                                             90
   Génétique du syndrome de
   Williams
 Hérédité
   Sporadique
   Rare   dominance
 Locus    génétique
   Chromosome        7
      Microdélétion7q11
      Hémizygotie au locus Elastine
           Délétions
           Autres gènes de la région: LIM Kinase 1 …..

                                                          91
92
Syndromes acquis

  Syndrome de l’alcoolisme fœtal



                                   93
   Autres « maladies héritées »,
   non génétiques

 Syndrome    d’Alcoolisme fœtal
   Sous-diagnostiqué
     10 à 20% des QI 50-80 ?
     1/1000 naissances en France

   Tableau   malformatif
     RCIU  précoce
     Malformations possibles
        CIV, CIA
        Fentes labiales ou labiopalatines
                                             94
   Présentation clinique

 RCIUavec PC non conservé
 Dysmorphie faciale
   Philtrum long, lisse et bombé
   Fentes palpébrales étroites …

 Malformations
   Hypoplasie des phalanges distales
   CIA, CIV, fentes faciales


                                        95

								
To top