of CpG islands associated with promoter regions of

Document Sample
of CpG islands associated with promoter regions of Powered By Docstoc
					Supplementary Figure S1. Differential expression of DNMTs in histologically confirmed GBM
tissues relative to normal brain tissues. Total RNA was extracted from tissue samples and
relative expression of DNMTs in GBM samples (o) with respect to expression in a normal brain
samples () was determined using real-time PCR. The expression of house keeping gene hGUS
was used as endogenous control. Y-axis units are arbitrary expression units used to calculate
fold change relative to expression in one non-tumor brain sample.
Supplementary Figure S2. Real-time PCR confirmation of microarray data. T98 cells were
treated every 24 hours for 30 days with two different DNMT specific siRNA molecules or control
(non-silencing) siRNA molecule. Total RNA was extracted before siRNA treatment (0 day) or
after 5, 10 or 30 day time-period and real-time PCR was performed using Assay on Demand
gene expression reagents specific for 10 randomly selected genes or the house keeping gene
hGUS in triplicate. Y axis, arbitrary expression units used to calculate fold change relative to
expression at before siRNA treatment (0 day).
Supplementary Figure S3. Results of methylation specific PCR (MSP) analysis of CpG islands
associated with promoter regions of DUSP5, SDC2 and TMTC1. Primers were designed to
specifically amplify either methylated (M) or unmethylated (U) alleles from sodium bisulfite-
converted sequences templates. The MSP assay was used to determine the methylation status
of CpG islands in 29 tumor samples along with water as negative control. Of the 29 tumor
samples investigated, 25, 27 and 28 samples demonstrated methylation of the investigated
promoter regions associated with DUSP5, SDC2 and TMTC1 respectively.
Supplementary Figure S5. Effect of DNMT inhibition on the growth of T98 glioblastoma cell
lines. Colony focus assays were performed to monitor the effect of reduced DNMT expression on the
growth of T98 immortalized glioma cell line. T98 glioma cells were transfected with plasmids
containing specific short hairpin RNA (shRNA) coding for siRNA1 (Panel 4), siRNA2 (Panel 5),
siRNA3 (Panel 6) or non-specific siRNA (Panel 3) along with controls (no transfection-Panel 1 or
empty vector-Panel 2). Decreased expression of DNMTs was confirmed in cells transfected with
siRNAs shown to inhibit DNMT expression levels using real-time PCR. G418 selected colonies
were quantified in three independent experiments relative to empty vector control and showed
no statistically significant differences between cells transfected with control vectors or shRNA
plasmids.
       Supplementary Table S2. Sequence of primers used for methylation specific PCR to
       investigate methylation of promoter associated CpG islands.

                                                       Position                                      Position of
                                                       of                                            primers
          Primer
Gene                  Unmethylated                     primers       Methylated                      relative to
          direction
                                                       relative to                                   TSS
                                                       TSS
          Forward:    5'- GTAGTTGTTATTGGTAGAAGTTGTGA   530 - 553     5'- GGTAGTCGTTATTGGTAGAAGTTGC   529 - 553
DUSP5
          Reverse:    5'- ACCTTTAAAAAAATAAACCCACAAA    613 - 636     5'- CTTTAAAAAAATAAACCCGCGA      615 - 636

          Forward:    5'- GATGGGGGTTAGATTTAAGAGATTT    1172 - 1195 5'- GATGGGGGTTAGATTTAAGAGATTC     1172 - 1195
SDC2
          Reverse:    5'- AACTAAAAATCCAATAACCAACATC    1314 - 1349 5'- AACTAAAAATCCAATAACCGACGT      1315 - 1349

          Forward:    5'- TGGGTGATTGTGAATAATTTTGAT     1171 - 1194 5'- GCGATCGTGAATAATTTCGAC         1174 - 1194
TMTC1
          Reverse:    5'- AAATAAAAACACAAAACAACCAAT     1283 - 1306 5'- ATAAAAACGCAAAACGACCG          1285 - 1304
    Supplementary Table S3. Sequence of primers used for bisulfite analysis of promoter
    associated CpG islands. The position of methylation specific PCR products relative to
    transcriptional start site and number of CpG sites probed are provided.


                                                                                 Position      Number of
Gene                                                                             relative to   CpGs
Name    Left Primer                         Right Primer                         TSS           probed
DUSP5   GGATTTTTTTGGGGTTTTGGT               TAAAACCAAATATAAATATTTCCCC            -24 to -395       50
SDC2    GGGAGTGTAGAAATTAATAAGTGAGAGGG       AACCACCAAACCCAAAATAAACAAA            371 to 661        32
SDC2    GAAGTAGGTTTAGGAGGGAGGGAGTTAG        ATTCAATTTCTAATTTTAAAAAATAAATTC        22 to 277        22
TMTC1   GGGGATTTAGGAGGGTTTAGTAGGT           TCCAAAAAAACCCCTTCTCCTAACT            209 to 501        26
TMTC1   TTTTAAGGGGTTGATATATTTTTTATTTGT      CCTCCCTCCTCTCCAAAATATACATAAC        1430 to 1769       22
Supplementary Table S4. Sequence of primers used for chromatin immunoprecipitation and
chromatin accessibility assays. The genomic positions relative to transcriptional start site (TSS)
are provided.
Gene
                Forward primer                Reverse primer                 Position relative to TSS
Name
DUSP5           ggctgcccatataaggccaaatat      ctcagcccacgtccgtgaagctga              –15 to –336
SDC2            cagtgtgactcccagataaacccg      ctaattgttctctagaaaagggaa              –16 to –272
TMTC1           ggatcacttgggtctcattatttc      ggtgcctgaaagaacaaatagaat              –5 to –252
Supplementary Table S1: DNMT inhibition induces widespread up-regulation of genes across
several important regulatory pathways. Genes that are regulated in T98 glioma cell lines were
categorized into different functional pathways using GO ontology classification.


                                                     Down-
              Up           Up-
                                        Hyper        regulated
              regulated    regulated
Gene_Symbol                             methylated   in Tumor    GO_Biological_Process
              on DNMT1     on DNMT3b
                                        CpG          tissue
              inhibition   inhibition
                                                     samples

AASDH              +           +
                                                                 lipid metabolism; steroid metabolism; transport;
ABCA1              +
                                                                 cholesterol metabolism
                                                                 lipid metabolism; transport; cholesterol
ABCA2              +           +            +
                                                                 metabolism
ABCB8                          +                                 transport
                                                                 DNA replication; DNA repair; DNA recombination;
ABCF2              +           +            +
                                                                 transport
                                                                 lipid metabolism; fatty acid metabolism; bile acid
ACOX2              +           +                                 metabolism; fatty acid beta-oxidation; electron
                                                                 transport
ACP2               +
ACPL2                          +
                                                                 lipid metabolism; fatty acid metabolism;
ACSL3                                                    +
                                                                 metabolism
                                                                 establishment and/or maintenance of chromatin
ACTL6B                                                   +
                                                                 architecture
ACTN1              +
ACTN3                          +
ACY1               +           +                                 amino acid metabolism; proteolysis
ACYP2                          +                         +       phosphate metabolism
ADAM15                         +            +                    cell-matrix adhesion; cell adhesion; proteolysis
ADAM19             +                                             proteolysis
ADAMTS16                                                         proteolysis
ADCK4                          +            +
ADCY1                          +                         +       intracellular signaling cascade; cAMP biosynthesis
ADPRHL2                        +
ADSSL1             +           +                                 purine nucleotide biosynthesis
                                                                 phospholipid biosynthesis; metabolism;
AGPAT2             +           +            +
                                                                 phosphatidic acid biosynthesis
AIG1               +           +
                                                                 nucleobase, nucleoside, nucleotide and nucleic
AK1                +
                                                                 acid metabolism; ATP metabolism
                                                                 nucleobase, nucleoside, nucleotide and nucleic
AK3L1                          +
                                                                 acid metabolism
                                                                 ADP biosynthesis; nucleobase, nucleoside,
                                                                 nucleotide and nucleic acid metabolism; ATP
AK5                            +                         +
                                                                 metabolism; pyrimidine ribonucleotide
                                                                 biosynthesis; dADP biosynthesis
AKAP1              +           +
                                                                 protein targeting; signal transduction; synaptic
AKAP5              +           +                         +
                                                                 transmission
AKR1C4         +           bile acid transport; androgen metabolism
AKR7A2     +   +   +       aldehyde metabolism; carbohydrate metabolism
AKR7A3     +   +           aldehyde metabolism
                           signal transduction; protein amino acid
AKT3       +
                           phosphorylation
ALDH1A3                +   lipid metabolism; metabolism; alcohol metabolism
ALG5       +       +       protein amino acid glycosylation
ALS2CR13   +       +   +
                           gonadal mesoderm development; Mullerian duct
AMH            +   +       regression; sex differentiation; cell-cell signaling;
                           sex determination
                           purine ribonucleoside monophosphate
AMPD2          +       +
                           biosynthesis; purine nucleotide metabolism
AMY2A      +   +           digestion; carbohydrate metabolism
ANAPC13    +   +   +
                           positive regulation of angiogenesis; negative
                           regulation of lipoprotein lipase activity; negative
                           regulation of apoptosis; positive regulation of lipid
ANGPTL4    +   +
                           metabolism; angiogenesis; cell differentiation;
                           response to hypoxia; cellular response to
                           starvation
                           negative regulation of progression through cell
ANKRD15    +
                           cycle; cell cycle
ANKRD31    +   +   +
ANXA10     +   +
                           inflammatory response; oxygen and reactive
AOX1       +           +
                           oxygen species metabolism; electron transport
AP1GBP1    +   +           intracellular protein transport; endocytosis
AP1M1          +           intracellular protein transport; endocytosis
                           receptor mediated endocytosis; intracellular
AP1S1      +   +   +   +
                           protein transport
                           protein complex assembly; Golgi to endosome
AP2A1      +   +       +   transport; intracellular protein transport;
                           endocytosis
                           acute-phase response; chaperone-mediated
APCS       +   +
                           protein complex assembly; protein folding
                           protein amino acid phosphorylation; negative
APEG1                  +   regulation of cell proliferation; muscle
                           development
APEH       +   +           proteolysis
APIP           +   +
APOBEC3C   +               biological process unknown
                           lipoprotein metabolism; inflammatory response;
APOL3      +               lipid transport; positive regulation of I-kappaB
                           kinase/NF-kappaB cascade
                           ER to Golgi vesicle-mediated transport;
ARF3       +   +       +   intracellular protein transport; small GTPase
                           mediated signal transduction
                           regulation of GTPase activity; ER to Golgi vesicle-
ARFGAP1        +
                           mediated transport; protein transport
                           signal transduction; intracellular protein transport;
ARFRP1     +       +
                           small GTPase mediated signal transduction
                           signal transduction; Rho protein signal
ARHGAP1        +   +       transduction; cytoskeleton organization and
                           biogenesis
ARHGDIA        +           negative regulation of cell adhesion; Rho protein
                           signal transduction
                           development; actin cytoskeleton organization and
ARHGDIB    +               biogenesis; negative regulation of cell adhesion;
                           immune response; Rho protein signal transduction
ARHGEF6        +           apoptosis; JNK cascade
ARIH2          +           development; protein ubiquitination
ARL14      +   +
ARL16      +   +           intracellular protein transport
                           G-protein coupled receptor protein signaling
ARL3       +   +   +       pathway; intracellular protein transport; small
                           GTPase mediated signal transduction
ARL4C      +   +           small GTPase mediated signal transduction
ARMC5          +
ARMC7          +       +
ARMC8
ARMCX6     +   +
ARMET      +   +           biological process unknown
                           entrainment of circadian clock; signal transduction;
ARNTL2     +           +
                           regulation of transcription, DNA-dependent
ARPC5L     +       +   +
ARRB1          +           sensory perception; signal transduction
ARSD       +   +   +       metabolism
                           development; regulation of transcription, DNA-
ARX        +           +
                           dependent
ASB11          +           intracellular signaling cascade
ASRGL1         +       +   glycoprotein catabolism
                           amino acid biosynthesis; arginine biosynthesis;
ASS        +           +
                           urea cycle
ASTN2      +   +
ATAD2          +   +
ATAD3B         +   +
                           ubiquitin cycle; autophagy; autophagic vacuole
ATG12      +   +
                           formation; apoptosis
ATG9B          +       +
                           negative regulation of progression through cell
                           cycle; signal transduction; regulation of
ATM        +
                           transcription, DNA-dependent; DNA repair; meiotic
                           recombination
                           ion transport; metal ion transport; copper ion
ATOX1          +           homeostasis; response to oxidative stress; copper
                           ion transport; protein folding
                           metabolism; sperm motility; potassium ion
                           transport; hydrogen ion homeostasis; sodium ion
ATP1A4     +
                           transport; ATP hydrolysis coupled proton
                           transport; cation transport
                           proton transport; ion transport; ATP synthesis
ATP5G1     +   +
                           coupled proton transport
                           proton transport; ion transport; ATP synthesis
ATP5H          +
                           coupled proton transport
ATP5J2         +           proton transport; ion transport; ATP biosynthesis
ATP5S          +           proton transport; ion transport
                           proton transport; ion transport; ATP synthesis
ATP6V0D1       +       +
                           coupled proton transport
ATP6V0E    +   +           proton transport; ion transport; ATP synthesis
                           coupled proton transport
                           ion transport; ATP synthesis coupled proton
                           transport; regulation of pH; excretion; energy
ATP6V1B1       +       +
                           coupled proton transport, against electrochemical
                           gradient; sensory perception of sound
ATP6V1G1   +   +           proton transport; ion transport; ATP biosynthesis
ATP8B3         +       +   cation transport
ATPAF2     +   +           protein folding
ATXN2          +   +
                           negative regulation of mitosis; positive regulation
AURKAIP1   +       +
                           of proteolysis
AUTS2      +   +       +   biological process unknown
AVEN       +   +           apoptosis
AVPI1      +       +   +
AYP1       +   +
B3GNTL1    +   +   +   +
                           lipid glycosylation; glycosphingolipid metabolism;
B4GALNT1       +   +   +
                           carbohydrate metabolism
B4GALT2        +   +       carbohydrate metabolism
                           proteoglycan metabolism; protein modification;
B4GALT7    +   +   +
                           carbohydrate metabolism
                           peptide hormone processing; negative regulation
                           of amyloid precursor protein biosynthesis; protein
BACE2      +   +
                           secretion; membrane protein ectodomain
                           proteolysis; protein modification
BAD        +   +   +       induction of apoptosis; apoptotic program
BANF1          +           response to virus
BASP1                  +
                           negative regulation of progression through cell
                           cycle; negative regulation of survival gene product
                           activity; regulation of apoptosis; induction of
BAX            +
                           apoptosis by extracellular signals; apoptosis; germ
                           cell development; apoptotic mitochondrial
                           changes; induction of apoptosis; cell cycle
BBS5       +   +
BCAR1          +           cell adhesion; cell proliferation
BCAS3      +   +
BCKDHA     +   +           metabolism
BCKDK          +           protein amino acid phosphorylation
                           positive regulation of cell proliferation; negative
                           regulation of transcription from RNA polymerase II
BCL6       +
                           promoter; inflammatory response; regulation of
                           transcription, DNA-dependent; transcription
BCORL1     +   +   +   +
BDNF       +           +   nervous system development
BET1L          +
BEX1       +   +   +   +
BEX2       +   +   +   +
BFSP1      +   +       +   biological process unknown; RNA processing
BHLHB2     +   +   +       regulation of transcription, DNA-dependent
                           induction of apoptosis via death domain receptors;
BID        +       +       positive regulation of apoptosis; apoptotic
                           mitochondrial changes
                            regulation of endocytosis; negative regulation of
BIN1        +   +   +   +   progression through cell cycle; cell proliferation;
                            cell differentiation
BIRC4       +   +           apoptosis; protein ubiquitination; anti-apoptosis
BLVRA       +   +           metabolism; electron transport
                            proteolysis; cartilage condensation; ossification;
BMP1        +   +
                            cell differentiation
                            cartilage development; cardiac cell differentiation;
BMP2        +   +           cell-cell signaling; epithelial to mesenchymal
                            transition; ossification; growth
                            positive regulation of osteoblast differentiation;
                            negative regulation of myoblast differentiation;
                            cartilage development; ureteric bud development;
                            positive regulation of protein amino acid
BMP4        +   +   +
                            phosphorylation; positive regulation of bone
                            mineralization; ossification; cell differentiation;
                            growth; negative regulation of striated muscle
                            development
                            cartilage development; growth; ossification; cell
BMP7        +       +
                            differentiation
BMPER       +       +   +
BNIP1       +   +           apoptosis; anti-apoptosis
BOLA1       +   +
BOLA2       +   +   +
BOLA3       +
                            cell differentiation; regulation of translation;
BOLL            +   +
                            meiosis; spermatogenesis
BPY2IP1     +   +       +
                            negative regulation of progression through cell
BRMS1           +
                            cycle; biological process unknown; cell cycle
BSCL2       +   +       +   biological process unknown
                            development; cell-cell signaling; humoral immune
BST2        +   +           response; cell proliferation; positive regulation of I-
                            kappaB kinase/NF-kappaB cascade
BTBD9       +           +   cell adhesion
                            negative regulation of cell growth; positive
                            regulation of angiogenesis; negative regulation of
                            cell proliferation; spermatid development; positive
                            regulation of endothelial cell differentiation;
BTG1        +
                            positive regulation of myoblast differentiation; cell
                            migration; regulation of apoptosis; positive
                            regulation of enzyme activity; regulation of
                            transcription
BTN3A2      +   +           biological process unknown
BTN3A3      +   +
C10orf104   +   +
C10orf107   +   +   +
C10orf11    +   +
C10orf114               +
C10orf32    +       +   +
C10orf33        +           carotenoid biosynthesis; electron transport
C10orf46        +       +   cell cycle
C10orf73    +   +
C10orf75        +
C10orf78    +   +   +
C10orf79    +           +
C10orf83    +   +       +
C10orf97    +
C11orf24    +   +
C12orf10    +   +
C12orf24        +   +   +
C12orf4         +
C12orf5     +           +   metabolism
C14orf122   +   +
C14orf125   +   +
C14orf139   +   +
C14orf149   +
C14orf156   +   +
C14orf168   +
C14orf79        +   +
C15orf20    +   +
C15orf39    +   +
C15orf40    +   +
C16orf24    +   +   +   +
C16orf35        +           biological process unknown
C16orf45    +   +       +
C16orf49    +   +
C16orf51    +   +
C16orf55    +   +   +
C17orf28    +   +       +
C17orf44    +   +
C17orf48    +   +
C17orf54        +
C17orf57    +           +
C18orf14    +
C18orf21    +   +   +
C18orf22    +   +   +       rRNA processing
C18orf37    +
C19orf10    +   +   +
C19orf22    +   +
C19orf29    +   +
C1orf122    +   +
C1orf123    +   +
C1orf135    +           +
C1orf151    +   +       +
C1orf21         +   +   +
                            biological process unknown; transport; protein
C1orf24     +
                            folding
C1orf35     +   +
C1orf41     +   +
C1orf51     +   +       +
C1orf66         +           rRNA modification
C1orf78         +
C1orf79     +
C1orf91     +   +
                            regulation of transcription, DNA-dependent;
C20orf100   +           +
                            transcription
C20orf102               +
C20orf116   +
C20orf117   +   +       +
C20orf132   +   +   +       small GTPase mediated signal transduction
C20orf174   +   +   +
                            regulation of cell growth; regulation of
C20orf20    +   +           transcription, DNA-dependent; transcription;
                            chromatin modification
C20orf24    +               biological process unknown
                            protein amino acid N-linked glycosylation;
C20orf31    +
                            carbohydrate metabolism
C20orf35    +   +           protein transport
C20orf46    +   +       +
C20orf55        +
C20orf65    +   +
C20orf81    +   +
C20orf98        +       +   biological process unknown
C21orf106   +   +       +   development; metabolism
C21orf121   +           +
C21orf2     +   +   +       biological process unknown
C21orf5         +           development
C21orf7     +   +   +       regulation of transcription, DNA-dependent
C21orf70        +
C21orf91    +
                            rRNA processing; translational elongation;
C2F         +
                            biological process unknown
C2orf17     +   +       +
C2orf23     +   +   +   +
                            regulation of transcription, DNA-dependent;
C2orf3      +   +
                            transcription
C2orf32     +           +
C3orf21     +   +
C3orf28     +   +
C3orf31         +
C3orf40     +           +
C5orf3      +   +       +
C6orf105    +           +
C6orf107        +       +
C6orf136    +   +
C6orf162        +
C6orf170    +
C6orf203    +   +
C6orf25    +   +
C6orf35    +   +       +
C6orf51    +   +   +
C7orf19        +
C7orf23    +
C7orf27    +   +   +   +
C8ORFK36   +   +
C8orf32    +
C8orf58        +
C9orf103   +       +       amino acid biosynthesis; carbohydrate metabolism
C9orf111   +   +       +   lipid metabolism
C9orf114   +   +
C9orf115   +   +
C9orf3     +   +   +   +   proteolysis
C9orf32    +   +   +
C9orf42    +   +       +
C9orf50    +   +   +   +
C9orf52    +   +
                           negative regulation of I-kappaB kinase/NF-kappaB
C9orf89    +   +   +
                           cascade
C9orf95    +   +           pyridine nucleotide biosynthesis
CA6            +           one-carbon compound metabolism
                           ion transport; calcium ion transport; cation
CACNA1C    +   +       +
                           transport; regulation of heart contraction
CACNA2D3   +       +   +
CALB2      +   +       +
CALCOCO1       +
                           signal transduction; nervous system development;
CAMK1      +           +   protein amino acid phosphorylation; cell
                           differentiation
                           signal transduction; protein amino acid
CAMK2B     +           +
                           phosphorylation
                           regulation of protein kinase activity; positive
                           regulation of transcription; calcium-mediated
CAMKK2         +       +
                           signaling; protein amino acid autophosphorylation;
                           MAPKKK cascade
CAMKV      +           +   protein amino acid phosphorylation
CANP       +   +
CAPN1      +   +           positive regulation of cell proliferation; proteolysis
                           barbed-end actin filament capping; actin
CAPZB      +   +
                           cytoskeleton organization and biogenesis
                           regulation of apoptosis; protein complex assembly;
CARD10         +   +   +
                           activation of NF-kappaB-inducing kinase
                           proteolysis; regulation of apoptosis; signal
CASP1      +               transduction; positive regulation of I-kappaB
                           kinase/NF-kappaB cascade
                           proteolysis; regulation of apoptosis; induction of
CASP4      +
                           apoptosis
CCBL1      +   +           amino acid derivative metabolism; biosynthesis
CCDC12     +   +
CCDC28B    +
CCDC33     +   +       +
                           sensory perception; signal transduction; cell-cell
CCL26      +   +
                           signaling; inflammatory response; chemotaxis
                           cell division; G/S transition of mitotic cell cycle;
CCND1      +   +   +
                           regulation of progression through cell cycle
                           cell division; regulation of progression through cell
CCND3      +   +
                           cycle
                           biological process unknown; antimicrobial humoral
CD163      +
                           response (sensu Vertebrata)
                           development; cell adhesion; signal transduction;
                           negative regulation of cell adhesion; heterophilic
CD164      +   +   +
                           cell adhesion; immune response; negative
                           regulation of cell proliferation; hemopoiesis
CD320          +           regulation of cell growth
                           transmembrane receptor protein tyrosine kinase
CD3EAP     +       +       signaling pathway; rRNA transcription; immune
                           response
                           cell-cell adhesion; antimicrobial humoral response
CD58       +
                           (sensu Vertebrata)
CD5L       +   +           apoptosis; cellular defense response
                           cytidine metabolism; nucleobase, nucleoside,
CDA        +
                           nucleotide and nucleic acid metabolism
                           positive regulation of cell proliferation; cell
                           division; M phase of mitotic cell cycle; protein
CDC25B     +   +
                           amino acid dephosphorylation; regulation of
                           progression through cell cycle; mitosis
CDC26      +   +
                           regulation of mRNA processing; cell division;
                           regulation of cell growth; apoptosis; protein amino
CDC2L2     +   +   +       acid phosphorylation; cell proliferation; regulation
                           of transcription, DNA-dependent; regulation of
                           progression through cell cycle; mitosis
                           ubiquitin cycle; G/S transition of mitotic cell cycle;
CDC34      +   +   +
                           DNA replication initiation
                           positive regulation of actin filament
                           polymerization; regulation of cell shape; positive
CDC42EP2   +   +   +       regulation of pseudopodium formation; positive
                           regulation of protein complex assembly; actin
                           filament organization
CDIPT      +               phospholipid biosynthesis
                           cell division; protein amino acid phosphorylation;
CDK5       +   +       +
                           cell proliferation; cell cycle
                           biological process unknown; negative regulation of
CDKN1B     +       +   +   cell proliferation; regulation of cyclin dependent
                           protein kinase activity; cell cycle arrest; cell cycle
                           negative regulation of cell proliferation; regulation
CDKN2D     +           +   of cyclin dependent protein kinase activity; cell
                           cycle arrest; cell cycle
                           protein amino acid dephosphorylation; negative
                           regulation of cell proliferation; cell cycle arrest; cell
CDKN3      +   +
                           cycle; G/S transition of mitotic cell cycle; regulation
                           of cyclin dependent protein kinase activity
                           inflammatory response; regulation of transcription,
                           DNA-dependent; transcription; acute-phase
CEBPB      +   +
                           response; transcription from RNA polymerase II
                           promoter
                           cell motility; cell adhesion; leukocyte adhesion;
CEECAM1        +   +
                           lipopolysaccharide biosynthesis
                          development; homophilic cell adhesion; signal
CELSR3    +   +   +   +
                          transduction; neuropeptide signaling pathway
CEP164    +   +
CEP192    +   +
CEP78     +       +   +
CES1      +   +           metabolism; response to toxin
CETN2     +   +           cell division; mitosis; cell cycle
CETN3     +   +           cell division; centrosome cycle; mitosis
CFDP1     +   +           biological process unknown
                          actin cytoskeleton organization and biogenesis;
CFL1          +   +
                          Rho protein signal transduction
                          induction of apoptosis by extracellular signals;
                          positive regulation of I-kappaB kinase/NF-kappaB
CFLAR     +   +   +
                          cascade; proteolysis; regulation of apoptosis; anti-
                          apoptosis
CG018         +
CGI-121   +   +           protein catabolism
CGI-14        +   +       N-acetylglucosamine metabolism
CHCHD6    +   +       +
CHI3L1    +   +           chitin catabolism; carbohydrate metabolism
CHIC2     +   +           biological process unknown
CHMP2A    +   +           protein transport
CHMP4A    +   +           protein transport
MGC5987       +           protein transport
CHPF          +
                          dermatan sulfate biosynthesis; carbohydrate
CHST12    +       +
                          metabolism
                          sulfur metabolism; inflammatory response; N-
CHST2         +   +       acetylglucosamine metabolism; carbohydrate
                          metabolism
                          chondroitin sulfate biosynthesis; sulfur
CHST7     +   +   +       metabolism; polysaccharide metabolism; N-
                          acetylglucosamine metabolism
                          response to DNA damage stimulus; cell adhesion;
CIB1      +   +
                          double-strand break repair
CIDEC     +   +       +   apoptosis; induction of apoptosis
CIR       +   +
CITED4                +
CKAP1     +   +   +       protein folding
CLCN2         +       +   chloride transport; ion transport
CLEC2L    +   +       +
                          chloride transport; ion transport; calcium ion
CLIC1     +
                          transport
CLMN      +   +
CLN3          +   +       protein folding
CLN8      +               nervous system development
CLTB      +   +       +   intracellular protein transport
CNBD1         +
CNIH4     +   +           intracellular signaling cascade
                          actomyosin structure organization and biogenesis;
CNN2      +   +
                          cytoskeleton organization and biogenesis
                          regulation of transcription, DNA-dependent;
COBRA1        +
                          negative regulation of transcription; transcription
COL13A1   +   +           biological process unknown; phosphate transport
                          skeletal development; epidermis development;
COL1A1    +   +
                          phosphate transport; sensory perception of sound
                          skeletal development; biological process unknown;
                          transmembrane receptor protein tyrosine kinase
COL1A2        +
                          signaling pathway; phosphate transport; sensory
                          perception of sound
COL23A1       +   +   +   phosphate transport
                          organ morphogenesis; circulation; phosphate
COL3A1    +   +
                          transport
                          extracellular matrix organization and biogenesis;
COL4A2    +   +
                          phosphate transport
                          cell adhesion; cell proliferation; circulation;
                          negative regulation of cell proliferation; phosphate
                          transport; induction of apoptosis; sensory
COL4A3    +   +
                          perception of sound; caspase activation;
                          proteolysis; cell surface receptor linked signal
                          transduction; negative regulation of angiogenesis
                          cell adhesion; epidermis development; phosphate
COL7A1        +   +
                          transport
COL8A1    +   +           cell adhesion; phosphate transport
COLEC10   +   +       +
COMMD1    +   +
COMMD6        +
                          skeletal development; cell adhesion; organ
COMP          +   +   +
                          morphogenesis
                          neurotransmitter catabolism; catecholamine
COMT      +   +
                          metabolism
COMTD1    +   +   +
COP1      +   +           proteolysis; regulation of apoptosis
COPS6     +   +
COPS7B    +   +
COQ4          +   +       ubiquinone biosynthesis
COTL1     +               biological process unknown
COX6A1        +       +   electron transport
COX6B1        +           electron transport
CRIPT         +
                          positive regulation of transcription from RNA
                          polymerase II promoter; transcription initiation
CRSP2         +
                          from RNA polymerase II promoter; androgen
                          receptor signaling pathway; transcription
                          transcription initiation from RNA polymerase II
                          promoter; regulation of transcription from RNA
CRSP7         +       +
                          polymerase II promoter; defense response;
                          transcription
                          positive regulation of transcription; regulation of
                          transcription from RNA polymerase II promoter;
CRSP9     +   +
                          transcription initiation from RNA polymerase II
                          promoter; transcription
CRTC3     +   +       +
CSAD          +           amino acid metabolism
                          development; cell surface receptor linked signal
CSF2      +   +
                          transduction; cellular defense response
CTA-216E10.6   +
CTA-250D10.2       +
                               protein amino acid dephosphorylation;
CTDP1              +   +
                               transcription from RNA polymerase II promoter
CTSH           +   +           proteolysis
CUEDC2         +   +
                               ubiquitin cycle; proteolysis; regulation of
CUL7               +           endothelial cell differentiation; vasculogenesis; cell
                               cycle
CX62               +
                               response to virus; cell adhesion; sensory
                               perception; G-protein coupled receptor protein
                               signaling pathway; signal transduction; cell-cell
CXCL12             +   +       signaling; inflammatory response; regulation of
                               actin polymerization and/or depolymerization;
                               circulation; immune response; calcium ion
                               homeostasis; chemotaxis
                               G-protein coupled receptor protein signaling
CXCL3          +       +       pathway; chemotaxis; sensory perception;
                               inflammatory response
CXXC5          +   +   +   +
CXorf52            +
CYB5           +               electron transport
CYHR1          +   +
CYLN2          +   +
CYP4F3             +           leukotriene metabolism; electron transport
CYTL1          +   +           signal transduction
                               chondroitin sulfate biosynthesis; dermatan sulfate
                               proteoglycan biosynthesis, polysaccharide chain
                               biosynthesis; cell recognition; heparin biosynthesis;
                               heparan sulfate proteoglycan biosynthesis,
                               polysaccharide chain biosynthesis; nervous system
ChGn               +       +   development; cell proliferation; chondroitin sulfate
                               proteoglycan biosynthesis, polysaccharide chain
                               biosynthesis; UDP-glucuronate metabolism;
                               morphogenesis; extracellular matrix organization
                               and biogenesis; UDP-N-acetylgalactosamine
                               metabolism
                               dopamine receptor signaling pathway; inactivation
D4S234E|GPS2   +   +
                               of MAPK activity; JNK cascade; cell cycle
DAD1           +   +           apoptosis
DALRD3             +           arginyl-tRNA aminoacylation
                               regulation of dendrite morphogenesis; nervous
                               system development; cell differentiation;
DBN1               +
                               regulation of neuronal synaptic plasticity; actin
                               filament organization
                               regulation of transcription from RNA polymerase II
DBP            +   +       +
                               promoter; rhythmic process; transcription
DCHS2          +           +   homophilic cell adhesion
                               lipid metabolism; fatty acid metabolism;
DCI            +   +
                               metabolism
DCPS               +   +       mRNA catabolism, nonsense-mediated decay
                               mitochondrion organization and biogenesis; lipid
DCTN6          +       +
                               biosynthesis
DDA1           +   +       +
DDX10           +           +
DDX52           +
DERP6           +       +
DGCR6L          +   +   +   +
                                protein kinase C activation; intracellular signaling
DGKB            +           +
                                cascade
                                guanosine metabolism; nucleobase, nucleoside,
DGUOK           +   +
                                nucleotide and nucleic acid metabolism
                                positive regulation of cell proliferation; spermidine
                                catabolism to deoxyhypusine, using deoxyhypusine
DHPS            +   +
                                synthase; hypusine biosynthesis from peptidyl-
                                lysine; protein biosynthesis
DHRS6           +   +           metabolism
DHX34               +           electron transport
                                actin cytoskeleton organization and biogenesis; cell
DIAPH3          +
                                organization and biogenesis
                                apoptosis; regulation of transcription, DNA-
DIDO1           +
                                dependent; transcription
DISC1           +   +       +   biological process unknown
DISP2           +   +       +
DKFZP434B0335       +
DKFZP566M1046       +
DKFZP586H2123   +   +           proteolysis
DKFZp313A2432   +   +
DKFZp434M0331   +   +
DKFZp451M2119   +
DKFZp586C1924       +
DKFZp666G057    +   +
DKFZp761L1417   +       +   +
DLEU1           +
                                signal transduction; nervous system development;
DLG4            +           +   protein complex assembly; synaptic transmission;
                                learning
DMWD                +       +   meiosis
DMXL2           +           +
DNAH11          +               microtubule-based movement
                                ciliary or flagellar motility; microtubule-based
DNAH3           +
                                movement
DNAJB5          +           +   protein folding; response to unfolded protein
DNAJC12         +   +           protein folding
DNAJC19             +           protein folding
DNAJC4              +           protein folding; response to unfolded protein
DNAL4               +   +   +   microtubule-based movement
                                protein amino acid glycosylation; macromolecule
DPM2            +   +   +
                                biosynthesis
DPM3            +   +           carbohydrate metabolism
DPP10           +   +       +   proteolysis
DPP3            +       +       proteolysis
DPP7            +   +           proteolysis
DPP9            +   +           proteolysis
                           visual perception; organelle organization and
DTNBP1     +   +       +
                           biogenesis; sensory perception
                           protein amino acid dephosphorylation; response to
DUSP1      +
                           oxidative stress; cell cycle
                           protein amino acid dephosphorylation; MAPKKK
DUSP4      +   +   +       cascade; regulation of progression through cell
                           cycle
DUSP5      +   +   +   +   protein amino acid dephosphorylation
                           inactivation of MAPK activity; protein amino acid
DUSP6      +   +   +       dephosphorylation; regulation of progression
                           through cell cycle
                           frizzled signaling pathway; development; heart
DVL3           +           development; nervous system development;
                           intracellular signaling cascade
DYNC2LI1       +
                           retrograde axon cargo transport; visual behavior;
DYNLRB1        +
                           microtubule-based movement
DYNLT1     +   +
                           regulation of transcription, DNA-dependent;
E2F4           +           transcription; regulation of progression through
                           cell cycle
EBP        +               skeletal development; cholesterol biosynthesis
EBPL       +               sterol metabolism
                           lipid metabolism; fatty acid metabolism; fatty acid
ECH1       +   +           beta-oxidation; metabolism; generation of
                           precursor metabolites and energy
                           positive regulation of I-kappaB kinase/NF-kappaB
ECM1           +
                           cascade; transport
                           regulation of transcription, DNA-dependent; cell
EDF1       +   +   +   +
                           differentiation; transcription
                           positive regulation of cell proliferation; regulation
EDN1       +               of vasoconstriction; blood pressure regulation;
                           signal transduction; cell-cell signaling; pathogenesis
EEF1B2     +               translational elongation; protein biosynthesis
EFHD1          +
EFNA2          +           cell-cell signaling
                           cell-cell signaling; nervous system development;
EFNA5      +   +   +   +
                           cell differentiation
                           angiogenesis; vasculogenesis; blood vessel
EGFL7      +   +
                           development; regulation of cell migration
                           regulation of transcription, DNA-dependent;
EGR1       +   +
                           transcription
                           mechanosensory behavior; regulation of
                           transcription, DNA-dependent; brain development;
EGR2           +
                           peripheral nervous system development;
                           transcription
EHD1       +   +       +   biological process unknown
EIF1AY     +   +           translational initiation; protein biosynthesis
EIF4E2     +   +   +       translational initiation; regulation of translation
                           positive regulation of transcription from RNA
                           polymerase II promoter; regulation of
ELF4           +
                           transcription, DNA-dependent; natural killer cell
                           proliferation; transcription; NK T cell proliferation
ELOF1      +
EMID2      +   +       +   phosphate transport
EML3       +   +
                          cell growth; development; cell death; epidermis
EMP1      +
                          development; cell proliferation
EMP2      +       +       development; cell death; cell proliferation
                          cell adhesion; signal transduction; neuropeptide
EMR1      +   +
                          signaling pathway
                          skeletal development; potassium ion transport;
EN1       +               regulation of transcription, DNA-dependent;
                          morphogenesis
ENDOG     +   +           DNA metabolism
ENG       +   +           cell adhesion; organ morphogenesis; circulation
ENY2          +   +
EPLIN         +
EPPB9     +   +
EPSTI1    +   +
ERAL1         +           biological process unknown
ERCC1     +   +           DNA repair; nucleotide-excision repair
                          cell-cell signaling; cell proliferation; epidermal
                          growth factor receptor signaling pathway;
EREG      +
                          regulation of progression through cell cycle;
                          angiogenesis; cell differentiation
                          regulation of transcription from RNA polymerase II
ERF           +       +   promoter; cell proliferation; transcription;
                          regulation of progression through cell cycle
                          pyrimidine nucleoside metabolism; nucleobase,
                          nucleoside, nucleotide and nucleic acid
ERH       +   +
                          metabolism; regulation of progression through cell
                          cycle
ETHE1     +   +   +
ETV5      +   +           regulation of transcription, DNA-dependent
EVI2A     +
F25965    +   +
F8A1      +           +   biological process unknown
                          metabolism; L-phenylalanine catabolism; aromatic
FAH       +   +
                          amino acid family metabolism; tyrosine catabolism
FAIM      +       +       negative regulation of apoptosis; apoptosis
FAM38A    +       +
FAM38B    +
FAM50A    +   +   +
FAM51A1   +   +
FAM53B    +               biological process unknown
FAM58A    +   +       +
FAM64A        +
FAM65A    +       +
FAM66E    +           +
FAM70A    +   +   +
FAM70B        +   +
FAM73A        +       +
FAM73B    +   +   +
FAM77C        +
FAM79B    +   +
FAM80A        +       +
FAM82A     +
FAM84A     +       +   +
FAM84B     +
FAM89A             +
FAM89B         +       +
FAM96A         +
FAM96B         +
FAM98B         +   +   +
FAM98C     +   +   +
FAM9C          +
FAP            +           proteolysis
FASN       +   +           fatty acid biosynthesis
                           biological process unknown; protein biosynthesis;
FAU        +   +   +
                           protein modification
FBXO25     +   +   +       protein ubiquitination
FBXO31     +   +       +   ubiquitin cycle
FBXO32     +   +           ubiquitin cycle
FBXO44     +   +   +   +   ubiquitin cycle; protein catabolism
                           ubiquitin cycle; Wnt receptor signaling pathway;
FBXW4      +               development; embryonic limb morphogenesis;
                           ubiquitin-dependent protein catabolism
FBXW5          +   +       ubiquitin cycle
                           development; regulation of cell shape; organ
                           morphogenesis; actin cytoskeleton organization
FGD1           +   +       and biogenesis; signal transduction; filopodium
                           formation; regulation of Cdc GTPase activity;
                           cytoskeleton organization and biogenesis
                           signal transduction; cell-cell signaling; cell
FGF3                   +   proliferation; morphogenesis; regulation of
                           progression through cell cycle
                           cell growth; skeletal development; protein amino
FGFR1      +   +           acid phosphorylation; fibroblast growth factor
                           receptor signaling pathway; MAPKKK cascade
                           positive regulation of cell proliferation; blood
FGG            +       +   pressure regulation; signal transduction; protein
                           polymerization; platelet activation
FIBP           +           fibroblast growth factor receptor signaling pathway
FJX1       +
                           positive regulation of I-kappaB kinase/NF-kappaB
FKBP1A         +
                           cascade; protein folding
FKBP1B     +   +   +   +   muscle contraction; protein folding
FKBP7          +           protein folding
FLJ10157       +       +
FLJ10159   +           +
FLJ10661   +   +   +
FLJ11000   +   +
FLJ11773   +       +
FLJ12442       +
FLJ12688   +   +
FLJ12998   +   +           metabolism
FLJ13224       +
FLJ13231   +
FLJ13491   +   +
FLJ14351   +   +
FLJ20186   +               intracellular signaling cascade
FLJ20534   +   +
FLJ20625   +   +
FLJ20643   +   +   +
FLJ21272   +   +
FLJ21749   +   +
FLJ22386       +       +
FLJ22471               +
FLJ22688   +       +
FLJ25067   +   +
FLJ25393   +
FLJ25477   +           +
FLJ27352   +   +
FLJ32224       +
FLJ32682       +       +
FLJ33915   +   +       +
FLJ34048   +   +       +
FLJ36031       +       +
FLJ37035       +       +
FLJ37078   +           +
FLJ38482   +   +
FLJ39534   +
FLJ39616   +   +
FLJ40125   +   +
FLJ40919   +   +
FLJ41766   +
FLJ42709   +   +       +
FLJ45422   +   +           antigen presentation
FLJ90650   +   +           proteolysis
FNDC3B     +
FNDC4          +
FNDC6      +           +
                           positive regulation of cell proliferation; response to
                           virus; regulation of transcription from RNA
FOSL1      +           +
                           polymerase II promoter; cellular defense response;
                           chemotaxis
                           regulation of transcription, DNA-dependent;
FOXL2          +       +
                           transcription
                           regulation of transcription, DNA-dependent;
FOXP1          +       +
                           transcription
                           regulation of transcription, DNA-dependent;
FOXP3          +       +
                           immune response; transcription
FRAS1          +   +   +   cell communication
                           signal transduction; fibroblast growth factor
FRS3           +
                           receptor signaling pathway
FST        +   +   +       development; negative regulation of follicle-
                             stimulating hormone secretion
                             cell proliferation; immune response; intracellular
                             sequestering of iron ion; negative regulation of cell
FTH1         +   +
                             proliferation; iron ion homeostasis; iron ion
                             transport
FTHP1        +   +
FUNDC2           +   +
FXR2             +
                             negative regulation of calcium-dependent cell-cell
FXYD5            +
                             adhesion; ion transport; microvillus biogenesis
                             protein kinase cascade; signal transduction; protein
                             amino acid phosphorylation; biological process
FYB          +   +
                             unknown; immune response; NLS-bearing
                             substrate import into nucleus
                             frizzled signaling pathway; development; G-protein
FZD8         +   +   +
                             coupled receptor protein signaling pathway
G0S2         +   +           regulation of progression through cell cycle
                             response to pest, pathogen or parasite; immune
G1P3         +   +
                             response
                             protein targeting; protein transport; synaptic
GABARAPL2    +   +
                             transmission
GADD45GIP1   +   +
GAGE1        +   +           cellular defense response
                             galactose metabolism; nucleotide-sugar
GALE         +   +
                             metabolism; carbohydrate metabolism
GALIG        +   +   +
GALNS        +   +           glycosaminoglycan metabolism; metabolism
GALNTL4          +       +
GALNTL5      +   +       +
GAMT             +           muscle contraction; creatine biosynthesis
                             sperm motility; negative regulation of cell
GAS8             +           proliferation; negative regulation of Ras protein
                             signal transduction
                             regulation of transcription, DNA-dependent;
                             transcription; positive regulation of phagocytosis;
GATA2            +       +
                             phagocytosis; transcription from RNA polymerase II
                             promoter
                             regulation of transcription, DNA-dependent;
GATAD2B          +       +
                             transcription
GCNT1            +           protein amino acid O-linked glycosylation
                             oligosaccharide metabolism; protein amino acid N-
GCS1         +   +
                             linked glycosylation
                             signal transduction; cell-cell signaling; transforming
GDF15        +   +
                             growth factor beta receptor signaling pathway
GDPD1        +   +           glycerol metabolism
                             spliceosome assembly; spliceosomal snRNP
GEMIN6       +
                             biogenesis
GH1              +       +   signal transduction
GHR          +           +   skeletal development; endocytosis; growth
GIMAP2           +
GLB1L        +   +   +
                             peptidoglycan biosynthesis; regulation of cell
GLCE         +           +   shape; heparin biosynthesis; heparan sulfate
                             proteoglycan biosynthesis
                          development; regulation of transcription from RNA
                          polymerase II promoter; signal transduction;
GLI1          +
                          transcription; regulation of smoothened signaling
                          pathway
                          positive regulation of transcription from RNA
                          polymerase II promoter; negative regulation of
GLIS3         +           transcription from RNA polymerase II promoter;
                          regulation of transcription, DNA-dependent;
                          transcription
GLT8D2    +   +       +
GLTP      +   +           lipid transport
GLYATL2   +   +
                          regulation of transcription, DNA-dependent;
GM632         +
                          transcription
                          de novo' GDP-L-fucose biosynthesis; leukocyte
GMDS      +   +       +   adhesion; biosynthesis; nucleotide-sugar
                          metabolism; carbohydrate metabolism
GMPPA     +   +
GMPPB         +   +       biosynthesis
                          muscle contraction; G-protein coupled receptor
GNAO1     +   +       +   protein signaling pathway; signal transduction;
                          nervous system development; axon guidance
                          G-protein coupled receptor protein signaling
                          pathway; signal transduction; G-protein signaling,
GNAS          +       +
                          adenylate cyclase activating pathway; protein
                          secretion; pregnancy
                          G-protein coupled receptor protein signaling
GNG2      +   +       +
                          pathway; signal transduction
GNPTG     +   +
GOLGA2    +
                          intra-Golgi vesicle-mediated transport; ER to Golgi
GOSR1     +   +           vesicle-mediated transport; intracellular protein
                          transport
GP9           +       +   blood coagulation; cell adhesion
GPATC4    +   +
GPC5      +
GPNMB         +   +       negative regulation of cell proliferation
                          G-protein coupled receptor protein signaling
GPR103    +   +   +   +
                          pathway; signal transduction
                          signal transduction; neuropeptide signaling
GPR112    +   +       +
                          pathway
                          G-protein coupled receptor protein signaling
GPR146    +   +       +
                          pathway; signal transduction
GPR155    +   +       +   intracellular signaling cascade
                          G-protein coupled receptor protein signaling
GPR158    +   +       +
                          pathway; signal transduction
                          G-protein coupled receptor protein signaling
GPR37     +   +
                          pathway; signal transduction
                          G-protein coupled receptor protein signaling
GPR7          +   +       pathway; signal transduction; synaptic
                          transmission
                          phospholipid metabolism; development; response
GPX4      +   +
                          to oxidative stress
GRAMD1A       +
                          positive regulation of cell proliferation; signal
GRN       +   +
                          transduction; cell-cell signaling; cell proliferation
GRPEL1    +               protein import into mitochondrial matrix; protein
                            folding
                            actin filament severing; actin filament
GSN         +   +
                            polymerization; barbed-end actin filament capping
GSTM4       +   +       +   metabolism
GSTO2       +       +   +   metabolism
                            transcription initiation from RNA polymerase II
GTF2A2      +               promoter; regulation of transcription, DNA-
                            dependent; transcription
                            signal transduction; immune response; protein
GTPBP1      +   +       +
                            biosynthesis; electron transport
GTPBP6          +
                            nitric oxide mediated signal transduction;
GUCY1A3     +   +       +
                            circulation; cGMP biosynthesis
GUK1        +   +       +   GTP biosynthesis
H1FOO       +           +
                            nucleosome assembly; chromosome organization
H2BFS       +   +
                            and biogenesis (sensu Eukaryota)
HIST2H4         +   +
HAX1            +
HBE1        +               oxygen transport; transport
HBXIP       +   +           response to virus; viral genome replication
HCG4            +       +
                            regulation of transcription, DNA-dependent;
HCLS1       +
                            intracellular signaling cascade
HDGF2           +
HEBP2       +
HECTD2      +   +       +   ubiquitin cycle; oxygen transport
HEL308      +   +
HEMK1       +   +   +   +   DNA methylation; protein amino acid methylation
HERC2P4     +   +
                            regulation of transcription, DNA-dependent;
HES1        +   +   +
                            nervous system development
HES2        +   +       +   regulation of transcription, DNA-dependent
                            nervous system development; regulation of
HES4        +   +       +
                            transcription, DNA-dependent; cell differentiation
                            development; regulation of transcription, DNA-
HESX1       +
                            dependent; brain development
                            signal transduction; intracellular protein transport;
HGS         +   +
                            negative regulation of cell proliferation
HIGD1A      +
HINT1           +       +   signal transduction
HIRIP3      +   +   +       chromatin assembly or disassembly
                            nucleosome assembly; chromosome organization
HIST1H2AB   +   +
                            and biogenesis (sensu Eukaryota)
                            nucleosome assembly; chromosome organization
HIST1H2AC   +   +   +
                            and biogenesis (sensu Eukaryota)
                            nucleosome assembly; chromosome organization
HIST1H2AK   +   +
                            and biogenesis (sensu Eukaryota)
HIST1H2AL   +   +
                            nucleosome assembly; chromosome organization
HIST1H2BA   +
                            and biogenesis (sensu Eukaryota)
                            nucleosome assembly; chromosome organization
HIST1H2BB   +   +
                            and biogenesis (sensu Eukaryota)
                              nucleosome assembly; chromosome organization
HIST1H2BD     +
                              and biogenesis (sensu Eukaryota)
HIST1H2BG     +   +   +
HIST1H2BF     +   +
                              chromosome organization and biogenesis (sensu
HIST1H2BH     +   +
                              Eukaryota); nucleosome assembly
                              nucleosome assembly; chromosome organization
HIST1H2BJ     +   +
                              and biogenesis (sensu Eukaryota)
                              nucleosome assembly; chromosome organization
HIST1H2BM     +   +
                              and biogenesis (sensu Eukaryota)
                              nucleosome assembly; chromosome organization
HIST1H2BO     +   +
                              and biogenesis (sensu Eukaryota)
HIST1H3A      +   +
                              nucleosome assembly; chromosome organization
HIST1H3D          +   +
                              and biogenesis (sensu Eukaryota)
                              nucleosome assembly; chromosome organization
HIST1H3F          +
                              and biogenesis (sensu Eukaryota)
HIST1H3G          +   +
HIST1H4L      +
                              nucleosome assembly; chromosome organization
HIST2H2AA     +   +
                              and biogenesis (sensu Eukaryota)
                              nucleosome assembly; chromosome organization
HIST2H2BE     +
                              and biogenesis (sensu Eukaryota)
                              antigen presentation; antigen presentation,
HLA-A         +   +   +   +   endogenous antigen; antigen processing,
                              endogenous antigen via MHC class I
                              antigen presentation, endogenous antigen; antigen
HLA-C         +   +
                              processing, endogenous antigen via MHC class I
                              antigen presentation; antigen presentation,
                              endogenous antigen; biological process unknown;
HLA-C|HLA-B   +   +
                              antigen processing, endogenous antigen via MHC
                              class I
                              antigen presentation, exogenous antigen; antigen
                              processing, exogenous antigen via MHC class II;
HLA-DMA       +   +
                              detection of pest, pathogen or parasite; biological
                              process unknown; immune response
                              antigen presentation, exogenous antigen; antigen
HLA-DPA1      +   +           processing, exogenous antigen via MHC class II;
                              immune response
                              antigen presentation, exogenous antigen; antigen
HLA-DQA1      +   +           processing, exogenous antigen via MHC class II;
                              immune response
                              antigen presentation; antigen presentation,
HLA-F         +   +           endogenous antigen; antigen processing,
                              endogenous antigen via MHC class I
                              detection of pest, pathogen or parasite; antigen
                              presentation; antigen presentation, endogenous
HLA-G         +   +
                              antigen; cellular defense response; antigen
                              processing, endogenous antigen via MHC class I
                              regulation of transcription, DNA-dependent;
HLX1          +               transcription from RNA polymerase II promoter;
                              development
                              positive regulation of transcription; loss of
                              chromatin silencing; lipoprotein metabolism; DNA
                              unwinding during replication; chromosome
HMGA1         +   +       +   organization and biogenesis (sensu Eukaryota);
                              protein complex assembly; regulation of
                              transcription, DNA-dependent; lipid transport;
                              transcription; transmembrane receptor protein
                            tyrosine kinase signaling pathway; nucleosome
                            disassembly




                            nucleosome assembly; establishment and/or
                            maintenance of chromatin architecture; DNA
                            replication; regulation of transcription from RNA
HMGB2           +   +       polymerase II promoter; DNA unwinding during
                            replication; DNA repair; phosphoinositide-
                            mediated signaling; base-excision repair, DNA
                            ligation
                            generation of precursor metabolites and energy;
HMGCL           +
                            amino acid metabolism
HMGN3           +           biological process unknown
HMOX2       +   +   +   +   heme oxidation
HNMT        +   +           respiratory gaseous exchange
HNRPUL1     +   +           response to virus; RNA processing
                            regulation of transcription, DNA-dependent;
HOXA11      +   +       +
                            morphogenesis
                            development; determination of anterior/posterior
HOXB6       +   +       +   axis, embryo; regulation of transcription, DNA-
                            dependent
HPN         +               proteolysis
                            negative regulation of progression through cell
HRASLS3     +   +
                            cycle; biological process unknown; cell cycle
HSA272196   +   +
                            lipid metabolism; metabolism; glucocorticoid
HSD11B1     +
                            metabolism
                            metabolism; biological process unknown; estrogen
HSD17B1         +
                            biosynthesis
HSD17B7     +               steroid biosynthesis; metabolism
                            transcription from RNA polymerase II promoter;
HSF2BP      +   +
                            spermatogenesis
                            regulation of transcription, DNA-dependent;
HSF4            +       +   transcription; protein folding; response to unfolded
                            protein
HSPA5BP1    +   +       +
HSPC009     +   +
HSPC016     +   +
HSPC111     +   +
HSPC135     +   +
HSPC138     +   +
HSPC268     +   +
HTRA1       +   +           proteolysis; regulation of cell growth
                            glycosaminoglycan catabolism; carbohydrate
HYAL2       +
                            metabolism
HYAL3       +   +           carbohydrate metabolism
HYLS1           +       +
IFI35       +   +           response to virus; immune response
                            response to biotic stimulus; immune response;
                            regulation of progression through cell cycle; cell
IFITM1      +   +   +
                            surface receptor linked signal transduction;
                            negative regulation of cell proliferation
IFITM3          +           response to biotic stimulus; immune response
IFT20         +
                          signal transduction; regulation of cell growth;
IGFBP6    +   +
                          negative regulation of cell proliferation
IGLJ3     +
IGLL1     +   +           immune response
                          positive regulation of cell proliferation; cell surface
IL12RB1   +   +           receptor linked signal transduction; antimicrobial
                          humoral response (sensu Vertebrata)
IL15RA    +   +           signal transduction; cell proliferation
IL17B     +               cell-cell signaling; inflammatory response
IL17RB    +   +           regulation of cell growth; defense response
                          signal transduction; cell-cell signaling; apoptosis;
                          cell proliferation; negative regulation of cell
IL1B      +           +   proliferation; fever; regulation of progression
                          through cell cycle; antimicrobial humoral response
                          (sensu Vertebrata)
IL1F6     +               inflammatory response
IL1RAP    +               inflammatory response; protein complex assembly
IL21R         +           natural killer cell activation
                          signal transduction; cell proliferation; protein
IL2RG     +   +       +
                          complex assembly; immune response
IL4R      +               signal transduction; immune response
                          positive regulation of cell proliferation; cell surface
                          receptor linked signal transduction; cell-cell
IL6       +   +       +   signaling; humoral immune response; negative
                          regulation of cell proliferation; acute-phase
                          response
                          cell motility; neutrophil activation; regulation of
                          retroviral genome replication; calcium-mediated
                          signaling; sensory perception; regulation of cell
                          adhesion; G-protein coupled receptor protein
IL8       +               signaling pathway; cell-cell signaling; angiogenesis;
                          negative regulation of cell proliferation;
                          intracellular signaling cascade; induction of positive
                          chemotaxis; neutrophil chemotaxis; chemotaxis;
                          cell cycle arrest
IMMP1L    +   +           proteolysis
IMMP2L    +   +           proteolysis
                          morphogenesis; RNA processing; protein
IMP-3     +       +
                          biosynthesis
                          GTP biosynthesis; purine nucleotide biosynthesis;
IMPDH1    +   +   +       sensory perception; visual perception; GMP
                          biosynthesis
INCA      +   +           proteolysis; regulation of apoptosis
                          tryptophan catabolism; immune response;
INDO      +   +
                          pregnancy
                          negative regulation of transcription, DNA-
                          dependent; apoptosis; negative regulation of cell
ING4      +   +           proliferation; protein amino acid acetylation;
                          negative regulation of growth; cell cycle arrest; cell
                          cycle
                          positive regulation of follicle-stimulating hormone
                          secretion; skeletal development; hemoglobin
                          biosynthesis; negative regulation of follicle-
                          stimulating hormone secretion; negative regulation
                          of B cell differentiation; ovarian follicle
                          development; negative regulation of
                          phosphorylation; cell surface receptor linked signal
INHBA     +   +           transduction; cell-cell signaling; negative regulation
                          of interferon-gamma biosynthesis; nervous system
                          development; defense response; cell
                          differentiation; growth; response to external
                          stimulus; negative regulation of macrophage
                          differentiation; erythrocyte differentiation; cell
                          cycle arrest; induction of apoptosis; mesoderm
                          development
                          positive regulation of follicle-stimulating hormone
                          secretion; negative regulation of hepatocyte
                          growth factor biosynthesis; negative regulation of
INHBB     +       +       follicle-stimulating hormone secretion; ovarian
                          follicle development; defense response; cell
                          differentiation; growth; response to external
                          stimulus
INPP5A        +       +   cell communication
                          protein import into nucleus, docking; signal
IPO8          +
                          transduction; protein transport
IRF2BP1       +
                          response to virus; regulation of transcription, DNA-
IRF3      +       +       dependent; transcription; transcription from RNA
                          polymerase II promoter
IRX1          +   +       regulation of transcription, DNA-dependent
IRX5      +       +       regulation of transcription, DNA-dependent
                          regulation of transcription, DNA-dependent;
                          transcription from RNA polymerase II promoter;
ISGF3G    +   +           response to virus; cell surface receptor linked
                          signal transduction; protein ubiquitination;
                          immune response; transcription
ISOC2     +   +
                          integrin-mediated signaling pathway; cell-matrix
ITGA3         +
                          adhesion; cell adhesion
                          integrin-mediated signaling pathway; cell-matrix
ITGAX     +           +
                          adhesion; cell adhesion; organ morphogenesis
                          protein biosynthesis; integrin-mediated signaling
ITGB4BP   +   +
                          pathway; translational initiation
ITPA      +   +           nucleotide metabolism
ITPKA         +       +   signal transduction
ITPKB         +       +   signal transduction
                          development; regulation of transcription, DNA-
JARID2    +   +           dependent; central nervous system development;
                          transcription
JMJD2D        +
JTB       +   +
                          regulation of transcription from RNA polymerase II
JUNB          +
                          promoter; transcription
                          regulation of transcription from RNA polymerase II
JUND          +       +
                          promoter; transcription
KCNAB1        +       +   ion transport; potassium ion transport
KCNF1         +       +   potassium ion transport; cation transport
                            potassium ion transport; regulation of
                            transcription, DNA-dependent; two-component
KCNH5           +       +
                            signal transduction system (phosphorelay); cation
                            transport
KCNK4           +   +   +   ion transport; potassium ion transport
                            regulation of vasoconstriction; ion transport;
                            regulation of action potential; potassium ion
KCNMB4      +   +           transport; detection of calcium ion; generation of
                            action potential; synaptic transmission; regulation
                            of neurotransmitter secretion
                            ion transport; potassium ion transport; defense
KCNN4       +   +
                            response
KCTD17      +           +
KCTD4       +           +   potassium ion transport
                            ER to Golgi vesicle-mediated transport; protein
KDELR1      +
                            transport; intracellular protein transport
                            ER to Golgi vesicle-mediated transport; protein
KDELR3      +   +       +
                            transport
KIAA0319L   +   +           homophilic cell adhesion
KIAA0367        +       +
KIAA0460    +
KIAA0664        +   +       protein biosynthesis
KIAA0889    +   +
KIAA0913        +
KIAA1171        +       +
KIAA1199        +       +   sensory perception of sound
KIAA1205        +       +
KIAA1276    +   +
KIAA1279        +       +
KIAA1324        +       +
KIAA1505    +   +
KIAA1949    +
KIAA1977        +
KIAA2013        +       +
KIF18A          +           microtubule-based movement
KIF9        +   +           microtubule-based movement
KIN         +   +   +
KIR3DL3     +
KLC2        +   +       +   microtubule-based movement
                            regulation of transcription, DNA-dependent;
KLF13           +   +   +   transcription; transcription from RNA polymerase II
                            promoter
                            regulation of transcription, DNA-dependent;
KLF2        +   +
                            transcription
                            cell growth; B cell differentiation; regulation of
KLF6        +   +           transcription, DNA-dependent; biological process
                            unknown; transcription
KLK4        +   +       +   proteolysis
                            intracellular protein transport; NLS-bearing
KPNA1           +       +   substrate import into nucleus; regulation of DNA
                            recombination
                            epidermis development; response to oxidative
KRT1            +
                            stress; fibrinolysis; complement activation, lectin
                            pathway; regulation of angiogenesis

KRT6IRS         +       +
KRTAP1-5    +   +       +   biological process unknown
KRTHB1          +       +
LAMB2           +           cell adhesion; synaptic transmission
LAPTM5      +   +
LARP2           +       +
LAX1            +           cation transport
LAYN        +
LBX2        +
                            C-terminal protein amino acid methylation; protein
LCMT1       +   +   +   +
                            modification
                            lipid metabolism; protein amino acid O-linked
LDLR        +   +   +       glycosylation; lipid transport; steroid metabolism;
                            endocytosis; cholesterol metabolism
LENG1       +   +
LENG4       +       +   +
LEPROT      +   +           biological process unknown
LHPP        +   +           metabolism
                            positive regulation of cell proliferation;
LIF         +           +   development; cell surface receptor linked signal
                            transduction; cell-cell signaling; immune response
LIMS1       +   +           cell aging
                            regulation of transcription from RNA polymerase II
LITAF       +   +           promoter; transcription; positive regulation of I-
                            kappaB kinase/NF-kappaB cascade
LMCD1       +   +           biological process unknown
LMTK3       +           +
LOC112869   +
LOC113444   +           +
LOC119358   +   +           mRNA processing
LOC124512       +
LOC124685   +   +
LOC127406   +   +           protein biosynthesis
LOC127545   +   +           protein biosynthesis
LOC128153       +
LOC128439   +   +
LOC129138   +   +
LOC130355   +   +
LOC131076   +           +
LOC134505   +   +
LOC138412   +   +       +
LOC144233   +   +
LOC147650       +
LOC147710   +
LOC150223   +           +
LOC151194   +   +
LOC151475   +   +
LOC152195   +
LOC152485       +
LOC153546   +   +
LOC153684       +
LOC155060       +           regulation of transcription, DNA-dependent
LOC158230   +   +       +
LOC163233   +   +       +
LOC201229   +   +       +
LOC221143   +   +
LOC253982   +           +   peptidyl-amino acid modification
LOC255783   +   +
LOC257039   +   +           protein biosynthesis
LOC283130   +               transport
LOC283337   +   +
LOC283731   +   +
LOC283951   +
LOC284001   +   +   +   +
LOC284184   +
LOC284262       +
LOC284379   +   +       +   amino acid transport
LOC284393   +   +           protein biosynthesis
LOC285053   +   +           protein biosynthesis
LOC285176   +   +           protein biosynthesis
LOC285593       +
LOC285740       +
LOC285741   +   +
LOC285944       +
LOC286016   +   +
LOC339123   +   +
LOC339942   +       +
LOC340286   +
LOC341511   +
LOC341604   +   +           protein biosynthesis
LOC342659       +
LOC347292   +   +           protein biosynthesis
LOC347544   +   +           protein biosynthesis
LOC375295   +   +           carbohydrate metabolism
LOC387745   +   +
LOC387763   +   +
LOC387880   +               protein folding
LOC387882   +   +
LOC388282   +   +
LOC388284   +   +
LOC388444       +
LOC388519   +   +       +
LOC388789   +   +
LOC388965   +   +
LOC389025       +
LOC389048   +
LOC389199       +   +
LOC389372       +   +
LOC389747   +       +   response to oxidative stress
LOC390006   +   +       protein folding
LOC390020   +   +
LOC390358   +   +       protein ubiquitination
LOC390364   +   +
LOC390498   +   +       microtubule-based process
LOC390732   +   +       metabolism; response to toxin
LOC391124   +   +
LOC391169   +   +
LOC391359   +   +
LOC391370   +   +
LOC391847   +   +       protein biosynthesis
LOC392447   +   +       protein biosynthesis
LOC392451   +   +       protein biosynthesis
LOC392531   +
LOC392872   +   +       protein biosynthesis
LOC400055       +       protein biosynthesis
LOC400664   +   +   +
LOC400948   +   +
LOC401431   +   +   +
LOC401848   +   +   +   ubiquitin cycle
LOC401887   +   +   +
LOC401895   +   +       protein biosynthesis
LOC401951       +
LOC402095   +           protein biosynthesis
LOC402176       +
LOC402397   +   +       isoprenoid biosynthesis
LOC440066   +   +   +   proteolysis
LOC440424   +   +
LOC440450   +   +
LOC440557       +
LOC440582   +   +       protein folding
LOC440588   +   +
LOC440715   +
LOC440733   +   +       protein biosynthesis
LOC440794   +       +
LOC441016   +   +   +
LOC441019   +
LOC441150   +   +
LOC441259   +   +       mismatch repair
LOC441468       +
LOC441481   +   +           response to oxidative stress
LOC441498   +
LOC441561   +   +           proteolysis
LOC441682   +
LOC441761   +   +       +
LOC441771   +   +
LOC441840   +               protein biosynthesis
LOC441861       +       +
LOC442022   +   +       +
LOC442047       +       +
LOC442175   +   +           translational elongation
LOC442181   +               protein biosynthesis
LOC442331   +   +           microtubule-based process
LOC442344   +   +           protein biosynthesis
LOC492311       +       +
LOC493856   +
LOC497661   +   +
LOC51035        +
LOC51234        +
LOC51334        +       +
LOC54103    +
LOC541471   +   +
LOC541472   +   +
LOC550631   +   +
LOC554203   +   +
LOC57228    +           +
LOC89894    +   +
LOC90313    +       +
LOC90379    +
LOC90580    +   +
LOC90835        +
LOC91149    +
LOC91664    +   +
LOC92249    +   +
LOC92659        +
LOC93343    +
LOR         +               keratinization
LRFN4           +   +
LRP10       +   +           endocytosis
LRRC1           +   +
LRRC17      +   +
LRRC21          +           biological process unknown
LRRC28      +   +
LRRC44          +   +   +
LSM10       +   +           nuclear mRNA splicing, via spliceosome
LSM4        +               nuclear mRNA splicing, via spliceosome; RNA
                           splicing
LSM7       +   +           nuclear mRNA splicing, via spliceosome
LSM8       +               nuclear mRNA splicing, via spliceosome
LTBP3      +
LY75       +               inflammatory response; endocytosis
LYNX1      +       +   +
                           negative regulation of progression through cell
LZTS2      +   +
                           cycle; cell cycle
MACF1      +       +       biological process unknown; cell cycle arrest
                           mitotic telophase; cell division; mitotic anaphase;
MAD1L1     +   +
                           mitotic checkpoint; mitotic metaphase; cell cycle
                           regulation of transcription, DNA-dependent;
MAF        +   +           transcription; transcription from RNA polymerase II
                           promoter
                           regulation of transcription, DNA-dependent;
MAFG       +   +       +   transcription; transcription from RNA polymerase II
                           promoter
MAGEC2     +               regulation of progression through cell cycle
MAGED4         +
MAGEF1     +   +
MAGEL2     +   +       +   biological process unknown
                           mannose metabolism; protein deglycosylation;
MAN2B1         +   +
                           protein modification; carbohydrate metabolism
MANBAL     +   +
MAP1A      +           +
                           ubiquitin cycle; autophagy; autophagic vacuole
MAP1LC3A   +   +       +
                           formation
                           cell motility; signal transduction; protein amino
MAP2K1         +       +
                           acid phosphorylation; chemotaxis
                           signal transduction; protein amino acid
MAP2K4         +       +
                           phosphorylation; JNK cascade
                           signal transduction; protein amino acid
MAP2K5         +
                           phosphorylation
MAP3K15    +               protein amino acid phosphorylation
                           activation of JNK activity; protein amino acid
MAP3K9                 +
                           autophosphorylation
                           protein amino acid phosphorylation; regulation of
MAPK3      +   +       +
                           progression through cell cycle
                           negative regulation of microtubule
MAPT       +   +       +   depolymerization; apoptosis; microtubule
                           cytoskeleton organization and biogenesis
MBNL2      +
                           G-protein signaling, coupled to cyclic nucleotide
MC5R           +
                           second messenger; signal transduction
MCEE       +   +   +       L-methylmalonyl-CoA metabolism
                           regulation of progression through cell cycle;
MCRS1          +
                           protein modification
MDGA1      +   +
MDS032     +               transport
                           negative regulation of transcription from RNA
MEN1           +           polymerase II promoter; regulation of
                           transcription, DNA-dependent
METRNL     +   +   +
MFGE8      +   +           cell adhesion; fertilization (sensu Metazoa)
MFSD2      +       +
MFSD4          +       +
MGC10986       +   +
MGC11082   +
MGC11335       +       +   metabolism; electron transport
MGC13008   +
MGC13040   +   +
MGC13159   +
MGC13170   +   +
MGC14141       +
MGC15416       +
MGC15523       +           amino acid transport
MGC16028   +   +
MGC16075   +   +       +
MGC16186               +
MGC16275   +
MGC16385       +           regulation of transcription, DNA-dependent
MGC16597   +   +
MGC19604   +   +       +   electron transport
MGC21830       +
MGC23280       +
MGC26647   +   +       +
MGC2731    +   +
MGC27348   +   +           protein biosynthesis
MGC27382   +   +
MGC29891   +   +
MGC32020   +   +
MGC3265        +
MGC33212       +       +
MGC42174   +
MGC4266        +       +
MGC43122   +           +
MGC4473    +           +
MGC4659        +       +
MGC47869   +   +
MGC48628       +
MGC52057       +
                           asparagine biosynthesis; glutamine metabolism;
MGC72080   +
                           amino acid biosynthesis; metabolism
MGC90512   +
MGC9850    +   +
MGC9913    +   +
                           lipid metabolism; inflammatory response; aromatic
MGLL       +   +
                           compound metabolism
MGMT       +   +   +   +   DNA ligation; DNA repair
                           lipid metabolism; signal transduction; antimicrobial
MGST3      +   +   +   +
                           humoral response (sensu Vertebrata)
                           negative regulation of microtubule
MID1IP1    +
                           depolymerization
                           prostaglandin biosynthesis; regulation of
                           macrophage activation; cell surface receptor linked
MIF            +   +       signal transduction; negative regulation of
                           apoptosis; cell proliferation; inflammatory
                           response
                           development; melanocyte differentiation;
MITF           +           regulation of transcription, DNA-dependent;
                           sensory perception of sound
                           regulation of transcription, DNA-dependent;
MLL4           +           chromatin-mediated maintenance of transcription;
                           transcription
MLPH       +               intracellular protein transport
MMAA       +   +
                           proteolysis; peptidoglycan metabolism; collagen
MMP1           +   +
                           catabolism
                           proteolysis; peptidoglycan metabolism; collagen
MMP13          +
                           catabolism
MMP17      +   +   +       proteolysis; peptidoglycan metabolism
                           proteolysis; peptidoglycan metabolism; collagen
MMP2           +
                           catabolism
MOBKL2A    +       +
MORG1      +
MPG        +   +           DNA dealkylation; base-excision repair
                           M phase of mitotic cell cycle; regulation of
MPHOSPH6   +
                           progression through cell cycle
                           cyanate catabolism; response to toxin; sulfate
MPST       +   +   +
                           transport
MRPL11     +   +           protein biosynthesis
MRPL12     +   +           protein biosynthesis
MRPL14         +
MRPL17     +   +           protein biosynthesis
MRPL2      +   +
MRPL20     +   +           protein biosynthesis
MRPL21     +   +           protein biosynthesis
MRPL22     +               protein biosynthesis
MRPL27     +   +           protein biosynthesis
MRPL38     +   +   +
MRPL4      +   +           protein biosynthesis
MRPL43     +   +       +
MRPL50     +   +
MRPL55     +   +
MRPS11     +   +           protein biosynthesis
MRPS12     +   +   +       protein biosynthesis
MRPS17     +   +           protein biosynthesis; transport
MRPS18C        +           protein biosynthesis
MRPS21         +   +       protein biosynthesis
MRPS23     +   +
MRPS25     +   +           protein biosynthesis
MRPS28     +               biological process unknown
MS4A3      +   +       +   signal transduction
MSI2        +   +   +
                            skeletal development; development; organ
MSX1            +           morphogenesis; regulation of transcription, DNA-
                            dependent
MT          +   +   +       fatty acid biosynthesis; metabolism
MT1A            +           biological process unknown
MT1X        +               response to metal ion
MT4         +               biological process unknown
                            circulation; amino acid metabolism; methionine
MTHFR       +
                            metabolism
MTIF3       +   +           translational initiation
                            G-protein signaling, coupled to cyclic nucleotide
MTNR1A      +   +           second messenger; circadian rhythm; signal
                            transduction; mating behavior
MTX1            +           protein transport
MUS81           +   +       DNA metabolism; DNA repair; DNA recombination
                            isoprenoid biosynthesis; phosphorylation;
MVD         +           +
                            cholesterol biosynthesis
MVP             +           response to drug
MYH11       +               striated muscle contraction; muscle development
                            regulation of muscle contraction; muscle
MYL5        +   +
                            development
                            cell motility; nervous system development; protein
MYLIP       +   +
                            ubiquitination
                            apoptosis; I-kappaB kinase/NF-kappaB cascade;
MYO18A      +
                            DNA metabolism; anti-apoptosis
MYOM2       +   +           striated muscle contraction; muscle development
NACAP1      +   +
                            N-acetylmannosamine metabolism; N-
NAGK        +   +
                            acetylglucosamine metabolism
                            protein targeting to lysosome; lysosome
NAGPA       +   +       +   organization and biogenesis; protein modification;
                            carbohydrate metabolism
                            carbohydrate biosynthesis; lipopolysaccharide
NANS        +   +
                            biosynthesis
NAP5        +   +           biological process unknown
                            membrane fusion; intra-Golgi vesicle-mediated
NAPA        +           +   transport; ER to Golgi vesicle-mediated transport;
                            intracellular protein transport
NBLA00301   +
NCF2        +               superoxide metabolism; cellular defense response
                            positive regulation of actin filament
                            polymerization; signal complex formation; negative
                            regulation of cell proliferation; intracellular
NCK2        +   +
                            signaling cascade; positive regulation of T cell
                            proliferation; regulation of epidermal growth
                            factor receptor activity; T cell activation
                            nervous system development; cell proliferation;
                            visual perception; sensory perception; vacuole
NDP         +   +
                            organization and biogenesis; signal transduction;
                            cell-cell signaling; sensory perception of sound
NDRG2       +   +   +   +   Cell proliferation and differentiation
                            protein amino acid sulfation; protein amino acid
NDST3       +   +       +
                            deacetylation
NDUFA4      +           +
NDUFB11     +
                            mitochondrial electron transport, NADH to
NDUFB3      +   +
                            ubiquinone
                            mitochondrial electron transport, NADH to
NDUFB4          +
                            ubiquinone; electron transport
                            mitochondrial electron transport, NADH to
NDUFB5      +
                            ubiquinone
                            mitochondrial electron transport, NADH to
NDUFB8      +           +
                            ubiquinone; electron transport
                            mitochondrial electron transport, NADH to
NDUFC2      +   +
                            ubiquinone
                            mitochondrial electron transport, NADH to
NDUFS3      +   +
                            ubiquinone; electron transport
                            mitochondrial electron transport, NADH to
NDUFV2      +   +
                            ubiquinone; nervous system development
                            integrin-mediated signaling pathway; cell adhesion;
                            regulation of progression through cell cycle; actin
NEDD9       +   +           filament bundle formation; cytoskeleton
                            organization and biogenesis; cell division; signal
                            transduction; regulation of cell growth; mitosis
NEFL        +   +   +   +
                            cell division; regulation of mitosis; protein amino
NEK2            +
                            acid phosphorylation; meiosis
NGFB        +   +           development; cell-cell signaling
                            ribosome biogenesis and assembly; nuclear mRNA
NHP2L1      +               splicing, via spliceosome; regulation of progression
                            through cell cycle
NICN1       +   +       +
NID2            +           cell-matrix adhesion; cell adhesion
NIF3L1BP1   +   +       +
NIFUN       +   +   +   +   iron-sulfur cluster assembly
NIPSNAP1    +       +   +
                            biological process unknown; nitrogen compound
NIT1        +   +
                            metabolism
NIT2        +   +
                            UTP biosynthesis; regulation of transcription, DNA-
                            dependent; nucleotide metabolism; nucleoside
                            triphosphate biosynthesis; GTP biosynthesis;
NME2        +   +
                            negative regulation of progression through cell
                            cycle; transcription; CTP biosynthesis; negative
                            regulation of cell proliferation; cell cycle
                            nucleotide metabolism; nucleoside triphosphate
NME6        +               biosynthesis; GTP biosynthesis; CTP biosynthesis;
                            apoptosis; UTP biosynthesis; anti-apoptosis
NNMT        +
NOD27       +
NOD9        +   +
NOLA1       +   +           rRNA processing
NOLA3       +   +           rRNA processing; pseudouridine synthesis
NOLC1                   +   rRNA processing; mitosis; cell cycle
NOTCH2NL    +   +
                           cell growth; stem cell maintenance; organ
                           morphogenesis; positive regulation of Ras protein
                           signal transduction; nervous system development;
                           regulation of transcription, DNA-dependent; Notch
NOTCH2     +   +           signaling pathway; cell differentiation;
                           transcription; negative regulation of cell
                           proliferation; regulation of development; cell cycle
                           arrest; hemopoiesis; anti-apoptosis; cell fate
                           determination; induction of apoptosis
                           signal transduction; regulation of transcription,
NPAS2      +   +   +   +   DNA-dependent; central nervous system
                           development
NPC2       +
NPHP3      +   +       +
                           actin cytoskeleton organization and biogenesis;
NPHP4          +       +   signal transduction; cell-cell adhesion; visual
                           behavior
NPM3       +   +           protein folding
                           central nervous system development; transport;
NPTX1      +   +       +
                           synaptic transmission
                           regulation of transcription, DNA-dependent;
NR1H2      +   +   +
                           transcription
                           signal transduction; regulation of transcription,
NR2F1      +   +   +
                           DNA-dependent; transcription
                           signal transduction; regulation of transcription,
NR2F6      +   +   +
                           DNA-dependent; transcription
NRIP2          +
                           cell adhesion; organ morphogenesis; cell-cell
                           signaling; positive regulation of cell proliferation;
NRP1           +   +
                           signal transduction; angiogenesis; nervous system
                           development; cell differentiation; axon guidance
NS3BP          +
                           regulation of transcription, DNA-dependent;
NSBP1          +
                           transcription
NT5E       +       +       nucleotide catabolism; DNA metabolism
NTE        +   +   +       lipid metabolism
                           base-excision repair; nucleotide-excision repair,
NTHL1      +   +
                           DNA incision, '-to lesion; carbohydrate metabolism
NUCB1      +   +
                           regulation of RNA export from nucleus; calcium-
                           mediated signaling; cyclic-nucleotide-mediated
NUDT10                 +
                           signaling; intracellular transport; intracellular
                           signaling cascade
NUDT16L1   +   +
NUDT18     +   +   +
                           nucleotide metabolism; D-ribose catabolism;
NUDT5      +   +
                           ribonucleoside diphosphate catabolism
NUDT8      +   +
NUP188         +   +
NUP214         +           transport
                           cell death; regulation of Ras protein signal
                           transduction; cell surface receptor linked signal
                           transduction; negative regulation of apoptosis;
NUP62      +               negative regulation of cell proliferation; positive
                           regulation of epidermal growth factor receptor
                           signaling pathway; transport; regulation of signal
                           transduction; negative regulation of nonapoptotic
                            programmed cell death




NUTF2           +           protein transport
                            response to virus; nucleobase, nucleoside,
OAS1        +   +           nucleotide and nucleic acid metabolism; immune
                            response
                            nucleobase, nucleoside, nucleotide and nucleic
OAS2        +   +
                            acid metabolism; immune response
OBFC1       +   +           biological process unknown
OGG1        +   +           base-excision repair; carbohydrate metabolism
OLFML2A         +
OLFML3      +   +
OPA3        +           +   sensory perception; visual perception
                            G-protein coupled receptor protein signaling
OR8D1       +               pathway; sensory perception; signal transduction;
                            sensory perception of smell
                            sensory perception; G-protein coupled receptor
OR8G2       +           +   protein signaling pathway; signal transduction;
                            sensory perception of smell
ORF1-FL49   +   +
ORM1        +           +   inflammatory response; acute-phase response
                            cholesterol transport; lipid transport; steroid
OSBPL5      +               metabolism; Golgi to plasma membrane transport;
                            cholesterol metabolism
OSR1        +   +   +
OTUB1       +   +       +   ubiquitin cycle; immune response
OVCH2       +   +       +
                            blood coagulation; G-protein signaling, coupled to
P2RY1       +   +
                            IP second messenger (phospholipase C activating)
                            proteolysis; negative regulation of transcription,
PA2G4       +   +
                            DNA-dependent; cell proliferation; cell cycle arrest
PADI3       +   +           protein modification
PAG1        +   +
PAK3            +       +   protein amino acid phosphorylation; development
PAQR3       +
PARC        +               protein ubiquitination; cell cycle
PARK7       +               Ras protein signal transduction; protein folding
PARP3           +           protein amino acid ADP-ribosylation; DNA repair
                            organ morphogenesis; regulation of transcription,
                            DNA-dependent; central nervous system
PAX6        +   +   +
                            development; visual perception; cell
                            differentiation; eye development
PBXIP1          +
                            positive regulation of transcription, DNA-
PCBD2       +   +   +
                            dependent
                            cell adhesion; homophilic cell adhesion; calcium-
PCDHB10         +           dependent cell-cell adhesion; synaptic
                            transmission; synaptogenesis
                            cell adhesion; homophilic cell adhesion; calcium-
PCDHB2          +           dependent cell-cell adhesion; synaptic
                            transmission; synaptogenesis
                          cell adhesion; homophilic cell adhesion; calcium-
PCDHB7    +   +
                          dependent cell-cell adhesion
PCGF1     +
                          regulation of transcription, DNA-dependent;
PCGF2     +   +   +
                          protein ubiquitination; transcription
PCNXL2    +
PCOLCE        +           development
PCOLCE2   +
PCSK1     +   +       +   proteolysis; metabolism; cell-cell signaling
PDAP1     +   +           signal transduction; cell proliferation
                          induction of apoptosis by extracellular signals;
PDCD6     +   +   +
                          apoptosis
PDE1C     +   +           signal transduction
PDE4A     +           +   cyclic nucleotide metabolism; signal transduction
                          actin cytoskeleton organization and biogenesis;
PDE4DIP   +       +   +   protein biosynthesis; cytoskeleton organization
                          and biogenesis
                          protein amino acid phosphorylation; cell
                          proliferation; transmembrane receptor protein
PDGFRA    +   +
                          tyrosine kinase signaling pathway; cell surface
                          receptor linked signal transduction
PECI      +               fatty acid metabolism; metabolism
PEX16     +   +           peroxisome organization and biogenesis
                          regulation of transcription, DNA-dependent;
PFDN5     +   +
                          protein folding
PFKFB4    +   +           metabolism; fructose ,-bisphosphate metabolism
PFKL      +               fructose -phosphate metabolism; glycolysis
PGC           +       +   proteolysis; digestion
PGCP      +               proteolysis
                          negative regulation of transcription, DNA-
PGEA1     +   +   +       dependent; protein localization; negative
                          regulation of Wnt receptor signaling pathway
PGPEP1    +               proteolysis
PH-4      +           +   protein metabolism
PHC2      +   +
PHF11     +               regulation of transcription, DNA-dependent
PHIP          +       +   insulin receptor signaling pathway
PHLDA1    +   +   +
PHLDA2    +   +   +   +   apoptosis; imprinting
PHLDA3    +   +
PHLDB1        +   +
PHLDB3        +
PHPT1     +   +   +       dephosphorylation
PIGP          +           biological process unknown
PIGV      +   +
                          signal transduction; protein amino acid
PIK3CD        +
                          phosphorylation
PIK3R1        +       +   intracellular signaling cascade
PIN1L     +   +       +   biological process unknown
                          protein kinase cascade; response to stress; protein
PINK1     +   +       +
                          amino acid phosphorylation
PKD2L2         +       +   cation transport
PKHD1      +           +
PKM2       +   +   +       glycolysis
PL6            +           signal transduction
                           blood coagulation; proteolysis; protein
PLAT       +
                           modification
                           blood coagulation; proteolysis; signal transduction;
PLAU       +
                           fibrinolysis; chemotaxis
                           regulation of proteolysis; cell motility; blood
PLAUR      +               coagulation; cell surface receptor linked signal
                           transduction; chemotaxis
PLEK           +           intracellular signaling cascade
PLEKHJ1    +   +
PLSCR2     +               phospholipid scrambling
PLXNA2     +   +   +   +   development
PLXNB2     +   +           development; biological process unknown
PMF1       +
                           regulation of transcription, DNA-dependent;
PML        +   +           protein ubiquitination; biological process unknown;
                           transcription
PMM1       +   +       +   metabolism; mannose biosynthesis
PNPLA1         +       +
PODXL2         +       +
POLD2      +   +           DNA replication
POLE4      +   +   +   +
POLR2H     +   +           transcription
POLR2J3    +   +           transcription
                           regulation of transcription from RNA polymerase I
                           promoter; transcription from RNA polymerase II
POLR2K     +
                           promoter; transcription; transcription from RNA
                           polymerase III promoter
                           DNA replication, synthesis of RNA primer;
POLRMT         +
                           transcription
POPDC2     +   +           biological process unknown
POPDC3     +   +           biological process unknown
PORCN      +   +       +   Wnt receptor signaling pathway
PPAP2B     +   +           lipid metabolism; germ cell migration
PPAPDC1A   +   +           microtubule-based movement
PPAPDC1B   +   +
PPCDC      +   +   +       coenzyme A biosynthesis
PPCS       +   +
PPGB       +   +           proteolysis; intracellular protein transport
PPOX       +   +           heme biosynthesis; electron transport
PPP1R11    +   +
PPP1R12C       +
                           response to DNA damage stimulus; apoptosis; cell
PPP1R15A   +   +
                           cycle arrest
PPP1R7     +   +       +   biological process unknown
                           regulation of apoptosis; response to oxidative
PRDX2      +   +   +
                           stress
PRDX4          +           I-kappaB phosphorylation
PRG1        +
PRH1        +   +       +
PRICKLE2    +   +       +
                            fatty acid biosynthesis; signal transduction;
PRKAB1      +
                            carbohydrate metabolism
                            fatty acid biosynthesis; signal transduction; protein
PRKAG1      +   +
                            amino acid phosphorylation; spermatogenesis
PRO1073     +   +
PRO1580     +   +
PRR4|FRYL   +   +       +   physiological process; visual perception
PRR7        +
PRR8        +
PRRT3       +           +
PRSS3       +   +       +   proteolysis; digestion
                            actin cytoskeleton organization and biogenesis;
PSCD2       +   +
                            endocytosis
PSG1        +               pregnancy
PSG4        +   +           defense response; pregnancy
PSG5        +               pregnancy
PSG7        +               pregnancy
                            proteolysis; humoral immune response; ubiquitin-
PSMB10      +   +
                            dependent protein catabolism
PSMB3       +       +       ubiquitin-dependent protein catabolism
PSMD9           +           ubiquitin-dependent protein catabolism
PSME2       +   +           immune response
                            negative regulation of progression through cell
PTCH        +   +           cycle; signal transduction; cell proliferation;
                            morphogenesis; cell cycle
PTD015      +   +
                            G-protein coupled receptor protein signaling
PTGER2      +   +
                            pathway; signal transduction
                            cell death; G-protein coupled receptor protein
PTGER3                  +   signaling pathway; signal transduction; biological
                            process unknown; transcription, DNA-dependent
                            positive regulation of cell proliferation; lactation;
                            cell-cell signaling; epidermis development;
PTHLH       +   +   +   +
                            negative regulation of cell proliferation; pregnancy;
                            cAMP metabolism
                            cell adhesion; signal transduction; protein amino
PTK7        +   +
                            acid phosphorylation
PTPN5                   +   protein amino acid dephosphorylation
                            phosphate metabolism; protein amino acid
PTPRD       +   +       +   dephosphorylation; transmembrane receptor
                            protein tyrosine phosphatase signaling pathway
PTPRE       +   +       +   protein amino acid dephosphorylation
PTPRN2      +           +   protein amino acid dephosphorylation
                            protein amino acid dephosphorylation;
PTPRT                   +   transmembrane receptor protein tyrosine kinase
                            signaling pathway
                            L-phenylalanine catabolism; central nervous
PTS         +               system development; amino acid metabolism;
                            tetrahydrobiopterin biosynthesis
PTTG2           +
PTX3        +               inflammatory response
                              regulation of transcription, DNA-dependent;
PURA          +   +
                              transcription; DNA replication initiation
                              cell-cell adhesion; entry of virus into host cell;
PVRL1                     +
                              immune response
PVRL3                     +
PVT1|COL6A1   +   +           cell adhesion; phosphate transport
PX19          +   +       +   development; immune response
PXMP2         +   +
                              signal complex formation; cell motility; cell-matrix
PXN               +
                              adhesion; signal transduction; cell adhesion
                              amino acid biosynthesis; proline biosynthesis;
PYCR2         +   +
                              electron transport
QPCT          +       +   +   proteolysis; protein modification
                              intracellular protein transport; small GTPase
RAB11B        +
                              mediated signal transduction
                              autophagy; protein transport; intracellular protein
RAB24         +   +           transport; small GTPase mediated signal
                              transduction
                              ER to Golgi vesicle-mediated transport; protein
RAB2B         +   +           transport; intracellular protein transport; small
                              GTPase mediated signal transduction
                              protein transport; small GTPase mediated signal
RAB31         +   +   +
                              transduction
                              intracellular protein transport; small GTPase
RAB32         +   +
                              mediated signal transduction
RAB42         +   +   +   +
                              intracellular protein transport; small GTPase
RAB7B         +   +   +   +
                              mediated signal transduction
                              intracellular protein transport; small GTPase
RAB7L1        +
                              mediated signal transduction
                              Golgi to endosome transport; intracellular protein
RAB9B         +   +       +   transport; small GTPase mediated signal
                              transduction
RABL5         +   +   +
RAD23A        +   +           nucleotide-excision repair; protein modification
RAG1AP1       +   +
                              signal transduction; intracellular protein transport;
RALA          +   +           small GTPase mediated signal transduction;
                              chemotaxis
                              intracellular protein transport; regulation of G-
RAMP1         +   +           protein coupled receptor protein signaling
                              pathway; transport
RANGNRF       +   +
RARRES1       +   +           negative regulation of cell proliferation
RASAL2        +   +   +   +   signal transduction
RASGEF1A      +   +       +
                              small GTPase mediated signal transduction; long-
RASGRF1                   +
                              term memory
                              intracellular signaling cascade; Ras protein signal
RASSF1        +   +   +   +
                              transduction; cell cycle arrest; cell cycle
RBM12B        +   +
                              estrogen receptor signaling pathway; regulation of
RBM9          +   +       +   cell proliferation; RNA metabolism; negative
                              regulation of transcription
RBMS2         +               regulation of translation; RNA processing
RBX1          +   +           protein ubiquitination
                                regulation of transcription, DNA-dependent;
RDBP
                                biological process unknown; transcription
                                response to toxin; regulation of transcription, DNA-
                                dependent; positive regulation of I-kappaB
RELA            +               kinase/NF-kappaB cascade; activation of NF-
                                kappaB transcription factor; anti-apoptosis;
                                transcription from RNA polymerase II promoter
RENBP           +               mannose metabolism; blood pressure regulation
                                telomerase-dependent telomere maintenance;
RFC1                +           DNA-dependent DNA replication; regulation of
                                transcription, DNA-dependent; transcription
RG9MTD3         +   +           tRNA processing
RGS10           +   +           negative regulation of signal transduction
                                negative regulation of signal transduction;
RGS3            +   +       +   inactivation of MAPK activity; regulation of G-
                                protein coupled receptor protein signaling pathway
RHBDL1          +   +   +       signal transduction
RHBDL2          +   +
RHBDL4          +       +
                                protein transport; small GTPase mediated signal
RHOC            +   +           transduction; positive regulation of I-kappaB
                                kinase/NF-kappaB cascade
RIBC2           +           +
RICTOR          +   +
RIN3            +           +   endocytosis; intracellular signaling cascade
RIP                 +
RNASEH2A        +   +   +       DNA replication; RNA catabolism
RNASET2         +   +           RNA catabolism
RNF113A         +   +           development; protein ubiquitination
RNF121          +               protein ubiquitination
RNF123          +   +           protein ubiquitination
RNF126              +       +   protein ubiquitination
RNF157          +   +           protein ubiquitination
RNF166              +       +
RNU3IP2         +   +           rRNA processing
RNUT1           +   +
RP1-32F7.2      +           +
RP11-175D17.5   +   +
RP11-19J3.3     +   +
RP11-323H21.4   +
RP11-5G9.1      +   +
RP11-93B10.1    +               gametogenesis
RP3-366L4.2     +               protein folding
RP3-402G11.12   +   +
RP4-742C19.3        +
RP4-747L4.3     +   +
RP5-1070B1.1    +   +
RP5-1104E15.4   +
RP5-821D11.2    +   +       +
RPA3            +   +           DNA replication; DNA repair
RPL17     +   +   +       protein biosynthesis
RPL18A    +   +           protein biosynthesis
RPL27     +   +           protein biosynthesis
RPL28     +   +   +       protein biosynthesis
RPL29     +   +           protein biosynthesis; embryo implantation
RPL36AL   +   +           protein biosynthesis
RPP40     +               tRNA processing
RPS10P3   +   +
RPS2          +           protein biosynthesis
RPS25     +
RPS27A    +   +           protein biosynthesis; protein modification
RPS29     +               protein biosynthesis
RPS4Y2P   +               protein biosynthesis
                          signal transduction; protein amino acid
RPS6KB2   +   +           phosphorylation; protein biosynthesis; regulation
                          of progression through cell cycle
RPS9      +   +           protein biosynthesis
                          cell adhesion; cell surface receptor linked signal
RPSA      +   +   +   +   transduction; regulation of translation; protein
                          biosynthesis
RPUSD3    +   +
RTN2          +       +   signal transduction
RUSC2     +           +
RUTBC1        +
RWDD2     +       +
                          apoptosis; regulation of transcription, DNA-
RYBP      +   +
                          dependent; transcription
S100A2    +   +           biological process unknown
S100A5    +   +
S100P     +   +
                          positive regulation of cell adhesion; negative
                          regulation of inflammatory response; regulation of
                          protein secretion; elevation of cytosolic calcium ion
SAA1      +   +           concentration; acute-phase response; macrophage
                          chemotaxis; neutrophil chemotaxis; platelet
                          activation; lymphocyte chemotaxis; positive
                          regulation of interleukin- secretion
                          regulation of transcription, DNA-dependent;
SAFB2         +
                          transcription
                          regulation of transcription, DNA-dependent;
SALL1     +   +
                          transcription; morphogenesis
SAMD14        +
SAMD6         +   +
                          regulation of transcription from RNA polymerase II
SAP18     +   +
                          promoter; transcription
SARM1
SAT       +   +   +   +
SATB2                     regulation of transcription, DNA-dependent
SBP1      +   +
                          protein transport; post-Golgi vesicle-mediated
SCAMP2        +
                          transport
SCAMP3        +           protein transport; post-Golgi vesicle-mediated
                           transport
                           cell adhesion; apoptosis; transport; cholesterol
SCARB1     +
                           metabolism
SCNM1      +
SCO2       +   +   +       electron transport; protein folding
SCRN2      +   +   +
                           regulation of transcription, DNA-dependent;
SCRT1                  +
                           transcription
SCUBE1     +       +   +
SCYL1      +   +
SCYL2          +   +       protein amino acid phosphorylation
SDC2       +   +   +   +   biological process unknown
                           nervous system development; intracellular
SDCBP2         +       +
                           transport; intracellular signaling cascade
SDF2       +   +           protein amino acid glycosylation
SDF2L1     +   +
SEC13L1    +   +   +       intracellular protein transport
                           ER to Golgi vesicle-mediated transport; vesicle-
SEC22L2        +   +
                           mediated transport
                           regulation of transcription, DNA-dependent;
SEDLP      +   +
                           transcription
SERINC2    +
SERPINB6   +
SERPINB7   +   +
SERPINC1   +   +           blood coagulation
                           positive regulation of cell proliferation; regulation
                           of transcription, DNA-dependent; transcription;
SERTAD1    +   +
                           regulation of cyclin dependent protein kinase
                           activity
SERTAD4    +   +
SESN2      +               cell cycle arrest
SF3B5      +   +           nuclear mRNA splicing, via spliceosome
SFRS16         +           nuclear mRNA splicing, via spliceosome
SFRS3      +   +           nuclear mRNA splicing, via spliceosome
SFXN3          +   +   +
SFXN5      +   +       +   cation transport; transport; iron ion transport
                           peptide hormone processing; regulation of
                           hormone secretion; neuropeptide signaling
SGNE1      +   +       +
                           pathway; intracellular protein transport; transport;
                           protein folding
SH3MD1         +           intracellular signaling cascade
SHB        +   +           intracellular signaling cascade
SHC4       +   +           intracellular signaling cascade
                           skeletal development; development; heart
SHOX2          +           development; nervous system development;
                           regulation of transcription, DNA-dependent
SIPA1L2    +
SITPEC     +   +
                           induction of apoptosis by extracellular signals;
SIVA       +   +
                           apoptosis; defense response
                           development; regulation of transcription, DNA-
SIX3       +       +
                           dependent; brain development; visual perception
SLC10A6      +   +
SLC14A1      +   +           urea transport; transport
SLC14A2          +       +   urea transport; transport
                             organic anion transport; monocarboxylic acid
SLC16A3      +   +   +
                             transport; transport
SLC22A17     +   +       +   ion transport
SLC22A18AS   +   +   +       biological process unknown
SLC22A7      +   +           ion transport; sodium ion transport; transport
SLC22A9          +       +
                             ion transport; potassium ion transport; calcium ion
SLC24A3      +   +
                             transport; sodium ion transport
SLC25A11     +   +           transport
SLC25A26     +
SLC25A30     +               mitochondrial transport; transport
SLC25A37     +   +           transport
                             homophilic cell adhesion; sulfate transport;
SLC26A6          +
                             neuropeptide signaling pathway; transport
SLC29A4          +       +   transport
SLC2A11      +   +           carbohydrate transport
                             carbohydrate transport; glucose transport;
SLC2A3       +   +       +
                             carbohydrate metabolism
SLC35A4      +   +   +
SLC35D2      +               biological process unknown
SLC44A3      +
SLC44A5          +
SLC5A12          +
SLC5A9       +               transport
SLC6A16          +           neurotransmitter transport
SLC6A4       +   +   +       neurotransmitter uptake; serotonin transport
SLC6A9       +               neurotransmitter transport; amino acid transport
                             ion transport; regulation of pH; sodium ion
SLC9A4       +           +
                             transport
SLD5         +   +   +
SLPI         +   +
                             regulation of transcription, DNA-dependent;
SMARCA3      +               protein ubiquitination; transcription; chromatin
                             modification
SMPX         +   +       +   striated muscle contraction
SMTN         +   +           smooth muscle contraction; muscle development
SMUG1        +               DNA repair; carbohydrate metabolism
                             neurotransmitter secretion; neurotransmitter
                             uptake; synaptic vesicle docking during exocytosis;
SNAP25       +   +       +
                             synaptic transmission; regulation of insulin
                             secretion
                             regulation of transcription, DNA-dependent;
                             transcription; transcription initiation from RNA
SNAPC5       +   +
                             polymerase III promoter; transcription from RNA
                             polymerase II promoter
                             protein amino acid phosphorylation; regulation of
                             progression through mitotic cell cycle; cell cycle;
SNF1LK       +   +
                             regulation of cell differentiation; protein kinase
                             cascade
                          protein transport; regulation of transcription, DNA-
SNF8      +   +
                          dependent; transcription
                          neurotransmitter secretion; synaptic vesicle
SNPH      +   +       +
                          docking during exocytosis
SNRPD2    +   +           nuclear mRNA splicing, via spliceosome
                          glycolysis; nuclear mRNA splicing, via spliceosome;
SNRPF         +           regulation of transcription, DNA-dependent;
                          transcription
SNX24     +   +           protein transport; intracellular signaling cascade
                          regulation of transcription from RNA polymerase II
                          promoter; response to superoxide; superoxide
SOD2      +               metabolism; response to oxidative stress; cellular
                          defense response (sensu Vertebrata); age-
                          dependent response to reactive oxygen species
                          intracellular protein transport; biological process
SORT1     +   +
                          unknown; endocytosis
                          negative regulation of ossification; negative
SOST      +   +
                          regulation of BMP signaling pathway
                          regulation of transcription, DNA-dependent;
SOX14     +   +   +
                          nervous system development; transcription
                          regulation of transcription, DNA-dependent;
SOX7                  +
                          transcription
SP8       +   +   +
SPAG7     +   +
SPAG8     +   +
SPANXA2   +   +           spermatogenesis
SPANXC    +   +       +
SPANXF1   +   +       +
SPATA7    +   +
SPBC25    +   +
SPECC1        +
                          positive regulation of progression through mitotic
                          cell cycle; positive regulation of smooth muscle
                          contraction; positive regulation of fibroblast
                          proliferation; positive regulation of angiogenesis;
                          calcium-mediated signaling; G-protein coupled
SPHK1         +   +   +
                          receptor protein signaling pathway; protein kinase
                          C activation; sphingosine metabolism; intracellular
                          signaling cascade; positive regulation of cell
                          migration; sphingoid catabolism; anti-apoptosis;
                          positive regulation of cell growth
SPIN1     +   +           transport
SPOCD1    +
                          cell-matrix adhesion; cell adhesion; cell-cell
                          signaling; immune cell chemotaxis; ossification;
                          regulation of myeloid cell differentiation; negative
SPP1      +               regulation of bone mineralization; T-helper type
                          immune response; induction of positive
                          chemotaxis; positive regulation of T cell
                          proliferation; anti-apoptosis
SPR       +   +           metabolism; tetrahydrobiopterin biosynthesis
SPRY1     +   +   +   +   development; regulation of signal transduction
                          development; organ morphogenesis; cell-cell
SPRY2     +   +
                          signaling; regulation of signal transduction
SPTAN1    +   +           barbed-end actin filament capping
SPTB          +       +   barbed-end actin filament capping
SPTLC1        +           biosynthesis; sphingolipid metabolism
SQRDL     +   +
SRA1      +   +   +
                          regulation of transcription from RNA polymerase II
SRCAP         +
                          promoter; DNA repair; chromatin modification
SRGAP3        +       +
                          protein targeting; negative regulation of
SRP9      +   +
                          translational elongation
SRPX2     +
SSBP1     +   +           DNA replication
SSBP4         +   +   +
SSFA2         +   +
SSH1          +           protein amino acid dephosphorylation
                          protein amino acid glycosylation; ganglioside
ST3GAL5   +   +
                          biosynthesis; carbohydrate metabolism
ST5       +   +
                          protein amino acid glycosylation; glycosphingolipid
ST8SIA1   +   +   +
                          biosynthesis; carbohydrate metabolism
STAC2         +
                          chromosome segregation; synaptonemal complex
STAG3     +       +
                          formation; meiosis; cell cycle
                          regulation of transcription from RNA polymerase II
                          promoter; signal transduction; regulation of
STAT6     +
                          transcription, DNA-dependent; transcription;
                          intracellular signaling cascade
STEAP1    +   +
STEAP1    +   +
                          positive regulation of cell proliferation; negative
STIM1         +   +   +   regulation of progression through cell cycle; cell-
                          cell adhesion; cell cycle
STK11         +           protein amino acid phosphorylation
                          nervous system development; intracellular
STMN3     +   +       +
                          signaling cascade
STOML2    +
STRA6         +
STX10     +       +       intracellular protein transport
                          intracellular protein transport; neurotransmitter
STX4A     +   +
                          transport
STX8      +   +           transport
                          RNA elongation from RNA polymerase II promoter;
                          positive regulation of transcription from RNA
                          polymerase II promoter; negative regulation of
                          transcription from RNA polymerase II promoter;
SUPT5H        +
                          regulation of transcription, DNA-dependent;
                          response to organic substance; chromatin
                          remodeling; retroviral genome replication; cell
                          cycle
SURF2     +   +       +   biological process unknown
SUSD4         +       +
SYNGR1    +   +       +
SYNJ2BP   +   +
SYT17     +           +   transport
SYTL3     +               intracellular protein transport
                           cell-cell signaling; insemination; synaptic
                           transmission; detection of abiotic stimulus;
TAC1       +   +   +   +
                           neuropeptide signaling pathway; tachykinin
                           signaling pathway
TACC2          +       +
                           transcription initiation; regulation of transcription,
TAF12      +   +
                           DNA-dependent; transcription
TAF15      +   +
TAF7L      +   +   +   +   regulation of transcription
                           amino acid biosynthesis; transcription initiation;
                           regulation of transcription, DNA-dependent;
TAF9       +
                           transcription; transcription from RNA polymerase II
                           promoter
TAGLN2     +   +   +       muscle development
                           cell proliferation; regulation of transcription, DNA-
TAL1           +
                           dependent; cell differentiation
TANC2          +
                           cell migration; regulation of cell shape; actin
                           cytoskeleton organization and biogenesis; positive
                           regulation of JNK cascade; response to stress;
TAOK2      +   +           regulation of cell growth; apoptosis; protein amino
                           acid phosphorylation; protein targeting to
                           membrane; focal adhesion formation; activation of
                           MAPKK activity
TAPBPL     +   +
TATDN3     +   +
TBC1D10A   +   +           biological process unknown
TBC1D17    +   +
TBC1D7     +
                           prostaglandin biosynthesis; blood coagulation;
TBXAS1     +   +
                           fatty acid biosynthesis; electron transport
TCEAL3     +   +       +
TCEAL4         +   +
TCL6       +   +       +   biological process unknown
                           cobalamin transport; cobalt ion transport; ion
TCN2       +   +
                           transport; transport
                           skeletal development; regulation of transcription
                           from RNA polymerase II promoter; regulation of
TEAD4      +   +
                           transcription, DNA-dependent; transcription;
                           muscle development
TEKT4      +   +
                           DNA replication and chromosome cycle; telomere
TEP1       +
                           maintenance
                           telomerase-dependent telomere maintenance; cell
TERF1          +           division; regulation of mitosis; regulation of
                           transcription; cell cycle
                           RNA-dependent DNA replication; telomere
TERT       +       +
                           maintenance
TETRAN     +   +           transport
TEX264     +   +
TF         +   +           transport; iron ion homeostasis; iron ion transport
                           regulation of transcription from RNA polymerase II
                           promoter; ectoderm development; signal
TFAP2A     +
                           transduction; regulation of transcription, DNA-
                           dependent; transcription
TFB1M     +
                          positive regulation of transcription; androgen
TGFB1I1   +   +           receptor signaling pathway; positive regulation of
                          transcription, DNA-dependent
                          development; negative regulation of transcription
TGIF      +   +           from RNA polymerase II promoter; regulation of
                          transcription, DNA-dependent
                          positive regulation of cell adhesion; G-protein
TGM2      +               coupled receptor protein signaling pathway;
                          peptide cross-linking
TGOLN2    +   +
THAP3     +   +
                          regulation of transcription, DNA-dependent;
THAP7     +   +
                          transcription
THBS3         +           cell motility; cell-matrix adhesion; cell adhesion
                          substrate-bound cell migration, cell extension; cell
THBS4         +   +
                          adhesion
THOP1     +   +           proteolysis
THSD1         +
                          thiamin metabolism; dephosphorylation;
THTPA         +       +   generation of precursor metabolites and energy;
                          cAMP biosynthesis
THY1      +   +       +   biological process unknown
THYN1     +   +
TIGA1     +   +
TIGD6         +
                          protein import into mitochondrial inner
TIMM13    +   +           membrane; protein transport; sensory perception
                          of sound
TIMP2         +   +
                          sensory perception; induction of apoptosis by
                          extracellular signals; visual perception;
TIMP3     +       +   +
                          transmembrane receptor protein tyrosine kinase
                          signaling pathway
TIMP4     +   +           biological process unknown
                          DNA replication; nucleobase, nucleoside,
TK2       +   +
                          nucleotide and nucleic acid metabolism
TLCD1     +   +
TLN1          +           cell motility; cytoskeletal anchoring
TMCC1     +           +
TMEM100   +   +
TMEM103   +   +
TMEM111   +
TMEM18    +   +
TMEM30B   +   +
TMEM41A   +
TMEM45A   +   +
TMEM47    +   +
TMEM60    +   +   +
TMEM76        +   +
TMEM80        +   +   +
TMEM93    +   +   +
TMEM99      +   +
TMEPAI      +   +   +       androgen receptor signaling pathway
TMPIT       +   +
TMSB10      +   +           cytoskeleton organization and biogenesis
TMTC1       +   +   +   +   RNA processing
TMTC4           +
TNC             +           cell adhesion
TNFAIP8L3       +
                            cell motility; cell adhesion; apoptosis;
TNFRSF12A   +   +   +
                            angiogenesis; cell differentiation
                            cell surface receptor linked signal transduction;
TNFRSF14    +   +
                            apoptosis; immune response
                            immune response; negative regulation of cell
TNFRSF9     +   +       +
                            proliferation; induction of apoptosis
                            signal transduction; cell-cell signaling; apoptosis;
TNFSF10     +   +           immune response; positive regulation of I-kappaB
                            kinase/NF-kappaB cascade; induction of apoptosis
                            cell proliferation; positive regulation of cell
TNFSF13B    +   +           proliferation; signal transduction; immune
                            response
TNFSF5IP1   +   +
                            regulation of muscle contraction; muscle
TNNT1       +   +       +
                            development
                            protein amino acid dephosphorylation;
TNS3        +           +
                            intracellular signaling cascade
                            cell-cell signaling; phosphorylation; inflammatory
TOLLIP      +   +   +   +   response; immune cell activation; intracellular
                            signaling cascade
TOP1P2      +   +
TP53INP2    +   +   +   +
TPCN1       +   +           cation transport
TPD52       +   +       +   morphogenesis
TPD52L1     +               biological process unknown
                            regulation of apoptosis; signal transduction;
TRAF1           +
                            protein complex assembly
TRAPPC3     +   +           ER to Golgi vesicle-mediated transport; transport
                            neurotransmitter receptor biosynthesis; vesicle-
TRAPPC4     +   +           mediated transport; dendrite morphogenesis; ER
                            to Golgi vesicle-mediated transport
TRAPPC5     +   +           ER to Golgi vesicle-mediated transport; transport
                            protein amino acid phosphorylation; regulation of
TRIB1       +       +
                            MAPK activity
TRIM17      +   +   +       protein ubiquitination; biological process unknown
TRIM26      +   +       +   protein ubiquitination
TRIM29      +   +           transcription from RNA polymerase II promoter
TRIM62          +   +       protein ubiquitination
                            barbed-end actin filament capping; actin
TRIOBP      +   +
                            modification
TRPC6       +   +   +       calcium ion transport; cation transport
TRPV1       +               calcium ion transport; cation transport
TRUB1           +       +   tRNA processing
TSC22D1     +   +           regulation of transcription
TSPAN1          +       +   cell motility; cell adhesion; cell proliferation
TSPAN14     +       +
TSPAN15         +   +
TSPAN33         +
TSPAN4      +   +   +       protein complex assembly
TSPAN9      +   +
TSPYL2      +   +       +   nucleosome assembly
TTC9C       +
TTLL11      +   +       +   protein modification
                            protein amino acid phosphorylation; muscle
                            contraction; biological process unknown; immune
                            response; protein amino acid autophosphorylation;
TTN             +       +
                            regulation of striated muscle contraction; muscle
                            development; mitosis; response to oxidative stress;
                            myofibril assembly; carbohydrate metabolism
                            microtubule-based movement; protein
TUBA2       +   +       +
                            polymerization
                            microtubule-based movement; protein
TUBB2A      +   +       +
                            polymerization
TUSC2           +       +
TWISTNB     +   +           transcription
TXN2        +   +           electron transport
U1SNRNPBP   +   +
U2AF1L3         +           cell cycle
U2AF1L4     +
                            positive regulation of transcription; long-term
                            strengthening of neuromuscular junction; ER-
                            associated protein catabolism; protein
UBA52       +       +
                            ubiquitination; regulation of synaptic plasticity;
                            axon guidance; protein biosynthesis; protein
                            modification; cell cycle
                            positive regulation of cell proliferation; ubiquitin
                            cycle; cell division; spindle organization and
UBE2C       +   +   +       biogenesis; phosphoinositide-mediated signaling;
                            ubiquitin-dependent protein catabolism; mitosis;
                            cyclin catabolism; cell cycle
UBE2D4          +
UBE2R2      +   +
UBE2S       +   +           ubiquitin cycle
UBIAD1      +   +       +
                            regulation of transcription from RNA polymerase I
UBTF        +   +           promoter; regulation of transcription, DNA-
                            dependent; transcription
                            ubiquitin cycle; ubiquitin-dependent protein
UCHL3       +   +
                            catabolism
                            proton transport; mitochondrial transport;
UCP2        +
                            transport
                            electron transport; mitochondrial electron
UCRC        +
                            transport, ubiquinol to cytochrome c
UFC1        +   +           ubiquitin cycle
ULBP2       +           +   natural killer cell activation; antigen presentation
ULBP2       +           +   natural killer cell activation; antigen presentation
                            signal transduction; protein amino acid
ULK1            +   +
                            phosphorylation
ULK4        +               protein amino acid phosphorylation
UNC45B        +
UNC84A        +
UNQ1912       +       +
UNQ501    +   +
UNQ9217   +   +
UPB1      +   +           nitrogen compound metabolism
UQCR          +           electron transport
                          heme biosynthesis; uroporphyrinogen III
UROS      +   +       +
                          biosynthesis
                          ubiquitin cycle; ubiquitin-dependent protein
USP11     +   +       +
                          catabolism
                          ubiquitin cycle; ubiquitin-dependent protein
USP16         +
                          catabolism; cell cycle
                          ubiquitin cycle; ubiquitin-dependent protein
USP18     +
                          catabolism
                          protein deubiquitination; ubiquitin-dependent
USP20     +   +   +
                          protein catabolism
                          ubiquitin-dependent protein catabolism; protein
USP48         +   +
                          modification
UXT           +   +       biological process unknown; protein folding
VAMP2         +       +   vesicle-mediated transport
                          positive regulation of cell proliferation; signal
                          transduction; angiogenesis; cell proliferation; cell
VEGFC     +           +
                          differentiation; substrate-bound cell migration;
                          regulation of progression through cell cycle
VGF           +       +   biological process unknown
VIL2      +       +       regulation of cell shape; cytoskeletal anchoring
                          positive regulation of cell proliferation; muscle
                          contraction; G-protein signaling, coupled to cyclic
VIPR1     +   +       +   nucleotide second messenger; digestion; signal
                          transduction; immune response; synaptic
                          transmission
VKORC1        +       +
                          regulation of transcription, DNA-dependent;
VPS25     +   +
                          protein transport; transcription
VPS28         +   +       protein transport
VPS29     +               protein transport
WBSCR18   +   +   +       protein folding
WDR54         +
WDR8      +   +   +
WIBG      +   +
                          Wnt receptor signaling pathway; development;
WIF1      +   +       +
                          signal transduction; cell-cell signaling
WNT5B     +   +           development; frizzled- signaling pathway
WTIP          +
XIST      +
XKR6          +
XKR8      +
XTP3TPA   +
XYLT1         +
YIF1A     +   +   +       biological process unknown
YIF1B     +   +
YPEL3         +   +   +
                          regulation of transcription, DNA-dependent;
ZBTB39        +
                          transcription
ZBTB8OS   +   +
ZC3H10    +   +
ZC3H6     +
ZCCHC17   +   +
ZCCHC9    +   +
                          peptidyl-diphthamide biosynthesis from peptidyl-
ZCSL2     +   +   +       histidine; positive regulation of binding; negative
                          regulation of protein secretion
ZDHHC12   +   +
ZDHHC4    +
ZFAND2A   +   +   +
ZFAND2B   +
ZFP57     +   +           regulation of transcription, DNA-dependent
ZFPL1     +   +           regulation of transcription
ZGPAT     +       +
                          regulation of transcription, DNA-dependent;
ZKSCAN1   +   +
                          transcription
ZMAT5     +   +
                          regulation of transcription, DNA-dependent;
ZNF205    +   +
                          transcription
                          regulation of transcription, DNA-dependent;
ZNF335        +       +
                          transcription
                          regulation of transcription, DNA-dependent;
ZNF393    +
                          transcription
                          regulation of transcription, DNA-dependent;
ZNF514        +
                          transcription
ZNF524    +   +   +
                          regulation of transcription, DNA-dependent;
ZNF559        +
                          transcription
ZNF574        +       +
ZNF576    +   +
                          negative regulation of transcription from RNA
ZNF593    +   +           polymerase II promoter; regulation of
                          transcription, DNA-dependent; transcription
                          regulation of transcription, DNA-dependent;
ZNF597    +   +       +
                          transcription
ZNF598    +   +
ZNF610    +
ZNF618    +
ZNF626    +
                          regulation of transcription, DNA-dependent;
ZNF646    +   +   +   +
                          transcription
ZNF651    +       +
                          regulation of transcription, DNA-dependent;
ZNF655    +
                          transcription
ZNF659    +   +       +
ZNF694        +   +       regulation of transcription, DNA-dependent
ZNF703    +       +
ZNF706        +
ZNF8      +               regulation of transcription, DNA-dependent;
                     transcription
ZNHIT3   +   +   +   regulation of transcription, DNA-dependent

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:30
posted:5/19/2012
language:English
pages:60