AFFYMETRIX SNP chips by wA7VNT61

VIEWS: 572 PAGES: 42

									   AFFYMETRIX
     SNP chips



 Karin Dahlman-Wright
Department of Biosciences
       and BEA
  Karolinska Institutet
                    Agenda

   Introduction
   AFFYMETRIX technology
   DNA analysis products

   www.affymetrix.com
Introduction
                       Milestones in Affymetrix history
                                                                                                                 Affymetrix
                                       Commercial Launch                                                         Japan KK

                                                                1st Expression                                        Human Genome
                                                                    Product                           DNA Analysis     2.0 Plus array



                          1st Microarray
Invention of the          Patent Issued                       IPO
  microarray                                                                                                                   Nimble
                                                                                                                              Express™


                                 Photolithography
 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004
                          Operate                                                          CustomExpress™     GeneChip®
                       Independently                                                                           Scanner
                                                                                                                3000
                                                        1st Catalog
                                     Commercial          Product
                                    DNA Microarray
  Invention of                        prototype
      the
   microarray                                                                                     Human
    scanner                                                                                       Genome             Rat and Mouse
                                                               GeneArray®         Sacramento
                                                                                 manufacturing   Set (U133)             Genome
                                                                Scanner                                                2.0 arrays
                                                                                    facility
                   Cover of
                   Science                 MD Scanner
Affymetrix Gene Chips




               Expression
               variability




               Sequence
               variability
      Genome analysis
                       Whole
 Candidate            genome
   gene              genotyping
  analysis




CustomSeq™
   30 Kb



                Mapping 10k and 100k
                 10,000 and 100,000
                      genotypes
AFFYMETRIX technology;
    The Gene Chip
 Photolithography 1




Probe DNA sequences are synthesized in
predetermined locations on glass wafers
using masks to activate photosensitized DNA
with UV light.
       Photolithography 2



Lamp




                 Mask       Array
Synthesizing oligonucleotide arrays
Manufacturing flexibility




49 Chips per Wafer   400 Chips per Wafer
            Probe construction
GeneChip Probe Array             Hybridized Probe Cell
                                                                  *       *
                                Single stranded,
                                labeled ‘target’
                                                            **        *
                          Oligonucleotide ‘probe’
                                                                              18 µm



                                                    Millions of copies of a specific
        1.28cm                                      oligonucleotide probe



                                                    >500,000 different
                                                    complementary probes




                       1.28cm
            Probe construction
GeneChip Probe Array             Hybridized Probe Cell

                                Single stranded,
                                labeled ‘target’
                          Oligonucleotide ‘probe’                *****
                                                                             11 µm



                                                    Millions of copies of a specific
        1.28cm                                      oligonucleotide probe



                                                    >1.300,000 different
                                                    complementary probes




                       1.28cm
            Probe construction
GeneChip Probe Array             Hybridized Probe Cell

                                Single stranded,
                                labeled ‘target’
                          Oligonucleotide ‘probe’
                                                                   *****
                                                                             8 µm



                                                    Millions of copies of a specific
        1.28cm                                      oligonucleotide probe



                                                    >2.500,000 different
                                                    complementary probes




                       1.28cm
DNA analysis products
Affymetrix mapping product timeline
1996   1997     1998      1999      2000      2001   2002      2003




                         HuSNP®                             Mapping 10K

               HuSNP® Mapping Assay:

                       1,500 SNPs
                 Multiplex PCR assay
              Allele specific hybridization
GeneChip® Mapping 10K System



GeneChip Mapping
    10K Assay                           GeneChip Scanner 3000
                     GeneChip Mapping
                        10K Arrays




 NetAffx SNP Annotation                   GDAS 2.0 Software
        Genome coverage:
11,555 SNPs, Mapping 10 K array




                   Median intermarker distance:   105 kb

                   Mean intermarker distance:     210 kb

                   Mean genetic gap distance:     0.32 cM

                   Average Heterozygosity         0 .37
Genome coverage;
   100K SNP




                  July 2003 NCBI bld 34



        Median intermarker distance:      8 kb

        Mean intermarker distance:     22.5 kb

        Average Heterozygosity         0 .29

        Average minor allele frequency 0.21
                  SNP tiling strategy
                           A/G

              GGTAGCCATGCANGAGTTACTACAG


PM Allele A   CCATCGGTACGTTCTCAATGATGTC
MM Allele A   CCATCGGTACGTACTCAATGATGTC

PM Allele B   CCATCGGTACGTCCTCAATGATGTC
MM Allele B   CCATCGGTACGTACTCAATGATGTC
                     ”Offset” probes
                         A/G

                  GCCATGCANGAGTTACTACAGTAGC


PM + 4 Allele A   CGGTACGTTCTCAATGATGTCATCG
MM +4 Allele A    CGGTACGTTCTCTATGATGTCATCG

PM +4 Allele B    CGGTACGTCCTCAATGATGTCATCG
MM + 4 Allele B   CGGTACGTCCTCTATGATGTCATCG
          Each SNP is interrogated by 40
                oligonucleotides

      PM A PM A PM A PM A PM A PM A PM A
      MM A MM A MM A MM A MM A MM A MM A
      PM B PM B PM B PM B PM B PM B PM B
      MM B MM B MM B MM B MM B MM B MM B


                        quartet

   7 quartets were evaluated and 5 were chosen to represent each SNP.
   Each SNP is interrogated on forward and reverse strand.
   A total of 10 quartets or 40 probes are used to interrogate one SNP.
   Dispersed probe pairs.
            GeneChip® mapping 10K;
                Assay overview
  Genomic DNA
 Xba      Xba   Xba
                         RE Digestion



                                                 Adapter
                      PCR: One Primer            Ligation
                       Amplification

                         Complexity
                         Reduction


Fragmentation
 and Labeling
                                  Hyb & Wash
                                               AA BB AB
                    Assay details

   250 ng genomic DNA
   50 ng/ul
   Reduced EDTA
   Amplify to 250 to 1000 base pair fragments
   DNA quality control?
                 Array performance

   Accurancy: > 99.5 %
    Concordance with single base extension over 20.000 calls
    Mendelian inheritance errors: 0.049 % over 30 trios
   Reproducibility: 99.96 %
    9 samples x 6 replicates
    3 caucasians, 3 african american, 3 asian
   Call rate: > 90 %
                    GDAS
   QA report
   Genotype call
             Discrimination score 1
   Ensures there is sufficient specific
    hybridization
             Forward                    (PMA-MMA)
                                   d=
PMA                                     (PMA+MMA)
MMA                               If MMA>PMA, discard
PMB
MMB
              Reverse
PMA
MMA
PMB
MMB
      Discrimination score 2
       Forward

PMA
                               Calculate 4 median
                   d fA
MMA                            discrimination score
PMB
MMB
                          Calculate d for SNP
       Reverse
PMA
                   d=Max (Min(dfA, drA), Min(dfB, drB)
MMA
PMB
                                  d > 0.08
MMB
                             RAS score 1

     A RAS score is calculated for each quartet
                      PMA-MMavg
             R=
                  (PMA-MMavg) + (PMB-MMavg)

                  Forward                     Reverse
PMA    100                             PMA
MMA    10                              MMA
PMB    10                              PMB
MMB    10                              MMB


             100-10
  R=                        = 1.0
       (100-10) + (10-10)
                  RAS score 2

     Determine median RAS score for forward
      and reverse strand
RASf
1.0
                    AA




            AB




0 BB                       RASr
                     1.0
10 k SNP array

       *
** * *
                    4200 SEK
            18 µm



*****               2050 SEK
        11 µm
      100 k SNP array



50 k Xba I      5250 SEK


                            *****
                                    8 µm




50 k Hind III    5250 SEK
 500 k SNP array




*****   5 µm
               To be launched Q1, 2005
               24 probes per SNP
       Mix and match
10 k                    100 k




       50 k     250 k
        Affymetrix CustomSeq™ arrays

                                    30kb double-stranded (60 kb total) sequence
                                     per chip
                                    sequence can be contiguous or dispersed, any
                                     organism

                                    Accuracy=>99.99%
                                    Reproducibility= >99.99%

    T    T   T   A   T   C       C     T   A    A   C    C    G    T    A
A
C
G
T
    Resequencing strategy

ATCGGTAGCCATACATGAGTTACTA
ATCGGTAGCCATTCATGAGTTACTA
ATCGGTAGCCATCCATGAGTTACTA
ATCGGTAGCCATGCATGAGTTACTA
ATCGGTAGCCATGCATGAGTTACTA CAGCT
TAGCCATCGGTACGTACTCAATGAT GTCGA
TAGCCATCGGTAGGTACTCAATGAT
TAGCCATCGGTACGTACTCAATGAT
TAGCCATCGGTATGTACTCAATGAT
TAGCCATCGGTAAGTACTCAATGAT
   Resequencing   tiling strategy
TCGGTAGCCATGAATGAGTTACTAC
 TCGGTAGCCATGCATGAGTTACTAC
 TCGGTAGCCATGGATGAGTTACTAC
 TCGGTAGCCATGTATGAGTTACTAC
ATCGGTAGCCATGCATGAGTTACTA CAGCT
TAGCCATCGGTACGTACTCAATGAT GTCGA
 AGCCATCGGTAGATACTCAATGATG
 AGCCATCGGTAGCTACTCAATGATG
 AGCCATCGGTAGGTACTCAATGATG
 AGCCATCGGTAGTTACTCAATGATG
    Resequencing tiling strategy

  CGGTAGCCATGCATGAGTTACTACA
  CGGTAGCCATGCCTGAGTTACTACA
  CGGTAGCCATGCGTGAGTTACTACA
  CGGTAGCCATGCTTGAGTTACTACA
ATCGGTAGCCATGCATGAGTTACTA CAGCT
TAGCCATCGGTACGTACTCAATGAT GTCGA
  GCCATCGGTACGAACTCAATGATGT
  GCCATCGGTACGCACTCAATGATGT
  GCCATCGGTACGGACTCAATGATGT
  GCCATCGGTACGTACTCAATGATGT
 Resequencing Tiling Strategy

   GGTAGCCATGCAAGAGTTACTACAG
   GGTAGCCATGCACGAGTTACTACAG
   GGTAGCCATGCAGGAGTTACTACAG
   GGTAGCCATGCATGAGTTACTACAG
ATCGGTAGCCATGCATGAGTTACTA CAGCT
TAGCCATCGGTACGTACTCAATGAT GTCGA
   CCATCGGTACGTACTCAATGATGTC
   CCATCGGTACGTCCTCAATGATGTC
   CCATCGGTACGTGCTCAATGATGTC
   CCATCGGTACGTTCTCAATGATGTC
HTA – High throughput assay
            BEA-NOVUM
Bio-informatics and Expression Analysis
              at NOVUM
    The objective is to support the KI/KS/HS cluster in the field of
     gene expression and bio-informatics.
    Supported by Karolinska Institute, board of research and
     Wallenberg Consortium North


 Functions                          Areas
    Provide infrastructure         Sequence analysis
    Provide analysis tools         Expression analysis
    Provide service                Human genetics
    Provide education

                              www.bea.ki.se

								
To top