Docstoc

187229Supplemental_Table_S3_primer_sequences

Document Sample
187229Supplemental_Table_S3_primer_sequences Powered By Docstoc
					Supplemental Table S3: Primer sequences used for qRT-PCR and cloning of VIGS vectors into pTV00 or full length seq
Name
NtAT1_CDS_primerFWD
NtAT1_CDS_primerRVS
Na12868_FWD
Na12868_RVS
AT11-34
AT12-33
12868_NdeI_pET23a
12868_XhoI_pET23a
Name
NtCV86_CDS_primerFWD
NtCV86_CDS_primerRVS
NaCV86_FWD_SP1
NaCV86_RVS_SP1
CV86_VIGS2_F_SalI
CV86_VIGS2_R_BamHI
CV86_fwd_NdeI
CV86_RVS_NotI
Name
NtDH29_CDS_primerFWD
NtDH29_CDS_primerRVS
NaBEAT_FWD_SP1
NaBEAT_RVS_SP1
BEAT1-32
BEAT2-31
NaBEAT_NdeI_pET23a
Beat_RVS_XhoI
NaBEATsil_FOR
NaBEATsil_REV
Name
MYB 8 f1
MYB 8 r1
Name
NaLOX3_FWD1
NaLOX3_RVS1
Table S3: Primer sequences used for qRT-PCR and cloning of VIGS vectors into pTV00 or full length sequences into pET23a for protein expression
                   Sequence (5'->3')                                                 Direction
                   GAAATTATTGCTTAGAAATAGTAAACC                                       forward
                   TTCATTTTAAACCTCATAGCTCCTT                                         reverse
                   TCACAAGGTTCACTTGTGGCTCTG                                          forward
                   GCATTTGCCTTGAGTTTGCCTAGG                                          reverse
                   GCGGCGGTCGACTCCTTCAATGTCTTTGACAACG                                forward
                   GCGGCGGGATCCCAATACTTCATCTAACGTGGC                                 reverse
                   TATATATACATATGAATGTGAAAATTGAGAGCTCAAG                             forward
                   GAGAGAGActcgagTTTTGCTTTCAAATCAAGAGAATAGC                          reverse
                   Sequence (5'->3')                                                 Direction
                   CTCCTTTCCATTGTAGTTTGCAAAC
                   AACATTGAAGTAAAACATTGATTCA
                   ATCAAATAGCTGAAGATGTC                                              forward
                   CCAACAAAGTAGTGCTGTACT                                             reverse
                   ATATATATAGTCGACTACTGCCTCGTATTCCTGGAGAG                            forward
                   TGTGTGTGTGGATCCGATCTTACTGCGCAAGTTGACTG                            reverse
                   ATATATATATCATATGGGTTCCCAATCTGCTGCCCTG                             forward
                   CACACACACATGCGGCCGCCCACTTAAAATAAGCCTTGATA                         reverse
                   Sequence (5'->3')                                                 Direction
                   TTACTCTGATATTTCTCTCCTATATCAA
                   TAAGTTGTACAAGATACGTATATGA
                   ATCAACTAGCCATTAGAATG                                              forward
                   CCAAAAATGATTTGCAAGGTC                                             reverse
                   GCGGCGGTCGACGAGGAAGTGGACGAATTCAC                                  forward
                   GCGGCGGGATCCCAACGGGGAAAATATCCTC                                   reverse
                   AGTTGACTATCATATGGGTTTCCTTTGTGCCAACCTG                             forward
                   TATATATATCTCGAGATTATTCAAAATAGTAAAAGTGTT                           reverse
                   GGCGGGCATTAATTCGTGCTTC                                            forward
                   CCGTTGCATCACGGATCAAAGC                                            reverse
                   Sequence (5'->3')                                                 Direction
                   AACCTCAAGAAACTCAGGACATACAA                                        forward
                   GATGAATGTGTGACCAAATTTTCC                                          reverse
                   Sequence (5'->3')                                                 Direction
                   GGCAGTGAAATTCAAAGTAAGAGC                                          forward
                   CCCAAAATTTGAATCCACAACA                                            reverse
00 or full length sequences into pET23a for protein expression analysis

                      Purpose                                   Gene
                      N. attenuata CDS cloning                  AT1
                      N. attenuata CDS cloning                  AT1
                      qRT-PCR                                   AT1
                      qRT-PCR                                   AT1
                      VIGs cloning                              AT1
                      VIGs cloning                              AT1
                      pET23a cloning                            AT1
                      pET23a cloning                            AT1
                      Purpose                                   Gene
                      N. attenuata CDS cloning                  CV86
                      N. attenuata CDS cloning                  CV86
                      qRT-PCR                                   CV86
                      qRT-PCR                                   CV86
                      VIGs cloning                              CV86
                      VIGs cloning                              CV86
                      pET23a cloning                            CV86
                      pET23a cloning                            CV86
                      Purpose                                   Gene
                      N. attenuata CDS cloning                  DH29
                      N. attenuata CDS cloning                  DH29
                      qRT-PCR                                   DH29
                      qRT-PCR                                   DH29
                      VIGs cloning                              DH29
                      VIGs cloning                              DH29
                      pET23a cloning                            DH29
                      pET23a cloning                            DH29
                      qRT-PCR (VIGs silencing efficiency)       DH29
                      qRT-PCR (VIGs silencing efficiency)       DH29
                      Purpose                                   Gene
                      qRT-PCR                                   MYB8
                      qRT-PCR                                   MYB8
                      Purpose                                   Gene
                      qRT-PCR                                   LOX3
                      qRT-PCR                                   LOX3

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:6
posted:4/15/2012
language:
pages:3