A generalist tymovirus of the tallgrass prairie

Document Sample
A generalist tymovirus of the tallgrass prairie Powered By Docstoc
					            A generalist tymovirus of the
                  tallgrass prairie



•Michael Palmer1
•Andrew Doust1
•Rick Nelson2
•Min Byoung2
•Vaskar Thapa1
•Marilyn Roossinck2
•Ulrich Melcher1
1Oklahoma State University
2Samuel Roberts Noble Foundation
Plant Virus Biodiversity and Ecology


 PVBE
 Methods
 Preliminary Results
 Confusions
Disclaimer: I am not a virologist
     Plant Virus Biodiversity and
           Ecology (PVBE)
An attempt to document the presence of viruses in
  plants of the Nature Conservancy’s Tallgrass
  Prairie Preserve, and to generate testable
  hypotheses
            PVBE People

     Virologists,
    ecologists,
    geneticists,
bioinformaticians,
computer scientists
Known viruses species are mostly from cultivated plants
           Plants of the Tallgrass Prairie Preserve
Abutilon theophrasti     Asclepias sullivantii    Carex granularis        Cryptotaenia             Dracopis                 Fuirena simplex           Lactuca ludoviciana     Nelumbo lutea           Pleopeltis              Rubus flagellaris         Spiranthes vernalis
Acalypha gracilens       Asclepias syriaca        Carex gravida           canadensis               amplexicaulis            Galactia regularis        Lactuca serriola        Nemastylis              polypodioides           Rubus occidentalis        Sporobolus
Acalypha ostryifolia     Asclepias tuberosa       Carex lanuginosa        Cucurbita foetidissima   Dryopteris marginalis    Galium aparine            Lamium amplexicaule     geminiflora             Poa annua               Rubus ostryifolius        compositus
Acalypha virginica       Asclepias verticillata   Carex leavenworthii     Cuscuta cuspidata        Echinacea pallida        Galium circaezans         Laportea canadensis     Nepeta cataria          Poa arida               Rudbeckia hirta           Sporobolus
Acer negundo             Asclepias viridiflora    Carex microdonta        Cuscuta indecora         Echinochloa crus-        Galium pilosum            Lechea mucronata        Nothoscordum bivalve    Poa compressa           Ruellia humilis           cryptandrus
Achillea millefolium     Asclepias viridis        Carex muehlenbergii     Cuscuta pentagona        galli                    Galium virgatum           Lechea tenuifolia       Nuttallanthus           Poa pratensis           Ruellia strepens          Sporobolus
Aegilops cylindrica      Asimina triloba          Carex nigromarginata    Cycloloma                Echinochloa muricata     Gamochaeta purpurea       Leersia oryzoides       canadensis              Poa sylvestris          Rumex altissimus          heterolepis
Aesculus glabra          Asplenium                Carya cordiformis       atriplicifolium          Eclipta prostrata        Gaura coccinea            Leersia virginica       Oenothera biennis       Polanisia dodecandra    Rumex crispus             Sporobolus
Agalinis aspera          platyneuron              Carya illinoinensis     Cynanchum laeve          Eleocharis               Gaura lindheimeri         Lepidium densiflorum    Oenothera laciniata     Polygala incarnata      Rumex hastatulus          pyramidatus
Agalinis heterophylla    Asplenium                Carya texana            Cynodon dactylon         montevidensis            Gaura longiflora          Lepidium virginicum     Oenothera linifolia     Polygala verticillata   Sabatia campestris        Sporobolus
Agalinis purpurea        rhizophyllum             Ceanothus               Cyperus acuminatus       Eleocharis obtusa        Gaura parviflora          Leptochloa              Oenothera speciosa      Polygonatum biflorum    Sagina decumbens          vaginiflorus
Agalinis tenuifolia      Asplenium                americanus              Cyperus bipartitus       Eleocharis palustris     Geranium                  fascicularis            Oenothera triloba       Polygonum               Sagittaria latifolia      Stachys tenuifolia
Agastache nepetoides     trichomanes              Celastrus scandens      Cyperus echinatus        Eleocharis parvula       carolinianum              Lespedeza bicolor       Oenothera villosa       arenastrum              Salix caroliniana         Staphylea trifolia
Ageratina altissima      Aster anomalus           Celtis laevigata        Cyperus erythrorhizos    Elephantopus             Geranium pusillum         Lespedeza capitata      Onosmodium molle        Polygonum aviculare     Salix nigra               Stellaria media
Agrimonia parviflora     Aster drummondii         Celtis occidentalis     Cyperus lupulinus        carolinianus             Geum canadense            Lespedeza cuneata       Ophioglossum            Polygonum               Salsola kali              Stipa comata
Agrimonia pubescens      Aster ericoides          Cenchrus carolinianus   Cyperus                  Eleusine indica          Glandularia               Lespedeza intermedia    engelmannii             convolvulus             Salvia azurea             Stipa curtiseta
Agrostis elliottiana     Aster falcatus           Cenchrus longispinus    pseudovegetus            Ellisia nyctelea         bipinnatifida             Lespedeza               Ophioglossum            Polygonum               Sambucus canadensis       Strophostyles helvula
Agrostis gigantea        Aster lanceolatus        Cephalanthus            Cyperus setigerus        Elymus canadensis        Glandularia               procumbens              vulgatum                hydropiper              Samolus valerandi         Strophostyles
Agrostis hyemalis        Aster oblongifolius      occidentalis            Cyperus squarrosus       Elymus hystrix           canadensis                Lespedeza repens        Opuntia macrorhiza      Polygonum               Sanicula canadensis       leiosperma
Agrostis scabra          Aster oolentangiensis    Cerastium fontanum      Cyperus strigosus        Elymus villosus          Gleditsia triacanthos     Lespedeza stuevei       Osmorhiza longistylis   hydropiperoides         Sanicula odorata          Stylosanthes biflora
Agrostis stolonifera     Aster patens             Cerastium               Cystopteris protrusa     Elymus virginicus        Glycyrhiza lepidota       Lespedeza violacea      Ostrya virginiana       Polygonum               Sapindus saponaria        Symphoricarpos
Alisma subcordatum       Aster praealtus          glomeratum              Cystopteris              Elytrigia repens         Gnaphalium                Lespedeza virginica     Oxalis dillenii         lapathifolium           Schedonnardus             orbiculatus
Allium canadense         Aster sericeus           Ceratophyllum           tennesseensis            Equisetum hyemale        obtusifolium              Leucanthemum            Oxalis stricta          Polygonum               paniculatus               Talinum calycinum
Allium stellatum         Aster subulatus          demersum                Dactylis glomerata       Equisetum laevigatum     Gossypianthus             vulgare                 Oxalis violacea         pensylvanicum           Schizachyrium             Talinum parviflorum
Allium vineale           Astragalus canadensis    Cercis canadensis       Dalea candida            Eragrostis capillaris    lepidota                  Leucospora multifida    Panicum anceps          Polygonum persicaria    scoparium                 Taraxacum
Alopecurus               Astragalus               Chaerophyllum           Dalea multiflora         Eragrostis cilianensis   Gratiola neglecta         Liatris aspera          Panicum capillare       Polygonum punctatum     Scirpus americanus        laevigatum
carolinianus             crassicarpus             tainturieri             Dalea purpurea           Eragrostis               Grindelia lanceolata      Liatris punctata        Panicum                 Polygonum               Scirpus atrovirens        Taraxacum officinale
Amaranthus albus         Astragalus               Chaetopappa             Danthonia spicata        curtipedicellata         Grindelia squarrosa       Liatris pycnostachya    dichotomiflorum         ramosissimum            Scirpus koilolepis        Tephrosia virginiana
Amaranthus hybridus      nuttallianus             asteroides              Dasistoma                Eragrostis hirsuta       Gymnocladus dioicus       Lindernia dubia         Panicum flexile         Polygonum scandens      Scirpus pendulus          Teucrium canadense
Amaranthus spinosus      Astranthium              Chamaecrista            macrophylla              Eragrostis intermedia    Gymnopogon                Linum medium            Panicum obtusum         Polygonum tenue         Scleria pauciflora        Thalictrum
Ambrosia                 integrifolium            fasciculata             Datura stramonium        Eragrostis pectinacea    ambiguus                  Linum rigidum           Panicum rigidulum       Polygonum               Sclerochloa dura          dasycarpum
artemisiifolia           Bacopa rotundifolia      Chamaecrista            Daucus carota            Eragrostis pilosa        Hackelia virginiana       Linum sulcatum          Panicum virgatum        virginianum             Scrophularia              Thelesperma filifolium
Ambrosia bidentata       Baptisia alba            nictitans               Daucus pusillus          Eragrostis spectabilis   Hedeoma hispida           Lithospermum incisum    Parietaria              Polytaenia nuttallii    marilandica               Thlaspi arvense
Ambrosia psilostachya    Baptisia australis       Chamaesyce maculata     Delphinium               Eragrostis trichodes     Hedyotis nigricans        Lobelia cardinalis      pensylvanica            Populus deltoides       Scutellaria lateriflora   Torilis arvensis
Ambrosia trifida         Baptisia bracteata       Chamaesyce              carolinianum             Erechtites               Helenium amarum           Lolium perenne          Paronychia fastigiata   Portulaca oleracea      Scutellaria ovata         Toxicodendron
Amelanchier arborea      Barbarea vulgaris        missurica               Descurania pinnata       hieraciifolia            Helenium autumnale        Lomatium                Parthenium              Portulaca pilosa        Scutellaria parvula       radicans
Ammannia coccinea        Bidens aristosa          Chamaesyce nutans       Descurania sophia        Erigeron annuus          Helianthus annuus         foeniculaceum           hysterophorus           Potamogeton foliosus    Sedum nuttallianum        Tradescantia
Amorpha canescens        Bidens bipinnata         Chamaesyce prostrata    Desmanthus               Erigeron                 Helianthus hirsutus       Lotus unifoliolatus     Parthenium              Potamogeton nodosus     Selaginella rupestris     occidentalis
Amorpha fruticosa        Bidens frondosa          Chamaesyce serpens      illinoensis              philadelphicus           Helianthus                Ludwigia alternifolia   integrifolium           Potentilla arguta       Senecio plattensis        Tradescantia ohiensis
Ampelopsis arborea       Boehmeria cylindrica     Chasmanthium            Desmanthus               Erigeron strigosus       maximiliani               Ludwigia palustris      Parthenocissus          Potentilla simplex      Senna marilandica         Tradescantia tharpii
Ampelopsis cordata       Bothriochloa             latifolium              leptolobus               Erigeron tenuis          Helianthus mollis         Ludwigia peploides      quinquefolia            Prenanthes aspera       Setaria glauca            Tragia betonicifolia
Amphiachyris             saccharoides             Cheilanthes lanosa      Desmodium canescens      Eriochloa contracta      Helianthus                Luzula bulbosa          Pascopyrum smithii      Prionopsis ciliata      Setaria parviflora        Tragopogon dubius
dracunculoides           Botrychium               Chenopodium album       Desmodium ciliare        Eryngium                 pauciflorus               Lycopus americanus      Paspalum floridanum     Proboscidea             Setaria viridis           Tribulus terrestris
Amphicarpaea             virginianum              Chenopodium             Desmodium                leavenworthii            Helianthus salicifolius   Lythrum alatum          Paspalum laeve          louisianica             Sibara virginica          Tridens flavus
bracteata                Bouteloua                ambrosioides            cuspidatum               Eryngium yuccifolium     Heliopsis                 Maclura pomifera        Paspalum pubiflorum     Prunella vulgaris       Sida spinosa              Tridens strictus
Anagallis minima         curtipendula             Chenopodium simplex     Desmodium                Erythronium              helianthoides             Malva rotundifolia      Paspalum setaceum       Prunus americana        Sideroxylon               Trifolium arvense
Andropogon gerardii      Bouteloua gracilis       Chloris verticillata    glutinosum               mesochoreum              Heliotropium tenellum     Malvastrum hispidum     Passiflora incarnata    Prunus angustifolia     lanuginosum               Trifolium campestre
Andropogon ternarius     Bouteloua hirsuta        Chrysopsis pilosa       Desmodium illinoense     Escobaria                Hibiscus trionum          Marrubium vulgare       Pedicularis             Prunus mexicana         Silene antirrhina         Trifolium pratense
Andropogon               Brickellia               Cicuta maculata         Desmodium                missouriensis            Hieracium longipilum      Marsilea vestita        canadensis              Prunus serotina         Silene stellata           Trifolium repens
virginicus               eupatorioides            Cinna arundinacea       marilandicum             Eupatorium               Hordeum pusillum          Matelea gonocarpos      Pediomelum              Psoralidium             Silphium integrifolium    Trifolium vesiculosum
Androsace                Bromus catharticus       Cirsium altissimum      Desmodium obtusum        altissimum               Houstonia pusilla         Medicago lupulina       argophyllum             tenuiflorum             Silphium laciniatum       Triodanis leptocarpa
occidentalis             Bromus japonicus         Cirsium undulatum       Desmodium                Eupatorium               Hymenopappus              Medicago minima         Pediomelum              Ptelea trifoliata       Sisymbrium officinale     Triodanis perfoliata
Anemone caroliniana      Bromus pubescens         Cirsium vulgare         paniculatum              coelestinum              scabiosaeus               Medicago sativa         esculentum              Ptilimnium nuttallii    Sisyrinchium              Tripsacum dactyloides
Antennaria neglecta      Bromus tectorum          Cissus incisa           Desmodium                Eupatorium               Hypericum                 Melica nitens           Pediomelum              Pycnanthemum            campestre                 Typha domingensis
Antennaria               Buchloe dactyloides      Claytonia virginica     pauciflorum              perfoliatum              drummondii                Melilotus officinalis   linearifolium           tenuifolium             Smilax bona-nox           Typha latifolia
plantaginifolia          Buchnera americana       Clematis pitcheri       Desmodium                Eupatorium serotinum     Hypericum                 Melothria pendula       Pellaea atropurpurea    Pyrrhopappus            Smilax herbacea           Ulmus americana
Apios americana          Callirhoe alcaeoides     Clematis virginiana     sessilifolium            Euphorbia corollata      hypericoides              Menispermum             Peltandra virginica     carolinianus            Smilax tamnoides          Ulmus rubra
Apocynum                 Callirhoe involucrata    Cocculus carolinus      Dianthus armeria         Euphorbia                Hypericum                 canadense               Penstemon cobaea        Pyrrhopappus            Solanum americanum        Utricularia gibba
cannabinum               Callitriche              Coelorachis             Diarrhena obovata        cyathophora              perforatum                Mentzelia               Penstemon tubiflorus    grandiflorus            Solanum carolinense       Valerianella radiata
Aquilegia canadensis     heterophylla             cylindrica              Dicentra cucullaria      Euphorbia dentata        Hypericum punctatum       oligosperma             Penthorum sedoides      Pyrus communis          Solanum dimidiatum        Verbascum thapsus
Arabis canadensis        Calylophus serrulatus    Commelina erecta        Dichanthelium            Euphorbia                Hypoxis hirsuta           Mimosa quadrivalvis     Perideridia americana   Quercus macrocarpa      Solanum                   Verbena bonariensis
Arctium minus            Calystegia sepium        Commelina virginica     acuminatum               heterophylla             Ipomoea pandurata         Mimulus alatus          Phalaris canariensis    Quercus marilandica     elaegnifolium             Verbena bracteata
Arenaria serpyllifolia   Camassia scilloides      Conium maculatum        Dichanthelium boscii     Euphorbia marginata      Iresine rhizomatosa       Minuartia patula        Phalaris caroliniana    Quercus                 Solanum ptychanthum       Verbena canescens
Argyrochosma             Cannabis sativa          Convolvulus arvensis    Dichanthelium            Euphorbia spathulata     Iris variegata?           Mirabilis albida        Phleum pratense         muehlenbergii           Solanum rostratum         Verbena hastata
dealbata                 Capsella bursa-          Convolvulus equitans    clandestinum             Euthamia                 Iva annua                 Mirabilis nyctaginea    Phryma leptostachya     Quercus prinoides       Solanum sarrachoides      Verbena simplex
Argythamnia              pastoris                 Conyza canadensis       Dichanthelium            gymnospermoides          Juglans nigra             Mollugo verticillata    Phyla cuneifolia        Quercus shumardii       Solidago canadensis       Verbena stricta
mercurialina             Cardamine hirsuta        Conyza ramosissima      linearifolium            Evax prolifera           Juncus acuminatus         Monarda citriodora      Phyla lanceolata        Quercus stellata        Solidago gigantea         Verbena urticifolia
Arisaema dracontium      Carex amphibola          Coreopsis grandiflora   Dichanthelium            Evolvulus nuttallianus   Juncus brachycarpus       Monarda fistulosa       Physalis angulata       Quercus velutina        Solidago                  Verbesina alternifolia
Arisaema triphyllum      Carex annectens          Coreopsis tinctoria     malacophyllum            Evonymus                 Juncus diffusissimus      Monolepis nuttalliana   Physalis longifolia     Ranunculus abortivus    missouriensis             Verbesina encelioides
Aristida longespica      Carex austrina           Cornus amomum           Dichanthelium            atropurpureus            Juncus dudleyi            Morus alba              Physalis pubescens      Ranunculus hispidus     Solidago nemoralis        Verbesina virginica
Aristida oligantha       Carex bicknellii         Cornus drummondii       oligosanthes             Festuca arundinacea      Juncus interior           Morus rubra             Physalis pumila         Ranunculus sceleratus   Solidago radula           Vernonia arkansana
Aristida purpurascens    Carex blanda             Corydalis crystallina   Dichanthelium            Festuca pratensis        Juncus marginatus         Muhlenbergia bushii     Physalis virginiana     Ratibida columnifera    Solidago rigida           Vernonia baldwinii
Aristida purpurea        Carex brevior            Corydalis micrantha     scoparium                Festuca                  Juncus tenuis             Muhlenbergia            Phytolacca americana    Rhus aromatica          Solidago ulmifolia        Veronica arvensis
Aristolochia             Carex bushii             Crataegus crus-galli    Dichanthelium            subverticillata          Juncus torreyi            capillaris              Pilea pumila            Rhus copallinum         Sonchus asper             Veronica peregrina
tomentosa                Carex caroliniana        Crotalaria sagittalis   sphaerocarpon            Fimbristylis puberula    Juncus validus            Muhlenbergia            Plantago aristata       Rhus glabra             Sorghastrum nutans        Viburnum rufidulum
Arnoglossum              Carex cephalophora       Croton capitatus        Dicliptera brachiata     Fragaria virginiana      Juniperus virginiana      schreberi               Plantago lanceolata     Rhynchospora            Sorghum halepense         Vicia sativa
plantagineum             Carex davisii            Croton glandulosus      Digitaria cognata        Fraxinus americana       Justicia americana        Muhlenbergia            Plantago major          glomerata               Spartina pectinata        Viola bicolor
Artemisia                Carex emoryi             Croton                  Digitaria ischaemum      Fraxinus                 Koeleria macrantha        sobolifera              Plantago patagonica     Rhynchospora harveyi    Spermolepis               Viola pedata
dracunculus??            Carex festucacea         lindheimerianus         Digitaria sanguinalis    pennsylvanica            Krigia cespitosa          Myosotis verna          Plantago pusilla        Ribes aureum            divaricata                Viola sororia
Artemisia filifolia      Carex fissa              Croton                  Diodia teres             Fraxinus                 Kummerowia                Myriophyllum            Plantago rugelii        Rorippa sessiliflora    Spermolepis inermis       Vitis riparia
Artemisia ludoviciana    Carex flaccosperma       monanthogynus           Diospyros virginiana     quadrangulata            stipulacea                pinnatum                Plantago virginica      Rosa carolina           Sphenopholis obtusata     Vulpia octoflora
Asclepias speciosa       Carex frankii            Croton texensis         Draba brachycarpa        Froelichia floridana     Kummerowia striata        Najas guadalupensis     Platanus occidentalis   Rosa multiflora         Spiranthes cernua         Woodsia obtusa
Asclepias stenophylla    Carex gracilescens       Croton willdenowii      Draba cuneifolia         Froelichia gracilis      Lactuca floridana         Nasella leucotricha                             Rubus allegheniensis    Spiranthes lacera         Xanthisma texanum
                Sandstone outcrops




                                                                            Sandstone
                                                      crosstimbers


                  Tallgrass
                   Prairie
Acidity, sand




                                        savannas




                                                                     Limestone or
                                                                      bottomland
                                                      mesic forest


                Shortgrass prairie /
                limestone outcrops



                                       Forest cover
                PVBE schema
                Extract nucleic                    Propose and
                                  Mine data and
                  acids and                       test ecological
Sample plants                        interpret
                  sequence                          hypotheses




                Current status
Plants are sampled without regard for symptoms
                         PVBE schema
                         Extract nucleic                    Propose and
                                           Mine data and
                           acids and                       test ecological
 Broad survey                                 interpret
                           sequence                          hypotheses




“target plant species”

Ambrosia psilostachya
   Asclepias viridis
  Panicum virgatum
 Sorghastrum nutans
  Vernonia baldwinii
    Ruellia humilis
  Selected target species




Ambrosia psilostachya, western ragweed   Asclepias viridis, antelope-horn milkweed      Panicum virgatum, switchgrass




  Sorghastrum nutans, Indiangrass          Ruellia humilis, wild/prairie petunia     Vernonia baldwini, western ironweed
Vegetation
monitoring
  plots




   10m
                         PVBE schema
                         Extract nucleic
                          Virus-like                          Propose and
                                             Mine data and
                           acids and
                            particle                         test ecological
 Broad survey                                   interpret
                           sequence
                           isolation                           hypotheses




“target plant species”

Ambrosia psilostachya
   Asclepias viridis
  Panicum virgatum
 Sorghastrum nutans              dsRNA isolation with
  Vernonia baldwinii             454 pyrosequencing
    Ruellia humilis
                         PVBE schema
                         Extract nucleic                        Propose and
                           Virus-like        Mine data and
                           acids and                           test ecological
 Broad survey               particle            interpret
                           sequence                              hypotheses
                            isolation




“target plant species”

Ambrosia psilostachya
   Asclepias viridis
  Panicum virgatum
 Sorghastrum nutans              dsRNA isolation with
  Vernonia baldwinii             454 pyrosequencing          Intense study of
    Ruellia humilis                                          Asclepias viridis
                                                                by RT-PCR
Laboratory method for double-stranded RNA purification

                                                                                                Mix vigorously
         Young leaves (5 g)                                                                        to form                Centrifuge
                                                                                                  emulsion
                                                        Grind in
                                                         liquid                                                                             Transfer top phase into
                                                                 Transfer into 50 ml tube
                                                        nitrogen                                                                                  new tube
                                                                     containing 10 ml
                                                                 extraction buffer and 10                                                                                           Final aqueous
                                                                         ml Ph:Ch                                                                                                       phase
                                                                                                                       Repeat Ph:Ch extraction

                                    Centrifuge
                                                                                                                                             Add absolute
                                     to pellet                        Add elution
                                                                                                                                             proof ethanol
                                     dsRNA                              buffer
 Decant and                                                                                                                                    (16,5% of
                                                                                    Wash in 6 time
 resuspend in 0,1                                                                                                                               aqueous
                                                                                    with application
 mM EDTA / 0.3                                                                                                                                  volume)
                                                                                         buffer
 M NaOAC
                                                                                                                              Pass through
                            Precipitate with                                                                                                                   Total NA (for bar
                                                 Transfer eluate to                                                            enocolumn
                            NaOAc and                                                                                                                         coding and making
                                                   a 15 ml tube                                                                 containing
                            EtOH overnight                                                                                                                   hybridization target)
                                                                                                                              CF11powder
                            at -20ْ C
                                                                                                                            cellulose binding
                                                                      1   2 3 4 Lad 1 kb
                                                                                                                           dsRNA (if ethanol
                                                                                                                             concentration is                             Buffers
      Transfer to a                                                                                                                                          Extraction buffer:    Application buffer:
microcentrifuge tube and                                                                                                         16,5%)                      0.1 M NaCl            0.1 M NaCl
                                     Resuspend in 50 mkl 0.1 mM                                                                                              50 mV Tris, pH 8      50 mM Tris, pH8
fill with cold ethanol to                                                                                                                                    1 mV EDNA, pH 8       0.5 mV EDTA, pH8
                                               EDTA                                   bp                                                                     1% SDS                16.5% Ethanol
      reprecipitate                                                                                                                                                     Elution buffer:
                                                                                      12,2                                                                              0.1 M NaCl
                                                                                      2       Vernonia baldwinii (line 1) and                                           50 mV EDTA, pH 8
                                                                                      1,6
                                                                                              Flavoparmelia sp. (line 4) have no dsRNA.
                                   Check the dsRNA by                                 1
                                                                                              Ambrosia psilostachya (line 2) and Parmelia
                                   electrophoresis on a                               506,5
                                                                                              sp1. (line 3) show bands for dsRNA
                                                                                      396
                                   1.5% agarose gel in                                344
                                                                                      298
                                       0.5X TBE II
                                                                                                            Protocol for ds RNA isolation adopted from M. Roossinck, 2005
      454 sequencing




Sophisticated, high-throughput system –
      but easier said than done
          Preliminary (2006) Results

  592 specimens analyzed

  296 plant species in 307 genera and 91 families

  308 specimens are positive for dsRNA (i.e. probable viruses)


                2007-2008 Results
not yet tabulated on project database

high rate of novelties detected by main methods

many ‘fungal’ viruses
BLAST results:

One virus is
 predominantly found in
 Asclepias viridis that
 appears that is distinct
 from, but has high
 similarity to,

Kennedya yellow
 mosaic tymovirus
                             http://virology.wisc.edu
From ICTVdB



Tymovirus

  Icosahedral virion
  ssRNA
  Genome 6000-7000nt
  Infects dicots
  Symptoms none to severe;
appear in leaves
  Transmitted by beetles
Virus-like particle        Asclepias viridis          Other species

                                                              Negative,
                                                                74
                      Positive, 9
                                         Negative,
                                            7


                                                     Positive, 5

                                                         Negative,
                                                           612
                        Positive,
dsRNA (454)




                          10
                                        Negative,
                                           7

                                                       Positive, 8
Tymovirus in Asclepias viridis

                              dsRNA
                    Negative No data Positive Grand Total
      Negative             3        3        1          7
VLP




      No data             4                 5          9
      Positive                     7        3         10
      Grand Total         7       10        9         26
Species                     # of positives
Ambrosia psilostachya             1
Amorpha fruticosa                 1
Asclepias viridis                 36
Asplenium rhizophyllum            1
Cephalanthus occidentalis         1
Croton monanthogynus              1
Cyperus acuminatus                1
Desmanthus illinoensis            1
Lythrum alatum                    1
Panicum virgatum                  2
Ruellia humilis                   2
Solanum rostratum                 1
Vernonia baldwinii                1
                                          Plot 208 (Swale)                                                                                                                                                                                           Asclepias viridis intensely sampled from 3
                                          2005, 2006, 2007
                                          (-, -,+)                                                                     4                   4
                                                                                                                                                   20
                                                                                                                                                                                                                                                     plots, (and sequenced from selections of two)
                                                                                                                       7                   8
                                                                                                   4
                                                                                                                   4
                                                                                                   5                                               15
                                                                                                           4       3           4
                                                                                                           4                   6
                                                                                                                   4
                                                                                                                   2
                                                                                                       4
                                                                                                       1                                           10
                                                                                                                           4                   3
                                                                                                   3
                                                                                                                           0                   9
                                                                                                   8
                                                                                                                           3
                                                                      4
                                                                                                                           7
                                                       5                          1                                                                5                                                                                                    1        2
                     Distance (m)




                                                                                                                                                                                                                                                                                            2        2
                                                           2                                                                                                                                                                                            8        0
                                                                                                                                                                                                                     1                                                                      2        4            1
                                                                 6        3                                                                                1                                                                                    1
                                                                                                                                       5                                                                             5                                           2                                                9
                                           9                          1                       1                                                            6                                                                                    7                                   2
                                                   1                                                                                   0                            1                                                                                            1
                                                                     81   7                   2                    4                             1                                                                                                                                  3
                                                   0                                                                                                                4
                                                                                                                   9                             30                                                                                                                                                                                                                                                 4
                                    -15                    -10                                -5       2                                       2
                                                                                                                                           3 0                                                 5                                          10                                        15                                    20
                                                                                                                                                                                                                                                                                                                                                                                                    8
                                                                                                       5                       2               8                                                                                                                                                                                                                                      4
                                                                                                               2                           1     3
                                                                                          3                                    7                                                                                                                                                                                                                                                      7
                                                                                                               6                                 2
                                                                                                                                                 0
                                                                                          2
                                                                                                                                                 9
                                                                                                                                                 -5                                                                                                                                                                                                             4
                                                                                                                                                                                                                                                                                                                                                                                              45        70
                                                                                                                                                                                                                                                                                                                                                                6                                       m
                                                                                                                                   3                                                                                                                                                                                                                                              4
                                                                                                                                   3                                                                                                                                                                                                                                              4
                                                                                                                                                   3
                                                                                                       3                   3                       -10
                                                                                                                                                   5                                                                                                                                                                                                                              4           40
                                                                                                       6                   4                                                                                                                                                                                                                                                      5


                                                                                                                                                                                                                                                                                                              Plot 307 (Sand creek)                                                   4
                                                                                                                                                   -15
                                                                                                                                                                                                                                                                                                                                                                    4
                                                                                                                                                                                                                                                                                                                                                                                      3
                                                                                                                                                                                                                                                                                                                                                                                          4 35
                                                                                                                                                                                                                                                                                                                                                                                          2
                                                                                                                                                                                                                                                                                                                                                                                                             Probability of equal
                                                                                                                                                        Distance (m)
                                                                                                                                                                                                                                                                                                              (+,+,+)                                               3
                                                                                                                                                                                                                                                                                                                                                                    1
                                                                                                                                                                                                                                                                                                                                                                                          4                  infection in each transect
                                                                                                                                                                                                                                                                                                                                                                    93




                                                                                                                                                                                                                                                                     Distance (m)
                                                                                                                                                                                                                                                                                                                                                                      8                   0
                                                                                                                                                                                                                                                                                                                                                                                              30
                                                                                                                                                                                                                                                                                                                                                                                                             <0.01
                                                                                                                                                                                                                                                                                                                                                                                  3
                                                                                                                                                                                                                                                                                                                                                                                  7                     25                 2
                                                                                                                                                                                                                                                                                                                                                                                                                  1   1
                                                                                                                                                                                                            25                                                                                                        9                  6   5                                                          m                  12 5
                                                                                                                                                                                                                                                                                                                                                                                                                  4   61
                                                                                                                                                                                                                                                                                    1               1                          8                            2                         4                                  2   2 0       2
                                                                                                                                                                                                                                                                                                    1                                                  3                                                      1        7               4
                                                                                                                                                                           4                                                                                                        2
                                                                                                                                                                                                                                                                                    1                                              7                                                  9                                  0
                                                                                                                                                                                                                                                                                                                  1                              4                   1                                        5            1       2
                                                                                                                                                                           8                                                                                             3                                                                                                                    0
                                                                                                                                                                                                   4                                                                                                              0                                                                                                        9       3
                                                                                                                                                                                                             4                                                        60m 50m                                         -25              -15                      -5                                            5               15           25
                                                                                                                                                                                       4           7
                                                                                                                                                                   4                                        20
                                                                                                                                                                                                             6
                                                                                                                                                                                       4                                                                                                                 40                                                          2                2
                                                                                                                                                                   5                       4                                                                                                             m                                                                            5
                                                                                                                                                                                                                                                                                                                                                                     6        2                -5
                                                                                                                                                                                           3
                                               Plot 343 (Stadia)                                                                                                                                   4
                                                                                                                                                                                                   2
                                                                                                                                                                                                                                                                                                                                                                              7 2

                                                                                                                                                                   4                                        15                                                                                                                                                                  8
                                                                                                                                                                   1                                                                                                                                                                                                  3         2             -10
                                           (+,-,+)                                                                                                                             3
                                                                                                                                                                               9
                                                                                                                                                                                                   4
                                                                                                                                                                                                   0
                                                                                                                                                                                                                                                                                                                                                                    32
                                                                                                                                                                                                                                                                                                                                                                      0
                                                                                                                                                                                                                                                                                                                                                                      3         3
                                                                                                                                                                                                                                                                                                                                                                                9
                                                                                                                                                                                                                                                                                                                                                                                1
                                                                                                                                                                                                                                                                                                                                                                                3
                                                                                                                                                                                                           3 10                                                                                                                                                     3           4
                                                                                                                                                                                                           8
                                                                                                                                                                                   3                                                                                                                                                                                                          -15
                                                                                                                                                                                   7                                                                                                                                                                 Distance (m)
Distance (m)




                                                                                                                                                                                                                                                                                                                                                                          3
                                                                              5                                                                                                                                                                                                                                                                                                                          30
                                                                                                                                                                                                                    1                                        2                                                                                                            5
                                                                                                                                                                                                                5                                                                       2                                                                                                                m
                                                                     8                                                                                                                                              4                                        0                                                2                                                               3
                                                                                                                                                               2                                 5                                                               1                      1                                                                                     6
                                               1                                                                                                       4                                                            1                     1                                                     2             4
                                                                                      6                                                                            3                             1
                                                                                                                                                                                                 5                                                               9                                            2
                                               0       9                                                                                                                                                            3             1       6                                                     2
                                      1                                   7                                                                                            1                       40                                 5                    1                            1                         3
                                      2                                                                                                                                                        9                0                                      7                            8
               -35
                                               1
                                               1
                                                           -25                                         -15                                                         -5                                                                 5
                                                                                                                                                                                                                                                    buffer
                                                                                                                                                                                                                                                                                                15                                      Red- Tymovirus infection
                                                                                                                                                                       2
                                                                                                                                                                       6
                                                                                                                                                                                               2
                                                                                                                                                                                               5                -5                                                                                                                      Black – no Tymovirus
                                                                                                                                                                                                                         buffer




                                                                                                                                                                         2                             2
                                                                                                                                                                       2 8                             7
                                                                                                                                                                   3   9                               3
                                                                                                                                                                   0 3     3                           1
                                                                                                                                                                     23    3                                3
                                                                                                                                                                                                            5
                                                                                                                                                                       4
                                                                                                                                                                           3                                                                   10m
                                                                                                                                                                           6

                                                                                                                                                                                                             -15
Presence of tymovirus in Asclepias viridis over time and space



 Plot      2005        2006             2007                               343 remote
                                                                                        343 (+,-)


 208     Negative    Negative    Positive (36%,18/50)
                                                                             307 (+,+)

                                      Positive          208 (-, -)
 307      Positive    Positive
                                    (66%, 33/50)

                                      Positive                       208 remote
 343      Positive   Negative
                                    (82%, 41/51)
                                          RT-PCR results for Asclepias viridis

                                                       positive   negative


                        2007 plots
Source of samples




                        2008 plots


                       2008 TGPP


                    2008 not TGPP


                                     0%     20%        40%          60%      80%   100%
                                                          % positive
Tymovirus presence in A. viridis tubers in plot 208 (RT-PCR)

                         (+/+)                                                             Plot 208 (Swale)
                                                                                                                               (Plant/ tuber)
                                                                                                20
                                                                                                                                   (-/-)
                                                                           47             48

                                                            45
                                                                       43
                                                                 44             46              15

                                                                       42
                                                                41
                                                                                                10
                                                                            40             39
                                                            38
                                                                            37
 Distance (m)




                                         4
                         5                        1                                             5                                                18 20
                             2                                                                                                                                22 24
                                                                                                                              15                                      19
                                 6            3                                                      16                                     17
                                                                                     50                                                             21
                9                        11            12                                                                                                23
                    10                                                                                           14
                                     8        7                        49                       13
                                                                                                    0
                                                                25                           28
 -15                         -10
                                     (-/-)                 -5                             31 0                         5    buffer     10                   15             20
                                                                                27
                                                      32
                                                                      26                      30                                                    (+/+)
                                                                                              29
                                                                                                 -5
                                                                                                        buffer




                                                                                 33
                                                                                                35
                                                                36          34                  -10




                                                                                                -15          Distance (m)
              Most viruses have relatively low proportion of reads in VLPs

               Exception: a new tymovirus, but only in Asclepias viridis.


Virus Genus                  Plant species                   # plant    # Reads/   Read
                                                           specimens    specimen    %
Ascovirus                    Artemisia ludoviciana            1               3    2.0
Badnavirus                   Ambrosia psilostachya            2              10    1.3
                             Sorghastrum nutans               1               3    1.0
Chrysovirus                  Asplenium rhizophyllum           1              27    11.9
Comovirus                    Asclepias viridis                1               4    0.7
Flexivirus                   Ambrosia psilostachya            2              97    25.4
Metapneumovirus              Desmanthus illinoensis           1               3    1.5
Coccolithovirus              Festuca subverticillata          1               2    0.8
                             Sorghastrum nutans               1               2    0.8
Ranavirus                    Panicum virgatum                 1               2    0.7
lambda-like phage            Ambrosia psilostachya            1               2    0.4
Tymovirus                    Amorpha fruticosa                1               2    0.7
                             Asclepias viridis                10             315   85.7
     Interpretation:         Asplenium rhizophyllum           1              33    14.6
        high titers          Cephalanthus occidentalis        1               4    1.1
                             Desmanthus illinoensis           1               7    3.5
Tymovirus reads from Virus-like Particles (positives only)




         Few reads mean that the genome is
         poorly sampled
                RT-PCR
                from
                capsid




Non-Asclepias
                 Asclepias
                 only




Interspecific   Capsid
comparison      comparison
               Analysis
Principal Components Analysis (PCA), with
  each position represented by four dummy
  variables (the four nucleotides).

AACAAGGACTACGGAGAACCCGTGGAA

The realized dimensionality is much less
 than sequence length x 4, because most
 positions are not variable.
   Common to all PCA results
~50% of variation can be explained by the
 first four axes

Axes higher than 2 do not add anything to
 the interpretation
                                                Tymovirus from Asclepias
   3.0
                                                viridis only

                                                         A group from plot 343 in two
                                                         different years


                                                         A group from many locations,
                                                         including most of plot 307 but
       PCA Axis 2




                                                         one from plot 343, and using
                                                         three methods
                                              SAMPLES
                                                                 Two outlier groups
                                                   vlp

                                                   ds

                                                   7.307

                                                   7.343
-3.0




                                                   8.343

                    -1.5                2.0
                           PCA Axis 1
   3.0
                                                         Capsid comparison


                                                             Location effects still evident


                                                         Most non-Asclepias samples
                                                         are similar to those from plot
                                                         307 Asclepias.
       PCA Axis 2




                                              SAMPLES

                                                   Ambrosia

                                                   Amorpha

                                                   Ruellia

                                                   av

                                                   307
-3.0




                                                   343

                    -1.5                2.0
                           PCA Axis 1
   4.0
                                                  Interspecific comparisons


                                              Some Non-Asclepias might be
                                              outliers, but this might be a
                                              methodological artifact, and the
                                              variation within Asclepias is huge
                                              relative to interspecific variation.
       PCA Axis 2




                                                SAMPLES

                                                       Asplenium

                                                       Ambrosia

                                                       Desmanthus

                                                       Panicum

                                                       Artemisia
-2.0




                                                       Asclepias viridis

                    -1.0   PCA Axis 1   3.0
•There are relatively few well-
supported clades

•Non-Asclepias samples are all
nested within well-supported
clades of Asclepias samples

•Does this imply other non-
Asclepias hosts are sinks?




    Outgroup
Confusions:


 Why does tymovirus reach high level only in Asclepias?

 Are non-Asclepias ‘sink’ populations? (note: there are several orders of
magnitude more non-Asclepias than Asclepias in the TGPP.)

 Are there two different strains?

 How does transmission within and between species occur? (milkweed
beetles are specialists)

 Are the sequence differences phylogenetic?

 Are there relevant structural differences in the RNA?

 Is the relationship parasitic, commensal, or mutualistic?

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:10
posted:4/13/2012
language:English
pages:41