Docstoc

Transcription and Translation Transcription and Translation

Document Sample
Transcription and Translation Transcription and Translation Powered By Docstoc
					Transcription and Translation
    Decoding DNA’s Information
   DNA carries instructions on how to
    make proteins
       Each protein’s instructions are in a gene
   These proteins determine your traits
   We need to “photocopy” a gene in
    order to produce the protein (trait)
    RNA = Ribonucleic acid
    Nucleic acid that is directly involved in the
   making of proteins
   The “photocopy” is called RNA
   Genes – segments of DNA nucleotides
    that code for specific proteins
   DNA is in nucleus, but cell’s “machinery” to
    make proteins is in the cytosol…how do we
    follow DNA’s instructions?
RNA vs. DNA Structure
   3 structural differences between
    RNA & DNA:
       1. RNA nucleotide has the sugar Ribose
        (not deoxyribose)
       2. RNA is single stranded
       3. RNA uses the base Uracil (U) instead
        of Thymine (T)
            a. A pairs with U instead
RNA…the “link” between DNA
and Proteins
   DNA must stay in the nucleus of a cell.
   Proteins are assembled at the ribosomes (in the
    cytoplasm).

3 different types of RNA used to make proteins:
       1. mRNA = (messenger RNA) carries
                    information from DNA to Ribosomes.
       2. tRNA = (transfer RNA) reads the mRNA and
                   brings the correct amino acid to build
                   the protein.
       3. rRNA = (ribosomal RNA) part of the
                  Ribosome that grabs on to the mRNA to
                  position it for protein synthesis to
                  occur.
Protein Structure

   Made up of amino acids
   Polypeptide- string of amino acids
   20 amino acids are arranged in
    different orders to make a variety of
    proteins
   Assembled on a ribosome
 Replication

             DNA


•DNA double helix unwinds
•DNA now single-stranded
•New DNA strand forms using
complementary base pairing (A-T, C-G)
•Used to prepare DNA for cell division
•Whole genome copied/replicated
Transcription and Translation: An
Overview (aka the Central Dogma)


              DNA
                     Transcription

              RNA
                      Translation

           Protein
 RNA vs. DNA
           DNA                     RNA
    Double stranded        Single stranded
    Deoxyribose sugar      Ribose sugar
    Bases: C,G A,T         Bases: C,G,A,U




Both contain a sugar, phosphate, and base.
Transcription
   The information contained in DNA is stored in
    blocks called genes
      the genes code for proteins
      the proteins determine what a cell will be
       like

   The DNA stores this information safely in the
    nucleus where it never leaves
      instructions are copied from the DNA into
       messages comprised of RNA
      these messages are sent out into the cell to
       direct the assembly of proteins
Transcription
   The path of information is often referred to
    as the central dogma

                DNA      RNA  protein

   The use of information in DNA to direct the
    production of particular proteins is called
    gene expression, which takes place in
    two stages

       transcription is the process when a messenger
        RNA (mRNA) is made from a gene within the DNA

       translation is the process of using the mRNA to
        direct the production of a protein
Transcription
                   RNA forms base
                    pairs with DNA
                       C-G
                       A-U
                   Primary transcript-
                    length of RNA that
                    results from the
                    process of
                    transcription
  TRANSCRIPTION

ACGATACCCTGACGAGCGTTAGCTATCG
UGCUAUGGGACU
WHY is TRANSCRIPTION Important?
   It is needed to get the DNA message out of
    the nucleus so the ribosomes know what
    protein to make!
   Without transcription, the ribosome would have
    no idea what proteins the body needed and
    would not make any.
   You could NOT replace the hair that we loose
    every day; could NOT grow long fingernails; be
    able to fight off diseases; cells would fall apart
    because the proteins were not being
    replaced!!
TRANSCRIPTION

DNA is copied into a complementary
 strand of mRNA.

WHY?
 DNA cannot leave the nucleus. Proteins
  are made in the cytoplasm. mRNA
  serves as a “messenger” and carries
  the protein building instructions to the
  ribosomes in the cytoplasm.
Please note that due to differing
operating systems, some
animations will not appear until
the presentation is viewed in
Presentation Mode (Slide Show
view). You may see blank slides
in the “Normal” or “Slide Sorter”
views. All animations will appear
after viewing in Presentation
Mode and playing each
animation. Most animations will
require the latest version of the
Flash Player, which is available at
http://get.adobe.com/flashplaye
r.
Major players in transcription

                      mRNA- type of
                       RNA that
                       encodes
                       information for
                       the synthesis of
                       proteins and
                       carries it to a
                       ribosome from
                       the nucleus
Major players in transcription
   RNA polymerase-
    complex of
    enzymes with 2
    functions:
       Unwind DNA
        sequence
       Produce primary
        transcript by
        stringing together
        the chain of RNA
        nucleotides
mRNA Processing
                     Primary transcript
                      is not mature
                      mRNA
                     DNA sequence has
                      coding regions
                      (exons) and non-
                      coding regions
                      (introns)
                     Introns must be
                      removed before
                      primary transcript
                      is mRNA and can
                      leave nucleus
Transcription is done…what now?

Now we have mature mRNA
 transcribed from the cell’s DNA. It
 is leaving the nucleus through a
 nuclear pore. Once in the
 cytoplasm, it finds a ribosome so
 that translation can begin.

We know how mRNA is made, but
 how do we “read” the code?
Translation

   Second stage of protein production
   mRNA is on a ribosome
Translation

   To correctly read a gene, a cell
    must translate the information
    encoded in the DNA (nucleotides)
    into the language of proteins
    (amino acids)
       translation follows rules set out by the
        genetic code
       the mRNA is “read” in three-nucleotide
        units called codons
            each codon corresponds to a particular
             amino acid
Translation

   The genetic code was determined
    from trial-and-error experiments to
    work out which codons matched
    with which amino acids

   The genetic code is universal and
    employed by all living things
Figure 13.2 The genetic code
(RNA codons)




There are 64 different codons in the genetic code.
     Translation
   Translation occurs in ribosomes, which
    are the protein-making factories of the
    cell
       each ribosome is a complex of proteins and
        several segments of ribosomal RNA (rRNA)
       ribosomes are comprised of two subunits
            small subunit
            large subunit
       the small subunit has a short sequence of
        rRNA exposed that is identical to a leader
        sequence that begins all genes
            mRNA binds to the small subunit
13.2 Translation

   The large RNA subunit has three
    binding sites for transfer RNA
    (tRNA) located directly adjacent to
    the exposed rRNA sequence on the
    small subunit
       these binding sites are called the A, P,
        and E sites
       it is the tRNA molecules that bring
        amino acids to the ribosome to use in
        making proteins
Figure 13.3 A ribosome is
composed of two subunits
Translation
   The structure of a tRNA molecule is
    important to its function
       it has an amino acid attachment site at
        one end and a three-nucleotide
        sequence at the other end
       this three-nucleotide sequence is called
        the anticodon and is complementary
        to 1 of the 64 codons of the genetic
        code
       activating enzymes match amino
        acids with their proper tRNAs
Figure 13.4 The structure of
tRNA.
Translation

   Once an mRNA molecule has bound
    to the small ribosomal subunit, the
    other larger ribosomal subunit binds
    as well, forming a complete
    ribosome
       during translation, the mRNA threads
        through the ribosome three nucleotides
        at a time
       a new tRNA holding an amino acid to
        be added enters the ribosome at the A
        site
Translation

   Second stage of protein production
   mRNA is on a ribosome
   tRNA brings amino acids to the
    ribosome
tRNA
          Transfer RNA
          Bound to one
           amino acid on one
           end
          Anticodon on the
           other end
           complements
           mRNA codon
tRNA Function

   Amino acids must be in the correct
    order for the protein to function
    correctly
   tRNA lines up amino acids using
    mRNA code
    Translation
   Before a new tRNA can be added, the
    previous tRNA in the A site shifts to the P
    site

   At the P site, peptide bonds from
    between the incoming amino acid and the
    growing chain of amino acids

   The now empty tRNA in the P site
    eventually shifts to the E site where it is
    released
Figure 13.5 How translation
works
Translation

   Translation continues until a “stop”
    codon is encountered that signals
    the end of the protein

   The ribosome then falls apart and
    the newly made protein is released
    into the cell
WHY is TRANSLATION Important?

  Makes all the proteins that the
   body needs
  Without translation, proteins
   wound not be made and we could
   not replace the proteins that are
   depleted or damaged
Please note that due to differing
operating systems, some
animations will not appear until
the presentation is viewed in
Presentation Mode (Slide Show
view). You may see blank slides
in the “Normal” or “Slide Sorter”
views. All animations will appear
after viewing in Presentation
Mode and playing each
animation. Most animations will
require the latest version of the
Flash Player, which is available at
http://get.adobe.com/flashplaye
r.
SUMMARY of PROTEIN
SYNTHESIS
DNA:   TAC CTT GTG CAT GGG ATC
mRNA AUG GAA CAC GUA CCC UAG
A.A    MET G.A HIS VAL PRO
  STOP
IMPORTANT CODONS



   AUG = start translation (Met)
   UAA, UAG, UGA= stop translation
Please note that due to differing
operating systems, some
animations will not appear until
the presentation is viewed in
Presentation Mode (Slide Show
view). You may see blank slides
in the “Normal” or “Slide Sorter”
views. All animations will appear
after viewing in Presentation
Mode and playing each
animation. Most animations will
require the latest version of the
Flash Player, which is available at
http://get.adobe.com/flashplaye
r.
Figure 13.6 Ribosomes guide
the translation process
Ribosomes

   2 subunits, separate in cytoplasm
    until they join to begin translation
       Large
       Small
   Contain 3 binding sites
       E
       P
       A
Reading the DNA code

   Every 3 DNA bases pairs with 3
    mRNA bases
   Every group of 3 mRNA bases
    encodes a single amino acid
   Codon- coding triplet of mRNA
    bases
         The Genetic Code
   We now know the complete genetic
    code
   64 “words,” or codons
   61 represent an amino acid
   More than one codon for some
    amino acids
   AUG is the start signal and
    represents methionine
   UAG, UAA and UGA are the
   stop signals
   Universal
   Non-overlapping
   No spaces between codons
The language of amino acids is based on codons



           1 codon =       3 mRNA nucleotides


           1 codon =       1 amino acid




    AUA U A U G C C C GC

   How many codons are in this sequence of mRNA?
Using this chart,
you can determine
which amino acid
the codon “codes”
for!




 Which amino acid
 is encoded in the
 codon CAC?
                 Find the
                 second letter
                 of the codon
                 CAC
Find the first
letter of the
codon CAC




                 Find the third
                 letter of the
                 codon CAC
CAC codes for
the amino
acid histidine
(his).
  What does
  the mRNA
  codon
  UAC code
  for?


Tyr or tyrosine
Notice there is one start
codon AUG.
Transcription begins at
that codon!
Notice there are three
stop codons.
Transcription stops when
these codons are
encountered.
   Although we do have proofreading
    mechanisms in place, sometimes
    mutations occur and a protein is not
    translated properly.

   Are there possible consequences to such
    errors in transcription? Well, errors in
    transcription will lead to the wrong codon
    and incorrect translation of amino acid
    and erroneous protein SO……. One disease
    we see as and example on this is…….
The Genetic Code
Which codons code for which
amino acids?

   Genetic code- inventory of linkages
    between nucleotide triplets and the
    amino acids they code for
   A gene is a segment of RNA that
    brings about transcription of a
    segment of RNA
Transcription vs. Translation Review

      Transcription             Translation
   Process by which       Process by which
    genetic                 information
    information             encoded in mRNA
    encoded in DNA is       is used to
    copied onto             assemble a protein
    messenger RNA           at a ribosome
   Occurs in the          Occurs on a
    nucleus                 Ribosome
   DNA      mRNA          mRNA         protein
Chapter 14: Gene Technology
Biotechnology

   Genetic engineering is the use of
    technology to alter the genomes of
    organisms.
       Biotechnology includes genetic
        engineering and other techniques to
        make use of natural biological systems
        to achieve an end desired by humans.




                                             65
     The Cloning of a Gene
   Recombinant DNA Technology.
       Uses at least two different DNA sources.
            Vector used to introduce foreign DNA into a
             host cell.
                 Plasmid.

   Enzymes.
       Restriction enzymes cleave DNA.
       DNA ligase seals DNA into an opening
        created by the restriction enzyme.


                                                           66
67
Polymerase Chain Reaction

   Polymerase Chain Reaction (PCR)
    can create millions of copies of a
    DNA segment very quickly.
       Can be subjected to DNA fingerprinting
        using restriction enzymes to cleave the
        DNA sample, and gel electrophoresis to
        separate DNA fragments.




                                              68
69
    Biotechnology Products
Products                     Effects and Uses

Anticoagulants               Involved in dissolving blood clots; used
                             to treat heart attack patients

Colony-stimulating factors   Stimulate white blood cell production,
                             used to treat infections and immune
                             system deficiencies (e.g.; lupus)

Growth factors               Stimulate differentiation and growth of
                             various cell types; used to aid wound
                             healing (e.g.; burn victims)

Human Growth Hormone (HGH)   Used to treat dwarfism

Insulin                      Involved in controlling blood sugar
                             levels; used in treating diabetes

Interferons                  Disrupt the reproduction of viruses;
                             used to treat some cancers

Interleukins                 Activate and stimulate white blood cells;
                             used to treat wounds, HIV infections,
                             cancer, immune deficiencies
                                                                    70
        Biotechnology Products
   New prostate cancer vaccine (FDA app. Apr 2010)
   Treats patients advanced form of prostate cancer.
       Provenge : The series of three shots using a patient's
        own cells, and are designed to train the immune system
        to recognize and kill malignant cells.
   Does NOT cure cancer, just make patients live
    longer (avg: 4 months)
   $50-75K price range
   Still in testing stage
Biotechnology Products

   Transgenic Bacteria.
       Insulin.
       Human Growth Hormone.
   Transgenic Plants.
       Pest resistance.
            Higher yields.




                                72
Genetic Engineering of Farm
Animals

   Transgenic Animals.
       The use of transgenic farm animals to
        produce pharmaceuticals is currently
        being pursued.
            Cloning transgenic animals.
                 Dolly (1997).




                                                73
Genetic Engineering of Farm
Animals

   Production of bovine somatotropin
    (BST) 1994
        Became commercially available for
        dairy farmers to increase animals’ milk
        production
       More money
       Although BST is functional, harmless,
        and sanctioned by the FDA, much
        controversy exists over whether it is
        actually desirable.

                                              74
Genetic Engineering of Crop Plants

   Manipulation of the genes of crop
    plants to make them more resistant to
    disease from insects and improve crop
    yield.
       Cotton:
         Over 40% of the chemical insecticides used
          for these crops
         Bacillus thuringiensis (Bt)

         Harmful to caterpillars/tomato hornworms but
          not harmful to humans
         81% of U.S acreage is Bt cotton
Genetic Engineering of Crop Plants

   60-70% of processed foods in the U.S.
    grocery shelves have genetically
    modified ingredients.
   Table 14.2 (pg. 265)
   List of Genetically Modified Crops
Is eating genetically modified food
dangerous?
    EPA, FDA, and USDA approve food
     regulations in the U.S.
    EPA approved EPSP enzyme (change
     in protein sequence) for human
     consumption
    Bt (inhibits pests on cotton/corn
     crops) protein is approved for human
     consumption by the EPA
Benefits vs Risk

   Benefits:
       Increased pest and disease resistance
       Drought tolerance
       Increased food supply
       Farmers make more money and keep
        food cost down for consumers
Benefits vs Risk

   Risk:
       Introducing allergens and toxins in
        foods
       Antibiotic resistance
       Adversely changing the nutrient
        content of a crop
       Creation of “super” weeds and other
        environmental risk
       Unknown long-term health effects
So, do you think that it is safe to
eat genetically modified foods?

   This is for you to decide…

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:66
posted:4/7/2012
language:English
pages:80