Structure of the DNA double helix iii

Document Sample
Structure of the DNA double helix iii Powered By Docstoc
					          MOLECULAR GENETICS

CLASS SESSIONS:
    1. DNA, Genes, Chromatin
    2. DNA Replication, Mutation, Repair
    3. RNA Structure and Transcription
    4. Eukaryotic Transcriptional Regulation
    5. CLASS DISCUSSION – GENETIC DISEASES
    6. RNA Processing
    7. Protein Synthesis and the Genetic Code
    8. Protein Synthesis and Protein Processing
    9. CLASS DISCUSSION – GENETIC DISEASES
    10. DNA Cloning and Isolating Genes
THE FLOW OF GENETIC INFORMATION


          2         3
    DNA       RNA       PROTEIN
    1

    DNA


1. REPLICATION   (DNA SYNTHESIS)
2. TRANSCRIPTION (RNA SYNTHESIS)
3. TRANSLATION   (PROTEIN SYNTHESIS)
            DNA Structure and Chemistry


a). Evidence that DNA is the genetic information
     i). DNA transformation – know this term
     ii). Transgenic experiments – know this process
     iii). Mutation alters phenotype – be able to define
            genotype and phenotype
b). Structure of DNA
     i). Structure of the bases, nucleosides, and nucleotides
     ii). Structure of the DNA double helix
     iii). Complementarity of the DNA strands
c). Chemistry of DNA
     i). Forces contributing to the stability of the double helix
     ii). Denaturation of DNA
              Structures of the bases


Purines           Pyrimidines




Adenine (A)       Thymine (T)



                                 5-Methylcytosine (5mC)



Guanine (G)       Cytosine (C)
           Nucleoside




[structure of deoxyadenosine]




           Nucleotide
                Nomenclature

                    Nucleoside          Nucleotide
 Base               +deoxyribose        +phosphate

Purines
     adenine                  adenosine
     guanine                  guanosine
     hypoxanthine             inosine

Pyrimidines
     thymine                  thymidine
     cytosine                 cytidine
                    +ribose
     uracil                   uridine
                                  ii). Structure DNA
                              Structure of theof the
                                   DNA double helix
                              polynucleotide chain




         5’



                 3’


• polynucleotide chain
• 3’,5’-phosphodiester bond
                                                                A-T base pair


  Hydrogen bonding of the bases




                                                                G-C base pair

Chargaff’s rule: The content of A equals the content of T,
                 and the content of G equals the content of C
                 in double-stranded DNA from any species
          Double-stranded DNA
                                  5’   3’


              Major groove


              Minor groove




“B” DNA
                             3’   5’    3’   5’
                 Chemistry of DNA

Forces affecting the stability of the DNA double helix
• hydrophobic interactions - stabilize
     - hydrophobic inside and hydrophilic outside
• stacking interactions - stabilize
     - relatively weak but additive van der Waals forces
• hydrogen bonding - stabilize
     - relatively weak but additive and facilitates stacking
• electrostatic interactions - destabilize
     - contributed primarily by the (negative) phosphates
     - affect intrastrand and interstrand interactions
     - repulsion can be neutralized with positive charges
           (e.g., positively charged Na+ ions or proteins)
                                  Stacking interactions




               Charge repulsion




Charge repulsion
Model of double-stranded DNA showing three base pairs
  Denaturation of DNA
                              Strand separation
    Double-stranded DNA       and formation of
                              single-stranded
                              random coils


Extremes in pH or A-T rich regions
 high temperature denature first




    Cooperative unwinding
         of the DNA strands
   Electron micrograph of partially melted DNA


                                 Double-stranded, G-C rich
                                   DNA has not yet melted




A-T rich region of DNA
has melted into a
single-stranded bubble




• A-T rich regions melt first, followed by G-C rich regions
Hyperchromicity

                                      Absorbance maximum
                                      for single-stranded DNA

            Absorbance
                                           Absorbance
                                           maximum for
                                           double-stranded DNA




                         220   260   300

 The absorbance at 260 nm of a DNA solution increases
   when the double helix is melted into single strands.
DNA melting curve

                                 100
       Percent hyperchromicity


                                  50




                                   0


                                       50        70          90
                                            Temperature oC

• Tm is the temperature at the midpoint of the transition
Tm is dependent on the G-C content of the DNA
  Percent hyperchromicity



                                                            E. coli DNA is
                                                               50% G-C
                            50




                                 60        70          80
                                      Temperature oC

Average base composition (G-C content) can be
determined from the melting temperature of DNA
      Genomic DNA, Genes, Chromatin


a). Complexity of chromosomal DNA
      i). DNA reassociation
      ii). Repetitive DNA and Alu sequences
      iii). Genome size and complexity of genomic DNA
b). Gene structure
      i). Introns and exons
      ii). Properties of the human genome
      iii). Mutations caused by Alu sequences
c). Chromosome structure - packaging of genomic DNA
      i). Nucleosomes
      ii). Histones
      iii). Nucleofilament structure
      iv). Telomeres, aging, and cancer
 DNA reassociation (renaturation)

                                    Double-stranded DNA



                  Denatured,
                  single-stranded
                  DNA
                                           Faster,
                                           zippering
                                           reaction to
                   k2                      form long
Slower, rate-limiting,                     molecules
second-order process of                    of double-
finding complementary                      stranded
sequences to nucleate                      DNA
base-pairing
   DNA reassociation kinetics for human genomic DNA

              Cot1/2 = 1 / k2                        k2 = second-order rate constant
                                                     Co = DNA concentration (initial)
                                                     t1/2 = time for half reaction of each
                                                              component or fraction

                      0
                                                 fast (repeated)
                                                                                Kinetic fractions:
% DNA reassociated




                                                                                  fast
                                                            intermediate          intermediate
                                                             (repeated)           slow
                           Cot1/2
                     50
                                            Cot1/2
                                                                            slow (single-copy)
                                                           Cot1/2
                     100
                           I        I   I       I   I   I      I    I   I
                                                log Cot
  106 copies per genome of         1 copy per genome of
a “low complexity” sequence   a “high complexity” sequence
    of e.g. 300 base pairs      of e.g. 300 x 106 base pairs




        high k2                     low k2
Type of DNA            % of Genome                Features

Single-copy (unique)       ~75%             Includes most genes 1
Repetitive
 Interspersed              ~15%             Interspersed throughout genome between
                                            and within genes; includes Alu sequences 2
                                            and VNTRs or mini (micro) satellites
 Satellite (tandem)        ~10%             Highly repeated, low complexity sequences
                                                          usually located in centromeres
                                                          and telomeres
  0
                       fast ~10%
                                                           2 Alu sequences are
                                      intermediate        about 300 bp in length
                                          ~15%            and are repeated about
 50                                                       300,000 times in the
                                                          genome. They can be
         slow (single-copy)                               found adjacent to or
            ~75%                                          within genes in introns
                                                          or nontranslated regions.
100
          I   I   I    I      I   I     I     I   I
1 Some genes are repeated a few times to thousands-fold and thus would be in
 the repetitive DNA fraction
             Classes of repetitive DNA


Interspersed (dispersed) repeats (e.g., Alu sequences)

GCTGAGG              GCTGAGG             GCTGAGG



Tandem repeats (e.g., microsatellites)

      TTAGGGTTAGGGTTAGGGTTAGGG
        Genome sizes in nucleotide pairs (base-pairs)

                      plasmids
                        viruses
                                         bacteria
                               fungi
                                        plants
                                         algae
                                    insects
                                         mollusks
                                         bony fish
The size of the human
genome is ~ 3 X 109 bp;                  amphibians
almost all of its complexity
is in single-copy DNA.                           reptiles
                                                  birds
The human genome is thought
to contain ~30,000 to 40,000 genes.          mammals

       104     105     106        107       108       109   1010   1011
                  Gene structure


promoter    exons (filled and unfilled boxed regions)
 region



           +1
                   introns (between exons)

                    transcribed region

 mRNA structure

            5’                                3’


                    translated region
       The (exon-intron-exon)n structure of various genes

histone
                    total = 400 bp; exon = 400 bp

b-globin

                    total = 1,660 bp; exons = 990 bp


HGPRT
(HPRT)
                  total = 42,830 bp; exons = 1263 bp


factor VIII

                total = ~186,000 bp; exons = ~9,000 bp
Properties of the human genome

Nuclear genome

• the haploid human genome has ~3 X 109 bp of DNA
• single-copy DNA comprises ~75% of the human genome
• the human genome contains ~30,000 to 40,000 genes
• most genes are single-copy in the haploid genome
• genes are composed of from 1 to >75 exons
• genes vary in length from <100 to >2,300,000 bp
• Alu sequences are present throughout the genome

Mitochondrial genome

• circular genome of ~17,000 bp
• contains <40 genes
Alu sequences can be “mutagenic”
               Familial hypercholesterolemia
                 • autosomal dominant
                 • LDL receptor deficiency




From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.
LDL receptor gene

                 Alu repeats present within introns


                4   5 6
                                       Alu repeats in exons
unequal              4             5               6
crossing over               Alu          Alu

                            X
           Alu              Alu
     4               5            6

                                       one product has a
                                               deleted exon 5
                      Alu              (the other product is not shown)
                4             6
       Chromatin structure




EM of chromatin shows presence of
nucleosomes as “beads on a string”
              Nucleosome structure




Nucleosome core (left)
     • 146 bp DNA; 1 3/4 turns of DNA
     • DNA is negatively supercoiled
     • two each: H2A, H2B, H3, H4 (histone octomer)
Nucleosome (right)
     • ~200 bp DNA; 2 turns of DNA plus spacer
     • also includes H1 histone
Histones (H1, H2A, H2B, H3, H4)
   • small proteins
   • arginine or lysine rich: positively charged
   • interact with negatively charged DNA
   • can be extensively modified - modifications in
       general make them less positively charged
            Phosphorylation
            Poly(ADP) ribosylation
            Methylation
            Acetylation
                   Hypoacetylation
                           by histone deacetylase (facilitated by Rb)
                          “tight” nucleosomes
                           assoc with transcriptional repression
                   Hyperacetylation
                           by histone acetylase (facilitated by TFs)
                          “loose” nucleosomes
                           assoc with transcriptional activation
Nucleofilament structure
Condensation and decondensation
of a chromosome in the cell cycle
                                                    Telomeres are protective
       Telomeres and aging                          “caps” on chromosome
                                                    ends consisting of short
                                                    5-8 bp tandemly repeated
                                                    GC-rich DNA sequences,
             Metaphase chromosome
                                                    that prevent chromosomes
                                                    from fusing and causing
                                                    karyotypic rearrangements.

telomere               centromere           telomere

                                     <1 to >12 kb
    telomere structure
                                    (TTAGGG)many
                                                              young
                              (TTAGGG)few
                                               senescent

    • telomerase (an enzyme) is required to maintain telomere length in
        germline cells

    • most differentiated somatic cells have decreased levels of telomerase
       and therefore their chromosomes shorten with each cell division
Class Assignment (for discussion on Sept 9th)

             Botchkina GI, et al.
“Noninvasive detection of prostate cancer by
quantitative analysis of telomerase activity.”
Clin Cancer Res. May 1;11(9):3243-3249, 2005

 PDF of article is accessible on the website

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:155
posted:4/1/2012
language:Latin
pages:38