Characterization and Rapid Diagnostic Analysis of DNA by dandanhuanghuang

VIEWS: 8 PAGES: 6

									CLIN. CHEM. 36/9,             1614-1619        (1990)



Characterization   and Rapid                                   Diagnostic              Analysis       of DNA Polymorphisms                                 Closely           Linked           to
the Cystic Fibrosis Locus
Glenn 1. Horn, Brenda RIchards, Janet                          J. MerrIll,1 and KatherIne W. Kllnger

Six genetic polymorphisms,            closely linked to the cystic fibro-                            (RFLP),        where       alteration           in the sequence                or spacing       ol
sis gene and useful in clinical            linkage analysis,      have been                          restriction       enzyme sites leads to variations                        in fragment        size
characterized     and converted         to a more rapid form of assay.                               detected       in a Southern              blot assay. This technique                    can be
Sequences     flanking      the met!) (Ban I), metH (Msp I), XV-2c                                   applied to a wide range of polymorphisms,                                  but is slow and
(Taq I), KM.19 (Pst I), MP6d-9               (Msp I), and J3.11 (Msp I)                              relatively       insensitive.         Large       amounts         of sample DNA must
polymorphic     restriction sites have been determined               and used                        be carefully          isolated       to avoid shearing                 and to guarantee
to design specific       polymerase       chain reaction (PCR) amplifi-                              that it will be amenable                 to enzyme digestion.                The digestion,
cation primers and allele-specific            oligonucleotide     probes. All                        blotting,       hybridization,             and autoradiography                    steps often
                                                                                                     combine        for a total analysis               time of up to seven days.
six of these polymorphisms              were found to involve single-
                                                                                                         Another         analytical         technique           is much          faster,    but re-
base alterations,      and the XV-2c polymorphism             was found to
                                                                                                     quires detailed            sequence          information            about the polymor.
lie within an Alu repeat segment.             These PCR-based         tests, in
                                                                                                     phism being studied.               Sample DNA is first amplified                       in vitrc
conjunction with the CS.7 (Hha I) assay described elsewhere
                                                                                                     by the polymerase                 chain       reaction        (PCR)       method       (7) and
(Stanier P et al. Hum Genet 1988;80:309-10;                   Williams C et
                                                                                                     then      analyzed        with allele-specific                 oligonucleotide           (ASOJ
al. Lancet 1 988;ii:1 02-3),        provide a convenient,          rapid, and                        probes      (8). This combined                 PCRJASO            method        can be initi.
reliable method of haplotype            and linkage analysis, clinically                             ated with small amounts                     of crudely         purified       DNA and can
useful in those situations where direct detection of mutations                                       be performed              within        one day. Furthermore,                       the large
is not possible.                                                                                     amounts         of amplified           DNA         available        for analysis         allowe
                                                                                                     the application             of nonradioactive                labeling         and detection
Additional Keyphrases:                          f
                                      restrictionragment length polymorphism                         methods        (9).
    polymerase        chain    reaction           screening             heritable    disorders
                                                                                                         Here we describe the application                         of this technique            to the
                                                                                                     analysis of genetic polymorphisms                            linked       to CF. We have
    Cystic     fibrosis       (CF) is an autosomal                  recessive       disorder         chosen       polymorphic            restriction          sites located           near probee
involving         intracellular         chloride         transport,         affecting         ap-    met!)     and metff          (10), XV-2c           and KM.19            (11), MP6d-9          (5),
proximately            1 in 2500 Caucasians.2                      Before       the recent           and J3.11 (6). Analysis                  and amplification                of an additional
discovery       of the CF transmembrane                      regulator       (CVFR) gene             polymorphism             near CF, the Hha I RFLP within probe CS.7
and the most frequent               CF mutation               (1),inheritance             of the     (4), has been reported                by others          (12, 13).
disease      could only be inferred                  via linkage          analysis          with
nearby       polymorphic           DNA       probes          (2) (Figure          1). These          Materials         and Methods
polymorphisms,               all within       1 centiMorgan                of the CV1’R
                                                                                                        The starting     points    for these analyses          were the known
gene, now have diagnostic                    utility        in those families               with
                                                                                                     DNA probes linked closely to CF. Probe met!? was obtained
uncharacterized             CF mutations           and have research               utility      in
                                                                                                     from the American         Type Culture      Collection,      Rockville,       Mt
defining      the haplotypes            surrounding             newly      characterized
                                                                                                     (ATCC    40220), whereas probes met!), XV-2c, KM.19,                          an
mutations.
                                                                                                     J3.11 were the gift of R. Williamson                (St. Mary’s      Hospital
    Polymorphic            DNA     markers          from four loci are among
                                                                                                     London).    High-Me     genomic      DNA was isolated           by standard
those most frequently               used in haplotype                 analysis      of fami-
                                                                                                     methods     (14) from individuals          of known         CF status         an
lies. DNA probes from the met oncogene                                (3) reveal exten-
                                                                                                     RFLP haplotypes        (15). Oligonucleotide          primers    and probe
sive polymorphisms,               whereas      the D7S23 (IRP) (4), D7S399
                                                                                                     were synthesized         by the phosphoranudite               method       on
(5), and D7S8 (6) loci most closely flank the disease gene.
                                                                                                     Model 380B synthesizer           (Applied    Biosystems,        Foster City
    Segregation          of these markers               is currently          followed         by
                                                                                                     CA).
analyzing          restriction        fragment             length       polymorphisms




                                                                                                                      /                                  /
                                                                                                                          met             D7S23               D7S3     99              D7S8
  Departments          of Genetic Disease Research and 1 Molecular                         Biol-
                                                                                                                          melD            XV-2c    ‘t
ogy, Integrated        Genetics, One Mountain     Road, Framingham,                          MA
                                                                                                                          metH            KM
                                                                                                                                          CS.7                MpSd-9              /T
01701.
   2 Nonstandard          abbreviations:         PCR,     polynierase       chain reaction;
ASO, allele-specific      oligonucleotide;   RFLP,                 restriction    fragment                                                                   (CFTR)
length polymorphism;          CF, cystic fibrosis; CVFR, cystic fibrosis                                                     300   Kb
transmembrane       regulator; SDS, sodium dodecyl sulfate; IRP, mt-i                                Fig. 1.       Genetic  loci and probes linked to cystic fibrosis
related protein; lx SSC, saline sodium citrate = 8.765 g of NaCl +
                                                                                                     Shown      is a representationof the segment of human chromosome 7 containin
4.41 g of sodium citrate per liter, pH 7.0; and lx Denhardt’s                                        the cystic fibrosis transmembrane regulator (CFTR) gene, which resides in
solution, 200 mg of Ficoll + 200 mg of polyvinylpyrrolidone       + 200                              region flanked by loci 07S399 and D7S8. Below each locus are listed the DN
mg of bovine serum albumin per liter of water.                                                       probes that reveal genetic polymorphisms useful in linkage and haplotyp
   Received May 4, 1990; accepted July 9, 1990.                                                      analysis

1614      CLINICAL        CHEMISTRY,           Vol. 36, No. 9, 1990
  The      sequencing         of DNA    segments    from                  polymorphic
                                                                                                                   Table 2. ASO Probe AnalysIs                       of CF-Linked
egions      and their        analysis by PCR/ASO-based                       assays re-
                                                                                                                                PolymorphIsms
itnred precise localization                  of the RFLP sites. This initially
nvolved        general       mapping          of the polymorphism                   to a small           ASO                       Wash tamp,
egion,       based      on standard             restriction          analysis         methods.
                                                                                                         name            Site                                       Sequence (5’-3’)
[‘he polymorphic             segment         was then subcloned into vectors                           metD-1             -                45           GCATGTFGCCACCTACA
‘113mp18         or pUC18            and sequenced.               In most cases, final                 metD-2             +            42               TGTAGGTGCCAACATGC
haracterization              of the polymorphic                  site occurred             by re-      metH-2             -            45               CAGAAAAATCCAGGTAATCAG
itriction     analysis        and sequencing               of amplified         DNA (16).              metH-3             +            45               CTGAUACCCGGA     I I I I I CTG
     We amplified          the DNA by PCR essentially                          as described            XV2c-1             -            42               AGGAGATCAAGACCATC
lsewhere          (7), using         AmpliTaq            DNA        polymerase              and a      XV2c-2             +            42               GATGGTCTCGATCTCCT
)NA       Thermal         Cycler        (Perkin-Elmer,              Norwalk,          CT) and          KM19-1             -            48               GAGCCTACAGCAGCAAG
he synthetic          primers         shown in Table 1. Table 1 also lists                             KM19-2             +            45               CTGCTGCTGCAGGCTC
 he specific         amplification           conditions          used for each set of                  MP6d-1             -            38               TAGAGACCAGTtTCCTAC
)rimers.      Typically,         1 g of total genomic                   DNA was mixed                  MP6d-2             +            38               TAGGAGACCGGTtTCTA
with reaction          buffer,      dNTP        mixture         (deoxynucleoside                tn-    J31 1-1            -            42               CAGCATCCAGGAAAGG
)hosphate:         200 nmol each of dATP,                           dCTP,        dGTP,         and     J31 1-2            +            42               CC1TCCCGGAATGCTG
ITFP; Perkin-Elmer),                  and primers            at 0.4 molJL,              and this
nixture       was amplified            for 28 cycles of 10 s at 94#{176}C,                 20s at
          and
5 #{176}C, 20 s at 74 #{176}C.            After the last cycle, the reactions
                                                                                                       disrupt      the secondary  structure                 that    is predicted      to occur
were incubated              at 74#{176}C     for 5 mm to ensure                       complete
                                                                                                       within      this probe (see below).
rimer       extension.         Using        the specific          conditions          listed in
[‘able 1, we found each of the six amplification                                reactions         to
  e specific      for their respective               target       sequences          (data not         Results
ihown).                                                                                                     metD (Ban 1). One of the original loci found to exhibit
    We analyzed             genetic       polymorphisms                in the amplified                close linkage to CF was the met oncogene (3). This gene was
)NA with labeled ASO probes in a dot-blot format, essen-                                               first isolated     from a cell line with a complex translocation
 ially as described             elsewhere         (17). The PCR amplification                          between       chromosomes     1 and 7, although   the proto-onco-
  roducts      (10 L)        were denatured                in 200 L of a solution                      gene has now been characterized                      from untransformed          cells
lontaining       0.5 mol of NaOH,                2.0 mol of NaCl, and 25 mmol                          (10). Several        unique-sequence              probes have been isolated
 f EDTA        per liter. Aliquots              of this solution (100 L) were                          from met and reveal extensive                  polymorphism          (2). The met!)
hen applied to nylon blotting                      membranes             (Micron         Separa-       probe is located         within      this gene and detects polymorphic
ions, Westboro,             MA), neutralized             with 100 jL of 20 x SSC                       Ban I and Taq I restriction                   sites. Analysis        of a genomic
14), and then fixed to the membrane                            by 2 mm of ultraviolet                  cosmid clone, isolated            from a library           with the met!) probe
rradiation          (17). Oligonucleotide                   probes        (Table        2) were        (18), produced          the map shown in Figure                    2A. Sequence
abeled by treatment                 with     DNA polynucleotide                   kinase       and     analysis     of the region          containing          the polymorphic       Ban I
  -32P-ATP        (14) and then purified                    on BioGel          P4 (Bio-Rad             site is summarized             in Figure        3A. The PCR primers              were
Aboratories,           Richmond,           CA). Hybridization                 to the ampli-            then used to amplify             DNA from an individual                homozygous
led DNA on the dot-blot filters                           typically         occurred         over-     for “allele-i,”        and subsequent               sequencing       revealed     the
                        in
oight at 37#{176}C 2 x SSC, 10 x Denhardt’s                                   solution (14),           single base change responsible                  for the RFLP. The combined
Lnd 2 g of SDS per liter. Stringent                        washing         was performed               PCR/ASO          assay (Figure         4) was found to reflect the geno-
  y immediately           immersing           the filters       in 0.2 x SSC plus 1 g                  typing    seen in the Southern               blot RFLP procedure.
tf SDS per liter for 15 mm at the temperatures                                         listed in           metH     (Msp I). A second                 useful      probe   from the met
rable 2. Autoradiography                     was typically            for 4 h at -70 #{176}C           oncogene        is met!?,      which       is able to reveal          at least two
  ‘ith an intensifying             screen. In contrast,              the ASO detection                 RFLPs     with Msp I or Taq 1(2). The appearance                           on South-
 f the MP6d-9              (Msp      I) polymorphism                 was most specific                 ern blots of two bands specific to the smaller Msp I RFLP
  ‘hen 6 x SSC was used in both the hybridization                                    and wash          allele suggested         that the polymorphic                site might be inter-
  )lutions.     This higher concentration                      of salt appears to help                 nal to the probe fragment               (Figure      2B); therefore,      the cloned



                                                Table      1. PCR Amplification                 of CF-Linked                  Polymorphisms
 Locus                    PCR size, bp                      Primer concn,       gmoI/L                     Primer name                                       Sequence     (5’-3’)
                                145                                      1.0                                     GH367                          GAGAAATGAGGTCTTGGATG
                                                                                                                 GH364                          GCCTCTGGGTAAAATGAGTC
 etH                            203                                      1.0                                     GH220                          CCATGTAGGAGAGCCTAGTC
                                                                                                                 GH324                          GTCTAAGGACACACCTGC
 /-2c                           291                                      1.0                                     GH390                          CAGGCGCA11CATGAGGCATr
                                                                                                                 GH391                          CCTCCCAGGTCACGCTAT
                                206                                     0.4                                      GH295                          GGCAGGGCTAAATFGCAAC
                                                                                                                 GH296                          CATCCCCTCTCACACTTC
 P6d-9                          373                                      1.0                                     GH333                          GCAACAATCACCCAATGCT
                                                                                                                 GH334                          GGTTAGGTCAGAGAACAAAG
                                186                                     0.4                                      GH237                          CTAGGGATGTCCTGTCTCAG
                                                                                                                 GH256                          CGTrCA1TFGACATACA1TrACTGAGC


                                                                                                                                CLINICAL        CHEMISTRY,     Vol. 36, No. 9, 1990        1615
     A.                                                                                                                                    21)). Further        subcloning         and characterization              of this ge
                                    H    GH                R               BC          B    B                     RUG
                                                                                                                                           nomic segment revealed                 its sequence (Figure              3D),      whic]
                                         II                t               l           I                                                   was used to design amplification                      primers.        Amplificatiot
                   I
                                                                                melD                               B
                   B       B
                                                   1Kb                                                                                     and analysis of a DNA sample homozygous                             for the smalle:
                                                                                                                                           RFLP allele revealed the exact location of the Pst I site ant
       B.
                                                                                                                                           showed that the polymorphism                      arises from a single T-(
       I
           I
                                                                       P                              U.                         R
                                                                                                                                           transitional      change. ASO probes were then designed ant
                                                                  metH                                                                     verified as above on samples of known                        genotype (data no
                            200bp                                                               .
                                                                                                                                           shown). Amplification             primers      that are more distant fron
                                                                                                                                           this polymorphism            have also been reported (22).
       C.                                                                                                                                      MP6d-9      (Map I). The Msp I RFLP                        of probe MP6d-1
               I   H                               I                                   U        HI.                      I                 (D7S399)           is from a region just 40-kb upstream                       from tht
                   I                                                                            1J                           I
                                                                                                                                           beginning       of the CF gene (1), and PCR primers                            flankinj
                                                         XV-2c
                           400      bp
                                                                                                                                           this polymorphism             have been described              (23). To allow th
                                                                                                                                           application      of ASO probes to this assay, we amplified                              ant
       0.                                                                                                                                  sequenced this 373-hp genomic segment (Figure                                 3E). Th
       RH                                      H                 P.               H                 B                            R         design of efficient oligonucleotide                  probes was complicatet
       II                                                                         I
                                                                                                                                           by the hairpin        symmetry        of the DNA sequence, centered a
                           500 bp
                                                                                                             KM. 19
                                                                                                                                           the polymorphic          Msp I site. This structure               makes the AS(
Fig. 2. Restriction maps of CF-linked polymorphisms                                                                                        probes largely selfcomplementary,                      affecting both labelini
In each map the original probe segment is indicated as a shaded                box.                                                        and hybridization          efficiencies (data not shown). These prob
Restriction sites are as follows: R, EcoRl; H, HindIll; T, Taq I; M, Msp I; B, Ban
I; P, Pst I; 0, Bgl II; C, CIa I; M, BamHI. Polymorphic sites are indicated with                                                           lems were         partially        alleviated        by incorporating                 mis
an asterisk. (A) The region surrounding probe metD. This map is oriented with                                                              matched residues (shown as lower case letters in Table 2
the direction of the met oncogene transcription (10). ( The polymorphic Msp                                                                into the ASOs at positions that preferentially                          disrupt thi
I site detected by metH is located within the 1.3-kb probe fragment The
                                                                                                                                           probe’s interaction           with itself      This     assay      also performet
segment amplifiedfordetectionof thispolymorphism is indicated below the
map. (C) The XV-2c (Taq I) RFLP site is located 190 bp beyond the end of the                                                               best when the ASO probes were hybridized                            and washed ii
2.2-kb probe fragment and 80 bp within an Alu repeat (thick line). (L The                                                                  solutions containing            6 x SSC.
1.0-kb probe fragment KM.19 detects a polymorphic Pst I site in the adjacent
                                                                                                                                               J3.i1 (MspI).       The final locus chosen for conversion                       to th
EcoRI restriction fragment
                                                                                                                                           PCRIASO       format was D7S8. Probe J3.11 was isolated fron
                                                                                                                                           this region and revealed              a frequent       RFLP with Msp 1(22)
probe              was    sequenced                    dfrectly.           PCR         primers              flanking                 the   The polymorphic            site is known         (6) to be located             immedi
general                location           of       the           polymorphic               site            were         used          to   ately adjacent to the probe fragment.
amplify     DNA samples homozygous                  for either “allele-2”          or                                                          The 1.3-kb genomic HindIll                  fragment          containing          hot]
“allele-3.”    Sequence analysis           (Figure     3B) showed that the                                                                 J3.11 and the Map I polymorphism                        was subcloned from i
RFLP was caused by the alteration                  of a single basepair.          As                                                       cosmid isolated from the D7S8 region (18). Sequencing                                     o
was the case with the other two Msp I RFLPs                            described
                                                                                                                                           the polymorphic          region (Figure 3F) allowed for the desigi
                                                                                                                                           of amplification        primers. Because           the D7S8 cosmid was no
below, the sequence            change seen here was of the type
                                                                                                                                           derived from a chromosome                   containing          the Msp I site, I
expected     from deamination            of methylated        cytosine in the
                                                                                                                                           DNA sample homozygous                   for the smaller RFLP allele wa
CpG dinucleotide         (19). ASO probes were designed to detect
                                                                                                                                           amplified      and analyzed           to determine           that the polymor
this polymorphism,          and their specificity          was verified (Fig-
                                                                                                                                           phism was a single T-C transition.                  As before, the speciflcit
ure 4) on DNA samples with alleles previously                       determined
                                                                                                                                           of ASO probes for this segment was verified on samples o
in Southern      blot analysis.
                                                                                                                                           known genotypes            (Figure 4).
    XV-2c (Taq I). Three DNA probes useful in CF linkage
analysis    have been isolated         from the IRP (D7523)             locus (4).
One of these, XV-2c,            detects a polymorphic               Taq I site.                                                            Discussion
Mapping      and sequencing        studies on the XV-2c probe were                                                                             The use of in vitro DNA amplification               and analysis wi
underway        when primers         for amplifying          this locus were                                                               synthetic    oligonucleotide      probes provides a rapid altern
reported (20). These studies were then combined to produce                                                                                 tive to many RFLP-based             assays. The PCR amplificatio
the map shown in Figure 2C. Sequencing                       of the amplified                                                              process   requires just a few hours and can be initiated                   wi
segment (Figure 3C) revealed that the Taq I polymorphism                                                                                   small amounts of low-quality            DNA (17). Analysis           of amp
is embedded       in an Alu repeat unit (21). Thus, the design of                                                                          fled DNA with ASO probes can also be completed                        in just
an efficient and specific PCR/ASO               assay relies on the use of                                                                 few hours, although         more typically        the results are av
at least one primer          in the unique sequences flanking                    the                                                       able the next day. The combined                PCR/ASO         assay is am
repeat. Consideration          should be made in the interpretation                                                                        nable to nonradioactive         labeling     methods      (9).
of this assay to compensate              for the detection         of the many                                                                 We have presented         a detailed      analysis     of six polymo
Mu repeats present in the unamplified                     genomic DNA.                                                                     phisms    known to be closely linked             to the CF gene. Whe
    KM.19     (Pst I). Another         useful probe from the D7S23                                                                         used in linkage analysis, these polymorphisms                    can serve
locus is designated         KM.19      (11), which detects a frequent                                                                      a foundation       in predicting       inheritance       of CF within
Pst I RFLP and exhibits strong linkage                  disequilibrium         with                                                        pedigree, regardless       of whether the specific CF mutation
the CF mutation.           A cosmid        containing       both the KM.19                                                                 known. Furthermore,          as shown with the /3-globin gene (24
fragment       and the nearby           CS.7 probe segment                (4) was                                                          the definition       of RFLPs      flanking       disease      mutations
isolated    and mapped          to determine           the location          of the                                                        useful in population       and evolutionary          studies.
polymorphic       region. The RFLP is caused by a polymorphic                                                                                  The elucidation      of the exact nature           of these polymo
Pst I site located     within a 3.5-kb EcoRI fragment,                   immedi-                                                           phisms also contributes        to the general understanding               oft
ately adjacent to the 1.0-kb KM.19                probe fragment           (Figure                                                         types   and distribution      of genomic mutations.              All seven

1616               CLINICAL CHEMISTRY,                                Vol. 36, No. 9, 1990
 .4*-                    .00                            00                                         C.) 1.)     - 41-                     -       0           0        -     C I-                                                                              C1-                  I-C               #{149}00.
    00                         CI-.                     Cl-                                        00              00                            ‘-‘C                       01.)                                                                              Cl-’                 -CI-                    1-Cbo
        Cl-’                 CI-                        00                                         I-C             00                            ‘                          00                                                                                I--C                 00
                                                                                                                                                                                                                                                                                                           1-40
        00                  00                          00                                         CI-             1-C                           I-C                        I-C                                                                               CI-                  CI-                     C        U                                eS
        CI-                 00                          00                                         1)1..)            1)0                         CI-                        C                                                                                 CI-’                 00                      C1-bo
        00                     CI-                      00                                         I-C               00                          I-C                        C                                                                -                00                   00                      01.)
     -CI-’                  CI-                         00                                         CI-               -CI-                        CI-                        C                                                                                                                              I-C
     OC.)                   1-4                         I-C                                        I-C             00                            CI-                        -C                                                                                                                             1-C                          0041
     00                     I-C                         00                                         00                C.)0                   1.51)                         1)0                                                                                   Cl-’               I-C                     1-C
     I-.C                   00                          I-C                                        1)0               01.)                   CI-                           0(5                                                                                 00                00                         1-C
  .)Q                    .1-4                                                               .QQ                .41-                      -1-4                         .(5’J
                                                                                                                                                                                                                                                              I-C            #{149}OQ                -00
     I--C                   00                          1-Cl                                  I-C                    I-C                         C.)O                       CI-                                                                               ()0               00                         00
      CI-.                  C.,c:                       41-I                                  I-.C                   C.)0                        Cl-’                       I-C                                                                               00                00                         00
                            00                          001                                   I-C                    I-C                         I-C                        I-C                                                                               1-C                   CI-                    I-C
        00                  CI-.                        ()0I                                       0’.)              Cl-                         CI-                        (JO                                                                               00                   00                      1-C
        CI-.                   00                       00’                                        1)0               1)0                         1)1.)                      I-C                                                                               010                  C                       I-C                          W        .
                               CI-                      00                                         ‘_)O              Cl-                         1)0                        I-’C                                                                              1-C                  C                       CI-’
        OC.)                   00                       CI-”O                                      1)0               01.)                        I-C                        00                        00-                                                     00                   0                       I-C
        CI-’                   ‘CI-                     1-Q’                                       1)0               I-C                         1)0                        00                        00        I                                             00                   CI-                     00                           V            01-
        I-C                    00                       OON                                        0(.               1)15                        CI-                        I-C                       CI-       I                                         I-C                      00                      1-C
  #{149}41-               .00                     ‘CI-=                                     .41-               .1-C                      .151)                        -CI-                    -CI-              I                                       -CI-                 -00                           1-C
     00                      I-’’C                      000                                    O<.                   CI-                    00                           CI-                     1-C            I                                           CI--’-                 00                      1-C
     CI-’                    CE’                        I-C                                        I-C               C                           1-C                    I-C                           1)0       I                                          001-                    1-C                     00
     00                      CI-’                       001                                        1)0               151.)                       C1-                        I-C                       00                                             -‘00C.                        00                      I-C
     00                      C.)C.)                     1-Cl                                       01.)              I-C                         1)1..)                     01.)                      CI--?                                          1-0001                        CI-.                    00
     1-4                     -CI-                       001                                        00                00                          00                         CI-                       00      (‘1                                    ‘-00                        CI-’                      I-C
     CI-                     00                         C1-I                                       I-C               1)0                         I-C                        f-C                                                                               00-                00                        00
     01.)                    CI-’                       CI-’                                       CI-               I-C                         CI-’                       I-C                       00                                                      1-C               I-C                        00
                                                                                                                                                                                                                                                                                                                                        .2
         00                    CI-’                     00’?                                       0(5               CI-                         C.)’.)                     CI-                                                                               1-4                00
                                                                                                                                                                                                                                                                                                                                        -C       .C           C’)
                                                                                                                                                                                                                                                                                                           <1-
     00                      1.)C.                      0’.)                                       1-C               C’-                     I-C                            I--C                                                                           I-C                   I-C                       CI-
  .1--C                   .01.)                  #{149}l-C                                  .00                .<l-                       .1-4                            CI-
                                                                                                                                                                      #{149}                                                                            #{149}0C)            -1-C                    .1-C
         C.)’.)                00                   00                                         1-C                   1-4                         I-C                        I-C               -                                                            00                    00                        -Cl-.
         l-.C                  CI-’                     00                                         CI-               CI-                         I-C                        00                        00        I                                          00                    41-                       Cr’
         01.)                  CI-                      1-C                                        00                I-C                         CI-                        CI-                       1-C       I                                          00                    1-C                       C,-
         01.)                  41-                      00                                         (51.)             01.)                        1)0                        I-C                                                                               1-C                00                        CI-
         I-C                   00                       C                                          I-C             1-C                           CI-                        01.)                                                                              00                   (50                     CI-
         1-C                   CI-                      1.)                                        I-C             CI-                           CI-                        CI-                       00%.’                                                   00                   00                      00
AQO                            CI-.                     1-C                                        I-C             CI-’                          -CI-                       I-C                       00                                                      I-C                  4*-.                    I-C
  141-.                        00                       01.)                                     CI-               C,-’                       1)0                           00                        1-C                                                  I-C                   00                        Cl-
     CI-                       00                       1-C                                      CI-               CI-                        CI-                           00                   I-C                                                        <1-                  00                        I-C
     01.)                 #{149}C*-’              .#{231}).)                                 ‘CI-              .1)0                       .1)1..)                     -1-C                    -I-C                                                      -I-C                 ‘I-C                    .4*-
         00                    1-4                         C                                     CI-               CI-                        C                             1-C                                                                            I-C                     00                      (-C
  lI-C                         Cl-’                     C                                          I-C             I-C                        .4                            <.)Q                      C                                                       00                   Cl-.                    01.)
         -.<                   01.)                     CL                                         00                00                       l-.C                          01.)                      0                                                       00                   I-C                     CI-.                                                WV
,iCI-                          CI-                      C                                          00                I-C                      01.)                          I-C                       C                                                       CI-                I-C                       CI-                          a
CSCI-.                         <p.’                        -C                                      01.)              00                          00                         1)0                       C                                                       00                 I-C                    I-C                             WS                     .
NCI-                           0)                          C                                       00                I-C                      I-C                         C1-                         I-C                                                     1-4                00                      CI-
     I-C                       00                          4                                       CI-               C1-                      CI-.                        0’.)                        I-C                                                     00                 00                     00
00C)                           ‘CI-                        C                                       0’.)              1-C                      00                          00                          1-C                                                   00                   I-C                    00-
         00                    I-C                         01.)                           Al-.4                     00                        1-C                         Cl-                     00                                                        00                   CI-                    00          I
  IOU                     ‘CE’                                                              I .JC.)            .‘.)tJ                     -Cl-’                       -I-C                    -I-C                                                      .41-’                .1-C                    -CI-’          I
         00                    01.)                        00                               IOU                      1-C                         010                               C              00                                                        00                   00                     <1-         I
  1<1-                         00                          ‘-C              .‘              11-C                     I-C                         CII-                       l-.C                  00                                                        00                                          00          I                    c
  101.)                        Cl-.                        C                                l.C                      CI-                         C                          <I-                   1-C                             -                  ,s00                                               I-C         I
                                                                                                                                                                                                                                                                                                                                                               0             -

  IOU                          I-’C                        C                     C.         141-.                    CI-                         bo                         00                    I-C                             1-                   ‘CI-                                  C          CI-         I
-00                            00                          C’-               01                    Cl-.              1-C                         00                         I-C                   I-C                              C.                       00                               C             CI-      I                                .
         Cl-.                  CI-                         ol.,             X
                                                                                          cIU0
                                                                                                   00                1-C
                                                                                                                     1)0
                                                                                                                                                 I-C                        1-C                   1-C                                  01              ‘1-4
                                                                                                                                                                                                                                                           00
                                                                                                                                                                                                                                                                                             C             Ci-’     I                    o                             41)
         00                    CI-                         I-C              ‘-                                                                   00                         1-4                   00                                                                               Ci-’                    00       I                   .C
         00                    C.)0                        CI-.                           (‘100                      1-4                         1-C.’                      1-C                       I-C                         ‘-‘                  lI-C                        00                      I-C                                                         C’)
         Cl-’                  41-                         1-C              C’            (‘ICI-                     C’-               ‘OCJI-’                              CI-                       C                                                lOU                         (JO                     00.0
         I-.         .    . 4 1-                  -        oIc                                     1..)0                               <01)0.                         .00                     -C                                  -                    Il-C                  .00                           I- Cfl
         00                 00                             ‘-4              V             OI-C                       00                -0001                                CI-.                                                  -                           00                 C                         CI-N
         00                    00                                           ‘0                     I-C               I-C                         OOX                        CI-                       I-C                            -               r-00                        U                         I-C                           41                            (P.1
         CI-                   I-C                         01.)               C.            141-.                    00                          CI-’-                      CI-                       C                           (‘1                “lI-C                       00                        000                           W
         01.)                  1.)’..)                     0C.)#{149}        X                     CI-.              4’-’                        01.)                     00                          0                                 )            NI-C                        (50                       1-C                                                         N-
         ‘_)U                  00              ..CI-’-.l                                           00                00                          CI-’                     41-                         I-C                                                     00                 C-’                       CI-      I
                                                                                                                                                                                                                                                                                                                                        ‘2               co
         01.)                  1-4             I-’U1.)’                                     ICI-                     I-C                         (51)                     00                          (JO                         -‘                 01-C                        C’                        CI-      I
         1-C                   I-C              ..-‘C.)U)                        O                 CI-.              Cl-.                        CI-                      I-C                         00                               o                      CI-                0                         CI-      I
         -C’-.                 l-’C                        1-Ca-                            100                      00                          I-C                      CI-                         I-C                                              100                       C’-
         4L                    I-.C                        00-’                  4)       -01)                       00                          00                       01.)                        I-C                              41              100                       01)
  .Ct..                   ..)O                     .Q()                          U                             .1-C                          .‘.LJ                    .4.1-                   -1-C                                     o               100                   -I-C                    ‘<1-           I                   .C
      Cl-’                    41-                          1-C                   C                                 C                             I-C                      C,-’                        C                                C               ICI-                      00                     00          I
         C                     Cl-’                        00                    4)                                  CI-.                        00                       CI-.                        0                                41              11-C                      I-C                    I-C         I



                                                                                                                                                                                                                                                                                                                                        i-lU-
         00                    00                          00                                                        00                          CI-’                     00                          I-C                              )             -00                         00                     00          I
         00                    I-#{149}C                   1-C                   C’                                  00                          CI-                      Ci-’                        C1-                              C’                     CI-                00                     00’?
         00                    Cl-                         I-C                   4)                                  I-C                         I-C                      Ci-                         00                               4)                     00                 Cl-                    I-C
         Cl-.                  00                          01.)                                                      I-C                         CI-                      CI-                         I-C                         (l                          CI-.               Ct-.                   00
         01..)                 1-4                         01.)                                                      00
                                                                                                                     Cl-
                                                                                                                                                 00
                                                                                                                                                 CI-
                                                                                                                                                                          00
                                                                                                                                                                          C’-’
                                                                                                                                                                                                      I-C
                                                                                                                                                                                                      00
                                                                                                                                                                                                                                                              00
                                                                                                                                                                                                                                                              00
                                                                                                                                                                                                                                                                                   I-C
                                                                                                                                                                                                                                                                                   CI-
                                                                                                                                                                                                                                                                                                        C’-                             a.
         00                    -CI-                                                                                                                                                                                                                                                                     Ci.-
         CI-                   1)0                         00                                                        01.5                        I-C                      CI-                         1-C                         0.                          Cl-.                 1-C                     1-C




                                                                                                                                                                                                                                                                                                                            0               CV
   .41-.                  00                                                                 -Cl-’             -00                           -00                                              ‘00                   --41                               -boo                  -o
      I-C                        Cl-’                      I-C                                   00                  00                          CI-                                                  00                14’-’                             boo                       boo
       1)0                       I-C                        CI-.                                                                                 00                                                   1-C               boo                                     OX                  “U
          CI-’                   00                        CI-                                                                                   00                                                   00                   bOO                                  OX                  “14                                     0
          CI-                    Cl-’                      C                                       1-C               CI-                             C1-                                              00                    0”                                  boo                 v
          I-C                    00                        1.)                                     Cl-’              C                               00                                               00                   000                                  10”                 XIJ
          I-.C                   Cl-                       IC                                      CI-                      0                        00                                               00                   000                   -            -U                    10”
          I-C
          Cl-
          01..)
          .. 4
                                 I-’C
                             01.)-
                             001-
                           .41-            C       .4
                                                           C
                                                           C
                                                           C
                                                                                             -00
                                                                                                   01.)
                                                                                                   00
                                                                                                   00
                                                                                                               ‘41-
                                                                                                                     00

                                                                                                                            0
                                                                                                                                             -I-C
                                                                                                                                                 01.)
                                                                                                                                                 00
                                                                                                                                                     C                                                I-C
                                                                                                                                                                                                      I-C
                                                                                                                                                                                                      C1-
                                                                                                                                                                                                                           41-
                                                                                                                                                                                                                           OX
                                                                                                                                                                                                                           boo
                                                                                                                                                                                                                                                              ‘-‘10
                                                                                                                                                                                                                                                               #{128}0”
                                                                                                                                                                                                                                                                U
                                                                                                                                                                                                                                                                                    boO
                                                                                                                                                                                                                                                                                    10”
                                                                                                                                                                                                                                                                                    OX
                                                                                                                                                                                                                                                                                                                        -c
                                                                                                                                                                                                                                                                                                                            a
                                                                                                                                                                                              -I-C                  .000                               #{149}I0                     00IJ
          Cl-.           -004                              C                                       00              C                                                                              00                       10”                              10”                     0001
          l-.C           )(#{231}                          -Cl-                                    I-C             ‘.                                CI-                                          00                       000                              10’.’                   I0I
          00                     ()0-’                     I-C                                     CI-             I-.C                                                                           00                       OX                               10”                     boO          i
          Cl-                    I-C                       C                                       00                l-<                                                                          1-C                      OX                               10’.’                   boO          I                          0
                                                                                                                                                                                                                                                                                                                            Dl
                                                                                                                                                                                                                                                                                                                                        -E
          01..)                  I-C                       0                                       00                I-C                             C                                            00                       000                                  000                  001.11
          I-C
          01.)
                                 C.)C.)
                                 I-’C
                                                           C
                                                           C
                                                                                                   I-C
                                                                                                   CI-
                                                                                                                     00
                                                                                                                     1-C
                                                                                                                                                     00
                                                                                                                                                     CI-
                                                                                                                                                                                                  00
                                                                                                                                                                                                  00
                                                                                                                                                                                                                           000                                  #{128}0”
                                                                                                                                                                                                                                                              .‘l4
                                                                                                                                                                                                                                                                                    ‘.‘l0
                                                                                                                                                                                                                                                                                    Obo
                                                                                                                                                                                                                                                                                                                                                                   a
          -C’-                   CI-.                      C                                       00                Ct3                             00                                               1-C                  boO                                  U’-’                000C”                               -                   e
          Ct-.                   01..)                     .                                       00                0                               CI-                                              1-C                  Q                                    14..                  o-’m
 A0O                       .00                     .4*-’                                     -CI-              -00                           -00                                              .00                   -000                               .10’-’                       10’-’
   lI-C                          41-                       1-C                                                                                       CI-’                                             00                   “4)                                  14’-’                0000
          Ct-’                   CI-’                      I-C                                     00                ‘.5                             CI-                                              I-C                               U                       .0”                 “14
   IO._,
      01.)
   11-C
                                 0..)
                                 00
                                 1-4
                                                           Cl-’
                                                           00
                                                           00
                                                                                                   CI-
                                                                                                   CI-
                                                                                                                     tIC)
                                                                                                                     I-IC
                                                                                                                               C                     00
                                                                                                                                                     41-
                                                                                                                                                     I-C
                                                                                                                                                                                                      1-C
                                                                                                                                                                                                      00
                                                                                                                                                                                                      I-C
                                                                                                                                                                                                                           “10
                                                                                                                                                                                                                           OX
                                                                                                                                                                                                                           14’-’
                                                                                                                                                                                                                                                              .“U
                                                                                                                                                                                                                                                                000
                                                                                                                                                                                                                                                                10”
                                                                                                                                                                                                                                                                                     0001
                                                                                                                                                                                                                                                                                     0001
                                                                                                                                                                                                                                                                                     0001
   lI-C                          1-C                       4-.                                     I-C               1-IC                            00-                                         C                         OX                                 “14                   l0”l
          01..)                  Cl-.                 l-                                           00                1-IC                            C1-I                                        0                         000                                  000                 “101
 r’-1-C                          1-C                  00                                           C1-               1-IC                            00’                                         CI-                                                                    14          14-’’?                                                                              1.)
 .01-4                           00                   C1-                                          1-C               I-IC                            41-I                                        00                        “U                                   OX                  B                                       ce
 (‘100                     -CI-.                   .41-                                       -    0   U       -     CII-          .         -       I-      -C                               .1-C                  -OX                                -“15                  .001.1
          01.)                CI-                     00                                            CE’              (jl0’-l                         1-C          I                              I-C                       U                                    001)                “‘0                                 .i
 041-                            Cl-’                 CI-                                          CI-       ‘OlOC.                                  00                                          I-C                       “10                                  000                 bOO                                 -C                   e.Doz
   Il-C
       01..)                     00
                                 00
                                                      00
                                                           00
                                                                                                   00
                                                                                                   00
                                                                                                             1-01001
                                                                                                             ‘-‘OIOX
                                                                                                                                                     00.?
                                                                                                                                                     I-CN
                                                                                                                                                                                                 00
                                                                                                                                                                                                  C
                                                                                                                                                                                                                           0”
                                                                                                                                                                                                                           41”
                                                                                                                                                                                                                                                                OX
                                                                                                                                                                                                                                                                000
                                                                                                                                                                                                                                                                                    001.1
                                                                                                                                                                                                                                                                                    IS”                                     e-                           o
          CI-’                   I-C                       ‘CI-                                    Cl-             010’-’                            OU1’l                                       0                         “10                                  OX                  OX
                                                                                                                                                                                                                                                                                                                            0
   IC                            00                        CI-.                                    00              CII-                              1-C                                         00                         000                                 10”                 10”
   I-Cl-’                        I-C                       I-C                                     I-C             1-IC                              000                                         I-C                       “IS                                  10”                 boO
   IL1.)                      I-C                          I-C                                     00              I-IC                              I--C                                         CI-                      000                                  IS”                 “14
   141-                       I--C                         I-C                                     00              CII-’                             001                                         1-4                       OX                                   001.1            000
 _(_,C.)                   .41-’                   -I-                                                                                                                                      A1-C                    -000                               .000                  -000
                                                                                              -1-C                   010                     -00                  I                           Il-C
      00
          Cl-
          1-C
                                 00
                                 Cl-
                                 00
                                                           1-
                                                           I-C
                                                           CI-’
                                                                                                    fl
                                                                                                    00
                                                                                                                     tI
                                                                                                                     00                              001
                                                                                                                                                                                              IC1-
                                                                                                                                                                                              100
                                                                                                                                                                                                                           OX
                                                                                                                                                                                                                           14”
                                                                                                                                                                                                                           OX
                                                                                                                                                                                                                                                                000
                                                                                                                                                                                                                                                                boO
                                                                                                                                                                                                                                                                OX
                                                                                                                                                                                                                                                                                  000
                                                                                                                                                                                                                                                                                    10’.’
                                                                                                                                                                                                                                                                                    boo
          00                     1-C                       1-C                                      1-C              C                               00’?                                             00                   “IS                                  10”                 boO
          00                     00                        I-C                                      00                         C                     CI-                                      I 00                         OX                                   000                 IS”
          00                      CI-’                     C                                        -CI-             00                              00                                       IC                           000                                  IS”                 OX
          00                      CI-’                     C                                        Cl-              C                               00                                       I’..)                        000                                   10”                “U
          0Crn)                   0C)                      1-C                                                       C                                                                                1-C                               14                    “U                    OX
       Cl-.                       00                       Cl-.                              Il-C                    I-C                                                                    OCI-                           000                             000                      IS”
    #{149}CI-              ‘1-C                       .l-.C                                  IOU               -00                           -I-C                                           0’00                    -‘0”                               -bOO                  -“14
       I-C                     I-C                         ‘JO                               ICE’                    1-C                         1-C                                        “11-C                          OX                                   000                 000
       00                         1-4                       4.1-                             Il-C                    00                          00                                             1-C                        bOO                                “14                   boo
       Cl-.                       I-C                      1-C                               Il-C                    00                          I-C                                        0<1-’                          OX                                   OX                  IS”
           I-C                    00                       I-C                               100                     I-C                             00                                               00                   000                                  (JOe                OX
           I-C                    *--c                     CI-.                  -                 00             I-C                            00                                    C’     I(5U                         boO                                “‘0                   OX
           Cl-                    1-C                      00-                    0.       000                    1-C                            I-C                                   ‘0     100                          bOo                                14                    OX
      1..)’..)                I-C                        00                       U        (‘.1<1-                00                             00                                           IOU                          OX                                   OX                  “‘0                                     0
      I-C                     Cl-’                       00’                     X         N00                     00                            00                                -          100                          OX                                   OX                  boo
      01..)                   I-C                        CI-’                                      CI-            00                             I-C                                          ‘Cl-                         000                                  U”                  U’-’
    .QQ
           00
                           .41-
                                  CI.
                                                      .00
                                                               .I-I
                                                                        I                  (50’.)
                                                                                                   00
                                                                                                               -CI-
                                                                                                                   CI-
                                                                                                                                             .41-
                                                                                                                                                 00                                N
                                                                                                                                                                                       o    -00
                                                                                                                                                                                                      1-C
                                                                                                                                                                                                                    -boo
                                                                                                                                                                                                                      00
                                                                                                                                                                                                                                                       -
                                                                                                                                                                                                                                                                14’
                                                                                                                                                                                                                                                                        0    ‘“‘0
                                                                                                                                                                                                                                                                                    000
                                                                                                                                                                                                                                                                                                                            o
                                                                                                                                                                                                                                                                                                                            (I)
           00                     I-C                       00                                ‘CI-’                (JO                           00                                                   I-C                 1-4                         10                0           “14
                                                                                                                                                                                                                                                                                                                                             E
             CI-                  CI-                       01..)-?                  01       lI-C                 00                            CI-                                                  C1-                 00                         ‘-‘OX                          OX
             00
             CI-
                                  l-.C
                                  E#{149}-C
                                                            00.0
                                                            Cl--’
                                                                                              IOU
                                                                                              Il-C
                                                                                                                   I-C
                                                                                                                   I-C
                                                                                                                                                 I-C
                                                                                                                                                 1-C
                                                                                                                                                                                   *4                 I-C
                                                                                                                                                                                                      CI-
                                                                                                                                                                                                                          CI-
                                                                                                                                                                                                                          41-
                                                                                                                                                                                                                                                              “IS
                                                                                                                                                                                                                                                               IS.-’
                                                                                                                                                                                                                                                                                    OX
                                                                                                                                                                                                                                                                                    bOO
                                                                                                                                                                                                                                                                                                                            2                E.
             0<.)
             I-C
                                  1-C
                                  00
                                                        1-C
                                                         1-CO                        0        ‘00
                                                                                                    CI-            tC
                                                                                                                               0
                                                                                                                                                 1-C
                                                                                                                                                 1-C
                                                                                                                                                                                   -
                                                                                                                                                                                       C
                                                                                                                                                                                                      00
                                                                                                                                                                                                      I-C
                                                                                                                                                                                                                          00
                                                                                                                                                                                                                          I-C                                   UI”
                                                                                                                                                                                                                                                                        0           000
                                                                                                                                                                                                                                                                                    000
                                                                                                                                                                                                                                                                                                                                0            g            e’-
             01..)                00                     I-C                               -00                       I-C                         00                                                   00                  00                                    000                 000
             00               I-C                        I-Cl                        01            I-C               00                          C                                     01             00                  I-C                                   boo                 000
    .1)0                   -1-4                       -CI-                           V         -Cl-’                 1-C                     -1.)o                                     U          -I-C              .00                                .151”                 .“14
       1-C                    I-’C                             001                   0             00                00                          00                                    C             I-C                   CI-                             OX                       XO
       CI-.                   00                               1-Cl                  41            C                 C                           I-C                                   4)            1-C

                                                                                                                                                                                                                                                                                                                                             b
                                                                                                                                                                                                                          CI-                                 “U                    Xl)
       (51..)                 I-C                              00                                  1)0                         0                 1-C                                                  I-C                 C,-                                  000
             I--C                 .Cl.                         Ct-I                  C’             01.)             I-C                         00                                                   I-C                  Ci-                                 000                   XII
             CI-’                 *-C                          (5)V               44                CI-              01.)                        00                                 41                CI-                 Ci-.                                 U”                   -‘14
                                                                                                                                                                                                                                                                                                                                    -                    1-
             CI-.                 01..)                        I-C               4                  00                -Ci--                      1-C                               (I)                C                   I-C                                   000                 “10
             00                   CI-                          C’-.                                 CI-              Ci’                          00                                                  0                   Ci-                                 “‘0                   boO
             1-4                  CI-                          <I-                                  I-C              01.)                        *-C                                                  00                  00                                   0”                   050
             01.5                 I-C                          l.C               0                  CI-              00                           CI-                              0                  I-C                  Ci-’                                OX                   500




                                                                                                                                                                                                                    CLINICAL                                    CHEMISTRY,                       Vol. 36, No. 9, 1990                                               1617
                                                                                                          polymorphic       sites involves        direct digestion           of the amplifiei
                                                                                                          DNA with the restriction              enzyme.        In this way, polymorphi
                                                                                                          sites near XV-2c (20), KM.19                  (22), or J311          (31) have beei
                                                                                                          assayed.     Although        this is a convenient             analytical        method
                                                                                                          the application        of this technique          to clinical     diagnosis        raise

                      F #{149}..                         metD-1
                                                    #{149}
                                                                                                          concerns.     Unless
                                                                                                          lack of digestion
                                                                                                                                   appropriate
                                                                                                                                     of the amplified
                                                                                                                                                       control     sites are included,
                                                                                                                                                                  DNA could          arise
                                                                                                                                                                                                  thi
                                                                                                                                                                                               fron
                                                                                                          either the absence          of the polymorphic            site or a failure         of thi

                      F                  #{149}..
                                                                 metD-2                                   enzyme
                                                                                                          results
                                                                                                                      to digest
                                                                                                                    of an incomplete
                                                                                                                                      the amplified
                                                                                                                                               digestion
                                                                                                                                                              DNA.       Furthermore,
                                                                                                                                                                of a homozygous            sampli
                                                                                                                                                                                                  thl

                                                                                                          can appear the same as a complete                      digestion       of a heterozy
                                                                 metH-2                                   gous sample,       and the presence             of nonspecific         ampliflcatioi
                            .#{149}.                .                                                     products     can confuse       the analysis        of the digest (22). Finally
                                                                                                          the extraction,        digestion,      and gel analysis            of a large num
                                                                 metH-3                                   ber of samples        increase      the possibility          of diagnostic         error.
                           .           ...
                                                                                                              We thank Kathy Hehir and Rene Schweickhardt             for additions
                                                                                                          sequencing;      Gary White for oligonucleotide   synthesis     and prepa
                                                                 J31     1-1                              ration;   Greg Landes, Gabriela       Wright, and Ben Leverone             fo
                                  ...#{149}                                                               cosmid DNAs; John Johnson         for assistance with the initial meti
                                                                                                          mapping; Robei-t Williamson      for many of the CF RFLP probes; ani
                                                                 J31     1-2                              Barbara     Handelin  and Bob Rochelle for summaries      of their clinics
                           S...                                                                           testing experiences.    This work was supported    in part by NIH gran
                                                                                                          1-R43-HD-25348-01.
Fig. 4. Detection        of polymorphisms     by ASO dot-blots
At the top is diagrammed the pedigree of a family segregating a CF mutation.                              References
To test the correspondence       between the RFLP and PCR/ASO methods, we                                 1. Rommens         JM, Iannuzzi           MC, Kerem BS, et al. Identification                       o
amplified these DNA samples, applied them in duplicate to nylon blotting
                                                                                                          the cystic    fibrosis gene: chromosome                walking and jumping.               Scieno
membranes (boxes), and then hybridized them with the labeled ASO probes
listed on the right. Stringent washing of the filters followed by autoradiography                          1989;245:1059-65.
allows genotyping of the samples at each locus. These results correspond with                             2. Beaudet        A, Bowcock A, Buchwald                   M, et al. Linkage            of cysti
those seen previously in Southern blot RFLP analysis (data not shown)                                     fibrosis to two tightly linked DNA markers:                           joint report from
                                                                                                          collaborative       study. Am J Hum Genet 1986;39:681-93.
                                                                                                          3, WhiteR,        Woodward         S, Leppert M, et al. A closely linked geneti
the CF-linked            RFLPs        (including         CS.7) are caused by single-                      marker for cystic fibrosis. Nature (London) 1985;318:382-4.
                                                                                                          4 Estivill X, Fan-all M, Scambler                      PJ, et al. A candidate for thi
base alterations.             All five of the polymorphisms                             involving
                                                                                                          cystic fibrosis locus isolated                by selection          for methylation             ft-a
 CpG dinucleotides                are of the transitional                    type      consistent         islands. Nature (London) 1987;326:840-5.
with the deamination                   of a methylated             cytosine        (19), leading          5. EstivillX, McLean C, Nunes V, et al. Isolation                             of a new DNI
to conversion           to a thymine              residue       after replication.                        marker      in linkage        disequilibrium           with cystic fibrosis,             situatei
    The polymorphic                Taq I site near probe                  XV-2c was found                 between J3.11 (D758) and IRP. Am J Hum Genet 1989;44:704-1O
within       an Alu repeat             element,        with other members                     of this     6. Bartels I, Grzeschik              KH, Cooper DN, Schmidtke                      J. Regiona
                                                                                                          mapping of six cloned DNA sequences                          on human chromosome                    7
family potentially              serving         as donors        of altered         sequence.         A
                                                                                                          Am J Hum Genet 1986;38:280-7.
polymorphic            Bgl I site in the Factor                       VIII gene was also                  7. Saiki RK, Gelfand              DH, Stoffel S, et al. Primer-directed                       enzy
found to reside in an Alu repeat (25). The polymorphic                                            Msp     matic amplification          of DNA with a thermostable                   DNA polymerase
I site near probe MP6d-9 is centered                             on a potential             hairpin       Science 1988;239:487-91.
structure,        which affects both the labeling                        and hybridization                8. Stundencki         AB, Conner BJ, Impraim                   CC, Teplitz RL, Wallaci
efficiencies        of the ASO probes. Although                        we have suggested                  RB. Discrimination           among the human               fr, 9, and 9-globin               gene
                                                                                                          using allele-specific          oligonucleotide           hybridization         probes.       Am,
procedural           modifications              to circumvent              these       problems,
                                                                                                          Hum Genet 1985;37:42-51.
this assay          may also illustrate                 an advantage                of non-ASO            9. Saiki RK, Chang CA, Levenson CH, et al. Diagnosis of sickl
formats.                                                                                                  cell anemia and -thalassemia                  with enzymatically             amplified DN
    In this study         we hoped to find additional                       polymorphisms,                and nonradioactive          allele-specific       oligonucleotide          probes.     N Engl
not involving             altered         restriction         sites,      near       the known            Med 1988;319:537-41.
RFLP       sites. These polymorphisms                          may have been able to                      10. Park M, Haces M, Dean M, et al. The met oncogene:                                       a ne
                                                                                                          member       of the tyrosine          kinase     family and a marker for cysti
increase       the genetic          diversity        of these loci, thereby                improv-
                                                                                                          fibrosis. Cold Spring Harbor               Symp Quant Biol 1986;51:967-75,
ing their diagnostic               utility.      Regions        surrounding             several      of   11. Estivill      X, Scambler          PJ, Wainwright              BJ, et al. Patterns
these known            polymorphisms                (including         our analysis            of the     polymorphism          and linkage         disequilibrium           for cystic fibrosis.
CS.7 probe; data not shown)                           were analyzed               from several            nomics 1987;l:257-63.
different       haplotypes.          In most cases, no additional                        polymor-         12. Stanier       P, Estivill X, Lench N, Williamson                      R. Detection          of
phisms        were revealed.              A single        polymorphism                not associ-         rare-cutter      RFLP in a CpG-rich                 island     near the cystic fibrosi
                                                                                                          locus. Hum Genet 1988;80:309-10.
ated with the RFLP was found within                                probe J3.11 (data not
                                                                                                          13. Williams         C, Williamson           R, Coutelle C, Loeffler F, Smith
shown),        but when            studied         in detail         was limited             to one       Ivinson A. Same-day, first-trimester                    antenatal      diagnosis       for cyst
pedigree        and may have represented                         a new mutation.                          fibrosis by gene amplification.               Lancet       1988;ii:102-3.
    Several       methods        are available            to analyze         polymorphisms                14. Maniatis         T, Fritsch       EF, Sambrook            J. Molecular          cloning
in amplified           DNA. In addition                  to the ASO hybridization                         laboratory manual. Cold Spring Harbor, NY: Cold Spring H
assay      used       here,    the amplified                DNA        can be sized              (26),    Laboratory,       1982.
                                                                                                          15. Klinger K, Stanislovitis               P, Hoffman N, et al. Genetic homog
sequenced          (27), or selectively               denatured          (28). More recent
                                                                                                          neity of cystic fibrosis.         Nucleic      Acids Res 1986;14:8681-6.
methods         involve       allele-specific            PCR primers                 (29) or the          16. Scharf SJ, Horn GT, Erlich HA. Direct cloning                               and sequen
detection        of altered         conformation             in single         strands        of the      analysis     of enzyznatically          amplified        genomic       sequences.         Scien
amplified         DNA        (30). A common                    analytical           method         for    1986;233:1076-8.

1618       CLINICAL        CHEMISTRY,             Vol. 36, No. 9, 1990
17. Saiki RK, Bugawan            TL, Horn GT, Mullis KB, Erlich HA.                    prenatal     diagnosis  of genetic diseases      by analysis     of amplified
analysis   of enzymatically      amplified     -globin   and HLA DQa DNA               sequences.     N Engl J Med 1987;317:985-90.
Nith allele specific probes. Nature (London) 1986;324:163-6.                           26. Horn GT, Richards B, Klinger KW. Amplification                 of a highly
18. Leverone      B, Lerner T, Watkins            PA, Landes    G, Klinger    K.       polymorphic     VNTR     segment    by the polymerase        chain reaction.
osmid    clone isolated by probe pJ3.11 reveals a new RFLP linked                      Nucleic Acids Res 1989;17:2140.
o cystic fibrosis. Am J Hum Genet 1988;43: A192 (abstract                 0764).       27. Gyllensten     UB, Erlich HA. Generation             of single-stranded
19. Bird A. CpG-rich        islands    and the function      of DNA methyl-            DNA by the polymerase         chain reaction     and its application     to the
ttion. Nature     (London)    1986;321:209-13.
                                                                                       direct sequencing    of the HLA-DQa       locus. Proc Natl Acad Sci USA
10. Rosenbloom       CL, Kerem BS, Rommens             JM, et al. DNA ampli-
                                                                                       1988;85:7652-6.
ication  for detection    of the XV-2c polymorphism             linked   to cystic
ibrosis.  Nucleic    Acids Res 1989;17:7117.
                                                                                       28. Sheffield      VC, Cox DR, Lerman LS, Myers RM. Attachment                    of
                                                                                       a 40-base-pair        G+C-rich     sequence     (GC-clamp)       to genomic    DNA
11. Labuda D, Striker       G. Sequence   conservation      in Alu evolution.
ucleic    Acids Res 1989;17:2477-91.                                                   fragments      by the polymerase         chain reaction      results in improved
12. Feldman GL, Williamson            R, Beaudet AL, O’Brien WE. Prena-                detection      of single-base       changes.      Proc NatI Acad Sci USA
al diagnosis    of cystic fibrosis by DNA amplification        for detection of        1989;86:232-6.
KM.19 polymorphism.          Lancet    1988;ii:102.                                    29. Wu DY, Ugozzoli              L, Pal BK, Wallace           RB. Allele-specific
13. Huth A, Estivill X, Grade K, et al. Polymerase             chain reaction          enzymatic      amplification     of -globin     genomic DNA for diagnosis of
hr detection    of the pMP6d-9/Msp        I RFLP, a marker closely linked              sickle cell anemia. Proc Natl Acad Sci USA 1989;86:2757-60.
o the cystic fibrosis mutation.         Nucleic Acids Res 1989;17:7118.                30. Orita M, Suzuki Y, Sekiya T, Hayashi                 K. Rapid and sensitive
14. Wong      C, Antonarakis        SE, Goff SC, Orkin SH, Boehm                  C,   detection     of point mutations        and DNA polymorphisms            using the
Kazazian     HH. On the origin and spread of $-thalassemia:                recur-      polymerase       chain reaction.     Genomics      1989;5:874-9.
mnt observation      of four mutations      in different ethnic groups. Proc           31. Northrup        H, Rosenbloom        C, O’Brien WE, Beaudet          AL. Addi-
atl Acad Sci USA 1986;83:6529-32.                                                      tional polymorphism           for D7S8 linked to cystic fibrosis including
15. Kogan SC, Doherty M, Gitachier               J. An improved method for             detection    by DNA amplification.           Nucleic Acids Res 1989;17:1784.




                                                                                                         CLINICAL     CHEMISTRY,         Vol. 36, No. 9, 1990        1619

								
To top