Table 6 - Proceedings of the National Academy of Sciences

Document Sample
Table 6 - Proceedings of the National Academy of Sciences Powered By Docstoc
					Table 6. Primers used for quantitative RT-PCR


                                                                                                                                                                Validated CONV   Validated CONR
Gene name                                                                          Forward primer                            Reverse primer                                 a                b
                                                                                                                                                                 vs GF 6dpf       vs GF 6dpf

Angiogenin 4 (Ang4)                                                          5'-   TGCTGGTCTTCAGCTTCTCTTTC             5'-   TTGCACACTCATATCAGGATCCA                   N/A            yes
Apolipoprotein B (Apob)                                                      5'-   GGAAGCATGATCTGCGTCAGA               5'-   AAGACGTGATCCCATTGTTGTG                    yes            yes
Arginase II (Arg2)                                                           5'-   GAGCATGGACCCAAAGCTATTC              5'-   GAAGGTCAGGTCTCCGAAATCAT                   yes            yes
Complement component 3 (C3)                                                  5'-   TGGGAGGCAATAGGCATGA                 5'-   GCGTAGGATCCATCTGGTTTG                     yes            yes
Cytochrome P450, family 27, subfamily A, polypeptide 1 (Cyp27a1)             5'-   CACTGAACGAAAGTTTGCCTTAAC            5'-   TGGAAATGCATCTGGCTTTG                      no             yes
Deleted in malignant brain tumors 1 (Dmbt1)                                  5'-   TAGGAGCTGCCAAGGGATCTC               5'-   GTAAGGTGATCATCTGCCCTGATA                  yes            N/A
Dolichyl-diphosphooligosaccharide-protein glycosyltransferase (Ddost)        5'-   TTTTCTTTTTCTCTCATATGGAGAAAGAC       5'-   CCCAGTACGAGCGCTTCATC                      yes            N/A
Fasting-induced adipose factor (Fiaf)                                        5'-   CGAGCGCATCAAGCAACA                  5'-   TCGCTCGTTTTTCATCGTAATCT                   N/A            yes
Glutathione peroxidase 2 (Gpx2)                                              5'-   AACTGCACAAATGAAGAGATCCTTT           5'-   CCACTTTCTCCAAGAGCTGGAAT                   yes            yes
Glutathione S-transferase pi 1 (Gstp1)                                       5'-   GATGAAGGGCGACTTGAAAGC               5'-   CATGGCGTTGGACTGAAACA                      yes            N/A
Integrin beta 1 binding protein 3 (Itgb1bp3)                                 5'-   ATCCCATATGAGGAGTGCAAAAAA            5'-   GGGCCACACATGACCATCA                       yes            N/A
Myeloperoxidase (Mpo)                                                        5'-   TTGAGGGAAGCCAGATCCAA                5'-   TGAACACCCAGGACCACATGT                     yes            yes
Peroxisome proliferative activated receptor, alpha (Ppara)                   5'-   CTTCCGTCGGACCATTCG                  5'-   GTATTGGCACTTGTTTCGGTTCT                   N/A            yes
Serum amyloid A protein (Saa1)                                               5'-   CGCCGAGGCAATTCAGAT                  5'-   CAGGCCTTTAGGTCTGTATTTGTTG                 yes            N/A
Solute carrier family 31, member 1 (Slc31a1)                                 5'-   GGATCTGATGGCACCGTACTC               5'-   TGTGAAGAAGCGTCTGTAAGAAGTG                 yes            no
Tryptophanyl-tRNA synthetase (Wars)                                          5'-   AGAAGCATGTGACTTTTAACCAGGTT          5'-   CTGCCTGAATGGCTGGAAA                       yes            N/A
Tyrosyl-tRNA synthetase (Yars)                                               5'-   TATATTTAGAGAAGATTGATGTGGGTGAA       5'-   TCCTGAAGCTGTTCCTCTGTGA                    yes            N/A
18S ribosomal RNA (18S)                                                      5'-   CACTTGTCCCTCTAAGAAGTTGCA            5'-   GGTTGATTCCGATAACGAACGA                    N/A            N/A


  aResults from qRT-PCR validation of CONV vs GF 6dpf digestive tracts (yes = >1.5-fold difference in same direction as microarray results; no = <1.5-fold difference; N/A
  = not applicable, no difference found in DNA microarray comparison).

  b   Results from qRT-PCR validation of CONR vs GF 6dpf digestive tracts.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:12
posted:3/3/2012
language:
pages:1