DNA Structure and Replication (PowerPoint download) by lanyuehua

VIEWS: 20 PAGES: 10

									DNA Structure and
Replication
AHSGE Review




                    white
Ch 11.1 DNA Structure
   A DNA molecule is
    made of 2 strands of
    repeating subunits
    called nucleotides.
   Each nucleotide is
    made of 3 parts:
1.  Simple sugar called                  Sugar (deoxyribose)
    deoxyribose.
                             Phosphate
2.  Phosphate group            group
(These both form the                                           Nitrogenous
    ‘backbone’ or sides of                                         base
    the DNA molecule.)
3.  Nitrogenous base
    (adenine, guanine,
    cytosine, or thymine)
The bases form the ‘rungs
    of the ladder.’
Practice!

   Match this DNA strand with its
       complementary strand.


TCGTTCATAATCGCTGCATA
AGCAAGTATTAGCGACGTAT
Question 1
 Which of the following is NOT a component of
  DNA?
  A. simple sugars
  B. phosphate groups
  C. nitrogenous bases
  D. proteins


The answer is D.
Question 2

 Which of the following correctly comprises a
  complimentary base pair?
 A. adenine – thymine
 B. thymine – guanine
 C. guanine – adenine

 D. cytosine – thymine
The answer is A.
Question 3

 Which of the following makes up the backbone of a
  DNA molecule?
 A. ribose sugar, phosphate group
 B. nitrogen base, ribose sugar
 C. deoxyribose sugar, nitrogen base

 D. deoxyribose sugar, phosphate group
The answer is D.
Replication of DNA
   Before a cell can divide by mitosis or meiosis,
    it must first make a copy of its
    chromosomes.
   DNA is copied during interphase prior to
    mitosis and meiosis.
   It is important that the new copies are
    exactly like the original molecules.
   The DNA in the chromosomes is copied in a
    process called DNA replication.
   Without DNA replication, new cells would          Video
    have only half the DNA of their parents.
 Copying DNA
                                    New DNA
                                    molecule


               Original
                DNA
               Strand                     Free
                          New DNA      Nucleotides   New DNA
                           Strand                    molecule
                                    Original
                                     DNA
                                    Strand




Original DNA
Steps for DNA Replication
1.   Separation of strands: an enzyme breaks
     the hydrogen bonds holding the strands
     together.
2.   Base pairing: Free nucleotides floating in
     the surrounding area attach to the
     exposed nucleotides on the DNA strands.
3.   Bonding of bases: The sugar and
     phosphate of each nucleotide bond to
     form the backbone as the nitrogen bases
     bond down the center of the ‘ladder.’
    Results of
    Replication

•After DNA replication is   DNA
complete, two identical
molecules of DNA are
produced.
                              Replication
• Each newly made
molecule of DNA has a
strand of the original
DNA molecule and a
newly made strand.

								
To top