Nessun titolo diapositiva by 4fItVny5

VIEWS: 33 PAGES: 37

									SEQUENZIAMENTO DEL DNA
APPLICAZIONI DELL’ANALISI DI SEQUENZA
               DEL DNA


  -Identificazione di particolari sequenze:

  - geni, regioni regolatorie della replicazione, trascrizione, traduzione.
  - Attribuzione di prodotti proteici a sequenze geniche (progetto genoma).

  - Analisi della struttura secondaria e terziaria di acidi nucleici (tRNA).

  - Studio di mutazioni genetiche ( Patologie).

  - Studi evolutivi (più accurati di quelli con dati paleontologici).
UNA COPPIA DI BASI PESA 660 DALTONS !
1- Metodo di analisi di sequenza del DNA per idrolisi chimica
secondo:
             MAXAM E GILBERT


2- Metodo di analisi di sequenza del DNA per replicazione
enzimatica secondo:

                    SANGER



      PREMI NOBEL PER LA CHIMICA 1977
                           MAXAM E GILBERT
      5’                                                3’
      3’                                                5’
                             Marcatura Terminale
       5’ *                                             3’
       3’                                               5’
                                                    *
Occorre avere la marcatura ad una sola delle due estremità !!!

           Taglio con ER                           Sep strands
  *                                     *
                                   *

                                                                 *

                           Reazioni di Sequenza
          MARCATURA IN 3’
5’                                      3’
3’                                      5’
          + Enzima di Restrizione
     5’      T             CTTAA       3’
     3’      AATTC                 T   5’
                   + DNA Polimerasi
                   + dNTP
                   + dATP a 32P

     5’     TT**          CTTAA        3’
           AATTC            **TT
     3’                                5’


          Reazioni di Sequenza
                     MARCATURA IN 5’
    5’ p                                                        3’
                                                            p
    3’                                                          5’
                           +Fosfatasi alcalina
     5’                                                         3’
     3’                                                         5’
                           + Polinucleotide chinasi
                           + ATP g 32P
    5’ *                                                        3’
                                                                5’
    3’                                                  *
           Taglio con ER                              Sep strands

*                                         *
                                 *
                                                                     *
                       Reazioni di Sequenza
1- Metodo di analisi di sequenza del DNA per idrolisi chimica
secondo:
               MAXAM E GILBERT



  - Modificazione delle basi (metilazione ecc)

  - Rilascio della base e alterazione sterica

  - Rottura a livello della base e scissione della strand (Piperidina)
REAZIONI A LIVELLO DELLE G
                            REAZIONE SULLE G

*GAATCGTAGCACATTGATCATTTGACAAATTGGCATACATGACTCTCGAA

  G        G      G            G              G                GG               G             G

*G + -----------------------------------------------------------------------------------------------
*GAATCG + -------------------------------------------------------------------------------------
*GAATCGTAG + -------------------------------------------------------------------------------
*GAATCGTAGCACATTG + -----------------------------------------------------------------
*GAATCGTAGCACATTGATCATTTG + -------------------------------------------------
*GAATCGTAGCACATTGATCATTTGACAAATTG + --------------------------------
*GAATCGTAGCACATTGATCATTTGACAAATTGG + ------------------------------
*GAATCGTAGCACATTGATCATTTGACAAATTGGCATACATG + -------------
*GAATCGTAGCACATTGATCATTTGACAAATTGGCATACATGACTCTCG + -

Regolando opportunamente la reazione si ottiene una popolazione eterogenea di molecole
che iniziano tutte con la stessa estremità marcata e finiscono a livello della G.
PRINCIPI DELLA METODICA DI MAXAM E GILBERT

                      PURINE (A e G)
       DMS                                ACIDO FORMICO


    PIPERIDINA                               PIPERIDINA

    Taglio di G                             Taglio di G +A
                     PIRIMIDINE (C e T)

      IDRAZINA                            IDRAZINA + NaCl


     PIPERIDINA                              PIPERIDINA


   Taglio di C e T                           Taglio di C
*GTTACGTAACTGATCAGTAACCTGATCAGTACATGACATGCTAGCATATCTGATGA
                                    DIVIDERE IN 4 ALIQUOTE




          G                    G+A                  C+T                     C

    DMS                ACIDO FORMICO       IDRAZINA                 IDRAZINA +NaCl
    + PIPERIDINA       + PIPERIDINA        + PIPERIDINA             + PIPERIDINA



-                         GEL ELETTROFORESI

                                                              11
                                                                             10
                                9

                                8
                                                          7
                   6
                                                                              5

                                4
                                                               3
                                                              2

                   1
+
                                                                   MAXAM E GILBERT
MAXAM E GILBERT
                         SANGER
3’ GTTACGTAACTGATCAGTAACCTGATCAGTACATGACATGCTAGCATATCTGATGA                   5’
5’ CAATGCATTGACTAGTCATTGGACTAGTCATGTACTGTACGATCGTATAGACTACT                   3’

                                  Denaturazione
3’ GTTACGTAACTGATCAGTAACCTGATCAGTACATGACATGCTAGCATATCTGATGA                    5’


5’ CAATGCATTGACTAGTCATTGGACTAGTCATGTACTGTACGATCGTATAGACTACT                    3’
                                  Annealing primer

3’ GTTACGTAACTGATCAGTAACCTGATCAGTACATGACATGCTAGCATATCTGATGA                    5’
5’ CAATGCATTGACTAGTCA
                                  Allungamento primer
                                  (DNA pol + dNTP + dATP a 32P +ddNTP specifico)

3’ GTTACGTAACTGATCAGTAACCTGATCAGTACATGACATGCTAGCATATCTGATGA                        3’
5’ CAATGCATTGACTAGTCATTGGA*C
                          ddT     Interruzione crescita catena
STRUTTURA CHIMICA DEL DNA E RNA
      (La polarità della catena)




  9              CATENA
                  POLI
              NUCLEOTIDICA
                 DI DNA
             INTERRUZIONE CATENA A LIVELLO DELLE G

*TAATCGTAGCACATTGATCATTTGACAAATTGGCATACATGACTTGAA

          ddG ddG ddG               ddG         ddG             ddG      ddG     ddG


* ATTAGddG-------------------------------------------------------------------------------------
* ATTAGCATddG-------------------------------------------------------------------------------
* ATTAGCATCGTddG-------------------------------------------------------------------------
* ATTAGCATCGTGTAACTAddG-----------------------------------------------------------
* ATTAGCATCGTGTAACTAGTAAACTddG--------------------------------------------
* ATTAGCATCGTGTAACTAGTAAACTGTTTAACCddG----------------------------
* ATTAGCATCGTGTAACTAGTAAACTGTTTAACCGTATddG--------------------
* ATTAGCATCGTGTAACTAGTAAACTGTTTAACCGTATGTACTddG----------

Si ha la crescita della catena del DNA sino a quando non viene incorporato un ddNTP.
     GTTACGTAACTGATCAGTAACCTGATCAGTACATGACATGCTAGCATATCTGATGA
    *CAATGCATTGACTAGTCA
    1                               18             DIVIDERE IN 4 ALIQUOTE




DNA pol + dNTP + dATP a 32P   DNA pol + dNTP + dATP a 32P   DNA pol + dNTP + dATP a 32P   DNA pol + dNTP + dATP a 32P
        +ddATP                      +ddGTP                      +ddTTP                          +ddCTP




-                                    GEL ELETTROFORESI

                                                                                31
                     30
                                                                                                            29
                                                                               28
                                                 27
                     26
                                                                               25

                                                                                                              24
                     23
                                                    22
                                                    21
                                                                                20
+                                                                               19
                                                                                                           SANGER
SANGER
GEL DI SEQUENZA
GEL MAXAM E GILBERT
             GAT G   GAT G   GAT G   GAT G   GAT G




GEL SANGER
                  SEQUENZIAMENTO DI UN FRAMMENTO CLONATO




Si utilizzano primers che si annilano sul plasmide di cui si conosce la sequenza e si cammina nel polilinker
sequenziando il frammento clonato
Varie strategie di sequenza (SANGER)




                                       (Walking on chromosome)
SEQUENZIATORE AUTOMATICO
                    SEQUENZIAMENTO AUTOMATIZZATO
Si utilizza una variante del metodo di Sanger, che prevede l’utilizzo di marcatori
fluorescenti.
Il marcatore fluorescente viene attaccato ai ddNTP(o dei primers) , utilizzando un
fluoroforo differente per ciascun ddNTP.




 Le catene che terminano con A sono quindi marcate con un fluoroforo, quelle che
 terminano con C con un secondo fluoroforo, etc etc, pertanto le quattro famiglie di
 catene terminate presenteranno 4 colori diversi.
 Non c’è bisogno di allestire 4 provette, ognuna per ogni dideossi.
 Tutti e 4 i dideossi marcati col fluoroforo sono aggiunti nella stessa provetta, e i
 frammenti di DNA colorati vengono separati in una singola corsa elettroforetica
 mediante un gel contenuto in un tubo capillare (elettroforesi capillare: un metodo che
 consente separazioni ottimali e molto rapide.)
 I frammenti migrano attraverso il gel, che è collegato ad un sistema laser per la
 rivelazione delle fluorescenza.
 In tempo reale (non appena la bande passano davanti al rivelatore) viene identificato
 il ddNTP presente in ciascuna banda.
SEQUENZA AUTOMATIZZATA
   COLORAZIONE DEI PRIMERS
SEQUENZA AUTOMATIZZATA
   COLORAZIONE DEI ddNTP
                                             3100


                                                    3700




          Throughput in 24 hours
                  3100            3700
Sequencing
Std run         176 samples   768 samples
                (800bp)       (1000bp)
Rapid run       368 samples   1152 samples
                (550bp)       (700bp)


GenScan         736 samples   3456 samples
                   Model 3700                      3100data.ab1.ab1                                   Signal G:3083 A:2887 T:2508 C:1336                                                                  Page 1 of 2
                   BC 1.1.0.0
                                                   bdt
                                                        Standard Sequencing on the 3100               DT3700POP6{BD}v0_3.mob                                                                Wed, Jan 19, 2000 5:10 PM
                                                                                                                                                                                            Tue, Aug 17, 1999 9:47 PM
                                                   Lane 13                                            Points 3292 to 17806 Base 1: 3292                                                               Spacing: 14.21
   A
  G AT T CCCCT GCAGGC GT GGC T GCAGC CT GGT TAT G TT AC TGT T A T GT T GC TAC T AC T GC T G
                                                 A                                                      C        C                                                     C
                                                                                           ACAA T GC T G T GC T G T TC TC CT CAC T GT C TCCAC T T C CT T GAACA A T GC G C GT CA TGC T T C T T T T GC C T C C
              10                20            30              40           50             60               70                  80                90           100              110                 120             130




         C                          C                                                                                                                                         A
 CCGC T G T C CA GA AA GC TA GGC C G A GAT CA GA AC CA C C AC A GT CA A T A T CA C CA C C T T C C T C T T A T A GA T T C GG A A T C T CA T GA TA GGG GC TCA GC C T C T GT GC G G T GGA GA G AA GT T T
        140              150           160              170             180              190                200                     210               220                230                 240                 250




T GC A G GC GA G C T GA G GA GCA A T T GC A GG T GA T A T G A T GT GC T C GG C T CA A GA A GC GGGC C C GG AG A G GA A GA A GT C GT GC C GGG G C TA A T T A T T G GCA A A A C GA G C T C T T GT T G
       260                270               280                290              300                  310                 320                    330                340                350                  360




 GT A A A CA T T GA T C CA A C T GG A A T GT CA C T A A T G G C GA A T CA A T A T T C CA T A A G G CA T GA T G G T T GC T CA G A G G CA G G A G A A G A G CA A C GA A T A C GA T C C T A T AA A A G A T AA A
 370                380               390                 400              410                  420                     430                 440                   450                460                   470                 480




 A A CA T A A A T A A A C A GT C T T GA T T A T A T T C T G G GT A T T A A A G C CA CA A T CA G A A CAA A TA T A T GC T T T GT A T C T T T T C T T GC C T T C T T CA T T A C C AA C T G C T T C C GC GGC CA C A T
480                490               500                 510              520                  530                540                     550               560                570                   580                 590




                   Model 3700                      3100data.ab1.ab1                                   Signal G:3083 A:2887 T:2508 C:1336                                                                  Page 2 of 2
                   BC 1.1.0.0                                                                         DT3700POP6{BD}v0_3.mob                                                                Wed, Jan 19, 2000 5:10 PM

                                                 Points 3292 to standard run, total run time 2 hours
                   3100 Sequencing Data, HSP69 standard,17806 Base 1: 3292
                             bdt
                             Lane 13
                                                                                                                                                                                            Tue, Aug 17, 1999 9:47 PM
                                                                                                                                                                                                      Spacing: 14.21
T TA A GA G A AC T T GT G GTAA G AT AA GA A GATA T T T T A T T C GT T CT GC T GA C T T GC T G           G                        A
                                                                                             GAT GT C GG AA ATA T T CT GCA T TT G T AAGAGGC GGTT AA T T GCA GATAT AAT T GGTA GT GAA AAGGGT C GT TGCT

								
To top