Section H � Cloning vectors

Document Sample
Section H � Cloning vectors Powered By Docstoc
					Section H – Cloning vectors
                   Contents
H1 Design of plasmid vectors
 Ligation products, Twin antibiotic resistance, Blue-white
 screening, Multiple cloning sites, Transcription of cloned
 inserts, Expression vectors
H2 Bacteriophage vectors
 Bacteriophage λ, λReplacement vectors, Packaging and
 infection, Formation of plaques, λLysogens, M13 phage
 vectors, Cloning in M13, Hybrid plasmid-M13 vectors
H3 Cosmids, YACs and BACs
 Cloning large DNA fragments, Cosmid vectors, YAC vectors,
 Selection in S. cerevisiae, BAC vectors
H4 Eukaryotic vectors
 Cloning in eukaryotes, Transfection of eukaryotic cells,
 Shuttle vectors, Yeast episomal plasmids, Agrobacterium
 tumefaciens TI plasmid, Baculovirus, Mammalian viral
 vectors, Direst gene transfer
H1 Design of plasmid vectors —
                         Ligation products


• The most frequent unwanted product is
  recreated vector plasmid formed by
  circularization of the linear vector
  fragment
   Minipreparations from a
number of transformed
colonies, and screening by
digestion and agarose gel
electrophoresis.
H1 Design of plasmid vectors —
                Twin antibiotic resistance


Contain two antibiotic resistance genes:
   If a target DNA fragment is ligated into the coding
  region of one of the resistance genes the gene will
  become insertionally inactivated, and can be
  determined by the antibiotic resistance exhibited by
  the transformants.
Screening by insertional inactivation of a resistance gene


  Ampr               Tcr
                      B                 B       X      B
         pBR322


         ori                            B
                   Ampr                         Ampr
                                        X                          Tcr
                            Recombinant
                                                       Religated

                                            B
                            ori                        ori
  Ampicillin resistant?           yes                      yes
  Tetracycline resistant?         No                       yes
Replica plating: transfer of the colonies from one plate
to another using absorbent pad or velvet



                      transfer of colonies




    +ampicillin                              + ampicillin
                                             + tetracycline

          These colonies have bacteria with
          recombinant plasmid
H1 Design of plasmid vectors —
                     Blue-white screening
 • A more sophisticated procedure can be
   carried out on a single transformation plate;
 • Blue white screening;
 • Involves the insertional inavtivation of the
   gene lacZ.
Screening by insertional inactivation of the lacZ gene

                       Lac promoter
                              MCS (Multiple cloning sites)
     Ampr
                pUC18          lacZ’
                (3 kb)


             ori
The insertion of a DNA fragment interrupts the ORF
of lacZ’ gene, resulting in non-functional gene product
that can not digest its substrate x-gal.
        lacZ encode enzyme b-galactosidase

lac promoter                                         (substrate of
                                               X-gal the enzyme)
                    IPTG
                                              Blue product

   RegulatoryGene
                                      Operon


               i     p   o       z             y           a            DNA


                                                                        m-RNA

                                                                        Protein

                         β -Galactosidase              Transacetylase
                                            Permease
Recreated vector: blue transformants
Recombinant plasmid: white transformants
(containing inserted DNA)

                Recreated vector (no insert)




         Recombinant plasmid (contain insert)
 lacZ’: a shortened derivative of lacZ,
encoding N-terminal a-peptide of b-
galactosidase.
 Host strain carrying a mutant gene encoding
only the C-terminal portion of b -galactosidase
which can then complement the a-peptide to
produce the active enzyme
   H1 Design of plasmid vectors —
                              Multiple cloning sites
  Multiple restriction sites enable the convenient insertion of target DNA
  into a vector
                          Lac promoter
                                MCS             Insertion of
         Ampr                                   target DNA in
                    pUC18          lacZ’        MCS
                                                inactivates the
                    (3 kb)
                                                lacZ’
                    ori
                                     SalI
                     SmaI
                          BamHI XbaI HincII PstI
                                     AccI
     EcoRI SacI KpnI XmaI                                         SphI
…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…
. Thr Asn Ser Ser Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…
                                Lac Z’
H1 Design of plasmid vectors —
         Transcription of cloned inserts


Some cloning vector :The pUC vectors have a
  promoter (lac) adjacent to the site of insertion of a
  cloned fragment, such a promoter could be used to
  transcribe the inserted DNA, either to produce an
  RNA transcript in vitro (used as a hybridization
  probe), or to express the protein product of a gene.
Special transcriptional vectors
•    The pBluescript ⅡSK has promoters from
  bacteriophages T7 and SP6 flanking an MCS.
H1 Design of plasmid vectors —
                        Expression vectors




• (1)Promoter and terminator for RNA
  transcription are required.
• (2)Intact ORF and ribosomal binding sites
  are required for translation.
                 Strong Promoters
Promoter:
1.lacUV-5: a strong mutant lac promoter
  independent of cAMP receptor protein (CRP or
  CAP) .
2.lPL promoter
3.Phage T7 promoter
           Fusion protein and fusion tag
1.Defined epitope : a small piece of peptide sequence
  containing a defined epitopeor specific binding site
2.Green fluorescent protein : fusion with GFP.
3.His-tag: usually 6 consecutive histidines, which allows
  purification of the fusion protein by binding to Ni 2+
  column. Commonly used in E. coli.
                                   Lac promoter
                                        MCS
               Ampr
                            pUC18           lacZ’
                            (3 kb)
                           ori
                                     SalI
                    SmaI
    EcoRI SacI Kpn XmaI  BamHI XbaI HincII PstI SphI
                                     AccI
…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…
               I
. T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…

                                   Lac Z’
1. The ORF of the inserted gene has to be in the same
   direction and same frame as the lacZ’
2. A fusion protein between the N-terminal sequence of
   lacZ and the inserted ORF produced
       How to make a fusion protein (in pUC18)?

                       SmaI            SalI
       EcoRI
             SacI
                  KpnI XmaI BamHI XbaI HincII
                                       AccI PstI SphI HindⅢ
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
M I T N S S S V P G D P L E S T C R H A S L
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCgatgcggagc..gtgaacggatagCTGCAG
M I T N S S S V P G D P M R S ..V N G *
      From original ORF              Inserted ORF
  Add one nucleotide (g) between BamHI site (GGATCC) and the
             first codon (ATG) to fuse the two ORFs
  BamHI: GGATCC                   PstI: CTGCAG
          CCTAGG                        GACGTC
The following fusion is wrong:
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCatgcggagc..gtgaacggatagCTGCAG
M I T N S S S V P G D P C G G .. *
H2 Bacteriophage vectors —
                         Bacteriophage λ

 1.Viruses that can
 infect bacteria.
 2.48.5 kb in length
 3.Lytic phase:
 Replicate and release
 4.Lysogenic phase :
 integrate into host
 genome
  5.The phage  cos ends
(Linear or circular genome)


           5‘-CGGGGCGGCGACCTCG-3’
           3’-GCCCCGCCGCTGGAGC-5’

                          Circular form
       Cleavage                 Ligation
    (during packaging)     (after infection)

              GGGCGGGCGACCTCG-3’
    5’-CG     +            GC-5’
    3’-GCCCCGCCGCTGGA
                          Linear form
H2 Bacteriophage vectors —
                 λReplacement vectors


• e.g. EMBL3, DASH

•     Replace the nonessential region of
    the phage genome with exogenous
    DNA (~20kb)
H2 Bacteriophage vectors —
                       Packaging and infection

• Replication of phage λin vivo produces long linear molecules
    with multiple copies of the λ genome. These concatemers are
    then cleaved at the cos sites, to yield individual λ genomes,
    which are then packaged into the phage particles.

• Ligated λ ends which do not contain an insert, or have one
    which is smaller or larger than the 20kb optimum, are too
    small or to large to be packaged, and recombinants with two
    left or right arms are likewise not viable.

•   High infection efficiency (109 recombinants/ug vector DNA,
    100-time higher than plasmid)
H2 Bacteriophage vectors —
                      Formation of plaques




1. The clear areas within the lawn where lysis and re-
   infection have prevented the cells from growing.
2. Recombinant l DNA may be purified from phage
   particles from plaques or from liquid culture.
H2 Bacteriophage vectors —   λLysogens


• Genes or foreign sequences may be
  incorporated essentially permanently into
  the genome of E. coli by integration of a 
  vector containing the sequence of interest.
    The E. coli strain
BL21(DE3) include the
gene for T7 RNA
polymerase under
control of the lac
promoter as a 
lysogen. The gene can
be induced by IPTG,
and the polymerase
will then transcribe
the gene in the
expression vector.
H2 Bacteriophage vectors —
                       M13 phage vectors
• E. coli vector;
• 6.7 kb circular single strand of DNA;
• Contrasting to phage ,the cell are not
  lysed by M13, but continue to grow
  slowly,and single-stranded forms are
  continuously packaged and released
  from the cells as new phage particles.
H2 Bacteriophage vectors —          Cloning in M13

• When the single-stranded form of a
  fragment is required fragments are
  subcloned into M13 RF using standard
  plasmid methods.


   Cloning      Transfection       Growth      Plaques formation
     RF           recombinant        plating on          slow
like plasmid         DNA            a cell lawn         growth
H2 Bacteriophage vectors —
           Hybrid plasmid-M13 vectors

• Small plasmid vectors being developed to
  incorporate M13 functionality.
• Contain both the plasmid and M13 origins of
  replication.
• Normally propagate as true plasmids.
• Can be induced to form single-stranded
  phage particles by infection of the host cell
  with a helper phage.
H3 Cosmids, YACs and BACs —
         Cloning large DNA fragments
• Analysis of eukaryotic genes and the
  genome organization of eukaryotes
  requires vectors with a larger capacity
  for cloned DNA than plasmids or phage
  
• Human genome (3 x 109 bp): large
  genome and large gene demand
  vectors with a large size capacity.
• The limitation of conventional gel
  electrophoresis: large DNA fragments do not
  separate, but instead, comigrate, because
  nucleic acids alternate between globular and
  linear forms.
•    If the field is applied discontinuously and
  the direction is also made to vary,the DNA
  molecules reorient their long axes and takes
  longer for larger molecules.
H3 Cosmids, YACs and BACs —
                          Cosmid vectors


•   Utilizing the properties of the phage l
    cos sites in a plasmid vector.
•   The insert can be 30-45 kb
   The simplest
  cosmid vector
  A normal small
plasmid, containing a
plasmid origin of
replication, a
selectable marker, a
cos site, a suitable
restriction site for
cloning.
Cloning in a cosmid
vector C2XB
H3 Cosmids, YACs and BACs —   YAC vectors

Essential components of
  YAC vectors :
• Centromere
• Telomere
• Autonomous replicating
  sequence
• Ampr for selective
  amplification and
  markers
  YACs can accommodate genomic DNA
fragments of more than 1 Mb, and can
be used to clone the entire human
genes, but not good in mapping and
analysis.
   YACs have been invaluable in
mapping the large-scale structure of
large genomes, for example in the
Human Genome Project.
H3 Cosmids, YACs and BACs —
               Selection in S. cerevisiae




• (1)Growth of yeast on selective media lacking
  specific nutrients can serve for selection.
  Auxotrophic yeast mutants are made as host strains
  for plasmids containing the genes complementary to
  the growth defect.
• (2)Saccharomyces cerevisiae selectable markers do
  not confer resistance to toxic substances
H3 Cosmids, YACs and BACs —   BAC vectors

 BAC: Bacterial Artificial Chromosome, 300kb



        Vectors for large DNA fragments
  BAC: 300kb
  PAC: Bacteriophage P1 cloning system,100kb
  Cosmid:35-45 kb
  YAC: > 1Mb (1987)
H4 Eukaryotic vectors —
                   Cloning in eukaryotes


• Many applications of genetic engineering
  require vectors for the expression of genes
  in diverse eukaryotic species.
H4 Eukaryotic vectors —
       Transfection of eukaryotic cells
The take-up of DNA into eukaryotic cells
1. More problematic than bacterial
   transformation. The plant cell wall
   must normally be digested to yield
   fragile protoplasts, which may then
   take up DNA fairly readily.
2. Much lower efficiency
Transfection methods:

•Calcium phosphate

•Electroporation

•Gene gun

•Microinjection
H4 Eukaryotic vectors —   Shuttle vectors
• Most of the eukaryotic vectors are
  constructed as shuttle vectors .
• Vectors contain sequences required for
  replication and selection in both E. coli
  and the desired host cells, so that the
  construction and many other
  manipulation of the vectors can be
  completed in E. coli., before transfer to
  the appropriate eukaryotic cells.
A Shuttle vector
             MCS
H4 Eukaryotic vectors —
                 Yeast episomal plasmids
Vectors for the cloning and expression of
   genes in Saccharomyces cerevisiae.
1.   Based on 2 micron (2m) plasmid which is 6 kb in
     length.
•    One origin
•    Two genes involved in replication
•    A site-specific recombination protein FLP,
     homologous to  Int.

2. Normally replicate as plasmids, and may integrate
   into the yeast genome.
YEp vector
H4 Eukaryotic vectors —         Agrobacterium
                        tumefaciens Ti plasmid
 1. Place the target gene in the T-DNA region of a Ti plasmid, then
   transform the recombinant Ti plasmid. (Not good because of
   the crown gall formation)
Deletion of the genes in T-DNA that are responsible for crown gall
  formation. The deleted T-DNA is called disarmed T-DNA shuttle
  vector.

2. The T-DNA and the remainder of the Ti plasmid are on separate
   molecules within the same bacterial cell, integration will still
   take place. Plasmid with recombinant T-DNA can be
   transformed into the A. tumefaciens cell carrying a modified Ti
   plasmid without T-DNA.
Agrobacterium mediated gene transfer




     crown gall or tumor
Agrobacterium mediated gene transfer
H4 Eukaryotic vectors —   Baculovirus
1. Infects insect cells
2. The strong promoter expressing polyhedrin
   protein can be used to over-express foreign
   genes engineered. Thus, large quantities of
   proteins can be produced in infected insect
   cells.
3. Insect expression system is an important
   eukaryotic expression system.
H4 Eukaryotic vectors —
                Mammalian viral vectors
• 1. SV40
   5.2 kb, suffers from packaging constraints
  similar to phage l.
2. Retrovirus
   Single-stranded RNA genome, which copy to
  dsDNA after infection. Integrated into the
  host genome by a transposition-like
  mechanism.
   Have some strong promoters for gene
  expression. Considered as vectors for gene
  therapy
H4 Eukaryotic vectors —
                      Direct gene transfer
• Genes may be transiently or
  permanently introduced into cultured
  eukaryotic cells without the use of
  vector.
     Multiple choice questions
1. Blue-white selection is used          .
A to test for the presence of a plasmid in bacteria.
B to reveal the identity of a cloned DNA fragment.
C to express the product of a cloned gene.
D to test for the presence of a cloned insert in a plasmid.
2. A multiple cloning site        .
A contains many copies of a cloned gene.
B allows flexibility in the choice of restriction enzymes for
   cloning.
C allows flexibility in the choice of organism for cloning.
D contains many copies of the same restriction enzyme
   site.
3. Infection of E. coli by bacteriophage λis normally detected
   by     .
A resistance of the bacteria to an antibiotic.
B the growth of single bacterial colonies on an agar plate.
C the appearance of areas of lysed bacteria on an agar plate.
D restriction digest of the bacterial DNA.
4. Which vector would be most appropriate for cloning a 150 kb
   fragment of DNA?
A a plasmid.
B a λvector.
C a BAC.
D a YAC.
5. Which vector would you chose to
  express a foreign gene in a plant?
A a baculovirus vector.
B a retroviral vector.
C a Yep vector.
D a T-DNA vector.
THANK YOU !

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:119
posted:2/16/2012
language:English
pages:61