jhg201171x1 by xiagong0815

VIEWS: 0 PAGES: 10

									Y-SNP typing hierarchy

Initial typing
Y- SRY10831-1 (G-A)
Y- YAP (a/p)
Y- M213 (T-C)
Y- M168 (C-T)
Haplogroup A
Y- M51 (G-A)
Haplogroup B
Y-M112 (G-A)
Y- M150 (C-T)
Y-M129 (G-A)
Y-M169 (T-C)
Y-M211 (C-T)
Haplogroup E
Y- M2 (A-G)
Y- M191 (T-G)
Y- M75 (G-A)
Y- M35 (G-C)
Haplogroup R
Y- M9 (C-G)
Y- M207 (A-G)
Y- SRY10831-2 (A-G)
Y- M17 (a/p - G)
Other groups (J,C, H, I)
Y- p12f2 (a/p - 88bp)
Y-M172 (T-G)
Y- M130 (C-T)
Y- M52 (A-C)
Y- M170 (A-C)
Phylogeny
Primers

Y-SNP

Initial                    F PRIMER (5'-3')             R PRIMER (5'-3')
Y- SRY10831-1 (G-A)        TCCTTAGCAACCATTAATCTGG       AAATAGCAAAAAATGACACAAGGC
Y- YAP (a/p)               CAGGGGAAGATAAAGAAATA         ACTGCTAAAAGGGGATGGAT
Y- M213 (T-C)              TATAATCAAGTTACCAATTACTGGC    TTTTGTAACATTGAATGGCAAA
Y- M168 (C-T)              AGTTTGAGGTAGAATACTGTTTGCT    AATCTCATAGGTCTCTGACTGTTC
Haplogroup A
Y- M51 (G-A)               GAGCCTCTATCTCCTGAAGC         TGACTGCTCTGTTGCGACA
Haplogroup B
Y-M112 (G-A)               GAAAAGCAAAAGAGAACTGCC        TTTCTTGATGATGAGACCAATATTTC
Y- M150                    CCCACACACACAGATAGACGT        CCTACTTTCCCCCTCTTCTG
Y-M129 (G-A)               AATGGCTTACTACAAAGAACATTTC    TACACGGTCTCTACCAAAGAAGA
Y-M169 (T-C)               TTGAGGTAGAATACTGTTTGCTGG     TGACCCAGTCTCATTCAAACC
Y-M211 (C-T)               CATTTACCCACCCAATCCAC         TGTGGAGAAATTTGCTGGAA
Haplogroup E
Y- M2 / SY81 (A-G)         ATGGGAGAAGAACGGAAGGA         TGGAAAATACAGCTCCCCCT
Y- M191 (T-G)              GGAGGAGCAAGTACAGCGAG         TTTCAGCAGACATAGGTAAACAGTG
Y- M75                     CACATCAAGAAAACTTGCAAGAC      TATAAAGGTATTTCTCTGTATATACA
Y- M35                     AGGGCATGGTCCCTTTCTAT         TGGGTTCAAGTTTCCCTGTC
Haplogroup R
Y- M9 (C-G)                GCAGCATATAAAACTTTCAGG        AAAACCTAACTTTGCTCAAGC
Y- M207 (A-G)              AGGAAAAATCAGAAGTATCCCTG      CAAAATTCACCAAGAATCCTTG
Y- SRY10831-2 (A-G)        TCCTTAGCAACCATTAATCTGG       AAATAGCAAAAAATGACACAAGGC
Y- M17 (a/p - G)           GTGGTTGCTGGTTGTTACGT         AGCTGACCACAAACTGATGTAGA
Other groups (J,C, I, H)
Y- p12f2 (a/p - 88bp)      CTGACTGATCAAAATGCTTACAGATC   GGATCCCTTCCTTACACCTTATAC
Y-M172 (T-G)               ATCCCCCAAACCCATTTTGATGCAT    GGATCCATCTCCATCTTCACTCAATGTTG
Y- M130 / RPS4Y711 (C-T)   CTGTACTTACTTTTATCTCCTC       CAGCAACAGTAAGTCGAATG
Y- M52 (A-C)               GAAATGGAGTCATGAACTCCT        ATATCAAGAAACCTATCAAACATAC
Y- M170 (A-C)              AAATAATTTCACGTTTGTTCAAATAA   ACACAACCCACACTGAAAAACA
Optimised conditions

Marker                                        SRY10831                       YAP                       M213                        M168                        M51
Mutation                                 A-G; reversion G-A        absence - presence of YAP             T-C                        C-T                        G-A
Haplogroup(s) defined by                 SRY10831.1: B - R                 D and E                      F-R                         E-R                      A - M51
derived state                              SRY10831.2: R
PCR stock solutions
MgCl2 (25 mM)                                  1.5 mM                       1.5 mM                    2.5 mM                      2.5 mM                      2 mM
primer F (10 uM)                                0.4 uM                      0.4 uM                     0.4 uM                      0.4 uM                     0.4 uM
primer R (10 uM)                                0.4 uM                      0.4 uM                     0.4 uM                      0.4 uM                     0.4 uM
BSA (10 mg/ml)                                     -                        1 ug/ul                       -                           -                          -
spermidine (2.5 mM)                                -                           -                          -                           -                          -


PCR conditions
annealing temperature (ºC)                        60                          51                         56                          56                         58


Digestion
PCR product size (bp)                            167               150 (YAP-) / 450 (YAP+)               409                        473                         339
restriction enzyme                          Dra III + BSA                      -                   Nla III + BSA                    Hinf I                    Hind III
digestion conditions (ºC)                         37                           -                         37                          37                         37
gel detection                                3% agarose                   2% agarose                2% agarose                  3% agarose                 2% agarose
ancestral allele - product sizes (bp)         167 (A)                     150 (YAP-)               290 + 119 (T)          234 + 105 + 81 + 52 (C )          339 (G)
derived allele - product sizes (bp)         112 + 55 (G)                 450 (YAP+)                   409 (C )              234 + 186 + 52 (T)            307 + 32 (A)


Comments                                  reverse mut. G-A
                                               in HG R
References
Reference: polymorphism                 (Whitfield et al., 1995)        (Hammer, 1994)          (Shen et al., 2000)          (Shen et al., 2000)      (Underhill et al., 2000)
Reference: primers                      (Santos et al., 1999)       (Hammer & Horai, 1995)     (Underhill et al., 2001)    (Underhill et al., 2000)   (Underhill et al., 2000)
Reference: PCR-RFLP assay               (Santos et al., 1999)                  -                    unpublished                 unpublished                unpublished
Optimised conditions                    cont

Marker                                                     M112                          M150                       M129                     M169                  M211
Mutation                                                    G-A                            C-T                       G-A                      T-C                   C-T
Haplogroup(s) defined by                                 B - M112                       B - M150                   B - M129                B - M169              B - M211
derived state
PCR stock solutions
MgCl2 (25 mM)                                              2 mM                         1.5 mM                     1.5 mM                   1.5 mM                 2 mM
primer F (10 uM)                                          0.4 uM                         0.4 uM                     0.4 uM                   0.4 uM               0.4 uM
primer R (10 uM)                                          0.4 uM                         0.4 uM                     0.4 uM                   0.4 uM               0.4 uM
BSA (10 mg/ml)                                                -                             -                          -                        -                     -
spermidine (2.5 mM)                                           -                             -                          -                        -                     -


PCR conditions                                      PCR in 50-ul vol.
annealing temperature (ºC)                                   61                            60                         62                       58                    58


Digestion                                      in 50-ul vol.; overlay with oil
PCR product size (bp)                                       227                            167                        255                     200                   208
restriction enzyme                                    TspR I + BSA                        Aat II                     Msp I               Dra I (Roche)             Rsa I
digestion conditions (ºC)                                    65                            37                         37                       37                    37
gel detection                                          2% agarose                    3% agarose                  2% agarose              2% agarose             2% agarose
ancestral allele - product sizes (bp)                 155 + 72 (G)                   146 + 21 (C)               219 + 36 (G)             106 + 94 (T)            208 (C)
derived allele - product sizes (bp)                      227 (A)                        167 (T)                    255 (A)                  200 (C)            137 + 71 (T)


Comments


References
Reference: polymorphism                           (Underhill et al., 2000)       (Underhill et al., 2000)   (Underhill et al., 2000)   (Shen et al., 2000)   (Shen et al., 2000)
Reference: primers                                     unpublished                    unpublished           (Underhill et al., 2000)     unpublished           unpublished
Reference: PCR-RFLP assay                              unpublished                    unpublished                unpublished             unpublished           unpublished
                                                                                   mismatch primer
Optimised conditions                    cont

Marker                                               M2 (sY81)                  M191                   M75                     M35                         M9
Mutation                                                A-G                      T-G                   G-A                     G-C                        C-G
Haplogroup(s) defined by                               E - M2                 E - M191               E - M75                 E - M35                      O-R
derived state
PCR stock solutions
MgCl2 (25 mM)                                         1.5 mM                   2.5 mM                 2 mM                    2 mM                      1.5 mM
primer F (10 uM)                                       0.2 uM                  0.3 uM                0.3 uM                   0.4 uM                     0.2 uM
primer R (10 uM)                                       0.2 uM                  0.3 uM                0.3 uM                   0.4 uM                     0.2 uM
BSA (10 mg/ml)                                            -                        -                     -                       -                          -
spermidine (2.5 mM)                                       -                        -                     -                       -                          -


PCR conditions
annealing temperature (ºC)                               58                       60                    55                      58                         54


Digestion
PCR product size (bp)                                    148                     156                   189                     186                         340
restriction enzyme                                 Nla III + BSA                Mbo I             Nla III + BSA                Bsr I                      Hinf I
digestion conditions (ºC)                                37                       37                    37                      65                         37
gel detection                                       3% agarose               3% agarose            3% agarose              2% agarose                3% agarose
ancestral allele - product sizes (bp)               105 + 43 (A)              156 (T)               189 (G)               122 + 64 (G)            181 + 95 + 64 (C )
derived allele - product sizes (bp)                   148 (G)               129 + 27 (G)          165 + 24 (A)               186 (C)                 245 + 95 (G)


Comments


References
Reference: polymorphism                        (Seielstad et al., 1994)   (Shen et al., 2000)   (Shen et al., 2000)   (Underhill et al., 2000)   (Underhill et al., 1997)
Reference: primers                             (Thomas et al., 1999)        unpublished           unpublished              unpublished           (Underhill et al., 1997)
Reference: PCR-RFLP assay                      (Thomas et al., 1999)        unpublished           unpublished              unpublished                unpublished
                                                                          mismatch primer       mismatch primer
Optimised conditions                    cont

Marker                                                 M207                        M17                           p12f2                     M172              M130 (RPS4Y)
Mutation                                                A-G                     WT-del G                      no del - del                 T-G                     C-T
Haplogroup(s) defined by                              R - M207                    R-M17                    J - p12f2 (Eu 10)         J - M172 (Eu 9)            C - M130
derived state
PCR stock solutions
MgCl2 (25 mM)                                         1.5 mM                     1.5 mM                         1.5 mM                     2 mM                  1.5 mM
primer F (10 uM)                                       0.4 uM                     0.3 uM                        0.3 uM                    0.4 uM                 0.4 uM
primer R (10 uM)                                       0.4 uM                     0.3 uM                        0.3 uM                    0.4 uM                 0.4 uM
BSA (10 mg/ml)                                            -                          -                             -                         -                       -
spermidine (2.5 mM)                                       -                          -                             -                         -                       -
                                                                                                     M2-F and M2-R (0.3 uM each)
PCR conditions
annealing temperature (ºC)                               56                         56                            58                        58                      50


Digestion
PCR product size (bp)                                    423                        124                 p12f2 = 88; M2 = 148                148                     91
restriction enzyme                                 Dra I (Roche)                   Afl III                         -                  Nla III + BSA                Bsl I
digestion conditions (ºC)                                37                         37                             -                        37                      55
gel detection                                       2% agarose                 3% agarose                    2% agarose                2% agarose              3% agarose
ancestral allele - product sizes (bp)               356 + 77 (A)                124 (+G)                  148 + 88 (no del)             148 (T)                57 + 34 (C)
derived allele - product sizes (bp)                   423 (G)                    101 (-G)                      148 (del)              122 + 26 (G)                91 (T)
                                                                                                       (co-amplification with M2)
Comments


References
Reference: polymorphism                         (Shen et al., 2000)       (Underhill et al., 1997)      (Casanova et al., 1985)     (Shen et al., 2000)    (Bergen et al., 1999)
Reference: primers                             (Underhill et al., 2001)   (Thomas et al., 1999)          (Rosser et al., 2000)      (Nebel et al., 2001)   (Kayser et al., 2000)
Reference: PCR-RFLP assay                           unpublished           (Thomas et al., 1999)                    -                (Nebel et al., 2001)   (Kayser et al., 2000)
                                                                            mismatch primer                                          mismatch primer
Optimised conditions                    cont

Marker                                                  M52                     M170
Mutation                                                A-C                      A-C
Haplogroup(s) defined by                              H - M52                  I - M170
derived state
PCR stock solutions
MgCl2 (25 mM)                                         2.5 mM                    4 mM
primer F (10 uM)                                       0.4 uM                  0.4 uM
primer R (10 uM)                                       0.4 uM                  0.4 uM
BSA (10 mg/ml)                                            -                        -
spermidine (2.5 mM)                                       -                        -


PCR conditions
annealing temperature (ºC)                               60                       59


Digestion
PCR product size (bp)                                    164                     129
restriction enzyme                                  HpyCH4 IV               Nla III + BSA
digestion conditions (ºC)                                37                       37
gel detection                                       3% agarose              3% agarose
ancestral allele - product sizes (bp)                164 (A)                109 + 20 (A)
derived allele - product sizes (bp)                138 + 26 (C)                129 (C)


Comments                                                                     incomplete
                                                                              digestion
References
Reference: polymorphism                        (Underhill et al., 2000)   (Shen et al., 2000)
Reference: primers                                  unpublished             unpublished
Reference: PCR-RFLP assay                           unpublished             unpublished
                                                 mismatch primer          mismatch primer

								
To top