Docstoc

nsmb.2129-S7

Document Sample
nsmb.2129-S7 Powered By Docstoc
					Embryo stage
        Insert
Primer Set        # Clones # align # perfect                     Number of mismatches
        size (bp) sequence          size     0-2    9-Mar 19-Oct 20-39 40-59 60-79 80-89 90-99 100+
      1       695 d      12       8        8      8
      2       462        12       7        6      3     1      2
      3       306        12       0        0
      4       420        12      10       10     10
      5       353        36      33       33     28            1             4
      6       333        12       7        7      5     1      1
      7       469        12       4        4      4
      8       525        12       3        3      3
      9       386        36      36       36     22                   3     11
     10       317        12      10       10      0     2      1      2      5


L4 stage
        Insert
Primer Set        # Clones # align # perfect                     Number of mismatches
        size (bp) sequence          size     0-2    9-Mar 19-Oct 20-39 40-59 60-79 80-89 90-99 100+
      1       695 d      12      11       10                                        1   2     4     3
      2       462        24       9        9      4                          2      3
      3       306        12       0        0
      4       420        12       9        9      9
      5       353        36      33       33     23                   2      8
      6       333        12       5        5      5
      7       469        12      12       12     10                          2
      8       525        12       0        0
      9       386        12      12       12      3                   5      4
     10       317        12      10       10                          5      5
>PRIMERSET_1_ce6_dna range=chrV:8854507-8855201 strand=+
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_ce6_dna range=chrV:8896602-8897296 strand=+
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_ce6_dna range=chrV:8890687-8891381 strand=-
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_ce6_dna range=chrV:8848592-8849286 strand=-
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG

>PRIMERSET_1_Embryo_cDNA_clone1
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone3
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone4
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone6
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone7
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone9
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone10
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_Embryo_cDNA_clone12
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG

>PRIMERSET_1_L4_cDNA_clone1
TCCGGCCACGGACCCGTTCCAATCGGTCATCCCAAATTGTTTCTCCCTCTCCCACCATTCAATCGTTCGTTCTACATTTTGATTTTTGTCCGCAACCGATCACCCCATT
>PRIMERSET_1_L4_cDNA_clone2
TCCGGCCACGGACTTGTTCCAATCGGTCATCCCAAATTGTTTCCCCCTCTCCCACCATTCAACCGTCCGTCCTACACTCCGACTTCCGTCTGCAATTGATTACTTCATT
>PRIMERSET_1_L4_cDNA_clone3
TCCGGCCACGGACCTGTTCCAATCGGCCATCCCAAACTGTTTCCCCCTCTCCCACTACCCAATCGTCCGTTCTATATTCCGATCCTCGTCTGCAATTGACCACTCCATT
>PRIMERSET_1_L4_cDNA_clone4
CCTGGCCACGGACCCGTTCCAACCGGTCATCCCAAACTGTTTCCCCCTCTCCCACCATTCAATCGTTTGCTTTATACTTCGATTTCCGTCTGCAATTGACCACTCCATT
>PRIMERSET_1_L4_cDNA_clone6
CCTGGCCACGGACCTGTTCCAATCGGTCATCCCAAACTGTTTCCTCCTCTCCCACTATTCAATCGTTTGTTTTATACTTTGATTTCTGTCTGCAATTGACCACTCCATTC
>PRIMERSET_1_L4_cDNA_clone7
CCCGGCCACGGACNTGCTCCAATCGGTCATCCCAAACTGTTTCCCCCTCTCCCACCATTCAATCGTTCGTTTTATATTTTGATTCCCGTCTGCAATTGACCACTCCATT
>PRIMERSET_1_L4_cDNA_clone8
CCCGGCCACGGACCCGTTCCAATCGGCCATCCCAAACCGTTTCCCCCTCTCCCACTACTCAACCGTTCGTTTTATATTTCGATCCCCGTCTGCAACCGACCACTTCAT
>PRIMERSET_1_L4_cDNA_clone9
CCCGGCCACGGACCTGTTCCAATCGGTCACCCCAAACTGTTTCCTCCTCTCCCACTACTCAATCGTCCGTTTTATACCCCGATTCCCGTCCGCAACTGATTACTTCATT
>PRIMERSET_1_L4_cDNA_clone10
CCCGGCCACGGACCCGTTCCAATCGGCCATCCCAAACTGTTTCCTCCTCTCCCACCATTCAATCGTTCGTCCTATATTTTGACCTTCGTCTGCAATTGACCACTTTATT
>PRIMERSET_1_L4_cDNA_clone11
CCCGGCCACGGACCTGTTCCAATCGGTCATCCCAAATTGTTTCCCCCTCTCCCACCACCCAATCGCCTGCCCTATACTCTGATCTTTGTCTGCAATTGACCACTCTACT
>PRIMERSET_1_L4_cDNA_clone12
CCCGGCCACGGACCCGCTCCAATCGGCCACCCCAAATTGTTTCCTCCTCTCCCACCACTCAATCGTTCGTTCCATATTCCGATCCTCGTCTGCAATTGACCACTTCAT

>PRIMERSET_1_genomicDNA_clone1
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone2
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone3
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone4
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone5
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone6
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone7
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone8
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone9
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone10
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone11
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG
>PRIMERSET_1_genomicDNA_clone12
TTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTG


>PRIMERSET_2_ce6_dna range=chrV:8854025-8854486 strand=+
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_ce6_dna range=chrV:8896120-8896581 strand=+
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_ce6_dna range=chrV:8891402-8891863 strand=-
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_ce6_dna range=chrV:8849307-8849768 strand=-
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT

>PRIMERSET_2_Embryo_cDNA_clone2
AATGGATGCCTTCTTGGAGCATTTTGCCGAACCCGGCGGCCCTCTTTGGGGCCACAGGTGTTTCAGATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTT
>PRIMERSET_2_Embryo_cDNA_clone3
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_Embryo_cDNA_clone5
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_Embryo_cDNA_clone7
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_Embryo_cDNA_clone8
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTGGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTT
>PRIMERSET_2_Embryo_cDNA_clone9
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_Embryo_cDNA_clone10
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT


>PRIMERSET_2_L4_cDNA_clone1
AATAGATGCCTTCTCAAAACATTCCACCGAACCCAACGGCCCTCTTCAGAGCCACAAATATCCCAAATCCTCCACTGACTGAATAAATATATTATAGTATTTCAATTTT
>PRIMERSET_2_L4_cDNA_clone5
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_L4_cDNA_clone9
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_L4_cDNA_clone11
AATAGATGCCTTCTTAAAACATTTTACCGAGCCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGAATAAGTATATTGTAGTATTTCAATTTTT
>PRIMERSET_2_L4_cDNA_clone13
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGGGTAAATATATTGTGGTATTTCAATTTTT
>PRIMERSET_2_L4_cDNA_clone14
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGAATGGGTATATTGTAGTATTTCAATTTTT
>PRIMERSET_2_L4_cDNA_clone17
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTCCAGAGCCACAAATATTTCAAATCCTCCATTGACTGAATAAATATACTATAGTACTTCAATTTTT
>PRIMERSET_2_L4_cDNA_clone19
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_L4_cDNA_clone23
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT

>PRIMERSET_2_genomicDNA_clone5
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTT
>PRIMERSET_2_genomicDNA_clone6
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTT
>PRIMERSET_2_genomicDNA_clone10
AATAGATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTT


>PRIMERSET_4_ce6_dna range=chrV:8853445-8853864 strand=+
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_ce6_dna range=chrV:8895540-8895959 strand=+
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_ce6_dna range=chrV:8849929-8850348 strand=-
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_ce6_dna range=chrV:8892024-8892443 strand=-
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT

>PRIMERSET_4_Embryo_cDNA_clone1
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone3
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone4
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone5
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone6
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone7
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone8
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone10
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone11
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_Embryo_cDNA_clone12
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT

>PRIMERSET_4_L4_cDNA_clone3
CATTGACATTCTGCGGGGACACCTCTCCATGCTGTCTCCCACGCCGAATGCACAAAGTGCACAGTTTCTCCCGGCCACTCCGCCACCTCCCCCATCCGTCCCATCTC
>PRIMERSET_4_L4_cDNA_clone4
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_L4_cDNA_clone5
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_L4_cDNA_clone6
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCCTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTA
>PRIMERSET_4_L4_cDNA_clone8
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_L4_cDNA_clone9
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_L4_cDNA_clone10
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_L4_cDNA_clone11
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_4_L4_cDNA_clone12
TATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTAT
>PRIMERSET_5_ce6_dna range=chrV:8853074-8853426 strand=+
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_ce6_dna range=chrV:8895169-8895521 strand=+
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_ce6_dna range=chrV:8850367-8850719 strand=-
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_ce6_dna range=chrV:8892462-8892814 strand=-
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG

>PRIMERSET_5_Embryo_cDNA_clone1
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone2
CCTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGACACGCCCGAAGACGTCGTTGACGAAAGAGTTCATGAT
>PRIMERSET_5_Embryo_cDNA_clone3
TCCGAATCTCGCGAGAAGAGATGGTGGACCCCCCGTCGTAGTGAGCAAGACGAGACGCCTCAGCAGCGACACGCTCGAAGACGCCGTTGACGAAAGAGTTCACGA
>PRIMERSET_5_Embryo_cDNA_clone4
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone5
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone6
TCCGAATCTCGCGAGAAGAGATGGTGGATCCCCCGCTGTAGTGAGCAAGACGAGACGCCCCAGCAGCGACACGCTCGAAGACGCCGTTGACGAAAGAGTTCATGA
>PRIMERSET_5_Embryo_cDNA_clone7
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCTTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone8
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone9
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone11
TCCGAATCTCGCGAGAAGAGATGGTGGATCCCCCGCTGCAGTGAGCAAGACGAGATGCCCCAGCAGCGATACGCCCGAAGACGTCGTCGACGAAAGAGTTCATGA
>PRIMERSET_5_Embryo_cDNA_clone12
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone13
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCTTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone15
TCCGAATCTCGCGAGAAGAGATGGTGGATCCCCCGTCGCAGTGAGCAAGACGAGACGCCCCAGCAGCGACACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGA
>PRIMERSET_5_Embryo_cDNA_clone16
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone17
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone18
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone19
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone20
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone21
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone22
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone23
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone24
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone25
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone26
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone27
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCTTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone28
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone29
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone31
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone32
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone33
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone34
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone35
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_Embryo_cDNA_clone36
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG

>PRIMERSET_5_L4_cDNA_clone1
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone2
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone3
TTCGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone4
TCCGAATTTCGCGAGAAGAGATGGTGGACCTCCCGCTGTAGTGAGCAAGACGAGACGCCCCAGCAGCGACACGCTCGAAGACGCCGCCGACGAAAGAGTTCACGA
>PRIMERSET_5_L4_cDNA_clone5
TCCGAACCTCGCGAGAAGAGATGGTGGATCTCCCGTTGTAGTGAGCAAGACGAGACGCCCCAGCAGCGACACGCCCGAAGACGTCGCTGACGAAAGAGTCCACGA
>PRIMERSET_5_L4_cDNA_clone6
TCCGAATTTCGCGAGAAGAGACGGTGGACCTCCCGTTGTAGTGAGCAAGACGAGACGCCCCAGCAGCGACACGCTCGAAGACGTCGCCGACGAAAGAGTTCATGA
>PRIMERSET_5_L4_cDNA_clone7
TTTGAATTTCGCGAGAGGAGATGGTGGATCTCTTGTTGTGGTGAGCGGGACGGGATGCCTCGGCGGCGGTACGCTCGGGGACGTCGTTGACGGGGGAGTTCATGG
>PRIMERSET_5_L4_cDNA_clone8
TCCGAATCTCGCGAGAAGAGACGGTGGATCTCCCGTTGCAGTGAGCAAGACGAGACGCCCCAGCAGCGACACGCTCGAAGACGCCGTCGACGAAAGAGTCCACGA
>PRIMERSET_5_L4_cDNA_clone10
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone11
TCCGAATTTCGCGAGAAGAGATGGTGGACCTCCCGTCGTAGTGAGCAAGACGAGATGCCCCAGCAGCGACACGCCCGAAGACGTCGTCGACGAAAGAGTTCACGA
>PRIMERSET_5_L4_cDNA_clone12
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone13
TTTGGGTTTCGCGAGAGGGGATGGTGGATCTCTTGTTGTGGTGAGCGGGACGGGATGCCTCGGCGGCGATGCGCTCGAGGACGTCGTTGACGAGGGGGTTCATGG
>PRIMERSET_5_L4_cDNA_clone14
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone15
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone16
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone17
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone18
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone19
TCCGAATTTCGCGAGAAGAGACGGTGGATCTCCCGTTGCAGTGAGCAAGACGAGACGCCTCAGCAGCGATACGCTCGAAGACGCCGCCGACGAAAGAGTTCACGA
>PRIMERSET_5_L4_cDNA_clone20
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone21
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone22
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone23
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone25
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone26
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone27
TCCGAATCTCGCGAGAAGAGACGGTGGATCTCCCGTTGCAGTGAGCAAGACGAGATGCCCCAGCAGCGACACGCTCGAAGACGCCGTCGACGAAAGAGTTCATGA
>PRIMERSET_5_L4_cDNA_clone28
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone29
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone30
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone31
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone32
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone33
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone34
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_L4_cDNA_clone35
TCCGAATCTCGCGAGAAGAGATGGTGGATCTCCCGCTGTAGTGAGCAAGACGAGATGCCCCAGCAGCGACACGCTCGAAGACGTCGCTGACGAAAGAGTTCACGA
>PRIMERSET_5_L4_cDNA_clone36
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone1
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCTTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone2
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone3
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone4
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone5
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone6
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATA
>PRIMERSET_5_genomicDNA_clone7
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone8
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATA
>PRIMERSET_5_genomicDNA_clone9
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone10
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG
>PRIMERSET_5_genomicDNA_clone11
TTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAGAGTTCATGATG

>PRIMERSET_6_ce6_dna range=chrV:8852969-8853301 strand=+
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_ce6_dna range=chrV:8895064-8895396 strand=+
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_ce6_dna range=chrV:8850492-8850824 strand=-
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_ce6_dna range=chrV:8892587-8892919 strand=-
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT

>PRIMERSET_6_Embryo_cDNA_clone4
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_Embryo_cDNA_clone5
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_Embryo_cDNA_clone7
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGCAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_Embryo_cDNA_clone9
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_Embryo_cDNA_clone10
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_Embryo_cDNA_clone11
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_Embryo_cDNA_clone12
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT

>PRIMERSET_6_L4_cDNA_clone4
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGCAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_L4_cDNA_clone5
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_L4_cDNA_clone10
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_L4_cDNA_clone11
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT
>PRIMERSET_6_L4_cDNA_clone12
AGCAATTGAATGCTTACTTGCTAGAGGTGTACTTGGTGACAGCCTTGGTTCCCTCAGAGACGGCGTGCTTGGCAAGCTCTCCTGGAAGAATCAAACGGACGGCAGTT


>PRIMERSET_7_ce6_dna range=chrV:8853327-8853795 strand=+
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_ce6_dna range=chrV:8895422-8895890 strand=+
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_ce6_dna range=chrV:8849998-8850466 strand=-
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_ce6_dna range=chrV:8892093-8892561 strand=-
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG

>PRIMERSET_7_Embryo_cDNA_clone3
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_Embryo_cDNA_clone5
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_Embryo_cDNA_clone7
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_Embryo_cDNA_clone10
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG

>PRIMERSET_7_L4_cDNA_clone1
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone2
TTTGGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAGGTGTGGGGAGTGGGTTGTTGGCCATTACCTTTATGACAGTTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone3
TTTGGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAGGTGTGGGGAGTGGGTTGTTGGCCATTACCTTTATGACAGTTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone4
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone5
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone6
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone7
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone8
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone9
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone10
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone11
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG
>PRIMERSET_7_L4_cDNA_clone12
TTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTTCGGTGGG


>PRIMERSET_8_ce6_dna range=chrV:8853852-8854376 strand=+
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC
>PRIMERSET_8_ce6_dna range=chrV:8895947-8896471 strand=+
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC
>PRIMERSET_8_ce6_dna range=chrV:8849417-8849941 strand=-
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC
>PRIMERSET_8_ce6_dna range=chrV:8891512-8892036 strand=-
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC

>PRIMERSET_8_Embryo_cDNA_clone4
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC
>PRIMERSET_8_Embryo_cDNA_clone5
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC
>PRIMERSET_8_Embryo_cDNA_clone11
AAACGCTGCCCGTGACAACAAGAAGACCAGAATTGCCCCAAGACATCTCCAACTTGCCGTCCGTAACGACGAGGAGTTGAACAAACTGTTGGCTGGAGTGACCATC


>PRIMERSET_9_ce6_dna range=chrV:8854397-8854782 strand=+
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_ce6_dna range=chrV:8896492-8896877 strand=+
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_ce6_dna range=chrV:8849011-8849396 strand=-
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_ce6_dna range=chrV:8891106-8891491 strand=-
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC

>PRIMERSET_9_Embryo_cDNA_clone1
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone2
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone3
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone4
AGAAGTATACTTATGGTGACGTCGCAACACGTACAGTTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGGATCTCACGGCCGCCCCCACCCA
>PRIMERSET_9_Embryo_cDNA_clone5
AGAAGTATACTTGTAGTGGCGTCACAACGCATACAATTGATATGGTGTGTTGTTTGTCCCACTTTGCCTGTGGATCTCATCGGTGAGTCTCACGGCCACCCCCACCCA
>PRIMERSET_9_Embryo_cDNA_clone6
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone7
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone8
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone9
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone10
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone11
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone12
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone13
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTGTCCCACTTTACCTATGAATCTCATCGGTGAATCTCACGGCCGCCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone14
AGAAGTATACTTGTGGTGGCGTCGCAACACATACAATTGATATGGTGTGTTGTTTGTCCCACTTTACCTATGGGTCTCATCGGTGAATCTCACGGCCGCCCCCACCCA
>PRIMERSET_9_Embryo_cDNA_clone15
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone16
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone17
AGAGGTATACTTGTAGTGGCGTCACAACACATACAATTGATGTAGTGTGTTGTTTGTCCCACTTTGCCTGTGGATCTCATCGGTGAATCTCACGACCACCCCCGCCCA
>PRIMERSET_9_Embryo_cDNA_clone18
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone19
AGAAGTATACTTGTAGTGGCGTCGCAACACGTACAATTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGAATCTCATCGGTGAATCTCACGGCCACCCCCACCCA
>PRIMERSET_9_Embryo_cDNA_clone20
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone21
AGAAGTATACTTGTAGTGGCGTCACGACGCATGCAGTTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCGTCGGTGAATCTCACGGCCACCCCCACCC
>PRIMERSET_9_Embryo_cDNA_clone22
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone23
GGAAGTATGCTTATGGTGGCGTCACGACACGTACAATTGATGTAGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGAGTCTCACGGCCACCCCCACCC
>PRIMERSET_9_Embryo_cDNA_clone24
AGAAGTATGCTTGTGGTGGCGTCACAACGCATACAATTGATGTAATGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGAATCTCACGGCCACCCCCGCCCA
>PRIMERSET_9_Embryo_cDNA_clone25
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone26
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone27
AGAAGTATACTTGTGGTGACGTCACAACACATGCAATTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGGGTCTCATCGATGAGTCTCACGGCCACCCCCACCCA
>PRIMERSET_9_Embryo_cDNA_clone28
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone29
AGAAGTATGCTTGTGGTGGCGTCACAACGCGTACGGTTGATGTAATGTGTTGTTTGTCCCACTTTACCTGTGGGTCTCATCGGTGAATCTCACGGCCGCCCCCACCC
>PRIMERSET_9_Embryo_cDNA_clone30
AGGGGTATACTTGTAGTGGCGTCACAACGCATACAATTGATATAGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGGGTCTCACGGCCACCCCCACCCA
>PRIMERSET_9_Embryo_cDNA_clone31
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone32
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone33
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone34
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTGTGGATCTCATCGGTGAATCTCACGGCCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone35
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_Embryo_cDNA_clone36
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC

>PRIMERSET_9_L4_cDNA_clone1
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_L4_cDNA_clone2
AGAAGTATACTTGTAGTGGCGTCGCAACGCATACAATTGGTATGGTGTGTTGTTTGTCCCACTTTACCTATGAATCTCATCGGTGAATCTCACGACCACCCCCGCCCA
>PRIMERSET_9_L4_cDNA_clone3
AGAGGTATACTTGTAGTGACGTCACAACACATACGGTTGATGTAATGTGTTGTTTGTCCCACTTTACCTGTGGGTCTCATCGATGAGTCTCACGGCCACCCCCACCCA
>PRIMERSET_9_L4_cDNA_clone4
GGAAGTGTACTTGTAGTGGCGTCACAACACATACGGTTGATATGATGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGAATCTCACGACCACCCCCGCCCA
>PRIMERSET_9_L4_cDNA_clone5
AGAAGTATACTTGTAGTGACGTCACAACGCATACGGTTGGTATAGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGAGTCTCACGGCCGCCCCCACCCA
>PRIMERSET_9_L4_cDNA_clone6
AGAAGTATACTTGTAGTGACGTCACGACACATGCAGTTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGAATCTCGTCGGTGGATCTCACGGCCACCCCCACCCA
>PRIMERSET_9_L4_cDNA_clone7
GGAAGTGTACTTGTGGTGACGTCACAGCACATACAATTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGGATCTCACGGCCACCCCCACCCA
>PRIMERSET_9_L4_cDNA_clone8
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_L4_cDNA_clone9
AGAAGTATACTTATGGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTGTCCCACTTTGCCTATGAATCTCATCGGTGAATCTCACGGCCACCCCCACCCAC
>PRIMERSET_9_L4_cDNA_clone10
AGAAGTATACTTGTAGTGACGTCGCAACGCATACAATTGATGTAGTGTGTTGTTTGTCCCACTTTACCTGTGGATCTCATCGGTGAATCTCACGGCCACCCCCACCCA
>PRIMERSET_9_L4_cDNA_clone11
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_L4_cDNA_clone12
AGAAGTATACTTGTGGTGACGTCACAACACATACGGTTGATGTGGTGTGTTGTTTGTCCCACTTTACCTATGGATCTCATCGGTGAATCTCACGGCCGCCCCCACCCA

>PRIMERSET_9_genomicDNA_clone1
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone2
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone3
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone4
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone5
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone6
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone7
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone8
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone9
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone11
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_9_genomicDNA_clone12
AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCTCACAACCACCCCCACCCAC
>PRIMERSET_10_ce6_dna range=hrV:8854730-8855046 strand=+
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTT
>PRIMERSET_10_ce6_dna range=chrV:8848747-8849063 strand=-
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTT
>PRIMERSET_10_ce6_dna range=chrV:8890842-8891158 strand=-
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTT
>PRIMERSET_10_ce6_dna range=chrV:8896825-8897141 strand=+
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTT


>PRIMERSET_10_Embryo_cDNA_clone1
ACCGCACTCTTTAGGGGCAAACATGCGTCCAAATGCATACTTTCTGAATAAAATGCATTCCCTCTCCCTCTCACGAGACCATATCAATGAGAAGCCCACCAATCATTT
>PRIMERSET_10_Embryo_cDNA_clone2
GCTGCACTCTTTGGGGGCGGATGTGCGTTCGGGTGTGTACTTTCTGAATGGAATGCGTTTTCTTTCTTTCTCATGGGATCGTGTCGGTGAGAGGCCCATTAGTCGTT
>PRIMERSET_10_Embryo_cDNA_clone4
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATCCTCCCTCTTCCCCATGAGATCATATCAATGAGAAGCCCACCAATCATTTT
>PRIMERSET_10_Embryo_cDNA_clone6
GCTGCACTCTTTGGGGGCAAATGTGCGTTCAAATGTATACTTTCTGGGTGGAATGCATTTTCTTTCTTTCTCGTGGGATCGTATCGATGAGAAGCCCATTAATCATTTT
>PRIMERSET_10_Embryo_cDNA_clone7
ACTGCACTCCTCAGGGGCAAATATGCGTTCAAATGCATACTTTCTGAACAAAATGCATCCTCCTTCTTTCTCATGAGATCATATCAATGAGAAGCCCACCAATCACTTT
>PRIMERSET_10_Embryo_cDNA_clone8
GCTGCACTCTTTGGGGGCAGGTGTGCGTTCAGATGTGTACTTTCTGAATAGAATGCATTTTCTTTCTTTCTCATGGGATCATGTCGATGAGAGGCCCATTAATCATTTT
>PRIMERSET_10_Embryo_cDNA_clone9
ACTGCACTCTTTGGGGGCGGGTGTGCGTTCAGATGTGTACTTTCTGGGTGGAATGCATTTTCTTTCTTTCTCATGGGATCGTGTCGATGAGGGGCCCATTGGTCATTT
>PRIMERSET_10_Embryo_cDNA_clone10
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTT
>PRIMERSET_10_Embryo_cDNA_clone11
ACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTT
>PRIMERSET_10_Embryo_cDNA_clone12
GCTGCACTCTTTGGGGGCGGATGTGCGTTCAGGTGTATACTTTCTGAGTAGAATGCATTTTCTTTCTTTCTCATGGGATCATGTCGGTGGGGGGCCCATTGGTCATTT

>PRIMERSET_10_L4_cDNA_clone1
GCTGCACTCTTTGGGGGCAGATGTGCGTTCAGGTGTATACTTTCTGAATGGAATGCGTTTTCTTTCTTTCTCATGGGATCATATCGGTGAGAAGCCCATTGGTCATTT
>PRIMERSET_10_L4_cDNA_clone2
ACTGCACTCTTCAGGGGCAAATATGCGTTCAAATGCATACTTTCTGAATAAAATGCATCTTCCCCCTTTCTCATGAGATCATATCAATGAGAAGCCCACCAATCACTTT
>PRIMERSET_10_L4_cDNA_clone4
GCTGCACTCTTTGGGGGCAGGTATGCGTTCAGGTGTGTACTTTCTGGATAAAATGCGTTTTCTTTCTTTCTCATGGGATCATGTCGATGAGGGGCCCATTAATCATTT
>PRIMERSET_10_L4_cDNA_clone5
ACTGCACTCCTCAGGGGCAAATATGCGCCCAAACGTATACTTTCTGAACAAAATGCACCTTCTCCCTTCCCCATGAGACCATATCAACGAGAAGCCCACCAATCATTT
>PRIMERSET_10_L4_cDNA_clone6
ACTGCACTCTTCAGGGGCAAATATGCGCTCAAATGTACACTTTCCGAACAAAATGCATCCCCCCTCTTTCCCATGAGATCACATCAATGAGAAGCCCACCAATCACCT
>PRIMERSET_10_L4_cDNA_clone7
GCTGCACTCTTTGGGGGCAGGTATGCGTTCAGGTGTATACTTTCTGGATGGAATGCATTTTCTTTCTTTCTCATGAGATCATATCGATGAGAGGCCCATTGATCATTTT
>PRIMERSET_10_L4_cDNA_clone8
ACTGCACTCTTCAGGGGCAAATATGCGTTCAAATGCATACTTTCTGAACAAAATGCATCCTCTTTCTCTCCCATGAGATCACATCAATGAGAAGCCCACCAATCATTTT
>PRIMERSET_10_L4_cDNA_clone9
ACTGCACTCTTTGGGGGCGGATATGCGTTCAGGTGTGTACTTTCTGGGTAGGATGCATTTTCTTTCTTTCTCATGGGATCATGTCGATGAGAGGCCCATTAATCATTT
>PRIMERSET_10_L4_cDNA_clone11
ACTGCACTCCTCAGGGGCAAATATGCGTTCAAATGCATACTTTCTGAACAAAATGCACCCTCTCTCTCCCTCATGAGATCATACCAATGAGAAGCCCACCAATCATTT
>PRIMERSET_10_L4_cDNA_clone12
ACTGCACTCTTCAGGGGCAAATATGCGCCCAAACGTATACCTTCCGAATAAAATGCATCCCCCCTCTTTCCCATGAGATCACATCAATGAGAAGCCCACCAATCACCT
TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT


TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGTGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT


TCCGCAACCGATCACCCCATTCCGAAATTCTGAATGGTTGAGAAGAAATAAACAAACAACAACTGTGGACAGACCTGGAACCCCCTAAGATAAGCGATCTGCGACGTCACCAATAA

GTCTGCAATTGATTACTTCATTCCGAAACCTTGAATGGTCGAGAAGAAATAAACAAACAACAACTGTGGACAGACCCGGAACTCCTCAAGACAAGCGATCCGCGACGTCACCAATA

GTCTGCAATTGACCACTCCATTTTGAAACTCCGAATGGTTGAGAAGAAATAAACAAACAACAATTGTGGACAGACCCGGAACCCCTTAAGATAAGCGATTCGCGACGTCACCAATAA
TCTGCAATTGACCACTCCATTCTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTCTTCAAGACAAGCGATCCGCGACGTCACCAATAA

CTGCAATTGACCACTCCATTCTGAAATCCTGAATGGTTGAGAAGAAATAAACAAATAACAACCGTGGACAGACCTGGAACTTTCCAAGATAAGCGATTTGCGACGTCACCAATAAC

TCTGCAATTGACCACTCCATTCTGAAATTTTGAATGGTCGAGAAGAAACAAACAAATAACAACTGTGGACAGACCTGGAACTTTTCAAGACAAGCGATCTGCGACGTCACCAACAA

GTCTGCAACCGACCACTTCATCCCGGAACTCTTCAAGATAAGCGATCCGCGACGTCACCAACAACATTCGTCGTCCGGTCTGCACCGCACTCTTCAGGGGCAAATATGCGTTCAAA

GTCCGCAACTGATTACTTCATTCCGAAATTTTGAATGGTCGAGAAGAAACAAACAAACAACAATTGTGGACAGACCTGGAACTCCCCAAGACAAGCGATTTGCGACGTCACCAATAA

TCTGCAATTGACCACTTTATTTTGAAATTCTGAATGGTCGAGAAGAAATAAACAAACAACAATTGTGGACAGACCCGGAACTCTCCAAGATAAGCGATCCGCGACGTCACCAACAA

GTCTGCAATTGACCACTCTACTTTGAAATTCCGAATGGTTGAGAAGAAATAAACAAACAACAACCGTGGACAGACCTGGAACTCCTCAAGATAAGCGATCCGCGACGTCACCAATAA

GTCTGCAATTGACCACTTCATTTTGAAATTTTGAATGGTTGAGAAGAAACAAACAAACAACAACTGTGGACAGACCTGGAACTCCCCAAGACAAGCGATCCGCGACGTCACCAACA


TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT
TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT

TGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATANNAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATT




ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT


TATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAAAAACTTCTTCTCAAAATTATTTGATTCACAAAAAAATTTTTAATGCTTTC

ATATTATAGTATTTCAATTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTC




TATATTATAGTATTTCAATTTTTTCCCTGCACTCCACTACCAACTGAAAACCTTCTCAACGTTTGCAATCAAGAAACTTCTTCCCGAAATCAGTCGACTCACAAAAGAACCCTCAACGC

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT
ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTGTAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGGGAATCTTTTCGGCGTTTGCGGTCGGGGGACTTCTTCTCGAAATTGGTTGATTCGCAGGAGAATTTTTGATGCT

ATATTGTGGTATTTCAATTTTTTTTTTGTACTTTGTTACTGGTTGGGAATCTTTTCGACGTTTGCAATCGGGAGGCTTCTTCTCGAAATTGGTTGATTCACAGAAGAGTTTTTGATGCT

ATATTGTAGTATTTCAATTTTTTTTTTGTACTTTGTTACTGATTGGGAATCTTTTCGGCGTTTGCAATCGGGAGGCTTCTTCTCGAGATTGGTTGATTCGCAGGAGAGTTTTTGGTGC

ATACTATAGTACTTCAATTTTTCCCTTGTACCCCATTACCAATCGAAAATCTTCTCAACGCTTGCAATCAAGAAACTTCTTCCCGAAACCAGTCGACTCACAAAAGAATTTCCAATGC

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT


ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT

ATATTATAGTATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTT




CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC


CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC
CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC


CTCCCCCATCCGTCCCATCTCCATGTGCCCGCCCAGTCACCGCAGCCGTGCCCAAAAGGGTGCTGTCCAATGGTCCTCTTCAGATCGCCTCCACATCTACCAACCAATCATCACCA

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC

CCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTC
TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC


TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GTTGACGAAAGAGTTCATGATGGACATAGCCCTGGAAGAGACTCCAGCGTCTGGATGAACCCGCTTGAGCACACGGCAGATGTACACGGAGTAGGATTCTCCACGGGCATGACGT

CGTTGACGAAAGAGTTCACGATGGACATAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCCCGAGCACACGGTAGATGCACACGGAGCAGGACTCTTCACGGGCACGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

CGTTGACGAAAGAGTTCATGATGGACACAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCCCGAGCACACGGCAGATGCACACGGAGCAGGACTCTCCACGGGCATGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GTCGACGAAAGAGTTCATGATGGACATAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCCCGAGCACACGGTAGACGTACACGGAGTAGGACTCTCCACGGGCATGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

CGTTGACGAAAGAGTTCATGATGGACACAGCCCCGGAAGAGACTCCAGTGTCCGGACGAACCCGCTTGAGCACACGGCAGACGTACACGGAGCAGGACTCTTCACGGGCATGAC
TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC
TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC


TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GCCGACGAAAGAGTTCACGATGGACACAGCCCCGGAAGAGACTCCAGTGTCCGGACGAACCTGCTCGAGCACACGGCAGATGTACACGGAGTAGGACTCCCCACGGGCATGAC

GCTGACGAAAGAGTCCACGATGGACATAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCCCGAGCACACGGCAGATGTACACGGAGTAGGACTCTCCACGGGCACGAC

GCCGACGAAAGAGTTCATGATGGACACAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCTCGAGCACACGGTAGACGCACACGGAGTAGGACTCTTCACGGGCATGAC

GTTGACGGGGGAGTTCATGGTGGACATAGCCTTGGGGGGGACTCCGGTGTCTGGATGGACCTGCTTGGGCACACGGTAGATGTACACGGAGTGGGATTCTTTGCGGGCATGAC

CGTCGACGAAAGAGTCCACGACGGACACAGCCCCGGAAGAGACCCCAGTGTCCGGATGAACCCGCCTGAGCACACGGTAGATGTACACGGAGTAGGACTCTCCACGGGCACGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GTCGACGAAAGAGTTCACGATGGACATAGCCCCGGAAGAGACTCCAGTGTCCGGACGAACCCGCCCGAGCACACGGTAGATGCACACGGAGCAGGATTCCTCACGGGCATGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAAATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

CGTTGACGAGGGGGTTCATGGTGGACATAGCCTTGGGGGGGACTCCGGTGTCTGGATGAACCTGCTTGGGCACACGGTGGATGTACACGGAGTGGGATTCTTTGCGGGCGTGGC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC
TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GCCGACGAAAGAGTTCACGATGGACACAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCTTGAGCACACGGTAGACGTACACGGAGCAGGACTCTCCACGGGCATGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GTCGACGAAAGAGTTCATGATGGACACAGCCCCGGAAGAGACTCCAGTGCCCGGACGAACCCGCTCGAGCACACGGTAGACGCACACGGAGCAGGATTCTCCACGGGCATGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

GCTGACGAAAGAGTTCACGATGGACATAGCCCCGGAAGAGACTCCAGTGTCCGGATGAACCCGCCCGAGCACACGGCAGATGCACACGGAGTAGGATTCTCCACGGGCATGAC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC
TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGTACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATAGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGTACACGGTAGATGTACACAGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATAGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGTACACGGTAGATGTACACAGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC

TTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTC


AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG


AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAGG
AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG


AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG

AGAATCAAACGGACGGCAGTTTGAATTTCGCGAGAAGAGATGGTGGATCTCTTGTTGTAGTGAGCAAGACGAGATGCCTCAGCAGCGATACGCTCGAAGACGTCGTTGACGAAAG




TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC


TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC
TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC


TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATGACAGTTTTTCGGTGGGGAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTGTGCTGTCTCTCATGCCGAATGTGCAAAGTGCATGGTTTTTCTTGGTCACTCTGCC

TTATGACAGTTTTTCGGTGGGGAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTGTGCTGTCTCTCATGCCGAATGTGCAAAGTGCATGGTTTTTCTTGGTCACTCTGCC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC

TTATAACAATTTTTCGGTGGGAAGGAGGAGCCTATTGACATTCTGTGGGGACACCTTTCTATGCTGTCTCTCATGCCGAATGTACAAAGTGCATAGTTTTTCTTGGTCACTCTGCCAC




TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG

TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG
TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG

TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG


TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG

TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG

TGTTGGCTGGAGTGACCATCGCCCAAGGAGGAGTTCTTCCAAATATCCAAGCTGTTCTTCTTCCAAAGAAGACTGGAGGAGACAAGGAATAGATGCCTTCTTAAAACATTTTACCG




TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG


TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCGCCCCCACCCACATTTGGCCGCGGACTTGTTCCAGTCGGTCATCTTGGGTTGTTTCTTCCTCTCCCACTATTCAGTCGTTTGTTTTATGTTTTGGTTTTTGTCTGTGA

TCTCACGGCCACCCCCACCCACGTTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTATTCGGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTGA

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG
TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

CTCACGGCCGCCCCCACCCACATTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTGGATTGTTTCTTCCTCTCCCACTGTTCAGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTGAT

TCTCACGGCCGCCCCCACCCACATTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTGGATTGTTTCTTCCTCTCCCACTGTTCAGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTGG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGACCACCCCCGCCCACATTTGGCCGCGGACTTGTTCCGATCGGTCATCTTGGATTGTTTCTTCCTCTCCCACTATTCAGTCGTTTGTTTTATATTTTGATTTTTGTCTGTGAT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTGTATTTTGATTTTTGTCTGTGAT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCAATCGGTCGTCTTGGATTGTTTCTTCCTCTCCCACTGTTCAGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTGG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTGGATTGTTTCTTCCTCTCCCACTATTCGGTCGTTTGTTTTATGTTTTGATTTTTGTCTGTGA

TCTCACGGCCACCCCCGCCCACATTTGGCCACGGACTTGTTCCGGTCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTGTTCAATCGTTTGTTTTATGTTTTGGTTTTTGTCTGTGA

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG
TCACAACCACCCCCACCCACATTTGGTCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTGTATTTTGATTTTTGTCTGTGAT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCGCCCCCACCCACATTTGGCCACGGACTTGTTCCGATCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTATTCGGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTAA

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAGT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

CTCACGGCCACCCCCACCCACATTTGGCCACGGACTTGTTCCGATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTGATT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG


TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGACCACCCCCGCCCACATTTGGCCACGGACTTGTTCCGATCGGTCATCTTAGATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGGTTTTTGTCTGTAGT

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCAATCGGTCATCTTGGATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAAT

TCTCACGACCACCCCCGCCCACATTTGGCCGCGGACTTGTTCCGATCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTGTTCAGTCGTTTGTTTTGTGTTTTGATTTTTGTCTGTGG

TCTCACGGCCGCCCCCACCCACATTTGGCCGCGGACTTGTTCCAATCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAAT

TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCGGTCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTATTCGGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTAA
TCTCACGGCCACCCCCACCCACATTTGGCCGCGGACTTGTTCCAATCGGTCATCTTAGATTGTTTCTTCCTCTCCCACTGTTCAATCGTTTGTTTTGTATTTTGATTTTTGTCTGTAAT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

CTCACGGCCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTGGATTGTTTCTTCCTCTCCCACTGTTCGGTCGTTTGTTTTATATTTTGATTTTTGTCTGTAATT

TCTCACGGCCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTGTTCAATCGTTTGTTTTATGTTTTGATTTTTGTCTGTAAT

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCTCACGGCCGCCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTGAATTGTTTCTTCCTCTCCCACTATTCGGTCGTTTGTTTTGTATTTTGATTTTTGTCTGTGGT


TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG

TCACAACCACCCCCACCCACATTTGGCCACGGACTTGTTCCAATCGGTCATCTTAAATTGTTTCTTCCTCTCCCACTATTCAATCGTTTGTTTTATATTTTGATTTTTGTCTGTAATTG
AGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCA

AGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCA

AGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCA

AGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCA




GAGAAGCCCACCAATCATTTTCCAAACACCATACCCTGTCATCTCCGCAATCGCTGACGATACCACCACTCCAATCAATTGCAGTCAATGCTCTGCATGAAACCAGGCACGCAAAA

TGAGAGGCCCATTAGTCGTTTTTTGAACATTGTACTTTGTCGTCTCTGCGGTCGCTGACGATGTCGTCATTTCGATCGGTTGCAGTCGGTGCTCTGTATGAGACTGGGCATGTAAA

GAGAAGCCCACCAATCATTTTTCAAACATTATACTTTGTCATCTCCGCAATCGCTGACGACATCATCATTCCAACCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATT

GAGAAGCCCATTAATCATTTTTTGAACATTGTACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCGGTCGGTTGCGGTCAGTGCTCTGTGTGGAACTGGGCATGTAGAAT

GAGAAGCCCACCAATCACTTTTCAAACACTATACTTCGTCATCTCCGCAATCGCCGACGATATCACCACCCCAATCAATTGCAGTCAACGCTCTGCATGAAACCAGGCATGTAAAAC

GAGAGGCCCATTAATCATTTTTTGAACATTGTGCTTTGTCATCTCTGCGGTCGCTGACGATGTCGTCATTTCGATCGGTTGCGGTCGGTGCTCTGTATGGAACTGGGCATGTGGGA

TGAGGGGCCCATTGGTCATTTTTTGAACATTGTACTTTGTCGTCTCTGCGGTCGCTGACGATGTCATCGTTTCAGTCGATTGCGGTCGGTGCTCTGTGTGGAACTGGGCATGTAGA

AGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCA

AGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCA

TGGGGGGCCCATTGGTCATTTTTTGAACATTATGCTTTGTCATCTCTGCGGTCGCTGACGATATCATCGTTTCGGTCGGTTGCGGTCAATGCTCTGTGTGGAACTGGGCATGTAGAA


TGAGAAGCCCATTGGTCATTTTTTGAACATTGTACTTTGTCATCTCTGCGGTCGCTGACGATATCATCATTTCGGTCGATTGCAGTCGATGCTCTGTGTGGGACTAGGCATGTAGAG

GAGAAGCCCACCAATCACTTTCCAAACACTATACTCCGTCATCTCCGCAATCGCCGACGACATCACCATTCCAATCAACCGCAGTCAATGCTCTGCATGAAACCAGGCATGCAAAAT
TGAGGGGCCCATTAATCATTTTTTGAGCATTGTACTTTGTCATCTCTGCAGTCGCTGACGATATCATCATTTCGATCGATTGCGGTCAATGCTCTGTGTGGAACTGGGCATGTAAAAT

CGAGAAGCCCACCAATCATTTTCCAAACACCACACCCCGTCATCTCCGCAATCGCCGACGACATCATCATTCCAATCAATTGCAGTCAACGCTCTGCATGAAACTAGGCACGCAAAA

TGAGAAGCCCACCAATCACCTTCCAAACACTACACCCCGCCATCTCCGCAATCGCTGACGACACCACCATTCCAATCAATTGCAGTCAACGCTCTGCATGAAACTAGGCATGTAAAA

GAGAGGCCCATTGATCATTTTTTGAACATTGTACTTTGTCATCTCTGCGGTCGCTGACGATATCATCATTTCGGTCGATTGCGGTCGGTGCTCTGTGTGGAACTGGGCATGTAAAA

GAGAAGCCCACCAATCATTTTCCAAACACTATACTTTGTCATCCCCGCAATCGCTGACGACATCATCATCTCAATCAATTGCAGTCAATGCTCCGTATGAAACCAGGCATGTAAAAT

TGAGAGGCCCATTAATCATTTTTTGAACATTGTACTTTGTCATCTCTGCGGTCGCTGACGATGTCATCGTTTCGGTCGATTGCAGTCGGTGCTCTGTGTGAAACTGGGCGTGTAGAA

GAGAAGCCCACCAATCATTTTTCAAACACCATACTTCGTCATCCCCGCAATCGCCGACGACATCACCATTCCAATCAATTGCAGTCAACGCTCTGCATGAAACCAGGCACGTAAAA

TGAGAAGCCCACCAATCACCTTCCAAACACCATACTTTGTCATCTCCGCAATCGCTGACGACATCATCATTTCAATCAATCGCAGTCAACGCTCTGCATGAAACCAGGCATGCAAAA
GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT


GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGTGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT


AGCGATCTGCGACGTCACCAATAACATTCGTCGTCCGGTCTGCACTGCACTCCTCAGGGGCAAATATGCGTTCAAATGCATACTTTCTGAACAAAATGCATCCTCTCTCTTTCCCAC

AAGCGATCCGCGACGTCACCAATAACATTCGTCGTCCGGTCCGTACTGCACTCTTCAGGGGCAAATATGCGCTCAAATGCACACTTTCTGAACAAAATGCATTCTCCCTCTCTCCCA

AAGCGATTCGCGACGTCACCAATAACACTCGTCGCCCGGTCTGTACTGCACTCTTCAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATCCTCCTTCTTTCCCA
AGCGATCCGCGACGTCACCAATAACATTTGTCGTCTGGTCTGCACTGCACTCTTCAGGGGCAAATATGCGCTCAAACGTATACCTTCTGAATAAAATGCATCCCCCCTCTCTCCCAT

GCGATTTGCGACGTCACCAATAACATTTGTCGTCTGGTCTGTACTGCACTCTTCAGGGGCAAATATGCGTTCAAATGTACACTTTCTGAATAAAATGCACCCTCTTTCTTTCCCATG

AGCGATCTGCGACGTCACCAACAACATTCGTCGTCCGGTCCGTACTGCACTCTTCAGGGGCAAATATGCGTTCAAACGTACACTTTCCGAACAAAATGCATCCCCTTTCCTTCTCAT

TTCAGGGGCAAATATGCGTTCAAATGTACACTTTCCGAACAAAATGCACCCTCCCTCTTTCCCATGAGACCATACCAATGAGAAGCCCACCAATCATTCTCCAAACACCATACTCCG

AAGCGATTTGCGACGTCACCAATAACATTTGTCGTCCGGTCTGCACTGCACTCCCCAGGGGCAAACATGCGTTCAAATGCATACTCCCTGAACAAAATGCATCCTCCCCCTTTCCCA

AGCGATCCGCGACGTCACCAACAACATTCGTCGTCCGGTCCGTACCGCACTCCCCAGGGGCAAACATGCGCCCAAACGTACACTTTCCGAATAAAATGCATTCCCTCTCTCTCCCA

AAGCGATCCGCGACGTCACCAATAACATTCGTCGTTTGGTCTGCACTGCACTCCTCAGGGGCAAATATGCGTTCAAACGTACACTTTCCGAATAAAATGCATCCTCCCTCTTTCCCA

AAGCGATCCGCGACGTCACCAACAACATTCGTCGTCCGGTCTGTACCGCACTCCCCAGGGGCAAACATGCGTCCAAATGCATACTTTCTGAACAAAATGCATCCCCCCTCTCTCCC


GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT
GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT

GATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAATGCATTTTCTTTCTTTCTCATGAGAT




TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG


GATTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAAAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGC

TCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGC




CGACTCACAAAAGAACCCTCAACGCTCTCCAATACCCTCTCCCACAACTGTTAATCAAAATCGGACTTCCTCACCAAAAACCCAAACAAATTGGCGCCAAATTCAAAGTTGCTCCTG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG
TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

GATTCGCAGGAGAATTTTTGATGCTTTCCAATGTTTTCTCTTACAATTGTTGATCAGGATTGGACTTCTTCATTAGGAATTCGGACGGATTGGCGCCGGGTTCGGAGTTGCTCTTGA

GATTCACAGAAGAGTTTTTGATGCTTTCCAATGTTTTCTCTTACAATTGTTGATCAGGATTGGACTTCTTCATTGAAGATTCGGACGGATTGGCGCCAAATTCAAAGTTGCTCTTGGG

GATTCGCAGGAGAGTTTTTGGTGCTTTCCAATATTTTCTCTTACGATTGTTGATCAGGGTTGGACTTCTTCGTTGGGGATTCGGGCAGATTGGCGCCGGGTTCGGAGTTGCTCTTG

GACTCACAAAAGAATTTCCAATGCTTTCCAATACCCTCTCCCACAATTGTTAATCAAAATTGGACTTCTCCACCAAAAATCCAAACAAATTGGCGCCAAACCCAAAGTTGCTCCTGA

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG


TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG

TTCACAAAAGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGG




TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC


TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC
TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC


CACATCTACCAACCAATCATCACCATGTCCGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCCCACCAAGAGCCGGACTCCAATTCCCAGTTGGCC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC

TCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTC
TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG


TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

GTAGGATTCTCCACGGGCATGACGTCTCTTCTCTCCGTCCTTTGGCCTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTG

AGCAGGACTCTTCACGGGCACGACGTCTCCCCTCCCCGTCCTCCGGCCCGGTGACGGTCCCGGCGGCCCTCTTCGCTCCTCCAGCAGACGGCTCCGGCGGGGCCATTCCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGCAGGACTCTCCACGGGCATGACGTCCCCCCTCCCCGTCCCCCGGCCTGGTGACGGTCCCGGCGGCCCTCTCCGCTCCTCCAGCAGACGGCTCCGGTGGGGCCATCCCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGTAGGACTCTCCACGGGCATGACGTCTCCCCTCCCCGTCCTCCGGCCCGGTGACGGTCCTGGCGGCCCTCTCCGCTCCTCTAGCAGACGGCTCCGGCGGGGCCATTTCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGCAGGACTCTTCACGGGCATGACGTCTCCCCTCTCCGTCCCCCGGCTTGGTGACGGTCCTGGCGGCCCTCCCCGCCCCTCCAGCAGACGGCCCCGGTGGGGCCATTTCGATTG
TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG
TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG


TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGTAGGACTCCCCACGGGCATGACGTCTCCCCTCTCCGTCCCCCGGCTTGGTGACGGTCCCGGCGGCCCTCTCCGCTCCTCTAGCAGACGGCTCCGGTGGGGCCATCCCGACCG

AGTAGGACTCTCCACGGGCACGACGTCTCCCCCCTCCGTCCTCCGGCCCGGTGACGGTCCCGGCGGCCCTCCCCGCTCCTCTAGCAGACGGCTCCGGTGGGGCCATCCCGATCG

AGTAGGACTCTTCACGGGCATGACGTCCCCCCTTTCCGTCCCCCGGCTCGGTGACGGTCCTGGCGGCTCTCTCCGCTCCCCCAGCAGACGGCTTCGGTGGGGCCATTTCGATCGA

AGTGGGATTCTTTGCGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTGGCGGACGGCTTTGGTGGGGCCATTTCGATTGAT

AGTAGGACTCTCCACGGGCACGACGTCTCCCCTCTCCGTCCTCCGGCCCGGTGACGGTCCCGGCGGCCTTCTCCGCTCCCCTAGCAGACGGCTCCGGTGGGGCCATCCCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGCAGGATTCCTCACGGGCATGACGTCCCCCCTCCCCGTCCTCCGGCCCGGTGACGGTCCCGGCGGCCCTCTCCGCTCCCCTAGCAGACGGCCCCGGTGGGGCCATCCCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGTGGGATTCTTTGCGGGCGTGGCGTCTCTTCTTTCCGTCCTTTGGCTTGGTGGCGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGAT

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG
TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGCAGGACTCTCCACGGGCATGACGTCTCCCCTCCCCGTCCTCCGGCCCGGTGACGGTCCCGGCGGCCCTCTCCGCTCCTCCAGCAGACGGCTTCGGTGGGGCCATCCCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGCAGGATTCTCCACGGGCATGACGTCTCCCCTCTCCGTCCTCCGGCTTGGTGACGGTCCTGGCGGCTTTCTCCGCTCCTTTAGCAGACGGCTCCGGTGGGGCCATCTCGATCGA

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGTAGGATTCTCCACGGGCATGACGTCTCCTCTCTCCGTCCTCCGGCCCGGTGACGGTCCTGGCGGCCCTCTCCGCTCCTCCAGCAGACGGCTCCGGTGGGGCCATCCCGACCG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG
TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGA

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

AGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGGA

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG

TAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGACGGTCTTGGCGGCTTTCTTTGCTCCTTTAGCAGACGGCTTTGGTGGGGCCATTTCGATTGATTGG


GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT


GCTCGAAGACGTCGTTGACGAAGGAGTTCATGATAGACATGGCCTTTGAGGAGACTCCGGTGTCTGGGTGAACTTGCTTGAGAACACGGTAGATGTAGACGGAGTACGATTCCT
GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATAGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGTACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT


GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT

GCTCGAAGACGTCGTTGACGAAAGAGTTCATGATGGACATAGCCTTGGAAGAGACTCCAGTGTCTGGATGAACCTGCTTGAGCACACGGTAGATGTACACGGAGTAGGATTCTTT




ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT


ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT
ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT


ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

CATGGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTGTCTCTATGTGCCCGCCTGGTCACCGCAGCTGTGTTTGAAGGGGTGCTGTCTAATGGTCTTCTTCGGATCGTTT

CATGGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTGTCTCTATGTGCCCGCCTGGTCACCGCAGCTGTGTTTGAAGGGGTGCTGTCTAATGGTCTTCTTCGGATCGTTT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT

ATAGTTTTTCTTGGTCACTCTGCCACTTCCCCCATCTGTCTTATCTCTATGTGCCCGCCTAGTCACCGCAGCTGTGTTTAAAAGGGTGCTGTCTAATGGTCTTCTTCAGATCGTTTCT




GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTGTACTTTAT

GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTGTACTTTAT
GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTGTACTTTAT

GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGGGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTGTACTTTAT


GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTGTACTTTAT

GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTTGTACTTTA

GATGCCTTCTTAAAACATTTTACCGAACCCAACGGCCCTCTTTAGAGCCACAAATATTTCAAATCCTCTATTGACTGAATAAATATATTATAGTATTTCAATTTTTTTTTTGTACTTTAT




TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG


TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTTATGTTTTGGTTTTTGTCTGTGATTGATTACTTTATTTTGAGATTTTGAGTGGTTGAGAAGAAATGGACAAATAATAGTTGTGGACGGACCTGGAACTTTTTGGGATAGGCGATT

TTTTGTATTTTGATTTTTGTCTGTGATTGATTACTTTGTTTTGAGGTTTTGGGTGGTTGAGAGGAAATGGACGAATGATGGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGAT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG
TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTGTATTTTGATTTTTGTCTGTGATTGATTACTTTATTTTGAAATTTTGAATGGTTGGGAGGAAATAAACGGATAATAATTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATTTG

TTTTGTATTTTGATTTTTGTCTGTGGTTGATTGCTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATGGACAGATAATAGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTATATTTTGATTTTTGTCTGTGATTGATTACTTTGTTTTGAGGTTTTGAATGGTTGGGGGGAAATAGACGGATAATAATTGTGGACGGACCTGGAACTTTTTGGGATGGGCGATT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTGTATTTTGATTTTTGTCTGTGATTGGTTACTTTGTTTTGAGGTTTTGGGTGGTTGGGGGGAAATGAACAGATGATGGTTGTGGACGGACCTGGAACTTTTTGGGATGGGCGATT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTTGTATTTTGATTTTTGTCTGTGGTTGATTGCTTTGTTTTGGGGTTTTGGGTGGTTGAGGGGAAATGGACGGATGATGGTTGTGGACAGACCTGGAGCTTTTTGAGATGGGCGAT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTTATGTTTTGATTTTTGTCTGTGATTGATTACTTTGTTTTGAAATTTTGAATGGTTGGGAAGAGGTAAACAGATAATAGTTGTGGACAGACCTGGAACTTTTTGAGATGGGCGATT

TTTATGTTTTGGTTTTTGTCTGTGATTGATTACTTTGTTTTGGAATTTTGGGTGGTTGAGAGGAAATGAGCAGATAATGATTGTGGACAGACCTGGAGCTTTTTGAGATGGGCGATT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG
TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTGTATTTTGATTTTTGTCTGTGATTGATTACTTTGTTTTGAGATTTTGGATGGTTGAGGGGAAATAAACAGATAATGGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATTT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTTGTATTTTGATTTTTGTCTGTAATTGATTGCTTTGTTTTGGGATTTTGAATGGTTGAGAAGAGATGGACAGATGATAATTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATT

TTTATATTTTGATTTTTGTCTGTAGTTGATTACTTTGTTTTGGGGTTTTGAATGGTTGAGAAGAGATAAACGGATAATGGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTATATTTTGATTTTTGTCTGTGATTGATTACTTTGTTTTGAAATTTTGAATGGTTGGGAAGAGATAAACGGATAATAGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATTTG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG


TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTATATTTTGGTTTTTGTCTGTAGTTGATTACTTTATTTTGAAGTTTTGGGTGGTTGAGAAGAAATAAACAGATGATGGTTGTGGACAGGCCTGGAACTTTTTGAGATGGGCGATTT

TTTATATTTTGATTTTTGTCTGTAATTGATTGCTTTGTTTTGGGGTTTTGAATGGTTGAGAAGAAATGGACAGATAATGGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATTT

TTTGTGTTTTGATTTTTGTCTGTGGTTGATTGCTTTGTTTTGAAATTTTGAATGGTTGAGAAGAGATGAACAGATGATGGTTGTGGACAGACCTGGAGCTTTTTGAGATAGGCGATT

TTTATATTTTGATTTTTGTCTGTAATTGATTACTTTGTTTTGAAATTTTGAATGGTTGAGAGGAAATGGACAAATAATAATTGTGGACAGACCTGGAACTTTTTGGGATGGGCGATTT

TTTGTATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATGGACAAATAATGGTTGTGGACGGACCTGGAACTTTTTGAGATGGGCGATTT
TTTGTATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAGATTTTGAGTGGTTGAGAGGAAATAGACGGATAATGGTTGTGGACAGACCTGGAGCTTTTTGAGATGGGCGATTT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTATATTTTGATTTTTGTCTGTAATTGATTACTTTGTTTTGAAATTTTGAATGGTTGAGGGGAAATGGACGGATAATAGTTGTGGACAGACCTGGAACTTTTTGGGATGAGCGATTTG

TTTATGTTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGGGATTTTGAATGGTTGGGAGGAGATAAACGGATAATAGTTGTGGACGGACCTGGATCTTTTTGAGGTGGGCGATTT

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TTTGTATTTTGATTTTTGTCTGTGGTTGATTACTTTGTTTTGAAATTTTGGGTGGTTGAGAGGAAATGAACAGATGATAGTTGTGGACAGACCTGGAACTTTTTGGGATGGGCGATT


TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAACAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG

TATATTTTGATTTTTGTCTGTAATTGATTACTTTATTTTGAAATTTTGAATGGTTGAGAAGAAATAAACAAATAATAATTGTGGACAGACCTGGAACTTTTTAAGATAAGCGATTTGCG
TATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTT

TATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTT

TATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTT

TATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTT




CTGCATGAAACCAGGCACGCAAAATTCAAACCAAATCTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTAGTACAGATCTACCAGACATATTTTCCTGTGCTGGATACA

TCTGTATGAGACTGGGCATGTAAAATTCGAATTGGATTTGTGGCGGGAAGTTTTGGGTGACGTTTCCTTGTTCCAGTGGTATGGATTTACCGGACATGTTTTCTTGTGCTGGATATG

TGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAG

CTGTGTGGAACTGGGCATGTAGAATTCGGATTGGATTTGTGGCGGGAAGTTTTGGGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAA

CTGCATGAAACCAGGCATGTAAAACTCAAATTAAATTTGTGGCGGGAAGTTCTAAGTGACATTTCCCTGTTCCAGTAGTATAGATCTACCAGACATATTTTCCCGTGCTGGATACAA

CTGTATGGAACTGGGCATGTGGGATTCGGATTGGGTTTGTGGCGGGAAGTTTTGGGTGACGTTTCCTTGTTCCAGTAGTATAGATTTACCAGACGTGTTTTCTTGTGCTGGATATG

TCTGTGTGGAACTGGGCATGTAGAATTCGGATTGGGTTTGTGGCGGGAGGTTTTGGGTGACGTTTCCTTGTTCCAGTGGTATGGATTTGCCGGACATGTTTTCTTGTGCTGGATAT

TATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTGAGTGGCATTTCCTTGTTCCAGTGGTATAGATTTACCAGACATGTTTTCTTGTGCTGGATATGGAGT

TATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTAGTATAGATTCACCAGACATATTTTCTTGTGCTGGATATAAAGT

TCTGTGTGGAACTGGGCATGTAGAATTCAGATTGGATTTGTGGCGGGAAGTTTTGGGTGACATTTCCTTGTTCCAGTAGTATAGATTTACCAGACGTGTTTTCTTGTGCTGGATATG


CTGTGTGGGACTAGGCATGTAGAGTTCGGATTGGATTTGTGGCGGGAAGTTTTGGGTGACATTTCCTTGTTCCAGTGGTATGGATTTACCAGACATGTTTTCTTGTGCTGGATATG

CTGCATGAAACCAGGCATGCAAAATTCAAATTAAATTTGTGGCGGGAAGCCTCAAGTGACATCTCCCCGTTCCAGTAGTACAGATTTACCAGACACATTCTCCTGTGCTGGACACAA
CTGTGTGGAACTGGGCATGTAAAATTCGGATTGGATTTGTGGCGGGAAGTTTTGAGTGACATTTCCTTGTTCCAGTAGTATAGATTTGCCAGACATATTTTCTTGTGCTGGATATGG

TCTGCATGAAACTAGGCACGCAAAACCCAAATCAAATCTGTGGCGGGAAGTTCCAAGTGACATCTCCCCGTTCCAGTAGTATAGATCCACCAGACACACTTTCCCGTGCTGGATAC

TCTGCATGAAACTAGGCATGTAAAATTCAAACTAAATTTGTGGCGGGAAGCTCCAAGTGACACTTCCCCGTTCCAGTAGTATAGACCTACCAGACATATTTTCCCGTGCCGGATACA

CTGTGTGGAACTGGGCATGTAAAATTCGGATTAGATTTGTGGCGGGAAGTTTTGGGTGACGTTTCCTTGTTCCAGTAGTGTAGATTTACCAGACATATTTTCTTGTGCTGGATATGG

CGTATGAAACCAGGCATGTAAAATTCAAACCAAATTTGTGGCGGGAAGTCCCAAGTGACATTTCCCCGTTCCAGTAGTATAGATCCACCAGACACATTCCCCTGTGCTGGACACAA

CTGTGTGAAACTGGGCGTGTAGAATTCGGATTGGATTTGTGGCGGGAAGTTTTGGGTGACATTTCCTTGTTCCAGTAGTATGGATTTACCGGACATGTTTTCTTGTGCTGGATATG

CTGCATGAAACCAGGCACGTAAAACCCAAACCAAATTTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTAGTATAGATTTACCAGACACATTTTCCCGTGCTGGACACA

CTGCATGAAACCAGGCATGCAAAATTCAAATTAAATTTGTGGCGGGAAGTTCCAAGTGACACTTCCCCGTTCCAGTAGTATAGATCTACCAGACACATTTTCCCGTGCCGGATACA
TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT


TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT


CAAAATGCATCCTCTCTCTTTCCCACGAGATCATACCAACGAGAAGCCCACCAATCATCTTCCAAACACCATACTTCGTCATCCCCGCAATCGCCGACGACATCACCACCCCAATCA

CAAAATGCATTCTCCCTCTCTCCCACGAGATCATATCAATGAGAAGCCCACCAATCACTTTTCAAACACCATACTTTGTCATCTCCGCAATCGCTGACGACATCATCATTCCAATCAA

TAAAATGCATCCTCCTTCTTTCCCATGAGACCATACCAATGAGAAGCCCACCAATCATTTTCCAAACACCATACCCCGTCATCTCCGCAATCGCTGACGATACCACCATTCCAACCAA
AAAATGCATCCCCCCTCTCTCCCATGAGACCATATCAATGAGAAGCCCACCAATCATTTTCCAAACACTATACTTTGTCATCCCCGCAATCGCCGACGACATCATCATTCCAATCAA

AAATGCACCCTCTTTCTTTCCCATGAGATCACATCAATGAGAAGCCCACCAATCATTTTCCAAACACTACACTTTGTCATCTCCGCAATCGCCGACGATATCATCATCCCAACCAATT

CAAAATGCATCCCCTTTCCTTCTCATGAGATCATACCAATGAGAAGCCCACCAATCATTTTCCAAACACTACACTTTGTCATCTCCGCAATCGCTGACGATATCATCATCCCAATCAA

ATCATTCTCCAAACACCATACTCCGTCATCTCCGCAATCGCCGACGATACCACCATCCCAATCAACTGCAGTCAATGCTCTGTATGAAACTAGGCACGCAAAATTCAAACTAAATTT

CAAAATGCATCCTCCCCCTTTCCCATGAGATCATACCAATGAGAAGCCCACCAATCATTTTTCAAACACTATACTTTGTCATCTCCGCAATCGCTGACGACATCACCATTCCAATCA

ATAAAATGCATTCCCTCTCTCTCCCACGAGATCATACCAATGAGAAGCCCACCAATCACTTTCCAAACACTATACTCCGTCATCTCTGCAATCGCCGACGATATCATCATCCCAATCA

TAAAATGCATCCTCCCTCTTTCCCATGAGACCATACCAATGAGAAGCCCACCAATCATTTTCCAAACACTATACTTCGTCATCCCCGCAATCGCCGACGACATCACCATTCCAATCA

ACAAAATGCATCCCCCCTCTCTCCCACGAGACCATACCAATGAGAAGCCCACCAATCACCTTTCAAACACCATACTCCGCCATCTCCGCAATCGCCGACGACACCACCACTCCAACC


TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT
TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT

TGCATTTTCTTTCTTTCTCATGAGATCATATCAATGAGAAGCCCATTAATCATTTTTTAAACATTATACTTTGTCATCTCTGCAATCGCTGACGATATCATCATTTCAATCAATTGCAGT




CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA


CCAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTC

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTGGAGAGAGCCCTTGATATGGTGTATTTTGACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTGTAGTGGCGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

AAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAAAAAAAGCCCTTGATATGATGTATTTTAACACCCCTTGTTGGAGTTCTCTCAAAAGTATACTTATAGTGACGTCAC

AAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCAC




GCGCCAAATTCAAAGTTGCTCCTGAATGGCTGAACACTACGATTTTAGAGAGAGCCCCCGACATGATGTATTCCAACACGCCCCGCCGGAGTTCTCCCAGAAGCATACCCATAGT

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA
CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CGCCGGGTTCGGAGTTGCTCTTGAGTGGCTGGGCACTATGATTTTGGAGAGGGCCCTTGATATGATGTGTTTTGACACGCCTTGTTGGAGTTCTCTCGGAAGTGTACTTGTAGTGG

CGCCAAATTCAAAGTTGCTCTTGGGTGGCTGAACACTATGATTTTGGAGAGAGCCCTTGGTATGATGTATTTTGACACGCCTTGTTGGAGTTCTCTCGGAAGTATACTTGTAGTGAC

GCGCCGGGTTCGGAGTTGCTCTTGGATGGCTGAACACTGTGATTTTGGAGAGAGCCCTTGGTATGATGTATTTTGACACGCCTTGTTGGGGTTCTCTCAGAAGTATACTTGTGGTG

CGCCAAACCCAAAGTTGCTCCTGAATGGCTGAACACTACGACTCCAGAGAGAGCCCTCGACATGATGCATTTCAACACGCCCCGCCGGAGCTCTCCCAGAAGCATACCCATAGTG

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA


CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA

CAAATTCAAAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACACGCCTTGTTGGAGTTCTCTCAGAAGTATACTTATAGTGACGTCA




GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT


GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT
GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT


GCCGGACTCCAATTCCCAGTTGGCCGTCCTCATCGTATTCTCCGCAAAGGAAACCACGCTCAACGTGCCGGAGCCGGAGCCCCAGTCCACCCGGCCGCTGCCCTTGAGTACCCCG

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT

GACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCAGTTTACCTGGCTGCTGTTCTTGAGTACCTCGCTGCT
GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT


GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

TTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCTCCGGCGGGGCCATTCCGACCGATCGGACTGGTCGCCGGACAAGTGTAAGGAATGGGCTGCCGGCCACCACCTCCATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCTCCGGTGGGGCCATCCCGACCGATTGGACCGGTCGCCGGACAAGTGTAAGGAATGGGCCGCCGGCCACCACCCCCACAACAACCCTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGGCAAGTGTAAGGAATGGGTTGATGGTAATTTCTTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCTCCGGCGGGGCCATTTCGACCGATCGGACTGGTCGCCGGACAAGTGTAAGGAATGGGTTGCCGGCCACTACCCCTATAACAATCTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCCCCGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT
GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT
GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT


GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCTCCGGTGGGGCCATCCCGACCGATTGGACCGGTCGCCGGACAAGTGTAAGGAATGGGTTGCCGGCCACCACCCCCATAACAATTCTT

GCTCCGGTGGGGCCATCCCGATCGATTGGACTGGTCGCCGGACAAGTGCAAGGAATGGGTTGCCGGCCACCACCTCCATAACAATTTTT

GCTTCGGTGGGGCCATTTCGATCGACCGGACTGGTCGCCGGACAAGTGTAAGGAATGGGCTGTTGGCCACCACCTCTACAACAATCCTT

TTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCTCCGGTGGGGCCATCCCGACCGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGCCGTTGGCCACCACCTTCATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCCCCGGTGGGGCCATCCCGACCGACTGGACTGGTCGCCGGACAAGTGTAAGGAATGGGTTGCCGGCCACCACCTCCATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

CTTTGGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAGGTGTGGGGAATGGGTTGTTGGCCATTACCTTTGTGGCAGTTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT
GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GCTTCGGTGGGGCCATCCCGACCGACCGGACCGGTCGTCGGACAAGTGCAAGGAATGGGCTGCTGGCCACCACCTCCATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

CTCCGGTGGGGCCATCTCGATCGACTGGACCGGTCGCCGGACAAGTGTAAGGAATGGGTTGCCGGCCACCACCTCCATAACAATCTTC

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

CTCCGGTGGGGCCATCCCGACCGATTGGACTGGTCGCCGGACAAGTGTAAGGAATGGGCTGCTGGCCACCACCTCTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT
GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGGCAAGTGTAAGGAATGGGTTGATGGTAATTTCTTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAAGAATGGGTTGATGGCCATTTCCTTTATAATAATTCAT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCNATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT

GGTGGGGCCATTTCGATTGATTGGACTGGTCGTTGGACAAGTGTAAGGAATGGGTTGTTGGCCATTACCTTTATAACAATTTTT


AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA


AGATGTAGACGGAGTACGATTCCTTGCGGGCATGGCGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA
AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA


AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA

AGATGTACACGGAGTAGGATTCTTTACGGGCATGACGTCTCTTCTTTCCGTCCTTTGGCTTGGTGA




TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG


TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG
TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAGAGCCAAGTCCCGCTCATCAAGAG


TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TCTAATGGTCTTCTTCGGATCGTTTCTGCATCTACCAACCGGTCATCACCATGTCTGGACGCGGAGGGGGGGGCGGAGCCGGGACCGGGGGAGAAGCCGGGTCCCGCTCATCGG

TCTAATGGTCTTCTTCGGATCGTTTCTGCATCTACCAACCGGTCATCACCATGTCTGGACGCGGAGGGGGGGGCGGAGCCGGGACCGGGGGAGAAGCCGGGTCCCGCTCATCGG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG

TAATGGTCTTCTTCAGATCGTTTCTACATCTACCAACCAATCATCACCATGTCTGGACGCGGAAAGGGAGGCAAAGCCAAGACCGGAGGAAAAGCCAAGTCCCGCTCATCAAGAG




TATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATTT

TATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATTT
TATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATTT

TATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATTT


TATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATTT

TATTTCAATTTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATT

TATTTCAATTTTTTTTTTGTACTTTATTACTAATTGAAAATCTTTTCAACGTTTGCAATCAAGAAACTTCTTCTCGAAATTAGTTGATTCACAAAAGAATTTTTAATGCTTTCCAATATTT




AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA


AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

TGGAACTTTTTGGGATAGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCGGATATGCGTTCGGGTGTGTACTTTCTGAATGGAA

CTGGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCGGGTATGCGTTCAGGTGTATACTTTCTGGGTGAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA
AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

GGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGGTAACATTTGTCGTTTGGTCTGTGCTGCGCTCTTTGGGGGCAGATGTGCGTTCAGGTGTGTACTTTCTGGATAGAA

TGGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGGTGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGGTGTGCGTTCGGGTGTGTACTTTCTGGATAGGA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

TGGAACTTTTTGGGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCGCTCTTTGGGGGCGGATGTGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

TGGAACTTTTTGGGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCGGATGTGCGTTCAGGTGTATACTTTCTGGGTNGAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

CCTGGAGCTTTTTGAGATGGGCGATTTGCGACGTCGCTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGGTGTGCGTTCGGGTGTGTACTTTCTGAATGGAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

TGGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCAGGTATGCGTTCAGGTGTATACTTTCTGAATGGAA

TGGAGCTTTTTGAGATGGGCGATTTGCGGCGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCGGGTATGCGTTCGGGTGTATACTTTCTGAATGGGA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA
AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

TGGAACTTTTTGAGATGGGCGATTTGCGGCGTCACTAATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGGTGTGCGTTCAGGTGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

CTGGAACTTTTTGAGATGGGCGATTTGCGGCGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCGGATGTGCGTTCAAGTGTGTACTTTCTGGGTAGAA

TGGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCGGATATGCGTTCAGGTGTGTACTTTCTGGGTGGAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

GAACTTTTTGAGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGGTGTGCGTTCAAGTGTGTACTTTCTGGATGAGG

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA


AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

GGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCAAATGTGCGTTCAGGTGTGTACTTTCTGGGTGGGA

TGGAACTTTTTGAGATGGGCGATTTGCGACGTCACTAATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGATGTGCGTTCAAATGTGTACTTTCTGAATAGAA

TGGAGCTTTTTGAGATAGGCGATTTGCGACGTCACTGATAACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGATGTGCGTTCAGGTGTATACTTTCTGGATGGAA

GGAACTTTTTGGGATGGGCGATTTGCGACGTCACTAATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGATGTGCGTTCAGGTGTGTACTTTCTGGATAGAA

TGGAACTTTTTGAGATGGGCGATTTGCGACGTCACTGATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCAGGTGTGCGTTCAGGTGTATACTTTCTGGATAGAA
TGGAGCTTTTTGAGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCAAGTGTGCGTTCAAATATGTACTTTCTGAGTGGAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

GGAACTTTTTGGGATGAGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCGGATGTGCGTTCAAATGTGTACTTTCTGAGTAGAA

GGATCTTTTTGAGGTGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTACTGCACTCTTTGGGGGCGGGTATGCGTTCGGGTGTATACTTTCTGAATAGAG

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

TGGAACTTTTTGGGATGGGCGATTTGCGACGTCACTGATGACATTTGTCGTTTGGTCTGTGCTGCACTCTTTGGGGGCAGATGTGCGTTCAAGTGTGTACTTTCTGGGTGAAA


AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA

AACTTTTTAAGATAAGCGATTTGCGACGTCACTAATAACATTTGTCGTTTGGTCTGTACTGCACTCTTTAGGGGCAAATATGCGTTCAAATGTATACTTTCTGAATAAAA
ATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA

ATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA

ATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA

ATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA




GACATATTTTCCTGTGCTGGATACAAAGTTGATGACGTCACCAGTA

GGACATGTTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTGGTA

ATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA

ACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA

ACATATTTTCCCGTGCTGGATACAAAGTTGATGACGTCACCAGTA

GACGTGTTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTGGTG

GGACATGTTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTAGTG

TGTTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTGGTG

TATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTA

GACGTGTTTTCTTGTGCTGGATATGGGGTTGATGACGTCACTGGTA


GACATGTTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTAGTA

ACACATTCTCCTGTGCTGGACACAAAGTTGATGACGTCACCAGTA
ACATATTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTGGTA

GACACACTTTCCCGTGCTGGATACAAAGTTGACGACGCCACTAGTA

GACATATTTTCCCGTGCCGGATACAAAGTTGATGACGTCACCAGTA

ACATATTTTCTTGTGCTGGATATGGAGTTGATGACGTCACTAGTA

ACACATTCCCCTGTGCTGGACACAAAGTTGATGACGTCACCAGTA

GACATGTTTTCTTGTGCTGGATATGGGGTTGGTGACGTCACTAGTA

GACACATTTTCCCGTGCTGGACACAAAGTTGATGACGTCACCAGTA

ACACATTTTCCCGTGCCGGATACAAAGTTGATGACGCCACCAGTA
ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT


ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATANATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT


CCGACGACATCACCACCCCAATCAATTGCAGTCAATGCTCCGCATGAAACCAGGCATGCAAAACTCAAATCAAATTTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTA

CTGACGACATCATCATTCCAATCAATTGCAGTCAACGCCCTGCACGAAACCAGGCATGTAAAACCCAAATTAAATTTGTGGCGGGAAGCTCCAAGTGACATTTCCCCGTTCCAGTA

CTGACGATACCACCATTCCAACCAATTGCAGTCAACGCTCTGCATGAAACTAGGCACGCAAAACTCAAACCAAATCCGTGGCGGGAAGTTCCAAGTGACACTTCCCCGTTCCAGTA
CGACGACATCATCATTCCAATCAATTGCAGTCAACGCTCTGCATGAAACTAGGCATGCAAAATTCAAACCAAATTTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTAG

GACGATATCATCATCCCAACCAATTGCAGTCAATGCTCTGCATGAAACTAGGCATGTAAAACTCAAATCAAATTTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTAGTA

CTGACGATATCATCATCCCAATCAATCGCAGTCAACGCTCTGCATGAAACTAGGCATGTAAAACTCAAACTAAATTTGTGGCGGGAAGTCCTAAGTGACATTTCCCCGTTCCAGTAG

GGCACGCAAAATTCAAACTAAATTTGTGGCGGGAAGCTCCAAGTGACATTTCCCCGTTCCAGTAGTATAGATTTACCAGACATATTTTCCCGTGCTGGATACAAAGTTGATGACGCC

CTGACGACATCACCATTCCAATCAATCGCAGTCAACGCTCTGCATGAAACCAGGCATGCAAAACCCAAATTAAATCTGTGGCGGGAAGTCTCAAGTGACACTTCCCCGTTCCAGTA

GCCGACGATATCATCATCCCAATCAATCGCAGTCAATGCTCCGCATGAAACTAGGCATGCAAAATTCAAATCAAATTTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTA

CCGACGACATCACCATTCCAATCAACTGCAGTCAATGCTCTGCATGAAACCAGGCACGCAAAACCCAAACCAAATCTGTGGCGGGAAGTTCCAAGTGACATTTCCCCGTTCCAGTA

CGCCGACGACACCACCACTCCAACCAATTGCAGTCAACGCTCTGCATGAAACTAGGCATGCAAAACCCAAACCAAATCTGTGGCGGGAAGTCCCAAGTGACATTTCCCCGTTCCAG


TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

TATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT
ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT

ATATCATCATTTCAATCAATTGCAGTCAATGCTCTGTATGAAACTAGGCATGTAAAATTCAAATTAAATTTGTGGCGGGAAGTTTTAAGTGACATTTCCTTGTTCCAGTAGTATAGATT




CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT


TCAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTGTAGTGGCGTCACAACACGTACAATTGATATGGTGTGTTGTTTGTCCCACTTTGCCTGTGAATCTCATCGGTGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

AAAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

AGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT




TTCTCCCAGAAGCATACCCATAGTGACGTCACAACACACACAATTGATATAATGTGCTGTTCATCCCACTCCACCCACGAATCTCATCAATGAATCC

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT
CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

TCTCTCGGAAGTGTACTTGTAGTGGCGTCGCAGCACGTACAATTGATATGGTGTGTTGTTTGTCCCACTTTACCTGTGGGTCTCATCGGTGGATCT

CTCTCGGAAGTATACTTGTAGTGACGTCACAACACATGCAATTGATATGGTGTGTTGTTTGTCCCACTTTGCCTGTGAATCTCATCGATGAATCT

TTCTCTCAGAAGTATACTTGTGGTGACGTCACAACGCATACGGTTGGTGTAATGTGTTGTTTGTCCCACTTTGCCTATGGGTCTCATCGGTGAATCT

CTCTCCCAGAAGCATACCCATAGTGACGTCACAACACACACAACCGATATAATGTGTTGTCTATCCCACTCCACCCATGAATCTCACCAATGAACCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT


CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT

CAGAAGTATACTTATAGTGACGTCACAACACATACAATTGATATAATGTGTTGTTTATCCCACTTTACCTATGAATCTCATCAATGAATCT




TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT


TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT
TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT


CGGCCGCTGCCCTTGAGTACCCCGCTGCCGAGGTTCCCGAGTCGGCTGGAAACGCCGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGN

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT

TGCTGTTCTTGAGTACCTCGCTGCTGAGGTTCTCGAGTTGGCTGGAAACGCTGCCCGT
AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA


AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCG
AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

GAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA


AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

GAGAAGCCGGGTCCCGCTCATCGGGAGCCGGACTCCGGTTCCCGGTTGGTCGTCTTCGTCGTATTCTCCGTGGAGGAAGCTACGCTCAGCGTGTTGGAGCCGGAGCCCCG

GAGAAGCCGGGTCCCGCTCATCGGGAGCCGGACTCCGGTTCCCGGTTGGTCGTCTTCGTCGTATTCTCCGTGGAGGAAGCTACGCTCAGCGTGTTGGAGCCGGAGCCCCG

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCG

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTTGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGAAACTACGCTCAACGTGTTGGAGCCGGAGCCCCA

AAGCCAAGTCCCGCTCATCAAGAGCCGGACTCCAATTCCCAGTTGGTCGTCTTCATCGTATTCTCCGTAAAGGNAANTACNCTCAACGTGTTGGAGCCGGAGCCCCA




GAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACACT

GAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACACT
AGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACACT

AGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACACT


GAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACACT

AGAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACAC

GAATTTTTAATGCTTTCCAATATTTTCTCTTACAATTGTTAATCAAAATTGGACTTCTTCATTAAAAATTCAAACAAATTGGCGCCAAATTCAAAGTTGCTCTTGAATGGCTGAACACT




ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA


ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

GGTGTGTACTTTCTGAATGGAA

GGTGTATACTTTCTGGGTGAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA
ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

GTGTGTACTTTCTGGATAGAA

GGTGTGTACTTTCTGGATAGGA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

AATGTATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

GGTGTATACTTTCTGGGTNGAA

ATACTTTCTGAATAAAA

GGGTGTGTACTTTCTGAATGGAA

ATACTTTCTGAATAAAA

GGTGTATACTTTCTGAATGGAA

GGTGTATACTTTCTGAATGGGA

ATACTTTCTGAATAAAA
ATACTTTCTGAATAAAA

GGTGTATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

AGTGTGTACTTTCTGGGTAGAA

GGTGTGTACTTTCTGGGTGGAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

TGTGTACTTTCTGGATGAGG

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA


ATACTTTCTGAATAAAA

GTGTGTACTTTCTGGGTGGGA

ATGTGTACTTTCTGAATAGAA

GGTGTATACTTTCTGGATGGAA

GTGTGTACTTTCTGGATAGAA

GTGTATACTTTCTGGATAGAA
ATATGTACTTTCTGAGTGGAA

ATACTTTCTGAATAAAA

ATGTGTACTTTCTGAGTAGAA

GTGTATACTTTCTGAATAGAG

ATACTTTCTGAATAAAA

AGTGTGTACTTTCTGGGTGAAA


ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA

ATACTTTCTGAATAAAA
TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA


TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATANATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA


CAAGTGACATTTCCCCGTTCCAGTAGTATAGACTTACCAGACATATTCTCCCGTGCTGGACATAAAGTTGATGACGTCACCAGTACCATCCGCCGGTATGCCTGTAGAACCCATCCC

CAAGTGACATTTCCCCGTTCCAGTAGTACAGATTTACCAGACACATTCTCCCGTGCTGGATACAAAGCTGATGACGTCACCAGTACCATCCGCTGGCATGTCCGTAGAACCCATCC

CAAGTGACACTTCCCCGTTCCAGTAGTATAGATCTACCAGACACATTTTCCTGTGCTGGACACAAAGTTGATGACGTCACCAGTACCATCCGCCGGTATGTCTGTAGAACCCATCCC
AAGTGACATTTCCCCGTTCCAGTAGTATAGATCCACCAGACATATTCTCCCGTGCTGGATACAAAGTTGATGACGTCACCAGTACCATCCGCCGGTATGCCTGTAGAACCCATCCCC

GTGACATTTCCCCGTTCCAGTAGTACAGACCCACCAGACATATTTTCCCGTGCCGGACATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCCATCCCTAC

AAGTGACATTTCCCCGTTCCAGTAGTATAGATCTACCAGACACATTTTCCTGTGCTGGACATAAAGTTGATGACGCCACCAGCACCATCCGCTGGTATGTCTGTAGAACCCATCCTC

TGCTGGATACAAAGTTGATGACGCCACTAGTACCATCCGCTGGCATGTCCGTAGAACCCATCCCCACAAAAAAAAACACATAGATGGACTCTCCCACACAATCAAAGTACAGTGAC

CAAGTGACACTTCCCCGTTCCAGTAGTACAGATCTACCAGACATATTCTCCCGTGCTGGACACAAAGTTGATGACGTCACCAGTACCATCCGCCGGTATGTCTGCAGAACCCATCC

CAAGTGACATTTCCCCGTTCCAGTAGTACAGATCCACCAGACACATTTTCCCGTGCTGGACACAAAGTTGATGACGTCACCAGTACCATCTGCTGGCATGTCCGTAGAACCTATCCC

CAAGTGACATTTCCCCGTTCCAGTAGTATAGATTTACCAGACACATTTTCCCGTGCTGGATACAAAGTTGATGACGTCACCAGTACCATCCGCTGGCATGTCCGTAGAACCCATCC

CCCAAGTGACATTTCCCCGTTCCAGCAGTACAGATCCACCAGACATATTCTCCCGTGCCGGATACAAAGTCGACGACGTCACCAGTACCATCCGCTGGCATGTCCGTAGAACCCAT


TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA
TTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA

ATTTCCTTGTTCCAGTAGTATAGATTTACCAGACATATTTTCTTGTGCTGGATATAAAGTTGATGACGTCACTAGTACCATCTGCTGGTATGTCTGTAGAACCTATCCTTACAAAAAAA
GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA


GGAGCCGGAGCCCCG
GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA


GGAGCCGGAGCCCCA

GTGTTGGAGCCGGAGCCCCG

GTGTTGGAGCCGGAGCCCCG

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCG

TGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA

GGAGCCGGAGCCCCA




AGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA

AGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA
AGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA

AGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA


AGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA

AAGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA

AGTTGCTCTTGAATGGCTGAACACTATGATTTTAGAGAGAGCCCTTGATATGATGTATTTTAACA
TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG


TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCNANNNNAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG


CCGGTATGCCTGTAGAACCCATCCCCACAAAAAAAAACACACAGATGGACTTTCCCACACAATCAAAGTATAGTGACGTCACAACTCAGACAATCGCCCAATTGAGCTGGACCCCG

CTGGCATGTCCGTAGAACCCATCCTCACAAAAAAAAACACACAGATGGACCCTCCCATACAATCAAAGTATAGTGACGCCACAACCCAGACAACCGCCCAATTGAGCCGGACTCCG

CCGGTATGTCTGTAGAACCCATCCCCACAAAAAAAAACACACAGATGGACCTTCTCACACAATCAAAGTACAGTGACGCCACAACCCAGACAATTGCCCAATTGAGCTGGACCCCG
CGGTATGCCTGTAGAACCCATCCCCACAAAAAAAAACACACAGATGGACTCTCTCACACAATCAAAGTACAGTGACGTCACAACTCAGACAACTGCCCAATTGAGCCGGATTCCGA

GTATGTCTGTAGAACCCATCCCTACAAAAAAAAACACATAGACGGACTTTCTCACACAATCAAAGTACAGTGACGTCACAACTCAGACAATTGCCCAATTGAGCTGGATTCCGACCA

TGGTATGTCTGTAGAACCCATCCTCACAAAAAAAAACACACAGACGGACTCTCCCACACAATCAAAGTATAGTGACGCCACAACTCAGACAATTGCCCAATTGAGCTGGACCCCGA

CCCACACAATCAAAGTACAGTGACGCCACAACTCAGACAATTGCCCAATTGAGCTGGACTCCGACCAAAACCGGCAACGTCACCAATGGCAGCCT

CCGGTATGTCTGCAGAACCCATCCCCACAAAAAAAAACACACAGACGGACTCTCCCACACAATCAAAGTATAGTGACGTCACAACCCAGACAATTGCCCAATTGAGCCGGACCCC

CTGGCATGTCCGTAGAACCTATCCCCACAAAAAAAAACACACAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACCCAGACAATTGCCCAATTGAGCTGGATTCCG

CTGGCATGTCCGTAGAACCCATCCCCACAAAAAAAAACACACAGATGGACTTTCCCATACAATCAAAGTATAGTGACGTCACAACTCAGACAATTGCCCAATTGAGCTGGACTCCG

CCGCTGGCATGTCCGTAGAACCCATCCCCACAAAAAAAAACACATAGATGGACTTTCCCACACAATCAAAGTATAGTGACGCCACAACCCAGACAATTGCCCAATTGAGCCGGATT


TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG
TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCNTAATTGAGCTGGATTCCGACTAAAATTGG

TGTAGAACCTATCCTTACAAAAAAAAACACATAGATGGACTTTCTCATACAATCAAAGTATAGTGACGTCACAACTCAGATAATTGCCTAATTGAGCTGGATTCCGACTAAAATTGG
GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT


GAGCTGGATTCCNANNNNAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT


ATCGCCCAATTGAGCTGGACCCCGACCAAAATTGGCAACGTCACCAATGGCAGCCC

AACCGCCCAATTGAGCCGGACTCCGACCAAAATTGGTAACGTCACCAATGGCAGCTT

AATTGCCCAATTGAGCTGGACCCCGACCAAAACCGGTAACGTCACCAATGGCAGCCC
CTGCCCAATTGAGCCGGATTCCGACCCAAATTGGTAACGTCACCAATGGCAGCTC

GCCCAATTGAGCTGGATTCCGACCAAAATTGGTAACGTCACCAATGGCAGCTT

TTGCCCAATTGAGCTGGACCCCGACCAAAATTGGTAACGTCACCAATGGCAGCCT




AATTGCCCAATTGAGCCGGACCCCGACCAAAACTGGCAACGTCACCAATGGCAGCCC

ATTGCCCAATTGAGCTGGATTCCGACCAAAATTGGTAACGTCACTAATGGCAGCTT

ATTGCCCAATTGAGCTGGACTCCGACCAAAACTGGCAACGTCACCAATGGCAGCCC

ACAATTGCCCAATTGAGCCGGATTCCGACCAAAACTGGCAACGTCACCAATGGCAGCCT


GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGAAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT
GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

GAGCTGGATTCCGACTAAAATTGGTAACGTCACTAATGGCAGCTT

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:2/13/2012
language:
pages:137