Erik_mammalian_mirtrons by wuzhengqin

VIEWS: 1 PAGES: 76

									Erik's mm9 Candidates
Found at: http://172.21.241.20:8888/interfaces/mm9_candidate/Mapping_candidates_main.html



             mm9 Mirtron candidate                         Coordinates              Reference
mmu-mir-3064                                      chr11:106643957-106644123 -   3.mmu-mir-3064
uc007xfs.1_intron_2_0_chr15_89015895_r            chr15:89015845-89016017 -     5.Fam116b




uc008uht.1_intron_4_0_chr4_116669635_f            chr4:116669585-116669772 +    4.Hectd3.4


uc009jvr.1_intron_6_0_chr7_134632765_f            chr7:134632715-134632951 +    4.Fbs1.6
uc008vjc.1_intron_42_0_chr4_137094201_f           chr4:137094151-137094335 +    4.Hspg2.42
uc009nuf.1_intron_11_0_chr8_125654006_f           chr8:125653956-125654122 +    5.Cpne7
uc009tof.1_intron_1_0_chrX_71519366_r             chrX:71519316-71519494 -      4.Dnase1.1
uc009mpd.1_intron_1_0_chr8_87585985_f             chr8:87585935-87586120 +      5.Fbxw9
mmu-mir-1224                                      chr16:20604475-20604659 +     2.mmu-mir-1224


uc008cgt.1_intron_1_0_chr17_35341420_r            chr17:35341370-35341552 -     4.Lta.1
mmu-mir-1981                                      chr1:186646236-186646417 -    3.mmu-mir-1981
mmu-mir-3087                                      chr2:25298249-25298404 +      3.mmu-mir-3087
mmu-mir-3097                                      chr5:35363648-35363814 +      3.mmu-mir-3097




uc007qrc.1_intron_5_0_chr13_55579042_r            chr13:55578992-55579187 -     5.Dbn1
mmu-mir-877                                       chr17:36097625-36097809 -     2.mmu-mir-877
mmu-mir-3100                                      chr7:19672127-19672291 +      2.mmu-mir-3100
mmu-mir-3094                                      chr4:40940678-40940841 +      3.mmu-mir-3094
uc007jlx.1_intron_34_0_chr11_66913306_f           chr11:66913256-66913427 +     4.Myh3.34
mmu-mir-320                                       chr14:70843267-70843448 +     1.mmu-mir-320

uc009fyn.1_intron_12_0_chr7_29153745_r            chr7:29153695-29153889 -      4.Plekhg2.12
mmu-mir-3103                                      chr7:135431833-135431999 -    3.mmu-mir-3103
uc009evl.1_intron_10_0_chr7_3607555_f             chr7:3607505-3607684 +        4.Cnot3.10

uc008ggm.1_intron_12_0_chr19_6051311_f            chr19:6051261-6051442 +       5.Syvn1

uc008ujq.1_intron_1_0_chr4_117883110_r            chr4:117883060-117883271 -    4.Ptprf.1
mmu-mir-3076                                      chr14:31385285-31385444 +     3.mmu-mir-3076
mmu-mir-1982                                      chr10:80291492-80291665 +     3.mmu-mir-1982
uc007xyb.1_intron_7_0_chr15_103180886_r   chr15:103180836-103181054 -   4.Itga5.7
uc009mga.1_intron_13_0_chr8_74993915_r    chr8:74993865-74994038 -      4.Cherp.13




uc008gdl.1_intron_7_0_chr19_5480150_f     chr19:5480100-5480283 +       4.Efemp2.7


mmu-mir-3082                              chr17:25968260-25968423 -     3.mmu-mir-3082




uc008bzw.1_intron_8_0_chr17_34023621_r    chr17:34023571-34023758 -     4.Kifc1.8


uc009pud.1_intron_8_0_chr9_56985182_f     chr9:56985132-56985325 +      4.Man2c1.8




uc007lrt.1_intron_8_0_chr11_102267565_r   chr11:102267515-102267725 -   4.Slc25a39.8


uc008fzo.1_intron_1_0_chr19_4263818_r     chr19:4263768-4263957 -       4.Ssh3.1

uc008bep.1_intron_1_0_chr17_27057877_f    chr17:27057827-27058014 +     4.Kifc1.1

uc007wig.1_intron_26_0_chr15_75895258_r   chr15:75895208-75895389 -     4.Scrib.26

uc009act.1_intron_3_0_chr5_137970738_r    chr5:137970688-137970880 -    5.Gnb2

uc008bah.1_intron_8_0_chr17_25382496_r    chr17:25382446-25382633 -     4.Baiap3.8


mmu-mir-3102                              chr7:108030770-108030973 -    3.mmu-mir-3102
mmu-mir-702                               chr5:137467253-137467461 +    1.mmu-mir-702


uc008xbn.1_intron_0_0_chr5_34241559_r     chr5:34241509-34241710 -      4.Whsc2.0


uc007lei.1_intron_14_0_chr11_97538374_f   chr11:97538324-97538511 +     4.Mllt6.14

uc008erp.1_intron_25_0_chr18_38150541_r   chr18:38150491-38150671 -     4.Centd3.25
uc008gjq.1_intron_15_0_chr19_7034708_r    chr19:7034658-7034831 -       4.Plcb3.15
uc008gik.1_intron_10_0_chr19_6374609_f    chr19:6374559-6374768 +       4.Sf1.10

mmu-mir-484                               chr16:14159669-14159835 +     1.mmu-mir-484
mmu-mir-3077                              chr14:58417211-58417374 +     3.mmu-mir-3077


uc008irh.1_intron_13_0_chr2_25160733_r    chr2:25160683-25160854 -      4.Grin1.13

uc007qqw.1_intron_9_0_chr13_55554446_f    chr13:55554396-55554582 +     4.Grk6.9


uc008cvq.1_intron_1_0_chr17_47739444_r    chr17:47739394-47739636 -     4.Bysl.1


uc008ger.1_intron_9_0_chr19_5679471_r     chr19:5679421-5679619 -       4.Pcnxl3.9

uc008gij.1_intron_22_0_chr19_6351239_f    chr19:6351189-6351364 +       4.Map4k2.22




uc007mtr.1_intron_8_0_chr11_120486125_r   chr11:120486075-120486240 -   4.Sirt7.8


uc007gbz.1_intron_2_0_chr10_79608053_f    chr10:79608003-79608221 +     4.Atp5d.2
mmu-mir-1982                              chr10:80291492-80291665 +     3.mmu-mir-1982
                                              Jaaved's Investigation
           Reads Pileup                        Structure                Conservation
Perfect                         Hairpin                          Conserved
Perfect                         Hairpin                          Not Conserved
Perfect mature strand pileup.
Inferred star strand may be
incorrect (24nt?). Exomic reads
present.                        Hairpin with tail                Neutral

Perfect star and mature read
pileup. Many loop reads.           Hairpin with very long stem   Fast Acceleration
Perfect                            Hairpin                       Acceleration
Perfect                            Hairpin                       Fast Acceleration
Pefect                             Hairpin                       Fast Acceleration
Perfect                            Hairpin                       Almost neutral
Perfect                            Hairpin                       Conserved
Perfect. I would call the mature
read as the one with 21nt vs
24nt.                              Hairpin                       Almost neutral
Perfect                            Hairpin                       Fast Acceleration
Perfect                            Hairpin                       Very Fast Acceleration
Perfect                            Hairpin                       Acceleration

Even though larger reads (23nt)
for star/mature duplex, some
still occur in AGO-IP libraries.   Hairpin with long stem        Almost neutral
Perfect                            Hairpin                       Conserved
Perfect                            Hairpin                       Acceleration
Perfect                            Hairpin                       Neutral
Perfect                            Hairpin                       Acceleration
No Star strand reads               Hairpin                       Conserved
Very low read count but duplex
reads seem to exist                Hairpin with tail             Acceleration
Perfect                            Hairpin                       Acceleration
Perfect                            Hairpin                       Fast Acceleration
Mature and star strand reads
but very low count                 Hairpin with small tail       Almost neutral

Perfect                            Hairpin with tail             Fast Acceleration
Perfect                            Hairpin                       Acceleration
Sporadic                           Hairpin                       Fast Acceleration
Nice read pileup with very low
count                              Hairpin with tail               Fast Acceleration
Perfect                            Hairpin                         Fast Acceleration


Sporadic reads with very low
counts.                            Hairpin                         Conserved

Perfect with lots of 3' MORs.
Not a crossmapping problem         Hairpin                         Neutral

                                Hairpin with tail. Alternative
                                RNAfold image shows bulge
Perfect. Few sporadic low-count near loop end to be
reads                           incorporated into the stem.        Acceleration


Perfect                            Hairpin with tail               Fast Acceleration
No Star strand reads. Lots of      Low probable hairpin-like
exomic reads esp. near splice      structure. RNAfold server
junction. Importantly, infered     reports different intron
duplex reads are too large (24nt   structure from what is shown
& 30nt).                           on our webpage.                 Acceleration
                                   Hairpin, if you only fold the
Perfect mature and star strand     portion with highest read and   1/2 of intron is conserved 1/2
read pileup.                       not the entire intron           is accelerated
Perfect with sporadic exomic
reads                              Hairpin with tail               Acceleration

Perfect                            Hairpin with tail               Acceleration

Pefect with lots of MOR reads      Low Probable hairpin            Fast Acceleration
Pefect. Very little star strand
reads though                       Hairpin                         Acceleration

Perfect. Star strand may be
inferred incorrectly from reads    Hairpin                         Conservation
Perfect                            Hairpin                         Acceleration
                                   Hairpin, if you only fold the
                                   portion with highest read and
Perfect                            not the entire intron           Acceleration
Perfect mature and star strand
read pileup, but many exomic
reads too.                         Hairpin with small tail         Fast Acceleration

Perfect                            Hairpin with small tail         Acceleration
Perfect                            Hairpin                         Acceleration
Nice mature strand pileup. Star
reads may be absent.              Low Probable hairpin           Mostly fast acceleration
Perfect. Small fraction of star
strand reads                      Hairpin                        Conserved
Perfect                           Poor hairpin                   Acceleration
Very few reads, star reads may
be not be present and thus
incorrectly called here.          Hairpin                        Almost neutral
Perfect mature and sar strand
pileup.                           Hairpin                        Fast Acceleration

                                Low probable hairpin, esp. the
Very sporadic, low-count reads. stem.                            50/50 conserved/accelerated
23nt mature strand (although
one in AGO-IP lib) and no star
strand reads                    Hairpin with tail                50/50 conserved/accelerated

Very sporadic reads.              Hairpin with tail              Fast Acceleration

Star strand (21nt) could be
infered in this case. Both are of
typical size. Low read count      Hairpin with tail              More conservation

                                  Hairpin with tail and a long
Reads are too long (i.e. 26nt).   stem                           More acceleration
Perfect                           Hairpin                        Very Fast Acceleration
           Present                           Type           Size Gene Name       Total reads Perfect reads
Yes                              Mirtron(tailed)              67                    1233.17         862.17
Yes                              Mirtron                      73 1700027J05Rik           175            67




Yes; agree w/ a tailed mirtron Mirtron Tailed candidate      88 Hectd3                   44            30


Yes                              Mirtron candidate          137   Fbs1                  137            87
Yes                              Mirtron candidate           85   Hspg2                 518          427
Yes                              Mirtron                     67   Cpne7               721.5         471.5
Yes                              Mirtron candidate           79   Dnase1l1              764          416
Yes                              Mirtron                     86   Fbxw9               729.5         135.5
Yes                              Mirtron                     85                     7860.58       2939.58


Yes                              Mirtron candidate           83 Lta                    337.5         185.5
Yes                              Mirtron                     82                      102396         75361
Yes                              Mirtron(tailed)             56                        531.5         389.5
Yes                              Mirtron(tailed)             67                        376.5         191.5




Yes                              Mirtron                     96 Dbn1                    764          163
Yes                              Mirtron                     85                    20375.46      10936.46
Yes                              Mirtron                     65                          88            57
Yes                              Mirtron(tailed)             64                         172          144
Yes                              Mirtron candidate           72 Myh3                 205.75         93.75
Yes                              Mirtron candidate           82                    1768548       1033258

Yes; agree w/ a tailed mirtron   Mirtron Tailed candidate    95 Plekhg2                44.5          25.5
Yes                              Mirtron(tailed)             67                        189           134
Yes                              Mirtron Tailed candidate    80 Cnot3                613.83        336.83
Yes, but may be a 5' tailed
mirtron.                         Mirtron                     82 Syvn1                   498            38
Yes, but may be a 3' tailed
mirtron                          Mirtron candidate          112 Ptprf                248.83        207.83
Yes                              Mirtron(tailed)             60                       780.5         389.5
Yes                              Mirtron(tailed)             74                      595.67        401.67
Yes, but may be a 3' tailed
mirtron                       Mirtron candidate           119 Itga5           61        43
Yes                           Mirtron candidate            74 Cherp       249.33    100.33

Yes. May be weakly expressed
or a nascent transcript due to
conservation.                  Mirtron candidate           84 Efemp2         31        20


Yes                           Mirtron(tailed)              64             504.89    325.89




Yes; agree w/ a tailed mirtron Mirtron Tailed candidate    88 Kifc1       534.83    162.83

Yes, but may be a 5' tailed
mirtron. Would rank higher    Mirtron candidate            94 Man2c1        669       421




No                            Mirtron candidate           111 Slc25a39     131.5     113.5

Yes, but may be a 3' tailed
mirtron                       Mirtron candidate            90 Ssh3           80        38

Yes; agree w/ a tailed mirtron Mirtron Tailed candidate    88 Kifc1       530.83    158.83

Yes; agree w/ a tailed mirtron Mirtron Tailed candidate    82 Scrib         447       275

Yes                           Mirtron                      93 Gnb2          416        95

Yes                           Mirtron candidate            88 Baiap3      1050.5     188.5


Yes                           Mirtron                     104            7887.58   3605.58
Yes                           Mirtron candidate           109              2480       730

Yes, but may be a 5' tailed
mirtron. Would rank higher    Mirtron candidate           102 Whsc2         531       172

Yes, but may be a 3' tailed
mirtron                       Mirtron candidate            88 Mllt6        143.5      60.5
Yes, but may be a 3' tailed
mirtron                       Mirtron candidate            81 Centd3       67.67     28.67
Yes                           piRNA candidate              74 Plcb3        336.5     185.5
Yes, may be a 5' tailed
mirtron.                      Mirtron candidate           110 Sf1           83        31

Yes                           Mirtron candidate            67          151470.5   96058.5
Yes                           Mirtron(tailed)              64            247.17     78.17


Yes                           Mirtron candidate            72 Grin1         28        17

Yes; agree w/ a tailed mirtron Mirtron Tailed candidate    87 Grk6        721.5     288.5

No. May be weakly expressed
or nascent transcript.      Mirtron candidate             143 Bysl          29        25

No. Not enough convincing
reads to support               Mirtron Tailed candidate    99 Pcnxl3       201       174
No. Reads indicative of intron
degradation.                   Mirtron candidate           76 Map4k2        67        58


Yes, may be a 5' tailed
mirtron.                      Mirtron candidate            66 Sirt7        159        84

No. RNAseq evidence does not
support this a miRNA         Mirtron candidate            119 Atp5d      871.11    781.11
Yes                          Mirtron(tailed)               74            595.67    401.67
Tail reads Perfect Sense Perfect intron sense Tail intron sense Mature Arm
       371         843.17                756.5               347 5p
       108             67                   65               105 3p




      14             30                   26               12 5p


      50             87                   84               50   5p
      91           424                  422                88   3p
     250          471.5                463.5              250   5p
     348           404                  396               346   5p
     594          135.5                134.5              586   5p
    4921        2819.83              2818.83             4899   5p


     152           185.5               184.5              151   5p
   27035          75331              75286.5            27030   5p
     142           382.5               381.5              141   5p
     185           190.5               189.5              185   3p




     601           158                  149               595   3p
    9439       10293.96             10276.71             9366   5p
      31             56                   54               31   3p
      28           141                  141                28   5p
     112          93.75                93.75              111   5p
  735290       1024999              1024981            735186   3p

      19           24.5                 20.5               15 3p
      55           134                  129                55 3p
     277         334.83               330.33              269 5p

     460             35                   33              446 3p

      41         206.33               203.33               37 3p
     391          382.5                378.5              390 3p
     194         379.17                 207               161 3p
  18       43       41     18 5p
 149   100.33    95.83    148 5p




  11      16        6      11 5p


 179   313.39   162.39    166 3p




 372   161.83    139.5    336 5p


 248     421      411     246 5p




  18    112.5      89       7 3p


  42      37       37      42 5p

 372   158.83    136.5    336 5p

 172     275      263     167 5p

 321      94       76     320 3p

 862    186.5    186.5    862 3p


4282    3588     3577    4269 3p
1750     728      711    1642 5p


 359     171      166     357 5p


  83      60       37      76 5p

  39    28.67    28.67     36 5p
 151    184.5    183.5    150 5p
   52       30       21       49 3p

55412   95113.5   95053    55277 5p
  169     74.17      64      163 3p


   11       14       12       11 3p

  433     288.5    279.5     433 3p


    4       24       12        1 5p


   27      174      171       27 3p

    9       57       53        8 3p




   75       84       69       73 5p


   90    781.05   492.05      51 5p
  194    379.17     207      161
           Mature read     Mature count               Star read
TCTGGCTGTTGTGGTGTGCAA               336 TGCCACACTGCAACACCTTACA
TCAGCTGCCTCTTGCCATCACAG              32 GTGGGAGAAGAGGCTGCTGTG




GTGAGTGGGCTCTGGGCATGAC              13 CAGATACATACTCTGGGTCCTCAG


GTGAGTGCTGGGTAGAATGGGA              21   TCTACTCTACCTTCTACTCAGA
TCACCCTGCTGCCGGCTTGCAGT            253   GTGAGCAGACAGGGAGTGGTGGGG
GTAGGAGCTGGAGGTGGGTTTGG            123   AGGCTCACCCCTCCGTTCCCT
GTAGGGGTGATAGATTCCATGGC            249   AGTGGCTTCTGTCGTCTCTAG
GTGAGGGGAGCTGAGGCAGGAG              44   CCAGGCTCTCCTTCCCTCCAG
GTGAGGACTGGGGAGGTGGAG             1337   CCCCACCTCTTCTCTCCTCAG


GTGAGGCAGCAAGAGATTGGGGGT            27   TCTCCACTCTCTTCTGTCCCA
GTAAAGGCTGGGCTTAGACGTGG          26521   CATCTAACCCTGGCCTTTGACA
CAGGGCAGGGCAAGAGTTGAGA              50   TAACTCACTGTCATGTCCTCA
CTCAGACCTTTCTACCTGTCAG              37   CACAGGTGGGAAGTGTGTGTCCA




TAACTCTTCCCTTGTGCCCTCAG             84   GTGAGAGCGGGGGGAGTGGCAAG
GTAGAGGAGATGGCGCAGGGGACA          3898   TGTCCTCTTCTCCCTCCTCCCA
CTGTGACACACCCGCTCCCAGT              17   TTGGGAACGGGGTGTCTTTGGG
TGTTGGGGACATTTTTAAAGC               25   CCTTTAAATTGTGTCCTCAAGT
GTGAGGGCAGGAGGATTGGGGTGT            20   ACACTCCCTCCTCCTCCCCAGA
AAAAGCTGGGTTGAGAGGGCGA          531081   GCCTTCTCTTCCCGGTTCTTCC

TGACTCCCATGTCCCCACAGA               11 TCATGGGGCCATGGGGATCTAG
TAACCTCTGATCCTTCCCACAG              21 AGGAGGGAGGATCTGCTGTTAG
TGGGGAACAGGGCAAGGTGGAC              51 TTACACTTGTCCTTCTTTCCCCAG

TGACCTCTGTATCTCCTGCCAG               8 GGGGTGGAGAGCTGAGGCCCA

TGACACAGCCATTCTCTGAGCAGT            81 AAGGCCAGGGAAGTTGATTGTGTGAAGG
CGCACTCTGGTCTTCCCTTGCAG             84 ACAGGGGAAGCTCAGTGCCAGC
TCTCACCCTATGTTCTCCCACAG             73 TTGGGAGGGTCCTGGGGAGGGGA
GGTGGGATGGATGGCAGAACCTGG      11 TTGCCTCTTGCCTCCATCCCACA
GTGAGGCTCAGTATGGGGTGG         10 TCACCCTGGACTGACTCTCAG




GGTGCTTGGGTGGGCAGGAGTTG        2 ACTCCACCTCCCTTGGCACAG


CACATGGCACTCAACTCTGCAG        42 GACAGAGTGTGTGTGTCTGTGT




CAGGGAGGGATAAAGACCAGT        23.5 CTCATCTTTATCTCTCCCCAGA


CACGGGGACTTGGCTGAGGCAG        90 TGAGAGCCTTATCCCCGCAGT




AGGGCTGACCTTTGTGTTTCAGAA      39 GTGAGTACCAGATCAAGGCGAGCTGCCTGA


TACTGAGGGGTGGCTGCTATGT         8 ACTCACAGCCACCTCCTCACA

CAGGGAGGGATAAAGACCAGT        23.5 CTCATCTTTATCTCTCCCCAGA

ATGGTGGGCGGTGAAACAGAGA        86 TCTCTGACTCTGCCTCCCACAG

ACTGCAACCTCCTTTCTCCAG         19 CAGGGGAAGGGAAGAGATGCACT

TGAGCACCACCCCTCTCTCAG         86 GTGGGAAGAGGGGTGGGGCCCGGGA


GAGCACCCCATTGGCTACCCACA      885 GGTGGTGCAGGCAGGAGAGCC
GTGAGTGGGGTGGTTGGCATG        200 TGCCCACCCTTTACCCCGCTCCAG


TTGGGGGATGGGTTGCTTGGC         39 CCAGCAGTCCCTGCTCCCTACAG


GTGAGGGGATCCAGCCCAGGCT        11 CCTGAGCTGGCTCCCCTGCAG

GTGGGGGGGGAGGCTAGGTTAG        12 TGACTTGCCTTCCACCCCAG
GTGAGTGGGGATGGGTGACTGGGAGC    43 TCTTACATCCCTCCTCCTCCCC
ACCCTGGTCTTACTGCCTGCAG         15 GTAATGCTGCTTACTCTCTTGGGATCT

TCAGGCTCAGTCCCCTCCCGAT       66203 ACCTAGGGGGCTGGCGGCG
CTGACTCCCTGCTTCTCCGCAGA         15 GCGGACGGGTGGGCGGGCA


TAAGCTCCAGGGTCCCGCGCA           4 GAGTGCTGGGCTGTGGGGT

CTGCTTCCATACCCCTACCCAG         69 TGGGGTGAGGTTGGAAGCTA


GTAGAGCAGAAGCAGGGGAGAAAGG


TTCACTTCCTACTCCTGGACAGT       118

CACCACCTCCTCCTCCCTGCAGT        19 AGAGCTGACTGTATGGGGCT




CGGCGCGCGCGGTCGCTCACCC         13


TGAGCAGTGGATGGGAAACTAAGGCA    168
                                0
Star count Perfect 5'+3' intron sense   Perfect 5' intron sense  Perfect 3' intron sense
         9                        595.5                    591.5                         4
        10                          54                        19                       35




         2                          26                        24                        2


         5                          76                       71                         5
        14                        374                        16                       358
        19                       355.5                    350.5                         5
        27                        388                      349                         39
         8                       125.5                    115.5                        10
         1                     2818.83                  2817.83                         1


        3                          168                      164                         4
      717                        73997                    73703                       294
       19                         333.5                    308.5                       25
       28                         167.5                    129.5                       38




        3                           96                        10                       86
      172                      9942.67                     9757                    185.67
       11                           52                        32                       20
       13                         109                         86                       23
        8                        90.75                     73.25                     17.5
        8                            2                         0                        2

         3                          15                         4                       11
        20                          58                        58                        0
        13                          25                         1                       24

         2                          14                         2                       12

         4                      180.33                         0                   180.33
        38                       214.5                       190                     24.5
         6                          87                         3                       84
  4         3        0      3
  8      71.5     63.5      8




  1        2        0       2


 28     56.58    55.58      1




8.5     43.67       6    37.67


 18       45        0      45




  1       88        1      87


  5        3        0       3

8.5     40.67       3    37.67

  7       11        0      11

  6       25        1      24

  4     139.5      5.5    134


347   1024.83   180.83    844
173      298         0    298


 14       15        0      15


  6       22       21       1

  3        4        0       4
  8      154      154       0
 1     17     2    15

14     35    15    20
 4     45    16    29


 2      6     2     4

29     86     5    81




 0   76%    17%   8%

 2   66%    17%   8%




 0   67%    45%   88%


 0    16%   78%   31%
 0   126%   54%   29%
Perfect other intron sense  5'+3' <=24 nt intron sense 5' <=24 nt intron sense 3' <=24 nt intron sense
                        161                       590.5                   587.5                       3
                         11                          52                      17                      35




                         0                         25                       23                       2


                        8                          60                      55                        5
                       48                        374                       16                      358
                      108                       303.5                   302.5                        1
                        8                        384                     345                        39
                        9                       125.5                   115.5                       10
                        0                     2812.83                 2811.83                        1


                     16.5                         168                     164                        4
                   1289.5                       73970                   73676                      294
                      48                         333.5                   308.5                      25
                      22                         159.5                   121.5                      38




                        53                         93                        7                      86
                    334.05                    9256.67                    9071                   185.67
                         2                         52                       32                      20
                        32                       107                        84                      23
                         3                      89.75                    72.25                    17.5
                  1024979                           1                        0                       1

                      5.5                          11                        0                      11
                       71                          58                       58                       0
                   305.33                          25                        1                      24

                        19                         12                        0                      12

                       23                      112.33                        0                  112.33
                      164                       206.5                      184                    22.5
                      120                          86                        3                      83
     38        3        0      3
  24.33     48.5     40.5      8




     4        2        0       2


 105.81    56.58    55.58      1




  95.83    36.67       0    36.67


   366       45        0      45




     1       81        0      81


    34        3        0       3

  95.83    36.67       0    36.67

   252       10        0      10

    51       24        0      24

    47     135.5      1.5    134


2552.17   990.83   179.83    811
   413      294         0    294


   151       15        0      15


    15       21       20       1

  24.67       4        0       4
   29.5      66       66       0
    4    15     0    15

95018    30    13    17
   19    43    14    29


    6     6     2     4

193.5    82     1    81




 17%    150     0   150

 31%     30     4    26




 30%     17    17     0


 52%    414   414     0
 62%     87     3    84
5'+3' 25-31 nt intron sense       5' 25-31 nt intron sense       3' 25-31 nt intron sense     other intron sense
                              5                              4                              1                 161
                              2                              2                              0                  11




                              1                              1                              0                  0


                         16                             16                                  0                  8
                          0                              0                                  0                 48
                         52                             48                                  4                108
                          4                              4                                  0                  8
                          0                              0                                  0                  9
                          6                              6                                  0                  0


                          0                              0                                  0               16.5
                         27                             27                                  0             1289.5
                          0                              0                                  0                48
                          8                              8                                  0                22




                          3                              3                                  0                  53
                        686                            686                                  0              334.05
                          0                              0                                  0                   2
                          2                              2                                  0                  32
                          1                              1                                  0                   3
                          1                              0                                  1            1024979

                              4                              4                              0                5.5
                              0                              0                              0                 71
                              0                              0                              0             305.33

                              2                              2                              0                 19

                         68                                  0                         68                     23
                          8                                  6                          2                    164
                          1                                  0                          1                    120
 0    0    0        38
23   23    0     24.33




 0    0    0        4


 0    0    0    105.81




 7    6    1     95.83


 0    0    0      366




 7    1    6        1


 0    0    0       34

 4    3    1     95.83

 1    0    1      252

 1    1    0       51

 4    4    0       47


34    1   33   2552.17
 4    0    4      413


 0    0    0      151


 1    1    0       15

 0    0    0     24.67
88   88    0      29.5
   2      2    0       4

   5      2    3   95018
   2      2    0      19


   0      0    0       6

   4      4    0   193.5




  21    150    0     150

  23     29    3      26




  52     17   17       0


78.05    12   12       0
 120     86    3      83
5'+3' intron sense % 5' intron sense % 3' intron sense % other trim intron sense % Tail Exon sense
               78.72%            78.19%             0.53%                    21.28%           86.67
               83.08%            29.23%            53.85%                    16.92%               2




           100.00%            92.31%              7.69%                      0.00%               4


            90.48%            84.52%              5.95%                     9.52%                3
            88.63%             3.79%             84.83%                    11.37%                2
            76.70%            75.62%              1.08%                    23.30%                8
            97.98%            88.13%              9.85%                     2.02%                8
            93.31%            85.87%              7.43%                     6.69%                1
           100.00%            99.96%              0.04%                     0.00%                1


            91.06%            88.89%              2.17%                     8.94%                 1
            98.29%            97.90%              0.39%                     1.71%              44.5
            87.42%            80.87%              6.55%                    12.58%                 1
            88.39%            68.34%             20.05%                    11.61%                 1




            64.43%             6.71%             57.72%                    35.57%                9
            96.75%            94.94%              1.81%                     3.25%            17.25
            96.30%            59.26%             37.04%                     3.70%                2
            77.30%            60.99%             16.31%                    22.70%                0
            96.80%            78.13%             18.67%                     3.20%                0
             0.00%             0.00%              0.00%                   100.00%               18

            73.17%            19.51%             53.66%                    26.83%                 4
            44.96%            44.96%              0.00%                    55.04%                 5
             7.57%             0.30%              7.27%                    92.43%               4.5

            42.42%              6.06%            36.36%                    57.58%                2

            88.69%             0.00%             88.69%                    11.31%                3
            56.67%            50.20%              6.47%                    43.33%                4
            42.03%             1.45%             40.58%                    57.97%           172.17
 7.32%    0.00%    7.32%   92.68%       2
74.61%   66.26%    8.35%   25.39%     4.5




33.33%    0.00%   33.33%   66.67%     10


34.84%   34.23%    0.62%   65.16%    151




31.30%    4.30%   27.00%   68.70%   22.33


10.95%    0.00%   10.95%   89.05%     10




98.88%    1.12%   97.75%    1.12%    23.5


 8.11%    0.00%    8.11%   91.89%      0

29.79%    2.20%   27.59%   70.21%   22.33

 4.18%    0.00%    4.18%   95.82%     12

32.89%    1.32%   31.58%   67.11%     18

74.80%    2.95%   71.85%   25.20%      0


28.65%    5.06%   23.60%   71.35%     11
41.91%    0.00%   41.91%   58.09%     17


 9.04%    0.00%    9.04%   90.96%      5


59.46%   56.76%    2.70%   40.54%     23

13.95%    0.00%   13.95%   86.05%      0
83.92%   83.92%    0.00%   16.08%      1
80.95%    9.52%   71.43%   19.05%       9

 0.04%    0.02%    0.02%   99.96%     60.5
70.31%   25.00%   45.31%   29.69%    10.17


50.00%   16.67%   33.33%   50.00%       2

30.77%    1.79%   28.98%   69.23%       9




    0        0        0       21    87.72%

    1        1        0       23    56.60%




    0        0        0       52    24.64%


  402      402        0     78.05   84.14%
    1        0        1      120    42.03%
Antisense DGCR8(-) DCR(-) PIWICLADE TESTES BRAIN EMBRYO OVARY 5' exon len. 3' exon len.
       19        0      0          0     0      0      0    0
         0       0      0          0     0      0      0    0          103          110




       0        0      0          0      0     0        0      0        116         114


        0       0      0          0      0     0        0      0         84         208
        3       0      0          0      0     0        0      0        101         181
        0       0      0          0      0     0        0      0         52         134
       12       0      0          0      0     0        0      0        249         113
        0       0      0          0      0     0        0      0        140         129
   119.75       0      0          0      0     0        0      0


       0        0      0          0      0     0        0      0        100         105
      30        0      0          0      0     0        0      0
       7        0      0          0      0     0        0      0
       1        0      0          0      0     0        0      0




        5       0      0          0      0     0        0      0        130          60
    642.5       0      0          0      0     0        0      0
        1       0      0          0      0     0        0      0
        3       0      0          0      0     0        0      0
        0       0      0          0      0     0        0      0        204         126
    8259        0      0          0      0     0        0      0

       1        0      0          0      0     0        0      0         47          67
       0        0      0          0      0     0        0      0
       2        0      0          0      0     0        0      0        382         124

       3        0      0          0      0     0        0      0        156         187

      1.5       0      0          0      0     0        0      0        136         155
        7       0      0          0      0     0        0      0
     22.5       0      0          0      0     0        0      0
   0    0   0   0   0   0   0   0    81    80
   0    0   0   0   0   0   0   0   152   138




   4    0   0   0   0   0   0   0   120   127


 12.5   0   0   0   0   0   0   0




   1    0   0   0   0   0   0   0   100   138


   0    0   0   0   0   0   0   0    93   117




   1    0   0   0   0   0   0   0    45    60


   1    0   0   0   0   0   0   0   271   201

   0    0   0   0   0   0   0   0   135   489

   0    0   0   0   0   0   0   0   131   167

   1    0   0   0   0   0   0   0    67   163

   2    0   0   0   0   0   0   0    69   192


17.58   0   0   0   0   0   0   0
    2   0   0   0   0   0   0   0


   1    0   0   0   0   0   0   0   730   100


  0.5   0   0   0   0   0   0   0   198    89

   0    0   0   0   0   0   0   0   185   121
   1    0   0   0   0   0   0   0    85    97
    1         0     0        0      0    0   0   0    60   180

  945         0     0        0      0    0   0   0
    4         0     0        0      0    0   0   0


    3         0     0        0      0    0   0   0   175   122

    0         0     0        0      0    0   0   0    38    90




 0.00%   87.72% 12.28%       3      0    0   0   0     0     0

 7.55%   49.06% 43.40%       4      1    0   0   0     0     0




24.64%    0.00% 75.36%      15      0    0   0   0     0     0


84.14%    0.00% 15.86%     289    0.07   0   0   0     0     0
 1.45%   40.58% 57.97%   172.17   22.5   0   0   0     0     0
My Rank
      1
      2




      3


      4
      5
      6
      7
      8
      9


     10
     11
     12
     13




     14
     15
     16
     17
     18
     19

     20
     21
     22

     23

     24
     25
     26
27
28




29


30




31


32




33


34

35

36

37

38


39
40


41


42

43
44
45

46
47


48

49




 0   0

 0   0




 0   0


 0   0
 0   0
111

 59




138


 89
172

104




 91


385
50

51




52


53
54
Erik's hg19 candidates
Found at: http://172.21.241.20:8888/interfaces/hg19_candidate/Mapping_candidates_main.html



            hg19 Mirtron candidate                       Coordinates              Reference
hsa-mir-1224                                    chr3:183959143-183959327 +    1.hsa-mir-1224
uc001nzb.2_intron_2_0_chr11_64022289_f          chr11:64022239-64022419 +     2.PLCB3.2
hsa-mir-877                                     chr6:30552059-30552244 +      1.hsa-mir-877
uc001agl.1_intron_14_0_chr1_1563780_f           chr1:1563730-1563918 +        2.MIB2.14
hsa-mir-1228                                    chr12:57588237-57588409 +     3.hsa-mir-1228

uc003bjb.2_intron_4_0_chr22_50356514_f          chr22:50356464-50356637 +     2.PIM3.4
uc002qtg.1_intron_15_0_chr19_59061652_f         chr19:59061602-59061793 +     2.TRIM28.15
uc002ozx.3_intron_4_0_chr19_45397139_f          chr19:45397089-45397267 +     2.TOMM40.4
hsa-mir-1237                                    chr11:64136024-64136225 +     1.hsa-mir-1237
hsa-mir-1234                                    chr8:145625426-145625609 -    3.hsa-mir-1234


uc010vpb.1_intron_44_0_chr16_88804849_r         chr16:88804799-88805025 -     2.FAM38A.44
uc010ybf.1_intron_1_0_chr19_50357801_f          chr19:50357751-50357958 +     2.PTOV1.1




uc003zbt.3_intron_4_0_chr8_145534936_f          chr8:145534886-145535056 +    2.HSF1.4


uc010vnv.1_intron_2_0_chr16_84163777_r          chr16:84163727-84163991 -     2.HSDL1.2
uc003oeo.1_intron_7_0_chr6_33406069_f           chr6:33406019-33406245 +      2.Syngap1.7
uc001ato.1_intron_4_0_chr1_12089199_f           chr1:12089149-12089329 +      2.MIIP.4
uc002dww.2_intron_3_0_chr16_30198267_f          chr16:30198217-30198409 +     2.CORO1A.3
uc001ciz.2_intron_2_0_chr1_43830319_r           chr1:43830269-43830458 -      2.ELOVL1.2

uc002cos.1_intron_28_0_chr16_2156679_r          chr16:2156629-2156855 -       2.PKD1.28
uc003oaj.3_intron_2_0_chr6_32147541_f           chr6:32147491-32147703 +      2.RNF5.2


uc010cgn.1_intron_2_0_chr16_72132945_f          chr16:72132895-72133152 +     2.DHX38.2
uc001obg.2_intron_5_0_chr11_64559559_r          chr11:64559509-64559693 -     2.MAP4K2.5


uc010lhk.1_intron_1_0_chr7_100465611_f          chr7:100465561-100465779 +    2.TRIP6.1
uc011dnk.1_intron_1_0_chr6_31323001_r           chr6:31322951-31323143 -      2.hla-b.1

uc003ejl.2_intron_1_0_chr3_127294109_r          chr3:127294059-127294295 -    2.TPRA1.1
hsa-mir-1227                                    chr19:2234011-2234198 -       3.hsa-mir-1227
uc003zxt.2_intron_24_0_chr9_35710681_r   chr9:35710631-35710843 -     2.TLN1.24
hsa-mir-1226                             chr3:47890995-47891169 +     3.hsa-mir-1226
hsa-mir-1229                             chr5:179225228-179225396 -   3.hsa-mir-1229


uc003dap.2_intron_6_0_chr3_50403595_r    chr3:50403545-50403747 -     2.CACNA2D2.6
hsa-mir-1236                             chr6:31924566-31924767 -     1.hsa-mir-1236
hsa-mir-1231                             chr1:201777689-201777880 +   1.hsa-mir-1231
hsa-mir-1225                             chr16:2140146-2140335 -      1.hsa-mir-1225
hsa-mir-1238                             chr19:10662748-10662930 +    3.hsa-mir-1238
hsa-mir-1233-1                           chr15:34674220-34674401 -    1.hsa-mir-1233
                                                                 Jaaved's Investigation
           Reads Pileup                                    Structure

Perfect                              Hairpin

Perfect                              Hairpin

Perfect, but low star to mature
ratio                                Hairpin
Sporadic                             Hairpin
Perfect                              Hairpin


Inferred star/mature strands
overlap. Might not be any star
reads                                Intron folds into nice hairpin
Perfect                              Hairpin with long tail

                                     Structure reported is not highly probable, so I
                                     doubt it may be correct. Proper overhang and
Perfect with exonic reads as well.   mature read aligns nicely to 3' end.
Perfect with exonic reads as well.
Reads do not occur on boundary of    Non-hairpin structure. RNAfold reports low
splice site.                         quality structure.
Perfect                              Hairpin with long tail
Perfect                              Hairpin
Perfect                              Hairpin with tail
Perfect                              Hairpin
Perfect, with equal mature and
star strand products                 Hairpin with a tail
Perfect                              Hairpin with a tail
Perfect mature strand pileup, but
star strand (24nt) may be called
incorrectly.                         Hairpin
Perfect                              Poor hairpin
Perfect mature strand pileup.
Sparse star strand reads albeit
reasonable size.                     Hairpin with tail
Perfect                              Hairpin
Perfect mature strand reads.
Sparse star strand reads.            Hairpin with long tail
Star strand ambiguous. Nice
mature strand pileup. Many
exomic reads.                   Hairpin




No star reads and very sparse
mature strand reads.            Hairpin with a short tail
d's Investigation
                     Conservation                   Present                           Type
                                                                           Mirtron
      Almost neutral                Yes                                    Mirtron candidate
                                                                           Mirtron
      Acceleration                  Yes                                    Mirtron Tailed candidate
                                                                           Mirtron

      Almost neutral                Yes                                    Mirtron candidate
      Acceleration                  Yes                                    Mirtron candidate
      50/50 conserved/accelerated                                          Mirtron candidate
                                                                           Mirtron
                                                                           Mirtron


      Very fast acceleration        Yes                                    Mirtron candidate
      Very fast acceleration        Yes                                    Mirtron candidate




      Fast acceleration             Yes                                    Mirtron candidate

                                    Yes, but may be intronic canonical
      Conserved                     miRNA.                                 Mirtron candidate
      Almost neutral                Yes, but may be a 5' tailed mirtron    Mirtron candidate
      Fast acceleration             Yes                                    Mirtron candidate
      Fast acceleration             Yes                                    Mirtron Tailed candidate
      Almost neutral                Yes                                    Mirtron Tailed candidate

      Fast acceleration             Yes, but may be a 5' tailed mirtron    Mirtron candidate
      Almost neutral                Yes                                    Mirtron candidate

                                    Yes, but may be intronic canonical
      50/50 conserved/accelerated   miRNA or 5' tailed mirtron             Mirtron candidate
      Fast acceleration             Yes                                    Mirtron candidate


      Very fast acceleration        Yest, but may be a 5' tailed mirtron   Mirtron candidate
      Neutral                       Yes                                    Mirtron candidate

      Fast acceleration             Yest, but may be a 5' tailed mirtron   Mirtron candidate
                                                                           Mirtron
                              Yes, but may be intronic canonical
Acceleration                  miRNA                                Mirtron candidate
                                                                   Mirtron
                                                                   Mirtron
                              No. May be a poorly expressed nascent
                              transcript, but will need Ago-IP to
50/50 conserved/accelerated   decide                                Mirtron candidate
                                                                    Mirtron
                                                                    Mirtron
                                                                    Mirtron
                                                                    Mirtron
                                                                    Mirtron
Size Gene Name Total reads Perfect reads Tail reads Perfect Sense Perfect intron sense
  85                851.12        431.12        420         430.12               430.12
  81 PLCB3               34            29         5             29                   22
  86             18728.48        9487.48       9241       9486.48               9461.48
  89 MIB2             16.33         14.33         2             14                   13
  73                   556           476         80            476                  440

 74 PIM3                  75           49        26             46                   35
 92 TRIM28             389.5        263.5       126          260.5                 160
 79 TOMM40             36.58        19.58        17          19.25                   18
102                     145            37       108             35                   18
 84                   385.09       330.09        55          12.98                 9.98


127 FAM38A              135            86        49             86                   84
108 PTOV1             310.83       215.83        95         212.83               154.83




 71 HSF1                25.5         16.5         9           15.5                  10


165   HSDL1           125.33       113.33        12         112.33               101.33
127   SYNGAP1             57           47        10             45                   41
 81   MIIP             150.5         90.5        60             88                   77
 93   CORO1A           334.5        225.5       109          225.5                 197
 90   ELOVL1           450.5        302.5       148          302.5                287.5

127 PKD1              780.84       157.84       623         157.55               153.44
113 RNF5               184.7        124.7        60          121.7                120.7


158 DHX38              73.33        40.33        33          40.33                29.33
 85 MAP4K2              163            94        69             94                   83


119 TRIP6             388.33       279.33       109         272.33               267.33
 93 hla-b             245.33       129.33       116         120.33                 96.5

137 TPRA1               426           320       106            316                 315
 88                     239            29       210             27                   9
113 TLN1       820.17   631.17    189   631.17   596.83
 75             2019      710    1309     709      702
 69            330.58   138.58    192   126.58    105.5


103 CACNA2D2    10.25    10.25      0     9.25     9.25
102              156      100      56       98       90
 92                 4        3      1        2        2
 90                14       10      4        9        5
 83              12.5     11.5      1     10.5        2
 82             41.62     7.62     34     7.12     1.62
Tail intron sense     Mature Arm              Mature read     Mature count
               419   5p            GTGAGGACTCGGGAGGTGGAG               119
                 5   5p            GTGAGTGATGAGCCTGGGAGTGA                6
              9218   5p            GTAGAGGAGATGGCGCAGGGGACA           4573
                 2   5p            TGCGGACGCGGCCCAGTCCTGC                 5
                76   5p            GTGGGCGGGGGCAGGTGTGTG               158

               23    5p            GTGCGTGGTGGCTCGAGGCGGG               10
              116    5p            GTGAGCCAGTGGAATGGAGAGG               37
               14    5p            TGAGTGGGGCACGGAGGCTGCT                5
               98    3p            TCCTTCTGCTCCGTCCCCCAG                 8
               43    3p            TCGGCCTGACCACCCACCCCAC                2


               49 3p               TGGAGACAGCGGGACACATGGC               16
               94 5p               TGCGGGGACAGGCCAGGGCAT                41




                7 3p               AACTGTGTCCTCTCTCTCCACA                4


                9    3p            ACAAAGACGTTGGCATCTTGGT               18
                9    5p            TGAGGACAGGGCAAATTCACGA               16
               57    5p            TGGGCGAGGGCGGCTGAGCGGC               21
              105    3p            TGACACTGTGGGGAACGTGCA                98
              146    5p            TGAGGGGAGAATGAGGTGGAGA               90

              620 3p               CCTCACCACCCCTTCTGCCTGC               28
               60 3p               GTGTGGAAGATGGGAGGAGAA                21


               33 3p               TCTGGGGCCGCTGGGGACAGG                 7
               66 3p               AGCATCCCTGCTGCCCCCTAGA               56


              104 5p               TGAGGGACCCAGGACAGGAGA                74
              110 5p               GTAAGGAGGGGGATGAGGGGT                24

              106 3p               TGGGGAGGTGTGGAGTCAGCAT               75
              206 3p               CGTGCCACCCTTTTCCCCAG                  3
 184 3p   CCCTGGGGTTCTGAGGACATG         302
1301 5p   CAGCTGGGATGGTCCAAAAGGGTGGCC   263
 172 3p   CTCTCACCACTGCCCTCCCACAG        15


   0 5p   GTGAGGATCAGGAAGAGAGTG           6
  55 5p   GTGAGTGACAGGGGAAATGG           28
   1 5p   TGTCTGGGCGGACAGCTGCAGGAAA       1
   3                                      0
   0                                      0
  30
             Star read     Star count Perfect 5'+3' intron sense   Perfect 5' intron sense
CCCCACCTCCTCTCTCCTCAG               2                         430                       428
ACCCTTCGCTGTCACCTACTCAG             1                          19                        18
TCCTCTTCTCCCTCCTCCCAG              51                       9284.5                   9232.5
CCTGGGCTGAGCCCGTCCCCA               1                          12                        12
TCACACCTGCCTCGCCCCCCA              83                         322                       322

CTGACCTCTCCGCTCCGCACAGA             1                          33                       29
CACTGCATTCCTGCTTGGCCCAG             2                         143                      141
CCGCCCTCACACCCCCTCCTCT              2                          11                       11
CGGGGGCGGGGCCGAAGCGCG               2                           9                        0
GTGGGGTGGCTGGGGGGGGGG               1                           1                        0


TGACTGTGGAGACAGCGGGACA              2                           0                        0
CGCCCCTCCTGCCCCCACAGA               4                          10                        3




GGGCCAGAGGGCCGGCGGGGGCC             2                           1                        1


TAGTTGCGGACTTCAGCAGCGGT             2                           0                        0
TTGGATTTTCCTGGGCCTCAG               1                           1                        0
TCATCCCCCTCGCCCTCTCAGA              2                           2                        0
TCGTGGCCTGCAGTGGATGAGG              8                          40                        0
CCCTTCCCTCACTCTTCTCTC               4                           2                        0

CTGCAGGCAGAAGTGGGGCTGA             10                        21.5                        0
TTTCTCTCTCCACTTCCTCAG               4                         10                         0


AGGATGAGCAGGGGCTGCCCTTCT            1                           0                        0
TCAGAGCTCTGGGGGGAG                  1                          78                        0


ATTCTTCCTGCCCTGGCTCCAT              2                           0                        0
ATCTTCCCCTCCTTTCCCA                 1                          88                       88

CCCGCGCTGACCCGCCTTCT                1                           1                        0
GTGGGCACTGCTGGGGTGGGCA              1                           4                        0
GAACTCGGAGGAGAGAGGG            2     1      1
TCACCAGCCCTGTGTTCCCTAG       183   337    147
GTGGGTAGGGTTTGGGGGAGAGCGTG     6    40     20


                               0   9.25   9.25
                               0     69     69
                               0      0      0
                               0      4      3
                               0      1      0
Perfect 3' intron sense       Perfect other intron sense   5'+3' <=24 nt intron sense 5' <=24 nt intron sense
                      2                               0.12                         430                     428
                      1                                  3                          17                      16
                     52                             176.98                      9139.5                  9087.5
                      0                                  1                          12                      12
                      0                               118                          314                     314

                          4                            2                          30                       27
                          2                           17                         142                      140
                          0                            7                          10                       10
                          9                            9                           9                        0
                          1                         8.98                           1                        0


                          0                           84                           0                        0
                          7                       144.83                           7                        0




                          0                            9                           1                        1


                      0                           101.33                           0                        0
                      1                               40                           1                        0
                      2                               75                           2                        0
                     40                             157                           40                        0
                      2                            285.5                           2                        0

                    21.5                          131.94                        21.5                        0
                     10                            110.7                         10                         0


                      0                            29.33                           0                        0
                     78                                5                          78                        0


                          0                       267.33                           0                        0
                          0                          8.5                          87                       87

                          1                          314                           1                        0
                          4                            5                           4                        0
  0   595.83     0      0
190     365    269     79
 20     65.5    31     11


  0       0    9.25   9.25
  0      21      63     63
  0       2       0      0
  1       1       3      2
  1       1       1      0
3' <=24 nt intron sense 5'+3' 25-31 nt intron sense 5' 25-31 nt intron sense 3' 25-31 nt intron sense
                       2                           0                        0                         0
                       1                           2                        2                         0
                      52                         145                      145                         0
                       0                           0                        0                         0
                       0                           8                        8                         0

                     3                            3                         2                        1
                     2                            1                         1                        0
                     0                            1                         1                        0
                     9                            0                         0                        0
                     1                            0                         0                        0


                     0                            0                         0                        0
                     7                            3                         3                        0




                     0                            0                         0                        0


                     0                            0                         0                        0
                     1                            0                         0                        0
                     2                            0                         0                        0
                    40                            0                         0                        0
                     2                            0                         0                        0

                  21.5                            0                         0                        0
                   10                             0                         0                        0


                     0                            0                         0                        0
                    78                            0                         0                        0


                     0                            0                         0                        0
                     0                            1                         1                        0

                     1                            0                         0                        0
                     4                            0                         0                        0
  0    1    1   0
190   68   68   0
 20    9    9   0


  0    0    0   0
  0    6    6   0
  0    0    0   0
  1    1    1   0
  1    0    0   0
other intron sense 5'+3' intron sense % 5' intron sense % 3' intron sense %
               0.12               99.97%            99.51%             0.46%
                  3               86.36%            81.82%             4.55%
             176.98               98.13%            97.58%             0.55%
                  1               92.31%            92.31%             0.00%
                118               73.18%            73.18%             0.00%

                 2              94.29%             82.86%            11.43%
                17              89.38%             88.12%             1.25%
                 7              61.11%             61.11%             0.00%
                 9              50.00%              0.00%            50.00%
              8.98              10.02%              0.00%            10.02%


               84                0.00%              0.00%             0.00%
           144.83                6.46%              1.94%             4.52%




                9               10.00%             10.00%             0.00%


           101.33                0.00%              0.00%             0.00%
               40                2.44%              0.00%             2.44%
               75                2.60%              0.00%             2.60%
             157                20.30%              0.00%            20.30%
            285.5                0.70%              0.00%             0.70%

           131.94               14.01%              0.00%            14.01%
            110.7                8.29%              0.00%             8.29%


            29.33                0.00%              0.00%             0.00%
                5               93.98%              0.00%            93.98%


           267.33                0.00%              0.00%             0.00%
              8.5               91.19%             91.19%             0.00%

              314                0.32%              0.00%             0.32%
                5               44.44%              0.00%            44.44%
595.83     0.17%     0.17%    0.00%
  365     48.01%    20.94%   27.07%
  65.5    37.91%    18.96%   18.96%


    0    100.00%   100.00%    0.00%
   21     76.67%    76.67%    0.00%
    2      0.00%     0.00%    0.00%
    1     80.00%    60.00%   20.00%
    1     50.00%     0.00%   50.00%
other trim intron sense % Tail Exon sense Antisense DGCR8(-) DCR(-) PIWICLADE TESTES BRAIN
                     0.03%               0         1       0      0          0     0      0
                    13.64%               7         0       0      0          0     0      0
                     1.87%              25         1       0      0          0     0      0
                     7.69%               1      0.33       0      0          0     0      0
                    26.82%              36         0       0      0          0     0      0

                 5.71%              11         3         0      0          0       0     0
                10.62%           100.5         3         0      0          0       0     0
                38.89%            1.25      0.33         0      0          0       0     0
                50.00%              17         2         0      0          0       0     0
                89.98%               3    317.11         0      0          0       0     0


               100.00%               2         0         0      0          0       0     0
                93.54%              58         3         0      0          0       0     0




                90.00%             5.5         1         0      0          0       0     0


               100.00%             11           1        0      0          0       0     0
                97.56%               4          2        0      0          0       0     0
                97.40%             11         2.5        0      0          0       0     0
                79.70%            28.5          0        0      0          0       0     0
                99.30%             15           0        0      0          0       0     0

                85.99%            4.11       0.29        0      0          0       0     0
                91.71%               1          3        0      0          0       0     0


               100.00%              11         0         0      0          0       0     0
                 6.02%              11         0         0      0          0       0     0


               100.00%               5         7         0      0          0       0     0
                 8.81%           23.83         9         0      0          0       0     0

                99.68%               1         4         0      0          0       0     0
                55.56%              18         2         0      0          0       0     0
 99.83%   34.33    0   0   0   0   0   0
 51.99%       7    1   0   0   0   0   0
 62.09%   21.08   12   0   0   0   0   0


  0.00%       0    1   0   0   0   0   0
 23.33%       8    2   0   0   0   0   0
100.00%       0    1   0   0   0   0   0
 20.00%       4    1   0   0   0   0   0
 50.00%     8.5    1   0   0   0   0   0
EMBRYO OVARY 5' exon len. 3' exon len. My Rank
      0    0                                 1
      0    0           69          141       2
      0    0                                 3
      0    0          127          234       4
      0    0                                 5

      0      0         177       1132        6
      0      0         138        339        7
      0      0         102        106        8
      0      0                               9
      0      0                              10


      0      0         214        169       11
      0      0         138         83       12




      0      0          76         62       13


      0      0         186         95       14
      0      0         624        145       15
      0      0         109         59       16
      0      0         130        185       17
      0      0         106         57       18

      0      0         280        144       19
      0      0         113         55       20


      0      0         119         77       21
      0      0         129        104       22


      0      0          78        126       23
      0      0         117        276       24

      0      0          81        103       25
      0      0                              26
0   0   123   90   27
0   0              28
0   0              29


0   0   153   72   30
0   0              31
0   0              32
0   0              33
0   0              34
Jaaved's mm9 candidates (i.e. candidates in addition to Erik's)
Only looked at first 4 pages (sorted decendingly by total read count) at: http://172.21.241.20:8888/interfaces/mammalian_


mm9 intron 50-100                                Coordinates                      Reference   Type Size


uc007hng.1_intron_4_0_chr10_127949024_r          chr10:127948974-127949163 -                           90




uc009frm.1_intron_3_0_chr7_25882086_r            chr7:25882036-25882210 -                              75


uc008ggm.1_intron_9_0_chr19_6050442_f            chr19:6050392-6050571 +                               80


uc009tno.1_intron_12_0_chrX_71268873_r           chrX:71268823-71268998 -                              76

uc009jqx.1_intron_4_0_chr7_133511485_r           chr7:133511435-133511609 -                            75




uc007kip.1_intron_22_0_chr11_78039600_r          chr11:78039550-78039731 -                             82


uc009kob.1_intron_1_0_chr7_149762236_r           chr7:149762186-149762363 -                            78

uc008ddp.1_intron_2_0_chr17_57143477_r           chr17:57143427-57143594 -                             68

uc008deg.1_intron_18_0_chr17_57356595_r          chr17:57356545-57356738 -                             94


uc008cds.1_intron_13_0_chr17_34982046_r          chr17:34981996-34982162 -                             67

uc008vwq.1_intron_11_0_chr4_149029610_r          chr4:149029560-149029739 -                            80

uc008vws.1_intron_11_0_chr4_149029613_r          chr4:149029563-149029739 -                            77


uc007jup.1_intron_6_0_chr11_70210437_r           chr11:70210387-70210566 -                             80




uc008mja.1_intron_5_0_chr2_130264421_f           chr2:130264371-130264568 +                            98
uc007cth.1_intron_11_0_chr1_137351180_r   chr1:137351130-137351317 -   88


uc009frc.1_intron_0_0_chr7_25755029_r     chr7:25754979-25755155 -     77


uc007wir.1_intron_18_0_chr15_76019611_r   chr15:76019561-76019736 -    76


uc009mns.1_intron_9_0_chr8_87391818_f     chr8:87391768-87391957 +     90
ion to Erik's)
88/interfaces/mammalian_Introns/html/mm9_50-100/Mapping_candidates_main.html


          Gene Name    Total reads Perfect Reads                        Reads Pileup


          Mbc2             1941.29        1376.29          Nice mature and star strand reads

                                                           Enrichment of mature strand reads but
                                                           deficient of star strand reads. May infer
          Pou2f2              1521           1042          the star strand read differently.

                                                           Many mature reads but star strand is
          Syvn1             940.83         618.83          difficult to call.


          Irak1                876            353      523 Perfect mature and star read pileup
                                                           Perfect mature read pileup. Star strand
          Lat               665.67         496.67          difficult to determine


                                                           Mature and star strand reads are a bit
          Supt6h             660.5          473.5          larger (23+ nt) but nice pileup
                                                           Many exomic reads, but mature and
                                                           star strand reads of the appropriate
          H19               392.83         257.83          size exists.

          Gtf2f1               367             89          Perfect sized mature and star reads
                                                           Mature and star strand reads. Mature
          C3                314.67         184.67          reads occur in AGO-IP lib

                                                           Potential mature and star strand reads
          Skiv2l             289.7          193.7          although not of the same size

          Pik3cd             235.5           86.5          Perfect sized mature and star reads
                                                           Very low read count cut nice
          Pik3cd             235.5           86.5          mature/star strand pileup

                                                           Mostly mature strand reads. Star
          Pelp1              218.5          152.5          species may be absent.




          Vps16                195            152          Perfect sized mature and star reads
Nav1     170.25   121.25   Perfect sized mature and star reads

                           Mature and star strand reads, however
Pra1       162       94    mature reads are long (24+ nt).

                           Few reads but nice mature and star
Plec1      156      101    strand pileup


Farsla     154      104    Nice mature and star strand reads
                Structure                              Conservation

Hairpin if you only fold the region with
reads only and not the entire intron     50/50 conservation and acceleration


Hairpin if you only fold the region with
reads only and not the entire intron     fast acceleration

Hairpin if you only fold the region with
reads only and not the entire intron     More accelerated sites
Perfect hairpin if you only fold the
region spanning the mature/star strand
reads                                    50/50 conservation and acceleration

Nice hairpin with small tail              Very fast acceleration

                                          Large gap in alignment, thus
High probable hairpin with proper         conservation cannot be determine.
overhang                                  May be existing multiz bug.


High probable hairpin                     Very fast acceleration

Hairpin                                   Very fast acceleration

Hairpin with tail                         50/50 conservation and acceleration


Hairpin                                 Acceleration
Hairpin, but with low probability base-
pairing                                 fast acceleration

Hairpin with tail                         Very fast acceleration
Hairpin if you only fold the mature
strand region until the splice acceptor
site.                                     Very fast acceleration

Hairpin if you only fold the mature       Large gap in alignment, thus
strand region until the splice acceptor   conservation cannot be determine.
site.                                     May be existing multiz bug.
Hairpin if you only fold the mature
strand region until the splice acceptor
site.                                     Very fast acceleration


Hairpin with tail                         fast acceleration
Hairpin if you only fold the mature
strand region until the splice acceptor
site.                                     Very fast acceleration
Hairpin if you only fold the mature
strand region until the splice acceptor
site.                                     Very fast acceleration
            Candidate Type


3' tailed mirtron




5' tailed mirtron


3' tailed mirtron


3' tailed mirtron

3' tailed mirtron




mirtron


mirtron

mirtron

3' tailed mirtron


mirtron

3' tailed mirtron

3' tailed mirtron


3' tailed mirtron




5' tailed mirtron
3' tailed mirtron


3' tailed mirtron


3' tailed mirtron


5' tailed mirtron
Jaaved's hg19 candidates (i.e. candidates in addition to Erik's)
Only looked at first 4 pages (sorted decendingly by total read count) at: http://172.21.241.20:8888/interfaces/mammalian_I




hg19 intron 50-100                                        Coordinates


uc011fwx.1_intron_12_0_chr6_dbb_hap3_1845750_f            chr6_dbb_hap3:1845700-1845885 +


uc002mvu.2_intron_4_0_chr19_13051267_f                    chr19:13051217-13051404 +


uc002fwx.1_intron_16_0_chr17_3853891_r                    chr17:3853841-3854036 -


uc002qjv.2_intron_19_0_chr19_55756554_r                   chr19:55756504-55756682 -

uc002jnz.3_intron_28_0_chr17_73494620_f                   chr17:73494570-73494759 +

uc003odf.2_intron_1_0_chr6_33169434_f                     chr6:33169384-33169571 +




uc010xlk.1_intron_8_0_chr19_11224126_f                    chr19:11224076-11224260 +

uc004dsg.2_intron_14_0_chrX_53432605_r                    chrX:53432555-53432752 -
addition to Erik's)
41.20:8888/interfaces/mammalian_Introns/html/hg19_50-100/Mapping_candidates_main.html


                                    Gene Total           Perfect
           Reference      Type Size Name reads           Reads


                                  86 ABCF1    18728.48 9487.48


                                  88 CALR        740.5      499.5

                                     ATP2A
                                  96 3            234         131


                                  79 SAPS1        217         162
                                     KIAA01
                                  90 95           203         146
                                     SLC39A
                                  88 7            182         132




                                  85 LDLR         161          91

                                  98 SMC1A        146          43
ng_candidates_main.html



                          Reads Pileup                                Structure
           Many mature strand reads, but little or no
           star strand species. Inferred mature reads
           are also large (24nt).                     Hairpin with long stem
                                                      Hairpin if you only fold the region spanned
           Perfect mature and star strand reads of    by mature and star reads only and not the
           the right size                             entire intron

           Many mature strand reads. No star strand   Hairpin if you only fold the mature strand
           species.                                   region until the splice acceptor site.
           Many mature strand reads. Few star         Hairpin if you only fold the region spanned
           strand reads. Both species are on the      by mature and star reads only and not the
           larger side (23nt).                        entire intron

           Perfect mature and star strand read pileup Hairpin with tail
           Nice mature and star strand reads of 22nt
           size                                       Hairpin with overhang on both sides

                                                     Hairpin but with overhangs on both sides.
           Nice mature and star strand reads of 21nt This is after subselecting portions of the
           size                                      intron spanned by mature/star reads
           Low read count but mature and star
           strand have reads.                        Hairpin with small tail
        Conservation in mammals                 Candidate Type



Conserved                         mirtron


Appears neutral                   5' tailed mirtron


Fast acceleration                 3' tailed mirtron


Very fast acceleration            3' tailed mirtron

Very fast acceleration            5' tailed mirtron

Conserved                         Intronic canonical miRNA




Very fast acceleration            5' tailed mirtron

Very fast acceleration            3' tailed mirtron

								
To top