Docstoc

Semester One Exam Review

Document Sample
Semester One Exam Review Powered By Docstoc
					First Semester Exam Review Topics – Life Characteristics


                                    NOT ALIVE!




      ALIVE!


                              Biology is all about being Alive!
                                  Know what that means!
                           O – H – M – R – G&D – E&A
First Semester Exam Review Topics – Pyramids
                              All about Energy!
                               Who has the energy?
                               Where from? How?
                            How much flows “upwards”
                               between the levels?
                            Can you Name the Levels?




                                What is wrong with this
                                      Diagram?
          First Semester Exam Review Topics – Food Webs




       What are these Illustrations Called?

Know the energy levels, -vores, -trophs, niche, etc…

       What is the Spider? Fox?! Rabbit?                What would happen if the area was
                                                       sprayed the area and the Herbivorous
  Why is the Toad the most fragile animal here?              Insects were wiped out?
       First Semester Exam Review Topics - Symbiosis


 One Consumes
   the other!          
                  Both Benefit!
        




                                                
                                           One Benefits
      
                                             without
One Benefits at                            affecting the
the expense of                                other!
  the other!
First Semester Exam Review Topics – Limiting Factors




Limiting Factors and Seasons that support/control the Producers.
           What do the Producers require to Thrive?!
First Semester Exam Review Topics – Population Growth

                      



       Balance




                               


                       Small populations are in
                         danger because: (?)
       First Semester Exam Review Topics – Human Population
               Remember! Growth Rate (GR) = Birth Rate (BR) – Death Rate (DR)


Age Structure
   Graph
  Shows the
  pattern of
 growth of a
 population.
  How many
  offspring =
 How fast the
Population will
     grow!



                      Developing          Slow Growing      Developed Country
                     Country = Fast         Developed         = Stable Zero
                     Growing Pop.            Country.            Growth.
       First Semester Exam Review Topics – Carbon Cycle




  ?!

Photosynthesis collects CO2 vs. Cellular Respiration releases CO2 in rough
                 Balance to maintain atmospheric levels.
    First Semester Exam Review Topics – Global Warming

Rapid and Recent Increase in
 the average temperature of
 the Earth following the
 beginning of the Industrial
 Revolution.
Linked to the release of CO2
 into the atmosphere which
 absorbs radiation and traps
 heat.
Excess CO2 results from
 Combustion of fossil fuels.

All related to the Greenhouse
 Effect.
      First Semester Exam Review Topics – Nitrogen Cycle

Why is Nitrogen
 essential to all living
 things?
What form does that
 Nitrogen need to be
 in to become
 available to the Food
 Web?
What important plants
 are especially
 important in the
 Nitrogen Cycle and
 what do they have?
       First Semester Exam Review Topics – Bioaccumulation



Pollution affects                                  Who is affected?
  organisms                                        Where is the
  when it become                                    Toxic
  concentrated                                      Chemical
  enough to                                         Stored?
  damage them.                                     How did the
                                                    environment
Producers collect
                                                    become
  a little of the                                   exposed?
  toxic chemicals,
                                                   Why did the
  but the higher
                                                    Producers not
  organisms in                                      die?
  the Food Web
  end up with
  toxic levels.
         First Semester Exam Review Topics – Dead Zones
 Ecosystems SHOULD be in rough Balance! If there is an over-abundance
   of Nutrient Run-off from farmlands, the algae “Bloom” and this leads
   to loss of Oxygen – Dead Zones!




Nutrients cause too much
 Algal Growth, leaving
 too much dead algae!
Decomposers then
 Overgrow and use the
 Oxygen!!                              Red Tide does Something
                                              Else! Toxic!
  First Semester Exam Review Topics – Organic Compounds

       Living Things are mostly composed of Organic Compounds.


Organic mean Based
 on CARBON!!
Carbon is the BFF                                 Typically, other
 that holds all of the                              elements involved
 various atoms                                      in Organic
 together.                                          Molecules include
Bonds in three                                      H,N, and O =
 dimensions and can                                 96+% of all living
 form highly                                        matter!
 complex, large
 molecules.
   First Semester Exam Review Topics – Organic Compounds

           There are four (4) basic types of Organic Compounds.

      CARBOHYDRATES are                         LIPIDS are Fats and
      Sugars and are universal                  are good for energy
          energy sources!                             storage!
         Photosynthesis!!
                                                      Triglyceride with
        Monosaccharides such as                       three Fatty Acids.
          Glucose = Blood Sugar!                                             P
        Benedict’s Test turns Orange
                                                       Phospholipid
                                                         found in
                                                       Membranes.
Polysaccharides that store glucose
  and thus energy.
Starch stores energy in Plants – Iodine   Lipids are Non-Polar and do not
  test = Black.
                                            dissolve in Water = Insoluble.
Cellulose in Cell Walls of Plants.
                                          Brown Paper Bag Test!!
Glycogen stores energy in Animals.
First Semester Exam Review Topics – Enzyme
     First Semester Exam Review Topics – Plasma Membrane


                                                             ?
                                                        Receptor for

 ?                                                      Information
                                                        and Control
                                                         of the Cell

Phospholipid
  Bilayer
  Barrier.



                        ?       Selective Permeability and
                                       Homeostasis!
               First Semester Exam Review Topics - Prokaryotes




 How do
   you
 KNOW
that it is a
  “Pro”
 karyote?
          First Semester Exam Review Topics - Eukaryotes




Must Know! Nucleus, Plasma Membrane,     Also Must Know! Cell Wall, Vacuole,
 Mitochondrion, Food Vacuole, Ribosome     Chloroplast and what THEY do!
 and what they do!
  First Semester Exam Review Topics – Cell Organization
                         Cell
        Cell



           Organize into

 Cell      Cell       Cell      Cell
           TISSUES
   Cell        Cell     Cell




           Organize into
                         Epithelial
          Blood
                            Muscular
               ORGANS
               Nervous
                      Connective

                                       ORGANISM
                                       ORGAN SYSTEM
               Organize into

ORGAN ORGAN ORGAN
    ORGAN SYSTEM
              First Semester Exam Review Topics - Osmosis
         Movement of Water to maintain Equilibrium. Uncontrolled.




       Low               Higher
 concentration       concentration
of solutes = lots   of solutes = less
    of water!            water!
      0%               i.e., 10%
    First Semester Exam Review Topics – Membrane Transport



                                                      Active
  Passive                                            Transport
Transport                                             always
  always                                               forces
flows High                                              from
     ↓                                                   Low
   Low                                                    ↓
                                                        High
“with” the
   conc.                                              Need ATP
 gradient.                                             to move
                                                      “against”
                                      ATP!
                                                      the conc.
                                                      gradient.
First Semester Exam Review Topics - Photosynthesis
            Plants Require CO2 and H2O!!! They then use
              those Reactants to produce Glucose!!




    Stomata Control Everything since they determine
    TRANSPIRATION and delivery of the Reactants!!
      First Semester Exam Review Topics – Cellular Respiration




 Fermentation                 If O2 present =
   in cytoplasm                  Aerobic!




If O2 NOT present
   = Anaerobic!

    2 ATP




                                                    36-38 ATP!
             First Semester Exam Review Topics – ATP

    Adenosine Triphosphate. THE Basic Energy Carrying
     Molecule of Cells. Can pass energy on to other molecules to
     drive Metabolism via the third Phosphate Group. Cycles back
     and forth with ADP.
                                      NH2

                                                          ATP!

                               Adenine
                                       N
P        P        P


                                            Respiration   ADP    Metabolism




    Universal Energy Source means that Enzymes and various
     Chemical Reactions can become specialized to use THIS
     molecule. Little Variation = Same Shapes!
         First Semester Exam Review Topics – Fermentation
      Fermentation is Anaerobic!! Useful Process for many different
        Foods. All are sealed during their Production!
                                                                 Lactic Acid
                                                               Fermentation
                                                                leaves a sour
                                                                 taste as the
  Alcoholic                                                     pH changes –
Fermentation                                                    Goes Down!!
  produces
   CO2 =
  Bubbly!!
                         Psst!!
                         CO2!

                                                          Fluffy with
                                                          CO2 holes!!


    Remember! What happens to Muscle as a result of Lactic Acid Fermentation?
       First Semester Exam Review Topics – DNA Structure


DeoxyriboNucleic                              Bases represent
        Acid                                  the information
   THE Genetic                               and always form
 Material carries                            Complementary
Information of the                              Base Pairs.
     Organism.                                   A  T
   If DNA Strand G C
                                                 GT A
Stable as a Double T A T T C G C A C G T A A C G  C
   Other Strand isC G
 Helix protecting A T A A G C G T G C A T T G C A T
                                             Complementary
 the information                                Base Pairs!
  on the Inside.
 Building Blocks
 are Nucleotides.


 This Illustration shows the copying of DNA. What is this process called
  and what is the final product? Why is it “Semi-Conservative”?
                First Semester Exam Review Topics – RNA

How is RNA different
  from DNA:
Structurally?
Bases?
Function?
Location?


What is this Process
 called?


  What is the Original
   Sequence Called?

      If DNA Strand G   C T A T T C G C A C G T A A C G T A
      RNA Strand is   C G A U A A G C G U G C A U U G C A U
First Semester Exam Review Topics – Protein Synthesis




    DNA  Transcription  RNA  Translation  Protein
         First Semester Exam Review Topics - Translation

GGAATGCCAGCGAAAAATGCCCATTAA
CCTTACGGTCGCTTTTTACGGGTAATT


GGAAUGCCAGCGAAAAAUGCCCAUUAA




   Met Pro Ala    Lys Asn   Ala His STOP


 NOW – Have an
Amino Acid Chain.
                                           mRNA Genetic Code
What has to happen
to get a functional
     Protein?
           First Semester Exam Review Topics - Mutation

                                                                     CAG
                                                                       ↓
                                                                    Q = Glu

                                                                      CAA
                                                                        ↓
                                                                     Q = Glu
                                                                   Same = Silent


                                                                        AAG
                                                                          ↓
                                                                       K = Lys
                                                                      Problem!


                                                                       TAG
                                                                         ↓
                                                                      STOP
                                                                     Disaster!

                                                                   Delete AG
                                                                       ↓
                                                                   Only 2?!
                            Usually caused during Replication      Disaster!
                          (=Error) OR as a result of exposure to
                            damaging Mutagens (=radiation,
Usually caused during
                             chemicals, etc…). Random and
 Meiosis! Random!
                                        Constant.
   First Semester Exam Review Topics – Cell Cycle
   The Production of new cells should be tightly controlled!

                                        Daughter Cells are only made
                                         when there is space during
                                           Growth and Healing.
                                       Cells have to “shut-down” DNA
                                              as Chromosomes!


                                       Most Cells Do Not Divide as they are
                                       specialized to function. G0 cells are
                                       “working” and typically cannot do
                                                      Mitosis.
                                          DNA is Chromatin and in Use!

In Mitosis, all of the Daughter Cells are Genetically Identical (barring
Mutation), but since they “Express” different genes in different ways,
 they can “Differentiate” into very different cellis: e.g., Muscle and
Nerve Cells that are very active (lots of Mitochondria!), or Connective
                           Tissue Cells, etc…
      First Semester Exam Review Topics – Cancer
The Cell Cycle is controlled by Genes just like everything else! If
  those genes are mutated, then the Cell Cycle will be affected.

                                       Those Daughter Cells SHOULD stop
                                      growing when they contact each other
                                      (Contact Inhibition!) and then shift to
                                              G0 and get to Work!.




                                      IF the Cell Cycle is disrupted (e.g., by
                                        mutated Oncogenes), this process
                                          cannot stop when it SHOULD!

 Cancer is caused by Mutation. Major causes include UV Radiation
(Ozone is Important!!), Smoking (Don’t do it!), Viruses (new vaccines
       can prevent!), and Replication Errors (No Fix There).
First Semester Exam Review Topics – Cell Division/Mitosis


                                           Controlled growth.




                                          UNControlled growth.
First Semester Exam Review Topics – Cell Division/Mitosis

                                              Asexual

                                              Identical

                                                Clone

                                          Daughter Cells

                                           Growth/Dev.


                                     Do not need to know the four
                                     Phases, but need to be able to
                                    recognize the parts and put the
                                           phases in order.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:2/10/2012
language:
pages:34