PowerPoint Presentation - Foundations of Biology

Document Sample
PowerPoint Presentation - Foundations of Biology Powered By Docstoc
					Gen i genom
             GENOM i GEN
 Genom   je ukupna DNK jedne haploidne
  ćelije.
 Funkcionalna jedinica genoma je gen.
 Početni koncept: jedan gen- jedan enzim.
  Multimerni proteini?
 Zatim: jedan gen-jedan polipeptid.
  Nisu svi geni protein-kodirajući
 Geni kodiraju i za polipeptide i za RNK
 Danas: Gen je segment DNK koji se
  transkribuje u RNK i zasebno je regulisan
    DENATURACIJA I RENATURACIJA
   Istraživanje organizacije DNK u genomu bazira se na
    razdvajanju i ponovnom spajanju komplementarnih lanaca
    DNK
   Denaturacija DNK, ili topljenje DNK, podrazumeva
    razdvajanje lanaca dvolančane zavojnice na dva jednolančana
    polinukleotidna lanca kao posledica raskidanja vodoničnih veza
    između komplementarnih baza. Pod određenim uslovima
    moguće je ponovno uspostavljenje vodoničnih veza između
    komplementarnih baza što rezultuje u renaturaciji DNK.
                           Denatured DNA
                        ATGAGCTGTACGATCGTG


ATGAGCTGTACGATCGTG                             ATGAGCTGTACGATCGTG
TACTCGACATGCTAGCAC                             TACTCGACATGCTAGCAC

Double stranded DNA                              Double stranded DNA
                        TACTCGACATGCTAGCAC
                        Single stranded DNA
           Temperatura topljenja DNK
   Testovi za praćenje denaturacije DNK baziraju se na merenju
    parametara koji su vezani za postojanje uređene, sekundarne
    strukture
   Optički test zasniva se na praćenju apsorpcije svetlosti na 260 nm
    prilikom uređivanja nukleotida u jednolančane i dvolančane polimere
   Uređena dvolančana DNK ispoljava hipohromni efekat, odnosno
    apsorbuje manje svetlosti na 260 nm u poređenju sa jednolančanom,
    a ona još manje od slobodnih nukleotida
   U toku denaturacije dolazi do hiperhromnog efekta, odnosno do
    porasta apsorpcije svetlosti na 260 nm.
   Krive koje pokazuju zavisnost A260 od temperature nazivaju se krive
    topljenja, a tačka topljenja se na njima može odrediti kao temperatura
    na kojoj je porast A260 jednak polovini maksimalnog porasta.
       Temperatura topljenja DNK
•   Tt zavisi od karakteristika celog sistema:
•   Unutrašnja svojstva DNK
1. GC sastav
2. Raspored nukleotida u lancu
3. Dužina lanca
•   Karakteristike rastvora u kome se nalazi DNK
1. Jonska jačina
2. pH rastvora
3. Rastvarač
4. Temperatura
               Kriva topljenja DNK
    1.0                                                   Jednolanč
                                                          ana DNK



                Relativno                           Relativno
                nizak                                   visok
                sadržaj GC                         sadržaj GC
                                                       parova
A260            parova
                              Tm = 75 oC    Tm = 85 oC


 Dvolanča
 na DNK


      0
          65      70         75      80    85      90    95
                        Temperatura (oC)
                      Hibridizacija

   Jednolančane DNK iz različitih izvora mogu da se spare
    preko komplementarnih baza i da formiraju dvolančanu
    zavojnicu (izvor jednolančane DNK irelevantan, jedino je
    važna njena sekvenca)
   Fenomen uspostavljanja vodoničnih veza između
    komplementarnih baza dve jednolančane DNK iz istih ili
    različitih vrsta, usled čega nastaje dvolančani heliks naziva se
    hibridizacija i može se koristi se za pravljenje hibridne
    DNK čiji lanci potiču iz različitih izvora
   Za regione DNK iz različitih izvora koji mogu da hibridizuju
    kaže se da su homologi.
                 Hibridizacija

Primer:
 Detekcija neke specifične nukleotidne sekvence u
  ispitivanom uzorku.
 Ukoliko se denaturisana (jednolančana) DNK iz nekog
  izvora imobiliše na čvrstoj podlozi, homologa DNK iz
  drugog izvora će hibridizovati sa njom i biće zadržana na
  podlozi od strane imobilizovane DNK. Nehomologa DNK
  neće hibridizovati i neće se zadržati na podlozi.
 Osnova velikog broja različitih metoda koje se koriste u
  molekularnoj biologiji (Southern blot, Northern blot,
  genski čipovi itd).
            Hibridizacija
              DNK iz izvora “X”

CTGATGGTCATGAGCTGTCCGATCGATCAT
           TACTCGACAGGCTAG



           Hibridizacija

TACTCGACAGGCTAG
  DNK iz izvora “Y”
Hibridizacija NK
http://highered.mcgraw-
  hill.com/sites/0072556781/student_view0/chapter1
  4/animation_quiz_4.html
     Određivanje kompleksnosti
        genoma eukariota
   Veličina genoma izražava se preko C-vrednosti- ukupna
    dužina DNK genoma izražena u baznim parovima
   Veličina genoma nije u korelaciji sa kompleksnošću
    organizama (paradoks C vrednosti)
   Kompleksnost organizama obrnuto proporcionalna
    gustini gena
   Istraživanje organizacije DNK u genomu bazira se na
    razdvajanju i ponovnom spajanju komplementarnih
    lanaca DNK
   Eukariotski genomi su veći od prostog zbira gena koji
    kodiraju proteine
   Ispitivanje organizacije DNK u genomu? Indirektna
    procena: DNK hibridizacija
      Genomi eukariotskih ćelija
       imaju složenu strukturu
 Hromozomska DNK isečena je
  endonukleazama na fragmente dužine 1000 bp
  koji su denaturisani, a zatim je omogućena
  renaturacija
 Merena je brzina renaturacije, tj. hibridizacije
  jednolančanih fragmenata
 Brzina renaturacije je utoliko veća, ukoliko je
  veća brzina kojom svaki fragment pronalazi svoj
  komplementarni par.
         Ponovljene sekvence DNK
             renaturišu brže
Zamislimo da a, b, ... z predstavlja niz baznih parova u DNK koji mogu
da hibridizuju. Radi pojednostavljenja, svako slovo predstavlja niz od 10
baznih parova (bp).

DNK 1 = ab. 2 slova ili 20 bp.
DNK 2 = cdefghijklmnopqrstuv. (20 slova ili 200 bp).
DNK 3 =
izyajczkblqfreighttrainrunninsofastelizabethcottonqwftzxvbifyoudontbe
lieveimleavingyoujustcountthedaysimgonerxcvwpowentdowntothecros
sroadstriedtocatchariderobertjohnsonpzvmwcomeonhomeintomykitc
hentrad.
(200 slova ili 2000 bp).
 Ponovljene sekvence DNK
     renaturišu brže
      DNK 1             DNK 2                                  DNK 3


   ab ab ab ab ab
   ab ab ab ab ab    cdefghijklmnopqrstuv

   ab ab ab ab ab    cdefghijklmnopqrstuv
   ab ab ab ab ab
                     cdefghijklmnopqrstuv
    ab ab ab ab ab
                     cdefghijklmnopqrstuv
   ab ab ab ab ab
    ab ab ab ab ab
   ab ab ab ab ab

         etc.
                                            izyajczkblqfreighttrainrunninsofastelizabethcottonqwf
                                            tzxvbifyoudontbelieveimleavingyoujustcountthedaysi
                                            mgonerxcvwpowentdowntothecrossroadstriedtocatch
                                            ariderobertjohnsonpzvmwcomeonhomeintomykitche
                                            ntrad
  Molarna koncentracija svake sekvence:
     150 microM         15 microM                                1.5 microM
Za jednaku masu/zapremini:
Relativna stopa seasocijacije
         100         10                                               1
           Kinetika renaturacije je
               reakcija 2. reda
                nucleation                     zippering
       +
                2.                             1.
                red,                           red,
                sporo                          brzo

Denaturisana DNK        Kratak dupleks
(dva jednolančana       formira se u regionu          Renaturisana DNK
fragmenta)              komplementarnosti             (dva lanca u
                                                      dupleksu)
         Britten-ov eksperiment
   60-tih godina prošlog veka
   Uočili su da ćelije miša sadrže više kopija veoma sličnih
    DNK sekvenci, praćenjem stope renaturacije DNK
    fragmenata.
   DNK iz prokariota i isečena endonukleazama na manje
    fragmente, denaturisana a zatim su obezbeđeni uslovi za
    renaturaciju.
   Što se brže snižava temperatura, ima manje vremena da
    se komplementarni fragmenti nađu- hibridizovaće i regioni
    koji imaju lokalnu komplementarnost.
   Jednolančana DNK razdvojena je od dvolančane uz
    pomoć hidroksi apatita koji vezuje dvolančanu DNK, dok
    jednolančana prolazi.
            Britten-ov eksperiment
   1962. godine radili su reakcije reasocijacije sa eukariotskom DNK. U
    poređenju sa E.coli, ćelije miša sadrže oko 100x više DNK. Bili su iznenađeni
    činjenicom da neke eukariotske DNK reasociraju brže od DNK E.coli.
   Pratili su zavisnost frakcije reasicirane DNK od proizvoda početne
    koncentracije DNK (Co) i vremena (t) i uporedili stopu reasocijacije
    organizama sa različitom veličinom genoma.
   Kod E.coli kriva je izmeštena u desno
    u odnosu na PolyU: PolyA kontrolne
    fragmente. Za reakciju reasocijacije
    je potrebno više vremena s obzirom
    da je DNK E.coli kompleksnija.




   Kriva reasocijacije satelitske DNK
    miša ima isti profil kao i E.coli, ali je
    pomerena u levo, odnosno satelitska
    DNK miša reasocira brže od DNK
    E.coli. Satelitska DNK miša sadrži
    brojne ponovljene sekvence. Ove
    sekvence su toliko slične da brzo
    reasociraju; nema unikalnih sekvenci
    kojima treba dosta vremena da nađu
    svoj komplementarni par.
             Britten-ov eksperiment
Prvi deo krive predstavlja
visokorepetitivnu DNK koja
najbrže reasocira. Ona može
da čini i do 25% genoma.
Drugi deo krive predstavlja
umereno ponovljene
sekvence koje čine oko 30%
eukariotskog genoma.
Treći deo krive predstavlja
nerepetitivnu DNK, tj.
unikalne sekvence koje
mogu biti zastupljene sa oko
45%                            Kriva reasocijacije eukariotskog genoma
             Britten-ov eksperiment


Ove različite frakcije DNK
testirane su kako bi se ustanovilo
koja kodira za proteine,
korišćenjem radioaktivno
obeležene iRNK u eksperimentu
reasocijacije. Nakon zagrevanja do
temperature blizu temperaturi
ključanja (denaturacija) a potom
hlađenja za oko 25°C, iRNK
hibridizovala je sa
komplementarnim DNK
fragmentom.
    Britten-ov eksperiment
iRNK nije hibridizovala sa
visokorepetitivnom frakcijom DNK.
   Britten-ov eksperiment
Veoma mali procenat radioaktivno obeležene iRNK je
hibridizovao sa umereno ponovljenim sekvencama
        Britten-ov eksperiment
Najveći procenat rarioaktivno obeležene iRNK hibridizovao je
sa “sporom” frakcijom DNK, što je upravo deo genoma koji
kodira za proteine.
 Britten:
 http://www.dnaftb.org/dnaftb/31/concept/index.ht
  ml
                           PITANJA
1.    Šta je denaturacija DNK?
2.    Koje veze se narušavaju pri denaturaciji DNK?
3.    Šta je renaturacija DNK?
4.    Šta je hibridizacija?
5.    Šta je hipohromni a šta hiperhromni efekat?
6.    Na koji način je moguće pratiti denaturaciju DNK?
7.    Šta je temperatura topljenja DNK?
8.    Šta je kriva topljenja?
9.    Koja DNK je stabilnija: ona čija je Tt 78°C ili ona čija je Tt 88°C?
10.   Koja DNK je stabilnija: ona koja ima više, ili ona koja ima manje
      GC parova?
11.   Ko apsorbuje više svetlosti na 260nm: dvolančana ili jednolančana
      DNK?
12.   Šta je Britten pratio u svojim eksperimentima?
                         PITANJA
13. Koliko delova ima kriva koja predstavlja rezultate Brittenovog
     eksperimenta i šta oni predstavljaju?
14. Da li će hibridizovati jednolančana DNK sa RNK?
15. Da li je mouće da hibridizuju DNK iz različitih vrsta?
16. Britten je pratio zavisnost _______________ od
     _____________.
17. Zašto je u Britten-ovom eksperimentu korišćena radioaktivno
     obeležena iRNK?
18. Da li je radioaktivno obeležena iRNK hibridizovala sa
     visokorepetitivnom frakcijom i zašto?
19. Kakvo značenje ima činjenica da je kriva renaturacije satelitske
     DNK miša pomerena ulevo u odnosu na krivu renaturacije E.coli?

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:76
posted:2/3/2012
language:Croatian
pages:27