Docstoc

Jingfu wang The role of WT1 gene in neuroblastoma Department of

Document Sample
Jingfu wang The role of WT1 gene in neuroblastoma  Department of Powered By Docstoc
					The role of WT1 gene in neuroblastoma



                  Jingfu wang


              Department of Pediatric Oncology
Key Laboratory of Cancer Prevention and Therapy of Tianjin,
Tianjin Medical University Cancer Institute and Hospital
                                                               Background/purpose




 The recurrence of neuroblastoma due to minimal residual disease (MRD) is often seen.
   Immunotherapy is an attractive therapeutic option for controlling MRD.
 Wilms tumor gene (WT1) was firstly identified as a suppressor involved in the
   development of Wilms tumor. However, oncogenic properties of WT1 were recently
   observed in various hematological and solid malignancies.
 Over the past years, the immunotherapy using peptide vaccines against WT1 in adults
   with leukemia and various solid cancers was promising.
 To determine whether WT1 vaccines are applicable for neuroblastoma, firstly, we must
   understand the exact function of WT1 in neuroblastoma. So the aim of this study was to
   probe it.
                                                Materials and methods




 WT1 mRNA expression in the tumor tissue of 22 neuroblastomas (NBs), 5
   ganglioneuromas (GNs) and 4 NB cell lines: conventional and real-time RT-
   PCR.
 WT1 protein expression in 20 NBs and 5 GNs: immunohistochemistry.
 Effect of WT1 gene knockdown on NB cell (NB19 and NB69) proliferation:
   siRNA against WT1; WST-1 assay.
                                                                   Materials and methods
                                                                        (continue)


Table 1 Sequence of primers and probes in conventional and real time PCR
Types of PCR       Primer and probe       Sequence (5'-3' orientation)

Conventional       WT1-F                  GGCATCTGAGACCAGTGAGAA
PCR
                   WT1-R                  GAGAGTCAGACTTGAAAGCAGT
                   GAPDH-F                TGAAAGTGCTGTCTCCATGC
                   GAPDH-R                ACCTTTGGTGAGACCTGTGG
Real time PCR      WT1-F                  GATAACCACACAACGCCCATC
                   WT1-R                  CACACGTCGCACATCCTGAAT
                   WT1-P                  FAM-ACACCGTGCGTGTGTATTCTGTATTGG-TAMRA
                   β-actin-F              CCCAGCACAATGAAGATCAAGATCAT
                   β-actin-R              ATCTGCTGGAAGGTGGACAGCGA
                   β-actin-P              FAM-TGAGCGCAAGTACTCCGTGTGGATCGGCG-TAMRA

 F: forward; R: reverse; P: probe.
                               WT1 mRNA expression in NBs and GNs
Patient   Pathology   WT1 mRNA level
   1         GN          7.61×10-3           Correlation of WT1 mRNA levels and histological grade
   2         GN          2.60×10-3

   3         GN          2.30×10-3

   4         GN          2.70×10-4      2.50E-02
   5         GN          1.70×10-3

   6         NB          3.49×10-3      2.00E-02
   7         NB          2.45×10-3

   8         NB          3.98×10-3      1.50E-02
   9         NB          8.40×10-6

  10         NB          4.90×10-3      1.00E-02
  11         NB          3.40×10-4

  12         NB          1.10×10-5      5.00E-03
  13         NB          2.10×10-4

  14         NB          2.30×10-3
                                        0.00E+00
  15         NB          1.30×10-3                             GN              NB
  16         NB          5.10×10-5

  17         NB          7.10×10-5

  18         NB          3.40×10-5

  19         NB          4.30×10-3
                                              Comparison between neuroblastoma and ganglioneuroma
  20         NB          1.10×10-4

  21         NB          4.10×10-4                            Mann-Whitney Test
  22         NB          2.30×10-3

  23         NB          1.45×10-3                                  p=0.261
  24         NB          2.30×10-2

  25         NB          4.30×10-5
                                       There was no difference between neuroblastoma and ganglioneuroma
  26         NB          2.70×10-3

  27         NB          1.00×10-4
                              WT1 mRNA expression in NBs and GNs (continue)

Patient   Pathology   Stage     WT1 mRNA level
                                                     Correlation of WT1 mRNA levels and clinical stage
  1          NB        Ⅰ           3.49×10-3
  2          NB        Ⅰ           2.45×10-3
  3          NB        Ⅰ           3.98×10-3     2.50E-02
  4          NB        Ⅰ           8.40×10-6
  5          NB        Ⅰ           4.90×10-3     2.00E-02

  6          NB        Ⅰ           3.40×10-4
                                                 1.50E-02
  7          NB        Ⅱ           1.10×10-5
  8          NB        Ⅱ           2.10×10-4
                                                 1.00E-02
  9          NB        Ⅱ           2.30×10-3
  10         NB        Ⅱ           1.30×10-3
                                                 5.00E-03
  11         NB        Ⅱ           5.10×10-5
  12         NB        Ⅲ           7.10×10-5     0.00E+00
  13         NB        Ⅲ           3.40×10-5                         Ⅰ         Ⅱ         Ⅲ          Ⅳ
  14         NB        Ⅲ           4.30×10-3
  15         NB        Ⅲ           1.10×10-4       Comparison among Stage Ⅰ,Ⅱ, Ⅲ and Ⅳ in neuroblastoma
  16         NB        Ⅲ           4.10×10-4
  17         NB        Ⅲ           2.30×10-3
                                                                         Kruskal-Wallis Test
  18         NB        Ⅳ           1.45×10-3
  19         NB        Ⅳ           2.30×10-2                                   P=0.412
  20         NB        Ⅳ           4.30×10-5
                                                            There was no difference among stage groups
  21         NB        Ⅳ           2.70×10-3
                           WT1 mRNA expression in NBs and GNs (continue)

Patients   Pathology   WT1/actin   Status   survival time (months)   Correlation of WT1 mRNA levels and prognosis
1          NB          8.40×10-6   alive    240.5
2          NB          1.10×10-5   alive    225.5
3          NB          3.40×10-5   alive    241
4          NB          4.30×10-5   alive    160
5          NB          5.10×10-5   alive    96
6          NB          7.10×10-5   dead     216
7          NB          1.00×10-4   alive    163
8          NB          1.10×10-4   alive    232
9          NB          2.10×10-4   alive    222
10         NB          3.40×10-4   alive    165
11         NB          4.10×10-4   alive    217.5
12         NB          1.30×10-3   alive    111
13         NB          1.45×10-3   dead     9.5
14         NB          2.30×10-3   alive    155
15         NB          2.30×10-3   dead     10
16         NB          2.45×10-3   alive    31
17         NB          2.70×10-3   dead     4
18         NB          3.49×10-3   alive    38
19         NB          3.98×10-3   alive    28                                 Log-Rank test: p=0.193
20         NB          4.30×10-3   alive    235
21         NB          4.90×10-3   alive    226                      The WT1 mRNA expression levels did not affect
22         NB          2.30×10-2   alive    236                      the prognosis
                Median: 8.55×10-4
WT1 mRNA expression in neuroblastic cell lines




                                 The highest expression appeared in
                                 NB69 without MYCN amplification
                                 (relatively low malignancy)
                                                            Summary1



 The levels of WT1 mRNA expression were not correlated with
    histological grade, clinical stage and prognosis.
 Among the four neuroblastic cells, NB69 with relatively low
    malignancy exhibited the highest WT1 mRNA expression.




WT1 does not play a significant role in the oncogenicity of
neuroblastoma.
                    WT1 protein expression in NBs and GNs




           Neuroblastic cells                             Ganglion cells

WT1 proteins were more strongly expressed in mature ganglion cells than neuroblastic cells
         WT1 protein expression in NBs and GNs (continue)


        Expression of WT1 protein in NBs and GNs (immunohistochemistry)

                         Polyclonal (C-19)                 Monoclonal (6F-H2)
  Tumor types
                 No. of positive cases   Ratio (%)   No. of positive cases   Ratio (%)



Neuroblastoma            2/20                10*             6/20              30**



Ganglioneuroma           5/5                 100*            5/5              100**


Fisher's Exact Probability Test: *p=0.000; ** p=0.009. NB: neuroblastoma; GN:
ganglioneuroma.


   The positive rate was significantly higher in GNs than in NBs
                                                                  Summary2




 Higher WT1 protein expression in ganglion cells and higher positive rate
   in GNs provides a clue that WT1 protein may be a candidate factor
   inducing primitive neuroblastic cells to differentiate into mature ganglion
   cell.
 Effect of WT1 gene knockdown on NB cell (NB19 and NB69) proliferation




A and B, Conventional RT-PCR (A) and real-time RT-PCR (B) revealed that WT1 gene was
obviously knocked down in NB19 and NB69 cells.
C and D, There was no significant change on cell proliferation of NB19 between negative
control and WT1 siRNA group (* p=0.937). However, silencing of WT1 gene prompted cell
growth in NB69 cell which possessed the highest WT1 mRNA expression (** p=0.001).
                                                               Summary3




 The silence of WT1 gene promoting cell growth in NB69 cells notes that
   WT1 may be a factor inhibiting neuroblastic cells growth.
                                                        In conclusion




 WT1 may be related to cell differentiation and suppression of cell
   proliferation in NB.
 WT1 gene does not act as an oncogene, but participates in the
   maturation of NB.
              How to understand our findings contrast to that in adults


                              A common role of WT1:

                   regulating the mesenchymal-epithelial balance


            Epithelial cells                       Mesenchymal cells


The adult cancers with high WT1 expression are generally derived from epithelial cells.
These tumors will undergo an epithelial-mesenchymal transition (EMT), and this is often
related to a worse prognosis.
In contrast, neuroblastoma is derived from primitive mesenchymal cells and WT1
normally plays a role of mesenchymal-epithelial transition (MET). The effect of forcing
the cells towards an epithelial state is linked to a favorable prognosis.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:9
posted:1/26/2012
language:English
pages:16