Supporting Online Material for - Science

Document Sample
Supporting Online Material for - Science Powered By Docstoc
					                          [URL for SX] www.sciencemag.org/cgi/content/full/science.1205292/DC1




                    Supporting Online Material for
                 Recombinant Origin of the Retrovirus XMRV
 Tobias Paprotka,* Krista A. Delviks-Frankenberry,* Oya Cingöz,* Anthony Martinez,
  Hsing-Jien Kung, Clifford G. Tepper, Wei-Shau Hu, Matthew J. Fivash Jr., John M.
                              Coffin, Vinay K. Pathak†

                 *These authors contributed equally to this work.
    †To whom correspondence should be addressed. E-mail: vinay.pathak@nih.gov

                          Published 31 May 2011 on Science Express
                                DOI: 10.1126/science.1205292

This PDF file includes:

       Materials and Methods
       Supplemental Discussion
       Table S1
       Figs. S1 to S8
       References
                                                                                                         2 

 

MATERIALS AND METHODS 

 
Nomenclature.    Using  the  Mouse  Genome  Database  Nomenclature  Committee  guidelines 
(http://www.informatics.jax.org/mgihome/nomen/short_gene.shtml),  the  genes  encoding  the 
novel endogenous proviruses described in these studies will be named Prexmrv1 and Prexmrv2.  
For ease of comparison to exogenous retroviruses, the viruses and viral sequences encoded by 
these genes will be referred to as PreXMRV‐1 and PreXMRV‐2, respectively.    
 
CWR22  xenografts.    Early  3rd  passage  and  an  unknown  passage  of  the  CWR22  xenograft, 
originally  provided  by  Thomas  G.  Pretlow  (Case  Western  Reserve  University),  were  obtained 
from  the  Division  of  Cancer  Treatment  and  Diagnosis  of  the  NCI  Tumor  Repository.    Early  7th 
passage  xenografts  CWR22‐9216R  and  ‐9218R,  and  total  nucleic  acid  from  late  passage 
xenografts 2152, 2524, 2272, and 2274 were originally provided by Thomas G. Pretlow (14, 29).  
Early passage xenografts CWR22‐8R and ‐8L were generated at University of California, Davis by 
transplantation of CWR22‐9216R and ‐9218R into Hsd nude mice.  The late passage xenograft 
samples were total RNA from which genomic DNA was not completely removed, and as a result 
contained  variable  levels  of  genomic  DNA.    Cell  line  22Rv1  was  obtained  from  the  American 
Type  Culture  Collection  and  CWR‐R1  was  originally  obtained  from  Elizabeth  M.  Wilson 
(University of North Carolina, Chapel Hill).  The nude mouse strains used for in vivo passages are 
not  known,  and  it  is  likely  that  different  strains  were  used  throughout  the  serial  passages 
(Thomas  G.  Pretlow,  personal  comm.);  however,  some  passages  likely  used  an  outbred  strain 
obtained from NIH (Lili Liu, personal comm.), which fits the description of strains maintained by 
Charles River and Harlan Laboratories.   

STR  analysis  and  IAP  assay.    STR  analysis  was  performed  using  the  GenePrint  STR  System 
(Promega) according to the manufacturer’s instructions.  To verify that the xenograft samples 
analyzed  were  all  derived  from  patient  CWR22,  short  tandem  repeat  (STR)  analysis  was 
performed  at  7  loci  on  different  chromosomes.    The  banding  patterns  for  xenograft  samples 
736, 777, 9216R, 9218R, 8R and 8L were identical for all 7 loci.  The allele patterns for CWR‐R1 
and 22Rv1 can vary with passage number and lab origin (21, 30), but matched the patterns for 
the early xenografts with one or two exceptions, respectively.  Primers for locus D5S818 were: 
forward             5’‐GGGTGATTTTCCTCTTTGGT‐3’                   and             reverse           5’‐
AACATTTGTATCTTTATCTGTATCCTTATTTAT‐3’  (31).    IAP  assay  was  performed  as  previously 
described (18, 19). 

Quantitative real‐time PCR assay for XMRV env detection.  To specifically quantify XMRV env 
sequences,  primers  3f  (5’‐CTTTCCCTAAACTATATTTTGACTTGTGTG‐3’;  600  nM  final 
concentration)  and  8r  (5’‐CTGGATGCTACCGGAGCCC‐3’;  800  nM  final  concentration),  probe 
5’FAM‐ATACTGTATTAACAGGGTGTGGAGGGCCGA‐TAM‐3’ (800 nM final concentration), and 2X 
Light Cycler 480 Probes Master (1X final concentration; Roche Diagnostics) were used in a 25  l 
reaction  volume.    Cycling  conditions  using  the  LightCycler  480  Roche  instrument  (Roche 
Diagnostics) were 95 °C for 30 sec followed by 50 cycles at 95 °C for 15 sec and 63 °C for 55 sec.  
BALB/c, NIH3T3 mouse DNAs and the mouse PG13 cell line, as well as all human cell lines tested 
gave  negative  results  in  this  qPCR  assay.    The  22Rv1  cell  line  was  determined  to  contain  an 
                                                                                                         3 

 

average  of  20  XMRV  proviral  copies/cell  based  upon  a  VP62  plasmid  DNA  standard  curve.  
Three‐fold serial dilutions of the 22Rv1 genomic DNA were used as standard control to test for 
the presence of XMRV in the genomic DNA of the xenografts.   

Cloning and identification of Prexmrv2.  A fragment of mouse DNA containing the gag leader 
with the characteristic 24‐base deletion, the 5’ LTR, and flanking mouse DNA was amplified and 
cloned with the aid of the Genome Walker kit (Clontech).  From the flanking sequence, primers 
C12_1f and C12_4r were developed (Fig. S2) and used in combination with the internal primers 
shown in Fig. S2 to amplify Prexmrv2 sequences for detection and sequencing.  

PCR  analysis.    In  order  to  specifically  amplify  XMRV,  primer  sets  that  had  a  100%  match  to 
XMRV, PreXMRV‐1 or both were developed.  Specificity was ensured by using a BLAST analysis 
(http://blast.ncbi.nlm.nih.gov/Blast.cgi)  (32)  and  excluding  primers  that  matched  MLV 
sequences  in  the  Genbank  database.    Primers  were  tested  with  22Rv1  and  CWR‐R1  DNA 
(positive  controls)  and  BALB/c,  C57BL/6,  NCR  nude  and  NIH3T3  DNA  (negative  controls)  to 
identify those that specifically amplified XMRV sequences from the 22Rv1 or CWR‐R1 cell DNA 
but did not  amplify murine endogenous proviruses present in the negative controls.  Phusion 
High‐Fidelity  PCR  (2x)  master  mix  (New  England  Biolabs)  supplemented  with  2%  DMSO  was 
used  for  PCR  amplification.    PCR  (30‐40  cycles)  was  performed  in  a  Bio‐Rad  T1000  thermal 
cycler  according  to  the  manufacturer’s  recommendations.    PCR  products  were  purified  from 
agarose  gels  and  cloned  into  pCR‐Blunt  (Invitrogen).    Sequencing  was  performed  by 
MACROGEN, using M13‐forward and M13‐reverse primers and continued by primer walking if 
necessary.                     Sequences             were         analyzed           with         Bioedit 
(http://www.mbio.ncsu.edu/bioedit/bioedit.html)  and  BLAST.    For  Fig.  2D,  the  following 
primers were used to detect 100 ng of sample input: XMRV, XmU3f and GAGr (514‐bp product); 
XMRV and PreXMRV‐1, 1b and 8r (1235 bp product); PreXMRV‐2, C12_1f and 129_1r (1124 bp 
product); human GAPDH, forward primer 5’‐CCCCACACACATGCACTTACC‐3’ and reverse primer 
5’‐CCTAGTCCCAGGGCTTTGATT‐3’  (97  bp  product)  (33),  and  mouse  IAP,  primers:  IAP‐F  5’‐
ATAATCTGCGCATGAGCCAAGG‐3’,  IAP‐R:  5’‐TCTGGTCTGTGGTGTTCTTCCT‐3’  described 
previously (18, 19).  The IAP assay in Fig. 1D used a total of 100 pg of DNA per reaction with the 
same primer set. 

Mouse  DNA  samples.  M.  cervicolor  popaeus  (J53),  M.  caroli  (J136),  M.  cookii  (J135),  M. 
spicilegus  (Halbturn)  (J131)  genomic  DNA  samples  were  given  by  Christine  Kozak  (NIAID, 
Bethesda, MD). M. macedonicus (XBS), M. cervicolor cervicolor (CRV), M. musculus bactrianus 
(BIR), M. famulus (FAM), M. platythrix (PTX), M. spicilegus (ZRU), M. musculus musculus (MPB) 
samples  were  sent  by  François  Bonhomme  (ISE,  Montpellier,  France).  M.  dunni  DNA  was 
prepared from tail fibroblasts (MDTF cells). Mouse tissues or DNA were acquired from Taconic 
(NCR  nude),  Harlan  Laboratories  (Hsd  nude),  Charles  River  Laboratories  (BALB/c  nude,  NIH‐III 
nude,  NIH‐Swiss,  and  NU/NU  nude),  and  Jackson  Laboratory  (AKR/J  nu  [stock  #000820], 
B6.129/J [stock #004361], B6CByF1/J nu [stock #100389], CByJ.Cg/J nu [stock #000711], BTBR/J 
[stock  #002232],  C57BL/6/J  [stock  #001929],  CByB6F1/J  nu  [stock  #100402],  NUJM  nu  [stock 
#001740],  SJLSmn.AK  nu  [stock  #001128],  STOCK  Ces1c/J  nu  [stock  #  003118]).    DNA  was 
extracted from nude mouse tissues using the DNeasy blood & tissue kit (Qiagen) according to 
the manufacturer’s recommendations. 
                                                                                                           4 

 

SUPPLEMENTAL DISCUSSION 

        In the main text, we present evidence that all published strains of XMRV arose from a 
single recombination event that occurred between 1993 and 1996 in a nude mouse carrying the 
CWR22  tumor  xenograft.    Here,  we  discuss  two  alternative  possible  explanations:  first,  that 
XMRV  is  present  in  mice  as  an  endogenous  provirus  and  can  occasionally  infect  humans; 
second,  that  the  predicted  recombination  event  can  occur  independently  multiple  times  and 
that  identification  of  XMRV  from  human  samples  originated  from  sources  other  than  the 
CWR22 xenograft or the 22Rv1 and CWR‐R1 cell lines. 

The absence of XMRV in the CWR22 tumor and early passage xenografts. Using qPCR assays, 
we estimated that the early xenografts contain ~1‐3 XMRV env copies/100 cells (Fig. 1C), which 
correlated with  the  amount  of  mouse  DNA  in the  early  xenografts  (0.3  ‐1%;  Fig.  1D),  and  the 
estimated 1 XMRV env copy/cell in the NU/NU and Hsd nude mice (Fig. 1C). Since no XMRV was 
detected  in  any  of  the  early  xenografts,  the  XMRV  env  sequences  detected  are  from  the 
endogenous Prexmrv1 provirus in the nude mouse DNA. 
         In  addition  to  the  qPCR  assays,  we  were  unable  to  detect  XMRV  from  the  early 
xenografts  after  using  six  different  primer  sets  and  sequencing  125  cloned  PCR  products  (Fig. 
S3B).  All six of these PCR primer sets had 100% identity to the published XMRV sequences, and 
could amplify XMRV from control infected cells as well as PreXMRV‐1.  The fact that none of the 
125 cloned PCR products was derived from XMRV (<0.80%) further reduces the possibility that 
the xenografts contained XMRV, with a detection limit of <1 XMRV copy/4167 cells (0.80% × [3 
copies/100 cells]).  Thus, our ability to detect XMRV is 6‐fold higher than needed to detect the 
lowest reported estimate of XMRV copies in infected prostate tumor cells (1 copy/660 cells) (1).   
         Several  studies  have  shown  that  XMRV  can  readily  infect  and  efficiently  spread  in 
prostate  cancer  cell  lines  (8,  34).    These  studies  strongly  imply  that  if  replication  competent 
XMRV  were  present  in  the  early  xenografts,  it  would  have  spread  and  infected  all  of  the 
prostate  cancer  cells  in  the  xenograft  during  the  long  time  period  (>  1  year)  in  which  the 
xenografts  were  passaged  in  nude  mice.    Because  the  CWR22  xenograft  is  androgen‐
dependent,  the  male  nude  mice  carrying  the  xenografts  were  treated  with  androgens  to 
maintain tumor growth (15), making it very likely that any XMRV viral promoters that might be 
present, which have been shown to be stimulated by androgens (35, 36), are transcriptionally 
active.   
         Our screen of 89 inbred and wild mice (Fig. S4) failed to detect XMRV as an endogenous 
provirus in any of these strains.  Thus, it is very unlikely that original CWR22 tumor was infected 
with  XMRV  derived  from  an  endogenous  XMRV  provirus.    Furthermore,  the  NU/NU  and  Hsd 
mice are the only mice among the 12 nude mouse strains that we analyzed that contain both 
PreXMRV‐1 and PreXMRV‐2 (Fig. 2D).  Taken together, the possibility is remote that the CWR22 
tumor was originally infected with XMRV—which would have to come from an extremely rare 
putative  endogenous  XMRV  provirus—and  by  coincidence  was  transplanted  into  rare  nude 
mice that harbor both parental proviruses.  Although the possibility that the CWR22 tumor was 
initially infected with XMRV can never be completely excluded, we conclude that it is far more 
likely  that  XMRV  arose  through  recombination  between  PreXMRV‐1  and  PreXMRV‐2  during 
passaging of the CWR22 xenograft in nude mice. 
                                                                                                            5 

 

The role of XMRV in prostate cancer.  The absence of detectable levels of XMRV in the early 
passage xenografts indicates that XMRV was not needed for the maintenance or propagation of 
the  tumor  cells  in  nude  mice.  Established  mechanisms  of  retrovirus‐mediated  oncogenic  (37) 
transformation  predict,  if  XMRV  had  a  direct  role  in  the  transformation  of  tumor  cells,  that 
XMRV  proviruses  would  be  present  in  most,  if  not  all,  of  the  tumor  cells.    Therefore,  even  if 
XMRV  was  present  at  undetectable  levels  in  the  early  xenografts,  it  is  unlikely  to  have 
contributed  to  the  formation  of  the  prostate  tumor  or  its  propagation.    It  is  possible  that 
predicted  recombinant  XMRV  could  have  contributed  to  increased  proliferation  or  androgen 
independence in the later xenografts.  The 22Rv1 and the CWR‐R1 cell lines are characterized 
by the presence of truncated androgen receptors lacking ligand binding domain, either through 
protease  cleavage  or  alternative  splicing  (29,  38‐40).    These  constitutively  active  androgen 
receptors have been postulated to be responsible for the androgen‐independent properties of 
these  cell  lines.    While  we  cannot  rule  out  XMRV’s  contribution  to  the  abundance  of  these 
receptors  in  these  cell  lines,  we  note  that  tumors  and  cell  lines  un‐infected  with  XMRV  also 
express  these  receptor  variants,  making  it  unlikely  that  XMRV  is  the  principal  cause  of 
hormone‐independence (38, 40, 41).    However, it is possible that the androgen‐independent 
tumor  cells  that  were  selected  in  response  to  androgen  deprivation  provide  more  suitable 
target cells for XMRV infection and spread.  Because all four of the late xenografts contained 
XMRV, we believe it is very likely that the predicted recombinant XMRV was generated in the 
progenitor tumor, and its generation was not dependent on androgen deprivation of the nude 
mice.   
         The  possibility  that  there  is  an  independently  integrated,  as  yet  undiscovered, 
endogenous provirus in mice becomes even more unlikely with analysis of the diversity among 
known endogenous proviruses.  Table S1 shows the pairwise genetic distance within each of the 
3 groups of endogenous MLVs of the 565 pairs in this comparison, the smallest pairwise genetic 
distance  is  0.0009  (7  bp)  between  MPMV  3  and  MPMV  9.    By  contrast,  the  predicted 
recombinant differs from the consensus XMRV by 0.0005 (4 bp), making it very unlikely that the 
isolated viruses result from independently integrated endogenous proviruses. 
 
Calculation  of  probability  that  an  identical  recombinant  was  generated  in  another 
independent  infection  event.    Recombination  in  retroviruses,  including  MLV,  occurs  by  a 
dynamic  copy‐choice  mechanism  (42)  and  has  been  shown  to  occur  throughout  the  viral 
genome (43).  It has been reported that MLV undergoes an average of 4 recombination events 
(crossovers) in each replication cycle (24).  Analysis of recombination breakpoints showed that 
recombination can occur within short regions of continuous identity (identity blocks) of ≤ 5 nt 
(44,  45).    Of  the  six  predicted  recombination  junctions  between  PreXMRV‐1  and  PreXMRV‐2 
that are hypothesized to generate XMRV, the shortest block contains a 20‐nt identity (Fig. 3).  
As a very conservative estimate, we define a potential recombination site as a ≥ 20‐nt identity 
block.   
         To  identify  regions  that  are  likely  to  undergo  recombination,  we  have  aligned  the 
PreXMRV‐1 and PreXMRV‐2 genomes and identify 111 blocks of ≥ 20‐nt identity.  We consider 
the events during reverse transcription from a virus that contains one copy of PreXMRV‐1 RNA 
and  one  copy  of  PreXMRV‐2  RNA.    DNA  synthesis  can  initiate  from  either  copackaged  RNA 
template;  minus‐strand  DNA  transfer  can  occur  inter‐  and  intramolecularly.    Assuming  that 
                                                                                                                   6 

 

crossovers can only occur in the 111 blocks of identity, the number of recombination patterns 
that can be generated is: 

                                Patterns = 2nH x nS x nT
                                 Patterns = 2111 x 2 x 2                                   (1)
                                   Patterns ≈ 1 x 1034

        where  nH = number of identity blocks 

                nS = number of templates available for initiation of DNA synthesis 

                nT = number of acceptor templates for minus‐strand DNA transfer 

        To  assign  a  probability  of  observing  a  given  pattern,  we  assume  that  the  selection  of 
template for initiation of DNA synthesis is random, the selection for the acceptor template of 
minus‐strand  DNA  transfer  is  random,  the  identified  ≥  20‐nt  identity  blocks  share  the  same 
probability of recombination, and recombination events are independent, i.e. recombination at 
one block does not affect the probability of a recombination event at any other block.  Given 
these  assumptions,  the  probability  of  observing  a  given  pattern  is:    (Probability  of  starting 
template)  ×  (Probability  of  acceptor  template)  ×  (Probability  of  exactly  k  recombinations)  × 
(Probability  of  a  specific  recombination  pattern).    This  relationship  may  be  written 
mathematically using the resulting general relationship describing the probability: 

                                                                               ⎡      ⎤
                                                                               ⎢      ⎥
                                       ⎡1⎤   ⎡1⎤   ⎡⎛ n ⎞                n−k ⎤
                     Prob(n, k.p r ) = ⎢ ⎥          ⎜ ⎟( p r ) (1 − p r ) ⎥ ⎢
                                                              k                   1 ⎥
                                             ⎢2⎥   ⎢⎜ ⎟                        ⎢⎛ n ⎞ ⎥
                                                                                                            (2) 
                                       ⎣2⎦   ⎣ ⎦   ⎣⎝k ⎠                     ⎦ ⎜ ⎟
                                                                               ⎢⎜ ⎟ ⎥
                                                                               ⎢⎝ k ⎠ ⎥
                                                                               ⎣      ⎦

where:          n = number of recombination loci 

                k = number of recombinations in the pattern 

                pr = probability that a given locus will recombine 

          The more detailed analysis in Fig. S8 explores the influence of recombination frequency 
on  the  probability  of  observing  a  second  independent  event  generating  the  same 
recombination patterns.  It is well established that DNA synthesis can initiate from either RNA 
template,  and  minus‐strand  DNA  transfer  can  occur  both  inter‐  and  intramolecularly.    Hence, 
we  hold  these  two  variables  constant,  assume  that  the  number  of  crossovers  is  distributed 
according to a Poisson  distribution, and examine the effect of recombination frequency.  The 
literature indicates that on average 4 crossovers occur during the synthesis of one genome; we 
calculated  the  probability  of  observing  a  second  independently‐generated  virus  with  an 
identical genotype that involved 6 crossovers between PreXMRV‐1 and PreXMRV‐2. As shown 
in  Fig.  S8,  the  probabilities  vary  according  to  the  estimate  for  average  number  of  crossovers 
                                                                                                           7 

 

that occur in the viral genome. For example, using the average of 4 crossovers described in the 
literature, the probability of observing a second independently derived provirus with the same 
6  crossovers  is  1.3  ×  10‐12.  The  probability  is  highest  when  the  average  number  of  crossovers 
per genome is 6; in this case, the probability is 3.0 × 10‐12.   

Estimation  of  the  number  of  possible  recombinants  that  encode  all  viral  proteins  with 
identical amino acid sequences to XMRV but have a distinguishable nucleotide sequence.  As 
described above in equation 1, the total number of recombination patterns between PreXMRV‐
1  and  PreXMRV‐2  is  approximately  1  ×  1034.    We  have  also  examined  the  number  of 
recombinants that encode the same amino acids in their genes as the predicted recombinant 
XMRV.  For this purpose, we aligned the viral nucleotide sequences and amino acid sequences 
of  XMRV,  PreXMRV‐1  and  PreXMRV‐2  and  identified  putative  crossover  events  that  do  not 
affect  encoded  amino  acid  sequences.    Using  these  events,  we  calculated  the  number  of 
recombination patterns that encode the same amino acids in gag‐pol and env genes.  Without 
limiting  the  number  of  crossover  events,  we  estimate  that  5.8  x  1017  different  patterns  of 
recombinants can encode the same amino acids in their gag‐pol and env genes as the predicted 
recombinant XMRV. 

Variation between the predicted recombinant and patient‐derived XMRVs.  To date, there are 
five full‐length XMRV sequences available that were reportedly isolated from patients (2, 3).  As 
shown in Fig. S7B, these sequences differ from the 22Rv1 sequence by 3 ‐13 nucleotides.  Here, 
we  consider  the  possibility  that  these  patient‐derived  XMRVs  represent  independent 
recombination events.  First, all five of these viruses have the same six crossover sites that are 
predicted to occur between PreXMRV‐1 and PreXMRV‐2; therefore, the same six crossovers and 
additional  crossovers  between  PreXMRV‐1  and  PreXMRV‐2  would  have  to  take  place  to 
generate  the  XMRV  sequences  with  some  of  these  nucleotide  differences.    Of  the  41  total 
nucleotide differences present in all five patient‐derived XMRVs, 35 nucleotide substitutions are 
not present in either PreXMRV‐1 or PreXMRV‐2; thus, these nucleotide differences cannot be 
explained  by  additional  crossovers  between  these  two  parental  viruses.    The  remaining  6 
nucleotide differences are present in one of the parents; however, none of these substituted 
sites is flanked by blocks of 20‐nt identity.  Therefore, using the assumptions for calculation of 
recombination  probability  described  above,  these  nucleotide  differences  most  likely  did  not 
arise  through  additional  recombination  events.    It  is  much  more  likely  that  these  differences 
represent  errors  during  PCR,  errors  during  sequencing,  or  variation  that  arose  as  a  result  of 
passage of the virus in another cell line.   
         The possibility that most of these nucleotide differences represent sequencing errors is 
strengthened  by  a  comparison  of  different  VP62  sequences  available  in  Genbank.    The  first 
deposited  VP62  sequence  (DQ399707.1)  differs  from  the  22Rv1  sequence  by  16  nucleotides; 
however, a later deposited sequence (EF185282.1) differs from the 22Rv1 sequence by only 4 
nucleotides.   
                                                                                            8 

 

Supplemental Table S1. Intragroup genetic distance within the endogenous MLVs.  

 

                               p‐distance1

             XMRV           PMV          MPMV           XMV 
               (5)2         (23)          (13)          (13) 
Average      0.0023        0.0105        0.0090        0.0469 
  Range  0.0009‐0.0034  0.0028‐0.025 0.0009‐0.0177 0.0052‐0.1026 
 
    1
    Calculated from alignments like those used to generate the trees shown in Figure S5. 
    2
    The number of proviruses in each group is in parentheses. 
                                                                                                          9 

 

SUPPLEMENTAL FIGURE LEGENDS 
 
Supplemental Fig. S1.  Short Tandem Repeat (STR) analysis of CWR22 xenografts.  STR analyses 
of the six xenografts (736, 777, 9216R, 9218R, 8R and 8L) and the 22Rv1 and CWR‐R1 cell lines 
were compared at 7 different loci for lineage determination.  Allele patterns for DNAs from the 
positive control human cell lines 293T, DU145 and K562 were as expected for all 7 loci (data not 
shown).    Allele  patterns  for  22Rv1  and  CWR‐R1  are  consistent  with  previous  reports  and 
American  Type  Culture  Collection  (21,  30,  46).    For  22Rv1  and  CWR‐R1,  5/7  and  6/7  allele 
patterns  matched  the  xenograft  alleles,  respectively.    The  STR  analysis  for  locus  D7S820 
involves  chromosome  7,  for  which  the  xenografts  CWR22  and  CWR22R  are  trisomic,  in 
agreement with previous reports (21, 30).  Since full trisomy 7 is lethal in early gestation, only 
alleles 9 and 10, which are common among the xenografts and CWR22‐derived cell lines, were 
used in the frequency calculation.  The frequency for full trisomy 7 would be negligible in the 
human  population.    Furthermore,  it  is  unknown  whether  the  trisomy  was  originally  from  the 
CWR22  prostate  tumor  or  was  amplified  during  serial  xenograft  transplantations.    All  allele 
frequencies were determined using the published frequencies for Caucasian‐Americans found 
at 
www.promega.com/techserv/apps/hmnid/referenceinformation/popstat/custstat_Allelefreq.h
tm.  

 Supplemental  Fig.  S2.    Primers  used  to  amplify  XMRV  and  XMRV‐related  sequences.    A 
schematic  overview  indicating  the  approximate  position  of  each  primer  is  shown.    Identity  of 
primers to XMRV (X), PreXMRV‐1 (1) or PreXMRV‐2 (2) is indicated with +/‐ signs.  Primers that 
did not have 100% identity, but still amplified the virus sequences are indicated by ‐!.  Primers 
used for amplifying XMRV are shown in black, primers used for XMRV and PreXMRV‐1 are red, 
primers  used  for  PreXMRV‐1‐specific  amplification  are  blue,  primers  used  for  PreXMRV‐2 
amplification are green, and primers used to amplify XMRV from 22Rv1 or CWR‐R1 in two parts 
are brown (8).  The 5’ end nucleotide position refers to the XMRV complete genome sequence 
from 22Rv1 (FN692043).  Primers were used in the following combinations: 8f‐U3r; 8sfa‐U5sra; 
8fsa‐U3r;  1b‐8r;  U3f‐13r;  18f‐13r;  24f‐13r;  F1f‐F1r,  F2f‐F2r;  XmU3f‐GAGr;  C121f‐129  1R;  G2f‐
G3r;  Xe1f‐13r;  Xe2f‐13r;  C12_1f‐129_1r;  C12_1f‐midX2r;  C12_1f‐4847r;  envOUT1f‐C12_4r; 
midX1f‐C12_4r;  M19f‐C12_4r;  4257F‐C12_4r.    The  specificity  of  the  PCR  reactions  may  be 
altered if the primers are used in different combinations.   

Supplemental Fig. S3.  PCR and sequencing analysis of XMRV, PreXMRV‐1, and PreXMRV‐2 from 
xenografts and cell lines.  A schematic overview of the XMRV (A), PreXMRV‐1 (B) and PreXMRV‐
2  (C)  proviruses  indicating  LTRs  and  open  reading  frames.    Single  nucleotide  differences  of 
PreXMRV‐1 and PreXMRV‐2 compared to consensus XMRV (1 nt difference compared to XMRV‐
22Rv1;  FN692043)  are  indicated  as  vertical  bars  using  a  modified  Hypermut  plot  (47); 
substitutions GG to AG are in red, GA to AA in cyan, GC to AC in green, GT to AT in magenta, 
gaps  in  orange,  and  all  other  mutations  are  in  black.    The  percent  sequence  identity  of  the 
indicated regions compared to consensus XMRV is shown below each plot, and the positions of 
the  last  mismatched  nucleotides  before  regions  of  identity  to  XMRV  are  indicated.    The 
numbers of cloned and sequenced PCR products from each indicated source are shown as red 
                                                                                                       10 

 

bars  along  with  the  primer  sets  used  for  amplification.    (A)  Characterization  of  XMRV 
sequences.  XMRV from the CWR‐R1 cell line was cloned in 2 parts, similar to XMRV from 22Rv1 
cells  (8).    Total  RNA  from  the  2152  xenograft  was  converted  to  cDNA  using  either  random 
primers  or  XMRV‐specific  primers,  while  total  nucleic  acid  from  2524,  2272  and  2274  was 
directly  used  for  PCR.  (B)  PCR  and  sequencing  of  PreXMRV‐1.    The  complete  PreXMRV‐1 
genome was cloned and sequenced from the indicated sources using primers that specifically 
amplify  XMRV  or  PreXMRV‐1  but  exclude  known  endogenous  MLV  sequences  (Fig.  S2).    We 
amplified  PreXMRV‐1  from  the  CWR‐R1  cell  line,  but  not  the  22Rv1  cell  line,  indicating  the 
absence  of  PreXMRV‐1  from  these  cells.    Partial  PreXMRV‐1  (env  divergent  region)  was  also 
amplified from xenografts 2524 and 2274, showing that both XMRV and PreXMRV‐1 are present 
in these samples.  (C) A fragment containing PreXMRV‐2 DNA joined to cellular sequences was 
cloned  from  DBA/2J  genomic  DNA  and  sequenced.    The  complete  provirus  was  sequenced 
following  amplification  of  overlapping  halves  using  flanking  primers  predicted  from  the 
integration  site,  and  internal  provirus‐specific  primers.  The  presence  of  PreXMRV‐2  was 
confirmed  in  the  sources  shown  through  amplification  of  the  junction  between  mouse 
chromosome 12 and the 5’ LTR.  

Supplemental Fig. S4. A list of wild‐derived (n=44) and laboratory (n=45) mouse strains tested 
for the presence of XMRV by PCR using primers XmU3f and GAGr (Fig. S2). XMRV was not found 
as  a  single  provirus  in  any  of  the  mouse  strains  tested,  representing  15  Mus  species  and 
subspecies.  Asterisks  indicate  outbred  strains,  which  differ  in  the  number  and  distribution  of 
individual proviruses (Fig. S6).  

Supplemental  Fig.  S5.  Phylogenetic  analysis  of  MLV  sequences.    Multiple  alignments  were 
obtained  using  ClustalW  (48)  and  phylogenetic  trees  were  prepared  using  the  MrBayes 
algorithm  as  implemented  in  Topali  v2.5  (http://www.topali.org/)  (49).    The  generalized  time 
reversible substitution model was recommended by Model Selection for A, B, C, the HKY model 
for D and used with 100,000 generations and two runs.  Bootstrap values above 0.75 are shown 
at  each  branching.    A  schematic  overview  of  the  XMRV,  Prexmrv1,  and  Prexmrv2  genomes, 
indicating nucleotide differences as vertical bars, and the genomic region analyzed as a red box 
is shown below each tree, as is an enlarged view of the XMRV branch.  XMRVs are highlighted 
with a grey box, and Prexmrv1 and Prexmrv2 and the predicted recombinant indicated with red, 
blue,  and  bicolored  arrows,  respectively.    (A)  Analysis  of  the  complete  genome  sequences.  
Prexmrv1 groups with xenotropic MLVs and Prexmrv2 groups on a separate branch closest to 
both  polytropic  and  modified  polytropic  MLVs.    As  has  been  previously  noted  (2),  XMRV 
sequences  group  in  a  distinct  clade  within  the  XMV  group.    (B)  Analysis  of  the  region 
encompassing nt 3933‐7073.  The XMRV branch now includes Prexmrv1, while Prexmrv2 does 
not change its position in this tree compared to one prepared using the full‐length genome.  (C) 
Analysis of nt 337‐3886.  Prexmrv2 groups with the other XMRV sequences and Prexmrv1 does 
not change its position in the tree.  (D) Analysis of the LTR sequences (nt 7726‐8185) in which 
XMRV  has  a  1‐nt  insertion  compared  to  Prexmrv1.    Again,  Prexmrv1  groups  tightly  with  the 
XMRV sequences.  Prexmrv2 clusters somewhat differently within the XMV group, suggestive of 
a recombinant origin.  
                                                                                                      11 

 

Supplemental Fig. S6.  Analysis of 5 retired NU/NU breeders (Charles River) for the presence of 
XMRV,  PreXMRV‐1,  or  PreXMRV‐2.    Approximate  length  and  location  (red  bars)  of  sequences 
positive for (A) PreXMRV‐1 or (B) PreXMRV‐2 are shown beneath each provirus.  Total number 
of clones sequenced are shown to the left of the red bar; primer pairs used to amplify the DNA 
shown to the right of the red bar.  For PreXMRV‐1, a total of 14 and 28 PCR products obtained 
using primer pairs 1b‐8r and 8fsa‐U3r, respectively, from NU/NU mouse nos. 1, 2, 4 and 5 were 
cloned and sequenced.  For PreXMRV‐2, a total of 17 PCR products obtained using chromosome 
specific  primer  pair  C12_1f  and  129_1r,  from  mouse  no.  2,  3,  and  4  were  cloned  and 
sequenced.  (C) Due to the outbred nature of the NU/NU strain, 2/5 NU/NU were found to be 
positive for both PreXMRV‐1 and PreXMRV‐2, 2/5 were positive for PreXMRV‐1 only, and 1/5 
were positive for PreXMRV‐2 only.  The Hsd nude served as a positive PCR control for PreXMRV‐
1 and PreXMRV‐2; 22Rv1 served a positive PCR control for XMRV.  (neg, negative control). 

Supplemental Fig. S7.  Regions of reverse transcriptase (RT) template switching events inferred 
to  be  involved  in  the  generation  of  the  predicted  XMRV  progenitor,  and  its  relationship  to 
XMRV. (A) Identical sequences between PreXMRV‐1 and PreXMRV‐2 within the crossover sites.  
All  recombination  sites  between  PreXMRV‐1  (top)  and  PreXMRV‐2  (bottom)  are  shown.  
Nucleotide mismatches relative to XMRV are indicated in red and the position of  the first (or 
last)  mismatched  nt  is  indicated  relative  to  the  XMRV‐22Rv1  genome.    (B)  Diversity  of  XMRV 
sequences.    Multiple  alignments  comparing  the  predicted  recombinant  with  the  XMRV 
consensus  sequence  and  all  available  XMRV  full‐length  genome  sequences  from  cell  lines 
(22Rv1, CWR‐R1), PC patients (VP35, VP42, VP62), and CFS patients (WPI‐1106, WPI‐1178) are 
shown.    Differences  relative  to  the  consensus  sequence  are  indicated with  black  vertical  bars 
and  deletions  with  orange  vertical  bars.    The  22Rv1  XMRV  sequence  differs  from  consensus 
XMRV by only 1 nt (at position 790), which is polymorphic among the multiple proviruses in this 
cell line.  Note that differential carryover of A or G into the various isolates implies at least two 
original  contamination  events.    XMRV  sequences  from  cell  lines  22Rv1  and  CWR‐R1  are 
identical.  Also note that the predicted recombinant would differ from all XMRV sequences only 
at positions 6698, 7154, and 8902.   

Supplemental Fig. S8.  Probability of observing another recombinant with identical nucleotide 
sequence  to  XMRV.    X‐axis,  the  average  number  of  recombination  events  per  genome  per 
replication  cycle;  Y‐axis,  probability  of  observing  a  specific  recombinant  genotype  with  the 
same 6 crossover events.   
 
                                                                                                12 

 

References and Notes 
 
29.   C. G. Tepper et al., Characterization of a novel androgen receptor mutation in a relapsed 
      CWR22 prostate cancer xenograft and cell line. Cancer Res 62, 6606 (2002). 
30.   A. van Bokhoven et al., Spectral karyotype (SKY) analysis of human prostate carcinoma 
      cell lines. Prostate 57, 226 (2003). 
31.   K. L. Opel, D. T. Chung, J. Drabek, J. M. Butler, B. R. McCord, Developmental validation of 
      reduced‐size STR Miniplex primer sets. J Forensic Sci 52, 1263 (2007). 
32.   S. F. Altschul et al., Gapped BLAST and PSI‐BLAST: a new generation of protein database 
      search programs. Nucleic Acids Res 25, 3389 (1997). 
33.   B. Zimmermann, W. Holzgreve, F. Wenzel, S. Hahn, Novel real‐time quantitative PCR test 
      for trisomy 21. Clin Chem 48, 362 (2002). 
34.   K. Stieler et al., Host range and cellular tropism of the human exogenous 
      gammaretrovirus XMRV. Virology 399, 23 (2010). 
35.   J. J. Rodriguez, S. P. Goff, Xenotropic murine leukemia virus‐related virus establishes an 
      efficient spreading infection and exhibits enhanced transcriptional activity in prostate 
      carcinoma cells. J Virol 84, 2556 (2010). 
36.   B. Dong, R. H. Silverman, Androgen stimulates transcription and replication of 
      xenotropic murine leukemia virus‐related virus. J Virol 84, 1648 (2010). 
37.   N. Rosenberg, P. Jolicoeur, in Retroviruses, J. M. Coffin, S. H. Hughes, H. E. Varmus, Eds. 
      (Cold Spring Harbor Laboratory Press, 1997). 
38.   S. J. Libertini et al., Evidence for calpain‐mediated androgen receptor cleavage as a 
      mechanism for androgen independence. Cancer Res 67, 9001 (2007). 
39.   S. M. Dehm, L. J. Schmidt, H. V. Heemers, R. L. Vessella, D. J. Tindall, Splicing of a novel 
      androgen receptor exon generates a constitutively active androgen receptor that 
      mediates prostate cancer therapy resistance. Cancer Res 68, 5469 (2008). 
40.   Z. Guo et al., A novel androgen receptor splice variant is up‐regulated during prostate 
      cancer progression and promotes androgen depletion‐resistant growth. Cancer Res 69, 
      2305 (2009). 
41.   R. Hu et al., Ligand‐independent androgen receptor variants derived from splicing of 
      cryptic exons signify hormone‐refractory prostate cancer. Cancer Res 69, 16 (2009). 
42.   C. K. Hwang, E. S. Svarovskaia, V. K. Pathak, Dynamic copy choice: steady state between 
      murine leukemia virus polymerase and polymerase‐dependent RNase H activity 
      determines frequency of in vivo template switching. Proc Natl Acad Sci U S A 98, 12209 
      (2001). 
43.   W. S. Hu, H. M. Temin, Retroviral recombination and reverse transcription. Science 250, 
      1227 (1990). 
44.   H. A. Baird et al., Sequence determinants of breakpoint location during HIV‐1 
      intersubtype recombination. Nucleic Acids Res 34, 5203 (2006). 
45.   M. P. Chin, J. Chen, O. A. Nikolaitchik, W. S. Hu, Molecular determinants of HIV‐1 
      intersubtype recombination potential. Virology 363, 437 (2007). 
46.   M. Kochera et al., Molecular cytogenetic studies of a serially transplanted primary 
      prostatic carcinoma xenograft (CWR22) and four relapsed tumors. Prostate 41, 7 (1999). 
                                                                                                  13 

 

47.    P. P. Rose, B. T. Korber, Detecting hypermutations in viral sequences with an emphasis 
       on G ‐‐> A hypermutation. Bioinformatics 16, 400 (2000). 
48.    M. A. Larkin et al., Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947 (2007). 
49.    I. Milne et al., TOPALi v2: a rich graphical interface for evolutionary analyses of multiple 
       alignments on HPC clusters and multi‐core desktops. Bioinformatics 25, 126 (2009). 
 
                                  Supplemental Fig. S1:
                           Short Tandem Repeat (STR) Analysis



                           Xenografts:
                                                             22Rv1                          CWR-R1
               736, 777, 9216R, 9218R, 8R, and 8L
     locus       alleles     frequency, 1 in ___  alleles   frequency, 1 in ___   alleles   frequency, 1 in ___
    D5S818*      11, 12              3.91          11, 13          9.50           11, 12           3.91
    D7S820 †     9,10,11            11.60         9,10,11         11.60           9,10,12         11.60
    D13S317        8, 12            15.94           9, 12         26.39             8, 12         15.94
    D16S539      12, 12              9.77          12, 12          9.77            12, 12          9.77
     TH01          6, 9.3            7.39          6, 9.3          7.39            6, 9.3          7.39
     TPOX          8, 8              4.11           8, 8           4.11              8, 8          4.11
    CSF1PO       10, 11              5.86          10, 11          5.86            10, 11          5.86
Random Match
Probability, 1 in ___ :          1,259,877                      5,062,112                       1,259,877

Random chance that
the xenografts and
22Rv1 or R1 would have
                                                                           -13                             -13
the same allele pattern:                                        1.6 X 10                        6.3 X 10

*STR analysis at locus D5S818 was not determined for sample 736.
†
 Frequency for D7S820 was determined using only the 9 and 10 allele frequencies.
                    Supplemental Fig. S2: Primers used for PCR
          XmU3f                     midX1f
                             18f                                   8fsa
       U3f F1f Xe2f                       F2f            1bf                           U3f
                                    G2f          4257f
C12_1f        Xe1f          24f
                                                                          envOUT1f
                                                                    8f
                                                     M19f
          LTR                                                                          LTR
                  GAGr               midX2r        4847r
                                                                         G3r       F2r U3r C12-4r
                                                                    8r
          U3r 129_1r                       F1r           13r
            U5rsa                                                                        U5rsa
Primer:                  Sequence                              5’ nucleotide position#       1    2    X
 U3f      5’-GTTTAATTAAAGAATAAGGCTGAATAAC-3’                                   7826          +    -    +
 13r      5’-ATGTCTTCTAACAGCTTTTTGGACACG-3’                                    5108          +    -    +
 18f      5’-GGCAGAGGATGAGCAGAGAGAGAG-3’                                       1974          -!   +    +
 24f      5’-AAGAAAAGGGACACTGGGCTAAGG-3’                                       2129          +    +    +
 1bf      5’-AGGCATTCCCGACCAAGCG-3’                                            5048          +    -    +
 8r       5’-CTGGATGCTACCGGAGCCC-3’                                            6284          +    -    +
 8f       5’-GGGCTCCGGTAGCATCCAG-3’                                            6266          +    -    +
 U3r      5’-CCCCTTTTTTATAGGGCTAGGAC-3’                                        8096          -!   -    +
 8fsa     5’-CCTGTTTTGATTCCTCAGTGGG-3’                                         6247          +    -    +
 U5rsa    5’-TCTGAGGAGACCCTCCCAAGG-3’                                           112          +    +    +
 F1f      5’-GCGCCAGTCATCCGATAGACTGAGTCGCCCGGGTAC
           CCGTGTTCCCAATAAAGCC-3’                                                  1         +    -    +
 F1r      5’-GCCGACGCCAAGGTCCCAGTTTTTGCGTTAGGACGC
           CTTTGGCGTAGCCCTGCTTCTCGTCGACAAAGAGTTC-3’                            3754          -    +    +
 F2f      5’-GAACTCTTTGTCGACGAGAAGCAGGGCTACGCCAAA
           GGCGTCCTAACGCAAAAACTGGGACCTTGGCGTCGGC-3’                            3682          -    +    +
 F2r      5’-TTGCAAACAGCAAAAGGCTTTATTGGGAACACGGGT
           ACCCGGGCGACTCAGTCTATCGGATGACTGGC-3’                                 8185          +    -    +
 XmU3f    5’-GTCCTAGCCCTATAAAAAAGGGG-3’                                        8074          -    -    +
 G2f      5’-CCCTTATACCCGCTCACCAAGAC-3’                                        3550          +    -    -
 G3r      5’-TGGAGCTGCTCAAATTGTTGGG-3’                                         7204          +    -    -
 Xe1f     5’-GTGGCCCAATCAGTAAGTCCGAG-3’                                         410          +    -    -
 Xe2f     5’-CACTCCCTTGAGTCTGACCCTTG-3’                                         630          +    -    -
 GAGr     5’-TCCCCCAACAAAGCCACTCCA-3’                                           473          -    +    +
 midX1f   5’-TTGTCGACGAGAAGCAGGGC-3’                                           3689          -    +    +
 midX2r   5’-TGCGTTAGGACGCCTTTGGC-3’                                           3731          -    +    +
 envOUT1f 5’-CTGACCCAACAGTATCACCAACTC-3’                                       7629          +    +    +
 C12_1f   5’-TGCTGGACAGAATCTCTGGTCTCT-3’                                       Ch12          -    -    -
 C12_4r   5’-GATACTCAAGTGGTTCCCACCC-3’                                         Ch12          -    -    -
 129_1r   5’-GCGGTTTCGGCGTAAAACCGAAAGCA-3’                                      537          -    +    +
 4847r    5’-CTTTGCTGGCATTTACTTGGGCA-3’                                        4909          +    -!   +
 4257f    5’-GATGGCAGAAGGTAAGAAGCTAAATGTTTA-3’                                 4296          +    -!   +
 M19f     5’-TGGCCTTACTGAAAGCTCTCTTCC-3’                                       4436          -    +    -

 #: 5’nucleotide position relative to XMRV-22Rv1 (Acc. FN692043).
 -!: primer has mismatches with the proviral genome, but was able to amplify
     the proviral sequence.
                         Supplemental Fig. S3: Location of Cloned PCR Products
                            Used for Sequencing and Sequence Coverage


                                            A
                                                        gap
                                                                                 XMRV
                                                LTR                                                        LTR
                                                                 gag
                                                                              gag-pro-pol
                                                                                                   env

                                            22Rv1*
                                                20x                                                              F1f-F1r
                                                                               20x                               F2f-F2r
                                                                                              7x                 8fsa-U5rsa
                                            CWR-R1               4x                                              18f-13r
                                                11x                                                              F1f-F1r
                                                                               17x                               F2f-F2r
                                                                                              8x                 8fsa-U5rsa
                                            2152                 6x                                              18f-13r
                                                                  8x                                             24f-13r
                                                                                            30x                  8f-U3r
                                            2524, 2272, 2274
                                                                                            26x                  8f-U3r


B                                                                                           C
                              PreXMRV-1                                                                  gap               PreXMRV-2
     LTR                                                               LTR                         LTR                                               LTR
                Δgag                                                                                             gag
                                   Δ-pro-pol                                                                               gag-pro-pol
                                                          env                                                                                  env



    99.8%      90%                              99.9%            91% 99.8%                         92%             99.9%                 88%      99% 94%
                     Δ16 fs
        337                          3886                     7097 7693                              307                          3933         7073 7753
777, 736, 9216R, 9218R, 8R, 8L
24x                                                                                         DBA/2J
                                                                             U3f-13r
                28x                                                          18f-13r         3x                                                             C12_1f - 129_1r
                  8x                                                         24f-13r         1x                                                             C12_1f - midX2r
                                            114x                             3f-8r           2x                                                             C12_1f - 4847r
                                         47x                                 1b-8r                                           1x                             midX1f - C12_4r
                                               37x                           8f-U3r                                               1x                        4257f - C12_4r
                                               28x                           8fsa-U5rsa
                              9x                                             G2f-G3r        NCR, Hsd, NIH-III, BTBR, NUJM, SJLSmn.AK
CWR-R1                                                                                      46x                                                             C12_1f - 129_1r
         8x                                                                  X1f-13r
          8x                                                                 X2f-13r        736, 777, 8R, 8L
                               8x                                            G2f-G3r         4x                                                             C12_1f - 129_1r
2524, 2274                                       3x                          8f-U3r         2272, 2274
                                                                                                                                                            C12_1f - 129_1r
NU/NU, Hsd                                                                                  29x
    8x                                                                       U3f-13r
                                         16x                                 1b-8r
                                                 11x                         8f-U3r
                                                 13x                         8f-U5rsa
                              12x                                            G2f-G3r
                   Supplemental Fig. S4:
                XMRV-Negative Mouse Strains

Laboratory mice             Wild-derived mice

Strain (n=45)               Subspecies          Strain (n=44)

129P1/ReJ                   M. m. domesticus    SF/CamEi
129P3/J                                         SK/CamEi
129S1/SvImJ                                     SK/CamRk
129X1/SvJ                                       PERA/Ei
A/J                                             PERC/Ei
AKR/J                                           CALB/Rk
AKR/J nude                                      WSB/Ei
B6.129/J                                        BIK
B6CByF1/J nude                                  ZALENDE/Ei
BALB/cByJ                                       TIRANO/Ei
BALB/cJ                                         Poschiavinus
BALB/c nude                                     BFM
BTBR/J                      M. m. castaneus     CTA
C3H/HeJ                                         CASA/Rk
C57BL/6J                                        CAST/Ei
C57L/J                      M. m. musculus      CZECH/I
C58/J                                           CZECH/II
CBA/J                                           SKIVE/Ei
CByB6F1/J nude                                  MPB
CByJ.Cg/J nude              M. m. molossinus    MOLC
CE/J                                            MOLD/Rk
CWD/LeJ                                         MOLE/Rk
DBA/1J                                          MOLF/Ei
DBA/2J                                          MOLG/Dn
HRS/J                                           MSM/Ms
HSD nude*                                       JF1/Ms
I/LnJ                       M. spretus          SFM
LP/J                                            SPRET/Ei
MA/MyJ                      M. spicilegus       J131
NCRNU-M*                                        PANCEVO/Ei
NFS/N                                           ZRU
NIH Swiss*                  M. caroli           KAR
NIH-III nude*                                   CAROLI/Ei
NU/J                                            J135
NU/NU*                      M. cookii           COK
NUJM nude                                       J136
NZB/BINJ                    M. cervicolor       CRV
P/J                                             J53
RIIIS/J                     M.   platythrix     PTX
SJL/J                       M.   bactrianus     BIR
SJLSmn.AK nude              M.   famulus        FAM
SM/J                        M.   macedonicus    XBS
ST/bJ                       M.   dunni          MDTF
STOCK Ces1c/J nude          M.   pahari         Mus pahari/ Ei
SWR/J
                                        S5A: Phylogenetic analysis of full-length genomes


                                                                                                       PreXMRV-1




                                                                                                                   PreXMRV-1/2 recombinant
                                                                                                                   XMRV-22Rv1/CWR-R1
                                                                                                                     XMRV-VP42
     0.03                                                                                                            XMRV-VP35
                                                                                                                    XMRV-VP62
                                                                                                                     XMRV-WPI-1106
                                                                                                                    XMRV-WPI-1178




                                                                                                                                             PreXMRV-2




                  LTR                                                     LTR
                                gag
                                          gag-pro-pol
                                                              env



     XMRV

  PreXMRV-1
                    337                       3886

  PreXMRV-2                                                                        PreXMRV-1/2 recombinant
                                                                                   XMRV-22Rv1/CWR-R1
                    307                        3933           7073                   XMRV-VP42
                                                                                     XMRV-VP35
                                                                                    XMRV-VP62
                                                                                     XMRV-WPI-1106
                                                                                    XMRV-WPI-1178




                     S5B: Phylogenetic analysis of XMRV and PreXMRV-1 homology


                                                                                                                                     XMRV-VP35
                                                                                                                                     XMRV-22Rv1/CWR-R1
                                                                                                                                      PreXMRV-1
                                                                                                                                      XMRV-WPI-1106
                                                                                                                                      XMRV-WPI-1178
                                                                                                                                      XMRV-VP62
                                                                                                                                      XMRV-VP42




     0.05
                                                                                                                   PreXMRV-2




            LTR                                                     LTR
                          gag
                                      gag-pro-pol
                                                        env


                                                                                XMRV-VP35
   XMRV                                                                         XMRV-22Rv1/CWR-R1
                                                                                 PreXMRV-1
PreXMRV-1                                                                        XMRV-WPI-1106
              337                         3886
                                                                                 XMRV-WPI-1178
                                                                                 XMRV-VP62
PreXMRV-2                                                                        XMRV-VP42
              307                         3933          7073
          S5C: Phylogenetic analysis of XMRV and PreXMRV-2 homology



                                                 PreXMRV-1




0.03

                                          XMRV-22Rv1/CWR-R1
                                          PreXMRV-2
                                           XMRV-VP42
                                             XMRV-VP35
                                            XMRV-WPI-1106
                                            XMRV-WPI-1178
                                            XMRV-VP62




                                                                          LTR                                          LTR
                                                                                   gag
        XMRV-22Rv1/CWR-R1                                                                 gag-pro-pol
                                                                                                                env
        PreXMRV-2
         XMRV-VP42
           XMRV-VP35                                             XMRV
          XMRV-WPI-1106
          XMRV-WPI-1178                                       PreXMRV-1
          XMRV-VP62
                                                                           337                 3886

                                                              PreXMRV-2
                                                                           307                 3933             7073




              S5D: Phylogenetic analysis of the U3-R region of 3’-LTR


                             XMRV-22Rv1/CWR-R1
                             PreXMRV-1
                             XMRV-WPI-1106
                             XMRV-WPI-1178
                             XMRV-VP62
                             XMRV-VP42
                             XMRV-VP35                            XMRV-22Rv1/CWR-R1
                        PreXMRV-2
                                                                  PreXMRV-1
                                                                  XMRV-WPI-1106
                                                                  XMRV-WPI-1178
                                                                  XMRV-VP62
       0.07                                                       XMRV-VP42
                                                                  XMRV-VP35



                                                                                 LTR                                          LTR
                                                                                         gag
                                                                                                  gag-pro-pol
                                                                                                                       env



                                                                     XMRV

                                                                  PreXMRV-1
                                                                                  337                   3886

                                                                  PreXMRV-2
                                                                                  307                   3933           7073
                             Supplemental Fig. S6:
           PreXMRV-1 and PreXMRV-2 Distribution in NU/NU Retired Breeders


A                                                                                        C
                                     PreXMRV-1                                                                  NU/NU




                                                                                                                                            22Rv1
           LTR                                                          LTR
                          Δgag




                                                                                                                                Hsd
                                         Δ-pro-pol




                                                                                                                                      neg
                                                               env
                                                                                                            1   2   3   4   5

                                                                                                   XMRV
          99.8%       90%                              99.9%      91% 99.8%
                            Δ16 fs
              337                          3886                7097 7693
     NU/NU                                     14x                            1b-8r      PreXMRV-1 + XMRV
                                                       10x                    8fsa-U3r

                                                                                               PreXMRV-2
B                   gap                  PreXMRV-2
             LTR                                                         LTR
                            gag
                                         gag-pro-pol
                                                                env                            mouse IAP


              92%                99.9%                   88%        99% 94%
                307                           3933               7073 7753

    NU/NU
    17x                                                               C12_1f - 129_1r
             Supplemental Fig. S7A: Predicted Regions of RT
                      Template Switching Events


                       7693
                     TAAAT GATTTTATTCAGTTTCC............CCATAAGGCTTAGCA CGCTA
             1       TAAAA GATTTTATTCAGTTTCC............CCATAAGGCTTAGCA AGCTA
                                                                       7753
                                               7557
                     GATAG TACTTTTATTAATCCTACTC CTCGG
             2       GATAA TACTTTTATTAATCCTACTC TTCGG
                        7536
                        7432
                     AACCT GAGACAAAAATTGTTCG............CCATGGTTCACGACC CTGAT
             3       AACCA GAGACAAAAATTGTTCG............CCATGGTTCACGACC TTGAT
                                                                       7506
                                                  7097
                     AAACT AAATATAAAAGAGAGCCGGTGTC TTTAA
             4       AAACC AAATATAAAAGAGAGCCGGTGTC ATTAA
                        7073
                       3886
                     CATCT TGGCCCCCCATGCGGTAGAAGCACTGGTCAAACAACCCCCTGACCG TTGGC
             5       CATTC TGGCCCCCCATGCGGTAGAAGCACTGGTCAAACAACCCCCTGACCG CTGGC
                                                                         3933
                                                         337
                     AGTTA GCTAACTAGATCTGTATCTGGCGGTTCCG TGGA
             6       AGTTG GCTAACTAGATCTGTATCTGGCGGTTCCG CGGA
                        307




             Supplemental Fig. S7B: XMRV Sequence Diversity

LTR              gag                                                           LTR
                                      gag-pro-pol                 env

                                                                                      XMRV consensus
       790                                                       6698 7154     8092
                                                                                      hypothetical
                                                                                      recombinant
                                                                                      22Rv1

  375     1109            2602                                         7356           CWR-R1
    450 1013 1477       2599                 4781 5082             7063
                                                   5086
                                       4159                                           VP35
              1565         2622      3795 4229-31             6550
                                           4235
                                                                           7699
                                                                                      VP42
                 1824                                                   7455 7782

                                             4889
                                                                                      VP62
                         2418                   4990 5835               7441
                                                                                      WPI-1106
                                                      5827 6377
                                                                                      WPI-1178


 0                  2000              4000                6000                 8000 nt position
                                              Supplemental Fig. S8: Probability of Observing a
                                              Recombinant with a Specific Set of 6 Crossovers




                                         3.5 x 10 -12
Probability of observing a recombinant
  with a specific set of 6 crossovers




                                         3.0 x 10 -12

                                         2.5 x 10 -12

                                         2.0 x 10 -12

                                         1.5 x 10 -12

                                         1.0 x 10 -12

                                         5.0 x 10 -13

                                                 0.0
                                                        0          2        4        6         8       10

                                                            Average number of recombination events/genome

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:9
posted:1/22/2012
language:English
pages:22