Docstoc

The Use of Zinc Finger Nucleases to Manipulate the Genome of

Document Sample
The Use of Zinc Finger Nucleases to Manipulate the Genome of Powered By Docstoc
					 Using Zinc Finger Nucleases to
Manipulate the Mammalian Genome


              Matthew Porteus
     UT Southwestern Medical Center
   Depts. of Pediatrics and Biochemistry
                 Dallas, TX
   Gene Targeting is a Precise
     Recombination Event
   Definition: Gene targeting is the replacement of
  genomic DNA with exogenous DNA by homologous
                   recombination.

  Commonly Used For Experimental Purposes in
certain cell types (yeast, chicken DT40 cells, murine
                embryonic stem cells)

 In addition to its usefulness for mammalian somatic cell
  genetics, it could also be an ideal way to treat genetic
                          diseases.
   GFP Gene Targeting System
                         37GFP-IRES-CD8
CMV-Sce



            37GFP-IRES-CD8




   CMV/CBA-GFP*-IRES-CD8a-PGK-Neo



       Stop-Sce Site
      Stop-Sc eSite
          DSB-Induced Gene Targeting




             CMV/CBA-GFP-IRES-CD8a-PGK-Neo




             Optimized Rate=3-5%
 (30-50,000 events per million transfected cells)



Porteus and Baltimore (2003)
         Two Components for
       DSB-Induced Homologous
            Recombination

1. Repair Substrate: Fragment of DNA that serves as
   template for repair of DSB by homologous
   recombination.

2. Nuclease: Enzyme to create DSB in target gene.
Schema of DSB-Induced Gene Conversion
         S
                          Undamaged DNA (Allele S)


                          DSB Created (spontaneous
                           or induced, e.g. by ZFN )


                       Strand Invasion into Undamaged
                          Homologous DNA (Allele A)
                  In gene targeting exogenous DNA serves as
                            homologous DNA donor.
         A


                   Repairing of original strands of DNA. Gaps
                   filled by DNA polymerase and nicks sealed
                                 by DNA ligase.


         A          Conversion of Blue Allele(“S”) into Red
                        Allele (“A”) in region of DSB
   Endogenous Genes Do Not
   have Recognition Sites for
    Homing Endonucleases

1. Modify Homing Endonucleases to Recognize
   new target sites.
2. Use Zinc Finger Nucleases
   Zinc Finger Nucleases as Potential Reagents to
   Create Double-Strand Breaks in Normal Genes




                              FokI nuclease
                               domain (Fn)




                              FokI nuclease
                               domain (Fn)




Initially developed by labs of Srinivasan Chandrasegaran (Johns Hopkins)
                        and Dana Carroll (Univ. Utah)
    ZFN Full Site/Sce Site

 CMV/CBA       GFP*    IRES    CD8    WRE

      tGFP                     Sce or ZFN
                               Expression
  GFP Donor                     Plasmid




CMV/CBA    G     FP     IRES    CD8    WRE
             tGFP




CMV/CBA      GFP      IRES     CD8    WRE
       Model Zinc Finger Nucleases
        Stimulate Gene Targeting
                                           Zif Site
                        QQR Site    6                     Sce Site

      7000
      6000                 4785                        4150
      5000
      4000
      3000
      2000
      1000                          14       53
         0
                           Sce     QQRL0     Zif      QQRL0/Zif
Porteus and Baltimore (2003)
   Continuous Expression of ZFNs
        causes Cytotoxicity
Time Course of Gene Targeting Using Sce
                      2.0
   Relative Rate of
   Gene Targeting




                      1.5

                      1.0

                      0.5

                      0.0
                            0   1   2   3       4   5   6    7    8   9   10    11   12   13   14   15




Time Course of Gene Targeting Using Zinc Finger Nucleases
               6000
                                                        QQRLO-CN/Zif-CN with
               5000                                     Target QQR/Zif
               4000                                     QQRLO-CN with Target
                                                        QQR6
               3000
               2000
               1000
                  0
                            0               5               10             15
 Can we design a pair of zinc
finger nucleases to stimulate
gene targeting in a real gene
   in human somatic cells?
Zinc Fingers Bind Triplets




        FokI nuclease
         domain (Fn)




        FokI nuclease
         domain (Fn)
       How to assemble a new zinc
             finger protein?
1. By altering the contact residues one can alter the target
   triplet.
2. By mixing different fingers one can assemble a zinc finger
   protein with new target site specificity.
3. Theoretically if one had zinc fingers for all 64 possible
   triplets one could assemble a zinc finger protein to
   recognize any sequence.
      Zinc fingers have been published that recognize all 16
       GNN,ANN, CNN triplets.
      But, the GNN fingers are best.
Can we assemble a pair of zinc
 finger nucleases to stimulate
        gene targeting?


          Full Site Consensus Sequence

       5’ nnCnnCnnCnnnnnnGnnGnnGnn 3’

 (GNNGNNGNN inverted repeat separated by 6 bp)

Such a sequence occurs in both GFP (twice) and CD8

                   Lucky, eh?
Empiric Design of
  Zinc Finger
  Nucleases
   (assembly
   approach)




  From Liu et al. (2002)
     Gene Targeting with Zinc Finger
           Nucleases to GFP

                     Fn      GFPZF2
5’ acC atC ttC ttc aag Gac Gac Ggc aac stop-Sce site tac
3’ tgG taG aaG aag ttc Cgc Ctg Ccg ttc
     GFPZF1         Fn

                     Finger1      Finger2        Finger3

   GFPZFN-1         QSSHLTR TRGNLVR QSGNLAR
                    (ggt) (gat) (gaa)

   GFPZFN-2 DRSHLTR DRSNLTR DRSNLTR
        (ggc) (gac) (gac)
 GFP ZFN Site         Sce Site



 CMV/CBA       GFP*     IRES     CD8    WRE

       tGFP                      Sce or ZFN
                                 Expression
  GFP Donor                       Plasmid




CMV/CBA    G     FP      IRES     CD8    WRE
              tGFP




CMV/CBA       GFP      IRES      CD8    WRE
Gene Targeting with Zinc
Finger Nucleases to GFP

                             6000
                                    4543
 Million Transfected Cells
  GFP Positive Cells per




                             5000


                             4000


                             3000


                             2000
                                              1071
                             1000


                                0
                                    Sce      GFP-CN
                                    Sce    GFPZF1-Fn
                                           GFPZF2-Fn
      CD8 Knockout Using Zinc
         Finger Nucleases

                            Fn     CD8ZF2
bp 441 5’acc ggCgcCcaC catcgc GtcGcaGcc ctg 3’ bp 471
     tgg ccGcgGgtG gtagcg CagCgtCgg gac
               CD8ZF1        Fn
           Knockout of CD8 transgene Using
              CD8 Zinc Finger Nucleases
                                                      85% CD8
 Cell Line     CMV/CBA   GFP*      IRES     CD8       Positive


   CD8
                            16% CD8 Negative       10/10 clones
Knockout         M1
                                                       CD8+
 Plasmid




    CD8
 Knockout                       80% CD8 Negative    0/12 clones
                  M1
  Plasmid                                              CD8+
     +
 CD8 ZFNs
   Demonstrates in Principle

1. Can make somatic cell knock-outs with
   ZFNs
2. Can do targeted transgenesis with ZFNs.
  i.e. Substitute gene of interest for
     selectable marker (or both. . .) and
     insert into pre-selected, “safe” and
     “permissive” genomic location.
How far from the site of the
break can you get targeting?
Co-conversion of Markers by Gene Targeting


                            37GFP-IRES-Puro-IRES-CD8
CMV-Sce



            37GFP-IRES-Puro-IRES-CD8




   CMV/CBA-GFP*-IRES-CD8a-PGK-Neo



        Stop-Sce Site
       Stop-Sc eSite
     Frequency of Co-Conversion using DSB Mediated
                     Gene Targeting




           CMV/CBA-GFP-IRES-Puro-IRES-CD8a-PGK-Neo




                      Day 3         Day17          Fold Change
                    (no puro)   (puro selection)
% GFP + Cells         0.041%         58%             1400
Total GFP + Cells      1200          66              (-18)

% GFP + Cells         0.013%         17%             1200
Total GFP + Cells       405          2               (-200)
            Demonstrates:

1. Can get targeting at a distance (up to 400
   bp) from site of DSB (at a price).
2. Can do co-conversion
  i.e. Correct mutation at one location and
     insert gene that confers selective
     advantage nearby.
   Can we design zinc finger
  nucleases to stimulate gene
targeting in a gene that causes
        human disease?

 Collaboration with Sangamo Biosciences (Richmond, CA)
         Human Interleukin-2 Receptor
        Common Gamma Chain Deficiency
                  (IL2RG)
1.   Part of Receptor Complex for IL-2, IL-4, IL-7, IL-9, IL-15, IL-21. . .
2.   On X-chromosome
3.   Mutations in which are the most common cause of SCID (severe combined
     immunodeficiency)
     -25% of mutations lie in Exon 5.
4.   Selective Advantage for corrected cells.
5.   Treatment
         -Bone Marrow Transplantation
                : Allogeneic (sibling)
                : Haploidentical (parent)
         -Gene Therapy
                : Alain Fischer trial in France
                : Ooops, leukemia.
           ZFN Gene Correction
            at the IL2RG gene
                             IL2RG ZFN-R
5’CTACACGTTTCGTGTTCGGAGCCGCTTTAACCCACTCTGTGGAAGTGCTC 3’
3’GATGTGCAAAGCACAAGCCTCGGCGAAATTGGGTGAGACACCTTCACGAG 5’
               IL2RG ZFN-L




  GFP Gene Targeting Reporter for IL2RG ZFNs


     5’ GFP        IL2RG site   Sce site   3’ GFP

      Target site of GFP ZFNs
Stimulation of Gene Targeting Using ZFNs
           for the IL2RG Gene


                             2500
 Million Transfected Cells


                                       1968
 GFP Positive Cells per




                             2000



                             1500

                                                    715

                             1000



                             500



                               0
                                     5-8L0/5-9L0   M16/M17
                                    IL2RG ZFN-L     GFP
                                    IL2RG ZFN-R     ZFNs
                                   Optimization of IL2RG ZFN-L

                            5000
Million Transfected Cells


                                                                     3892
GFP Positive Cells per




                            4500

                            4000
                                                      2897
                            3500

                            3000

                            2500
                                        1276
                            2000

                            1500

                            1000

                            500

                              0
                                    IL2RG ZFN-R   IL2RG ZFN-R    IL2RG ZFN-R
                                    IL2RG ZFN-L   IL2RG ZFN-L(D) IL2RG ZFN-L(G)
                                    Optimization of cgc ZFN-R

                            5000
Million Transfected Cells


                                                                         4420
GFP Positive Cells per




                            4500

                            4000

                            3500
                                     2943       2940
                            3000                                                                  2689
                                                             2656
                            2500
                                                                                      1937
                            2000

                            1500

                            1000

                            500

                              0
                                        1          2
                                   cgc ZFN-LG cgc ZFN-LG        3
                                                           cgc ZFN-LG       4
                                                                        cgc ZFN-LG   cgc 5
                                                                                         ZFN-LG   cgc6ZFN-LG
                                   cgc ZFN-R cgc ZFN-R     cgc ZFN-R    cgc ZFN-R    cgc ZFN-R    cgc ZFN-R
                                      (A)         (B)          (C)        (D)          (E)
                   4-Finger Zinc Finger Nucleases Seem
                         to Have Less Cytotoxicity

                            6000
Million Transfected Cells
GFP Positive Cells per




                            5000


                            4000


                            3000


                            2000


                            1000


                               0

                                   Day3   Day5   Day7
      Experimental Design to
        Detect Targeting at
     Endogenous IL2RG Locus
1. Transfect K562 cells with IL2RG ZFNs with
   repair substrate that contains BsrBI
   polymorphism.
2. Isolate individual clones (no selection).
3. Expand individual clones (no selection).
4. Harvest genomic DNA from individual clones.
5. Analyze genomic DNA for BsrBI
   polymorphism.
   Bi-Allelic Targeting in Human Somatic Cells
                      (K562)

bB BB           bB               bB bB




                                          Total clones:   76
                                            Corrected:    14 (18%)
  bB                 BBBB     bB                    bB:    9 (11.5%)
                bB          BB                     BB:     5 (6.5%)




                            BB     bBbB
             Future Directions
1. Design ZFNs to other target genes.
2. Develop efficient method to make specific
   ZFNs that recognize a broad range of
   sequences.
3. Refine ZFNs for use in primary cells, including
   stem cells.
4. Assess possible induction of genomic
   rearrangements by ZFNs.
   I.   Eliminate
   II. Use as a tool to study sequence specific
       DSBs in genetic instability.
5. Develop as a therapeutic tool.
      Potential Applications to
          Aging Research
1. Audience will be more clever than I.
2. Use as an experimental tool to study genetics
   of aging in mammalian cells.
3. Create allele specific gene variants in stem
   cells that are associated with slower “aging.”
                     Thank You

UT Southwestern                        Sangamo Biosciences
Patrick Connelly                             Fyodor Urnov
Ruth Ebangit                                Michael Holmes
Brian Ellis                                    Jeff Miller
Shondra Pruett                              Philip Gregory
Kimberly Wilson                               Casey Case


Funding
Burroughs-Wellcome Fund Career Development Award
NIH Career Development Award
UT Southwestern Medical Center

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:9
posted:1/18/2012
language:English
pages:40