Docstoc

techniques

Document Sample
techniques Powered By Docstoc
					MB Techniques
    DNA Amplification techniques
Techniques used to produce million of
copies of a specific DNA sequence by
imitating replication.
      PCR             Cloning
  Invitro           Invivo
  amplification:    amplification: in a
  in a test tube    host living cell
What is PCR?

   Kary Mullis
   Nobel and Japan Prizes in
   1993
   A revolutionary innovation
   which become a standard
   procedure in biotechonology
   and medical diagnostic lab.


Sanaa Eissa
Why PCR?
Sensitivity: PCR generates large amounts
of genetic material from a slight trace
which is too small to be analyzed
                                  We love
                                  biochemis
                                  try
       We love
       biochemis
       try           Xerox

                         PCR

                   PCR

 undetectable                  detectable
How PCR Works?
          By imitating replication
   Replication               PCR
   Unwinding by helicase     Unwinding by high temp
                             (denaturation)
   Primers to initiate DNA   Primers to initiate DNA
   synthesis                 synthesis (annealing)
   DNA pol.extend the        Heat stable DNA
   primer and complete       pol.extend the primer
   DNA synthesis             and complete DNA
                             synthesis (extension)
How
PCR
Works?




Sanaa Eissa
Sanaa Eissa   Sanaa Eissa     Sanaa Eissa   Sanaa Eissa

                            PCR

      Steps: 30 cycles each is formed of 3
      steps:
      1- Denaturation: separation of 2 DNA
      strands apart by heating to 95 C
      2- Annealing: binding of primers to
      template (SSDNA) at lower temp 55C
      3- Extension: Polymerization and new
      strand synthesis at 72C
Sanaa Eissa
Sanaa Eissa   Sanaa Eissa     Sanaa Eissa   Sanaa Eissa

                            PCR
      Requirements:
      1- DNA template (sample)
      2- Taq pol (heat stable): isolated from
      thermus aquaticus bacterium which
      naturally lives in very hot atmosphere
      3- dNTPs
      4- Primers: very specific to the DNA
      sequence to be amplified.
       Detection of PCR Product


Electrophoresis   Southern                   Sequencing
                             Hybridization
                  blotting




Sanaa Eissa
Sanaa Eissa   Sanaa Eissa   Sanaa Eissa   Sanaa Eissa

              PCR Applications
  I. Diagnosis;
  1- Genetic defects e.g. Prenatal and
     neonatal diagnosis of genetic
     diseases
  2- Detection of microoragnisms e.g HCV
  3- Cancer : detection of abnormal genes
 II. Forensic: to follow acused person even
 from a very small sample e.g hair
III. Archology: study of ancient DNA
Sanaa Eissa   Sanaa Eissa   Sanaa Eissa   Sanaa Eissa




                  PCR
Sanaa Eissa   Sanaa Eissa       Sanaa Eissa   Sanaa Eissa




                            RT-PCR
  DNA Amplification techniques

   PCR
Invitro
amplification:     Cloning
in a test tube
                 Invivo
                 amplification: in a
                 host living cell
       DNA Cloning
Invivo DNA amplification
by introduction of a specific gene
into a replicating cell to produce
many copies of this gene:
                       Cloning
1-Molecular scissors   A specific Gene (DNA
(restriction           fragment) to be amplified is
endonucleases)         separated e.g insulin gene


                The DNA fragment is inserted
  2-Vectors     into a DNA carrier  forming
  & ligase
                Recombinant DNA  that is able
                to enter a living cell (host cell)

                        Selection of host cell that
                        accepted the DNA
       1-Restriction endonucleases
       5’   GAATTC C TTAG          3’

       3’   C T T A A G G A A T C 5’


  Restriction endonucleases: are
  molecular sites are sequences of 4,6,8
Restriction scissors recognize specific
  DNA sequences palindrome pattern
bases that have acalled restriction sites
  and from 2 cuts one in each strand
(read make right the same as from left
direction e.g noon, dad)
   5’   GAATTC C TTAG             3’

        C TTAAGATTC G


            endonucleases are
Restriction endonucleases:may produce
molecular scissors with sticky single
2 DNA fragments recognize specific
DNA sequences called restriction sites
stranded ends
and make 2 cuts one in each strand
       GAAGGC C TTAG             3’

       CTTCCGGTTCG


Restriction endonucleases may produce
2 DNA fragments with blunt double
stranded ends
Recombinant
DNA
Uses of restriction endonucleases
1- using a panel of restriction
endonucleases a DNA  a family
of fragments with different lengths
can be separated by electrophoresis
(restriction map)
Uses of restriction endonucleases

2- some fragments are unique for
each individualDNA fingerprint
test & paternity test.
Uses of restriction endonucleases

3- some fragments are unique for
specific genetic deletions


4- In cloning : separation of a
specific DNA fragment e.g insulin
gene to be clonned for furthur use
in therapy
             2-Vectors
 A molecule of DNA that will carry the
 gene or DNA fragment to be clonned
Essential features of vectors:
1- capable of replication inside the host cell
2- must contain a restriction site
recognized by restriction endonucleases
3- must contain a marker gene, to trace
the vector after insertion ( to know which
host cell accepts the vector) e.g antibiotic
resistance gene can be a marker.
             Types of Vectors
1-Plasmids:
1- small circular extrachromosomal DNA
2- replicate independent of chromosomal
DNA
3- contain a restriction site recognized by
restriction endonuclease
4- contain a marker gene, to select the
bacteria containing recominant DNA e.g
antibiotic resistance.
5- can be readily isolated from bacterial cells
and reintroduced into them
                   Plasmid
                    Inserted
                      DNA
                  Restriction
                  endonuclease
                  sequence

                     A A T
                    G TTA TC
                     C     A
                             G
Tetracyclin                           Ampicillin
resistance                            resistance
gene                                  gene

              Origin of replication
                   Vectors
2-Viruses:
e.g retroviruses
3-Cosmids:
Are artificial recombinant plasmid:
1- has useful features of both plasmid &
bacteriphage  (virus infecting bacteria).
2- can insert larger DNA fragment up to
50 kbP ( bP=base pair,we measure DNA
length by the number of base pairs)
Steps of cloning
                                 DNA
                 GAATTC C TTAG
                 C TTAAGATTC G

1.DNA is cleaved with a
specific restriction enzyme to
separate a specific gene or
DNA fragment to be clonned
                                 DNA
                      AATTC C TTAG
            ligase
                                 GATTC G

         AGC TGAATTC G
Vector
         TC GAC TTAAGC
 3.DNA is cleaved with the
2.Vector fragment is joined
                Recombinant DNA,hybrid,
                 enzyme
same restrictionby Ligase
 to the vector chimeric DNA
                                  ligase
                    Inserted
                      DNA
                   Restriction
                   endonuclease
                   sequence

                     A A T
                    G TTA TC
                     C     A
                             G
Tetracyclin                           Ampicillin
resistance                            resistance
gene                                  gene

              Origin of replication
    Host cell accepts the recombinant DNA
      Introducing recombinant DNA into
    is identified by resistance to ampicillin.
      host cell e.g E.coli
    E.coli replicates and multiplies




E.Coli grow in         E.Coli Die in presence
presence of ampicillin of ampicillin
                                     Sanaa Eissa
          Uses of cloning and
      recombinant DNA technology
Production of useful proteins in drug
industry e.g insulin, erythropiotin,
interferons, growth hormone,
antihemophilic factor VIII, hepatitis
B vaccine
Sanaa Eissa   Sanaa Eissa    Sanaa Eissa   Sanaa Eissa




                        Cloning movie
             PCR             Cloning
Definition   Invitro DNA Invivo DNA
             amplification ( amplification ( in
             in a test       a living cell)
             tube)
Primers      Yes             NO
dNTPs        Yes             No
Vectors      NO              Yes
Host cell    No              Yes
Enzymes      Taq pol         restriction
                             endonucleases,
                             DNA ligase
steps 30 cycles of 3 steps:   1.DNA is cleaved with a specific
      1- Denaturation:        restriction enzyme
      separation of 2         2.Vector e.g plasmid is cleaved
      DNA strands by          with the same restriction enzyme
      heating 95C            3.DNA fragment is joined to the
      2- Annealing:           vector by Ligase a recombinant
      binding of primers      DNA is formed.
      to template             4. 4.Introducing recombinant DNA
      (SSDNA) at 55C         into host cell e.g E.coli
      3- Extension:           5. Host cell with recombinant DNA
      Polymerization and      is identified by tracer e.g resistance
      new strand              to ampicillin.
      synthesis at 72C       6. Host cell e.g E.coli replicates and
                              multiplies
steps 30 cycles of 3 steps:   1.DNA is cleaved with a specific
      1- Denaturation:        restriction enzyme
      separation of 2         2.Vector e.g plasmid is cleaved
      DNA strands by          with the same restriction enzyme
      heating 95 C            3.DNA fragment is joined to the
      2- Annealing:           vector by Ligase a recombinant
      binding of primers      DNA is formed.                     4.
      to template             Introducing recombinant DNA into
      (SSDNA) at 55C          host cell e.g E.coli
      3- Extension:           4. Host cell with recombinant DNA
      Polymerization and      is identified by tracer e.g resistance
      new strand              to ampicillin. 5. Host cell e.g E.coli
      synthesis at 72C        replicates and multiplies
Probe
                   CGTAGGCGTAGGCGTAAACCCAGG
       Heat        CGTAGGCGTAGGCGTAAACCCAGG
      Cool
  (denaturation)   GCATCCGCATCCGCATTTGGGTCC
 (hybridization)


       low high temp, 2DNA strands
 2-At1-Attemp,ssDNA stranded
A probe: labeled single can bind aDNA
      separated complementary
 a probe with a (denaturation)
fragment(hybridization)
sequence to a target DNA
Uses OF Probes in Southern and Northern
         blotting for the followings.
 Diagnosis of infectious diseases: e.g. T.B.
 and gonorrhoeae .
 Diagnosis of malignant tumors e.g.
 Leukemias and Lymphomas ..etc.
 Diagnosis of genetic diseases: e.g. Cystic
 fibrosis and Duchenne’s muscular
 dystrophy…etc.
 Prenatal diagnosis ( take a sample of
 amniotic fluid from a pregnant women, to
 study genes of fetus to detect inherited
 diseases.
 Paternity and forensic analysis.
                 Topic 12-1SANAA EISSA
    II. BLOTTING TECHNIQUES

Southern blotting: identification of
specific DNA sequence within a genome by
a specific DNA probe.
Northern blotting: identification of a
specific RNA sequence by a specific RNA
probe.
Western Blotting: identification of a
certain protein expressed by a specific
gene using specific antibodies.



             Topic 12-1SANAA EISSA
    II. BLOTTING TECHNIQUES

Southern blotting: identification of
specific DNA sequence within a genome by
a specific DNA probe.
Northern blotting: identification of a
specific RNA sequence by a specific RNA
probe.
Western Blotting: identification of a
certain protein expressed by a specific
gene using specific antibodies.



             Topic 12-1SANAA EISSA
Southern
blot movie
Topic 12-1SANAA EISSA
         Paternity test
Mother   baby    Father-1   Father-2

              DNA

          Restriction
          endonucleases




                      X       
Paternity test




                 Topic 12-1SANAA EISSA
Sanaa Eissa   Sanaa Eissa   Sanaa Eissa        Sanaa Eissa




                                          By Sanaa Eissa

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:15
posted:1/14/2012
language:English
pages:48