; template_plate
Learning Center
Plans & pricing Sign in
Sign Out
Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>



  • pg 1
									     Only copy the highlighted region!
     Sample Name    Vector Name Vector Size (bp) Insert Size (bp) Concentration (ng/ul)
 1   My Sample 1    pBX1234                 3000              500                   100
 2   My Sample 2    pBX1235                 3001              501                   100
 3   My Sample 3    pBX1236                 3002              502                   100
 4   My Sample 4    pBX1237                 3003              503                   100
 5   My Sample 5    pBX1238                 3004              504                   100
 6   My Sample 6    pBX1239                 3005              505                   100
 7   My Sample 7    pBX1240                 3006              506                   100
 8   My Sample 8    pBX1241                 3007              507                   100
 9   My Sample 9    pBX1242                 3008              508                   100
10   My Sample 10   pBX1243                 3009              509                   100
Free Primer Name Custom Primer Sequence if synthesis needed
                 oBX113        acagagagatagatagatagata
                 oBX114        agatagatagatatatatatataca
     Only copy the highlighted region!
     Sample Name Amplicon Size (bp) Concentration (ng/ul) Free Primer Name   Custom Primer
 1   A01                         500                  100 M13
 2   B01                         501                  100 G6
 3   C01                         502                  100                    oBX111
 4   D01                         503                  100                    oBX112
 5   E01                         504                  100                    oBX113
 6   F01                         505                  100                    oBX114
 7   G01                         506                  100                    oBX115
 8   H01                         507                  100                    oBX116
 9   A02                         508                  100                    oBX117
Sequence if synthesis needed

     Make sure your sample names are unique!
     Only copy the highlighted region! Each row represents a well.
     Sample Name   Vector Name Vector Size (bp) Insert Size (bp) Concentration (ng/ul)
 1   A01           pBX1234                 3000              500                   100
 2   B01           pBX1235                 3001              501                   100
 3   C01           pBX1236                 3002              502                   100
 4   D01           pBX1237                 3003              503                   100
 5   E01           pBX1238                 3004              504                   100
 6   F01           pBX1239                 3005              505                   100
 7   G01           pBX1240                 3006              506                   100
 8   H01           pBX1241                 3007              507                   100
 9   A02           pBX1242                 3008              508                   100
10   B02           pBX1243                 3009              509                   100
11   C02           pBX1244                 3010              510                   100
12   D02           pBX1245                 3011              511                   100
13   E02           pBX1246                 3012              512                   100
14   F02           pBX1247                 3013              513                   100
15   G02           pBX1248                 3014              514                   100
16   H02           pBX1249                 3015              515                   100
17   A03           pBX1250                 3016              516                   100
18   B03           pBX1251                 3017              517                   100
19   C03           pBX1252                 3018              518                   100
20   D03           pBX1253                 3019              519                   100
21   E03           pBX1254                 3020              520                   100
22   F03           pBX1255                 3021              521                   100
23   G03           pBX1256                 3022              522                   100
24   H03           pBX1257                 3023              523                   100
25   A04           pBX1258                 3024              524                   100
26   B04           pBX1259                 3025              525                   100
27   C04           pBX1260                 3026              526                   100
28   D04           pBX1261                 3027              527                   100
29   E04           pBX1262                 3028              528                   100
30   F04           pBX1263                 3029              529                   100
31   G04           pBX1264                 3030              530                   100
32   H04           pBX1265                 3031              531                   100
33   A05           pBX1266                 3032              532                   100
34   B05           pBX1267                 3033              533                   100
35   C05           pBX1268                 3034              534                   100
36   D05           pBX1269                 3035              535                   100
37   E05           pBX1270                 3036              536                   100
38   F05           pBX1271                 3037              537                   100
39   G05           pBX1272                 3038              538                   100
40   H05           pBX1273                 3039              539                   100
41   A06           pBX1274                 3040              540                   100
42   B06           pBX1275                 3041              541                   100
43   C06           pBX1276                 3042              542                   100
44   D06           pBX1277                 3043              543                   100
45   E06           pBX1278                 3044              544                   100
46   F06           pBX1279                 3045              545                   100
47   G06   pBX1280   3046   546   100
48   H06   pBX1281   3047   547   100
49   A07   pBX1282   3048   548   100
50   B07   pBX1283   3049   549   100
51   C07   pBX1284   3050   550   100
52   D07   pBX1285   3051   551   100
53   E07   pBX1286   3052   552   100
54   F07   pBX1287   3053   553   100
55   G07   pBX1288   3054   554   100
56   H07   pBX1289   3055   555   100
57   A08   pBX1290   3056   556   100
58   B08   pBX1291   3057   557   100
59   C08   pBX1292   3058   558   100
60   D08   pBX1293   3059   559   100
61   E08   pBX1294   3060   560   100
62   F08   pBX1295   3061   561   100
63   G08   pBX1296   3062   562   100
64   H08   pBX1297   3063   563   100
65   A09   pBX1298   3064   564   100
66   B09   pBX1299   3065   565   100
67   C09   pBX1300   3066   566   100
68   D09   pBX1301   3067   567   100
69   E09   pBX1302   3068   568   100
70   F09   pBX1303   3069   569   100
71   G09   pBX1304   3070   570   100
72   H09   pBX1305   3071   571   100
73   A10   pBX1306   3072   572   100
74   B10   pBX1307   3073   573   100
75   C10   pBX1308   3074   574   100
76   D10   pBX1309   3075   575   100
77   E10   pBX1310   3076   576   100
78   F10   pBX1311   3077   577   100
79   G10   pBX1312   3078   578   100
80   H10   pBX1313   3079   579   100
81   A11   pBX1314   3080   580   100
82   B11   pBX1315   3081   581   100
83   C11   pBX1316   3082   582   100
84   D11   pBX1317   3083   583   100
85   E11   pBX1318   3084   584   100
86   F11   pBX1319   3085   585   100
87   G11   pBX1320   3086   586   100
88   H11   pBX1321   3087   587   100
89   A12   pBX1322   3088   588   100
90   B12   pBX1323   3089   589   100
91   C12   pBX1324   3090   590   100
92   D12   pBX1325   3091   591   100
93   E12   pBX1326   3092   592   100
94   F12   pBX1327   3093   593   100
95   G12   pBX1328   3094   594   100
96   H12   pBX1329   3095   595   100
esents a well.
        Free Primer Name Custom Primer Sequence if synthesis needed
                         oBX113        acagagagatagatagatagata
                         oBX114        agatagatagatatatatatataca

To top