Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>

15 ?????? by 7R22ZRDu

VIEWS: 914 PAGES: 1446

									                                                             Уточненный Годовой план государственных закупок товаров, работ, услуг на 2010 год
                           РГП "Национальный центр биотехнологии Республики Казахстан" Комитета науки Министерства образования и науки Республики К
          Общие сведения
             БИН заказчика       РНН заказчика                                Наименование заказчика (на        Наименование заказчика (на русском
                                                   Для государственных          государственном языке)
                                                        учреждений

                                                    Код ГУ       Фонд
                    1                   2             3           4                       5                                         6
              051040004826        620200262274                            Қазақстан Республикасы Білім және   Республиканское государственное предпри
                                                                          ғылым министрлігі Ғылым комитеті    праве хозяйственного ведения "Националь
                                                                          "Қазақстан Республикасының          центр биотехнологии Республики Казахста
                                                                          Ұлттық биотехнология орталығы"      Комитета науки Министерства образовани
                                                                          шаруашылық жүргізу құқығындағы      науки Республики Казахстан
                                                                          республикалық мемлекеттік
                                                                          кәсіпорны


                                                                                     План государственных закупок
    №       Тип пункта плана                          Для государственных учреждений                         Код товара,
    п/п                          Администратор    Программа Подпрограм      Специфика        Источник          работы,
                                   бюджетной                      ма                      финансирования      услуги (в
                                   программы                                                               соответствии с
                                                                                                              КП ВЭД)



    1                2                 3              4            5             6                7                  8
1         01 Закупки, не                                                                                      19.20.21
          превышающие
          финансовый год




2         01 Закупки, не                                                                                      19.20.21
          превышающие
          финансовый год




3         01 Закупки, не                                                                                      61.10.43
          превышающие
          финансовый год

4         01 Закупки, не                                                                                      63.12.10
          превышающие
          финансовый год

5         01 Закупки, не                                                                                      84.25.19
          превышающие
          финансовый год




6         01 Закупки, не                                                                                      62.01.29
          превышающие
          финансовый год
7    01 Закупки, не   80.10.12
     превышающие
     финансовый год

8    01 Закупки, не   81.29.11
     превышающие
     финансовый год

9    01 Закупки, не   81.29.19
     превышающие
     финансовый год

10   01 Закупки, не   33.14.19
     превышающие
     финансовый год




11   01 Закупки, не   53.20.11
     превышающие
     финансовый год

12   01 Закупки, не   38.11.69
     превышающие
     финансовый год

13   01 Закупки, не   33.12.16
     превышающие
     финансовый год

14   01 Закупки, не   61.10.53
     превышающие
     финансовый год

15   01 Закупки, не   17.23.12
     превышающие
     финансовый год

16   01 Закупки, не   36.00.11
     превышающие
     финансовый год



17   01 Закупки, не   71.20.14
     превышающие
     финансовый год




18   01 Закупки, не   85.59.13
     превышающие
     финансовый год
19   01 Закупки, не   27.20.11
     превышающие
     финансовый год

20   01 Закупки, не   27.20.11
     превышающие
     финансовый год

21   01 Закупки, не   22.22.13
     превышающие
     финансовый год




22   01 Закупки, не   16.23.19
     превышающие
     финансовый год




23   01 Закупки, не   33.12.12
     превышающие
     финансовый год

24   01 Закупки, не   25.99.11
     превышающие
     финансовый год

25   01 Закупки, не   25.99.11
     превышающие
     финансовый год

26   01 Закупки, не   22.21.29
     превышающие
     финансовый год

27   01 Закупки, не   22.21.29
     превышающие
     финансовый год

28   01 Закупки, не   22.21.29
     превышающие
     финансовый год

29   01 Закупки, не   22.21.29
     превышающие
     финансовый год

30   01 Закупки, не   22.21.29
     превышающие
     финансовый год

31   01 Закупки, не   22.21.29
     превышающие
     финансовый год

32   01 Закупки, не   22.21.29
     превышающие
     финансовый год

33   01 Закупки, не   22.21.29
     превышающие
     финансовый год
34   01 Закупки, не   22.21.29
     превышающие
     финансовый год

35   01 Закупки, не   22.21.29
     превышающие
     финансовый год

36   01 Закупки, не   22.21.29
     превышающие
     финансовый год

37   01 Закупки, не   22.21.29
     превышающие
     финансовый год

38   01 Закупки, не   22.21.29
     превышающие
     финансовый год

39   01 Закупки, не   22.21.29
     превышающие
     финансовый год

40   01 Закупки, не   28.14.12
     превышающие
     финансовый год

41   01 Закупки, не   28.14.12
     превышающие
     финансовый год

42   01 Закупки, не   25.99.11
     превышающие
     финансовый год

43   01 Закупки, не   25.99.11
     превышающие
     финансовый год

44   01 Закупки, не   25.99.11
     превышающие
     финансовый год

45   01 Закупки, не   25.99.11
     превышающие
     финансовый год

46   01 Закупки, не   25.99.11
     превышающие
     финансовый год

47   01 Закупки, не   16.23.19
     превышающие
     финансовый год

48   01 Закупки, не   16.23.19
     превышающие
     финансовый год




49   01 Закупки, не   31.00.11
     превышающие
     финансовый год
50   01 Закупки, не   61.10.11
     превышающие
     финансовый год




51   01 Закупки, не   18.12.13
     превышающие
     финансовый год




52   01 Закупки, не   71.20.13
     превышающие
     финансовый год




53   01 Закупки, не   85.41.14
     превышающие
     финансовый год




54   01 Закупки, не   61.10.11
     превышающие
     финансовый год




55   01 Закупки, не   27.20.23
     превышающие
     финансовый год
56   01 Закупки, не   26.20.17
     превышающие
     финансовый год




57   01 Закупки, не   26.20.40
     превышающие
     финансовый год




58   01 Закупки, не   22.23.15
     превышающие
     финансовый год




59   01 Закупки, не   23.20.11
     превышающие
     финансовый год

60   01 Закупки, не   23.20.11
     превышающие
     финансовый год

61   01 Закупки, не   23.20.11
     превышающие
     финансовый год

62   01 Закупки, не   20.52.10
     превышающие
     финансовый год




63   01 Закупки, не   84.13.15
     превышающие
     финансовый год
64   01 Закупки, не   64.11.10
     превышающие
     финансовый год
65   01 Закупки, не   69.10.16
     превышающие
     финансовый год
66   01 Закупки, не   85.59.19
     превышающие
     финансовый год

67   01 Закупки, не   45.20.11
     превышающие
     финансовый год




68   01 Закупки, не   36.00.11
     превышающие
     финансовый год
69   01 Закупки, не   35.11.10
     превышающие
     финансовый год
70   01 Закупки, не   35.13.10
     превышающие
     финансовый год
71   01 Закупки, не   61.10.11
     превышающие
     финансовый год
72   01 Закупки, не   49.10.19
     превышающие
     финансовый год
73   01 Закупки, не   53.10.13
     превышающие
     финансовый год
74   01 Закупки, не   69.10.15
     превышающие
     финансовый год




75   01 Закупки, не   53.10.11
     превышающие
     финансовый год



76   01 Закупки, не   25.29.99
     превышающие
     финансовый год




77   01 Закупки, не   25.99.29
     превышающие
     финансовый год




78   01 Закупки, не   65.12.21
     превышающие
     финансовый год
79   01 Закупки, не   72.19.16
     превышающие
     финансовый год




80   01 Закупки, не   72.19.16
     превышающие
     финансовый год




81   01 Закупки, не   72.19.16
     превышающие
     финансовый год




82   01 Закупки, не   72.19.16
     превышающие
     финансовый год




83   01 Закупки, не   72.19.16
     превышающие
     финансовый год
84   01 Закупки, не   72.19.16
     превышающие
     финансовый год




85   01 Закупки, не   72.19.16
     превышающие
     финансовый год




86   01 Закупки, не   72.19.16
     превышающие
     финансовый год




87   01 Закупки, не   72.19.16
     превышающие
     финансовый год




88   01 Закупки, не   72.19.16
     превышающие
     финансовый год
89   01 Закупки, не   72.19.16
     превышающие
     финансовый год




90   01 Закупки, не   72.19.16
     превышающие
     финансовый год




91   01 Закупки, не   72.19.16
     превышающие
     финансовый год




92   01 Закупки, не   72.19.16
     превышающие
     финансовый год
93   01 Закупки, не   72.19.16
     превышающие
     финансовый год




94   01 Закупки, не   72.19.16
     превышающие
     финансовый год




95   01 Закупки, не   72.19.16
     превышающие
     финансовый год




96   01 Закупки, не   72.19.16
     превышающие
     финансовый год




97   01 Закупки, не   72.19.16
     превышающие
     финансовый год
98    01 Закупки, не   72.19.16
      превышающие
      финансовый год




99    01 Закупки, не   72.19.16
      превышающие
      финансовый год




100   01 Закупки, не   72.19.16
      превышающие
      финансовый год




101   01 Закупки, не   72.19.16
      превышающие
      финансовый год




102   01 Закупки, не   72.19.16
      превышающие
      финансовый год
103   01 Закупки, не   72.19.16
      превышающие
      финансовый год




104   01 Закупки, не   72.19.16
      превышающие
      финансовый год




105   01 Закупки, не   72.19.16
      превышающие
      финансовый год




106   01 Закупки, не   72.19.16
      превышающие
      финансовый год




107   01 Закупки, не   72.19.16
      превышающие
      финансовый год




108   01 Закупки, не   72.19.16
      превышающие
      финансовый год
109   01 Закупки, не   72.19.16
      превышающие
      финансовый год




110   01 Закупки, не   01.19.10
      превышающие
      финансовый год
111   01 Закупки, не   20.11.11
      превышающие
      финансовый год
112   01 Закупки, не   49.32.12
      превышающие
      финансовый год




113   01 Закупки, не   49.32.12
      превышающие
      финансовый год




114   01 Закупки, не   50.30.20
      превышающие
      финансовый год




115   01 Закупки, не   50.30.20
      превышающие
      финансовый год
116   01 Закупки, не   72.19.16
      превышающие
      финансовый год




117   01 Закупки, не   72.19.16
      превышающие
      финансовый год




118   01 Закупки, не   72.19.16
      превышающие
      финансовый год




119   01 Закупки, не   72.19.16
      превышающие
      финансовый год




120   01 Закупки, не   72.19.16
      превышающие
      финансовый год
121   02 Закупки,      62.01.11
      превышающие
      финансовый год




122   01 Закупки, не   38.11.69
      превышающие
      финансовый год

123   01 Закупки, не   81.29.11
      превышающие
      финансовый год

124   01 Закупки, не   80.10.12
      превышающие
      финансовый год




125   01 Закупки, не   80.10.12
      превышающие
      финансовый год



126   01 Закупки, не   33.14.19
      превышающие
      финансовый год




127   01 Закупки, не   49.32.12
      превышающие
      финансовый год

128   01 Закупки, не   33.12.16
      превышающие
      финансовый год
129   01 Закупки, не   61.10.43
      превышающие
      финансовый год

130   01 Закупки, не   80.10.12
      превышающие
      финансовый год

131   01 Закупки, не   80.10.12
      превышающие
      финансовый год




132   01 Закупки, не   39.00.11
      превышающие
      финансовый год

133   01 Закупки, не   84.25.19
      превышающие
      финансовый год

134   01 Закупки, не   64.11.10
      превышающие
      финансовый год
135   01 Закупки, не   69.10.16
      превышающие
      финансовый год
136   01 Закупки, не   35.11.10
      превышающие
      финансовый год
137   01 Закупки, не   35.13.10
      превышающие
      финансовый год
138   01 Закупки, не   36.00.11
      превышающие
      финансовый год
139   01 Закупки, не   36.00.11
      превышающие
      финансовый год
140   01 Закупки, не   36.00.11
      превышающие
      финансовый год
141   01 Закупки, не   61.10.11
      превышающие
      финансовый год
142   01 Закупки, не   49.10.19
      превышающие
      финансовый год
143   01 Закупки, не   53.10.13
      превышающие
      финансовый год
144   01 Закупки, не   35.11.10
      превышающие
      финансовый год
145   01 Закупки, не   17.21.15
      превышающие
      финансовый год
146   01 Закупки, не   19.20.21
      превышающие
      финансовый год
147   01 Закупки, не   22.11.11.
      превышающие
      финансовый год

148   01 Закупки, не   19.20.26
      превышающие
      финансовый год

149   01 Закупки, не   45.20.11
      превышающие
      финансовый год




150   01 Закупки, не   45.20.13
      превышающие
      финансовый год

151   01 Закупки, не   20.59.41
      превышающие
      финансовый год

152   01 Закупки, не   28.29.13
      превышающие
      финансовый год

153   01 Закупки, не   26.51.70
      превышающие
      финансовый год

154   01 Закупки, не   27.11.61.
      превышающие
      финансовый год

155   01 Закупки, не   20.59.43
      превышающие
      финансовый год

156   01 Закупки, не   10.11.39
      превышающие
      финансовый год
157   01 Закупки, не   62.01.29
      превышающие
      финансовый год

158   01 Закупки, не   22.22.29
      превышающие
      финансовый год
159   01 Закупки, не   13.92.22
      превышающие
      финансовый год
160   01 Закупки, не   13.92.24
      превышающие
      финансовый год
161   01 Закупки, не   25.73.30
      превышающие
      финансовый год
162   01 Закупки, не   27.40.23
      превышающие
      финансовый год
163   01 Закупки, не   13.92.22
      превышающие
      финансовый год
164   01 Закупки, не   22.29.29
      превышающие
      финансовый год
165   01 Закупки, не   22.29.29
      превышающие
      финансовый год
166   01 Закупки, не   31.00.11
      превышающие
      финансовый год
167   01 Закупки, не   91.01.11
      превышающие
      финансовый год
168   01 Закупки, не   68.20.12
      превышающие
      финансовый год




169   01 Закупки, не   29.31.23
      превышающие
      финансовый год

170   01 Закупки, не   85.59.13
      превышающие
      финансовый год




171   01 Закупки, не   95.11.10
      превышающие
      финансовый год

172   01 Закупки, не   95.11.10
      превышающие
      финансовый год

173   01 Закупки, не   22.23.15
      превышающие
      финансовый год




174   01 Закупки, не   22.23.11
      превышающие
      финансовый год

175   01 Закупки, не   22.23.11
      превышающие
      финансовый год

176   01 Закупки, не   22.23.11
      превышающие
      финансовый год

177   01 Закупки, не   16.23.11
      превышающие
      финансовый год

178   01 Закупки, не   27.12.21
      превышающие
      финансовый год
179   01 Закупки, не   25.72.14
      превышающие
      финансовый год

180   01 Закупки, не   25.72.12
      превышающие
      финансовый год

181   01 Закупки, не   25.72.14
      превышающие
      финансовый год

182   01 Закупки, не   25.72.14
      превышающие
      финансовый год




183   01 Закупки, не   26.30.21
      превышающие
      финансовый год




184   01 Закупки, не   35.11.10
      превышающие
      финансовый год
185   01 Закупки, не   61.10.11
      превышающие
      финансовый год
186   01 Закупки, не   61.10.43
      превышающие
      финансовый год

187   01 Закупки, не   45.20.11
      превышающие
      финансовый год




188   01 Закупки, не   21.20.24
      превышающие
      финансовый год
189   01 Закупки, не   27.20.21
      превышающие
      финансовый год




190   01 Закупки, не   22.11.11.
      превышающие
      финансовый год

191   01 Закупки, не   71.20.11
      превышающие
      финансовый год




192   01 Закупки, не   71.20.11
      превышающие
      финансовый год

193   01 Закупки, не   71.20.11
      превышающие
      финансовый год

194   01 Закупки, не   71.20.11
      превышающие
      финансовый год

195   01 Закупки, не   85.59.19
      превышающие
      финансовый год

196   01 Закупки, не   13.99.19
      превышающие
      финансовый год

197   01 Закупки, не   20.59.60
      превышающие
      финансовый год
198   01 Закупки, не   20.14.74
      превышающие
      финансовый год
199   01 Закупки, не   36.00.11
      превышающие
      финансовый год

200   01 Закупки, не   36.00.11
      превышающие
      финансовый год

201   01 Закупки, не   72.19.16
      превышающие
      финансовый год
202   01 Закупки, не   72.19.16
      превышающие
      финансовый год




203   01 Закупки, не   72.19.16
      превышающие
      финансовый год




204   01 Закупки, не   72.19.16
      превышающие
      финансовый год




205   01 Закупки, не   72.19.16
      превышающие
      финансовый год




206   01 Закупки, не   72.19.16
      превышающие
      финансовый год




207   01 Закупки, не   72.19.16
      превышающие
      финансовый год




208   01 Закупки, не   72.19.16
      превышающие
      финансовый год
209   01 Закупки, не   72.19.16
      превышающие
      финансовый год




210   01 Закупки, не   72.19.16
      превышающие
      финансовый год




211   01 Закупки, не   72.19.16
      превышающие
      финансовый год




212   01 Закупки, не   72.19.16
      превышающие
      финансовый год




213   01 Закупки, не   72.19.16
      превышающие
      финансовый год




214   01 Закупки, не   72.19.16
      превышающие
      финансовый год
215   01 Закупки, не   72.19.16
      превышающие
      финансовый год




216   01 Закупки, не   72.19.16
      превышающие
      финансовый год




217   01 Закупки, не   72.19.16
      превышающие
      финансовый год




218   01 Закупки, не   72.19.16
      превышающие
      финансовый год




219   01 Закупки, не   72.19.16
      превышающие
      финансовый год
220   01 Закупки, не   72.19.16
      превышающие
      финансовый год




221   01 Закупки, не   72.19.16
      превышающие
      финансовый год




222   01 Закупки, не   72.19.16
      превышающие
      финансовый год




223   01 Закупки, не   72.19.16
      превышающие
      финансовый год




224   01 Закупки, не   72.19.16
      превышающие
      финансовый год
225   01 Закупки, не   72.19.16
      превышающие
      финансовый год




226   01 Закупки, не   72.19.16
      превышающие
      финансовый год




227   01 Закупки, не   72.19.16
      превышающие
      финансовый год




228   01 Закупки, не   72.19.16
      превышающие
      финансовый год




229   01 Закупки, не   72.19.16
      превышающие
      финансовый год
230   01 Закупки, не   72.19.16
      превышающие
      финансовый год




231   01 Закупки, не   72.19.16
      превышающие
      финансовый год




232   01 Закупки, не   72.19.16
      превышающие
      финансовый год




233   01 Закупки, не   72.19.16
      превышающие
      финансовый год




234   01 Закупки, не   72.19.16
      превышающие
      финансовый год




235   01 Закупки, не   20.14.64
      превышающие
      финансовый год
236   01 Закупки, не   20.14.64
      превышающие
      финансовый год



237   01 Закупки, не   21.10.20.
      превышающие
      финансовый год
238   01 Закупки, не   21.20.23
      превышающие
      финансовый год



239   01 Закупки, не   20.16.54
      превышающие
      финансовый год
240   01 Закупки, не   20.16.54
      превышающие
      финансовый год
241   01 Закупки, не   10.84.11
      превышающие
      финансовый год
242   01 Закупки, не   22.29.29
      превышающие
      финансовый год
243   01 Закупки, не   21.20.23
      превышающие
      финансовый год

244   01 Закупки, не   25.73.60
      превышающие
      финансовый год

245   01 Закупки, не   25.73.60
      превышающие
      финансовый год

246   01 Закупки, не   23.62.10
      превышающие
      финансовый год

247   01 Закупки, не   23.62.10
      превышающие
      финансовый год

248   01 Закупки, не   25.93.14
      превышающие
      финансовый год

249   01 Закупки, не   32.91.12
      превышающие
      финансовый год

250   01 Закупки, не   20.30.11
      превышающие
      финансовый год

251   01 Закупки, не   20.30.11
      превышающие
      финансовый год

252   01 Закупки, не   08.99.22
      превышающие
      финансовый год
253   01 Закупки, не   22.19.60
      превышающие
      финансовый год

254   01 Закупки, не   38.21.30
      превышающие
      финансовый год

255   01 Закупки, не   22.23.19
      превышающие
      финансовый год

256   01 Закупки, не   23.62.10
      превышающие
      финансовый год

257   01 Закупки, не   23.62.10
      превышающие
      финансовый год

258   01 Закупки, не   20.30.11
      превышающие
      финансовый год

259   01 Закупки, не   22.29.29
      превышающие
      финансовый год

260   01 Закупки, не   22.29.29
      превышающие
      финансовый год

261   01 Закупки, не   22.29.29
      превышающие
      финансовый год

262   01 Закупки, не   26.20.21
      превышающие
      финансовый год

263   01 Закупки, не   27.32.12
      превышающие
      финансовый год

264   01 Закупки, не   22.29.25
      превышающие
      финансовый год

265   01 Закупки, не   17.12.73
      превышающие
      финансовый год

266   01 Закупки, не   17.23.13
      превышающие
      финансовый год

267   01 Закупки, не   17.29.19
      превышающие
      финансовый год

268   01 Закупки, не   26.80.12
      превышающие
      финансовый год
269   01 Закупки, не   26.80.12
      превышающие
      финансовый год

270   01 Закупки, не   25.99.23
      превышающие
      финансовый год

271   01 Закупки, не   17.23.13
      превышающие
      финансовый год

272   01 Закупки, не   17.23.13
      превышающие
      финансовый год

273   01 Закупки, не   17.23.13
      превышающие
      финансовый год

274   01 Закупки, не   25.93.18
      превышающие
      финансовый год

275   01 Закупки, не   58.19.13
      превышающие
      финансовый год

276   01 Закупки, не   28.23.12
      превышающие
      финансовый год

277   01 Закупки, не   32.99.15
      превышающие
      финансовый год

278   01 Закупки, не   20.52.10
      превышающие
      финансовый год

279   01 Закупки, не   20.52.10
      превышающие
      финансовый год

280   01 Закупки, не   20.52.10
      превышающие
      финансовый год

281   01 Закупки, не   25.99.29
      превышающие
      финансовый год

282   01 Закупки, не   25.99.29
      превышающие
      финансовый год

283   01 Закупки, не   25.99.29
      превышающие
      финансовый год

284   01 Закупки, не   17.23.13
      превышающие
      финансовый год
285   01 Закупки, не   17.23.13
      превышающие
      финансовый год

286   01 Закупки, не   17.23.12
      превышающие
      финансовый год

287   01 Закупки, не   17.23.12
      превышающие
      финансовый год

288   01 Закупки, не   17.23.12
      превышающие
      финансовый год

289   01 Закупки, не   32.99.16
      превышающие
      финансовый год

290   01 Закупки, не   22.29.25
      превышающие
      финансовый год

291   01 Закупки, не   22.22.13
      превышающие
      финансовый год

292   01 Закупки, не   32.99.12
      превышающие
      финансовый год

293   01 Закупки, не   32.99.12
      превышающие
      финансовый год

294   01 Закупки, не   32.99.12
      превышающие
      финансовый год

295   01 Закупки, не   26.12.20
      превышающие
      финансовый год

296   01 Закупки, не   26.12.20
      превышающие
      финансовый год

297   01 Закупки, не   13.10.81
      превышающие
      финансовый год

298   01 Закупки, не   25.71.11
      превышающие
      финансовый год

299   01 Закупки, не   25.71.11
      превышающие
      финансовый год

300   01 Закупки, не   22.29.25
      превышающие
      финансовый год
301   01 Закупки, не   17.23.13
      превышающие
      финансовый год

302   01 Закупки, не   22.29.25
      превышающие
      финансовый год

303   01 Закупки, не   22.29.25
      превышающие
      финансовый год

304   01 Закупки, не   22.29.25
      превышающие
      финансовый год

305   01 Закупки, не   22.29.25
      превышающие
      финансовый год

306   01 Закупки, не   22.29.25
      превышающие
      финансовый год

307   01 Закупки, не   22.29.25
      превышающие
      финансовый год

308   01 Закупки, не   17.21.15
      превышающие
      финансовый год

309   01 Закупки, не   22.29.25
      превышающие
      финансовый год

310   01 Закупки, не   22.29.25
      превышающие
      финансовый год

311   01 Закупки, не   22.29.25
      превышающие
      финансовый год

312   01 Закупки, не   22.29.25
      превышающие
      финансовый год

313   01 Закупки, не   22.29.25
      превышающие
      финансовый год

314   01 Закупки, не   22.29.25
      превышающие
      финансовый год

315   01 Закупки, не   22.29.25
      превышающие
      финансовый год

316   01 Закупки, не   32.99.12
      превышающие
      финансовый год
317   01 Закупки, не   32.99.12
      превышающие
      финансовый год

318   01 Закупки, не   32.99.12
      превышающие
      финансовый год

319   01 Закупки, не   26.20.30
      превышающие
      финансовый год

320   01 Закупки, не   27.31.11
      превышающие
      финансовый год

321   01 Закупки, не   26.30.23
      превышающие
      финансовый год

322   01 Закупки, не   26.30.23
      превышающие
      финансовый год

323   01 Закупки, не   25.93.14
      превышающие
      финансовый год

324   01 Закупки, не   17.23.13
      превышающие
      финансовый год

325   01 Закупки, не   22.29.25
      превышающие
      финансовый год

326   01 Закупки, не   17.23.13
      превышающие
      финансовый год

327   01 Закупки, не   32.99.16
      превышающие
      финансовый год

328   01 Закупки, не   32.99.16
      превышающие
      финансовый год

329   01 Закупки, не   32.99.16
      превышающие
      финансовый год

330   01 Закупки, не   32.99.16
      превышающие
      финансовый год

331   01 Закупки, не   25.99.23
      превышающие
      финансовый год

332   01 Закупки, не   58.11.14
      превышающие
      финансовый год
333   01 Закупки, не   22.29.25
      превышающие
      финансовый год

334   01 Закупки, не   32.99.14
      превышающие
      финансовый год

335   01 Закупки, не   32.99.14
      превышающие
      финансовый год

336   01 Закупки, не   32.99.14
      превышающие
      финансовый год

337   01 Закупки, не   32.99.12
      превышающие
      финансовый год

338   01 Закупки, не   32.99.12
      превышающие
      финансовый год

339   01 Закупки, не   32.99.12
      превышающие
      финансовый год

340   01 Закупки, не   17.23.13
      превышающие
      финансовый год

341   01 Закупки, не   17.23.13
      превышающие
      финансовый год

342   01 Закупки, не   22.29.25
      превышающие
      финансовый год

343   01 Закупки, не   22.29.25
      превышающие
      финансовый год

344   01 Закупки, не   22.29.25
      превышающие
      финансовый год

345   01 Закупки, не   32.99.16
      превышающие
      финансовый год

346   01 Закупки, не   65.12.21
      превышающие
      финансовый год
347   01 Закупки, не   65.12.11
      превышающие
      финансовый год
348   01 Закупки, не   68.20.12
      превышающие
      финансовый год




349   01 Закупки, не   72.19.16
      превышающие
      финансовый год




350   01 Закупки, не   72.19.16
      превышающие
      финансовый год




351   01 Закупки, не   33.14.19
      превышающие
      финансовый год




352   01 Закупки, не   95.29.19
      превышающие
      финансовый год




353   01 Закупки, не   28.13.23
      превышающие
      финансовый год
354   01 Закупки, не   28.13.23
      превышающие
      финансовый год




355   01 Закупки, не   28.13.23
      превышающие
      финансовый год




356   01 Закупки, не   10.61.22
      превышающие
      финансовый год
357   01 Закупки, не   43.22.11
      превышающие
      финансовый год
358   01 Закупки, не   45.20.11
      превышающие
      финансовый год




359   01 Закупки, не   45.20.11
      превышающие
      финансовый год




360   01 Закупки, не   17.12.73
      превышающие
      финансовый год

361   01 Закупки, не   22.29.25
      превышающие
      финансовый год

362   01 Закупки, не   86.90.19
      превышающие
      финансовый год

363   01 Закупки, не   71.20.14
      превышающие
      финансовый год

364   01 Закупки, не   72.11.11
      превышающие
      финансовый год
365   01 Закупки, не   71.20.11
      превышающие
      финансовый год
366   01 Закупки, не   71.20.11
      превышающие
      финансовый год
367   01 Закупки, не   71.20.11
      превышающие
      финансовый год
368   01 Закупки, не   53.20.11
      превышающие
      финансовый год

369   01 Закупки, не   53.10.13
      превышающие
      финансовый год
370   01 Закупки, не   71.20.12
      превышающие
      финансовый год




371   01 Закупки, не   71.20.12
      превышающие
      финансовый год




372   01 Закупки, не   86.10.19
      превышающие
      финансовый год




373   01 Закупки, не   71.20.14
      превышающие
      финансовый год



374   01 Закупки, не   65.12.21
      превышающие
      финансовый год
375   01 Закупки, не   49.32.12
      превышающие
      финансовый год
376   01 Закупки, не   20.14.64
      превышающие
      финансовый год




377   01 Закупки, не   20.14.64
      превышающие
      финансовый год




378   01 Закупки, не   20.59.55
      превышающие
      финансовый год
379   01 Закупки, не   20.59.59
      превышающие
      финансовый год
380   01 Закупки, не   20.59.59
      превышающие
      финансовый год



381   01 Закупки, не   20.15.10
      превышающие
      финансовый год
382   01 Закупки, не   20.12.21.
      превышающие
      финансовый год
383   01 Закупки, не   20.12.21.
      превышающие
      финансовый год
384   01 Закупки, не   21.20.23
      превышающие
      финансовый год
385   01 Закупки, не   20.12.21.
      превышающие
      финансовый год
386   01 Закупки, не   20.41.31
      превышающие
      финансовый год
387   01 Закупки, не   20.59.60
      превышающие
      финансовый год
388   01 Закупки, не   20.59.60
      превышающие
      финансовый год
389   01 Закупки, не   20.59.59
      превышающие
      финансовый год
390   01 Закупки, не   20.59.52
      превышающие
      финансовый год

391   01 Закупки, не   20.59.52
      превышающие
      финансовый год



392   01 Закупки, не   24.42.12
      превышающие
      финансовый год
393   01 Закупки, не   20.59.59
      превышающие
      финансовый год
394   01 Закупки, не   20.59.59
      превышающие
      финансовый год
395   01 Закупки, не   21.20.23
      превышающие
      финансовый год

396   01 Закупки, не   21.20.23
      превышающие
      финансовый год
397   01 Закупки, не   20.14.61
      превышающие
      финансовый год
398   01 Закупки, не   21.20.23
      превышающие
      финансовый год
399   01 Закупки, не   20.59.51
      превышающие
      финансовый год
400   01 Закупки, не   20.59.51
      превышающие
      финансовый год
401   01 Закупки, не   20.59.51
      превышающие
      финансовый год
402   01 Закупки, не   17.29.19
      превышающие
      финансовый год
403   01 Закупки, не   20.12.23
      превышающие
      финансовый год
404   01 Закупки, не   20.59.59
      превышающие
      финансовый год



405   01 Закупки, не   23.19.26
      превышающие
      финансовый год
406   01 Закупки, не   23.19.23
      превышающие
      финансовый год
407   01 Закупки, не   20.14.11
      превышающие
      финансовый год
408   01 Закупки, не   21.20.23
      превышающие
      финансовый год
409   01 Закупки, не   20.14.11
      превышающие
      финансовый год
410   01 Закупки, не   20.14.64
      превышающие
      финансовый год
411   01 Закупки, не   22.29.29
      превышающие
      финансовый год
412   01 Закупки, не   20.41.10
      превышающие
      финансовый год
413   01 Закупки, не   21.20.23
      превышающие
      финансовый год
414   01 Закупки, не   20.12.19
      превышающие
      финансовый год
415   01 Закупки, не   21.10.52.
      превышающие
      финансовый год
416   01 Закупки, не   20.20.14
      превышающие
      финансовый год
417   01 Закупки, не   20.13.41
      превышающие
      финансовый год
418   01 Закупки, не   20.14.63
      превышающие
      финансовый год
419   01 Закупки, не   20.59.52
      превышающие
      финансовый год
420   01 Закупки, не   20.59.52
      превышающие
      финансовый год
421   01 Закупки, не   32.91.19
      превышающие
      финансовый год
422   01 Закупки, не   20.59.60
      превышающие
      финансовый год
423   01 Закупки, не   20.59.60
      превышающие
      финансовый год
424   01 Закупки, не   20.14.51
      превышающие
      финансовый год
425   01 Закупки, не   21.20.21
      превышающие
      финансовый год



426   01 Закупки, не   21.20.21
      превышающие
      финансовый год

427   01 Закупки, не   20.14.22
      превышающие
      финансовый год
428   01 Закупки, не   21.20.23
      превышающие
      финансовый год
429   01 Закупки, не   21.10.52.
      превышающие
      финансовый год
430   01 Закупки, не   21.10.52.
      превышающие
      финансовый год
431   01 Закупки, не   20.59.59
      превышающие
      финансовый год
432   01 Закупки, не   20.15.59
      превышающие
      финансовый год
433   01 Закупки, не   20.15.75
      превышающие
      финансовый год
434   01 Закупки, не   20.15.51
      превышающие
      финансовый год
435   01 Закупки, не   20.15.35
      превышающие
      финансовый год
436   01 Закупки, не   20.59.59
      превышающие
      финансовый год
437   01 Закупки, не   32.50.13
      превышающие
      финансовый год
438   01 Закупки, не   32.50.13
      превышающие
      финансовый год
439   01 Закупки, не   07.29.13
      превышающие
      финансовый год
440   01 Закупки, не   20.15.10
      превышающие
      финансовый год
441   01 Закупки, не   20.13.52
      превышающие
      финансовый год
442   01 Закупки, не   20.13.52
      превышающие
      финансовый год
443   01 Закупки, не   25.93.13
      превышающие
      финансовый год
444   01 Закупки, не   08.91.19
      превышающие
      финансовый год
445   01 Закупки, не   21.20.23
      превышающие
      финансовый год

446   01 Закупки, не   23.19.23
      превышающие
      финансовый год
447   01 Закупки, не   23.19.23
      превышающие
      финансовый год
448   01 Закупки, не   23.19.23
      превышающие
      финансовый год
449   01 Закупки, не   23.19.23
      превышающие
      финансовый год
450   01 Закупки, не   20.14.64
      превышающие
      финансовый год
451   01 Закупки, не   20.14.64
      превышающие
      финансовый год
452   01 Закупки, не   22.29.29
      превышающие
      финансовый год
453   01 Закупки, не   22.29.29
      превышающие
      финансовый год
454   01 Закупки, не   20.59.55
      превышающие
      финансовый год
455   01 Закупки, не   21.20.23
      превышающие
      финансовый год
456   01 Закупки, не   22.29.29
      превышающие
      финансовый год
457   01 Закупки, не   21.20.23
      превышающие
      финансовый год
458   01 Закупки, не   27.40.15
      превышающие
      финансовый год
459   01 Закупки, не   27.40.15
      превышающие
      финансовый год
460   01 Закупки, не   20.14.32
      превышающие
      финансовый год
461   01 Закупки, не   22.29.29
      превышающие
      финансовый год
462   01 Закупки, не   20.14.51
      превышающие
      финансовый год
463   01 Закупки, не   20.12.12
      превышающие
      финансовый год
464   01 Закупки, не   32.91.11
      превышающие
      финансовый год
465   01 Закупки, не   22.29.29
      превышающие
      финансовый год

466   01 Закупки, не   22.29.29
      превышающие
      финансовый год




467   01 Закупки, не   22.29.29
      превышающие
      финансовый год




468   01 Закупки, не   20.12.12
      превышающие
      финансовый год
469   01 Закупки, не   23.19.23-
      превышающие
      финансовый год
470   01 Закупки, не   23.19.23
      превышающие
      финансовый год
471   01 Закупки, не   23.19.23
      превышающие
      финансовый год
472   01 Закупки, не   23.19.23
      превышающие
      финансовый год
473   01 Закупки, не   20.59.59
      превышающие
      финансовый год
474   01 Закупки, не   22.29.29
      превышающие
      финансовый год
475   01 Закупки, не   22.29.29
      превышающие
      финансовый год
476   01 Закупки, не   20.59.52
      превышающие
      финансовый год

477   01 Закупки, не   21.20.23
      превышающие
      финансовый год
478   01 Закупки, не   21.20.23
      превышающие
      финансовый год

479   01 Закупки, не   21.20.23
      превышающие
      финансовый год
480   01 Закупки, не   21.20.23
      превышающие
      финансовый год

481   01 Закупки, не   21.20.23
      превышающие
      финансовый год

482   01 Закупки, не   21.20.23
      превышающие
      финансовый год

483   01 Закупки, не   21.20.23
      превышающие
      финансовый год



484   01 Закупки, не   21.20.23
      превышающие
      финансовый год

485   01 Закупки, не   21.20.23
      превышающие
      финансовый год




486   01 Закупки, не   21.20.23
      превышающие
      финансовый год
487   01 Закупки, не   21.20.23
      превышающие
      финансовый год
488   01 Закупки, не   21.20.23
      превышающие
      финансовый год
489   01 Закупки, не   21.20.23
      превышающие
      финансовый год
490   01 Закупки, не   21.20.23
      превышающие
      финансовый год
491   01 Закупки, не   21.20.23
      превышающие
      финансовый год

492   01 Закупки, не   21.20.23
      превышающие
      финансовый год




493   01 Закупки, не   20.13.24
      превышающие
      финансовый год
494   01 Закупки, не   22.29.29
      превышающие
      финансовый год
495   01 Закупки, не   22.29.29
      превышающие
      финансовый год
496   01 Закупки, не   22.29.29
      превышающие
      финансовый год
497   01 Закупки, не   25.99.29
      превышающие
      финансовый год
498   01 Закупки, не   22.29.29
      превышающие
      финансовый год
499   01 Закупки, не   22.29.29
      превышающие
      финансовый год
500   01 Закупки, не   22.29.29
      превышающие
      финансовый год
501   01 Закупки, не   20.13.41
      превышающие
      финансовый год
502   01 Закупки, не   20.15.79
      превышающие
      финансовый год
503   01 Закупки, не   08.93.10
      превышающие
      финансовый год
504   01 Закупки, не   20.14.22
      превышающие
      финансовый год
505   01 Закупки, не   21.20.23
      превышающие
      финансовый год
506   01 Закупки, не   23.19.26
      превышающие
      финансовый год
507   01 Закупки, не   21.20.23
      превышающие
      финансовый год
508   01 Закупки, не   23.19.23
      превышающие
      финансовый год
509   01 Закупки, не   20.59.52
      превышающие
      финансовый год




510   01 Закупки, не   21.20.23
      превышающие
      финансовый год
511   01 Закупки, не   23.19.26
      превышающие
      финансовый год
512   01 Закупки, не   23.19.26
      превышающие
      финансовый год
513   01 Закупки, не   19.20.41
      превышающие
      финансовый год
514   01 Закупки, не   20.59.52
      превышающие
      финансовый год
515   01 Закупки, не   20.13.63
      превышающие
      финансовый год
516   01 Закупки, не   20.13.63
      превышающие
      финансовый год
517   01 Закупки, не   32.50.50
      превышающие
      финансовый год
518   01 Закупки, не   22.29.29
      превышающие
      финансовый год

519   01 Закупки, не   23.19.26
      превышающие
      финансовый год
520   01 Закупки, не   23.19.23
      превышающие
      финансовый год
521   01 Закупки, не   22.29.29
      превышающие
      финансовый год
522   01 Закупки, не   22.29.29
      превышающие
      финансовый год
523   01 Закупки, не   22.29.29
      превышающие
      финансовый год
524   01 Закупки, не   22.29.29
      превышающие
      финансовый год
525   01 Закупки, не   22.29.29
      превышающие
      финансовый год
526   01 Закупки, не   20.59.52
      превышающие
      финансовый год

527   01 Закупки, не   20.59.52
      превышающие
      финансовый год

528   01 Закупки, не   20.59.52
      превышающие
      финансовый год
529   01 Закупки, не   20.59.52
      превышающие
      финансовый год



530   01 Закупки, не   20.59.52
      превышающие
      финансовый год



531   01 Закупки, не   20.59.52
      превышающие
      финансовый год



532   01 Закупки, не   20.59.52
      превышающие
      финансовый год

533   01 Закупки, не   20.59.52
      превышающие
      финансовый год



534   01 Закупки, не   20.59.52
      превышающие
      финансовый год



535   01 Закупки, не   22.29.29
      превышающие
      финансовый год
536   01 Закупки, не   22.29.29
      превышающие
      финансовый год
537   01 Закупки, не   22.29.29
      превышающие
      финансовый год
538   01 Закупки, не   22.29.29
      превышающие
      финансовый год
539   01 Закупки, не   22.29.29
      превышающие
      финансовый год
540   01 Закупки, не   22.29.29
      превышающие
      финансовый год
541   01 Закупки, не   22.29.21
      превышающие
      финансовый год
542   01 Закупки, не   20.59.59
      превышающие
      финансовый год
543   01 Закупки, не   24.45.30
      превышающие
      финансовый год
544   01 Закупки, не   23.19.23
      превышающие
      финансовый год
545   01 Закупки, не   22.29.29
      превышающие
      финансовый год
546   01 Закупки, не   26.51.51
      превышающие
      финансовый год
547   01 Закупки, не   23.19.23
      превышающие
      финансовый год
548   01 Закупки, не   22.29.29
      превышающие
      финансовый год
549   01 Закупки, не   22.29.29
      превышающие
      финансовый год
550   01 Закупки, не   22.29.29
      превышающие
      финансовый год
551   01 Закупки, не   26.70.21
      превышающие
      финансовый год
552   01 Закупки, не   20.14.64
      превышающие
      финансовый год
553   01 Закупки, не   21.20.23
      превышающие
      финансовый год




554   01 Закупки, не   21.10.51
      превышающие
      финансовый год
555   01 Закупки, не   20.59.59
      превышающие
      финансовый год
556   01 Закупки, не   21.10.51.
      превышающие
      финансовый год
557   01 Закупки, не   20.59.59
      превышающие
      финансовый год
558   01 Закупки, не   20.59.52
      превышающие
      финансовый год
559   01 Закупки, не   20.59.52
      превышающие
      финансовый год



560   01 Закупки, не   20.59.59
      превышающие
      финансовый год




561   01 Закупки, не   20.59.59
      превышающие
      финансовый год
562   01 Закупки, не   26.51.52
      превышающие
      финансовый год
563   01 Закупки, не   20.59.59
      превышающие
      финансовый год
564   01 Закупки, не   32.50.13
      превышающие
      финансовый год
565   01 Закупки, не   01.11.81.
      превышающие
      финансовый год
566   01 Закупки, не   25.29.12
      превышающие
      финансовый год
567   01 Закупки, не   20.59.52
      превышающие
      финансовый год

568   01 Закупки, не   20.13.25
      превышающие
      финансовый год
569   01 Закупки, не   23.19.23
      превышающие
      финансовый год
570   01 Закупки, не   22.29.29
      превышающие
      финансовый год
571   01 Закупки, не   22.29.29
      превышающие
      финансовый год
572   01 Закупки, не   22.29.29
      превышающие
      финансовый год
573   01 Закупки, не   23.13.11
      превышающие
      финансовый год
574   01 Закупки, не   23.13.11
      превышающие
      финансовый год
575   01 Закупки, не   23.19.23
      превышающие
      финансовый год
576   01 Закупки, не   23.19.23
      превышающие
      финансовый год
577   01 Закупки, не   23.19.23
      превышающие
      финансовый год
578   01 Закупки, не   23.19.23
      превышающие
      финансовый год
579   01 Закупки, не   23.19.23
      превышающие
      финансовый год
580   01 Закупки, не   23.19.23
      превышающие
      финансовый год
581   01 Закупки, не   22.22.13
      превышающие
      финансовый год
582   01 Закупки, не   23.19.23
      превышающие
      финансовый год
583   01 Закупки, не   23.19.23
      превышающие
      финансовый год
584   01 Закупки, не   26.51.51
      превышающие
      финансовый год
585   01 Закупки, не   22.29.29
      превышающие
      финансовый год
586   01 Закупки, не   20.59.59
      превышающие
      финансовый год
587   01 Закупки, не   20.13.25
      превышающие
      финансовый год
588   01 Закупки, не   21.10.52.
      превышающие
      финансовый год



589   01 Закупки, не   20.14.64
      превышающие
      финансовый год
590   01 Закупки, не   20.14.64
      превышающие
      финансовый год
591   01 Закупки, не   49.42.19
      превышающие
      финансовый год
592   01 Закупки, не   21.10.52.
      превышающие
      финансовый год



593   01 Закупки, не   22.29.29
      превышающие
      финансовый год



594   01 Закупки, не   22.29.29
      превышающие
      финансовый год



595   01 Закупки, не   17.29.19
      превышающие
      финансовый год
596   01 Закупки, не   26.70.21
      превышающие
      финансовый год
597   01 Закупки, не   23.19.23
      превышающие
      финансовый год
598   01 Закупки, не   23.19.23
      превышающие
      финансовый год
599   01 Закупки, не   23.19.23
      превышающие
      финансовый год
600   01 Закупки, не   20.12.19
      превышающие
      финансовый год
601   01 Закупки, не   23.19.23
      превышающие
      финансовый год
602   01 Закупки, не   22.29.29-
      превышающие
      финансовый год
603   01 Закупки, не   22.29.29
      превышающие
      финансовый год
604   01 Закупки, не   25.71.11
      превышающие
      финансовый год
605   01 Закупки, не   23.19.23
      превышающие
      финансовый год
606   01 Закупки, не   25.99.29
      превышающие
      финансовый год
607   01 Закупки, не   22.29.29
      превышающие
      финансовый год
608   01 Закупки, не   22.29.29
      превышающие
      финансовый год
609   01 Закупки, не   22.29.29
      превышающие
      финансовый год
610   01 Закупки, не   21.20.23
      превышающие
      финансовый год
611   01 Закупки, не   20.59.59
      превышающие
      финансовый год
612   01 Закупки, не   21.20.21
      превышающие
      финансовый год



613   01 Закупки, не   21.10.52.
      превышающие
      финансовый год




614   01 Закупки, не   32.50.13
      превышающие
      финансовый год
615   01 Закупки, не   32.50.13
      превышающие
      финансовый год
616   01 Закупки, не   21.20.24
      превышающие
      финансовый год
617   01 Закупки, не   28.41.32
      превышающие
      финансовый год
618   01 Закупки, не   20.59.52
      превышающие
      финансовый год
619   01 Закупки, не   20.59.51
      превышающие
      финансовый год
620   01 Закупки, не   20.59.51
      превышающие
      финансовый год
621   01 Закупки, не   20.59.51
      превышающие
      финансовый год
622   01 Закупки, не   20.12.23 -
      превышающие
      финансовый год
623   01 Закупки, не   22.29.29
      превышающие
      финансовый год
624   01 Закупки, не   20.14.74
      превышающие
      финансовый год
625   01 Закупки, не   65.12.11
      превышающие
      финансовый год
626   01 Закупки, не   91.01.11
      превышающие
      финансовый год



627   01 Закупки, не   86.22.11
      превышающие
      финансовый год



628   01 Закупки, не   22.19.20
      превышающие
      финансовый год
629   01 Закупки, не   22.19.20
      превышающие
      финансовый год
630   01 Закупки, не   22.19.20
      превышающие
      финансовый год

631   01 Закупки, не   22.19.20
      превышающие
      финансовый год

632   01 Закупки, не   22.19.20
      превышающие
      финансовый год

633   01 Закупки, не   13.10.29
      превышающие
      финансовый год

634   01 Закупки, не   13.10.29
      превышающие
      финансовый год

635   01 Закупки, не   23.99.14
      превышающие
      финансовый год

636   01 Закупки, не   26.51.66
      превышающие
      финансовый год




637   01 Закупки, не   72.11.12
      превышающие
      финансовый год
638   01 Закупки, не   71.20.11
      превышающие
      финансовый год
639   01 Закупки, не   72.11.13
      превышающие
      финансовый год




640   01 Закупки, не   72.11.11
      превышающие
      финансовый год




641   01 Закупки, не   71.20.12
      превышающие
      финансовый год




642   01 Закупки, не   33.11.13
      превышающие
      финансовый год




643   01 Закупки, не   33.11.13
      превышающие
      финансовый год




644   01 Закупки, не   26.51.66
      превышающие
      финансовый год

645   01 Закупки, не   26.51.66
      превышающие
      финансовый год
646   01 Закупки, не   20.14.64
      превышающие
      финансовый год
647   01 Закупки, не   22.29.29
      превышающие
      финансовый год
648   01 Закупки, не   20.14.64
      превышающие
      финансовый год
649   01 Закупки, не   20.59.59
      превышающие
      финансовый год




650   01 Закупки, не   20.14.64
      превышающие
      финансовый год
651   01 Закупки, не   20.14.64
      превышающие
      финансовый год
652   01 Закупки, не   20.59.59
      превышающие
      финансовый год
653   01 Закупки, не   20.14.44
      превышающие
      финансовый год
654   01 Закупки, не   20.59.59
      превышающие
      финансовый год
655   01 Закупки, не   20.15.32
      превышающие
      финансовый год
656   01 Закупки, не   20.15.72
      превышающие
      финансовый год
657   01 Закупки, не   20.14.64
      превышающие
      финансовый год



658   01 Закупки, не   20.59.59
      превышающие
      финансовый год

659   01 Закупки, не   20.59.59
      превышающие
      финансовый год

660   01 Закупки, не   20.59.59
      превышающие
      финансовый год
661   01 Закупки, не   20.59.59
      превышающие
      финансовый год

662   01 Закупки, не   20.59.59
      превышающие
      финансовый год
663   01 Закупки, не   20.59.59
      превышающие
      финансовый год
664   01 Закупки, не   20.59.59
      превышающие
      финансовый год
665   01 Закупки, не   20.59.59
      превышающие
      финансовый год
666   01 Закупки, не   20.59.59
      превышающие
      финансовый год
667   01 Закупки, не   20.59.59
      превышающие
      финансовый год

668   01 Закупки, не   20.59.59
      превышающие
      финансовый год
669   01 Закупки, не   20.59.59
      превышающие
      финансовый год
670   01 Закупки, не   20.59.59
      превышающие
      финансовый год
671   01 Закупки, не   20.59.59
      превышающие
      финансовый год

672   01 Закупки, не   20.59.59
      превышающие
      финансовый год

673   01 Закупки, не   20.14.99
      превышающие
      финансовый год
674   01 Закупки, не   20.13.52
      превышающие
      финансовый год
675   01 Закупки, не   26.70.21
      превышающие
      финансовый год
676   01 Закупки, не   22.22.14
      превышающие
      финансовый год
677   01 Закупки, не   22.22.14
      превышающие
      финансовый год
678   01 Закупки, не   22.22.14
      превышающие
      финансовый год
679   01 Закупки, не   22.22.14
      превышающие
      финансовый год
680   01 Закупки, не   20.14.64
      превышающие
      финансовый год
681   01 Закупки, не   23.19.26
      превышающие
      финансовый год
682   01 Закупки, не   23.19.26
      превышающие
      финансовый год
683   01 Закупки, не   23.19.26
      превышающие
      финансовый год
684   01 Закупки, не   26.51.51
      превышающие
      финансовый год
685   01 Закупки, не   20.59.59
      превышающие
      финансовый год
686   01 Закупки, не   20.59.59
      превышающие
      финансовый год
687   01 Закупки, не   23.19.26
      превышающие
      финансовый год
688   01 Закупки, не   20.59.59
      превышающие
      финансовый год
689   01 Закупки, не   21.10.52
      превышающие
      финансовый год
690   01 Закупки, не   20.59.59
      превышающие
      финансовый год
691   01 Закупки, не   20.13.41
      превышающие
      финансовый год
692   01 Закупки, не   20.59.59
      превышающие
      финансовый год
693   01 Закупки, не   20.14.64
      превышающие
      финансовый год
694   01 Закупки, не   25.73.60
      превышающие
      финансовый год
695   01 Закупки, не   20.14.64
      превышающие
      финансовый год
696   01 Закупки, не   25.73.60
      превышающие
      финансовый год
697   01 Закупки, не   20.14.99
      превышающие
      финансовый год
698   01 Закупки, не   20.14.64
      превышающие
      финансовый год
699   01 Закупки, не   21.10.54
      превышающие
      финансовый год
700   01 Закупки, не   21.10.52
      превышающие
      финансовый год
701   01 Закупки, не   23.19.26
      превышающие
      финансовый год
702   01 Закупки, не   23.19.26
      превышающие
      финансовый год
703   01 Закупки, не   23.19.26
      превышающие
      финансовый год
704   01 Закупки, не   23.19.26
      превышающие
      финансовый год
705   01 Закупки, не   23.19.26
      превышающие
      финансовый год
706   01 Закупки, не   23.19.26
      превышающие
      финансовый год
707   01 Закупки, не   23.19.26
      превышающие
      финансовый год
708   01 Закупки, не   23.19.26
      превышающие
      финансовый год
709   01 Закупки, не   23.19.26
      превышающие
      финансовый год
710   01 Закупки, не   23.19.26
      превышающие
      финансовый год
711   01 Закупки, не   23.19.26
      превышающие
      финансовый год
712   01 Закупки, не   23.19.26
      превышающие
      финансовый год
713   01 Закупки, не   22.22.14
      превышающие
      финансовый год
714   01 Закупки, не   22.22.14
      превышающие
      финансовый год
715   01 Закупки, не   22.22.14
      превышающие
      финансовый год
716   01 Закупки, не   25.73.60
      превышающие
      финансовый год
717   01 Закупки, не   25.73.60
      превышающие
      финансовый год
718   01 Закупки, не   22.29.29
      превышающие
      финансовый год

719   01 Закупки, не   20.59.59
      превышающие
      финансовый год
720   01 Закупки, не   25.73.60
      превышающие
      финансовый год
721   01 Закупки, не   25.73.60
      превышающие
      финансовый год
722   01 Закупки, не   25.73.60
      превышающие
      финансовый год
723   01 Закупки, не   22.22.14
      превышающие
      финансовый год
724   01 Закупки, не   22.22.14
      превышающие
      финансовый год
725   01 Закупки, не   22.22.14
      превышающие
      финансовый год
726   01 Закупки, не   28.25.13
      превышающие
      финансовый год
727   01 Закупки, не   20.14.99
      превышающие
      финансовый год
728   01 Закупки, не   20.59.59
      превышающие
      финансовый год
729   01 Закупки, не   20.59.59
      превышающие
      финансовый год
730   01 Закупки, не   20.59.59
      превышающие
      финансовый год
731   01 Закупки, не   20.59.52
      превышающие
      финансовый год
732   01 Закупки, не   22.29.29
      превышающие
      финансовый год
733   01 Закупки, не   22.29.29
      превышающие
      финансовый год
734   01 Закупки, не   22.29.29
      превышающие
      финансовый год
735   01 Закупки, не   22.29.29
      превышающие
      финансовый год
736   01 Закупки, не   22.29.29
      превышающие
      финансовый год
737   01 Закупки, не   22.29.29
      превышающие
      финансовый год
738   01 Закупки, не   20.15.60
      превышающие
      финансовый год
739   01 Закупки, не   20.13.25
      превышающие
      финансовый год
740   01 Закупки, не   25.73.60
      превышающие
      финансовый год
741   01 Закупки, не   25.73.60
      превышающие
      финансовый год
742   01 Закупки, не   20.59.59
      превышающие
      финансовый год
743   01 Закупки, не   25.73.60
      превышающие
      финансовый год
744   01 Закупки, не   20.14.99
      превышающие
      финансовый год
745   01 Закупки, не   25.73.60
      превышающие
      финансовый год
746   01 Закупки, не   25.73.60
      превышающие
      финансовый год
747   01 Закупки, не   22.29.29
      превышающие
      финансовый год
748   01 Закупки, не   22.29.29
      превышающие
      финансовый год
749   01 Закупки, не   22.29.29
      превышающие
      финансовый год
750   01 Закупки, не   25.73.60
      превышающие
      финансовый год
751   01 Закупки, не   25.73.60
      превышающие
      финансовый год
752   01 Закупки, не   25.73.60
      превышающие
      финансовый год
753   01 Закупки, не   25.73.60
      превышающие
      финансовый год
754   01 Закупки, не   25.73.60
      превышающие
      финансовый год
755   01 Закупки, не   25.73.60
      превышающие
      финансовый год
756   01 Закупки, не   22.29.29
      превышающие
      финансовый год
757   01 Закупки, не   25.73.60
      превышающие
      финансовый год
758   01 Закупки, не   22.29.29
      превышающие
      финансовый год
759   01 Закупки, не   22.29.29
      превышающие
      финансовый год
760   01 Закупки, не   25.73.60
      превышающие
      финансовый год
761   01 Закупки, не   25.73.60
      превышающие
      финансовый год
762   01 Закупки, не   20.14.99
      превышающие
      финансовый год
763   01 Закупки, не   20.59.59
      превышающие
      финансовый год
764   01 Закупки, не   20.59.59
      превышающие
      финансовый год
765   01 Закупки, не   20.59.59
      превышающие
      финансовый год
766   01 Закупки, не   20.59.59
      превышающие
      финансовый год
767   01 Закупки, не   20.59.59
      превышающие
      финансовый год
768   01 Закупки, не   20.59.59
      превышающие
      финансовый год
769   01 Закупки, не   20.59.59
      превышающие
      финансовый год
770   01 Закупки, не   20.59.59
      превышающие
      финансовый год
771   01 Закупки, не   20.59.59
      превышающие
      финансовый год
772   01 Закупки, не   20.59.59
      превышающие
      финансовый год
773   01 Закупки, не   20.59.59
      превышающие
      финансовый год
774   01 Закупки, не   20.59.59
      превышающие
      финансовый год
775   01 Закупки, не   20.59.59
      превышающие
      финансовый год
776   01 Закупки, не   20.59.59
      превышающие
      финансовый год
777   01 Закупки, не   20.59.59
      превышающие
      финансовый год
778   01 Закупки, не   20.59.59
      превышающие
      финансовый год
779   01 Закупки, не   20.59.59
      превышающие
      финансовый год
780   01 Закупки, не   20.59.59
      превышающие
      финансовый год
781   01 Закупки, не   20.59.59
      превышающие
      финансовый год
782   01 Закупки, не   20.59.59
      превышающие
      финансовый год
783   01 Закупки, не   20.59.59
      превышающие
      финансовый год
784   01 Закупки, не   20.59.59
      превышающие
      финансовый год
785   01 Закупки, не   20.59.59
      превышающие
      финансовый год
786   01 Закупки, не   20.59.59
      превышающие
      финансовый год
787   01 Закупки, не   20.59.59
      превышающие
      финансовый год
788   01 Закупки, не   20.59.59
      превышающие
      финансовый год
789   01 Закупки, не   20.59.59
      превышающие
      финансовый год
790   01 Закупки, не   20.59.59
      превышающие
      финансовый год
791   01 Закупки, не   20.59.59
      превышающие
      финансовый год
792   01 Закупки, не   20.59.59
      превышающие
      финансовый год
793   01 Закупки, не   20.59.59
      превышающие
      финансовый год
794   01 Закупки, не   20.59.59
      превышающие
      финансовый год
795   01 Закупки, не   20.59.59
      превышающие
      финансовый год
796   01 Закупки, не   20.59.59
      превышающие
      финансовый год
797   01 Закупки, не   20.59.59
      превышающие
      финансовый год
798   01 Закупки, не   20.59.59
      превышающие
      финансовый год
799   01 Закупки, не   20.59.59
      превышающие
      финансовый год
800   01 Закупки, не   20.59.59
      превышающие
      финансовый год
801   01 Закупки, не   20.59.59
      превышающие
      финансовый год
802   01 Закупки, не   20.59.59
      превышающие
      финансовый год
803   01 Закупки, не   20.59.59
      превышающие
      финансовый год
804   01 Закупки, не   20.59.59
      превышающие
      финансовый год
805   01 Закупки, не   20.59.59
      превышающие
      финансовый год
806   01 Закупки, не   20.59.59
      превышающие
      финансовый год
807   01 Закупки, не   20.59.59
      превышающие
      финансовый год
808   01 Закупки, не   20.59.59
      превышающие
      финансовый год
809   01 Закупки, не   20.59.59
      превышающие
      финансовый год
810   01 Закупки, не   20.59.59
      превышающие
      финансовый год
811   01 Закупки, не   20.59.59
      превышающие
      финансовый год
812   01 Закупки, не   20.59.59
      превышающие
      финансовый год
813   01 Закупки, не   20.59.59
      превышающие
      финансовый год
814   01 Закупки, не   20.59.59
      превышающие
      финансовый год
815   01 Закупки, не   20.59.59
      превышающие
      финансовый год
816   01 Закупки, не   20.59.59
      превышающие
      финансовый год
817   01 Закупки, не   20.59.59
      превышающие
      финансовый год
818   01 Закупки, не   20.59.59
      превышающие
      финансовый год
819   01 Закупки, не   20.59.59
      превышающие
      финансовый год
820   01 Закупки, не   20.59.59
      превышающие
      финансовый год
821   01 Закупки, не   20.59.59
      превышающие
      финансовый год
822   01 Закупки, не   20.59.59
      превышающие
      финансовый год
823   01 Закупки, не   20.59.59
      превышающие
      финансовый год
824   01 Закупки, не   20.59.59
      превышающие
      финансовый год
825   01 Закупки, не   20.59.59
      превышающие
      финансовый год
826   01 Закупки, не   20.59.59
      превышающие
      финансовый год
827   01 Закупки, не   20.59.59
      превышающие
      финансовый год
828   01 Закупки, не   20.59.59
      превышающие
      финансовый год
829   01 Закупки, не   20.59.59
      превышающие
      финансовый год
830   01 Закупки, не   20.59.59
      превышающие
      финансовый год
831   01 Закупки, не   20.59.59
      превышающие
      финансовый год
832   01 Закупки, не   20.59.59
      превышающие
      финансовый год
833   01 Закупки, не   20.59.59
      превышающие
      финансовый год
834   01 Закупки, не   20.59.59
      превышающие
      финансовый год
835   01 Закупки, не   20.59.59
      превышающие
      финансовый год
836   01 Закупки, не   20.59.59
      превышающие
      финансовый год
837   01 Закупки, не   20.59.59
      превышающие
      финансовый год
838   01 Закупки, не   20.59.59
      превышающие
      финансовый год
839   01 Закупки, не   20.14.99
      превышающие
      финансовый год
840   01 Закупки, не   20.59.59
      превышающие
      финансовый год
841   01 Закупки, не   20.59.59
      превышающие
      финансовый год
842   01 Закупки, не   20.59.59
      превышающие
      финансовый год
843   01 Закупки, не   20.59.59
      превышающие
      финансовый год
844   01 Закупки, не   20.59.59
      превышающие
      финансовый год
845   01 Закупки, не   20.59.59
      превышающие
      финансовый год
846   01 Закупки, не   20.59.59
      превышающие
      финансовый год
847   01 Закупки, не   20.59.59
      превышающие
      финансовый год
848   01 Закупки, не   20.59.59
      превышающие
      финансовый год
849   01 Закупки, не   20.59.59
      превышающие
      финансовый год
850   01 Закупки, не   20.59.59
      превышающие
      финансовый год
851   01 Закупки, не   20.59.59
      превышающие
      финансовый год
852   01 Закупки, не   20.59.59
      превышающие
      финансовый год
853   01 Закупки, не   20.59.59
      превышающие
      финансовый год
854   01 Закупки, не   20.59.59
      превышающие
      финансовый год
855   01 Закупки, не   20.59.59
      превышающие
      финансовый год
856   01 Закупки, не   20.59.59
      превышающие
      финансовый год
857   01 Закупки, не   20.59.59
      превышающие
      финансовый год
858   01 Закупки, не   20.59.59
      превышающие
      финансовый год
859   01 Закупки, не   20.59.59
      превышающие
      финансовый год
860   01 Закупки, не   20.59.59
      превышающие
      финансовый год
861   01 Закупки, не   20.59.59
      превышающие
      финансовый год
862   01 Закупки, не   20.59.59
      превышающие
      финансовый год
863   01 Закупки, не   20.59.59
      превышающие
      финансовый год
864   01 Закупки, не   20.59.59
      превышающие
      финансовый год
865   01 Закупки, не   20.59.59
      превышающие
      финансовый год
866   01 Закупки, не   20.59.59
      превышающие
      финансовый год
867   01 Закупки, не   20.59.59
      превышающие
      финансовый год
868   01 Закупки, не   20.59.59
      превышающие
      финансовый год
869   01 Закупки, не   20.59.59
      превышающие
      финансовый год
870   01 Закупки, не   20.59.59
      превышающие
      финансовый год
871   01 Закупки, не   20.59.59
      превышающие
      финансовый год
872   01 Закупки, не   20.59.59
      превышающие
      финансовый год
873   01 Закупки, не   20.59.59
      превышающие
      финансовый год
874   01 Закупки, не   20.59.59
      превышающие
      финансовый год
875   01 Закупки, не   20.59.59
      превышающие
      финансовый год
876   01 Закупки, не   20.59.59
      превышающие
      финансовый год
877   01 Закупки, не   20.59.59
      превышающие
      финансовый год
878   01 Закупки, не   20.59.59
      превышающие
      финансовый год
879   01 Закупки, не   20.59.59
      превышающие
      финансовый год
880   01 Закупки, не   20.59.59
      превышающие
      финансовый год
881   01 Закупки, не   20.59.59
      превышающие
      финансовый год
882   01 Закупки, не   20.59.59
      превышающие
      финансовый год
883   01 Закупки, не   20.59.59
      превышающие
      финансовый год
884   01 Закупки, не   20.59.59
      превышающие
      финансовый год
885   01 Закупки, не   20.59.59
      превышающие
      финансовый год
886   01 Закупки, не   20.59.59
      превышающие
      финансовый год
887   01 Закупки, не   20.59.59
      превышающие
      финансовый год
888   01 Закупки, не   23.19.26
      превышающие
      финансовый год
889   01 Закупки, не   25.73.60
      превышающие
      финансовый год
890   01 Закупки, не   20.59.52
      превышающие
      финансовый год
891   01 Закупки, не   20.59.52
      превышающие
      финансовый год
892   01 Закупки, не   20.14.64
      превышающие
      финансовый год
893   01 Закупки, не   20.14.64
      превышающие
      финансовый год
894   01 Закупки, не   21.10.54
      превышающие
      финансовый год
895   01 Закупки, не   10.81.12
      превышающие
      финансовый год
896   01 Закупки, не   25.71.13
      превышающие
      финансовый год
897   01 Закупки, не   20.59.52
      превышающие
      финансовый год
898   01 Закупки, не   20.59.59
      превышающие
      финансовый год
899   01 Закупки, не   20.59.52
      превышающие
      финансовый год
900   01 Закупки, не   20.59.52
      превышающие
      финансовый год
901   01 Закупки, не   20.14.99
      превышающие
      финансовый год
902   01 Закупки, не   23.19.26
      превышающие
      финансовый год
903   01 Закупки, не   23.19.26
      превышающие
      финансовый год
904   01 Закупки, не   23.19.26
      превышающие
      финансовый год
905   01 Закупки, не   23.19.26
      превышающие
      финансовый год
906   01 Закупки, не   23.19.26
      превышающие
      финансовый год
907   01 Закупки, не   23.19.26
      превышающие
      финансовый год
908   01 Закупки, не   23.19.26
      превышающие
      финансовый год
909   01 Закупки, не   23.19.26
      превышающие
      финансовый год
910   01 Закупки, не   23.19.26
      превышающие
      финансовый год
911   01 Закупки, не   23.19.26
      превышающие
      финансовый год
912   01 Закупки, не   20.59.59
      превышающие
      финансовый год

913   01 Закупки, не   20.59.59
      превышающие
      финансовый год
914   01 Закупки, не   20.59.59
      превышающие
      финансовый год
915   01 Закупки, не   20.59.59
      превышающие
      финансовый год
916   01 Закупки, не   20.59.59
      превышающие
      финансовый год
917   01 Закупки, не   25.73.60
      превышающие
      финансовый год
918   01 Закупки, не   20.59.59
      превышающие
      финансовый год
919   01 Закупки, не   20.59.59
      превышающие
      финансовый год
920   01 Закупки, не   20.59.59
      превышающие
      финансовый год
921   01 Закупки, не   20.59.59
      превышающие
      финансовый год
922   01 Закупки, не   20.59.59
      превышающие
      финансовый год
923   01 Закупки, не   20.59.59
      превышающие
      финансовый год
924   01 Закупки, не   20.59.59
      превышающие
      финансовый год
925   01 Закупки, не   20.59.59
      превышающие
      финансовый год
926   01 Закупки, не   20.59.59
      превышающие
      финансовый год
927   01 Закупки, не   20.59.59
      превышающие
      финансовый год
928   01 Закупки, не   20.59.59
      превышающие
      финансовый год
929   01 Закупки, не   20.59.59
      превышающие
      финансовый год
930   01 Закупки, не   20.59.59
      превышающие
      финансовый год
931   01 Закупки, не   20.59.59
      превышающие
      финансовый год
932   01 Закупки, не   20.59.59
      превышающие
      финансовый год
933   01 Закупки, не   20.59.59
      превышающие
      финансовый год
934   01 Закупки, не   20.59.59
      превышающие
      финансовый год
935   01 Закупки, не   20.59.59
      превышающие
      финансовый год
936   01 Закупки, не   20.59.59
      превышающие
      финансовый год
937   01 Закупки, не   20.59.59
      превышающие
      финансовый год
938   01 Закупки, не   20.59.59
      превышающие
      финансовый год
939   01 Закупки, не   20.59.59
      превышающие
      финансовый год
940   01 Закупки, не   20.14.44
      превышающие
      финансовый год
941   01 Закупки, не   26.70.21
      превышающие
      финансовый год
942   01 Закупки, не   20.14.44
      превышающие
      финансовый год
943   01 Закупки, не   20.13.52
      превышающие
      финансовый год
944   01 Закупки, не   21.10.54
      превышающие
      финансовый год
945   01 Закупки, не   23.19.26
      превышающие
      финансовый год
946   01 Закупки, не   23.19.26
      превышающие
      финансовый год
947   01 Закупки, не   23.19.26
      превышающие
      финансовый год
948   01 Закупки, не   23.19.26
      превышающие
      финансовый год
949   01 Закупки, не   23.19.26
      превышающие
      финансовый год
950   01 Закупки, не   23.19.26
      превышающие
      финансовый год
951   01 Закупки, не   23.19.26
      превышающие
      финансовый год
952   01 Закупки, не   25.73.60
      превышающие
      финансовый год
953   01 Закупки, не   25.73.60
      превышающие
      финансовый год
954   01 Закупки, не   25.73.60
      превышающие
      финансовый год
955   01 Закупки, не   25.73.60
      превышающие
      финансовый год
956   01 Закупки, не   22.29.29
      превышающие
      финансовый год
957   01 Закупки, не   25.73.60
      превышающие
      финансовый год
958   01 Закупки, не   25.73.60
      превышающие
      финансовый год
959   01 Закупки, не   25.73.60
      превышающие
      финансовый год
960   01 Закупки, не   25.73.60
      превышающие
      финансовый год
961   01 Закупки, не   25.73.60
      превышающие
      финансовый год
962   01 Закупки, не   25.73.60
      превышающие
      финансовый год
963   01 Закупки, не   25.73.60
      превышающие
      финансовый год
964   01 Закупки, не   20.14.64
      превышающие
      финансовый год
965   01 Закупки, не   20.14.64
      превышающие
      финансовый год
966   01 Закупки, не   27.90.13
      превышающие
      финансовый год
967   01 Закупки, не   01.61.10
      превышающие
      финансовый год




968   01 Закупки, не   01.61.10
      превышающие
      финансовый год




969   01 Закупки, не   71.20.11
      превышающие
      финансовый год




970   01 Закупки, не   71.20.11
      превышающие
      финансовый год

971   01 Закупки, не   33.12.18
      превышающие
      финансовый год
972   01 Закупки, не   20.59.52
      превышающие
      финансовый год




973   01 Закупки, не   71.20.13
      превышающие
      финансовый год




974   01 Закупки, не   20.59.52
      превышающие
      финансовый год



975   01 Закупки, не   71.20.13
      превышающие
      финансовый год

976   01 Закупки, не   71.20.13
      превышающие
      финансовый год




977   01 Закупки, не   71.20.19
      превышающие
      финансовый год
978   01 Закупки, не   71.20.19
      превышающие
      финансовый год
979   01 Закупки, не   71.20.19
      превышающие
      финансовый год
980   01 Закупки, не   71.20.19
      превышающие
      финансовый год
981   01 Закупки, не   71.20.19
      превышающие
      финансовый год

982   01 Закупки, не   71.20.19
      превышающие
      финансовый год
983   01 Закупки, не   71.20.19
      превышающие
      финансовый год
984    01 Закупки, не   71.20.19
       превышающие
       финансовый год
985    01 Закупки, не   71.20.19
       превышающие
       финансовый год
986    01 Закупки, не   71.20.19
       превышающие
       финансовый год

987    01 Закупки, не   71.20.19
       превышающие
       финансовый год
988    01 Закупки, не   71.20.19
       превышающие
       финансовый год
989    01 Закупки, не   71.20.19
       превышающие
       финансовый год
990    01 Закупки, не   71.20.19
       превышающие
       финансовый год
991    01 Закупки, не   71.20.19
       превышающие
       финансовый год
992    01 Закупки, не   71.20.19
       превышающие
       финансовый год
993    01 Закупки, не   71.20.19
       превышающие
       финансовый год
994    01 Закупки, не   71.20.19
       превышающие
       финансовый год
995    01 Закупки, не   71.20.19
       превышающие
       финансовый год
996    01 Закупки, не   71.20.19
       превышающие
       финансовый год
997    01 Закупки, не   71.20.19
       превышающие
       финансовый год
998    01 Закупки, не   71.20.19
       превышающие
       финансовый год
999    01 Закупки, не   71.20.19
       превышающие
       финансовый год
1000   01 Закупки, не   45.20.11
       превышающие
       финансовый год
1001   01 Закупки, не   28.15.24
       превышающие
       финансовый год

1002   01 Закупки, не   29.31.22
       превышающие
       финансовый год

1003   01 Закупки, не   28.15.24
       превышающие
       финансовый год

1004   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1005   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1006   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1007   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1008   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1009   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1010   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1011   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1012   01 Закупки, не   28.29.13
       превышающие
       финансовый год

1013   01 Закупки, не   28.29.13
       превышающие
       финансовый год

1014   01 Закупки, не   28.29.13
       превышающие
       финансовый год

1015   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1016   01 Закупки, не   29.32.30
       превышающие
       финансовый год
1017   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1018   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1019   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1020   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1021   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1022   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1023   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1024   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1025   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1026   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1027   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1028   01 Закупки, не   29.31.23
       превышающие
       финансовый год

1029   01 Закупки, не   20.59.43
       превышающие
       финансовый год

1030   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1031   01 Закупки, не   29.32.30
       превышающие
       финансовый год

1032   01 Закупки, не   29.32.30
       превышающие
       финансовый год
1033   01 Закупки, не   33.12.16
       превышающие
       финансовый год

1034   01 Закупки, не   33.12.16
       превышающие
       финансовый год

1035   01 Закупки, не   33.12.16
       превышающие
       финансовый год

1036   01 Закупки, не   33.12.16
       превышающие
       финансовый год

1037   01 Закупки, не   27.33.13
       превышающие
       финансовый год



1038   01 Закупки, не   27.33.13
       превышающие
       финансовый год




1039   01 Закупки, не   19.20.21
       превышающие
       финансовый год
1040   01 Закупки, не   85.59.19
       превышающие
       финансовый год

1041   01 Закупки, не   26.70.16
       превышающие
       финансовый год




1042   01 Закупки, не   25.61.11
       превышающие
       финансовый год

1043   01 Закупки, не   82.99.19
       превышающие
       финансовый год
1044   01 Закупки, не   71.20.11
       превышающие
       финансовый год

1045   01 Закупки, не   39.00.23
       превышающие
       финансовый год

1046   01 Закупки, не   84.13.11
       превышающие
       финансовый год

1047   01 Закупки, не   45.20.11
       превышающие
       финансовый год




1048   01 Закупки, не   38.22.29
       превышающие
       финансовый год

1049   01 Закупки, не   38.22.29
       превышающие
       финансовый год

1050   01 Закупки, не   38.22.29
       превышающие
       финансовый год

1051   01 Закупки, не   38.22.29
       превышающие
       финансовый год

1052   01 Закупки, не   38.22.29
       превышающие
       финансовый год

1053   01 Закупки, не   38.22.29
       превышающие
       финансовый год

1054   01 Закупки, не   24.20.40
       превышающие
       финансовый год
1055   01 Закупки, не   24.20.13
       превышающие
       финансовый год
1056   01 Закупки, не   24.20.13
       превышающие
       финансовый год
1057   01 Закупки, не   25.94.11
       превышающие
       финансовый год
1058   01 Закупки, не   26.51.52
       превышающие
       финансовый год
1059   01 Закупки, не   26.51.51
       превышающие
       финансовый год
1060   01 Закупки, не   28.14.12
       превышающие
       финансовый год
1061   01 Закупки, не   33.11.19
       превышающие
       финансовый год
1062   01 Закупки, не   27.51.25
       превышающие
       финансовый год
1063   01 Закупки, не   27.51.25
       превышающие
       финансовый год
1064   01 Закупки, не   33.11.19
       превышающие
       финансовый год
1065   01 Закупки, не   28.14.12
       превышающие
       финансовый год
1066   01 Закупки, не   28.29.12
       превышающие
       финансовый год
1067   01 Закупки, не   28.29.12
       превышающие
       финансовый год
1068   01 Закупки, не   71.20.19
       превышающие
       финансовый год
1069   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1070   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1071   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1072   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1073   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1074   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1075   01 Закупки, не   25.73.30
       превышающие
       финансовый год

1076   01 Закупки, не   01.19.19
       превышающие
       финансовый год
1077   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1078   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1079   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1080   01 Закупки, не   22.29.21
       превышающие
       финансовый год

1081   01 Закупки, не   25.21.11
       превышающие
       финансовый год

1082   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1083   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1084   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1085   01 Закупки, не   22.23.12
       превышающие
       финансовый год

1086   01 Закупки, не   25.99.11
       превышающие
       финансовый год

1087   01 Закупки, не   22.21.29
       превышающие
       финансовый год

1088   01 Закупки, не   24.20.33
       превышающие
       финансовый год

1089   01 Закупки, не   24.20.33
       превышающие
       финансовый год

1090   01 Закупки, не   24.20.33
       превышающие
       финансовый год

1091   01 Закупки, не   24.20.33
       превышающие
       финансовый год

1092   01 Закупки, не   24.20.33
       превышающие
       финансовый год
1093   01 Закупки, не   24.20.33
       превышающие
       финансовый год

1094   01 Закупки, не   22.21.29
       превышающие
       финансовый год

1095   01 Закупки, не   22.21.29
       превышающие
       финансовый год

1096   01 Закупки, не   22.21.29
       превышающие
       финансовый год

1097   01 Закупки, не   24.20.40
       превышающие
       финансовый год

1098   01 Закупки, не   71.20.19
       превышающие
       финансовый год

1099   01 Закупки, не   71.20.19
       превышающие
       финансовый год

1100   01 Закупки, не   35.11.10
       превышающие
       финансовый год
1101   01 Закупки, не   35.13.10
       превышающие
       финансовый год
1102   01 Закупки, не   36.00.11
       превышающие
       финансовый год
1103   01 Закупки, не   36.00.11
       превышающие
       финансовый год
1104   01 Закупки, не   36.00.11
       превышающие
       финансовый год
1105   01 Закупки, не   53.10.13
       превышающие
       финансовый год
1106   01 Закупки, не   72.19.16
       превышающие
       финансовый год
1107   01 Закупки, не   72.19.16
       превышающие
       финансовый год




1108   01 Закупки, не   21.20.23
       превышающие
       финансовый год




1109   01 Закупки, не   21.10.51
       превышающие
       финансовый год
1110   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1111   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1112   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1113   01 Закупки, не   21.10.52
       превышающие
       финансовый год



1114   01 Закупки, не   21.10.52
       превышающие
       финансовый год

1115   01 Закупки, не   21.10.52
       превышающие
       финансовый год
1116   01 Закупки, не   20.59.60
       превышающие
       финансовый год
1117   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1118   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1119   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1120   01 Закупки, не   21.10.51
       превышающие
       финансовый год
1121   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1122   01 Закупки, не   20.59.55
       превышающие
       финансовый год
1123   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1124   01 Закупки, не   21.10.52
       превышающие
       финансовый год
1125   01 Закупки, не   20.59.55
       превышающие
       финансовый год
1126   01 Закупки, не   20.59.60
       превышающие
       финансовый год
1127   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1128   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1129   01 Закупки, не   21.10.52
       превышающие
       финансовый год



1130   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1131   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1132   01 Закупки, не   20.59.59
       превышающие
       финансовый год




1133   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1134   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1135   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1136   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1137   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1138   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1139   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1140   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1141   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1142   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1143   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1144   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1145   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1146   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1147   01 Закупки, не   27.90.31
       превышающие
       финансовый год

1148   01 Закупки, не   27.12.22.
       превышающие
       финансовый год

1149   01 Закупки, не   27.12.22.
       превышающие
       финансовый год

1150   01 Закупки, не   27.32.13
       превышающие
       финансовый год

1151   01 Закупки, не   27.33.11
       превышающие
       финансовый год

1152   01 Закупки, не   27.32.13
       превышающие
       финансовый год

1153   01 Закупки, не   27.33.14
       превышающие
       финансовый год

1154   01 Закупки, не   27.33.14
       превышающие
       финансовый год

1155   01 Закупки, не   27.40.13
       превышающие
       финансовый год

1156   01 Закупки, не   27.40.13
       превышающие
       финансовый год
1157   01 Закупки, не   27.40.13
       превышающие
       финансовый год

1158   01 Закупки, не   27.40.13
       превышающие
       финансовый год

1159   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1160   01 Закупки, не   27.40.25
       превышающие
       финансовый год

1161   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1162   01 Закупки, не   28.24.11
       превышающие
       финансовый год

1163   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1164   01 Закупки, не   25.93.15
       превышающие
       финансовый год

1165   01 Закупки, не   25.93.15
       превышающие
       финансовый год

1166   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1167   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1168   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1169   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1170   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1171   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1172   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1173   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1174   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1175   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1176   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1177   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1178   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1179   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1180   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1181   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1182   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1183   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1184   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1185   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1186   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1187   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1188   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1189   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1190   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1191   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1192   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1193   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1194   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1195   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1196   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1197   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1198   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1199   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1200   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1201   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1202   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1203   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1204   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1205   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1206   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1207   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1208   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1209   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1210   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1211   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1212   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1213   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1214   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1215   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1216   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1217   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1218   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1219   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1220   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1221   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1222   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1223   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1224   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1225   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1226   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1227   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1228   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1229   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1230   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1231   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1232   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1233   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1234   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1235   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1236   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1237   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1238   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1239   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1240   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1241   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1242   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1243   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1244   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1245   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1246   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1247   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1248   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1249   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1250   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1251   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1252   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1253   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1254   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1255   01 Закупки, не   13.99.19
       превышающие
       финансовый год
1256   01 Закупки, не   13.99.19
       превышающие
       финансовый год
1257   01 Закупки, не   01.19.10
       превышающие
       финансовый год
1258   01 Закупки, не   01.61.10
       превышающие
       финансовый год




1259   01 Закупки, не   01.49.19
       превышающие
       финансовый год
1260   01 Закупки, не   01.49.19
       превышающие
       финансовый год
1261   01 Закупки, не   65.12.21
       превышающие
       финансовый год
1262   01 Закупки, не   84.13.15
       превышающие
       финансовый год
1263   01 Закупки, не   84.13.15
       превышающие
       финансовый год
1264   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1265   01 Закупки, не   17.12.43
       превышающие
       финансовый год
1266   01 Закупки, не   17.12.20
       превышающие
       финансовый год
1267   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1268   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1269   01 Закупки, не   13.92.29
       превышающие
       финансовый год
1270   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1271   01 Закупки, не   13.20.44
       превышающие
       финансовый год
1272   01 Закупки, не   32.99.11
       превышающие
       финансовый год
1273   01 Закупки, не   22.29.10
       превышающие
       финансовый год
1274   01 Закупки, не   22.29.10
       превышающие
       финансовый год

1275   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1276   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1277   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1278   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1279   01 Закупки, не   32.50.50
       превышающие
       финансовый год
1280   01 Закупки, не   17.12.43
       превышающие
       финансовый год
1281   01 Закупки, не   20.14.14
       превышающие
       финансовый год
1282   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1283   01 Закупки, не   20.15.32
       превышающие
       финансовый год
1284   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1285   01 Закупки, не   21.10.51
       превышающие
       финансовый год



1286   01 Закупки, не   10.62.13
       превышающие
       финансовый год
1287   01 Закупки, не   10.89.13
       превышающие
       финансовый год
1288   01 Закупки, не   20.13.42
       превышающие
       финансовый год

1289   01 Закупки, не   20.13.31
       превышающие
       финансовый год
1290   01 Закупки, не   20.15.34
       превышающие
       финансовый год
1291   01 Закупки, не   20.13.51
       превышающие
       финансовый год
1292   01 Закупки, не   20.15.76
       превышающие
       финансовый год
1293   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1294   01 Закупки, не   20.13.41
       превышающие
       финансовый год
1295   01 Закупки, не   20.13.41
       превышающие
       финансовый год
1296   01 Закупки, не   08.93.10
       превышающие
       финансовый год
1297   01 Закупки, не   20.12.19
       превышающие
       финансовый год
1298   01 Закупки, не   21.20.23
       превышающие
       финансовый год




1299   01 Закупки, не   20.13.52
       превышающие
       финансовый год
1300   01 Закупки, не   20.13.41
       превышающие
       финансовый год
1301   01 Закупки, не   20.20.14
       превышающие
       финансовый год
1302   01 Закупки, не   20.13.63
       превышающие
       финансовый год
1303   01 Закупки, не   20.59.51
       превышающие
       финансовый год
1304   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1305   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1306   01 Закупки, не   20.14.74
       превышающие
       финансовый год
1307   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1308   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1309   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1310   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1311   01 Закупки, не   32.99.59
       превышающие
       финансовый год
1312   01 Закупки, не   17.29.19
       превышающие
       финансовый год
1313   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1314   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1315   01 Закупки, не   13.92.29
       превышающие
       финансовый год
1316   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1317   01 Закупки, не   22.19.71
       превышающие
       финансовый год
1318   01 Закупки, не   22.19.71
       превышающие
       финансовый год
1319   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1320   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1321   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1322   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1323   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1324   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1325   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1326   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1327   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1328   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1329   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1330   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1331   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1332   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1333   01 Закупки, не   25.92.13
       превышающие
       финансовый год
1334   01 Закупки, не   14.12.30
       превышающие
       финансовый год
1335   01 Закупки, не   17.21.14
       превышающие
       финансовый год
1336   01 Закупки, не   17.12.41
       превышающие
       финансовый год
1337   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1338   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1339   01 Закупки, не   27.90.33
       превышающие
       финансовый год
1340   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1341   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1342   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1343   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1344   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1345   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1346   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1347   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1348   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1349   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1350   01 Закупки, не   26.40.42
       превышающие
       финансовый год
1351   01 Закупки, не   32.50.13
       превышающие
       финансовый год
1352   01 Закупки, не   32.50.13
       превышающие
       финансовый год
1353   01 Закупки, не   32.50.13
       превышающие
       финансовый год
1354   01 Закупки, не   25.73.60
       превышающие
       финансовый год
1355   01 Закупки, не   25.73.60
       превышающие
       финансовый год
1356   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1357   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1358   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1359   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1360   01 Закупки, не   26.51.66
       превышающие
       финансовый год
1361   01 Закупки, не   26.51.66
       превышающие
       финансовый год
1362   01 Закупки, не   26.51.66
       превышающие
       финансовый год
1363   01 Закупки, не   26.51.66
       превышающие
       финансовый год
1364   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1365   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1366   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1367   01 Закупки, не   22.19.71
       превышающие
       финансовый год
1368   01 Закупки, не   26.51.53
       превышающие
       финансовый год
1369   01 Закупки, не   26.51.53
       превышающие
       финансовый год
1370   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1371   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1372   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1373   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1374   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1375   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1376   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1377   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1378   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1379   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1380   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1381   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1382   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1383   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1384   01 Закупки, не   26.52.28
       превышающие
       финансовый год

1385   01 Закупки, не   20.16.57
       превышающие
       финансовый год
1386   01 Закупки, не   20.16.57
       превышающие
       финансовый год




1387   01 Закупки, не   20.16.57
       превышающие
       финансовый год



1388   01 Закупки, не   25.73.30
       превышающие
       финансовый год
1389   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1390   01 Закупки, не   17.12.43
       превышающие
       финансовый год

1391   01 Закупки, не   14.12.30
       превышающие
       финансовый год



1392   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1393   01 Закупки, не   27.90.33
       превышающие
       финансовый год
1394   01 Закупки, не   20.14.14
       превышающие
       финансовый год
1395   01 Закупки, не   21.10.20
       превышающие
       финансовый год
1396   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1397   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1398   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1399   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1400   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1401   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1402   01 Закупки, не   20.15.10
       превышающие
       финансовый год
1403   01 Закупки, не   20.15.33
       превышающие
       финансовый год
1404   01 Закупки, не   20.15.32
       превышающие
       финансовый год
1405   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1406   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1407   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1408   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1409   01 Закупки, не   20.14.22
       превышающие
       финансовый год
1410   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1411   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1412   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1413   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1414   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1415   01 Закупки, не   20.14.33
       превышающие
       финансовый год
1416   01 Закупки, не   20.13.22
       превышающие
       финансовый год
1417   01 Закупки, не   10.89.13
       превышающие
       финансовый год
1418   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1419   01 Закупки, не   21.20.23
       превышающие
       финансовый год



1420   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1421   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1422   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1423   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1424   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1425   01 Закупки, не   20.14.22
       превышающие
       финансовый год
1426   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1427   01 Закупки, не   20.13.42
       превышающие
       финансовый год
1428   01 Закупки, не   20.13.42
       превышающие
       финансовый год
1429   01 Закупки, не   20.13.31
       превышающие
       финансовый год
1430   01 Закупки, не   20.15.76
       превышающие
       финансовый год
1431   01 Закупки, не   20.13.51
       превышающие
       финансовый год
1432   01 Закупки, не   20.13.51
       превышающие
       финансовый год
1433   01 Закупки, не   20.15.51
       превышающие
       финансовый год
1434   01 Закупки, не   20.15.76
       превышающие
       финансовый год
1435   01 Закупки, не   20.13.41
       превышающие
       финансовый год
1436   01 Закупки, не   20.15.35
       превышающие
       финансовый год
1437   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1438   01 Закупки, не   20.14.33
       превышающие
       финансовый год
1439   01 Закупки, не   20.14.33
       превышающие
       финансовый год
1440   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1441   01 Закупки, не   10.62.11
       превышающие
       финансовый год
1442   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1443   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1444   01 Закупки, не   10.89.15
       превышающие
       финансовый год
1445   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1446   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1447   01 Закупки, не   10.41.42
       превышающие
       финансовый год
1448   01 Закупки, не   10.41.42
       превышающие
       финансовый год
1449   01 Закупки, не   10.51.54
       превышающие
       финансовый год
1450   01 Закупки, не   21.10.40
       превышающие
       финансовый год
1451   01 Закупки, не   21.10.40
       превышающие
       финансовый год
1452   01 Закупки, не   21.10.40
       превышающие
       финансовый год
1453   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1454   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1455   01 Закупки, не   20.13.41
       превышающие
       финансовый год
1456   01 Закупки, не   01.49.22
       превышающие
       финансовый год
1457   01 Закупки, не   20.15.31
       превышающие
       финансовый год
1458   01 Закупки, не   10.61.21
       превышающие
       финансовый год
1459   01 Закупки, не   10.20.41
       превышающие
       финансовый год
1460   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1461   01 Закупки, не   20.14.44
       превышающие
       финансовый год
1462   01 Закупки, не   20.13.41
       превышающие
       финансовый год
1463   01 Закупки, не   20.13.51
       превышающие
       финансовый год
1464   01 Закупки, не   20.13.51
       превышающие
       финансовый год
1465   01 Закупки, не   08.93.10
       превышающие
       финансовый год
1466   01 Закупки, не   08.93.10
       превышающие
       финансовый год
1467   01 Закупки, не   21.20.23
       превышающие
       финансовый год




1468   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1469   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1470   01 Закупки, не   08.93.10
       превышающие
       финансовый год
1471   01 Закупки, не   20.15.39
       превышающие
       финансовый год
1472   01 Закупки, не   20.14.32
       превышающие
       финансовый год
1473   01 Закупки, не   10.61.40
       превышающие
       финансовый год
1474   01 Закупки, не   20.15.41
       превышающие
       финансовый год
1475   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1476   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1477   01 Закупки, не   20.16.51
       превышающие
       финансовый год
1478   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1479   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1480   01 Закупки, не   20.14.11
       превышающие
       финансовый год
1481   01 Закупки, не   20.14.11
       превышающие
       финансовый год
1482   01 Закупки, не   21.20.23
       превышающие
       финансовый год




1483   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1484   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1485   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1486   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1487   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1488   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1489   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1490   01 Закупки, не   20.14.11
       превышающие
       финансовый год
1491   01 Закупки, не   01.11.99
       превышающие
       финансовый год
1492   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1493   01 Закупки, не   20.13.42
       превышающие
       финансовый год
1494   01 Закупки, не   10.51.21
       превышающие
       финансовый год
1495   01 Закупки, не   10.61.22
       превышающие
       финансовый год

1496   01 Закупки, не   21.10.40
       превышающие
       финансовый год
1497   01 Закупки, не   20.13.66
       превышающие
       финансовый год
1498   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1499   01 Закупки, не   20.14.44
       превышающие
       финансовый год
1500   01 Закупки, не   20.59.51
       превышающие
       финансовый год
1501   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1502   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1503   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1504   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1505   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1506   01 Закупки, не   20.14.41
       превышающие
       финансовый год
1507   01 Закупки, не   20.14.11
       превышающие
       финансовый год
1508   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1509   01 Закупки, не   20.14.11
       превышающие
       финансовый год
1510   01 Закупки, не   20.13.42
       превышающие
       финансовый год
1511   01 Закупки, не   20.14.53
       превышающие
       финансовый год
1512   01 Закупки, не   20.14.64
       превышающие
       финансовый год



1513   01 Закупки, не   20.14.41
       превышающие
       финансовый год
1514   01 Закупки, не   20.13.31
       превышающие
       финансовый год
1515   01 Закупки, не   20.13.62
       превышающие
       финансовый год
1516   01 Закупки, не   10.89.13
       превышающие
       финансовый год
1517   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1518   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1519   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1520   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1521   01 Закупки, не   20.14.31
       превышающие
       финансовый год
1522   01 Закупки, не   71.20.13
       превышающие
       финансовый год

1523   01 Закупки, не   65.12.21
       превышающие
       финансовый год
1524   01 Закупки, не   49.32.12
       превышающие
       финансовый год




1525   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1526   01 Закупки, не   22.29.23
       превышающие
       финансовый год

1527   01 Закупки, не   21.20.24
       превышающие
       финансовый год

1528   01 Закупки, не   21.20.24
       превышающие
       финансовый год

1529   01 Закупки, не   21.20.24
       превышающие
       финансовый год
1530   01 Закупки, не   25.93.18
       превышающие
       финансовый год

1531   01 Закупки, не   25.94.11
       превышающие
       финансовый год

1532   01 Закупки, не   25.94.11
       превышающие
       финансовый год

1533   01 Закупки, не   20.42.15
       превышающие
       финансовый год

1534   01 Закупки, не   13.96.16
       превышающие
       финансовый год

1535   01 Закупки, не   20.51.20
       превышающие
       финансовый год

1536   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1537   01 Закупки, не   25.99.29
       превышающие
       финансовый год

1538   01 Закупки, не   25.99.29
       превышающие
       финансовый год

1539   01 Закупки, не   22.29.23
       превышающие
       финансовый год

1540   01 Закупки, не   25.99.29
       превышающие
       финансовый год

1541   01 Закупки, не   22.29.23
       превышающие
       финансовый год

1542   01 Закупки, не   22.29.23
       превышающие
       финансовый год

1543   01 Закупки, не   32.91.11
       превышающие
       финансовый год

1544   01 Закупки, не   27.51.15
       превышающие
       финансовый год

1545   01 Закупки, не   25.93.14
       превышающие
       финансовый год
1546   01 Закупки, не   25.93.14
       превышающие
       финансовый год

1547   01 Закупки, не   32.99.59
       превышающие
       финансовый год

1548   01 Закупки, не   08.11.20
       превышающие
       финансовый год

1549   01 Закупки, не   20.20.14
       превышающие
       финансовый год

1550   01 Закупки, не   32.99.59
       превышающие
       финансовый год

1551   01 Закупки, не   32.99.59
       превышающие
       финансовый год

1552   01 Закупки, не   22.21.42
       превышающие
       финансовый год

1553   01 Закупки, не   21.20,23
       превышающие
       финансовый год

1554   01 Закупки, не   22.29.29
       превышающие
       финансовый год

1555   01 Закупки, не   25.99.99
       превышающие
       финансовый год

1556   01 Закупки, не   25.99.99
       превышающие
       финансовый год

1557   01 Закупки, не   25.99.99
       превышающие
       финансовый год

1558   01 Закупки, не   14.12.30
       превышающие
       финансовый год

1559   01 Закупки, не   22.22.13
       превышающие
       финансовый год

1560   01 Закупки, не   22.22.13
       превышающие
       финансовый год

1561   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1562   01 Закупки, не   23.91.11
       превышающие
       финансовый год

1563   01 Закупки, не   23.91.11
       превышающие
       финансовый год

1564   01 Закупки, не   14.12.30
       превышающие
       финансовый год

1565   01 Закупки, не   13.20.31
       превышающие
       финансовый год



1566   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1567   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1568   01 Закупки, не   22.23.15
       превышающие
       финансовый год

1569   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1570   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1571   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1572   01 Закупки, не   22.22.11
       превышающие
       финансовый год

1573   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1574   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1575   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1576   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1577   01 Закупки, не   22.22.11
       превышающие
       финансовый год
1578   01 Закупки, не   22.22.11
       превышающие
       финансовый год

1579   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1580   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1581   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1582   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1583   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1584   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1585   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1586   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1587   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1588   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1589   01 Закупки, не   20.30.21
       превышающие
       финансовый год

1590   01 Закупки, не   28.29.22
       превышающие
       финансовый год

1591   01 Закупки, не   20.41.41
       превышающие
       финансовый год

1592   01 Закупки, не   15.20.13
       превышающие
       финансовый год

1593   01 Закупки, не   15.20.13
       превышающие
       финансовый год
1594   01 Закупки, не   20.20.14
       превышающие
       финансовый год

1595   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1596   01 Закупки, не   20.59.55
       превышающие
       финансовый год

1597   01 Закупки, не   32.99.11
       превышающие
       финансовый год

1598   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1599   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1600   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1601   01 Закупки, не   22.21.42
       превышающие
       финансовый год

1602   01 Закупки, не   13.92.14
       превышающие
       финансовый год

1603   01 Закупки, не   28.15.10
       превышающие
       финансовый год

1604   01 Закупки, не   25.71.13
       превышающие
       финансовый год

1605   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1606   01 Закупки, не   14.19.13
       превышающие
       финансовый год

1607   01 Закупки, не   32.99.11
       превышающие
       финансовый год

1608   01 Закупки, не   20.30.12
       превышающие
       финансовый год

1609   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1610   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1611   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1612   01 Закупки, не   25.73.30
       превышающие
       финансовый год

1613   01 Закупки, не   14.12.30
       превышающие
       финансовый год

1614   01 Закупки, не   22.19.30
       превышающие
       финансовый год

1615   01 Закупки, не   22.19.30
       превышающие
       финансовый год

1616   01 Закупки, не   13.92.29
       превышающие
       финансовый год

1617   01 Закупки, не   17.22.12
       превышающие
       финансовый год

1618   01 Закупки, не   25.94.13
       превышающие
       финансовый год

1619   01 Закупки, не   25.73.60
       превышающие
       финансовый год

1620   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1621   01 Закупки, не   25.99.11
       превышающие
       финансовый год

1622   01 Закупки, не   22.23.12
       превышающие
       финансовый год

1623   01 Закупки, не   15.20.13
       превышающие
       финансовый год

1624   01 Закупки, не   20.20.14
       превышающие
       финансовый год

1625   01 Закупки, не   26.51.52
       превышающие
       финансовый год
1626   01 Закупки, не   22.23.12
       превышающие
       финансовый год

1627   01 Закупки, не   22.23.12
       превышающие
       финансовый год

1628   01 Закупки, не   26.51.51
       превышающие
       финансовый год

1629   01 Закупки, не   17.12.20
       превышающие
       финансовый год

1630   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1631   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1632   01 Закупки, не   20.59.54
       превышающие
       финансовый год

1633   01 Закупки, не   27.51.23
       превышающие
       финансовый год




1634   01 Закупки, не   19.20.32
       превышающие
       финансовый год

1635   01 Закупки, не   16.29.12
       превышающие
       финансовый год

1636   01 Закупки, не   22.19.30
       превышающие
       финансовый год

1637   01 Закупки, не   22.19.30
       превышающие
       финансовый год

1638   01 Закупки, не   22.19.30
       превышающие
       финансовый год

1639   01 Закупки, не   32.50.13
       превышающие
       финансовый год

1640   01 Закупки, не   32.99.11
       превышающие
       финансовый год

1641   01 Закупки, не   20.41.32
       превышающие
       финансовый год
1642   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1643   01 Закупки, не   65.12.21
       превышающие
       финансовый год
1644   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1645   01 Закупки, не   82.99.19
       превышающие
       финансовый год

1646   01 Закупки, не   27.51.11
       превышающие
       финансовый год




1647   01 Закупки, не   19.20.32
       превышающие
       финансовый год
1648   01 Закупки, не   39.00.23
       превышающие
       финансовый год

1649   01 Закупки, не   22.19.71
       превышающие
       финансовый год
1650   01 Закупки, не   13.99.19
       превышающие
       финансовый год

1651   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1652   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1653   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1654   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1655   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1656   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1657   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1658   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1659   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1660   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1661   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1662   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1663   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1664   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1665   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1666   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1667   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1668   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1669   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1670   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1671   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1672   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1673   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1674   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1675   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1676   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1677   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1678   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1679   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1680   01 Закупки, не   20.41.10
       превышающие
       финансовый год
1681   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1682   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1683   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1684   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1685   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1686   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1687   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1688   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1689   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1690   01 Закупки, не   21.20.23
       превышающие
       финансовый год

1691   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1692   01 Закупки, не   20.14.64
       превышающие
       финансовый год

1693   01 Закупки, не   20.14.64
       превышающие
       финансовый год
1694   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1695   01 Закупки, не   32.91.19
       превышающие
       финансовый год
1696   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1697   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1698   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1699   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1700   01 Закупки, не   13.99.19
       превышающие
       финансовый год
1701   01 Закупки, не   22.23.13
       превышающие
       финансовый год
1702   01 Закупки, не   22.23.13
       превышающие
       финансовый год
1703   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1704   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1705   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1706   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1707   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1708   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1709   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1710   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1711   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1712   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1713   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1714   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1715   01 Закупки, не   74.90.20
       превышающие
       финансовый год



1716   01 Закупки, не   19.20.32
       превышающие
       финансовый год
1717   01 Закупки, не   19.20.32
       превышающие
       финансовый год
1718   01 Закупки, не   28.15.10
       превышающие
       финансовый год

1719   01 Закупки, не   27.90.40
       превышающие
       финансовый год

1720   01 Закупки, не   28.11.41
       превышающие
       финансовый год

1721   01 Закупки, не   28.11.41
       превышающие
       финансовый год

1722   01 Закупки, не   28.11.41
       превышающие
       финансовый год
1723   01 Закупки, не   28.25.20
       превышающие
       финансовый год

1724   01 Закупки, не   28.11.41
       превышающие
       финансовый год

1725   01 Закупки, не   27.90.40
       превышающие
       финансовый год

1726   01 Закупки, не   28.11.41
       превышающие
       финансовый год

1727   01 Закупки, не   22.19.73
       превышающие
       финансовый год

1728   01 Закупки, не   27.20.22
       превышающие
       финансовый год

1729   01 Закупки, не   22.19.73
       превышающие
       финансовый год

1730   01 Закупки, не   28.29.13
       превышающие
       финансовый год

1731   01 Закупки, не   28.29.13
       превышающие
       финансовый год

1732   01 Закупки, не   28.11.41
       превышающие
       финансовый год

1733   01 Закупки, не   28.14.12
       превышающие
       финансовый год

1734   01 Закупки, не   28.11.41
       превышающие
       финансовый год

1735   01 Закупки, не   28.15.39
       превышающие
       финансовый год

1736   01 Закупки, не   32.91.19
       превышающие
       финансовый год

1737   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1738   01 Закупки, не   20.59.41
       превышающие
       финансовый год
1739   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1740   01 Закупки, не   17.21.15
       превышающие
       финансовый год

1741   01 Закупки, не   18.12.19
       превышающие
       финансовый год




1742   01 Закупки, не   38.11.69
       превышающие
       финансовый год

1743   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1744   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1745   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1746   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1747   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1748   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1749   01 Закупки, не   26.51.65
       превышающие
       финансовый год

1750   01 Закупки, не   27.40.22
       превышающие
       финансовый год

1751   01 Закупки, не   27.40.22
       превышающие
       финансовый год

1752   01 Закупки, не   27.40.21
       превышающие
       финансовый год
1753   01 Закупки, не   27.40.39
       превышающие
       финансовый год

1754   01 Закупки, не   27.40.39
       превышающие
       финансовый год

1755   01 Закупки, не   27.40.42
       превышающие
       финансовый год

1756   01 Закупки, не   27.40.42
       превышающие
       финансовый год

1757   01 Закупки, не   27.40.42
       превышающие
       финансовый год

1758   01 Закупки, не   27.33.11
       превышающие
       финансовый год

1759   01 Закупки, не   27.11.42
       превышающие
       финансовый год

1760   01 Закупки, не   29.31.22
       превышающие
       финансовый год

1761   01 Закупки, не   29.31.22
       превышающие
       финансовый год

1762   01 Закупки, не   27.40.14
       превышающие
       финансовый год

1763   01 Закупки, не   27.40.14
       превышающие
       финансовый год

1764   01 Закупки, не   27.40.14
       превышающие
       финансовый год

1765   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1766   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1767   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1768   01 Закупки, не   27.33.11
       превышающие
       финансовый год
1769   01 Закупки, не   27.40.13
       превышающие
       финансовый год

1770   01 Закупки, не   27.40.13
       превышающие
       финансовый год

1771   01 Закупки, не   22.11.15
       превышающие
       финансовый год

1772   01 Закупки, не   27.90.12
       превышающие
       финансовый год

1773   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1774   01 Закупки, не   20.15.10
       превышающие
       финансовый год
1775   01 Закупки, не   24.42.12
       превышающие
       финансовый год
1776   01 Закупки, не   21.20.24
       превышающие
       финансовый год
1777   01 Закупки, не   22.29.10
       превышающие
       финансовый год
1778   01 Закупки, не   21.20.24
       превышающие
       финансовый год
1779   01 Закупки, не   17.12.41
       превышающие
       финансовый год
1780   01 Закупки, не   22.22.14
       превышающие
       финансовый год
1781   01 Закупки, не   22.22.14
       превышающие
       финансовый год
1782   01 Закупки, не   19.20.41
       превышающие
       финансовый год
1783   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1784   01 Закупки, не   23.19.26
       превышающие
       финансовый год
1785   01 Закупки, не   20.14.11
       превышающие
       финансовый год
1786   01 Закупки, не   20.14.33
       превышающие
       финансовый год
1787   01 Закупки, не   21.20.23
       превышающие
       финансовый год
1788   01 Закупки, не   20.20.14
       превышающие
       финансовый год
1789   01 Закупки, не   20.59.59
       превышающие
       финансовый год
1790   01 Закупки, не   13.92.29
       превышающие
       финансовый год
1791   01 Закупки, не   13.92.29
       превышающие
       финансовый год
1792   01 Закупки, не   20.59.60
       превышающие
       финансовый год
1793   01 Закупки, не   20.15.59
       превышающие
       финансовый год
1794   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1795   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1796   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1797   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1798   01 Закупки, не   26.70.21
       превышающие
       финансовый год
1799   01 Закупки, не   13.20.44
       превышающие
       финансовый год
1800   01 Закупки, не   32.99.11
       превышающие
       финансовый год
1801   01 Закупки, не   17.12.20
       превышающие
       финансовый год
1802   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1803   01 Закупки, не   22.19.60
       превышающие
       финансовый год
1804   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1805   01 Закупки, не   20.15.60
       превышающие
       финансовый год
1806   01 Закупки, не   08.93.10
       превышающие
       финансовый год
1807   01 Закупки, не   08.93.10
       превышающие
       финансовый год
1808   01 Закупки, не   32.50.12
       превышающие
       финансовый год
1809   01 Закупки, не   19.20.41
       превышающие
       финансовый год
1810   01 Закупки, не   22.29.29
       превышающие
       финансовый год
1811   01 Закупки, не   25.73.60
       превышающие
       финансовый год
1812   01 Закупки, не   25.73.60
       превышающие
       финансовый год
1813   01 Закупки, не   25.73.60
       превышающие
       финансовый год
1814   01 Закупки, не   23.19.26
       превышающие
       финансовый год
1815   01 Закупки, не   23.19.26
       превышающие
       финансовый год
1816   01 Закупки, не   23.19.26
       превышающие
       финансовый год
1817   01 Закупки, не   22.29.21
       превышающие
       финансовый год
1818   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1819   01 Закупки, не   32.99.11
       превышающие
       финансовый год
1820   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1821   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1822   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1823   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1824   01 Закупки, не   20.59.52
       превышающие
       финансовый год
1825   01 Закупки, не   20.59.51
       превышающие
       финансовый год
1826   01 Закупки, не   26.51.51
       превышающие
       финансовый год
1827   01 Закупки, не   26.51.51
       превышающие
       финансовый год
1828   01 Закупки, не   26.51.51
       превышающие
       финансовый год
1829   01 Закупки, не   20.59.54
       превышающие
       финансовый год
1830   01 Закупки, не   20.13.31
       превышающие
       финансовый год
1831   01 Закупки, не   17.29.19
       превышающие
       финансовый год
1832   01 Закупки, не   17.29.19
       превышающие
       финансовый год
1833   01 Закупки, не   17.29.19
       превышающие
       финансовый год
1834   01 Закупки, не   14.12.30
       превышающие
       финансовый год
1835   01 Закупки, не   20.14.53
       превышающие
       финансовый год
1836   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1837   01 Закупки, не   23.19.23
       превышающие
       финансовый год
1838   01 Закупки, не   22.29.10
       превышающие
       финансовый год
1839   01 Закупки, не   26.20.13
       превышающие
       финансовый год




1840   01 Закупки, не   27.20.23
       превышающие
       финансовый год




1841   01 Закупки, не   27.20.23
       превышающие
       финансовый год

1842   01 Закупки, не   86.10.19
       превышающие
       финансовый год
1843   01 Закупки, не   63.99.10
       превышающие
       финансовый год
1844   01 Закупки, не   65.12.11
       превышающие
       финансовый год
1845   01 Закупки, не   86.90.19
       превышающие
       финансовый год



1846   01 Закупки, не   38.11.69
       превышающие
       финансовый год

1847   01 Закупки, не   84.25.19
       превышающие
       финансовый год

1848   01 Закупки, не   33.11.13
       превышающие
       финансовый год

1849   01 Закупки, не   49.41.19
       превышающие
       финансовый год




1850   01 Закупки, не   19.20.21
       превышающие
       финансовый год




1851   01 Закупки, не   18.14.10
       превышающие
       финансовый год
1852   01 Закупки, не   45.20.11
       превышающие
       финансовый год




1853   01 Закупки, не   20.59.41
       превышающие
       финансовый год

1854   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1855   01 Закупки, не   32.91.19
       превышающие
       финансовый год
1856   01 Закупки, не   70.22.15
       превышающие
       финансовый год




1857   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1858   01 Закупки, не   26.51.70
       превышающие
       финансовый год




1859   01 Закупки, не   18.12.15
       превышающие
       финансовый год

1860   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1861   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1862   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1863   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1864   01 Закупки, не   18.12.19
       превышающие
       финансовый год
1865   01 Закупки, не   18.12.19
       превышающие
       финансовый год

1866   01 Закупки, не   49.41.19
       превышающие
       финансовый год
1867   01 Закупки, не   49.41.19
       превышающие
       финансовый год
1868   01 Закупки, не   19.20.21
       превышающие
       финансовый год
1869   01 Закупки, не   18.14.10
       превышающие
       финансовый год
1870   01 Закупки, не   45.20.11
       превышающие
       финансовый год
1871   01 Закупки, не   20.59.41
       превышающие
       финансовый год
1872   01 Закупки, не   17.12.20
       превышающие
       финансовый год

1873   01 Закупки, не   17.12.20
       превышающие
       финансовый год

1874   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1875   01 Закупки, не   20.41.32
       превышающие
       финансовый год

1876   01 Закупки, не   20.41.44
       превышающие
       финансовый год

1877   01 Закупки, не   20.41.31
       превышающие
       финансовый год

1878   01 Закупки, не   20.41.31
       превышающие
       финансовый год

1879   01 Закупки, не   20.41.20
       превышающие
       финансовый год

1880   01 Закупки, не   20.41.20
       превышающие
       финансовый год

1881   01 Закупки, не   22.22.11
       превышающие
       финансовый год

1882   01 Закупки, не   17.12.20
       превышающие
       финансовый год
1883   01 Закупки, не   20.41.31
       превышающие
       финансовый год

1884   01 Закупки, не   20.41.43
       превышающие
       финансовый год

1885   01 Закупки, не   22.22.11
       превышающие
       финансовый год

1886   01 Закупки, не   20.41.41
       превышающие
       финансовый год

1887   01 Закупки, не   27.40.15
       превышающие
       финансовый год

1888   01 Закупки, не   22.19.71
       превышающие
       финансовый год

1889   01 Закупки, не   16.29.11
       превышающие
       финансовый год

1890   01 Закупки, не   32.91.11
       превышающие
       финансовый год

1891   01 Закупки, не   22.29.22
       превышающие
       финансовый год

1892   01 Закупки, не   25.73.10
       превышающие
       финансовый год

1893   01 Закупки, не   25.91.12
       превышающие
       финансовый год

1894   01 Закупки, не   25.73.10
       превышающие
       финансовый год

1895   01 Закупки, не   25.73.10
       превышающие
       финансовый год

1896   01 Закупки, не   25.73.10
       превышающие
       финансовый год

1897   01 Закупки, не   25.73.10
       превышающие
       финансовый год

1898   01 Закупки, не   25.73.10
       превышающие
       финансовый год
1899   01 Закупки, не   13.92.29
       превышающие
       финансовый год

1900   01 Закупки, не   22.23.12
       превышающие
       финансовый год

1901   01 Закупки, не   22.19.30
       превышающие
       финансовый год

1902   01 Закупки, не   14.12.30
       превышающие
       финансовый год




1903   01 Закупки, не   22.22.13
       превышающие
       финансовый год

1904   01 Закупки, не   36.00.11
       превышающие
       финансовый год

1905   01 Закупки, не   17.12.73
       превышающие
       финансовый год

1906   01 Закупки, не   17.12.73
       превышающие
       финансовый год

1907   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1908   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1909   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1910   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1911   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1912   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1913   01 Закупки, не   22.29.25
       превышающие
       финансовый год
1914   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1915   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1916   01 Закупки, не   26.51.33
       превышающие
       финансовый год

1917   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1918   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1919   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1920   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1921   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1922   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1923   01 Закупки, не   25.93.14
       превышающие
       финансовый год

1924   01 Закупки, не   25.93.14
       превышающие
       финансовый год

1925   01 Закупки, не   20.52.10
       превышающие
       финансовый год

1926   01 Закупки, не   32.99.15
       превышающие
       финансовый год

1927   01 Закупки, не   25.71.11
       превышающие
       финансовый год

1928   01 Закупки, не   22.19.20
       превышающие
       финансовый год

1929   01 Закупки, не   17.23.13
       превышающие
       финансовый год
1930   01 Закупки, не   32.99.15
       превышающие
       финансовый год

1931   01 Закупки, не   25.73.30
       превышающие
       финансовый год

1932   01 Закупки, не   25.73.30
       превышающие
       финансовый год

1933   01 Закупки, не   25.73.30
       превышающие
       финансовый год

1934   01 Закупки, не   25.73.30
       превышающие
       финансовый год

1935   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1936   01 Закупки, не   25.99.23
       превышающие
       финансовый год

1937   01 Закупки, не   25.99.23
       превышающие
       финансовый год

1938   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1939   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1940   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1941   01 Закупки, не   13.94.11
       превышающие
       финансовый год

1942   01 Закупки, не   20.30.23
       превышающие
       финансовый год

1943   01 Закупки, не   17.23.12
       превышающие
       финансовый год

1944   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1945   01 Закупки, не   17.23.13
       превышающие
       финансовый год
1946   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1947   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1948   01 Закупки, не   17.23.13
       превышающие
       финансовый год

1949   01 Закупки, не   25.71.13
       превышающие
       финансовый год

1950   01 Закупки, не   25.71.13
       превышающие
       финансовый год

1951   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1952   01 Закупки, не   17.23.11
       превышающие
       финансовый год

1953   01 Закупки, не   17.23.12
       превышающие
       финансовый год

1954   01 Закупки, не   26.20.21
       превышающие
       финансовый год

1955   01 Закупки, не   28.23.12
       превышающие
       финансовый год

1956   01 Закупки, не   17.23.12
       превышающие
       финансовый год

1957   01 Закупки, не   22.29.25
       превышающие
       финансовый год

1958   01 Закупки, не   17.23.11
       превышающие
       финансовый год

1959   01 Закупки, не   32.99.12
       превышающие
       финансовый год

1960   01 Закупки, не   17.23.11
       превышающие
       финансовый год

1961   01 Закупки, не   17.23.11
       превышающие
       финансовый год
1962   01 Закупки, не   32.99.16
       превышающие
       финансовый год

1963   01 Закупки, не   32.99.16
       превышающие
       финансовый год

1964   01 Закупки, не   17.23.12
       превышающие
       финансовый год

1965   01 Закупки, не   17.23.11
       превышающие
       финансовый год

1966   01 Закупки, не   17.23.12
       превышающие
       финансовый год

1967   01 Закупки, не   27.33.13
       превышающие
       финансовый год

1968   01 Закупки, не   22.21.30
       превышающие
       финансовый год

1969   01 Закупки, не   65.12.11
       превышающие
       финансовый год
       ИТОГО
закупок товаров, работ, услуг на 2010 год
Министерства образования и науки Республики Казахстан от 15 ноября 2010 года


         Наименование заказчика (на русском языке)                  Финансовый год




                               6                                           7
       Республиканское государственное предприятие на    2010
       праве хозяйственного ведения "Национальный
       центр биотехнологии Республики Казахстан"
       Комитета науки Министерства образования и
       науки Республики Казахстан




енных закупок
                         Наименование закупаемых          Наименование закупаемых товаров,
                          товаров, работ, услуг (на         работ, услуг (на русском языке)
                           государственном языке)




                                      9                                    10
                      Бензин                             Бензин




                      Бензин                             Бензин




                      Интернетке қол жеткізу бойынша     Услуги по доступу к Интернету
                      қызметтер



                      www.@biocenter.kz сайтының         Хостинг сайта www.@biocenter.kz
                      Хостингі



                      Ӛрт сӛндіру сигналдама жүйесінің   Услуги по техническому обслуживанию
                      жабдықтарына техникалық қызмет     оборудования системы пожарной
                      кӛрсету бойынша қызметтер          сигнализации




                      "1С Бухгалтерия" бағдарламалық  Услуги по сопровождению
                      қамтамасызды сүйемелдеу бойынша программного обеспечения "1С
                      қызметтер                       Бухгалтерия"
Ғимаратын күзету бойынша          Услуги по охране здания
қызметтер



Дезинфекция қызметтері            Дезинфекционные услуги




Іргелес аумақты және ғимаратты    Услуги по уборке помещений и
жинау бойынша қызметтер           прилегающей территории



Жылулық энергиясын есептеу        Услуги по техническому обслуживанию
құралдарына техникалық қызмет     приборов учета тепловой энергии, снятие
кӛрсету және жылу энергиясын      показаний приборов учета тепловой
есепке алатын приборлардың        энергии и сдача их в
кӛрсеткішін алу, және оларды      энергоснабжающую организацию
энергия жабдықтаушы ұйымына
тапсыру
Курьерлік почта қызметтері        Услуги по курьерской почте




Қатты-тұрмыстық қалдықтарды        Вывоз и утилизация твердо-бытовых
кӛлікпен шығару және кәдеге жарату отходов
бойынша қызметтер

Ұйымдастыру техникаға қызмет      Услуги по обслуживанию и ремонту
кӛрсету және оларды жӛндеу        оргтехники
бойынша қызметтер

Цифрлы кабельдік теледидар        Услуги цифрового кабельного
қызметтері                        телевидения



Конверт                           Конверт




Асханалык ауыз су                 Питьевая столовая вода




Сүзгілерді және майды             Технический осмотр легкового
ауыстырумен DAEWOO Nexia Gle      автомобиля DAEWOO Nexia Gle с
жеңіл автокӛліктің техникалық     заменой масла и фильтров
тексеру




Қысымда тұрған ыдыстарды қауіпсіз Проведение курсов в области безопасной
пайдалану саласындағы курстарды   эксплуатации сосудов, работащих под
ӛткізу                            давлением
Батарейка                            Батарейка




Батарейка                            Батарейка




Ӛткізу құжаттар үшін, 100 ұяшыққа    Изготовление ящика под пропуска на 100
жәшік дайындау                       ячеек




Контейнер үшін тетіктері бар үстел   Изготовление стола с отверстиями под
дайындау                             контейнера




Брандспойттың электроқозғағышын Ремонт электродвигателя брандспойта
жӛндеу



Қоспалауыш                           Смеситель




Шланг                                Шланг




Құбыр                                Труба




Үшайыр                               Тройник




Үшайыр, қиғаш                        Тройник, косой




Бұрғыш                               Отвод




Жартылай бұрғыш                      Полуотвод




Муфта                                Муфта




Қамыт                                Хомут




Құбыр                                Труба
Құбыр                             Труба




Үшайыр                            Тройник




Бұрғыш                            Отвод




Жартылай бұрғыш                   Полуотвод




Муфта                             Муфта




Қамыт                             Хомут




Тетік                             Вентиль




Тетік                             Вентиль




Ағызатын бӛшкеге арматура         Арматура для сливного бочка




Сифон                             Сифон




Сифонға гофра                     Гофра под сифон




Унитазға гофра                    Гофра под унитаз




Писсуар                           Писсуар




Жұмыс үстелін дайындау            Изготовление стола рабочего




Бір томбалы, компьютер үстелін    Изготовление стола компьютерного,
дайындау                          однотумбовый




Кеңсе үстелі «ИЗО» (ISO) типтес   Стул офисный, типа «ИЗО»(ISO)
Тіркелген телефонды байланыс         Услуги фиксированной телефонной
қызметтер және басқа да              связи и других услуг коммуникаций
коммуникациялық қызметтер




"Биотехнология. Теория және          Услуги по изготовлению журнала
тәжірибе" журналын дайындау          "Биотехнология. Теория и практика"
бойынша қызметтер




Астана қаласы Уәлиханов кӛшесі,      Испытание электрооборудования
13/1 мекен-жайындағы, жалпы          внутренних электрических сетей
кӛлемі 1416,2 ш.м. әкімшілік және    административно-лабораторного здания
зертханалық ғимараттың ішкі электр   по адресу: г. Астана ул. Валиханова,
жүйесінің электр құрал               13/1, общей площадью 1416,2 кв.м
жабдықтарын сынау


Автоклав операторы мамандығы     Услуги по проведению курсов по
бойынша курстарды ӛткізу бойынша профессии оператор автоклава
қызметтер




Тіркелген телефонды байланыс         Услуги фиксированной телефонной
қызметтер және басқа да              связи и других услуг коммуникаций
коммуникациялық қызметтер




Үздіксіз қорек кӛзі                  Источник бесперебойного питания
Сұйықкристалды монитор       Монитор жидкокристаллический




Ӛткізгішсіз манипуляторлар   Беспроводной набор манипуляторов
жиынтығы




Еден қаптама                 Покрытие для пола




Плитка                       Плитка




Плитка                       Плитка




Плитка                       Плитка




Желім                        Клей




Ӛкілеттік шығындар           Представительские расходы



Банк қызметтері              Банковские услуги
Нотариус қызметтері                   Услуги нотариуса



Іс- шараларда сатылатын            Приобретение материалов реализуемых
материалдарын сатып алу, сондай-ақ на мероприятиях, а также оплата за
аталған іс-шараларға қатысқаны     участие в указанных мероприятиях
үшін ақы тӛлеу
Коммуникациялардың, тетіктердің,      Приобретения товаров, работ, услуг при
агрегаттардың, қосалқы                возникновении поломок, выхода из строя
бӛлшектердің және материалдардың      коммуникаций, механизмов, агрегатов,
 сынуы, істен шығуы туындаған         запасных частей и материалов
кезде тауарларды, жұмыстарды,
кӛрсетілетін қызметтерді сатып алу



Сумен жабдықтау және/немесе           Услуги по водоснабжению и/или
сарқынды суларды бұру                 отведению сточных вод

Электроэнергия                        Электроэнергия



Жылу энергия                          Тепловая энергия



Телефон байланыс қызметтері және      Услуги фиксированной телефонной
байланыс оператордың басқа            связи и прочие услуги оператора связи
қызметтері
Іс сапар шығындары                    Командировочные расходы



Почта корреспонденциясын жіберу       Пересылка почтовой корреспонденции



Мемлекеттiк монополияға               Услуги организации, подведомственной
жатқызылған салаларда                 Комитету по правам интеллектуальной
(ӛнертабыстарды, пайдалы              собственности
модельдердi, ӛнеркәсiптiк үлгiлердi   Министерства юстиции Республики
қорғау саласында қызметтер            Казахстан, осуществляющей
кӛрсету) қызметтi жүзеге асыратын     деятельность в сферах, отнесенных к
Қазақстан Республикасы Әдiлет         государственной монополии (оказание
министрлігінің                        услуг в области охраны изобретений,
Зияткерлiк меншiк құқығы              полезных моделей, промышленных
комитетке ведомстволық бағынысты      образцов).
ұйымның қызметтері


2010 жылға мерзімді баспасӛз          Приобретение периодических печатных
басылымдарын сатып алу                изданий на 2010 год




Металл бұйымдарын дайындау            Изготовление металлических изделий




Металл оттискті дайындау              Изготовление металлического оттиска




Азаматтық құқықтық                    Страхование гражданско- правовой
жауапкершілігін сақтандыру            ответственности
"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер




"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер
"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер




"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер
"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер
"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер
"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"2009-2011 жылдарға арналған       Услуги по проведению научных
медицинада, ауыл                   исследований по научно-технической
шаруашылығында, қоршаған ортаны    программе (НТП О.0493) «Разработка и
қорғауда, тамақ және қайта ӛңдеу   использование генно-инженерных и
ӛнеркәсібінде гендік инженерлік    клеточных технологий в медицине,
және жасушалық технологияны        сельском хозяйстве, охране окружающей
әзірлеу және қолдану" ғылыми-      среды, пищевой и перерабатывающей
техникалық бағдарламасы (О.0493    промышленности на 2009-2011 годы»
ҒТБ) бойынша ғылыми зерттеулерді
ӛткізу бойынша қызметтер



"Мемлекететтің ӛндірістік          Услуги по проведению прикладных
қауіпсіздігін нығайту мақсатында   научных исследований в рамках научно-
ауыл шаруашылық дақылдарының       технической программы «Разработка и
жаңа жоғарғы ӛнім беретін          внедрение в селекционную практику
сорттарын жедел жасаудың           молекулярно-генетических и
биоинженерлік және молекулярлы-    биоинженерных методов ускоренного
генетикалық әдістерін жасап,       создания новых высокоурожайных
селекциялық практикаға енгізу"     сортов сельскохозяйственных культур
ғылыми-техникалық бағдарламасы     для дальнейшего укрепления
шеңберінде қолданбалы ғылыми       продовольственной безопасности
зерттеулерді ӛткізу бойынша        страны»
қызметтер




"Мемлекететтің ӛндірістік          Услуги по проведению прикладных
қауіпсіздігін нығайту мақсатында   научных исследований в рамках научно-
ауыл шаруашылық дақылдарының       технической программы «Разработка и
жаңа жоғарғы ӛнім беретін          внедрение в селекционную практику
сорттарын жедел жасаудың           молекулярно-генетических и
биоинженерлік және молекулярлы-    биоинженерных методов ускоренного
генетикалық әдістерін жасап,       создания новых высокоурожайных
селекциялық практикаға енгізу"     сортов сельскохозяйственных культур
ғылыми-техникалық бағдарламасы     для дальнейшего укрепления
шеңберінде қолданбалы ғылыми       продовольственной безопасности
зерттеулерді ӛткізу бойынша        страны»
қызметтер
"Мемлекететтің ӛндірістік          Услуги по проведению прикладных
қауіпсіздігін нығайту мақсатында   научных исследований в рамках научно-
ауыл шаруашылық дақылдарының       технической программы «Разработка и
жаңа жоғарғы ӛнім беретін          внедрение в селекционную практику
сорттарын жедел жасаудың           молекулярно-генетических и
биоинженерлік және молекулярлы-    биоинженерных методов ускоренного
генетикалық әдістерін жасап,       создания новых высокоурожайных
селекциялық практикаға енгізу"     сортов сельскохозяйственных культур
ғылыми-техникалық бағдарламасы     для дальнейшего укрепления
шеңберінде қолданбалы ғылыми       продовольственной безопасности
зерттеулерді ӛткізу бойынша        страны»
қызметтер


"2008-2010 жылдарға арналған       Услуги по проведению прикладных
Каспий акваториясының              научных исследований в рамках научно-
биоценозын кешенді экологиялық-    технической программы "Комплексное
эпидемиологиялық зерттеу және      эколого-эпидемиологическое
оны сауықтыру бойынша шараларды    обследование биоценоза каспийской
әзірлеу" ғылыми-техникалық         акватории и разработка мер по его
бағдарлама шеңберінде қолданбалы   оздоровлению на 2008-2010 годы"
ғылыми зерттеулерді ӛткізу
бойынша қызметтер


"2008-2010 жылдарға арналған       Услуги по проведению прикладных
Каспий акваториясының              научных исследований в рамках научно-
биоценозын кешенді экологиялық-    технической программы "Комплексное
эпидемиологиялық зерттеу және      эколого-эпидемиологическое
оны сауықтыру бойынша шараларды    обследование биоценоза каспийской
әзірлеу" ғылыми-техникалық         акватории и разработка мер по его
бағдарлама шеңберінде қолданбалы   оздоровлению на 2008-2010 годы"
ғылыми зерттеулерді ӛткізу
бойынша қызметтер


"2008-2010 жылдарға арналған       Услуги по проведению прикладных
Каспий акваториясының              научных исследований в рамках научно-
биоценозын кешенді экологиялық-    технической программы "Комплексное
эпидемиологиялық зерттеу және      эколого-эпидемиологическое
оны сауықтыру бойынша шараларды    обследование биоценоза каспийской
әзірлеу" ғылыми-техникалық         акватории и разработка мер по его
бағдарлама шеңберінде қолданбалы   оздоровлению на 2008-2010 годы"
ғылыми зерттеулерді ӛткізу
бойынша қызметтер


"2008-2010 жылдарға арналған       Услуги по проведению прикладных
Каспий акваториясының              научных исследований в рамках научно-
биоценозын кешенді экологиялық-    технической программы "Комплексное
эпидемиологиялық зерттеу және      эколого-эпидемиологическое
оны сауықтыру бойынша шараларды    обследование биоценоза каспийской
әзірлеу" ғылыми-техникалық         акватории и разработка мер по его
бағдарлама шеңберінде қолданбалы   оздоровлению на 2008-2010 годы"
ғылыми зерттеулерді ӛткізу
бойынша қызметтер


"2008-2010 жылдарға арналған       Услуги по проведению прикладных
Каспий акваториясының              научных исследований в рамках научно-
биоценозын кешенді экологиялық-    технической программы "Комплексное
эпидемиологиялық зерттеу және      эколого-эпидемиологическое
оны сауықтыру бойынша шараларды    обследование биоценоза каспийской
әзірлеу" ғылыми-техникалық         акватории и разработка мер по его
бағдарлама шеңберінде қолданбалы   оздоровлению на 2008-2010 годы"
ғылыми зерттеулерді ӛткізу
бойынша қызметтер
"2008-2010 жылдарға арналған        Услуги по проведению прикладных
Каспий акваториясының               научных исследований в рамках научно-
биоценозын кешенді экологиялық-     технической программы "Комплексное
эпидемиологиялық зерттеу және       эколого-эпидемиологическое
оны сауықтыру бойынша шараларды     обследование биоценоза каспийской
әзірлеу" ғылыми-техникалық          акватории и разработка мер по его
бағдарлама шеңберінде қолданбалы    оздоровлению на 2008-2010 годы"
ғылыми зерттеулерді ӛткізу
бойынша қызметтер


Жануарлар үшін жем                  Корм для животных



Сұйық азот                          Азот жидкий



Тапсырыс берушінің № 1 бағдары      Услуги по аренде автомобиля для
бойынша жүру үшін автокӛлікті       движения по маршруту № 1 Заказчика
жалдау бойынша қызметтер




Тапсырыс берушінің № 2 бағдары      Услуги по аренде автомобиля для
бойынша жүру үшін автокӛлікті       движения по маршруту № 2 Заказчика
жалдау бойынша қызметтер




Теңіз түрі кемесін жалдау бойынша   Услуги по аренде судна морского типа
қызметтер




Ғылыми-зерттеу теңіз түрі кемесін   Услуги по аренде научно-
жалдау бойынша қызметтер            исследовательского судна морского типа
«Қазақстан Республикасында       Оказание услуг по выполнению
генетикалық түрлендірілген       прикладных научных исследований в
объектілердің айналымын          рамках НТП «Научно-техническое
мемлекеттік реттеуде ғылыми-     обеспечение государственного
техникалық жағынан қамтамасыз    регулирования оборота генетически
ету» ҒТБ шеңберінде қолданбалы   модифицированных объектов в
ғылыми зерттеулерді орындауда    Республике Казахстан»
қызметтерді кӛрсету




«Қазақстан Республикасында       Оказание услуг по выполнению
генетикалық түрлендірілген       прикладных научных исследований в
объектілердің айналымын          рамках НТП «Научно-техническое
мемлекеттік реттеуде ғылыми-     обеспечение государственного
техникалық жағынан қамтамасыз    регулирования оборота генетически
ету» ҒТБ шеңберінде қолданбалы   модифицированных объектов в
ғылыми зерттеулерді орындауда    Республике Казахстан»
қызметтерді кӛрсету


«Қазақстан Республикасында       Оказание услуг по выполнению
генетикалық түрлендірілген       прикладных научных исследований в
объектілердің айналымын          рамках НТП «Научно-техническое
мемлекеттік реттеуде ғылыми-     обеспечение государственного
техникалық жағынан қамтамасыз    регулирования оборота генетически
ету» ҒТБ шеңберінде қолданбалы   модифицированных объектов в
ғылыми зерттеулерді орындауда    Республике Казахстан»
қызметтерді кӛрсету


«Қазақстан Республикасында       Оказание услуг по выполнению
генетикалық түрлендірілген       прикладных научных исследований в
объектілердің айналымын          рамках НТП «Научно-техническое
мемлекеттік реттеуде ғылыми-     обеспечение государственного
техникалық жағынан қамтамасыз    регулирования оборота генетически
ету» ҒТБ шеңберінде қолданбалы   модифицированных объектов в
ғылыми зерттеулерді орындауда    Республике Казахстан»
қызметтерді кӛрсету


«Қазақстан Республикасында       Оказание услуг по выполнению
генетикалық түрлендірілген       прикладных научных исследований в
объектілердің айналымын          рамках НТП «Научно-техническое
мемлекеттік реттеуде ғылыми-     обеспечение государственного
техникалық жағынан қамтамасыз    регулирования оборота генетически
ету» ҒТБ шеңберінде қолданбалы   модифицированных объектов в
ғылыми зерттеулерді орындауда    Республике Казахстан»
қызметтерді кӛрсету
Лабораторлы – ақпараттық             Разработка лабораторно-
жүйені зерттемелеу (ЛАЖ), деректер   информационной системы (ЛИС),
базасына пайдаланушы                 поддержка ЛИС и приобретение
лицензияларын мүліктену және         лицензии пользователя на базу данных
ЛАЖ-ні қолдау




Қалдықтарды шығару және жинау        Вывоз и складирование мусора




Дезинфекция (дератизация)            Дезинфекция (дератизация)




Объектіні күзету бойынша             Услуги по охране объекта
қызметтер




Диспетчерлік байланыс қызметі        Услуги оперативной диспетчерской связи




Жылулық энергиясын есептеу           Услуги по техническому обслуживанию
құралдарына техникалық қызмет        приборов учета тепловой энергии, снятие
кӛрсету және жылу энергиясын         показаний приборов учета тепловой
есепке алатын приборлардың           энергии и сдача их в
кӛрсеткішін алу, және оларды         энергоснабжающую организацию
энергия жабдықтаушы ұйымына
тапсыру
Автокӛлік қызметтері                 Транспортные услуги




Ұйымдастыру техникаға қызмет         Услуги по обслуживанию и ремонту
кӛрсету және оларды жӛндеу           оргтехники
бойынша қызметтер
Интернетке қол жеткізу бойынша     Услуги по доступу к Интернету
қызметтер



Прекурсорлары бар қойманы қорғау Охрана склада с прекурсорами




Прекурсорлар қорғау қоймасындағы Техническое обслуживание средств
қорғау сигналдамасына техникалық охранной сигнализации, установленные
қызмет кӛрсету                   на складе прекурсоров




Жекеменшік бӛлінген шекарасына     Услуги по чистке канализации до
дейін канализацияларды тазалау     границы раздела собствености
бойынша қызметтер

Ӛрт сӛндіру сигналдама жүйесінің   Услуги по техническому обслуживанию
жабдықтарына техникалық қызмет     оборудования системы пожарной
кӛрсету бойынша қызметтер          сигнализации

Банк қызметтері                    Банковские услуги



Нотариус қызметтері                Услуги нотариуса



Электроэнергия                     Электроэнергия



Жылу энергия                       Тепловая энергия



Суық су                            Холодная вода



Сарқынды суларды бұру              Отвод сточных вод



Сарқынды суларды тазалау           Очистка сточных вод



Телефон байланыс және байланыс     Услуги телефонной связи и прочие
операторларының басқа да           услуги оператора связи
қызметтері
Іссапар шығындары                  Командировочные расходы



Почта корреспонденциясын жіберу    Пересылка почтовой корреспонденции



Электроэнергияны сатып алу         Приобретение электроэнергии



Тіркеу папкасы                     Папка - регистратор



Бензин                             Бензин
Автошиналар                          Автошины




Дизель жанар майы                    Дизельное топливо




Коммуникациялардың, тетіктердің,     Приобретения товаров, работ, услуг при
агрегаттардың, қосалқы               возникновении поломок, выхода из строя
бӛлшектердің және материалдардың     коммуникаций, механизмов, агрегатов,
 сынуы, істен шығуы туындаған        запасных частей и материалов
кезде тауарларды, жұмыстарды,
кӛрсетілетін қызметтерді сатып алу



Кӛліктің шиналарын монтаждау         Монтаж автошин




Мотор майы, жартылай синтетика,      Масло моторное, полусинтетика, с
алмастырумен                         заменой



Май сүзгіші, алмастырумен            Фильтр маслянный, с заменой




Термостат, алмастырумен              Термостат, с заменой




Генератордың белбеуі,                Ремень генератора,
алмастырумен                         с заменой



Антифриз                             Антифриз




Сиыр бауыры                          Печень говяжья



"1С Бухгалтерия" бағдарламалық  Услуги по сопровождению
қамтамасызды сүйемелдеу бойынша программного обеспечения "1С
қызметтер                       Бухгалтерия"

Шатыр                                Палатка



Каримат                              Каримат



Қаптӛсек                             Спальный мешок



Қалақша күрек                        Лопатка



Фонарь                               Фонарь



Каримат                              Каримат
Шатыр                               Палатка



Шатыр                               Палатка



Кітап типті орындық                 Стул книжка



Ғылыми-техникалық кітапханың        Услуги научно-технической библиотеки
қызметтері

Үй-жайды жалдау бойынша             Услуги по аренде помещений
қызметтер




Қабылдап таратқыш                   Приемопередатчик




Радиациялық қауіпсіздік саласында   Услуги по обучению в области
оқыту бойынша қызметтер             радиационной безопасности




СК - мониторларды жӛндеу            Ремонт ЖК-мониторов




ЭНТ - мониторларды жӛндеу           Ремонт ЭЛТ-мониторов




Еден қаптама                        Покрытие для пола




Ернеулік                            Плинтус




Ішкі бұрыш                          Угол внутренний




Торц бітеуіш                        Торцевая заглушка




ПВХ терезенің алды, орнатумен       Подоконник ПВХ, с установкой




Электромагнитті жүргізгіш           Пускатель электромагнитный
ПВХ есіктер үшін гарнитур қыспалы Гарнитур нажимной для ПВХ дверей




ПВХ есіктеріне бір тесікті құлып     Однозапорный замок для ПВХ дверей




ПВХ есіктері үшін 120 кг әмбебап     Универсальная петля для ПВХ дверей до
ілмек                                120 кг



Рычаг тартпасының жоғарыда           Доводчик верхнего расположения с
орналасқан жеткізуші                 рычажной тягой




Телефон аппараты                     Телефонный аппарат




Электроэнергия                       Электроэнергия



Телефон байланыс қызметтері және     Услуги фиксированной телефонной
байланыс оператордың басқа           связи и прочие услуги оператора связи
қызметтері
Интернетке қол жеткізу бойынша       Услуги по доступу к Интернету
қызметтер



2008 ш.ж. "Toyota Land Cruiser       Техническое обслуживание автомашины
Prado" автокӛлігіне техникалық       "Toyota Land Cruiser Prado" 2008 г.в.,
қызмет кӛрсету, қорап нӛмірі         номер кузова JTEBL29JX05107725,
JTEBL29JX05107725,                   объем двигателя 2700 см. куб.
қозғалтқыштың кӛлемі 2700 см. куб.




Автокӛлік үшін медициналық           Медицинская аптечка для автомобиля
дәріханашық
Аккумуляторлық батарея               Аккумуляторная батарея




Авто дӛңгелек                        Автошины




Топырақтың химиялық талдау           Химический анализ почв




Культуралды сұйықтықтардың 28        Химический анализ 28 образцов
үлгілерін химиялық талдау (13        культуральной жидкости (13 штаммов
микроағза штаммдары + бақылау        микроорганизмов + контроль)
нұсқасы)
Культуралды сұйықтықтардың 28        Химический анализ 28 образцов
үлгілерін химиялық талдау (13        культуральной жидкости (13 штаммов
микроағза штаммдары + бақылау        микроорганизмов + контроль)
нұсқасы)
Культуралды сұйықтықтардың 28        Химический анализ 28 образцов
үлгілерін химиялық талдау (13        культуральной жидкости (13 штаммов
микроағза штаммдары + бақылау        микроорганизмов + контроль)
нұсқасы)
Іс- шараларда сатылатын            Приобретение материалов реализуемых
материалдарын сатып алу, сондай-ақ на мероприятиях, а также оплата за
аталған іс-шараларға қатысқаны     участие в указанных мероприятиях
үшін ақы тӛлеу
Қазақстан Республикасының            Государственный Флаг Республики
мемлекеттік туы                      Казахстан



Азықтық желатин                      Пищевой желатин



Этил спирті                          Этиловый спирт



Ауыз су                              Питьевая вода




Ауыз су                              Питьевая вода




«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету
«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Мұнай ӛндіретін аймақтардағы        Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық       прикладных научных исследований
бағалау және биоремедиациялау»       в рамках научно-технической программы
ғылыми техникалық бағдарламасы        «Экологическая оценка и
шеңберінде қолданбалы ғылыми         биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді   зонах нефтедобычи» 

(жұмыстарды) кӛрсету
«Мұнай ӛндіретін аймақтардағы          Оказание услуг (работ) на выполнение
бұзылған экожүйені экологиялық         прикладных научных исследований
бағалау және биоремедиациялау»         в рамках научно-технической программы
ғылыми техникалық бағдарламасы          «Экологическая оценка и
шеңберінде қолданбалы ғылыми           биоремедиация нарушенных экосистем в
зерттеулерді орындауға қызметтерді     зонах нефтедобычи» 

(жұмыстарды) кӛрсету



«Әлемдік стандартқа сәйкес, азық-      Оказание услуг (работ) на выполнение
түлік ӛнімдерінің негізгі түрлерінің   прикладных научных исследований по
ғылыми-негізделген тұтыну              научно-технической программе
нормаларын әзірлеу» ғылыми-            «Разработка научно-обоснованных норм
техникалық бағдарламасы бойынша        потребления основных видов
қолданбалы ғылыми зерттеулерді         продовольственных продуктов,
орындауға қызметтерді                  соответствующих мировым стандартам»
(жұмыстарды) кӛрсету



«Әлемдік стандартқа сәйкес, азық-      Оказание услуг (работ) на выполнение
түлік ӛнімдерінің негізгі түрлерінің   прикладных научных исследований по
ғылыми-негізделген тұтыну              научно-технической программе
нормаларын әзірлеу» ғылыми-            «Разработка научно-обоснованных норм
техникалық бағдарламасы бойынша        потребления основных видов
қолданбалы ғылыми зерттеулерді         продовольственных продуктов,
орындауға қызметтерді                  соответствующих мировым стандартам»
(жұмыстарды) кӛрсету



«Әлемдік стандартқа сәйкес, азық-      Оказание услуг (работ) на выполнение
түлік ӛнімдерінің негізгі түрлерінің   прикладных научных исследований по
ғылыми-негізделген тұтыну              научно-технической программе
нормаларын әзірлеу» ғылыми-            «Разработка научно-обоснованных норм
техникалық бағдарламасы бойынша        потребления основных видов
қолданбалы ғылыми зерттеулерді         продовольственных продуктов,
орындауға қызметтерді                  соответствующих мировым стандартам»
(жұмыстарды) кӛрсету



«Қазақстанның биоалуантүрлілігін       Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,     прикладных научных исследований
микроорганизмдер жинақтамаларын        в рамках научно-технической программы
және бірегей генетикалық банкін         «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»        коллекций растений, животных,
ғылыми-техникалық бағдарламасы         микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми           генетических банков для сохранения
зерттеулерді орындауға қызметтерді     биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін       Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,     прикладных научных исследований
микроорганизмдер жинақтамаларын        в рамках научно-технической программы
және бірегей генетикалық банкін         «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»        коллекций растений, животных,
ғылыми-техникалық бағдарламасы         микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми           генетических банков для сохранения
зерттеулерді орындауға қызметтерді     биоразнообразия Казахстана»
(жұмыстарды) кӛрсету
«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету
«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету
«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету
«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету




РНҚаза ингибиторы бар кері           Набор для обратной транскрипции с
транскриптазаға арналған жиынтық     ингибитором РНКазы (на 1000 реакций)
(1000 реакцияға арналған)
Голд буфері бар АмплиТаг Голд      АмплиТаг Голд ДНК полимераза с Голд
ДНҚ полимераза                     буфером




Хай-ди ТМ Формамид                 Хай-ди ТМ Формамид



3.1 үлгілі ПРИЗМ БигДай            ПРИЗМ БигДай терминатор версия 3.1 -
Терминатор - циклдық               набор для циклического секвенирования
секвенирлеуге арналған жиынтық



POP-7 полимері                     Полимер POP-7



POP-4 полимері                     Полимер POP-4



ЭДТА бар Буфер (10х)               Буфер (10х) с ЭДТА



МикроАмп оптикалық 96 ұяшықты      МикроАмп оптические 96 луночные
реакциялық плашкалар (баркодсыз)   реакционные плашки (без баркода)

Жалғыз нуклеотидті                 Набор для проведения генотипирования
полиморфизмдерді генотиптеуге      одиночных нуклеотидных
арналған жиынтық                   полиморфизмов

Үлкен білікшелер                   Валики большие




Кішкентай білікшелер               Валики маленькие




Ғаныш қосындысы                    Гипсовая смесь




Ғанышкартон                        Гипсокартон




Дюбель-шегелер                     Дюбель-гвозди




Флейц қылқаламдар                  Кисти флейцы




ПФ эмаль                           Эмаль ПФ




Бояу                               Краска




Зімпара қағаз                      Наждачная бумага
Резеңке қолғаптар                 Перчатки резиновые




Еріткіш                           Растворитель




Вентиляциялық каналдарға шарбақ   Решетка на вентиляционные каналы




Акрилдық шпатлевка                Шпатлевка акриловая




Фиништік шпатлевка                Шпатлевка финишная




Ақ эмаль                          Эмаль белая




Түссіз пластикалық қаптамалар     Обложки прозрачные пластиковые




Қапсырма тарақшалар               Переплетные гребешки




Қапсырма тарақшалар               Переплетные гребешки




Флэш-жад                          Флэш память




USB шнуры                         USB шнур




Антистеплер                       Антистеплер




А4 форматты қағаз                 Бумага формата А4




Белгілер үшін қағаз               Бумага для заметок




Факс үшін қағаз                   Бумага для факса




CD-R дискілері                    Диски CD-R
DVD-R дискілері            Диски DVD-R




Тескіш                     Дырокол




Күнделік                   Ежедневник




Есепке алу журналы         Журнал учета




Қағаз белгі                Закладка




Ине                        Игла




Алмалы-салмалы күнтізбек   Календарь перекидной




Калькулятор                Калькулятор




Қарандаш жай               Карандаш простой




Желімді - қарандаш         Клей – карандаш




Желімді - қарандаш         Клей – карандаш




ПВА желімі                 Клей ПВА




Клипса 19 мм               Клипса 19 мм




Клипса 25 мм               Клипса 25 мм




Клипса 32 мм               Клипса 32 мм




Есеп кітабы                Книга учета
Есеп кітабы                     Книга учета




Хатқалта                        Конверт




Хатқалта                        Конверт




Хатқалта                        Конверт




Ӛшіргіш                         Ластик




Сызғыш                          Линейка




Құжаттар үшін тікшіл жайма      Лоток для документов вертикальный




Шыны бойынша маркер             Маркер по стеклу




Кең маркер                      Маркер широкий




Жіңішке маркер                  Маркер тонкий




Оперативті жад модулі           Модуль оперативной памяти




Оперативті жад модулі           Модуль оперативной памяти




Істерді тігу үшін жіп (жібек)   Нитки для прошивания дел (шелковые)




Қайшы                           Ножницы




Қағаздарды қыю үшін пышақ       Нож для разрезки бумаги




Қапсырма үшін тыс               Обложка для переплета
Қапсырма үшін тыс                  Обложка для переплета




Қағаздар үшін папка                Папка для бумаг




Файлдары бар папка                 Папка с файлами




Файлдары бар папка                 Папка с файлами




Файлдары бар папка                 Папка с файлами




Файлдары бар папка                 Папка с файлами




Серіппесі бар тығыз папка          Папка с пружинами плотная




Байлауы бар папка                  Папка на завязках




Бұрышты папка                      Папка уголок




Алмалы-салмалы күнтізбекке         Подставка под перекидной календарь
арналған тіреу



Қағазды қапсырмалау үшін пластик   Пружина пластиковая для переплета
серіппе                            бумаги



Қағазды қапсырмалау үшін пластик   Пружина пластиковая для переплета
серіппе                            бумаги



Қағазды қапсырмалау үшін пластик   Пружина пластиковая для переплета
серіппе                            бумаги



Қағазды қапсырмалау үшін пластик   Пружина пластиковая для переплета
серіппе                            бумаги



Шима үшін сұйылтқыш                Разбавитель для штриха




Шарикті қалам                      Ручка шариковая
Шарикті қалам                    Ручка шариковая




Шарикті қалам                    Ручка шариковая




Желілі фильтр                    Сетевой фильтр




Желілі кабель UTP                Сетевой кабель UTP




Желілі коммутатор                Сетевой коммутатор




Желілі коннектор                 Сетевой коннектор




Степлер үшін қапсармалар №24/6   Скобы для степлера №24/6




Картонды тез тіккіш А4           Скоросшиватель картонный А4




Пластикті тез тіккіш А4          Скоросшиватель пластиковый А4




Жылтыр тез тіккіш А4             Скоросшиватель лощеный А4




Скотч                            Скотч




Скотч                            Скотч




Скотч                            Скотч




Скотч екі жақты                  Скотч двухсторонний




Қыстырғыштар 28 мм               Скрепки 28 мм




Орысша-қазақша сӛздік            Словарь русско-казахский
Степлер 24/6 қапсармаларға     Степлер на скобы 24/6




Қызыл қалам желісі             Стержень красный




Кӛк қалам желісі               Стержень синий




Қара қалам желісі              Стержень черный




Мәтінді бӛліп кӛрсеткіш        Текстовыделитель




Мәтінді бӛліп кӛрсеткіш        Текстовыделитель




Мәтінді бӛліп кӛрсеткіш        Текстовыделитель




Жалпы дәптер                   Тетрадь общая




Оқушы дәптері                  Тетради ученические




Қос жалуыш                     Точилка двойная




Файл А4                        Файл А4




Жапсырма файл А4               Файл вкладыш А4




Шима                           Штрих




Кӛлік құралдарының йелерінің   Страхование гражданско- правовой
азаматтық құқықтық             ответственности владельцев
жауапкершілігін сақтандыру     автотранспортных средств
Жұмыс берушінің азаматтық      Страхование гражданско- правовой
құқықтық жауапкершілігін       ответственности работодателя
сақтандыру
Ӛнім берушінің материалдар мен         Предоставление участка для проведения
құралдарын қолдануымен                 полевых опытов, посев и уход за
ӛсімдіктерді егу және күту, егістік    растениями с использованием
тӛжірибені ӛткізу үшін учаскені беру   материалов и средств поставщика




«Биологиялық жүйелердің жұмыс          Оказание услуг (работ) на выполнение
жасау заңдылықтары – медицина,         научных исследований
ауыл шаруашылығы және қоршаған         в рамках программы фундаментальных
ортаны қорғау үшін инновациялық        исследований «Закономерности
технологияларды құрудың негізі»        функционирования биологических
іргелі зерттеу бағдарламасы            систем – основа создания
шеңберінде ғылыми зерттеулерді         инновационных технологий для
орындауға қызметтерді                  медицины, сельского хозяйства и охраны
(жұмыстарды) кӛрсету                   окружающей среды» 




«Биологиялық жүйелердің жұмыс          Оказание услуг (работ) на выполнение
жасау заңдылықтары – медицина,         научных исследований
ауыл шаруашылығы және қоршаған         в рамках программы фундаментальных
ортаны қорғау үшін инновациялық        исследований «Закономерности
технологияларды құрудың негізі»        функционирования биологических
іргелі зерттеу бағдарламасы            систем – основа создания
шеңберінде ғылыми зерттеулерді         инновационных технологий для
орындауға қызметтерді                  медицины, сельского хозяйства и охраны
(жұмыстарды) кӛрсету                   окружающей среды» 




"Almacom" ауабаптағыштарына            Техническое обслуживание
техникалық қызмет кӛрсету              кондиционеров "Almacom"




"Almacom" ауабаптағыштарын             Ремонт кондиционеров "Almacom"
жӛндеу




Ӛнім берушінің материалдар мен         Услуги по ремонту
құралдарымен LKB2021 орташа            среднетемпературного шкафа LKB2021 с
температуралы шкафын жӛндеу            инструментами и материалами
бойынша қызметтер                      поставщика
Ӛнім берушінің материалдар мен       Услуги по ремонту
құралдарымен ШХ1-12 орташа           среднетемпературного холодильного
температуралы мұздатқыш шкафын       шкафа ШХ1-12 с инструментами и
жӛндеу бойынша қызметтер             материалами поставщика




Ӛнім берушінің материалдар мен       Услуги по ремонту
құралдарымен «GRUNLAND»              среднетемпературного холодильника
орташа температуралы                 «GRUNLAND» с инструментами и
тоңазытқышын жӛндеу бойынша          материалами поставщика
қызметтер




Соя ұны                              Соевая мука



д. 100 cу құбырындағы судың          Устранение прорыва на водопроводе
бұзуын жою                           д.100

2008 ш.ж. "Toyota Land Cruiser       Ремонт катализатора выхлопной системы
Prado" автокӛлігінің түтіндік        автомашины "Toyota Land Cruiser Prado"
жүйенің катализаторын жӛндеу,        2008 г.в., номер кузова
қорап нӛмірі JTEBL29JX05107725,      JTEBL29JX05107725, объем двигателя
қозғалтқыштың кӛлемі 2700 см. куб.   2700 см. куб.



2008 ш.ж. "Toyota Land Cruiser       Техническое обслуживание автомашины
Prado" автокӛлігіне техникалық       "Toyota Land Cruiser Prado" 2008 г.в.,
қызмет кӛрсету, қорап нӛмірі         номер кузова JTEBL29JX05107725,
JTEBL29JX05107725,                   объем двигателя 2700 см. куб.
қозғалтқыштың кӛлемі 2700 см. куб.

Ақ қағаз                             Бумага белая




Файл қосымша бет                     Вкладыш файл




Санитариялық-эпидемиологиялық        Проведение санитарно -
сараптаманы ӛткізу                   эпидемиологической экспертизы



ГАЗ-3307, ГАЗ-2410 автокӛліктік  Услуги по формированию
техникалық қаралуын қалыптастыру автомобильного технического осмотра
бойынша қызметтер                ГАЗ-3307, ГАЗ-2410

Ангиогенин субстанциясының           Разработка лабораторно-
экспериментальды-зертханалық         экспериментальной серии субстанции
сериясын жасау                       ангиогенина
Топырақтың 29 үлгілерінің          Химический анализ 29 образцов почвы
химиялық талдау

Топырақтың 29 үлгілерін химиялық   Химический анализ 29 образцов почвы
талдау

Топырақтың 29 үлгілерін химиялық   Химический анализ 29 образцов почвы
талдау

Курьерлік почта қызметтері         Услуги по курьерской почте




Почта корреспонденциясын жіберу    Пересылка почтовой корреспонденции



Бидайдың ӛсімдік-регенеранттарын   Испытание растений-регенерантов
селекция кӛшеттіктерінде сынау,    пшеницы в селекционных питомниках,
дән сапасын анықтау                определение качества зерна




Бидайдың ӛсімдік-регенеранттарын   Испытание растений-регенерантов
селекция кӛшеттіктерінде сынау,    пшеницы в селекционных питомниках,
дән сапасын анықтау                определение качества зерна




Еңбек жағдайлары зиянды (ерекше    Услуги по обязательному медицинскому
зиянды) және (немесе) қауіпті      осмотру работников, занятых на работах
жұмыстарда істейтін                с вредными (особо вредными) и (или)
қызметкерлерді міндетті            опасными условиями труда
медициналық тексеру жӛніндегі
қызметтер
УАЗ-39094 жылжымалы              Услуги по формированию
зертхананың автокӛліктік         автомобильного технического осмотра
техникалық қаралуын қалыптастыру передвижной лаборатории УАЗ-39094
бойынша қызметтер

Кӛлік құралдарының йелерінің       Страхование гражданско- правовой
азаматтық құқықтық                 ответственности владельцев
жауапкершілігін сақтандыру         автотранспортных средств
Автокӛлікті жалдау бойынша         Услуги по аренде автомобиля
қызметтер
0,05% трипсин-                   0,05% раствор трипсин-
Этилендиаминтетрсірке қышқылы    Этилендиаминтетрауксусная кислота
(ЭДТА) ерітіндісі                (ЭДТА)




0,25% трипсин-                   0,25% раствор трипсин-
Этилендиаминтетрсірке қышқылы    Этилендиаминтетрауксусная кислота
(ЭДТА) ерітіндісі                (ЭДТА)




0,4% трипанды кӛк ерітіндісі     0,4% раствор трипановый синий



2-меркаптоэтанол                 2-меркаптоэтанол



SB 431542 гидрат 98%             SB 431542 гидрат 98%




Азот қышқылы                     Азотная кислота



Азур II                          Азур II



Романовско-Гимзе бойынша азур-   Азур-эозин по Романовскому - Гимзе
эозин

Аланинаминотрансфераза           Аланинаминотрансфераза



Ализарин                         Ализарин



Алсепт С                         Алсепт С



Бұқа альбумині, сарысулық        Альбумин бычий, сывороточный



Шошқаның сарысулы альбумині      Альбумин свиной, сывороточный



Натрий альгинаты                 Альгинат натрия



Альфа-минимальды Игл қоректік    Альфа-Минимальная среда Игла (α-МЕМ)
ортасы (α-МЕМ)



Альфа-минимальды Игл қоректік    Альфа-Минимальная среда Игла (α-МЕМ)
ортасы (α-МЕМ)




Алюминий оксиді                  Алюминий окись



Аммоний азотқышқылы              Аммоний азотнокислый
Хлорлы аммония                    Аммоний хлористый



Магнитті бӛлшектерімен            Анти - мышиные антитела IgG 1
конъюгирленген тышқанға қарсы     конъюгированные с магнитными
моноклоналды IgG1 антиденелері.   частицами

Аспартатаминотранфераза           Аспартатаминотрансфераза



Ацетон                            Ацетон



Билирубин                         Билирубин



Етпептонді сорпа                  Бульон мясопептонный



Құрғақ қоректік сорпа             Бульон сухой питательный



Хотингер сорпасы                  Бульон Хотингера



Сүзгіш қағаз                      Бумага фильтровальная



Буэн                              Буэн



Вальпроин қышқылы                 Вальпроиновая кислота




Бӛлгіш құйғы                      Воронка делительная



Химиялық құйғы                    Воронка химическая



Гексан                            Гексан



Гемоглобин                        Гемоглобин



Гептан                            Гептан



Гиалуронидаза,Тип I-S             Гиалуронидаза,Тип I-S



Гистологиялық кассеталар          Гистологические кассеты



Глицерин                          Глицерин



Глюкоза                           Глюкоза



Глютамакс-I                       Глютамакс-I
Дексаметазон                       Дексаметазон



Деохлор-таблеткалары               Деохлор-таблетки



Молекулярлы биология үшін          Диметил сульфоксид (ДМСО) для
диметил сульфоксид (ДМСО)          молекулярной биологии

Диэтил эфир                        Диэтиловый эфир



Кальций және магний иондары жоқ    Дульбекко фосфатно-солевой буфер без
Дульбекко фосфатты-тұзды буфері    кальция и магния

Кальций және магний иондары бар    Дульбекко фосфатно-солевой буфер с
Дульбекко фосфатты-тұзды буфері    кальцием и магнием

Пенициллин флакондарына            Ерш для пеницилиновых флаконов
арналған ысқыш

Желатин                            Желатин



Шошқа терісінен алынған желатин    Желатин из кожи свиньи



Күкірт-қышқылды темір 7-сулы       Железо сернокислое 7-водное



Ұрықтық сарысу алмастырғышы        Заменитель эмбриональной сыворотки
(нокаутты)                         (нокаутный)




Зеоцин                             Зеоцин




Изопропанол                        Изопропанол



CA15-3 онкомаркерін анықтау үшін   Иммуноферментная тест-система для
арналған иммуноферментті тест-     определения онкомаркера CA15-3
жүйесі
Бұқа ұйқы безі инсулині            Инсулин поджелудочной железы быка



Инсулин-трансферин-селенит (100×) Инсулин-трансферин-селенит (100×)



Калий азотқышқылы                  Калий азотнокислый



Йодты калий                        Калий йодистый



Калий фосфорқышқылы 1-орны         Калий фосфорнокислый 1-замещеный
басылған

Калий хлориді                      Калий хлористый



Кӛмірқышқылды кальций              Кальций углекислый
Сусыз хлорлы кальций (гранулалар)   Кальций хлористый безводный (гранулы)



Бұғана катетері                     Катетер подключичный



Бұғана катетері                     Катетер подключичный



Алюминокалий квасцтары              Квасцы алюминокалиевые



Азот қышқылы 0,1Н                   Кислота азотная 0,1Н



Фосфор қышқылы                      Кислота фосфорная



Хлор қышқылы                        Кислота хлорная



Лабораторлық жануарларға арналған Клетки для лабораторных животных
торлар

Кобальт (II)                        Кобальт (II)



Ешкінің анти-тышқан IgG             Козлиные анти-мышиные антитела IgG
антиденесі (H+L) түбір тамыр        (H+L) конъюгированные с пероксидазой
пероксидазасымен                    хрена
конъюгацияланған.
Конусты шыны колбы                  Колба коническая



Ӛлшеуіш шыны колбы                  Колба мерная



Ӛлшеуіш шыны колбы                  Колба мерная



Ӛлшеуіш шыны колбы                  Колба мерная



Коллагеназа, тип I                  Коллагеназа, тип I



Коллагеназа, тип IV                 Коллагеназа, тип IV



Зәр жинау үшін арналған             Контейнер PР для сбора мочи
                               PР
контейнері
Заттық шыныларға қорап-абақ         Коробка-штатив для предметных стекол



Гимза бояу ерітіндісі               Краситель Гимза раствор



Креатинин                           Креатинин



Крио шыны түтікшелер                Криопробирки
Лактатдегидрогеназа                Лактатдегидрогеназа



Шам дейтерилі                      Лампа дейтериевая



Толық катодты шам                  Лампа с полным катодом



Мұзды сірке қышқылы                Ледяная уксусная кислота



Ӛлшеу үшін тартпа                  Лоток для взвешивания



Күкірт қышқылды магний 7-сулы      Магний сернокислый 7-водный



Күкірт қышқылды марганец (II) 5-   Марганец (II) сернокислый 5-водный
сулы

Пластикке жазылатын маркер         Маркер по пластику



Жасушаларды ӛсіру үшін матрацтар Матрацы для культивирования клеток




Жасушаларды ӛсіру үшін матрацтар Матрацы для культивирования клеток




Жасушаларды ӛсіру үшін матрацтар Матрацы для культивирования клеток




Күкірт қышқылды мыс 5-сулы         Медь сернокислая 5-водный



Мензурка                           Мензурка



Мензурка                           Мензурка



Мензурка                           Мензурка



Мензурка                           Мензурка



Метилен хлориді                    Метилен хлористый



Микро шыны түтікшелер              Микропробирки
ПТР-ға арналған микротүтікшелер   Микропробирки для ПЦР



Тұрақты глутамині бар минимальды Минимальная среда Игла со стабильным
Игл қоректік ортасы              глютамином



Несепнәр                          Мочевина



Осt3/4 қарсы тышқанның            Мышиные моноклональные антитела IgG
моноклоналды IgG антиденесі        против Осt3/4 (Маркер эмбриональных
(ұрықтық бағаналы жасушалардың    стволовых клеток)
маркері)
Тип II коллагенге қарсы тышқанның Мышиные моноклональные антитела IgG
моноклоналды IgG антиденелері     к коллагену тип II

Ӛсу фактордың 2 эпидермальды      Мышиные моноклональные антитела IgG
рецепторына қарсы тышқанның       к человеческому эпидермальному
моноклоналды IgG антиденелері     рецептору ростового фактора -2 (ErbB 2)
(ErbB 2)
Nanog қарсы тышқанның             Мышиные моноклональные антитела IgG
моноклоналды IgG антиденесі       против Nanog (Маркер эмбриональных
(ұрықтық бағаналы жасушалардың    стволовых клеток)
маркері)
Ұрықтық арнайы 4-ші антигенге     Мышиные моноклональные антитела IgG
қарсы тышқанның моноклоналды      против специфического эмбрионального
IgG антиденесі (SSEA-4)           антигена – 4 (SSEA-4)

Адамның CD117 тышқанның           Мышиные моноклональные антитела
моноклоналды IgG1 антиденелері    IgG1 к CD117 человека




TRA-1-60 қарсы тышқанның          Мышиные моноклональные антитела
моноклоналды IgМ антиденесі       IgM против TRA-1-60 (Маркер
(ұрықтық бағаналы жасушалардың    эмбриональных стволовых клеток)
маркері)
Толық РНҚ бӛліп алу жиынтығы      Набор для выделения тотальной РНК




MS4-5 Vet Pack Гематологиялық     Набор для гематологического
анализаторға арналған жиынтық     анализатора MS4-5 Vet Pack

ЕРО 2 иммунноферменттік анализі   Набор для иммуноферментного анализа –
үшін жиынтық                      ЕРО 2

Кері транскрипцияны орындау үшін Набор для проведения реакций обратной
арналған жиынтық                 транскрипции
ЕРО – НS иммуноферменттік анализ Набор реагентов для
үшін реагент жиынтығы            иммуноферментного анализа ЕРО – НS

Жасушалардың магнитті               Набор реагентов для магнитной
сепарациясына арналған реагенттер   сепарации клеток
жиынтығы
Жасушаларда негіз фосфотазасының    Набор реагентов для определения
белсенділігін анықтауға арналған    активности щелочной фосфатазы в
реагенттер жиынтығы                 клетках

С-ПТР-де пайдаланатын жасыл         Набор реагентов для проведения К-ПЦР
флуоресцентті бояғышы I және        в присутствии зеленого флуоресцентного
референсті флуоресцентті бояғышы    красителя I и референсного
бар С-ПТР-да орындау үшін           флуоресцентного красителя
реагенттер жиынтығы                 использующиеся в К-ПЦР

Фиксанал жиынтығы HCl, 0,1Н         Набор фиксаналов HCl, 0,1Н



Ұштықтар                            Наконечники



Ұштықтар                            Наконечники



Ұштықтар                            Наконечники



Ұштықтар                            Наконечники



Мӛлшерлегіш үшін ұштық, 100-5000 Наконечники для дозатора, 100-5000 мкл
мкл

Сүзгісі бар ұштықтар                Наконечники с фильтром для дозатора



Сүзгісі бар ұштықтар                Наконечники с фильтром для дозатора



Натрий күкіртқышқылы                Натрий сернокислый



Натрий фторлы                       Натрий фтористый



Натрий хлориді                      Натрий хлористый



н-Бутанол, үлгілі                   н-Бутанол, эталонный



Жалпы белок                         Общий белок



Объект микрометр                    Объект микрометр



ФИТЦ-пен конъюгирленген             Овечьи антимышинные IgG антитела
тышқанның IgG қарсы қойдың          коньюгированные с ФИТЦ
антиденелері
Бір реттік микротомды пышақтар      Одноразовые микротомные ножи
Опти-минимальды Игл I қоректік    Опти-Минимальная среда Игла I (Oпти-
ортасы (OPTI-MEM I)               МЕМ I)




МS4-5 Vet Pack Гематологиялық     Очищающий раствор для
анализаторды тазалағыш ерітінді   гематологического анализатора МS4-5
                                  Vet Pack
Шыны таяқша                       Палочка стеклянная



Шыны таяқша                       Палочка стеклянная



Парафин ортасы                    Парафиновая среда



Параформальдегид                  Параформальдегид



Сутегі тотығы                     Перекись водорода



Сутегі тотығы (37%)               Перекись водорода (37%)



Хирургиялық іскек 150 мм          Пинцет хирургический 150 мм



Пипетатор (автоматты нәк).        Пипетатор (автоматическая груша)




Тамызғыш                          Пипетка



Пастер тамызғыштары               Пипетка Пастера



Ауыспалы кӛлемді мӛлшерлеуіш      Пипетка-дозатор переменного объема
тамызғыш

Серологиялық тамызғыштар          Пипетки серологические



Серологиялық тамызғыштар          Пипетки серологические



Серологиялық тамызғыштар          Пипетки серологические



Серологиялық тамызғыштар          Пипетки серологические



Модификацияланған Игл (MEM)       Питательная модифицированная среда
қоректік ортасы                   Игла (МЕМ)



199 қоректік ортасы               Питательная среда 199




Дульбекко модификациялаған Игл    Питательная среда Игла в модификации
қоректік ортасы (DMEM)            Дульбекко (DMEM)
Құрамында глюкозасы жоғары         Питательная среда Игла в модификации
Дульбекко модификацияланған Игл    Дульбекко (ДМЕМ) c высоким
қоректік ортасы (DMEM)             содержанием глюкозы



Құрамында жоғары дәрежеде          Питательная среда Игла в модификации
глюкозасы және тұрақты глутамині   Дульбекко (ДМЕМ) c высоким
бар Дульбекко модификацияланған    содержанием глюкозы и со стабильным
Игл қоректік ортасы (DMEM)         глютамином

Құрамында глюкозасы тӛмен          Питательная среда Игла в модификации
Дульбекко модификацияланған Игл    Дульбекко (ДМЕМ) c низким
қоректік ортасы (DMEM)             содержанием глюкозы



Құрамында глюкозасы тӛмен          Питательная среда Игла в модификации
Дульбекко модификацияланған Игл    Дульбекко (ДМЕМ) c низким
қоректік ортасы (DMEM)             содержанием глюкозы

Ұрықтық бағаналы жасушаларға       Питательная среда Игла в модификации
арналған (нокаутты) Дульбекко      Дульбекко (нокаутная) для
модификацияланған Игл қоректік     эмбриональных стволовых клеток
ортасы (DMEM)

Дульбекко модификацияланған        Питательная среда Игла в модификации
Игл/F12 қоректік ортасы (DMEM).    Дульбекко/F12




Ӛсіру үшін арналған 24 ұяшықты     Планшет для культивирования, 24 лунок
планшет

Ӛсіру үшін арналған 4 ұяшықты      Планшет для культивирования, 4 лунки
планшет

Ӛсіру үшін арналған 6 ұяшықты      Планшет для культивирования, 6-лунок
планшет

Ӛсіру үшін арналған 96 ұяшықты     Планшет для культивирования, 96-лунок
планшет

ПТР үшін 96 ұяшықты планшет        Планшет для ПЦР 96 лунок



Зарарсыздандыруға арналған         Пластиковые пакеты для стерилизации
пластикалық пакеттер

Лабораторлық қабыршақ              Пленка лабораторная



Полиэтиленгликоль 4000 (ПЭГ 4000) Полиэтиленгликоль 4000 (ПЭГ 4000)



Сақтандырғыш дискілер              Предохранительные диски



Түтік                              Пробирка



Түтік РР                           Пробирка РР



Түтік PP                           Пробирка PP
Биологиялық түтік                   Пробирка биологическая



Түтік PS                            Пробирка РS



Түтік PS                            Пробирка РS



Түтік РS                            Пробирка РS



Түтік PP                            Пробирка РР



Протеиназа К                        Протеиназа К



Жасуша ӛсіндісінде микоплазманы     ПЦР набор для определения микоплазмы
анықтау үшін ПТР жиынтығы           в культуре клеток




L-глютамин ерітіндісі               Раствор L-глютамина 200 mМ



Екінші дәрижелі                     Раствор второстепенных аминокислот 10
аминқышқылдарының ерітіндісі 10     mM (100X)
mM (100X)
Натрий пируват ерітіндісі           Раствор пирувата натрия 100 mM



Суспензиялық тазарту ерітіндісі     Раствор суспензионный очищающий



Трипсин-этилендиаминтетрацетат      Раствор Трипсин –
ерітіндісі (ЭДТА)                   этилендиаминтетрацетат (ЭДТА)

Трипсин – этилендиаминтетрацетат    Раствор Трипсин –
(ЭДТА) ерітіндісі                   этилендиаминтетрацетат (ЭДТА)




Жануар жасушаларын                  Реагент для трансфекции клеток
трансфекциялауға арналған реагент   животных




Неслер реактиві                     Реактив Неслера



Редуктор                            Редуктор



Қорғасын азотқышқылы                Свинец азотнокислый



Ұшы ӛткір орташа скальпель          Скальпель остроконечный средний
Соя ұны                          Соевая мука



Дюар ыдысы                       Сосуд Дьюара



RPMI-1640 қоректік ортасы        Среда RPMI – 1640




Буферлі ерітінділерді дайындау   СТ рН-метрии для приготовления
үшін СТ рН-метрия                буферных растворов

Жоғары стакан                    Стакан высокий



Жоғары стакан                    Стакан высокий



Жоғары стакан                    Стакан высокий



Құралдар үшін стакан РР          Стакан для инструментов РР



Тӛмен стакан                     Стакан низкий



Тӛмен стакан                     Стакан низкий



Тӛмен стакан                     Стакан низкий



Тӛмен стакан                     Стакан низкий



Тӛмен стакан                     Стакан низкий



Тӛмен стакан                     Стакан низкий



Жабын шыны                       Стекло покровное



Жабын шыны                       Стекло покровное



Жабын шыны                       Стекло покровное



Заттық шыны                      Стекло предметное



Заттық шыны                      Стекло предметное



Термометр                        Термометр



Термометр П-3                    Термометр П-3



Зарарсыздандырудың сапалық       Тест качества стерилизации
сынамасы
Тиосемикарбазид                    Тиосемикарбазид



Адамның рекомбинантты,             Трансформирующий ростовой фактор-
трансформацияланатын ӛсу β1-       β1, человеческий рекомбинантный
факторы



Бұқа ұйқы безінің трипсині         Трипсин поджелудочной железы быка



4 хлорлы кӛміртек                  Углерод 4-х хлористый



Реагенттерді жеткізу бойынша       Услуги по доставке реагентов
қызметтер

Адамның негізгі, рекомбинантты,    Фактор роста фибробластов-основной
фибробласт ӛсу факторы (ФӚФ)       человеческий рекомбинантный




Жасушаларға арналған сүзгі, 40 мкм Фильтр для клеток, 40 мкм




Жасушаларға арналған сүзгі, 70 мкм Фильтр для клеток, 70 мкм




Күлсіздендірілген, сүзгіш қағаз    Фильтры бумажные обеззоленные



Күлсіздендірілген, сүзгіш қағаз    Фильтры бумажные обеззоленные



Күлсіздендірілген, сүзгіш қағаз    Фильтры бумажные обеззоленные



Пенициллин флаконы ФО-10-НС-1А Флакон пенициллиновый ФО-10-НС-1А



Ӛлшеуіш цилиндр                    Цилиндр мерный



Күкірт қышқылды мырыш 7-сулы       Цинк сернокислый 7-водный



Петри шыныаяғы                     Чашки Петри



Қалақша                            Шпатель



Қалақша                            Шпатель



Бір реттік пісік                   Шприц одноразовый



Инсулинді бір рет қолданылатын     Шприц одноразовый инсулиновый
пісік
Абақ                                 Штатив



4 тамызғыш-мӛлшерлегіш үшін          Штатив для 4-х пипеток-дозаторов,
абақ, жан-жақты                      универсальный

Ұштықтар үшін абақ 0-1000мкл,        Штатив для наконечников 0-1000 мкл. с
қақпақпен                            крышкой

РР абағы                             Штатив РР



Сілтілік фосфатаза                   Щелочная фосфатаза



ЭДТҚ                                 ЭДТА (этилендиаминтетрауксусная
(этилендиаминтетрауксустықышқыл      кислота)
ы)
Термиялық ӛңделген бұзаудың          Эмбриональная телячья сыворотка
ұрықтық сарысуы                      термообработанная




Адамның рекомбинантты,               Эпидермальный ростовой фактор,
эпидермалды ӛсу факторы              человеческий рекомбинантный




Бір рет қолданбалы пісектер, 5 мл    Шприцы одноразовые, 5 мл



Бір рет қолданбалы пісектер, 10 мл   Шприцы одноразовые, 10 мл



Бекітетін лейкопластырь              Лейкопластырь фиксирующий



Кӛзге арналған хирургиялық           Ножницы хирургические, глазные
қайшылар

Қоректік агар                        Агар питательный



Агар құрғақ қоректік                 Агар сухой питательный



Агар-агар микробиологиялық           Агар-агар микробиологический



Майн-Грюнвельд үлгісі бойынша        Эозин - метиленовый синий по Майн -
метиленді Эозин, кӛк                 Грюнвальду

Майн-Грюнвельд үлгісі бойынша        Эозин - метиленовый синий по Майн -
метиленді Эозин, кӛк                 Грюнвальду

Ұштықтар                             Наконечники



Этил спирті                          Спирт этиловый



Жұмыс берушінің азаматтық            Страхование гражданско- правовой
құқықтық жауапкершілігін             ответственности работодателя
сақтандыру
Ғылыми-техникалық кітапханың      Услуги научно-технической библиотеки
қызметтері




Мұнай тотықтырғыш                 Услуги по анализу деструкции нефти
консорциумдарының препаративті    пробами препаративных форм
формалардың үлгілерімен мұнай     нефтеокисляющих консорциумов.
ыдырауын талдау бойынша
қызметтер.
Парақтық паронит, қалыңдығы 3 мм Паронит листовой толщиной 3 мм



Парақтық паронит, қалыңдығы 1 мм Паронит листовой толщиной 1 мм



Резеңке МЖТ, қалыңдығы 3мм        Резина МБС толщиной 3мм




Резеңке МЖТ, қалыңдығы 4мм        Резина МБС толщиной 4мм




Резеңке МЖТ, қалыңдығы 5мм        Резина МБС толщиной 5мм




Тығыздама, баудың диаметрі 8 мм   Сальниковая набивка, шнур диаметром
                                  8мм



Тығыздама, баудың диаметрі 6 мм   Сальниковая набивка, шнур диаметром
                                  6мм



Графитті жаққымай                 Графитовая смазка




Оттегі редукторы                  Редуктор кислородный




Микроағзалар штамдарының          Определение патогенности штаммов
патогендігін анықтау              микроорганизмов

Культуралды сұйықтықтардың 28     Химический анализ 28 образцов
үлгілерін химиялық талдау (13     культуральной жидкости (13 штаммов
микроағза штаммдары + бақылау     микроорганизмов + контроль)
нұсқасы)
Биопрепараттарды егістік жағдайда   Испытание биопрепаратов в полевых
тексеру, бидай және қызанақ         условиях, определение распространения
ӛсімдігіндегі саңырауқұлақ          грибных болезней на посевах пшеницы и
ауруларының таралымын анықтау.      томата




Егеуқұйрықтардың ішек               Диагностические исследования по
микрофлорасының қалыпты             оценке качественного и количественного
ӛкілдерінің сапалық және сандық     состава представителей нормальной
бағалауы бойынша диагностикалық     микрофлоры кишечника у крыс (60 проб)
зерттеулер (60 сынама)




Картоптың ӛсімдік-регенеранттарын Испытание растений-регенерантов
сынау                             картофеля




Ӛнім берушінің шығын                Ревизия запорной арматуры, промывка и
материалдарымен әкімшілік           опрессовка системы отопления
ғимаратында жылыту жүйесін          административного здания с расходными
тұшыту және жуу, тиек арматурасын   материалами поставщика
тексеру



Ӛнім берушінің шығын                Ремонт системы отопления
материалдарымен әкімшілік           административного здания с расходными
ғимаратында жылы жүйесін жӛндеу     материалами поставщика




МТ немесе МП манометрі              Манометр МТ или МП




Спирттік термометр                  Термометр спиртовый
6-Бензиламинопурин                  6-Бензиламинопурин



Мӛлшерлегіш үшін ұштық 2-200 мкл Наконечники для дозатора 2-200 мкл



BY5 Буфері                          BY5 Буфер



Tag ДНҚ-полимераза                  Taq ДНК-полимераза (рекомбинантная)
(рекомбинантты)




α- Нафтилсірке қышқылы (2,4 -Д)     α- Нафтилуксусная кислота (2,4 -Д)



Абсциз қышқылы                      Абсцизовая кислота



Агароза                             Агароза



Акриламид                           Акриламид



Бұқаның сарысу альбумині            Альбумин бычий сывороточный



Күкірт қышқылды аммоний             Аммоний сернокислый (NH4)2SO4
(NH4)2SO4

Фосфор қышқылды аммоний             Аммоний фосфорнокислый (NaH2PO4)
(NaH2PO4)

ДНҚ полимераза Голд буферімен       ДНК полимераза с Голд буфером




Реагенттер жиынтығы ГТ жүгері —     Набор реагентов ГМ кукуруза — FL
FL



Реагенттер жиынтығы ГТ соя — FL     Набор реагентов ГМ соя — FL




Реагенттер жиынтығы ГТ - Плант - 1 Набор реагентов ГМ - Плант - 1 - FL
- FL

Реагенттер жиынтығы ГТ жүгері —     Набор реагентов ГМ кукуруза — FL
FL



Реагенттер жиынтығы ГТ жүгері- 1 - Набор реагентов ГМ кукуруза - линии - 1
FL линиясы                         - FL

Реагенттер жиынтығы ГТ жүгері - 2 - Набор реагентов ГМ кукуруза - линии - 2
 FL линиясы                         - FL

Реагенттер жиынтығы ГТ жүгері - 3 Набор реагентов ГМ кукуруза - линии - 3
- FL линиясы                      - FL
Реагенттер жиынтығы ГТ жүгері      Набор реагентов ГМ кукуруза МОN 810-
МОN 810-EPh                        EPh

Реагенттер жиынтығы ГТ күріш-EPh Набор реагентов ГМ рис-EPh



Реагенттер жиынтығы ГТ соя — FL    Набор реагентов ГМ соя — FL




Реагенттер жиынтығы ГТ соя - FL    Набор реагентов ГМ соя - линии - FL
линиясы

Реагенттер жиынтығы ГТ соя 40-3-2- Набор реагентов ГМ соя 40-3-2-EPh
EPh

Реагенттер жиынтығы ДНҚ картоп,    Набор реагентов ДНК картофель, томат-
қызанақ-EPh                        EPh

Реагенттер жиынтығы ПЛАНТ-         Набор реагентов ПЛАНТ-СКРИН-EPh
СКРИН-EPh



Реагенттер жиынтығы Терминатор     Набор реагентов Терминатор Nos-EPh
Nos-EPh



Антисарысу                         Антисыворотка



Калий ацетаты                      Ацетат калия



Сүзгіш қағаз                       Фильтровальная бумага



Шӛлмек                             Бутыль



Шӛлмек, бұранбалы қақпағымен       Бутыль с закручивающей крышкой



Шӛлмек, бұранбалы қақпағымен       Бутыль с закручивающей крышкой



Шӛлмек, бұранбалы қақпағымен       Бутыль с закручивающей крышкой



В 57 Буфер BamHI үшін              В 57 Буфер для BamHI



Химиялық құйғы                     Воронка химическая



Химиялық құйғы                     Воронка химическая



Химиялық құйғы                     Воронка химическая



Гигрометр                          Гигрометр



Глицерин                           Глицерин
Глюкоза                           Глюкоза



Спирт жанарғысы                   Горелка спиртовая



Диметилсульфоксид (ДМСО)          Диметилсульфоксид (ДМСО)



Дихлорфеноксисірке қышқылы 2,4-Д Дихлорфеноксиуксусная кислота 2,4-Д



ДНҚ маркер Ladder                 ДНК маркер Ladder



Додецилсульфатты натрий, (SDS)    Додецилсульфат натрия (SDS)



Ашытқы сығындысы                  Дрожжевой экстракт



Жасмон қышқылы                    Жасмоновая кислота



Пакеттерді қысуға арналған қысқыш Зажим для пакетов



Зеатин                            Зеатин



Жалпыхирургиялық инеұстағыш       Иглодержатель общехирургический



Иммуноферменттік диагностикалық Иммуноферментные диагностические
жиынтықтар                      наборы

Индолилсірке қышқылы (ИСҚ)        Индолил-уксусная кислота (ИУК)



Канамицин сульфаты                Канамицина сульфат



Кинетин                           Кинетин



Конусты шыны колбы                Колба коническая



Конусты шыны колбы                Колба коническая



Конусты шыны колбы                Колба коническая



Ӛлшеуіш шыны колбы                Колба мерная



Ӛлшеуіш шыны колбы                Колба мерная



Ӛлшеуіш шыны колбы                Колба мерная



Ӛлшеуіш шыны колбы                Колба мерная
Градуирленген конусты шыны колбы Колбы конические градуированные



Градуирленген конусты шыны          Колбы конические градуированные
колбы

Градуирленген конусты шыны колбы Колбы конические градуированные



Градуирленген конусты шыны колбы Колбы конические градуированные



Градуирленген конусты шыны колбы Колбы конические градуированные



Зәр жинау үшін арналған контейнер   Контейнер для сбора мочи



Зәр жинау үшін арналған контейнер   Контейнер для сбора мочи



Нәжісті жинауға арналған контейнер Контейнер для сбора экскрементов



Қалдық заттарға арналған контейнер Контейнер для утилизации



Қалдық заттарға арналған контейнер Контейнер для утилизации



Тегіс түпті абақтағы крио шыны      Криопробирки в штативе с плоским дном
түтікшелер



Кумасси бриллиантты кӛгі 5х         Кумасси бриллиантовый синий 5х



Кӛз күрекшесі                       Лопаточка глазная



Магнитті араластырғыш               Магнит мешалки



Магнитті араластырғыш               Магнит мешалки



ПТР-ға арналған микротүтікшелер     Микропробирки для ПЦР



ПТР-ға арналған микротүтікшелер     Микропробирки для ПЦР



ПТР-ға арналған микротүтікшелер     Микропробирки для ПЦР



Мини — тоңазытқыш                   Мини-холодильник



ПТР ӛнімін тазалауға арналған       Набор для очистки ПЦР продуктов PCR
жиынтық. PCR Clean-Up Kit (70       Clean-Up Kit (70 реакций)
реакция)
Праймер жиынтығы                    Набор Праймеров



«СОРБ-ГТО-А» ДНҚ бӛлуге             Набор для выделения ДНК «СОРБ-ГМО-
арналған жиынтық                    А» (гуанидин+сорбент)
(гуанидин+сорбент)
«СОРБ-ГТО-Б» (ЦТАБ+сорбент)        Набор для выделения ДНК «СОРБ-ГМО-
ДНҚ бӛлуге арналған жиынтық        Б» (ЦТАБ+сорбент)

ДНҚ-ны агарозды гелден             Набор реагентов для извлечения ДНК из
ажырататын реагенттер жиынтығы     агарозного геля Silica Bead
Silica Bead
Ұштықтар 0,1-20 мкл                Наконечники 0,1-20 мкл



Ұштықтар 2-200 мкл                 Наконечники 2-200 мкл



Ұштықтар 50-1000 мкл               Наконечники 50-1000 мкл



Мӛлшерлегіш үшін ұштық 0,1-10      Наконечники для дозатора 0,1-10 мкл
мкл

Мӛлшерлегіш үшін ұштық 0,1-20      Наконечники для дозатора 0,1-20 мкл
мкл

Мӛлшерлегіш үшін ұштық 50-1000     Наконечники для дозатора 50 - 1000 мкл
мкл

Азот қышқылды натрий (NaNO3)       Натрий азотнокислый (NaNO3)



Натрий гидроокисі NaOH             Натрия гидроокись NaOH



Үшкір қайшы                        Ножницы остроконечные



Хирургиялық қайшы                  Ножницы хирургические



Пептон                             Пептон



Пергаментті қағаз                  Пергаментная бумага



Қоян АД-нен пероксидазды           Пероксидазные антивирусные и
антивирусты және антибактериалды   антибактериальные конъюгаты из
конъюгаттар                        кроличьих АТ
Пестик-гомогенизатор               Пестик-гомогенизатор



Хирургиялық іскек                  Пинцет хирургический



Шыны тамызғыш                      Пипетка стеклянная



Шыны тамызғыш                      Пипетка стеклянная



Шыны тамызғыш                      Пипетка стеклянная



Ауыспалы кӛлемді мӛлшерлеуіш       Пипетка-дозатор переменного объема
тамызғыш

Ауыспалы кӛлемді мӛлшерлеуіш       Пипетка-дозатор переменного объема
тамызғыш
Ауыспалы кӛлемді мӛлшерлеуіш     Пипетка-дозатор переменного объема
тамызғыш

Ауыспалы кӛлемді мӛлшерлеуіш     Пипетка-дозатор переменного объема
тамызғыш

Ауыспалы кӛлемді мӛлшерлеуіш     Пипетка-дозатор переменного объема
тамызғыш

Ауыспалы кӛлемді мӛлшерлеуіш     Пипетка-дозатор переменного объема
тамызғыш

Иммуноферменттік талдау жүргізуге Планшет для иммуноферментного
арналған планшет                  анализа

ПТР-ге арналған планшет          Планшет для ПЦР



Пластикті бұранбалы қақпағымен   Пластиковые пробирки с
шыны түтікше                     закручивающиеся крышкой

Пластикті бұранбалы қақпағымен   Пластиковые пробирки с
шыны түтік                       закручивающиеся крышкой

Зарарсыздандыруға арналған       Пластиковый пакет для стерилизации
пластикалық пакет

Зарарсыздандыруға арналған       Пластиковый пакет для стерилизации
пластикалық пакет

Иммуноферментті жиынтықтарға оң Положительные и отрицательные
және теріс бақылаулар           контроли к иммуноферментным наборам

Праймерлер (синтезделген         Праймеры (синтезированные
олигонуклоетидтер)               олигонуклеотиды)

Сfp10 праймері                   Праймер cfp10



Сfp10 праймері                   Праймер cfp10



ef11 праймері                    Праймер ef11



ef12 праймері                    Праймер ef12



ESAT6 праймері                   Праймер ESAT6



ESAT6 праймері                   Праймер ESAT6



FU-tubulin2 праймері             Праймер FU-tubulin2



FU-tubulin3 праймері             Праймер FU-tubulin3



Gwm210 праймері                  Праймер gwm210



Gwm210 праймері                  Праймер gwm210
Gwm292 праймері        Праймер gwm292



Gwm292 праймері        Праймер gwm292



Gwm332праймері         Праймер gwm332



Gwm332праймері         Праймер gwm332



Gwm37 праймері         Праймер gwm37



Gwm37 праймері         Праймер gwm37



Gwm383праймері         Праймер gwm383



Gwm383праймері         Праймер gwm383



Gwm608 праймері        Праймер gwm608



Gwm608 праймері        Праймер gwm608



igs15 праймері         Праймер igs15



igs16 праймері         Праймер igs16



ITS2 праймері          Праймер ITS2



ITS3 праймері          Праймер ITS3



ITS5 праймері          Праймер ITS5



RAPD ОРА 02 праймері   Праймер RAPD ОРА 02



RAPD ОРА03 праймері    Праймер RAPD ОРА03



RAPD OPA 01 праймері   Праймер RAPD OPA 01



RAPD ОРА04 праймері    Праймер RAPD ОРА04



RAPD ОРА06 праймері    Праймер RAPD ОРА06



RAPD ОРА07 праймері    Праймер RAPD ОРА07



RAPD ОРА08 праймері    Праймер RAPD ОРА08
SSR-1 түзу праймері    Праймер SSR-1 прямой



SSR-1 кері праймері    Праймер SSR-1 обратный



SSR-10 кері праймері   Праймер SSR-10 обратный



SSR-10 түзу праймері   Праймер SSR-10 прямой



SSR-11 кері праймері   Праймер SSR-11 обратный



SSR-11 түзу праймері   Праймер SSR-11 прямой



SSR-12 кері праймері   Праймер SSR-12 обратный



SSR-12 түзу праймері   Праймер SSR-12 прямой



SSR-13 кері праймері   Праймер SSR-13 обратный



SSR-13 түзу праймері   Праймер SSR-13 прямой



SSR-14 кері праймері   Праймер SSR-14 обратный



SSR-14 түзу праймері   Праймер SSR-14 прямой



SSR-15 кері праймері   Праймер SSR-15 обратный



SSR-15 түзу праймері   Праймер SSR-15 прямой



SSR-16 кері праймері   Праймер SSR-16 обратный



SSR-16 түзу праймері   Праймер SSR-16 прямой



SSR-17 кері праймері   Праймер SSR-17 обратный



SSR-17 түзу праймері   Праймер SSR-17 прямой



SSR-18 кері праймері   Праймер SSR-18 обратный



SSR-18 түзу праймері   Праймер SSR-18 прямой



SSR-19 кері праймері   Праймер SSR-19 обратный



SSR-19 түзу праймері   Праймер SSR-19 прямой
SSR-2 түзу праймері    Праймер SSR-2 прямой



SSR-20 кері праймері   Праймер SSR-20 обратный



SSR-20 түзу праймері   Праймер SSR-20 прямой



SSR-21 кері праймері   Праймер SSR-21 обратный



SSR-21 түзу праймері   Праймер SSR-21 прямой



SSR-22 кері праймері   Праймер SSR-22 обратный



SSR-22 түзу праймері   Праймер SSR-22 прямой



SSR-23 кері праймері   Праймер SSR-23 обратный



SSR-23 түзі праймері   Праймер SSR-23 прямой



SSR-24 кері праймері   Праймер SSR-24 обратный



SSR-24 түзу праймері   Праймер SSR-24 прямой



SSR-25 кері праймері   Праймер SSR-25 обратный



SSR-25 түзу праймері   Праймер SSR-25 прямой



SSR-6 кері праймері    Праймер SSR-6 обратный



SSR-7 кері праймері    Праймер SSR-7 обратный



SSR-7 түзу праймері    Праймер SSR-7 прямой



SSR-8 түзу праймері    Праймер SSR-8 прямой



SSR-8 кері праймері    Праймер SSR-8 обратный



SSR-9 кері праймері    Праймер SSR-9 обратный



SSR-9 түзу праймері    Праймер SSR-9 прямой



TAG F праймері         Праймер TAG F



TAG R праймері         Праймер TAG R
tri1 праймері         Праймер tri1



tri2 праймері         Праймер tri2



WMS273 праймері       Праймер WMS273



WMS273 праймері       Праймер WMS273



Xgwm135-1А праймері   Праймер Xgwm135-1A



Xgwm135-1A праймері   Праймер Xgwm135-1A



Xgwm136-1A праймері   Праймер Xgwm136-1A



Xgwm136-1A праймері   Праймер Xgwm136-1A



Xgwm140-1B праймері   Праймер Xgwm140-1B



Xgwm140-1B праймері   Праймер Xgwm140-1B



Xgwm153-1B праймері   Праймер Xgwm153-1B



Xgwm153-1B праймері   Праймер Xgwm153-1B



Xgwm155-3А праймері   Праймер Xgwm155-3А



Xgwm155-3А праймері   Праймер Xgwm155-3А



Xgwm162-3А праймері   Праймер Xgwm162-3А



Xgwm162-3А праймері   Праймер Xgwm162-3А



Xgwm164-1A праймері   Праймер Xgwm164-1A



Xgwm164-1A праймері   Праймер Xgwm164-1A



Xgwm181-3B праймері   Праймер Xgwm181-3B



Xgwm181-3B праймері   Праймер Xgwm181-3B



Xgwm191-2B праймері   Праймер Xgwm191-2B



Xgwm191-2B праймері   Праймер Xgwm191-2B
Xgwm210-2B праймері                 Праймер Xgwm210-2B



Xgwm210-2B праймері                 Праймер Xgwm210-2B



Xgwm247-3B праймері                 Праймер Xgwm247-3B



Xgwm247-3B праймері                 Праймер Xgwm247-3B



Xgwm257-2В праймері                 Праймер Xgwm257-2В



Xgwm257-2В праймері                 Праймер Xgwm257-2В



Xgwm415 -5А праймері                Праймер Xgwm415 -5А



Xgwm415 -5А праймері                Праймер Xgwm415 -5А



Xgwm44-7D праймері                  Праймер Xgwm44-7D



Xgwm44-7D праймері                  Праймер Xgwm44-7D



Xgwm497-3Dпраймері                  Праймер Xgwm497-3D



Xgwm497-3Dпраймері                  Праймер Xgwm497-3D



Fusarium саңырауқұлақтарын          Праймер для идентификации грибов
сәйкестендіруге арналған праймер    Fusarium ITS1-Fc1
ITS1-Fc1
Fusarium саңырауқұлақтарын          Праймер для идентификации грибов
идентификациялау-ға арналған        Fusarium ITS2-Fc1
праймер ITS2-Fc1
invSR1R IGS-аймағын                 Праймер для секвенирования IGS-
секвенирлеуге арналған праймер      региона invSR1R

LR12R IGS-аймағын секвенирлеуге     Праймер для секвенирования IGS-
арналған праймер                    региона LR12R

ITS1-Fg1 IТS-аймағын                Праймер для секвенирования IТS-
секвенирлеуге арналған праймер      региона ITS1-Fg1

ITS2-Fg IТS-аймағын секвенирлеуге   Праймер для секвенирования IТS-
арналған праймер                    региона ITS2-Fg

SSR-2 кері праймері                 Праймер SSR-2 обратный



SSR-3 кері праймері                 Праймер SSR-3 обратный



SSR-3 түзу праймері                 Праймер SSR-3 прямой



SSR-4 кері праймері                 Праймер SSR-4 обратный
SSR-4 түзу праймері               Праймер SSR-4 прямой



SSR-5 кері праймері               Праймер SSR-5 обратный



SSR-5 түзу праймері               Праймер SSR-5 прямой



SSR-6 түзу праймері               Праймер SSR-6 прямой



Биологиялық түтік                 Пробирка биологическая



ПТР-ӛзі жабысатын қабыршақ        ПЦР-пленка самоклеющаяся



Ӛлшемді стандарт                  Размерный стандарт



Мурасиге және Скугтың қоректік    Раствор витаминов по прописи среды
ортасы жазуы бойынша витаминдер   Мурасиге и Скуга
ерітіндісі
Рестриктаза ER 0051 BamHI         Рестриктаза ER 0051 BamHI



Рестриктаза ER 0681 Xbal          Рестриктаза ER 0681 Xbal



Рифампицин                        Рифампицин



Сахароза                          Сахароза



Скальпель                         Скальпель



Гамборг В5 қоректік ортасына      Смесь витаминов для среды Гамборга В5
арналған витаминдер қоспасы

dNTP                              Смесь дезоксинуклеотидтрифосфатов
дезоксинуклеотидүшфосфаттар       dNTP
қосындысы
Мурасиге мен Скугтың тұздар       Смесь солей Мурасиге и Скуга
қоспасы

Гамборг В5 ортасының тұздар       Смесь солей среды Гамборга В5
қоспасы

Спецификалық антивирусты және     Специфические антивирусные и
антибактериалды қоян антиденесі   антибактериальные кроличьи антитела

Жоғары стакан                     Стакан высокий



Жоғары стакан                     Стакан высокий



Жоғары стакан                     Стакан высокий



Жоғары стакан                     Стакан высокий
Тӛмен стакан                       Стакан низкий



Тӛмен стакан                       Стакан низкий



Фарфорлы стакан                    Стакан фарфоровый



Фарфорлы стакан                    Стакан фарфоровый



Жабын шынысы                       Стекла покровные



Горяев камерасына жабын шынысы     Стекла покровные к камере Горяева



Т-2 токсині                        Т-2 токсин




Твин 20                            Твин 20



Твин 40                            Твин 40



Твин 60                            Твин 60



Твин 80                            Твин 80



Термометр                          Термометр



Күріш тест жүйесі LLRICE62         Тест система Рис LLRICE62
сәйкестендіру                      идентификация

Соя тест жүйесі A2704-12           Тест система Соя A2704-12
сәйкестендіру                      идентификация

Соя тест жүйесі A5547-127          Тест система Соя A5547-127
сәйкестендіру                      идентификация

Тест жүйе ГТ-рапс скрининг         Тест система ГМ-рапс скрининг



Соя тест жүйесі / 35S сан          Тест система Соя / 35S количество



Соя тест жүйесі / GTS 40-3-2 сан   Тест система Соя / GTS 40-3-2 количество



Соя тест жүйесі GTS 40-3-2         Тест система Соя GTS 40-3-2
сәйкестендіру                      идентификация

Жүгері тест жүйесі / MON 810 сан   Тест система Кукуруза / MON 810
                                   количество

Жүгері тест жүйесі Bt 11           Тест система Кукуруза Bt 11
сәйкестендіру                      идентификация

Жүгері тест жүйесі / 35S саны      Тест система Кукуруза / 35S количество
Жүгері тест жүйесі GA21            Тест система Кукуруза GA21
сәйкестендіру                      идентификация

Жүгері тест жүйесі MIR 604         Тест система Кукуруза MIR 604
сәйкестендіру                      идентификация

Жүгері тест жүйесі MON 810         Тест система Кукуруза MON 810
сәйкестендіру                      идентификация

Жүгері тест жүйесі MON 863         Тест система Кукуруза MON 863
сәйкестендіру                      идентификация

Жүгері тест жүйесі MON 88017       Тест система Кукуруза MON 88017
сәйкестендіру                      идентификация

Жүгері тест жүйесі NK603           Тест система Кукуруза NK603
сәйкестендіру                      идентификация

Жүгері тест жүйесі Т25             Тест система Кукуруза Т25
сәйкестендіру                      идентификация

Жүгері тест жүйесі / 35S / NOS     Тест система Кукуруза / 35S / NOS
скрининг                           скрининг

Картоп тест жүйесі / Cry3A скрининг Тест система Картофель / Cry3A
                                    скрининг

Ӛсімдік тест жүйесі / 35S / NOS    Тест система Растение / 35S / NOS
скрининг                           скрининг

Соя тест жүйесі / 35S / NOS        Тест система Соя / 35S / NOS скрининг
скрининг

Триптон                            Триптон



Трис (гидроксиметил)-аминометан    Трис (гидроксиметил)-аминометан
негізгі                            основной

Сүзгіш қағаз                       Фильтровальная бумага



Формамид                           Формамид 




Бромды цетилтриметиламмониі        Цетилтриметиламмония бромид (CTAБ)
(CTAB)

Цефатоксим                         Цефатоксим



Ӛлшеуіш цилиндр                    Цилиндр мерный



Ӛлшеуіш цилиндр                    Цилиндр мерный



Ӛлшеуіш цилиндр                    Цилиндр мерный



Ӛлшеуіш цилиндр                    Цилиндр мерный



Ӛлшеуіш цилиндр                    Цилиндр мерный
Ӛлшеуіш цилиндр                 Цилиндр мерный



Ӛлшеуіш цилиндр                 Цилиндр мерный



Қалақша                         Шпатель



Бір рет қолданбалы пісек        Шприц одноразовый



Металлды абақ                   Штатив металлический



Металлды абақ                   Штатив металлический



Микро шыны түтікшелерге арналған Штатив для микропробирок
абақ

Микро шыны түтікшелерге арналған Штатив для микропробирок
абақ

Микро шыны түтікшелерге арналған Штатив для микропробирок
абақ

Микро шыны түтікшелерге арналған Штатив для микропробирок
абақ

Микро шыны түтікшелерге арналған Штатив для микропробирок
абақ

Металлды абақ                   Штатив металлический



Металлды абақ                   Штатив металлический



Металлды абақ                   Штатив металлический



Сілтілік фосфатаза              Щелочная фосфатаза



Экзонуклеаза I                  Экзонуклеаза I



Электрод                        Электрод
Манғыстау облысының мұнаймен        Услуги по проведению агротехнических
ластанған учаскелерінде             работ на нефтезагрязненных участках
агротехникалық жұмыстарын           Мангистауской области
жүргізу бойынша қызметтер




Атырау облысының Жылыой             Закладка полевого эксперимента на
ауданындағы «Қосшағыл» кен          месторождении Косчагыл Жылойского
орнында далалық тәжірибені          района Атырауской области
дайындау




Атырау облысының тәжірибе           Химический анализ содержания нефти,
учаскесіндегі топырақтың құрамын,   состава и других характеристик почвы
мұнай мӛлшерін және ӛзгеде          экспериментального участка в
ерекшеліктерін химиялық талдау      Атырауской области




Лизиметрикалық талдаулар үшін       Аренда стационара для лизиметрических
стационарды жалға алу               опытов



МХМ 6800 маркалы "АТЛАНТ" екі       Ремонт двухкамерного холодильника
камералы тоңазытқышты жӛндеу        "АТЛАНТ" марки МХМ 6800
Бактериалдық масса                 Бактериальная масса




Жылу энергия объектілерінің        Услуги по заключению экспертизы о
жылыту мезгіліне дайындығы         готовности объектов к отопительному
туралы сараптаманың қорытынды      сезону по теплоэнергии
беру қызметтері



Жылу энергия шаруашылығы және      Услуги по аттестации ответственных лиц
электро шаруашылығы бойынша        за теплохозяйство и электрохозяйство
жауапты адамдардың аттестациялау
қызметтері

Сімжелілердің, сымдардың және      Услуги по измерению сопротивления
аппаратураның изоляция             изоляции кабеля, проводов и аппаратуры
қарсылығын ӛлшеу бойынша
қызметтер
Степногорск қаласындағы 6 шағын    Услуги по измерению сопротивления
аудандағы 6 ғимаратында және 7     петли "фаза-ноль" токоприемников,
шағын аудандағы 21 ғимаратында     металлической связи
орналасқан электро құрал-          электрооборудования с заземляющим
жабдықтары жӛнінде сараптаманың    контуром и выдачи заключению
қорытындысын беру және жерге       экспертизы электрооборудования в
тұйықтайтын контуры бар электро    здании расположенном в г. Степногорск
құрал-жабдықтары металлдық         мкр. 6 здание 6 и мкр. 7 здание 21
байланысының
тоққабылдауыштардың «фазаноль»
арқанының қарсылығын ӛлшеу
бойынша қызметтер




Техникалық манометрлерді           Услуги по поверке манометров
салыстырып тексеру бойынша         технических
қызметтер
Бақылау мановакуумметрін           Услуги по поверке мановакуумметра
салыстырып тексеру бойынша         контрольного
қызметтер
Вакуумметрді салыстырып тексеру    Услуги по поверке вакуумметра
бойынша қызметтер

Электроконтактілі манометрді       Услуги по поверке манометра
салыстырып тексеру бойынша         электроконтактного
қызметтер
Суық судың санауышын               Услуги по поверке счетчика холодной
салыстырып тексеру бойынша         воды
қызметтер

Техникалық термометрді          Услуги по поверке термометра
салыстырып тексеру бойынша      технического
қызметтер
Электрондық таразыны салыстырып Услуги по поверке весов электронных
тексеру бойынша қызметтер
Лабораториялық таразыны         Услуги по поверке весов лабораторных
салыстырып тексеру бойынша
қызметтер
Электрондық таразыны салыстырып Услуги по поверке весов электронных
тексеру бойынша қызметтер

Сауда таразысын салыстырып         Услуги по поверке весов торговых
тексеру бойынша қызметтер



Лабораториялық таразыны            Услуги по поверке весов лабораторных
салыстырып тексеру бойынша
қызметтер
Лабораториялық таразыны            Услуги по поверке весов лабораторных
салыстырып тексеру бойынша
қызметтер
Талдау таразысын салыстырып        Услуги по поверке весов аналитических
тексеру бойынша қызметтер

Медициналық таразыны               Услуги по поверке весов медицинских
салыстырып тексеру бойынша
қызметтер
Платформалық таразыны              Услуги по поверке весов платформенных
салыстырып тексеру бойынша
қызметтер
Таразыны салыстырып тексеру        Услуги по поверке весов
бойынша қызметтер

Электрондық таразыны салыстырып Услуги по поверке весов электронных
тексеру бойынша қызметтер

Электрондық таразыны салыстырып Услуги по поверке весов электронных
тексеру бойынша қызметтер

Мегаомметрді салыстырып тексеру    Услуги по поверке мегаомметра
бойынша қызметтер

РН-метрлерді салыстырып тексеру    Услуги по поверке РН-метров
бойынша қызметтер

Әмбебап ионометрді салыстырып      Услуги по поверке ионометра
тексеру бойынша қызметтер          универсального

Лабораториялық таразыны            Услуги по поверке весов лабораторных
салыстырып тексеру бойынша
қызметтер
Дозиметрлерді салыстырып тексеру   Услуги по поверке дозиметров
бойынша қызметтер

ВАЗ 21150 автокӛлігін жӛндеу   Услуги по ремонту автомашины ВАЗ
бойынша қызметтер, кӛлік       21150, № кузова ХТА 21150043804895
қорабының № ХТА 21150043804895
Маховиктің тісті тәжі          Зубчатый венец маховика




Стартер                        Стартер




Ілінісу дискісі                Диск сцепления




БАҚҚ бекіту жастықшалары       Подушки крепления КПП




Радиаторға резеңке             Комплект резиновых патрубков на
келтеқұбырларының жиыны        радиатор



Блоктың бастиегі               Головка блока




Піспектер саусақтарымен        Поршни с пальцами




Піспектің сақиналары           Поршневые кольца




Жапсырмалар жиыны              Комплект вкладышей




Блоктың бастиек тӛсеніші       Прокладка головки блока




Клапанды механизм қақпағының   Прокладка крышки клапанного
тӛсеніші                       механизма



Ауа сүзгісі                    Воздушный фильтр




Жанармай сүзгісі               Топливный фильтр




Май сүзгісі                    Масленый фильтр




Мотор майы                     Моторное масло




Артқы бағаналар                Задние стойки
Алдыңғы бағаналар                 Передние стойки




Серіппелер алдыңғы                Передние пружины




Аспаның алдыңғы рычагтары         Передние рычаги подвески




Алдыңғы шарлы тіректер            Передние шаровые опоры




Алдыңғы тежегіш дискілері         Передние тормозные диски




Алдыңғы тежегіш қалыптары         Передние тормозные колодки




Артқы тежегіш қалыптары           Задние тормозные колодки




Алдыңғы тежегіш шлангтар          Передние тормозные шланги




Алдыңғы оң фара                   Правая передняя фара




Рульдің ұштықтары                 Рулевые наконечники




R-13 дискілері                    Диски R-13




Электробензосорғы                 Электробензонасос




Тосол                             Тосол




Қамыт                             Хомут




Герметик                          Герметик




Бүркігіш және датчиктері бар рампа Рампа с форсунками и датчиком
Картридждерді толтыру             Заправка картриджей




Фотобарабанды ауыстыру            Замена фотобарабана




Термопленканы ауыстыру            Замена термопленки




Принтерлерді жӛндеу               Ремонт принтера




Желілі фильтр (айырғыш            Сетевой фильтр (для сепараторной
центрифуга үшін)                  центрифуги)




Кернеу тұрлауландырғышы           Стабилизатор напряжения




Бензин                            Бензин



Іс- шараларда сатылатын            Приобретение материалов реализуемых
материалдарды сатып алу, сондай-ақ на мероприятиях, а также оплата за
аталған іс-шараларға қатысқаны     участие в указанных мероприятиях
үшін ақы тӛлеу
Проектор                          Проектор




Елтаңба мӛрді жасау               Изготовление гербовой печати




Елтаңба мӛрді жою                 Уничтожение гербовой печати
Атмосфераны ластайтын заттар        Услуги по проведению инвентаризации
шығарындыларының кӛздерiн           источников выбросов загрязняющих
түгендеуін ӛткізу бойынша           веществ в атмосферу
қызметтері
Қалдықтар тӛлқұжаттарын әзірлеу     Услуги по разработке паспортов отходов
бойынша қызметтері



"Биопрожест" инсектицидтің          Услуги по проведению
ӛндірістік сынақтарын ӛткізу        производственных испытаний
                                    инсектицида "Биопрожест"

Автокӛліктерге техникалық қызмет    Услуги по техническому обслуживанию
кӛрсету:                            автомашин:
Daewoo-Nexia, 2008 ш.ж., кузов      Daewoo-Nexia, 2008 г.в. номер кузова
нӛмірі XWB3132BD8A010728,           XWB3132BD8A010728, объем двигателя
двигатель кӛлемі 1498 см. куб.;     1498 см. куб.;
Chevrolet Epica, 2006 ш.ж., кузов   Chevrolet Epica, 2006 г.в., номер кузова
нӛмірі K111A691J6B017400,           K111A691J6B017400, 115/156, квт/лс на
115/156 квт/лс, ӛнім берушінің      базе и оборудовании поставщика
базасы мен жабдықтарында




Қалдықтар паспортында белгіленген Услуги по переработке (удалению)
әдісімен қалдықтарды қайта ӛңдеу  отходов способом предусмотренным
(жою) бойынша қызметтер           паспортом отхода

Қалдықтар паспортында белгіленген Услуги по переработке (удалению)
әдісімен қалдықтарды қайта ӛңдеу  отходов способом предусмотренным
(жою) бойынша қызметтер           паспортом отхода

Қалдықтар паспортында белгіленген Услуги по переработке (удалению)
әдісімен қалдықтарды қайта ӛңдеу  отходов способом предусмотренным
(жою) бойынша қызметтер           паспортом отхода

Қалдықтар паспортында белгіленген Услуги по переработке (удалению)
әдісімен қалдықтарды қайта ӛңдеу  отходов способом предусмотренным
(жою) бойынша қызметтер           паспортом отхода

Қалдықтар паспортында белгіленген Услуги по переработке (удалению)
әдісімен қалдықтарды қайта ӛңдеу  отходов способом предусмотренным
(жою) бойынша қызметтер           паспортом отхода

Қалдықтар паспортында белгіленген Услуги по переработке (удалению)
әдісімен қалдықтарды қайта ӛңдеу  отходов способом предусмотренным
(жою) бойынша қызметтер           паспортом отхода

Бұрғыш                              Отвод



Құбыр                               Труба



Құбыр                               Труба



Бұранда                             Резьба
Манометр                        Манометр



Термометр                       Термометр



Дәнекерлеу шүмектер             Кран приварной



Тартпаларды демонтаждау         Демонтаж задвижек



ЫСЖ 1 сатылы жылу алмастырғыш   Теплообменник ГВС 1 ступени



ЫСЖ 2 сатылы жылу алмастырғыш   Теплообменник ГВС 2 ступени



Бойлерді демонтаждау            Демонтаж бойлера



Шүмек                           Кран



Торлы сүзгіш                    Фильтр сетчатый



Торлы сүзгіш                    Фильтр сетчатый



Жылу алмастырғышты сығымдау     Опрессовка теплообменника



Вентиль d-15 мм                 Вентиль d-15 мм




Вентиль d-20 мм                 Вентиль d-20 мм




Вентиль d-25 мм                 Вентиль d-25 мм




Вентиль d-32 мм                 Вентиль d-32 мм




Ысырма d-50 мм                  Задвижки d-50 мм




Ысырма d-80 мм                  Задвижки d-80 мм




№2 газ кілті                    Ключ газовый №2




Сантехникалық зығыр             Лен сантехнический
Бұрылу d-15 мм                     Отвод d-15 мм




Бұрылу d-20 мм                     Отвод d-20 мм




Бұрылу d-25 мм                     Отвод d-25 мм




Фум пленкасы                       Пленка фум




Жылу радиаторы                     Радиатор отопления




Ойма жалғасу d-15 мм               Сгон d-15 мм




Ойма жалғасу d-20 мм               Сгон d-20 мм




Ойма жалғасу d-25 мм               Сгон d-25 мм




Сифон                              Сифон




Екі кернейлі қоспалауыш            Смеситель двухрожковый




Канализациялық құбыр d=50 мм       Труба канализационная d=50 мм




Суды, газды ӛткізетін кұбыр d-15мм Труба водогазопроводная d-15мм




Суды, газды ӛткізетін кұбыр d-20 мм Труба водогазопроводная d-20 мм




Суды, газды ӛткізетін кұбыр d-25 мм Труба водогазопроводная d-25 мм




Суды, газды ӛткізетін кұбыр d-32 мм Труба водогазопроводная d-32 мм




Суды, газды ӛткізетін кұбыр d-40 мм Труба водогазопроводная d-40 мм
Суды, газды ӛткізетін кұбыр d-50 мм Труба водогазопроводная d-50 мм




Құбыр d 20 мм                        Труба d 20 мм




Құбырлар d 25 мм                     Трубы   d 25 мм



Құбырлар d 32 мм                     Трубы d 32 мм




Фитинг d-50мм                        Фитинг d-50мм




Жылуды есепке алу жүйесін            Услуги по проведению поверки систем
салыстырып тексеруді ӛткізу          теплового учета
бойынша қызметтер

Жылуды есепке алу жүйесін            Услуги по проведению поверки систем
салыстырып тексеруді ӛткізу          теплового учета
бойынша қызметтер

Электр энергиясы                     Электроэнергия



Жылу энергиясы                       Тепловая энергия



Суық су                              Холодная вода



Сарқынды суларды бұру                Отвод сточных вод



Сарқынды суларды тазалау             Очистка сточных вод



Почта корреспонденциясын жіберу      Пересылка почтовой корреспонденции



«Қазақстанның биоалуантүрлілігін     Оказание услуг (работ) на выполнение
сақтау үшін ӛсімдіктер, жануарлар,   прикладных научных исследований
микроорганизмдер жинақтамаларын      в рамках научно-технической программы
және бірегей генетикалық банкін       «Пополнение, изучение и поддержание
толықтыру, зерттеу және қолдау»      коллекций растений, животных,
ғылыми-техникалық бағдарламасы       микроорганизмов и уникальных
шеңберінде қолданбалы ғылыми         генетических банков для сохранения
зерттеулерді орындауға қызметтерді   биоразнообразия Казахстана»
(жұмыстарды) кӛрсету
«Әлемдік стандартқа сәйкес, азық-      Оказание услуг (работ) на выполнение
түлік ӛнімдерінің негізгі түрлерінің   прикладных научных исследований по
ғылыми-негізделген тұтыну              научно-технической программе
нормаларын әзірлеу» ғылыми-            «Разработка научно-обоснованных норм
техникалық бағдарламасы бойынша        потребления основных видов
қолданбалы ғылыми зерттеулерді         продовольственных продуктов,
орындауға қызметтерді                  соответствующих мировым стандартам»
(жұмыстарды) кӛрсету



РВ-ПТР үшін праймерлер                 Праймеры для РВ-ПЦР




L-глютамин ерітіндісі 200 mМ           Раствор L-глютамина 200 mМ



Екінші кезектегі                       Раствор второстепенных аминокислот
аминқышқылдарының ерітіндісі           (100X)
(100X)
Квантталатын 3-21 жинақталатын         Квантуемая 3-21 комплектуемая
амниотикалық орта, L-глутаминмен       амниотическая среда, с L-глутамином

Коллагеназа, II түрі                   Коллагеназа, тип II



Фибробласт ӛсу факторы-негізгі         Фактор роста фибробластов-основной
адамдыкі рекомбинантты                 человеческий рекомбинантный




Тромбоцит-ВВ ӛсу факторы,              Фактор роста тромбоцитов-ВВ,
адамдыкі рекомбинантты                 человеческий рекомбинантный



Нейрон-β ӛсу факторы , адамдыкі        Фактор роста нейронов-β человеческий
рекомбинантты                          рекомбинантный

Адам сарысуы альбумині                 Человеческий сывороточный альбумин



3-изобутил-1-метилксантин              3-изобутил-1-метилксантин



Индометацин                            Индометацин
Бутилирленген гидроксианизол        Бутилированный гидроксианизол



L-аскорбинді қышқылы 2-фосфат       L-аскорбиновая кислота 2-фосфат



β-глицерофосфат                     β-глицерофосфат



Майлы қызыл бояу О (Oil Red O)      Краситель масляно-красный О (Oil Red
                                    O)

5-азацитидин                        5-азацитидин



Гидрокартизон, 98%                  Гидрокартизон, 98%



Ализаринді қызыл S                  Ализариновый красный S



Термиялық белсенсіздендірілген      Лошадиная сыворотка термически
жылқының сарысуы                    инактивированная

Магнитті бӛлшектермен               Анти - мышиные антитела IgG 1
байланысқан анти тышқан IgG 1       конъюгированные с магнитными
антиденесі                          частицами

Қоянның поликлоналды LYVE-1         Поликлональные кроличьи антитела
антиденесі                          к LYVE-1

Инсулин-трансферин-селенит +1       Инсулин-трансферин-селенит +1
қоректік ортаға қоспа (100×)        добавка к среде (100×)



Агароза                             Агароза



dNTP          дезоксинуклеотидүш-   Смесь дезоксинуклеотид-трифосфатов
фосфаттар қосындысы - (әрбіреуден   (dNTP) - (10 mM каждого)
10 mM)
Tag        ДНҚ-полимераза           Taq ДНК-полимераза (рекомбинантная с
(рекомбинантты буфермен)            буфером)




ISSR-1                              ISSR-1



ISSR-2                              ISSR-2



ISSR-3                              ISSR-3



ISSR-4                              ISSR-4



ISSR-5                              ISSR-5



ISSR-6                              ISSR-6
ISSR-7                         ISSR-7



ISSR-8                         ISSR-8



ISSR-12                        ISSR-12



ISSR-13                        ISSR-13



ISSR-47                        ISSR-47



ISSR-48                        ISSR-48



ISSR-50                        ISSR-50



ISSR-51                        ISSR-51



Қыздырып жапсыратын аппарат,   Сварочный аппарат переносной
тасымалды



АП-50 16А автоматты айырғыш    Автоматический выключатель АП-50 16А




АП-50 25 А автоматты айырғыш   Автоматический выключатель АП-50 25
                               А



Алюминий сымы                  Алюминиевый провод




Айырғыштар                     Выключатели




Кабель                         Кабель




Кабель каналы                  Кабельный канал




Кабель каналы                  Кабельный канал




ДРЛ-400 шамы                   Лампа ДРЛ-400




ЛД-40 шамы                     Лампа ЛД-40
100 Вт қызу шамы   Лампа накаливания 100 Вт




60 Вт қызу шамы    Лампа накаливания 60 Вт




Розеткалар         Розетки




ЛБ 2*40 шырағы     Светильник ЛБ 2*40




220В стартер       Стартер 220В




Электр бұрғы       Электрическая дрель




Электр вилкалары   Электрические вилки




Электродтар        Электроды




Электродтар        Электроды




Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер



Праймер            Праймер
Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер
Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер
Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер



Праймер   Праймер
Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Праймер                        Праймер



Random 6 праймері              Праймер Random 6



16S рРНК гендерің              Универсальный праймер для
амплификациялау үшін әмбебап   амплификации генов 16S рРНК
праймер
16S рРНК гендерің              Универсальный праймер для
амплификациялау үшін әмбебап   амплификации генов 16S рРНК
праймер
Полипропиленді қаптар          Мешки полипропиленовые



Полипропиленді қаптар          Мешки полипропиленовые



Жануарлар үшін азық қоспасы    Кормосмесь для животных



Атырау облысының Жылыой        Закладка полевого эксперимента на
ауданындағы «Қосшағыл» кен     месторождении Косчагыл Жылойского
орнында далалық тәжірибені     района Атырауской области
дайындау




Егеуқұйрықтар                  Крысы



Тышқандар                      Мыши
Кӛлік құралдарының йелерінің       Страхование гражданско- правовой
азаматтық құқықтық                 ответственности владельцев
жауапкершілігін сақтандыру         автотранспортных средств
Ӛкілдік ету шығыстарына            Услуги, связанные с представительскими
байланысты қызметтер               расходами

Ӛкілдік ету шығыстарына            Услуги, связанные с представительскими
байланысты қызметтер               расходами

Тілім тастағы Къельдаль аппараты   Аппарат Къельдаля на шлифах



Сүзгі қағаз                        Бумага фильтровальная



Мақта                              Вата



В56-80 химиялық ұра                Воронка химическая В56-80



В75-110 химиялық ұра               Воронка химическая В75-110



Шыны түтікшелерге арналған шайма Ерш пробирочный



Тербемелі жұмыр шыны               Колбы качалочные



Дәке                               Марля



Резеңкедегі медициналық бетперде   Маска медицинская на резинке



Біржолғы қалпақтар                 Одноразовые шапочки



Біржолғы бахилалар                 Одноразовые бахилы




Ақсӛл қолғаптары                   Перчатки латексные



Медициналық қолғаптар              Перчатки медицинские



Тығыз резеңке қолғаптар            Перчатки плотные резиновые



Биологиялық шыны түтікше           Пробирки биологические



Ерітінділерде спирт мӛлшерін       Прибор для количественного
анықтайтын жабдық                  определения спирта в растворах

Күлсіз сүзгі "кӛк таспа"           Фильтры обеззоленные "синяя лента"



4-нитрофенил-бета-дельта-глюко-    4-нитрофенил-бета-дельта-глюко-
пиранозид                          пиранозид

Агар (түрі СК-900)                 Агар (тип СК-900)
Күкіртқышқылды аммоний           Аммоний сернокислый



Антрон                           Антрон



В1 дәрумен (Тиамин)              Витамин В1 (Тиамин)




Медициналық кристаллдық глюкоза Глюкоза кристаллическая медицинская



Наубайханалық ашытқылар          Дрожжи пекарские



Күкіртқышқылды темір (II) хт     Железо сернокислое (II) хч




Йодты калий                      Калий йодистый



Калий натрий шарапқышқыл тта     Калий натрий виннокислый чда



Фосфорқышқылды калий 1-          Калий фосфорнокислый 1-замещенный
ауыспалы

Хлорлы кальций сусыз             Кальций хлористый безводный



Крахмал индикатор суда еритін    Крахмал индикатор водорастворимый



Күкіртқышқылды магний 7-сулы     Магний сернокислый 7-водный



Күкіртқышқылды мыс               Медь сернокислая



Хлорлы натрий хт                 Натрия хлористый хч



Натрий гидрототығы NaOH          Натрия гидроокись NaOH



Глюкозаны анықтауға арналған     Набор для определения глюкозы
жиын




Натрий тиосульфаты (фиксанал)    Натрия тиосульфат (фиксанал)



О-дианизидин                     О-дианизидин



ОП-7 (қосалқы зат)               ОП-7 (вспомогательное вещество)



Пергидроль Б маркасы             Пергидроль марка Б
Пептон                             Пептон



Пектин                             Пектин



Жұғымтал ет сорпасы (құрғақ)       Питательный бульон мясной (сухой)



Этил спирті                        Спирт этиловый



Стандарт титрлер 0,1 Н РН-метрия   Стандарт титры 0,1 Н для РН-метрии
үшін

Сусло-орта (халықаралық аты Wort   Сусло-среда (международное название
agar)                              Wort agar)

Целлобиоза                         Целлобиоза



Формалин                           Формалин



Falcon шыны түтікшелерге арналған Адаптер для пробирок Falcon
адаптер

Индикаторлық әмбебап қағаз         Бумага универсальная индикаторная



Бӛтелке V =5 л тар ауызбен         Бутыль V =5 л с узким горлом



Бӛтелке                            Бутыль



Ақсаң                              Бязь



В36-50 химиялық май құйғыш         Воронка химическая В36-50



Резеңке грушалар                   Груши резиновые



Медициналық груша                  Груша медицинская



Конус тәрізді жұмыр шыны 1 л       Колбы конические на 1 л с делениями
бӛлшектеумен

Конус тәрізді жұмыр шыны 100 мл    Колбы конические на 100 мл с делениями
бӛлшектеумен

Конус тәрізді жұмыр шыны 2 л       Колбы конические на 2 л с делениями
бӛлшектеумен

Конус тәрізді жұмыр шыны КН 2-     Колба коническая КН 2-250-34
250-34

Конус тәрізді жұмыр шыны КН 3-     Колба коническая КН 3-100-34
100-34

Конус тәрізді жұмыр шыны КН3-      Колба коническая КН3-500-50
500-50
Конус тәрізді түбі жалпақ, жылуға   Колба коническая плоскодонная
тұрақта жұмыр шыны                  термостойкая

Конус тәрізді жұмыр шыны КН-2-50- Колба коническая КН-2-50-22 без шкалы
22 шкаласыз

Ӛлшеуіш жұмыр шыны 500 мл-ге        Колба мерная на 500 мл



Ӛлшеуіш жұмыр шыны                  Колба мерная



Ӛлшеуіш жұмыр шыны                  Колба мерная



Ӛлшеуіш жұмыр шыны                  Колба мерная



Ӛлшеуіш жұмыр шыны                  Колба мерная



Дӛңгелек түбті тілімтаспен жұмыр    Колба круглодонная со шлифом
шыны

Металл тығындар                     Колпачки металлические



Хирургиялық қалпақ                  Колпак хирургический



Картон қораптар                     Коробки картонные



Крафт қағазы                        Крафт бумага



Спектрофотометр үшін кварц          Кюветы кварцевые на спектрофотометр
кюветтер 10 мм                      10 мм

Реактивтерге арналған пластмасс     Лопатка для реактивов пластмассовая с
күрекше аяғында қасығы бар          ложкой на конце

Магниттық былғауыш үшін магнит      Магниты для магнитной мешалки



ПТР үшін микро шыны түтікшелер      Микропробирки для ПЦР



Микро шыны түтікшелер               Микропробирки



Мензуркалар 50мл                    Мензурки 50 мл



Ұштықтар 0,5-5 мл                   Наконечники 0,5-5 мл



Ұштықтар 0-200 мкл                  Наконечники 0-200 мкл



Ұштықтар 200-1000 мкл               Наконечники 200-1000 мкл



Ұштықтар 100-1000 мкл               Наконечники 100-1000 мкл
Ұштықтар 20-200 мкл                Наконечники 20-200 мкл



Ұштықтар 0,5-10 мкл                Наконечники 0,5-10 мкл



Ұштықтар 0,5-10 мкл                Наконечники 0,5-10 мкл



Құлаққаптар -антифондар            Наушники-антифоны



Жұқа қабатты хромотографияға       Пластины для Тонкослойной
арналған пластиналар               хромотографии

ЖҚХ үшін пластиналар               Пластины для ТСХ



ЖҚХ үшін пластиналар               Пластины для ТСХ



Ілгек ұстатқыш                     Петледержатель



Бактериалдық ілгек PS, кӛлемі 1 мкл Петля бактериальная PS, объем 1 мкл



Тамызғыш 1 мл үшін толық           Пипетки на 1 мл с полным сливом,
құйылыспен, градуирленген          градуированные

Тамызғыш 10 мл үшін толық          Пипетки на 10 мл с полным сливом
құйылыспен, градуирленген          градуированные

Тамызғыш 5 мл үшін толық           Пипетки на 5 мл с полным сливом
құйылыспен, градуирленген          градуированные

Тамызғыш 25 мл үшін толық          Пипетки на 25 мл с полным сливом
құйылыспен, градуирленген          градуированные

Тамызғыш-мӛлшерлеуіш ауыспалы      Пипетка-дозатор переменного объема
кӛлемді

Тамызғыш-мӛлшерлеуіш ауыспалы      Пипетка-дозатор переменного объема
кӛлемді

Тамызғыш-мӛлшерлеуіш ауыспалы      Пипетка-дозатор переменного 1000-
кӛлемді 1000-10000 мкл             10000 мкл

Тамызғыш-мӛлшерлеуіш ауыспалы      Пипетка-дозатор переменного объема
кӛлемді

Биологиялық шыны түтікшелер        Пробирки биологические



Биологиялық шыны түтікшелер        Пробирки биологические



Адаптермен центрифугалық шыны      Пробирка центрифужная с адаптером, 50
түтікше, 50 мл                     мл

Тығын                              Пробки



Агрессиялық сұйықтықтарға          Пульверизатор для агрессивных
арналған пульверизатор             жидкостей
Груша тәрізді әмбебап пульверизатор Пульверизатор универсальный грушевый



Ӛлшеуіш стақан бӛлшектенумен 150 Стакан мерный с делением на 150 мл
мл

Ӛлшеуіш стақан бӛлшектенумен 250 Стакан мерный с делением на 250 мл
мл

Ӛлшеуіш стақан бӛлшектенумен 600 Стакан мерный с делением на 600 мл
мл

Ӛлшеуіш стақан бӛлшектенумен      Стакан мерный с делением на 1000 мл
1000 мл

Ӛлшеуіш стақан шкаламен 100 мл    Стакан мерный со шкалой на 100 мл



Ӛлшеуіш стақан шкаламен 50 мл     Стакан мерный со шкалой на 50 мл



Ӛлшеуіш стақан 50 мл шкаласыз     Стакан мерный на 50 мл без шкалы



Жылуға тұрақты химиялық стақан    Стакан химический термостойкий 500 мл
500мл

Жылуға тұрақты химиялық стақан    Стакан химический термостойкий 1000
500мл                             мл

Ӛлшеуге арналған стақан СВ24/10   Стаканчик для взвешивания СВ24/10



Жамылғы шынылар                   Стекла покровные



Жамылғы шынылар                   Стекла покровные



Заттық шынылар                    Стекла предметные



СЛ-2 спирт шамы                   Спиртовка СЛ-2



Таймер                            Таймер




Силикон құбыр (диаметр 6 мм)      Трубка силиконовая (диаметр 6 мм)



Силикон құбыр (диаметр 8 мм)      Трубка силиконовая (диаметр 8 мм)




Силикон құбыр (диаметр 10 мм)     Трубка силиконовая (диаметр 10 мм)




Қалақша                           Шпатель
Сауыттар                         Флаконы



Күлсіз сүзгі "кӛк таспа"         Фильтры обеззоленные "синяя лента"




Медициналық шапандар             Халаты медицинские




Петри шыны аяқтары               Чашки Петри



РН-метр үшін электордтар         Электроды на РН-метр



5-бромо-хлоро-3-индолил-β-D-     5-бромо-хлоро-3-индолил-β-D-
галактопиранозид                 галактопиранозид

N, N' - метиленбисакриламид,     N, N' - метиленбисакриламид,
бисакриламид                     бисакриламид

MRS агар                         MRS агар



MRS сорпа                        MRS бульон



ДНК-полимераза                   ДНК-полимераза



Акриламид                        Акриламид



Бұқалық альбумин іркіті құрғақ   Альбумин бычий сывороточный сухой



Ампицилин                        Ампицилин



Аммиак 25% қоюландырылған ТҮТ    Аммиак 25% концентрированный ЧДА



Азотқышқылды аммоний таза        Аммоний азотнокислый чистый



Күкірт қышқылды аммоний          Аммоний сернокислый



Күкіртқыш аммоний асқан (NH4)2   Аммоний надсернокислый (NH4)2 S2O8
S2O8 таза                        чистый

Аспарагин                        Аспарагин



Бакто-триптон                    Бакто-триптон



Бор қышқылы                      Борная кислота



Бутанол таза түт                 Бутанол чистый чда
Магниймен буфер ПТР үшін             Буфер с магнием для ПЦР



Бромтимолды кӛк                      Бромтимоловый синий



Бромфенолды кӛк                      Бромфеноловый синий (упаковка-5г)



Вектор pGEM7Z                        Вектор pGEM7Z




Глюкоамилаза                         Глюкоамилаза



Глицин                               Глицин



Гексадецилүшметиламмониум            Гексадецилтриметиламмониум бромид
бромиды

АДК ашытқылар (ақуыз-дәрумен         Дрожжи БВК (белково-витаминный
комплексі) жемдік ашытқылар          комплекс) кормовые дрожжи

"Beauveria bassiana" депонирленген   Депонированный штамм
микроорганизм штаммы                 микроорганизма "Beauveria bassiana"

ДНҚ маркер 100 нуклеотид реттілігі ДНК маркер 100 нуклеотидных
                                   последовательностей




ДНҚ лигаза Т4, 40 000 о.б.           ДНК лигаза Т4, 40 000 е.а.




Дезоксинуклеозидүшфосфаты            Дезоксинуклеозидтрифосфаты
(ферментативті синтезделген)         (ферментативно синтезированных)

Дезоксиаденозинүшфосфаты 100         Дезоксиаденозинтрифосфат 100
милимоль су ерітіндісі               милимоль водный р-р

Дифениламин                          Дифениламин



Изопропил-β-D-тиогалактопиранозид Изопропил-β-D-тиогалактопиранозид



Изопропанол абсолютирленген          Изопропанол абсолютированный



Құрғақ тазартылған ӛт                Желчь очищенная сухая



Күкірт қышқылды темір 7- сулы        Железо сернокислое 7-водное



Күкірт қышқылды темір (III) т        Железо сернокислое (III) ч



Хлорды темір                         Железо хлористое



Азотқышқылды калий                   Калий азотнокислый
Калий екіхромды K2Cr2O7 таза      Калий двухромовокислый K2Cr2O7
                                  чистый

Фосфорқышқылды калий 2-           Калий фосфорнокислый двузамещенный
ауыспалы т                        ч

Хлорлы калий                      Калий хлористый



Азотқышқылды кальций 4-сулы түт   Кальций азотнокислый 4 водный чда
Са(NO3)2 х 4Н2О                   Са(NO3)2 х 4Н2О

Хлорлы кальций сусыз              Кальций сернокислый



Күкіртқышқылды кальций            Кальций углекислый



Желатин капсулалары               Капсулы желатиновые



Қымыздық қышқыл стандарт -        Кислота щавелевая стандарт -титры 0,1Н
титрлер 0,1Н

Кәріптас қышқылы                  Кислота янтарная



Құрамдас жасушалар E.coli штамм   Компетентные клетки E.coli штамм JM
JM 109                            109

Картоп крахмалы                   Крахмал картофельный



Крахмал индикатор суда еритін     Крахмал индикатор водорастворимый



Сұлы қабыршақтан ксилан           Ксилан из оболочек овса



Жүгері сіріңдісі                  Кукурузный экстракт



Ксиленцианол                      Ксиленцианол



Ксиланаза                         Ксиланаза



Жүгері ұны                        Кукурузная мука



Жүгері қиыршықтары                Кукурузная крупа



Лактоза (Д-лактоза)               Лактоза (Д-лактоза)



Мальтоза                          Мальтоза



Маннит                            Маннит



Манноза                           Манноза
ПТР арналған минерал майы           Минеральное масло для ПЦР
(полимеразалық тізбектік реакция)   (полимеразной цепной реакции)

Иммерсиондық май, терпенді          Масло иммерсионное терпеновое



Аммоний молибдат аммония            Молибдат аммония



Тұтас сиыр сүті                     Молоко коровье цельное



Мочевина                            Мочевина



Бидай ұны                           Мука пшеничная



Балық ұны                           Мука рыбная



РНК П/п РНК бӛліп алуға арналған    Набор для выделения РНК П/п РНК, 50х
жиын, 50х

Азотқышқылды натрий хт              Натрий азотнокислый хч



Натрий додецилсульфаты ЧДА          Натрий додецилсульфат ЧДА



Лимонқышқылды натрий 3-             Натрий лимоннокислый 3-замещ. ЧДА
ауыспалы ТҮТ

Натрий тұзы целлюлозаның            Натриевая соль карбоксиметил
карбоксиметил целлюлозасы           целлюлозы (низкой вязкости)
(жабысқақтығы тӛмен)
Фосфорқышқылды натрий 2-            Натрий фосфорнокислый 2-х
ауыспалы, 12-сулы                   замещенный, 12-и водный

Фосфорқышқылды натрий 3-            Натрий фосфорнокислый 3-замещ.чда
ауыспалы түт

ДНҚ тез тігуге арналған жиын        Набор для быстрой сшивки ДНК




Граму бойынша бояғыштар жиыны       Набор красителей по Граму



ПТР үшін ДНҚ бӛліп шығару және      Набор для выделения и очистки ДНК для
тазартуға арналған әмбебап жиын     ПЦР универсальный

Сіркеқышқылды натрий үшсулы         Натрий уксуснокислый трехводный



Нитроамофоска                       Нитроамофоска



Олеин қышқылы                       Олеиновая кислота
Бидай кебектері              Отруби пшеничные



Ортофосфор қышқылы           Ортофосфорная кислота



Панкреатин                   Панкреатин



Майшабақтың панкреатикалық   Панкреатический гидролизат кильки
гидролизаты

Кӛбік сӛндіргіш (ниоген)     Пеногаситель (ниоген)



Сыра суслосы                 Пивное сусло



Протеиназа К                 Протеиназа К



Рамноза L сулы               Рамноза L водная



Рафиноза                     Рафиноза



Резорцин                     Резорцин




Рестриктаза Alu I            Рестриктаза Alu I




Рестриктаза BstMBI           Рестриктаза BstMBI




Рестриктаза BsuRI            Рестриктаза BsuRI




Рестриктаза RsaI             Рестриктаза RsaI




Рестриктаза Sma I 20 б/мкл   Рестриктаза Sma I 20 ед/мкл




Рестриктаза Tru9I            Рестриктаза Tru9I




Салицин                      Салицин



Сахароза                     Сахароза



Соя тұқымдары                Семена сои
Силикагель                        Силикагель



Азотқышқылды күміс түт            Серебро азотнокислое чда



ҚМС (құрғақ майсыздалған сүт)     СОМ (сухое обезжиренное молоко)



Соя ұны                           Соевая мука




Сорбит                            Сорбит



Қарапайым күкірт, таза            Сера элементарная, чистая



Стрептомицин                      Стрептомицин



Аминоқышқылдардың стандартты      Стандартный набор аминокислот
жиыны

Калибрленген ақуыз стандартты     Стандартный набор калибровочных
жиыны                             белков

Стандарт-титрлер 0,1 Н йод        Стандарт-титры 0,1 Н йод



СПА құрғақ                        Сухой СПА



Т4 полинуклеотид киназа           Т4 полинуклеотид киназа




Термолабильды сілті фосфатаза     Термолабильная щелочная фосфатаза




Тетрациклин                       Тетрациклин



Тетраметилэтилендиамин (ТЕМЕД)    Тетраметилэтилендиамин (ТЕМЕД)



Трис (гидроксиметил)-аминометан   Трис (гидроксиметил)-аминометан
негізгі                           основной

Трегалоза                         Трегалоза



Фруктоза                          Фруктоза



Темір хлориды (III)               Хлорид железа (III)



Хлороформ                         Хлороформ
Целловиридин Г20Х                 Целловиридин Г20Х




Цистин                            Цистин



Хлорлы мырыш                      Цинк хлористый



Цеолит                            Цеолит



Жемдіқ ашытқылар сіріңдісі        Экстракт кормовых дрожжей



Экзонуклеаза III                  Экзонуклеаза III



Эритромицин                       Эритромицин



ЭДТА (этилендиаминтетрасірке      ЭДТА (этилендиаминтетрауксусная
қышқылы)                          кислота)

Целлюлоза микрокристаллдық        Целлюлоза микрокристаллическая



Формамид таза                     Формамид чистый



Жылу энергия шаруашылығы          Обследование теплоустановок и
бойынша жауаптыны аттестациялау   аттестация ответственного за тепловое
және жылу қондырғыларын тексеру   хозяйство

Кӛлік құралдарының йелерінің      Страхование гражданско- правовой
азаматтық құқықтық                ответственности владельцев
жауапкершілігін сақтандыру        автотранспортных средств
Автокӛлікті жалдау бойынша        Услуги по аренде автомобиля
қызметтер




Ацетилосалицил қышқылы            Ацетилосалициловая кислота




Күл-қоқыр салатын жәшік           Урна для мусора




Бинт                              Бинт




Бинт                              Бинт




Бинт                              Бинт
Түйреуіш              Булавки




Бұрғы                 Бур




Бұрғы                 Бур




Қолға арналған май    Крем для рук




Сүрткіш мата          Ткань обтирочная




Сіріңке               Спички




Валидол               Валидол




Шелек                 Ведро




Шелек                 Ведро




Шелек                 Ведро




Шелек                 Ведро




Шелек                 Ведро




Шелек                 Ведро




Сыпырғыш              Веник




Тұрмыстық желдеткіш   Вентилятор бытовой




Шегелер               Гвозди
Шегелер               Гвозди




Ыдыс жуатын ысқыш     Губка для мытья посуды




Ғаныш                 Гипс




Деохлор таблеткалар   Деохлор таблетки




Шайма                 Ерш




Шайма                 Ерш




ПВХ изолентасы        Изолента ПВХ




Калий перманганаты    Калия пермаганат




Канистрлар кӛлемі     Канистры объем




Кастрӛл               Кастрюля




Кастрӛл               Кастрюля




Кастрӛл               Кастрюля




Мақта-мата костюм     Костюм хлопчатобумажный




Контейнер             Контейнер




Контейнер             Контейнер




Клемастин             Клемастин
Кескін шеңбер            Круг отрезной




Кескін шеңбер            Круг отрезной




Куртка                   Куртка




Лавсан                   Лавсан




Жабысқақ пластырь        Лейкопластырь




Жабысқақ пластырь        Лейкопластырь




Линолеум                 Линолеум




Май                      Масло




Май                      Масло




Май                      Масло




Қаптар                   Мешки




Метамизол                Метамизол




Таңбалаушы d-1дюйм       Метчики d-1 дюйм




Таңбалаушы d- 1/2 дюйм   Метчики d- 1/2 дюйма




Таңбалаушы d-3/4 дюйм    Метчики d-3/4 дюйма




Қаптар                   Мешки
Полиэтилен қаптар                Мешки полиэтиленовые




Ыдыс жууға арналған зат 1 л      Моющие средства для посуды 1 л




Ыдыс жууға арналған зат 0,4 л    Моющие средства для посуды 0,4 л




Шыны жууға арналған зат 500 мл   Моющие средства для стекла 500 мл




Мультиметр                       Мультиметр




Қалпақшалар жиыны                Набор головок




Кілттер жиыны                    Набор ключей




Бұрағыштар жиыны                 Набор отверток




Ойма қиғыш жиын                  Набор резьборезов




Қашаулар жиыны                   Набор стамесок




Нитроглицерин                    Нитроглицерин




Оттыбиоқорғауыш құрам            Огнебиозащитный состав




ОУ-5 ӛрт сӛндіргіш               Огнетушитель ОУ-5




Ауаны сергітуші                  Освежитель воздуха




Жуылатын аяқ киім                Обувь моющаяся




Жуылатын аяқ киім                Обувь моющаяся
Ағартқыш                       Отбеливатель




Дәнекерлейтін аспап            Паяльник




Монтаж қӛбігі                  Пена монтажная




Диэлектрикалық қолғаптар       Перчатки диэлектрические




Плашкалар 1 дюйм               Плашки 1 дюйм




Плашкалар 1/5 дюйм             Плашки 1/5 дюйма




Плашкалар 3/4 дюйм             Плашки 3/4 дюйма




Пленка ПИЛ                     Пленка ПИЛ




Мақта-мата орамал              Полотенце хлопчатобумажное




Подшипник                      Подшипник




Пышақтық мата                  Полотно ножовочное




Қір жуатын ұнтақ               Порошок стиральный




М/м қолғаптар                  Перчатки х/б




Шаруашылық резеңке қолғаптар   Перчатки хозяйственные резиновые




Еріткіш                        Растворитель




Аммиак ерітіндісі              Раствор аммика
Бриллиантты жасыл ерітіндісі 1%   Раствор бриллиантового 1%




Йод ерітіндісі                    Раствор йода




Қол сүргі                         Рубанок




Қолғаптар                         Рукавицы




Резеңке жең                       Рукав резиновый




Резеңке жең                       Рукав резиновый




Майлықтар                         Салфетки




Біржолғы майлықтар                Салфетки разовые




d-3,2 мм ӛзіндігінен кескіш       Саморез d-3,2 мм




Бұрғылар                          Сверла




Майлау вакуумдық                  Смазка вакуумная




Ваннаға арналған қоспалауыш       Смеситель для ванной




Қалақ                             Совок




Арнайы аяқкиім                    Спецобувь




Құрғақ хлорка                     Сухая хлорка




Суық су есептеуіш                 Счетчик холодной воды
Пластмассты шара 10 л              Таз пластмассовый 10 л




Пластмассты шара 5 л               Таз пластмассовый 5 л




Термометр                          Термометр




Әжетхана қағазы                    Туалетная бумага




Иіс сабын, 100г                    Туалетное мыло, 100 г




Кір сабын                          Хозяйственное мыло




Активтенген кӛмір таблеткалар      Уголь активированный таблетки




Булы үтік                          Утюг паровой




Хладон 22                          Хладон 22




Швабра                             Швабра




Оттегі шлангы                      Шланг кислородный




Резеңке шланг                      Шланг резиновый




Резеңке шланг                      Шланг резиновый




Шприц                              Шприц




Белдемше                           Фартук




Унитаздарды тазартуға арналған зат Чистящее средство для унитазов (400 г)
(400 г)
Ыдыстарды тазартуға арналған зат   Чистящие средства для посуды 400 г
400 г



Кӛлік құралдары йелерінің          Страхование гражданско-правовой
азаматтық- құқықтық                ответственности владельцев
жауапкершілігін сақтандыру         автотранспортных средств
Деректеме карточкаларын жасау      Услуги по изготовлению визиток
бойынша қызмет



Ұйым стандартын сараптау           Услуги по экспертизе стандарта
бойынша қызметтер                  организации



Мұздату камерасы                   Морозильная камера




Баллонды ацетиленмен толтыру       Услуги по заправке баллона ацетиленом
бойынша қызметтер

Қалдықтар тӛлқұжатын жасау         Услуги по составлению паспорта отходов
бойынша қызметтер



Тальксіз қолбақтар                 Перчатки безтальковые



Медициналық қаттау                 Халат медицинский




Аяққабы                            Бахилы



Бір жолғы қолдануға медициналық    Одноразовые халаты медицинские
қаттаулар

Праймер                            Праймер



Праймер                            Праймер



Праймер                            Праймер



Праймер                            Праймер



Праймер                            Праймер



Праймер                            Праймер



Праймер                            Праймер



Праймер                            Праймер
Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Праймер                  Праймер



Натрий додецилсульфаты   Додецилсульфат натрия



Праймер                  Праймер



Праймер                  Праймер



Глицерол                 Глицерол



Агароза                  Агароза



Тез ерігіш агароза       Агароза легкоплавкая
4 (2 Гидроксиэтил) 1 пиперазин этан 4 (2 Гидроксиэтил) 1 пиперазин этан
сульфон қышқылы                     сульфоновая кислота

Имидазол                            Имидазол



5-бром-4хлор-Зиндолил-|3-В-         5-бром-4хлор-Зиндолил-|3-В-
галактопиранозид                    галактопиранозид

Изопропил-β-D-1-                    Изопропил-β-D-1-тиогалактопиранозид
тиогалактопиранозид



Тұтас қаннан ДНҚ- ны бӛлуге         Набор для выделения ДНК из цельной
арналған жиынтық                    крови

ПТР ӛнімін тазалау үшін жиынтық     Набор для очистки ПЦР-продуктов



Аз мӛлшердегі үлгіден геномды       Набор для выделения геномной и
және митохондриалық ДНҚ бӛлу        митохондриальной ДНК из небольшого
үшін жиынтық                        количества образца
Сірнеден ДНҚ-ны экстракциялау       Набор для экстракции ДНК из геля
үшін жиынтық



GC бай аймақтарды                   Набор для амплификации GC-богатых
амплификациялауға үшін жиынтық      участков

Ыстық стартпен ДНҚ-плюс             ДНК - плюс полимераза с горячим
полимеразасы                        стартом



Амплификациядау үшін жиынтық        Набор для амплификации



Дезоксинуклеотидтрифосфат           Cмесь дезоксинуклеотидтрифосфатов
(дНТФ) қоспасы                      (дНТФ)

Цервикальді каналдан жағындыны      Щеточка для забора мазков из
жинауға арналған щеткасы            цервикального канала

Вакуумды қан жинау үшін түтік       Пробирка для вакуумного забора крови



ПТР үшін микротүтіктер              Микропробирки для ПЦР



Eppendorf типтес микротүтіктер      Микропробирки типа Eppendorf



Микротүтіктер                       Микропробирки



Лаборантқа арналған контейнер -     Контейнер-сумка для лаборанта
сӛмке

А класы медициналық қалдықтарды Бак для сбора и хранения медицинских
жинау мен сақтау үшін бак       отходов класса А

Бір жолғы қолданылған құралдарды    Контейнер РР для сбора
жинау үшін РР контейнер             использованного одноразового
                                    инструмента
Сүзгімен ұштықтар                   Наконечники с фильтром
Сүзгімен ұштықтар                   Наконечники с фильтром



Сүзгімен ұштықтар                   Наконечники с фильтром



Ұштықтар                            Наконечники



Ұштықтар                            Наконечники



Ауыспалы кӛлемді тамызғыш -         Пипетка-дозатор переменного объема
мӛлшерлеуіш

Ауыспалы кӛлемді тамызғыш -         Пипетка-дозатор переменного объема
мӛлшерлеуіш

Ауыспалы кӛлемді тамызғыш -         Пипетка-дозатор переменного объема
мӛлшерлеуіш

Ауыспалы кӛлемді тамызғыш -         Пипетка-дозатор переменного объема
мӛлшерлеуіш

Ауыспалы кӛлемді тамызғыш -         Пипетка-дозатор переменного объема
мӛлшерлеуіш

Ауыспалы кӛлемді тамызғыш -         Пипетка-дозатор переменного объема
мӛлшерлеуіш

Әткеншек абақ                       Штатив-карусель



Техникалық тӛлқұжатты беруімен      Услуги по проведению инвентаризации
түгендеуді ӛткізу бойынша           (государственное техническое
қызметтер (мемлекеттік техникалық   обследование) с выдачей технических
тексеру)                            паспортов

Баллонды ацетиленмен толтыру        Услуги по заправке баллона ацетиленом
бойынша қызметтер

Баллонды оттегімен толтыру          Услуги по заправке баллона кислородом
бойынша қызметтер

Артқы түбірлі подшипник             Задний коренной подшипник




Автошиналар                         Автошины




Клапан қақпақтарының аралық         Прокладки клапанных крышек
қабаттары



От алдыру білтесі                   Свечи зажигания




Жылу радиаторы                      Радиатор отопления
Жылу желдеткіш                    Вентилятор отопления




Беріліс ауыстыру қорабшасы        Коробка перемены передач




Ажырату дискі                     Диск сцепления




Резеңке түтікшелердің жиыны       Комплект резиновых патрубков




Салоның жылытқышына арналған      Резиновые патрубки на отопитель салона
резіңке түтікшелер



6СТ90 аккумуляторы                Аккумулятор 6СТ90




Артқы белдігі бәсендеткішінің     Сальник хвостовика редуктора заднего
артқы ілмек сальнигі              моста



Ауа сүзгіш                        Фильтр воздушный




Май сүзгіші                       Фильтр масляный




Генератор жетегінің және помпаның Ремни привода генератора и помпы
белбеулері



Құйылыс жүйенің шүмегі            Кран сливной системы




Мәреші                            Стартер




Шыны тазартушының жетегі          Привод стеклоочистителя




Шыны тазартушының щеткасы         Щетки стеклоочистителя




Тосол                             Тосол




Б.А.Қ. және артқы белдігіне       Масло трансмиссионное в К.П.П. и
трансмиссионды май                задний мост
Қозғалтқышқа май                    Масло для двигателя




Тіркеуш-папка                       Папка-регистратор




«Қазақстан Республикасы             Услуги по изготовлению брошюры
Заңдарының жобалары «Гендік-        "Проекты Законов Республики Казахстан
инженерлік іс-әрекеттерін           "О государственном регулировании
мемлекеттік реттеу туралы»,         генно-инженерной деятельности", "О
«Қазақстан Республикасының кейбір   внесении изменений и дополнений в
заңнамалық актілеріне гендік-       некоторые законодательные акты
инженерлік іс-әрекеттерін           Республики Казахстан по вопросам
мемлекеттік реттеу мәселелері       государственного регулирования генно-
бойынша ӛзгерістер мен              инженерной деятельности"
толықтырулар енгізу туралы»
кітапшаны жасау бойынша
қызметтер

Қалдықтарды кәдеге жарату           Услуги по утилизации отходов
бойынша қызметтер



Автомат                             Автомат




Автомат                             Автомат




Автомат                             Автомат




Автомат                             Автомат




Автомат                             Автомат




Автомат                             Автомат




Автомат                             Автомат




Шырақ                               Светильник




Шырақ                               Светильник




Шырақ                               Светильник
Электр шамы               Электролампа




Электр шамы               Электролампа




Жарықтандыру қалқаншасы   Щиток освещения




Жарықтандыру қалқаншасы   Щиток освещения




Жарықтандыру қалқаншасы   Щиток освещения




Ажыратқыш                 Рубильник




Трансформатор             Трансформатор




Стартер                   Стартер




Стартер                   Стартер




Шам                       Лампа




Шам                       Лампа




Шам                       Лампа




Айыры                     Вилка




Розетка                   Розетка




Розетка                   Розетка




Айырғыш                   Выключатель
Қызу шамы                     Лампа накаливания




Қызу шамы                     Лампа накаливания




Лента                         Лента




Кабель каналы                 Кабельный канал




Агар-агар                     Агар-агар



Азот қышқылы                  Азотная кислота



Алюминий оксиді               Алюминий оксид



Дәрі қобдиша                  Аптечка



Бахилалар                     Бахилы



Медициналық бинт              Бинт медицинский



Крафт қағазы                  Бумага Крафт



Жуғыш бӛтелкесі               Бутыль промывалка



Шүмекті бӛтелкесі             Бутыль с краном



Вазелин майы                  Вазелин масло



Жағындыларды бояу үшін ыдыс   Ванночка для окрашивания мазков



Зертханалық ұрасы             Воронка лабораторная



Гексан                        Гексан



Глицин                        Глицин



Глюкоза                       Глюкоза



Деохлор                       Деохлор



Ашытқы сығынды                Дрожжевой экстракт
Бӛтелке үшін ысқы              Ерш бутылочный



Түтік үшін ысқы                Ерш пробирочный



Азық-түлік желатин             Желатин пищевой



Кристалды йод                  Йод кристаллический



Тамызғыш - мӛлшерлеуіш         Капельница-дозатор



Жұмыр шыны жазық түпті         Колбы круглые плоскодонные



Тікбұрышты астаушық            Кювета прямоугольная



Тікбұрышты астаушық            Кювета прямоугольная



Ұлғайтқыш лупа                 Лупа с увеличением



Дәке                           Марля



Бір-жолғы бетперделер          Маски одноразовые



Медициналық мақта              Медицинская вата



Медициналық қолғаптар          Медицинские перчатки



Медициналық қолғаптар (ұзын)   Медицинские перчатки (длинные)



Бір каналды мӛлшерлеуіш үшін   Наконечники для дозаторов
ұштықтар                       одноканальные

Азот қышқылды натрий           Натрий азотнокислый



Фосфор қышқылды натрий         Натрий фосфорнокислый



Фосфор қышқылды натрий         Натрий фосфорнокислый



Бактерицидті сәулелеуші        Облучатель бактерицидный



Парафин                        Парафин



Пипетатор                      Пипетатор



Цангты ілмек ұстағыш           Петледержатель цанговый
Бактериологиялық ілмек             Петля бактериологическая



Бактериологиялық ілмек             Петля бактериологическая



Тамшуыр                            Пипетка



Тамшуыр                            Пипетка



Тамшуыр                            Пипетка



Үлдір                              Пленка



Биологиялық түтіктер               Пробирки биологические



Қорғаныш кӛзілдірігімен демалғыш   Респираторы с защитными очками



Зертханалық стакан                 Стакан лабораторный



Зертханалық стакан                 Стакан лабораторный



Жамылғы шынылар                    Стекло покровное



Заттық шыны                        Стекло предметное



Құрғак қоректік агар               Сухой питательный агар



Құрғақ қоректік сорпа              Сухой питательный бульон



Термометр                          Термометр



Термометр                          Термометр



Термометр                          Термометр



Кӛмір активте ҚАК                  Уголь активированный БАУ



Ферум хлорі                        Ферум хлор



Майсыздандырылған сүзгіштер        Фильтры обезжиренные



Майсыздандырылған сүзгіштер        Фильтры обезжиренные



Майсыздандырылған сүзгіштер        Фильтры обезжиренные
Ақ қаттаулар                  Халаты белые



Хлороформ                     Хлороформ



Кептіргіш табақша             Чашка выпарительная



Петри табақшасы (шыны)        Чашки Петри (стекло)



Бір -жолғы телпек             Шапочки разовые



Компьютер                     Компьютер




Үздіксіз қуат кӛзі            Источник бесперебойного питания




Батарейка                     Батарейка




Жұмысшыларды міндетті         Услуги по обязательному медицинскому
медициналық тексеру бойынша   осмотру работников
қызметтер
"Параграф" мәліметтік жүйесіне      Услуги по доступу к информационной
қатынау бойынша қызметтер           системе "Параграф"

Жұмыс берушінің азаматтық           Страхование гражданско- правовой
құқықтық жауапкершілігін            ответственности работодателя
сақтандыру
Санитарлық-эпидемиологиялық         Услуги по санитарно-
сараптау бойынша қызметтер          эпидемиологической экспертизе




ЛД-40, ЛБ-40 шамдарды кәдеге        Услуги по утилизации ламп ЛД-40, ЛБ-
жарату бойынша қызметтер            40



КӚ - 5 ӛрт сӛндіргіштерді қайта     Услуги по зарядке огнетушителей ОУ - 5
толтыру бойынша қызметтер



Электрлік тельферді куәландыру      Услуги по освидетельствованию
бойынша қызметтер                   электрического тельфера



Жүкті тасымалдау бойынша            Услуги по грузоперевозке
қызметтер




Бензин                              Бензин




Ғылыми-зерттеу есептерін түптеу     Услуги по переплету научно-
бойынша қызметтер                   исследовательских отчетов

Chevrolet Epica автокӛліктерге      Услуги по техническому обслуживанию
техникалық қызмет кӛрсету, 2006     автомашины Chevrolet Epica, 2006 г.в.,
ш.ж., кузов нӛмірі                  номер кузова K111A691J6B017400,
K111A691J6B017400, 115/156          115/156, квт/лс на базе и оборудовании
квт/лс, ӛнім берушінің базасы мен   поставщика
жабдықтарында
Моторлық майы (ІТД)                 Масло моторное (ДВС)




Автомобильды қатпайтын әйнек      Автомобильная незамерзающая
жуатын сұйықтық (қатпағыш) иіссіз стеклоомывающая жидкость
                                  (незамерзайка) без запаха

Мұз және қардан автокӛлікті тазалау Щетка со скребком для чистки кузова
үшін қырғышпен щеткасы              автомашин от снега и льда
ИСО 9001-2009 ҚР СТ сәйкес сапа   Услуги по разработке и внедрению
менеджментінің жүйесін (СМЖ)      системы менеджмента качества (СМК) в
ендіру және әзірлеу бойынша       соответствии со СТ РК ИСО 9001-2009
қызметтер




"Кіріс құжат" штампын жасау       Услуги по изготовлению штампа
бойынша қызметтер                 "входящий документ"



Капсула толтыратын машина         Капсулонаполняющая машина




Жапсырмаларды басып шығару        Печать этикеток




Андатпаларды ламинирлеу бойынша Услуги по ламинированию аннотаций
қызметтер



Баннерлерді жасау бойынша         Услуги по изготовлению баннеров
қызметтер



Деректеме карточкаларын жасау     Услуги по изготовлению визиток
бойынша қызметтер



Андатпаларды жасау бойынша        Услуги по изготовлению аннотаций
қызметтер



Бланкты ӛнімдерді жасау бойынша   Услуги по изготовлению бланочной
қызметтер                         продукции
Бланкты ӛнімдерді жасау бойынша   Услуги по изготовлению бланочной
қызметтер                         продукции



2011 жылға мерзімдік баспасӛз     Периодические издания на 2011 год
басылымдар

2011 жылға мерзімдік баспасӛз     Периодические издания на 2011 год
басылымдар

2011 жылға мерзімдік баспасӛз     Периодические издания на 2011 год
басылымдар

2011 жылға мерзімдік баспасӛз     Периодические издания на 2011 год
басылымдар

2011 жылға мерзімдік баспасӛз     Периодические издания на 2011 год
басылымдар

2011 жылға мерзімдік баспасӛз     Периодические издания на 2011 год
басылымдар

Қағазды орамал                    Бумажные полотенца




Қағаз майлық                      Бумажные салфетки




Әйнек жуғыш құрал                 Моющее средство для стекла




Ыдыс жуғыш құрал                  Моющее средство для посуды




Унитаз жуғыш құрал                Чистящее средство для унитаза




Иіс сабын                         Туалетное мыло




Шаруашылық сабыны                 Хозяйственное мыло




Кір жуу ұнтағы                    Стиральный порошок




Ағартқыш                          Отбеливатель




Қоқысқа арналған қап              Мешки для мусора




Әжетхана қағазы                   Туалетная бумага
Сұйық сабын              Жидкое мыло




Полироль                 Полироль




Бір -жолғы пакет-майка   Одноразовые пакеты - майка




Ауа сергіткіш            Освежитель воздуха




Шам                      Лампа




Қолғап                   Перчатки




Швабра                   Швабра




Сыпыртқы                 Веник




Пленка                   Пленка




Күрек                    Лопата




Шелек                    Ведро




Қалақ                    Совок




Кетпен                   Мотыжка




Тырмауыш                 Грабли




Су сепкіш                Лейка




Шапқы                    Тяпка
Техникалық мата                Ткань техническая




Суға арналған бак              Бак для воды




Шланг                          Шланг




Арнаулы киімі                  Спецодежда




Кеңсе, қоқыс үшін кәрзеңкесі   Корзина для мусора, офисная




Ауыз су                        Питьевая вода




Қағаз А4                       Бумага А4




Жазу қағазы                    Бумага писчая




Қалам шарикті                  Ручка шариковая




Қалам шарикті                  Ручка шариковая




Қалам шарикті                  Ручка шариковая




Қалам гелді                    Ручка гелевая




Қалам гелді                    Ручка гелевая




Жапсырма файл                  Вкладыш файл




Папка құлыппен                 Папка с замком
Папка файлдарымен             Папка с файлами




Құжат тігілетін папка         Скоросшиватель




Сызғыш                        Линейка




Жалпы дәптер                  Общая тетрадь




Жалпы дәптер                  Общая тетрадь




Дәптер                        Тетрадь




Маркер                        Маркер




Маркер                        Маркер




Маркер                        Маркер




Қағаз қыстырғыш               Скрепки




Қағаз қыстырғыш түрлі түсті   Скрепки цветные в подставке
тұғырықта



Кеңсе желімі                  Клей канцелярский




Қарындаш жәй                  Карандаш простой




Қайшы                         Ножницы




Ӛшіргіш                       Ластик




Кітап тіркеуш                 Книга регистрации
Түрлі түсті қарындаштар жиынтықта Карандаши в наборе цветные




Степлер                           Степлер




Степлер                           Степлер




Степлер                           Степлер




Степлер үлкен 100 параққа         Степлер большой на 100 лист




Папка резеңкемен                  Папка на резинке




Қағаз қысқышы                     Зажим для бумаг




Қағаз қысқышы                     Зажим для бумаг




Бетбелгі                          Закладки




Бетбелгі                          Закладки




Желімдегіш қағаз блогы            Блок бумаги самоклеющейся




Жіп арқан                         Шпагат




Түзеткіш                          Корректор




Күнделік                          Ежедневник




Тіркеу кітабы торлы қатты         Книга учета (клетка) с твердой обложкой
мұқабасымен



Тіркеу кітабы торлы қатты         Книга учета (клетка) с твердой обложкой
мұқабасымен
Қойма тіркеу кітабы               Книга складского учета




Тіркеу кітабы                     Книга учета




Құжаттарды тіркеу кітабы          Книга регистрации документов




Пышақ кеңсе                       Нож канцелярский




Пышақ кеңсе                       Нож канцелярский




Құжат тігілетін папка             Папка-скоросшиватель




Факс пленкасы Panasonic KX-FT 902 Пленка для факса Panasonic KX-FT 902




Конверт                           Конверт




Флешка                            Флешка




Калькулятор                       Калькулятор




Конверт                           Конверт




Құжат тігілетін папка             Скоросшиватель




Факс қағазы                       Бумага для факса




Мәтін маркері                     Маркер текстовой




Құжат тігілетін папка             Папка скоросшиватель




Папка конверт                     Папка конверт
Столүстілік жиынтық         Настольный набор




Столүстілік жиынтық         Настольный набор




Қойма дәптері               Блокнот




Папка планшет               Папка планшет




Телефон үшін қойынкітапша   Записная книжка для телефонов




Сүзгіш торлы                Фильтр сетевой




Фольга                      Фольга




Жұмыс берушінің азаматтық   Страхование гражданско- правовой
құқықтық жауапкершілігін    ответственности работодателя
сақтандыру
  Краткая характеристика (описание) товаров, работ и услуг (на государственном языке)




                                             11
АИ 93 (92) этилденбеген. Талондық жүйе арқылы.
ЖҚС қайсысында талон иесі бензинді алу құқылы:
1. Астана қ. (5 ЖҚС кем емес);
2. Ақмола облысында Степногорск қ. (1 ЖҚС кем емес);
3. Ақмола облысында Астана қ. - Степногорск қ. Жолы бойынша (1 ЖҚС кем емес)
орналасқан болу тиіс.


АИ 96 (95) этилденбеген. Талондық жүйе арқылы.
ЖҚС қайсысында талон иесі бензинді алу құқылы:
1. Астана қ. (5 ЖҚС кем емес);
2. Ақмола облысында Степногорск қ. (1 ЖҚС кем емес);
3. Ақмола облысында Астана қ. - Степногорск қ. жолы бойынша (1 ЖҚС кем емес)
орналасқан болу тиіс.


байланыс жылдамдығы – 1024 кб/с, шексіз трафик. ІР 4 адрестер бойынша блок жалдау




Дисктегі орны– 3 Gb, почта жәшіктерінің саны - 100 дн. кем емес, екінші дәрежедегі домендер-
3 дн. кем емес, FTP-аккаунттер - 5 дн. кем емес, MySQL деректер базасы, басқару панелі
(cpanel), MySQL базаның орнына - 100 Мб кем емес

1. "Верс-16ПК" бақылау- қабылдау құралын жұмысқа қабылеттілігін бақылау - 1 дн., 2. Ӛрт
хабарлағыштарды (түтінді ИП 212-45, ИП 212-41М, жылу ИП 101-1А) үрлеу арқылы бақылау
және жұмыс күйінде сақтау - 75 дн., 3. "Маяк-12КП" дабылды бақылау және жұмыс күйінде
сақтау- 7 дн. 4. "ШЫҒУ" жарық таблоның күйін сыртқы тексеру-7 дн. 5. ИПР - 514-2 қолдық ӛрт
хабарлағыштарды бақылау және жұмыс күйінде сақтау- 6 дн. 6. Жұмысқа қабылеттілігіне
тексеру арқылы ӛрт сӛндіру сигналдама жүйесін бақылау (қолдық немесе түтін шымылдық
арқылы)- әр қабат бойынша, іріктеп тексеру- 4 қабат. 7. РВ 12-7.0 аккумуляторлы батареяны
техникалық тексеру -1 дн.




40 адам/сағат жұмысы
Астана қ. Уәлиханов кӛш., 13/1 мекен-жай бойынша орналасқан әкімшілік ғимаратты мен
іргелес аумағын вахталық күзету. Формалы киіммен, резиналық таяғымен, рациясымен және
белгіленген үлгідегі куәлігімен дене күзету.

Жалпы кӛлемі 1416,20 ш.м. Астана қ. Уәлиханов кӛш., 13/1 мекен-жай бойынша орналасқан
ғимаратындағы бӛлмелерді дератизациялау (химиялық жолмен бӛлмелерді кеміргіштерден
ӛндеу)

Жалпы кӛлемі 1416,20 ш.м. Астана қ. Уәлиханов кӛш., 13/1 мекен-жай бойынша орналасқан
ғимаратындағы бӛлмелерді, және оған іргелес жатқан аумақты жинау



Энергия жабдықтаушы ұйымының белгіленген ережелеріне сәйкес жылу энергиясын есепке
алатын приборлардың кӛрсеткішін алуы және тапсырылуы әр ай сайын ӛткізіледі




Құжаттарды, хаттарды, пакеттерді және т.т. әр түрлі кӛлікпен халықаралық және ішкі экспресс
жеткізу қызметтері



Контейнерлерден қатты-тұрмыстық қалдықтарды кӛлікпен шығару және олардың кейінгі кәдеге
жарату



картрижді толтыру, принтерлерді жӛндеу, картридждерді жӛндеу




• Екі қосылу нүктесі;
• Екі ресиверді жалдау



Пішімі С4 жұлмалы лентамен




Озондалган, асханалық, газдалмаған, ауыз суы. Полимерлік ыдыста сыйымдылығы 19 л. Ыдыста
(шишада) 18,9 л су бар. ҚР СТ 1432-2005 «Табиғи минералды асханалык ауыз суды қоса алғанда,
ыдыстарға құйылған ауыз су сулары. Жалпы техникалық шарттар.»



Автокӛліктің агрегаттары мен түйіндерін диагностика ӛткізуімен № 6 техникалық тексеру, 5/40
мотор майы 4 л кӛлемдегі канистрада 1 канистра мӛлшерінде оның ауыстыруымен,
трансмиссиялық майы 1 л кӛлемдегі канистрада 2 канистра мӛлшерінде оның ауыстыруымен,
жасыл антифриз 5 л кӛлемдегі канистрада 1 канистра мӛлшерінде оның ауыстыруымен, отын
сүзгіш оның ауыстыруымен (кепілдік 19 500 км қашықтыққа), ауа сүзгіш оның ауыстыруымен
(кепілдік 19 500 км қашықтыққа), май сүзгіш оның ауыстыруымен (кепілдік 5 500 км
қашықтыққа). Сүзгіштер және майлар DAEWOO Nexia Gle (VIN XWB3L32BD8A010728) жеңіл
автокӛлік үшін болуы тиіс.


Шартты жасасқан сәтінен бір айдан кӛп емес мерзімнің ішінде жұмыс күндері (дүйсенбі - жұма)
Тапсырыс берушінің базасында курстар ӛткізілуі тиіс. Дәрістер сағат 17:00 ерте басталмауы
және сағат 19:00 кеш бітпеуі тиіс. Оқыту орыс тілінде ӛнеркәсіптік қауіпсіздік саласындағы
уәкілетті органмен немесе оның аумақтық бӛлімшемен келісілген бағдарламасы бойынша
жүргізілуі тиіс. 40 академиялық (оқу) сағаттан кем емес оқытуды бағдарлама қамтуға тиіс.
Тапсырыс берушінің базасында емтихандарды қабылдауды қамсыздандыру. Курстар біткеннен
кейін емтихандарды тапсырған адамдарға ыдыстармен қызмет кӛрсетуге құқығын беретін
куәліктері берілуі тиіс. Тыңдаушылардың саны 7 адам.
АА, LR 6, 1,5 V, жарамдылық мерзімі 2012 ж. ерте емес




ААА, LR 03, 1,5 V, жарамдылық мерзімі 2012 ж. ерте емес




ПВХ материалынан, түсі ақ, екі деңгейлі (жоғары деңгейі 50 ұяшыққа, тӛменгі деңгейі 50
ұяшыққа) габарит кӛлемі (см) 150*20*10,5 (ұзындығы, бийіктігі, тереңдігі) ПВХ сыртқы
қаңқасының қалыңдығы 8 мм, ұяшықтың кӛлемі (см) 2,5*7*9 (жалпақтығы*биіктігі*тереңдігі)
ПВХ ұяшықтың аралығының қалыңдығы 0,3 мм, деңгей аралығының планкасының биіктігі 4 см,
калыңдығы 8 мм. Саны - 1 жәшік

ЛДСП - материалынан, 16 мм қалыңдығы, жиегі 0,4 мм ПВХ, габаритті кӛлемі (мм)
1400*600*750 (ұзындығы*жалпақтығы*биіктігі), үстел бетінде тесік 45-50 д. саны 50 дн.
горизонталь 5 қатар 10 тесіктен (вертикаль 10 қатар 5 тесіктен) тесіктердің аралығы горизонталь
бойынша 20 мм, вертикаль бойынша 50 мм, тесіктердің астында контейнерлерді ұстап тұратын
сӛрелермен (мм) 55*810*600 (биіктігі*жалпақтығы*тереңдігі), 50 дана кабель ӛтетін
фурнитурамен, ЛДСП түсі тапсырыс берушінің келісімімен



Электроқозғағыштың орамасын қайтадан орау 5,5 кВт, 3000 ай/мин




Қоспалауыштың түрі бақалшық үшін, басқару түрі еківентельді, хромдалған латунь
материалынан корпусы, ұстайтын жері метал, серпігіш металлдан жасалған, букс кран керамика



Майысқақ, қоспалауышқа, металлмен қапталған ұзындығы 0,5 м




Канализациялық, ПВХ 50 мм д. тығыздалған




Канализациялық, ПВХ 50 мм д.




Канализациялық, ПВХ 50 мм д. тығыздалған




Канализациялық, ПВХ 50 мм д. тығыздалған




Канализациялық, ПВХ 50 мм д. тығыздалған




Канализациялық, ПВХ 50 мм д. тығыздалған




Канализациялық құбырларға ПВХ 50 мм д.




Су құбырына, салқын су үшін ПВХ 20 мм д.
Су құбырына, ыстық су үшін ПВХ 20 мм д.




Су құбырына ПВХ 20 мм д.




Су құбырына ПВХ 20 мм д.




Су құбырына ПВХ 20 мм д.




Су құбырына ПВХ 20 мм д.




Су құбырлар үшін ПВХ 20 мм д.




ПВХ 20 мм д.




Суда, буда жұмыс жасау, корпусы латуннан жасалған, ұстайтын жері маховик, жалғау түрі F-F,
130 температураға дейін жұмыс жасайды, 20 бар қысым, д. 20 мм



кнопкалы, бүйірінде қалтқысымен, жинақтағы




Құрастырма, пластик - болат тотықпайтын




Пластик ұзындығы 70 см тӛмен емес




Пластик ұзындығы 45 см тӛмен емес




Түсі ақ, керамика, тұтас құйылған, су әкелуі сыртқы, шығарылым астыға тетік үшін тесікпен,
сифонмен



ЛДСП материалынан, 16 мм қалыңдығы, жиегі 2 мм ПВХ, габаритті кӛлемі (мм) 850 х 600 х 750
(ұзындығы х жалпақтығы х биіктігі), үстел бетінде техникалық тесік д. 50 мм., ЛДСП түсі
тапсырыс берушінің келісімімен. Үстелдердің саны - 7 дн.

ЛДСП – материалынан, қалыңдығы 16 мм., ПВХ 2 мм жиегі, габаритті кӛлемі (мм) 1100 х 600 х
750 (ұзындығы х жалпақтығы х биіктігі), үстел бетінде техникалық тесікшесімен диаметрі 50
мм., доңғалақшасымен бағыттайтын 3 жәшікті тумба, әр жәшікте бұранда құлыпымен,
клавиатураға арналған, доңғалақшасымен бағыттайтын сӛре, ЛДСП түсі тапсырыс берушінің
келісімімен. Үстелдердің саны - 1 дн.

Габариттері: үстел кӛлемі (жалпақтығы/тереңдігі/биіктігі): 54/55/81 см, нетто салмағы: 6,65 кг.,
боялған рама (күңгірт) қабырға қалыңдығы 1,2 мм. «В» сериясынан қара сұр түсті мата
Абоненттік тӛлем
(Қалалық телефон нӛмірі) — 20 дана;
Интернетке коммутация жасаушы қол жетім;
Қалааралық сӛйлесулер (ҚР);
Халықаралық сӛйлесулер;
Тӛлемді анықтама;
Басқа да қызметтер ҚТБ (ТҚТ);
Ұялы операторлар желілерінде сӛйлесулер 



А-4 форматтағы журнал: офсетті баспа, кӛлемі - 28 баспа бет; бет қағазы - жылтыр, борлы,
тығыздығы - 300 г/м; түсі 4+4; ішкі жағы - қағаз 80 г/м және борлы қағаз 170 г/м, 2,5 баспа
парақ; түсі - 4+4; бет қағазды ламинаттау арқылы әшекейлеу. Түптеу - терможабыстыру. Басылу
кезеңінде оптикалық тығыздығына, бояудың жайылуы, растрлық элементтер кӛлемі, "сұрғылт"
теңдігі, түс ӛңінің ауытқуына (ахроматикалық) қатаң деситометрлік бақылау. Сигналды нӛмірді
даярлау - 3 күн. Тапсырыс берушінің сигналды үлгіні қарауы - 2 күн. Бекітілген нӛмірдің шығу
мерзімі - 5 күн. Нәмірдің саны тапсырыс берушінің сұранымы бойынша анықталады. Жылдық
жалпы саны - 800 дн.




Жерме контурын сынау, метал байланысын сынау, сымдардың және кабельдердің тежеу
кедергісін сынау, нӛль фазасы ілмектің қарсыластығын сынау, тапсырыс берушіге сынау актісі
мен хаттамасын ұсыну




Шартты жасасқан сәтінен 1,5 айдан кӛп емес мерзімнің ішінде дүйсенбі - жұма күндері
Тапсырыс берушінің базасында курстар ӛткізілуі тиіс. Дәрістер сағат 17:00 ерте басталмауы
және сағат 19:00 кеш бітпеуі тиіс. Оқыту орыс тілінде ӛнеркәсіптік қауіпсіздік саласындағы
уәкілетті органмен немесе оның аумақтық бӛлімшемен келісілген бағдарламасы бойынша
жүргізілуі тиіс. 40 академиялық (оқу) сағаттан кем емес және 60 академиялық (оқу) сағаттан кӛп
емес оқытуды бағдарлама қамтуға тиіс. Тапсырыс берушінің базасында емтихандарды
қабылдауды қамсыздандыру. Курстар біткеннен кейін емтихандарды тапсырған адамдарға
белгіленген нысанда курстарды ӛту туралы құжаттар берілуі тиіс. Тыңдаушылардың саны 6 адам.




Абоненттік тӛлем (Қалалық телефон нӛмірі) — 10 дана;
Қалааралық сӛйлесулер (ҚР);
Халықаралық сӛйлесулер;
Тӛлемді анықтама;
Ұялы операторлар желілерінде сӛйлесулер.

Түр: жолды-интерактивті (line-interactive),
Шығатын розеткалардың саны: 6 розетка;
Интерфейс: USB, RS-232;
Шығу күші: 1340 Ватт;
Телефондық/модемдік/желілік жолдарды
қорғау:
порт RJ-11/RJ-45 (біріктірілген);
Суық старт.
Кепіл мерзімі (ай): 12
Матрица түрі: TN+Film (TN), LED кӛмескі жарық
Қиғаш сызығы: 22"
Монитор форматы: 16:10
Кӛзі: 0.282 мм
Максималды ажыратылымдығы: 1680x1050
Максималды ажыратылымдығы кезіндегі тазалық: 60 Гц
Горизонталь/вертикаль бойынша экран шолуының бұрыштары: H:170/V:160
Жарықтығы: 250 кд/м2
Динамикалық қарама-қарсылық: 2000000:1
Үн қосу уақыты: 2 мс Кейіптеу түстері: 16.7 млн.
Қосылу интерфейсі: DVI, D-Sub, HDMI
Түсі: Қара Мультимедиасы: құлақшындар үшін алмалы-салмалы Қосымша: 2x HDMI Smart Auto
Bright
Дисплей қалындығы 20.5 мм
Кепіл мерзімі (ай): 12 



Клавиатура:
Түсі: Сұр, қара
Клавиатура түрі: ӛткізгішсіз, мультимедиялық Басқару түймесі: Play/Pause, Skip Backward, Skip
Forward, Mute, Vol+, Vol-
Тез рұқсат пернелер: Calculator,Home, Back, Forward, E-Mail, Messenger, Lock, F-Lock, жиі
пайдаланатын бейнесүреттерге, папкаларға, файлдарға және веб-беттерге рұқсаты үшін 5
қалпына келтірілетін пернелер, мини-қосымшаларды жіберу пернесі
Стандарттық пернелердің саны: 104
Қорек: AA типті 2 батарея
Интерфейс: USB
Тышқан:
Түсі: Сұр, қара
Тышқанның типі: ӛткізгішсіз лазерлі Максимальді рұқсат: 1000 dpi
Қорек: AA типті 2 батарея
Интерфейс: USB
Кепіл мерзімі (ай): 12



Линолеум коммерциялық, жалпы қалыңдығы 2 мм кем емес, тӛзімділік қабатының қалыңдығы
0,7 мм кем емес, ораманың жалпақтығы 3 м., ұзындығы 28 м., жалпы салмағы 2700 г/м 2,
абсолютті қалдық деформациясы 0,27 мм кем емес, сызықтық кӛлемнің тұрақтылығы 0,4 % кӛп
емес, жанғыштық тобы Г1, тұтанғыштық тобы В2, алау жаю тобы РП1, түтін шығару қабілеті
Д2, бетін жабу түсін тапсырыс берушінің келісумен



Еденге арналған, кӛлемі 300х300х8, керамика, су сіңіргіштігі 0,5 % кӛп емес, майыстырғанда
тӛзімділігінің шегі 35 Мпа кем емес, аязға тӛзімділігі саны 100 циклден кем емес, терең
қажалауына тӛзімділігі 150 мм3 кем емес, түсі тапсырыс берушінің келісімен

Еденге арналған, кӛлемі 300х300х8, сатыларға, керамика, су сіңіргіштігі 0,5 % кӛп емес,
майыстырғанда тӛзімділігінің шегі 35 Мпа кем емес, аязға тӛзімділігі саны 100 циклден кем
емес, терең қажалауына тӛзімділігі 150 мм3 кем емес, түсі тапсырыс берушінің келісімен

Еденге арналған, кӛлемі 400х400х9, керамика, су сіңіргіштігі 0,5 % кӛп емес, майыстырғанда
тӛзімділігінің шегі 35 Мпа кем емес, аязға тӛзімділігі саны 100 циклден кем емес, терең
қажалауына тӛзімділігі 150 мм3 кем емес, түсі тапсырыс берушінің келісімен

Кафельді, керамикалық плитка, кафель типтілердің барлығын қалау үшін, 1 мм қалыңдықта 1
кв. м. шығыны 1,3-1,5 кг., ерітінді қабаттың қалыңдығы 2 мм - 6 мм., ерітіндінің ӛмірге
қабілеттілігі 5-6 сағат, ашық жұмыс уақыты 20 мин., түзеу уақыты 20 мин., жік-жікті ысқылау 6-
8 сағат (қабырғада), 24 сағат (еденде), жұмыстың температурасы және желісі +5 ºС +30 ºС дейін,
айқасудың тӛзімділігі 0,8 Мпа, аязға тӛзімділігі 50 цикл, қап 25 кг

заңнамаға сәйкес



банк операциялары үшін комиссия, банкпен қызмет кӛрсету және басқа қызметтер
заңды тұлғаның жұмысы үшін құжаттарды нотариалды растау әрекеттері



іс-шаралар: кӛрмелер, семинарлар, конференциялар, кеңестер, форумдар, симпозиумдар,
тренингтер



Коммуникациялардың, тетіктердің, агрегаттардың, қосалқы бӛлшектердің және материалдардың
тасымал жолында тез арада қалпына келтіруді талап ететін істен шығуы




Ауыз су- 9761,94 куб. м., канализация - 9761,94 куб. м.



электроэнергияны сатып алу



жылу энергияны сатып алу



телефон байланысы және байланыс оператордың басқа қызметтері



Тәуліктік, жол жүру ақысы, тұру ақысы және басқа шығыстар



жай хаттар, бандерольдер, почта карточкалар



күзет құжаттарын беруге ӛтінімдер қабылдауды, оларды тіркеуді, ӛнеркәсіптік меншік
объектілеріне сараптама жүргізуді және оларға қатысушылар үшін құқықтар мен міндеттер
туындататын ӛзге де іс-әрекеттер




"Егемен Қазақстан" газеті-1 дн., "Казахстанская правда" газеті - 1 дн., "Справочник кадровика"
журналы- 1 дн., "В мире науки/Scientific" журналы- 1 дн., "Вечерняя Астана" газеті - 1 дн. ,
"Наука и техника-журнал для перспективной молодежи" журналы- 1 дн., "Научный мир
Казахстана" журналы - 1 дн.

Болат материалдарынан жасалған құбыр, кілттерге контейнер, корпус жабылатын қақпағымен
габаритті кӛлемі (мм) 100*40-45 (биіктігі*диаметрі), диаметрі 2 мм, тобустың жоғарғы бӛлігінде
екі тесігімен, мӛрмен мӛрлеуге арналған бау бүктелетін қақпақтар, алдын ала сыртын тегістеп,
контейнерді ПФ - 115 маркалы сырымен сырлау. Контейнерлердің саны -50 дн.



Металл/аллюминий - материал, басылым, кӛлемі (мм) 25*5-6 (диаметр*қалыңдығы) жұмыс
бӛлігінде 15 мм диаметрлі сақиналар дайындау, сақинаның ортасына 1 - ден 50-ге дейін
сандарды жазу, сақинаның сыртына 21-ге дейін мәтін жазу, басылымның арғы бетінде;
пайкіленген дӛңгелек стержень кӛлемі: (мм) 5*10 (диаметр*биіктігі) қабсырма үшін
үшбұрышты формадағы тесік кӛлемі: (мм) 7*7*7. Оттисктердің саны - 50 дн.

кӛлік құралдарының йелерінің АҚЖ, сақтандыру полисті беру, 3 авто кӛлік
Жобалар бойынша:
1 Адамның ісік жасушаларымен бірлесіп әрекет қылған ерекше пептидтердің және сальмонелл
аттенуирленген штамдардың негізінде қатерлі ісікке карсы препарат;
2 Адам ағзасында дәрілік препараттардың бағытталған тасымалдау жүйесін әзірлеу;
3 Адамның рекомбинантты цитокиндер - альфа ісік некрозды факторы, ангиогенин және
эритропоэтин негізінде жара айықтыратын препараттардың жаңа ұрпағын әзірлеу;
4. Инъекциясыз қолдану үшін жаңа ұрпақты микрокапсулалық вакциналарды әзірлеу;
5. Адамның эритропоэтиннің жаңа дәрігерлік нысаның клиникалық зерттеу;
6. Бенфорин (арНІФ-бета) және бета - Альнорин (арНІФ-альфа) және альфа некрозды ісік
рекомбинантты факторларының негізінде препараттарды клиникалық зерттеу;
7. Субдермалды күйіктерді емдеу үшін аллогенді эмбрионалды фибробластарды қолданылуымен
жасушалық терапияны қолданылуының әдістемелік негіздері.




Жобалар бойынша:
1. Адам ағзасында дәрілік препараттардың бағытталған тасымалдау жүйесін әзірлеу;
2. Адамның эритропоэтиннің жаңа дәрігерлік нысаның клиникалық зерттеу;
3. Онкологиялық зақымданулардың дамуының генетикалық маркерлердің кешенді талдауының
жүйесін әзірлеу.




"Адамның эритропоэтиннің жаңа дәрігерлік нысаның клиникалық зерттеу" жобасы бойынша




«Қайталамалы бедеу әйелдерде вирусты этиологиялар ахуалының иммунотапшы терапияларын,
алдын ала және диагностиканы жетілдіру үшін диагностикалық сынақтардың кешенін әзірлеу»
жобасы бойынша




Жобалар бойынша:
1. Бенфорин (арНІФ-бета) және бета - Альнорин (арНІФ-альфа) және альфа некрозды ісік
рекомбинантты факторларының негізінде препараттарды клиникалық зерттеу;
2. Субдермалды күйікті емдеу үшін аллогенді эмбрионалды фибробластарды жасуша
терапиясында қолданылуының әдістемелік негіздері.
Жобалар бойынша:
1. Интерлейкин-1β гені полиморфизмі және Helicobacter pylori вируленттік факторларының
негізінде адамдамның асқазанының қатерлі ісігінің дамуын болжау үшін кешенді сынақ-
жүйелерді әзірлеу;
2. Қазақстанның аумағының айналымында жүрген Mycobacterium tuberculosis
мультирезистенттігін анықтау үшін сынақ-жүйелерді әзірлеу;
3. Сифилистін диагностикасы үшін иммуноферменттік сынақ- жүйелерді әзірлеу;
4. Жұқпалы аурулардың диагностикасы үшін ДНҚ-чиптер;
5. Аусыл вирусының рекомбинатты құрылымдық емес ақуыздардың негізінде
иммуноферменттік диагностикалық сынақ- жүйелерін құру. 




Жобалар бойынша:
1. Урогенитальді індеттерді табу үшін диагностикалық сынақ- жүйелерді әзірлеу;
2. Вируссыз негізде Қазақстанда элиталық тұқымдарының ӛндірісіне технологияларды енгізу
және жоғары сапалы тұқымды материалды алу үшін аудандастырылған картоп сорттарын
клондау және биотехнологиясын сауығуын әзірлеу;
3. Ӛсімдіктерді тамыр шірігінен қорғайтын жәнеа ауыл шаруашылық
мәдениетінің шыбын-шіркей– зиянкестердін санын бақылау үшін биологиялық препараттарды
құру.
4. Биопрепараттардың әлеуетті белсенділігін жүзеге асыруын қамтамасыз ететін топырақ
сипаттарын және қолайлы параметрлерін анықтау негізінде, жанар-май майлау
материалдарымен ластанған топырақтарды қалпына келтіру әдістерінің оңтайландыру
тәсілдерін әзірлеу.



"Сифилистін диагностикасы үшін иммуноферменттік сынақ- жүйелерді әзірлеу" жобасы
бойынша




«Регенеративті медицина мақсаты үшін адамның перифериялық қанынан алынған,
культивтенетін бағаналы/прогениторлық жасушалардың (КС/ПК) иммунобиологиялық және
регенеративтік сипаттарын бағалау» жобасы бойынша




Жобалар бойынша:
1. Инсулин – продуциттелетін жасушаларға дифференцияланған адам жасушасының бағаналы
мезенхималдық микроинкапсуляциялаулардың тәсілдерін әзірлеу;
2. Жапырақтық тотына тӛзімді, бидайдың сорттарын және қарқынды кӛбейуінің нысандарын
және биотехнологиялық әдістерін құруын әзірлеу;
3. Қойлардың катаралдық безгегінің алдын ала емдеу және аса тиімді диагностика құралдарын
әзірлеу;
4. Түйелердің шешектерін және Ауески ауруларының қоздырғыштарын сәйкестендіру үшін ПТР
негізінде осы күнгі сынақ-жүйелерін құру;
5. Антиидитиптік иммуноглобулиндердің негізінде құтыру сынақ-жүйелерді әзірлеу.
Жобалар бойынша:
1. Адам жасушаларының бағаналық генетикалық индуцияланған эмбриональдығын алуының
жаңа технологиясы;
2. Гетерологиялық ақуыздың синтезінің жоғары тиімділігімен ӛсімдікдердің трансформаланған
жасушалалық жолдарын құру;
3. Иммуномодульдеуші медиаторлар және туберкулез қоздырғышының антигендерін
экспрессиялайтын, трансгенді ӛсімдікдерді алу технологиясын әзірлеу;
4. Адам фактор колониеынталандырмалы гранулоцит-макрофаг сүтіне секретиттеу және
синтездейтінге қабілетті трансгенді жануарларды шығару.




Жобалар бойынша:
1. Регенеративті медицина мақсаты үшін адамның перифериялық қанынан алынған,
культивтенетін бағаналы/прогениторлық жасушалардың (КС/ПК) иммунобиологиялық және
регенеративтік сипаттарын бағалау;
2. Топырақтың сорлануына жоғары тӛзімді генетикалық модификацияланған ӛсімдіктерді құру
биотехнологиясын әзірлеу.




"Молекулярлы-генетикалық маркерлер және ӛсімдіктер биотехнологиясы әдістерімен негізінде
жаздық жұмсақ бидайдың сұрыпын және құнды бастапқы материалын құру" жобасы бойынша




Жобалар бойынша:
1. Рапсты тұқым шаруашылығы және селекциялардың тиімділігін жоғарлату үшін
биотехнологияны пайдалану;
2. Экономикалық аса маңызды жеміс-жидек дақылдарының вироидтарын және вирустарын
анықтау вироидтарын айқындау үшін диагностикалық сынақ-жүйелерді әзірлеу;
3. Қазақстанның әртүрлі климаттық аймақтарында ӛндіру үшін перспективті күздік бидай
жолдарын алу технологиясын әзірлеу;
4. Солтүстік аймақтарға күріш егу үшін күріш сорттарының селекциясын жеделдетудің
биотехнологиялық әдістерін әзірлеу;
5. Отандық және шетелдік селекциялардың коммерциялық маңызды сорттардың таңдаулы
отырғызылатын ӛндірісі үшін раушан гүлдердің коллекциясын құру және раушан гүлдердің
биотехнологиялық клондауын әзірлеу;
6. Қазақстанның генетикалық қорларын тиімді қолдану, толтыру және сақтау үшін жемістік
ӛсімдіктерінің гермоплазма криогендік банкасын құру;
7. Жапырақтық тотына тӛзімді, бидайдың сорттарын және қарқынды кӛбейуінің нысандарын
және биотехнологиялық әдістерін құруын әзірлеу;
8. Жалпықуаттандырғыш әрекеттерін және антидиабетикалық арнайы диетикалық тағам
тамақтандыру және жана биологиялық белсенді қоспалардың биотехнологиясын алу;
9. Оңтүстік және Шығыс Қазақстанның азық-түлік белдемшелерін құру аймақтарында топырақ
ауыр металдарымен және пестицидтермен ластанған топырақтарды қалпына келтіру үшін
фиторемедиациялық технологиясын пайдалану. 

"Ауыл шаруашылық дақылдарын зиянкестерден қорғау үшін инсектицидті препаратты әзірлеу"
жобасы бойынша




Жобалар бойынша:
1. Аурулардың қоздырғыштарын микробтық кешенге қарсы ауыл шаруашылық дақылдарды
қорғауын тиімді құралдарын және жаңа экологиялық қауіпсіздігін әзірлеу
2. Полимеразды тізбекті реакциясында парамиксовирустық індеттерді және орто- үйлестірілген
және дифференциалды моно- диагностика үшін сынақ-жүйені ӛндіруін ұйымдастыру және
әзірлеу.
3. Бағытталған әрекеті жоғары тиімділік пробиотиктерді құру үшін лактобактериялар және
антибиотиктердің продуценттер-микророрганизмдер культураларының жаңа штаммдарын бӛлу
және сақтау.




"Азациклдер қатарынының індетке қарсы препараттардың жана молекулярлық әрлендіру"
жобасы бойынша




Жобалар бойынша:
1. Ірі қара малдың лейкозын диагностикасы үшін ПТР және ИФТ сынақ-жүйелерін әзірлеу;
2. Биотехнологиялық ӛндірісте қолдануда перспективті микроорганизмдердің жаңа штаммдарын
алу және сақтау;
3. Азық-түлік ӛнеркәсібі үшін тікелей енгізілетін сүтқышқылды ашытқыларды алу
технологиясын әзірлеу;
4. Пародонтитті алдын ала арналған биопрепаратты алу технологиясын әзірлеу;
5. Канализациялық құбырлардың май қалдықтарынан тазалау үшін перспективті
микроорганизмдердің коллекциясын құру.




Жобалар бойынша:
1. Ауыл шаруашылық жануарлардың эхинококкоздарын серологиялық жедел диагностикасы
үшін иммуноферментті сынақ- жүйесін әзірлеу;
2. Описторхозды иммуноферменттік диагностиканың тәсілдерін әзірлеу.
"Жоғары ӛнімді шошқа тұқымдары генофондын кеңейту және сақтау үшін жасушаларды
криоконсервациялау биотехнологиялық әдістерін пайдалану және әзірлеу" жобасы бойынша




Жобалар бойынша:
1. Биотехнологияда қолдану үшін оларды жаппай ӛсіру технологиясын ӛңдеу және
перспективалық балдырлар дақылдарын алу;
2. Целлюлозалық шикі заттан биоэтанол ӛндірісінде қолданылатын, ферменттерді алу үшін
генетикалық модификацияланған ағзаларда (про- және эукариот) целлюлозалық гендердің
жоғарылатылған мәнерлілігі және олардың клондау;
3. Әр түрлі микроорганизмдер түрлерінің композицияларының иммобилденген негізінде
канализациялық және ағынды суларды тиімді тазалау үшін жаңа полиспецификалық
биопрепараттарды құру.




"Сорлану жағдайында NaCl шоғырлаушылайтын, галофиттер тұқымдардың кӛктеуін жақсарту
үшін осмопротектантты пайдалану және бӛлу әдісі" жобасы бойынша




Жобалар бойынша:
1. Бидайдың сабақ тотаның аса қауіпті расаларына тӛзімді гендермен түйіндес, молекулярлы-
генетикалық маркерлер селекциясына енгізу және сәйкестендіру;
2. Молекулярлы–генетикалық әдістерді қолдануымен абиотикалық стерстік факторларға тӛзімді,
жұмсақ бидайдың жаңа сұрыптарын құру;
3. Күріштің ӛндірістік сұрыптарының таңдаулы тұқым шаруашылық тәжірибесіне
биотехнологиялық әдістерді енгізу және әзірлеу;
4. Қуаң жағдайларында ӛндеуге тӛзімділігі жоғары арпаның жаңа сұрып әзірлеу;
5. Жұмсақ бидай дәндерінің сапасын қалыптастырудың молекулярлы-генетикалық негіздері;
6. Соя геноқорын ұзақ сақтау және генотиптеу әдістерін селекциялық тәжірибеге енгізу және
әзірлеу;
7. ДНҚ-маркерлерді пайдалануымен арпа және бидай коммерциялық сұрыптарын генотиптеу.




"Геномның молекулярлы-генетикалық талдау әдістері және ӛсімдіктер биотехнологиясы әдістері
негізінде, Қазақстанның далалық аймақтарының құрғақшылдық жағдайларына тӛзімді, жаздық
жұмсақ бидайдың жаңа сұрыпын құру" жобасы бойынша
Жобалар бойынша:
1. Бидайдың сабақ тотаның аса қауіпті расаларына тӛзімді гендермен түйіндес, молекулярлы-
генетикалық маркерлер селекциясына енгізу және сәйкестендіру;
2. Қуаң жағдайларында ӛндеуге тӛзімділігі жоғары арпаның жаңа сұрып әзірлеу;
3. Күріштің ӛндірістік сұрыптарының таңдаулы тұқым шаруашылық тәжірибесіне
биотехнологиялық әдістерді енгізу және әзірлеу;
4. Жұмсақ бидай дәндерінің сапасын қалыптастырудың молекулярлы-генетикалық негіздері;
5. ДНҚ-маркерлерді пайдалануымен арпа және бидай коммерциялық сұрыптарын генотиптеу.




Кезеңдер бойынша:
1. Бӛлініп алынған патогендердің молекулярлы-генетикалық және биологиялық қасиеттерін
зерттеу. Республикалық микроорганизмдер коллекциясына бӛлініп алынған аурулардың
қоздырғыштарын сақтауға салу және паспорттандыру;
2. Каспий теңізінің қазақстандық секторындағы биоценозды сауықтыру, биоалуантүрлілікті
сақтау және қоршаған ортаны жақсарту бойынша ұсыныстарды ӛндіру.




"Каспий теңізінің қазақстандық секторындағы биоқорларды сақтау бойынша стратегияны
таңдау" кезеңі бойынша




Кезеңдер бойынша:
1. Каспий теңізінің қазақстандық секторындағы биоқорларды сақтау бойынша стратегияны
таңдау;
2. Каспидің қазақстандық секторындағы ағымдағы ластаушыларды минимизациялау және
қоршаған ортаға антропогенді факторлар кешеннің әсерін бағалау.




Кезеңдер бойынша:
1. Каспий теңізінің қазақстандық секторындағы биоқорларды сақтау бойынша стратегияны
таңдау;
2. Каспидің қазақстандық секторындағы ағымдағы ластаушыларды минимизациялау және
қоршаған ортаға антропогенді факторлар кешеннің әсерін бағалау;
3. Каспий теңізінің қазақстандық секторындағы биоценозды сауықтыру, биоалуантүрлілікті
сақтау және қоршаған ортаны жақсарту бойынша ұсыныстарды ӛндіру.




"Бӛлініп алынған патогендердің молекулярлы-генетикалық және биологиялық қасиеттерін
зерттеу. Республикалық микроорганизмдер коллекциясына бӛлініп алынған аурулардың
қоздырғыштарын сақтауға салу және паспорттандыру" кезеңі бойынша
Кезеңдер бойынша:
1. Каспидің қазақстандық секторындағы ағымдағы ластаушыларды минимизациялау және
қоршаған ортаға антропогенді факторлар кешеннің әсерін бағалау;
2. Каспий теңізінің қазақстандық секторындағы биоценозды сауықтыру, биоалуантүрлілікті
сақтау және қоршаған ортаны жақсарту бойынша ұсыныстарды ӛндіру.




Ересек қояндарға арналған КК-90 к құрама жем (түйіршіктелген, қапталған)



Түссіз, су тәріздес жылжымалы сұйықтық, қайнау температурасы: - 196 ºС



Жоғарғы ӛтімді жеңіл автокӛлігін жалдау. Жолаушылар орны - 8. Каспий теңізінің (Атырау,
Маңғыстау облыстары) қазақстандық секторы жағалаулық аймақтарында сынамалар алу
бойынша экспедициялық жұмыстар жүргізу үшін жоғарғы ӛтімді жеңіл автокӛлік. Қызмет
құнына ЖММ қамтамасыз ету, техникалық қызметтер және транспорттық басқару қызметтері
кіреді. Жалдау мерзімі 24 тәулік.



Жоғарғы ӛтімді жеңіл автокӛлігін жалдау. Жолаушылар орны - 8. Каспий теңізінің (Атырау,
Маңғыстау облыстары) қазақстандық секторы жағалаулық аймақтарында сынамалар алу
бойынша экспедициялық жұмыстар жүргізу үшін жоғарғы ӛтімді жеңіл автокӛлік. Қызмет
құнына ЖММ қамтамасыз ету, техникалық қызметтер және транспорттық басқару қызметтері
кіреді. Жалдау мерзімі 24 тәулік.



10 адам ғылыми қызметкерлерінен (экипаждың есебісіз) экспедицияларын ӛткізу үшін теңіз түрі
кемесін жалдау. Ӛнім беруші кемеге дейін әуежайдан (вокзалдан) ғылыми қызметкерлерді және
жабдықтарды жеткізуді және оларды кемеден жақын арадағы вокзалға немесе әуежайға дейін
экспедициялар бағдарларына сәйкес жеткізуді қамтамасыз етеді. Ӛнім беруші кемеде 10 адам
ғылыми қызметкерлерін ӛмір сүруімен және тамақтануымен қамтамасыз етеді. Кемеде
мұздатқыш камералар және тоңазытқыштар жарамды болуы тиіс. Ӛнім беруші ашық теңізге
шығу үшін заңнамамен белгіленген рұқсаттармен қамтамасыз етеді.
Саяз суда сынауларды іріктеп алу және ауларды қою үшін кемеде мотор қайығы болуы тиіс.
Кеме оның қауіпсізді пайдалануын қамтамасыз етуші, техникалық күй-жағдайда болуы тиіс.
Ӛнім беруші экспедицияны мүшелердің қайсысы кемемен басқаруын жүзеге асыру рұқсат
беретін құжаттары бар, білікті қызметкерлерімен қамтамасыз етеді. Ӛнім беруші Кеме, экипаж
мүшелері және ғылыми қызметкерлері үшін кеден, шекара, және ӛзге сәйкесті органдарда
қажетті рұқсаттарды ресімдеу бойынша шығындарды тӛлеуді қамтамасыз етеді. Ӛнім беруші әр
жолы Кеменің кетуімен және келуімен байланысты порттық шығындарды тӛлеуді қамтамасыз
етеді. Жалдау мерзімі 42 тәулік




Ғылыми зертханасы бар 5-6 ғылыми қызметкерлердің (экипаждың есебісіз) экспедициясына
арналған ғылыми-зерттеу теңіз түрі кемесін жалға алу. Ӛнім беруші кемеге дейін әуежайдан
(вокзалдан) ғылыми қызметкерлерді және жабдықтарды жеткізуді және оларды кемеден жақын
арадағы вокзалға немесе әуежайға дейін экспедициялар бағдарларына сәйкес жеткізуді
қамтамасыз етеді. Ӛнім беруші кемеде 5-6 адам ғылыми қызметкерлерін ӛмір сүруімен және
тамақтануымен қамтамасыз етеді. Кемеде мұздатқыш камералар және тоңазытқыштар жарамды
болуы тиіс. Ӛнім беруші ашық теңізге шығу үшін заңнамамен белгіленген рұқсаттармен
қамтамасыз етеді. Саяз суда сынауларды іріктеп алу және ауларды қою үшін кемеде мотор
қайығы болуы тиіс. Кеме оның қауіпсізді пайдалануын қамтамасыз етуші, техникалық күй-
жағдайда болуы тиіс. Ӛнім беруші экспедицияны мүшелердің қайсысы кемемен басқаруын
жүзеге асыру рұқсат беретін құжаттары бар, білікті қызметкерлерімен қамтамасыз етеді. Ӛнім
беруші Кеме, экипаж мүшелері және ғылыми қызметкерлері үшін кеден, шекара, және ӛзге
сәйкесті органдарда қажетті рұқсаттарды ресімдеу бойынша шығындарды тӛлеуді қамтамасыз
етеді. Ӛнім беруші әр жолы Кеменің кетуімен және келуімен байланысты порттық шығындарды
тӛлеуді қамтамасыз етеді. Жалдау мерзімі 16 тәулік
Жобалар бойынша:
1. Қазақстан Республикасында ГТО айналымына, қолданылуына және шығарылуына
байланысты әлеуетті және мүмкін болған қатерлерді ғылыми негіздемелер бойынша ұсыныстар
әзірлеу;
2. Абиотикалық факторларға тӛзімді трансгенді сояны алу;
3. Тұздалған топыраққа тӛзімділігі жоғары генетикалық түрлендірілген рапсты алу
биотехнологиясын әзірлеу;
4. Суыққа тӛзімді отандық мақтаның түрлерін алу үшін генетикалық трансформация
технологиясын әзірлеу;
5. Күріш трансформациясының технологиясын жасау;
6. Клейстогами генін оқшаулау және арпаның ген ағындарының мониторингін жасау;
7. Жүгеріден бидайға интродуцирленген РЕРС генін экспрессия жасауды зерттеу;
8. ГТ ауыл шаруашылық дақылдарын мониторингтеу әдістерін әзірлеу және жетілдіру.




Жобалар бойынша:
1. Ауруға тӛзімділікті жоғарлатуда маңызды рӛл ойнайтын, Қазақстанның бидай сұрыптарында
құба тотына тӛзімділігі бар гендерді анықтау;
2. Трансгенді AtDREB1A экспрессиясын оңтайландыру негізінде, қуаңшылыққа жоғары
тӛзімділігімен генетикалық түрлендірілген рапс ӛсімдігінің жасау биотехнологиясын әзірлеу




Жобалар бойынша:
1. Қазақстан Республикасында генетикалық түрлендірілген организмдердің айналымына
байланысты мүмкін болған қатерлерін бағалауға және генетикалық түрлендірілген сояны,
картопты, қант қызылшасын анықтау үшін ПТР нақты уақыттағы сынақ-жүйесін әзірлеу;
2. Қазақстан Республикасында ГТО мониторинг жасау мен айналымын реттеу үшін ғылыми-
әдістемелік негіздеме




"Ауыл шаруашылығында ГТО қолданғанда әлеуетті және мүмкін болған қатерлерін ғылыми
дәлелдеу бойынша нұсқауларды әзірлеу" жобасы бойынша




Жобалар бойынша:
1. Ӛсімдіктердің тұқым материалдарында генетикалық түрлендірілген кӛздерді тестілеу
бойынша әдісті әзірлеу және байқаудан ӛткізу;
2. Ӛсімдіктерде, тағам ӛнімдерінде, жануарларларға арналған жемдерде генетикалық
түрлендірілген кӛздердің экспресс-диагностика кестесін әзірлеу.
Тапсырыс берушінің техникалық тапсырмасына сәйкес. ЛАЖ-дың зерттемелеу және енгізу
мақсаты Қазақстан Республикасының Ұлттық биотехнология орталығының негізгі процесстерін
автоматтандыру және Орталықтың бӛлімше құрылымдарының қызметтерінің негізгі мәселелері
ақпаратты- аналитикалық қамтамасыздандыру есебінен нәтижелілік сапалығын жоғарылату
орындауын қолдау болып табылады. Кӛрсетілген мақсаттар келесі мәселелерді шешу
жолдарымен жетілуі міндетті:
• Орталықтың зерттеулік базалық біртұтасты электронды қойманы құру:
o Біртұтасты нормативті – анықтамалық ақпараттарын ұйымдастыру (СОП, жариялау, ғылыми
ашулар, ұйымдар және т.б.);
o Жеке ғылыми зерттеулерді басқару процесстерін автоматтандыру;
• Координация процесстерін автоматтандыру:
o Жобаларды жүзеге асыру орындаушылардың, ұйымдардың қатысуымен ҒТБ бойынша
біртұтасты есептілікті құру және жинауын автоматтандыру;
o Есептіліктің сапасын бақылау және формалау;
o Бағдарламалар аясында жобалар бойынша есептерді бірігу;
o Біртұтасты үлгілерді және анықтамалық деректерді қолдану;
• Қызметкердің жұмысының тиімділігі кӛрсеткіштерін ұйымдастыру:
o Қызметкердің жұмыс уақытының нақтылығының есебін автоматтандыру;
o Қызметкердің жұмысбастылығын бақылау;
o Жұмыс уақыты аяқталу пайызын және олардың нәтижелілігін анықтау;
o Ғылыми зертеулердің мониторингін қамтамасыз ету;
• Аналиталық және статискалық есептілікті ұйымдастыру;
o Бірыңғайлы формаларды ұйымдастыру;
o Берілген параметрлер бойынша статискалық есептілікті ұйымдастыру;
o Алынған деректер бойынша, есептерді ұйымдастыру, барлық жүйе бойынша контекстікті
іздеуді қамтамасыз ету;
o Пайдаланушы жүмысының жүйелік журналдарын ұйымдастыру.




49,7 куб. м.




Дезинфекциялық қызметтер (дератизация) бӛлмелер, филиал ғимаратында




Ақмола облысы, Степногорск қаласының алқабында, кӛлемі 3000 ш.м. Прогресс ӛнеркәсіп
алаңында № 527 ғимараты мен іргелес аумағын және осы ғимараттағы мүлікті патрульдеу
арқылы тәулік бойы күзету. Күзету формалы киіммен және рациямен болуы тиіс. Ғимаратта
медициналық жабдықтарды және дәрі-дәрмекті зарарсыздандыру үшін гамма-сәулелердің
стерилизаторы және басқада мүлік бар



Диспетчерлік қызмет кӛрсету: 1) Ӛртке қарсы қауіпсіздік; 2) Қоршаған ортаны қорғау; 3)
Еңбекті қорғау және қауіпсіздік техникасы; 4) Тӛтенше жағдайлар; 5) телефон сӛйлесулерін
жіберу; 6) Жеке дозиметрлерді қабылдау-беру.



Энергия жабдықтаушы ұйымының белгіленген ережелеріне сәйкес жылу энергиясын есепке
алатын приборлардың кӛрсеткішін алуы және тапсырылуы әр ай сайын ӛткізіледі




Әкімшілік ғимаратына мемлекеттік туды орнату МШТС-3 автомашинаның кызметтері 5 сағат




картрижді толтыру, принтерлерді жӛндеу, картридждерді жӛндеу
Кең ауқымды қол жеткізу (128 кбит/с)




Жабдықталған заттармен сигналдауды және орталанған қорғауды пультке қосу, қойманы
қорғаудағы күн сайынғы қабылдау және алыптастау. Қорғау сигналдаманың жұмыс істеген
кезінде күзетшілердің келуін қамтамасыздандыру, сигналдаманың жұмысыздығын жою

объектегі арнайы техникалық қорғау құралдарға техникалық қызмет кӛрсетуі. Прекурсорлар
қоймасы жабдықталған: Панель жинағы ППКОП "Барьер" (6.00)- 1 к-т, Комбинирленген
мәлімдеме "Маяк-12-КП" - 1 дана. Қорек блогы БИРП-12/1,6 -1 дана. Резервті қорек кӛзі
Аккумулятор 12В/7,0 А. Ч.-2 дана, Қозғалыс датчигі "Magnum Ultra -1 дана. Соқтығыс датчигі
"Шорох" -2 дана

Ыстық сумен жуу, канализациялық желілерді аршу (4 бағаналарды жою) Степногорск қ. 6 шағын
ауданда 6 ғимараттағы канализациялық құдықтан жекеменшік бӛлінген шекарасына дейін
(Степногосрк қ. 6 шағын ауданда орналасқан № 7 мектептегі шығару құдығына дейін)

Ӛрт хабарлағыштарды және басқа жабдықтарды бақылау және жұмыс күйінде сақтау




шотты банкілік қамтамасыз ету, ақша аудару т.б. банктік операциялар



Филиал жұмысы үшін қажетті құжаттарды растау бойынша нотариалдық әрекеттер



электроэнергияны сатып алу



жылу энергияны сатып алу



ауыз су



суды бұру



суды бұру



телефон байланысы және байланыс оператордың басқа қызметтері



тәуліктік, жол жүру ақысы, тұру ақысы және тұлғалардың басқа да іссапарға шыққан
шығындары

жай хаттар, бандерольдер, почта карточкалар



Степногорск қ. шекарасының маңында ӛнеркәсіп алаңы "Прогресс" аймағында орналасқан
радиациялық жабдыққа электроэнергияны беру

Ламинирленген, тіркеу папкасының қалыңдығы 8 см, форматы А4 құжатты тігу үшін



АИ 93 (92) этилденбеген. Талондық жүйе арқылы.
ЖҚС қайсысында талон иесі бензинді алу құқылы:
1. Астана қ. (5 ЖҚС кем емес);
2. Ақмола облысында Степногорск қ. (1 ЖҚС кем емес);
3. Ақмола облысында Астана қ. - Степногорск қ. Жолы бойынша (1 ЖҚС кем емес)
орналасқан болу тиіс.
R-13 (жазғы), ВАЗ 2115 автокӛлік үшін




(қысқы) дизельді аппаттық электростанция үшін




Коммуникациялардың, тетіктердің, агрегаттардың, қосалқы бӛлшектердің және материалдардың
тасымал жолында тез арада қалпына келтіруді талап ететін істен шығуы




Chevrolet-Epica, Daewoo-Nexia, Niva-Chevrolet автокӛліктері үшін, кӛліктің шиналары 15 дн.
Теңгеруді, шиналарды монтаждауды/демонтаждауды, автокӛлікке дӛңгелектерді
орнатуды/алуды ӛткізу керек.

10 w -40, қаптарма 4 литр




2123 Шевроле Нива автокӛлігіне, магнитпен




2123 Шевроле Нива автокӛлігіне




2123 Шевроле Нива автокӛлігіне




Салқындатқыш сұйықтық, қайнаудың жоғары температурасы, кристалдаудың тӛмен
температурасы, қаптарма 10 литр



Жас, жаңа сойылған, тұтас, қатырылмаған



30 адам/сағат жұмысы




Полиэстер шатыры, шіркейлерден қорғаныш тор, брезентті түп, металдық қада және арқан, 2
орынды

Полипропилен (ӛлшемі 180см*70см*0,5см)



Болоньды, толықтырылғыш синтепон, бекіткіш "найзағай" (ӛлшемі 205 см*40см*77см)



Найзаласқан, жиналмалы, металл сапты, темір корпус (ӛлшемі бүктеулі түрі - 23 см,
бӛлшектелінген түрі - 60 см)

Темір корпус, жинақта 2 батарея АА, қабы, қосымша лампыша



Кариматтың материалы поливенил-хлордан, қаптӛсек астына тӛсеу үшін ішінде поролон бар.
Каримат ӛзінен ӛзі үрленеді
Тығыз материалдан полиэстер шатыры (3 орындық) бағандары берік



Тығыз материалдан полиэстер шатыры (2 орындық) бағандары берік



Материалы брезенттен орындық, орындықтың аяқтары берік металдан



Патенттік іздену, ақпараттық іздену және кітапхананың басқа қызметтері



Ғылыми зертхана үшін. Тұрғын үйлерден оқшау орналасқан ғимарат жалпы кӛлемі 120 ш.м.
кем емес, бӛлмелердің саны 8 кем емес. Ғимарат:
ыстық және суық сумен;
220-380 вольттік электр қуатымен;
жылытумен;
ауа беру-сору желдетпемен;
телефондық байланысымен қамтамасыз етулуі тиіс.
Ғимаратта санитарлық торап болуы тиіс.


Кӛлік сигналдамасы үшін сұйық кристалдық (LCD) дисплеймен, дистанциялық басқарумен екі
жақты салпыншағы, ААА-1.5 В типті батареядан қоректендіру, салпыншақта түйме саны 4,
салпыншақтын қолданылуының қашықтығы 700 м., хабарлауды қабылдау қашықтығы 1200 м.,
бағдарламаны қайта бағдарламалау
Дәріс курстардың ұзақтығы 79 сағаттан кем емес, ӛнім берушінің базасында, 15 күнтізбелік
күннен кӛп емес. Оқыту тілі - орыс. Дәріс курстардың біткеннен кейін, жетістікті аттестация
кезде үлгіге сай куәлік беріледі. Егер тыңдаушы квалификациялық емтихан нәтижелері
бойынша аттестацияны ӛтпей қалса 3 ай ішінде ақысыз, қайта емтиханды тапсыруға құқығы бар.
Тыңдаушылардың саны 1 адам.

Кӛмескі жарық шамның 4 қорек блоктарын жӛндеу




2 қорек блоктарын жӛндеу




Линолеум коммерциялық, жалпы қалыңдығы 2 мм кем емес, тӛзімділік қабатының қалыңдығы
0,7 мм кем емес, ораманың жалпақтығы 2 м., ұзындығы 6,5 м., жалпы салмағы 2700 г/м 2,
абсолютті қалдық деформациясы 0,27 мм кем емес, сызықтық кӛлемнің тұрақтылығы 0,4 % кӛп
емес, жанғыштық тобы Г1, тұтанғыштық тобы В2, алау жаю тобы РП1, түтін шығару қабілеті
Д2, қаптаманың түсін тапсырыс берушінің келісуімен



ПВХ, кабель каналымен, кӛлемі 2500*50*20 (мм), түсін тапсырыс берушімен келісуімен




ПВХ ернеулігі үшін




ПВХ ернеулігі үшін




Ұзындығы 2200 мм, жалпақтығы 150 мм, терезенің алдының қалыңдығы 20 мм, терезенің
алдының "клювик" биіктігі - 40 мм, түсі ақ



LC1-D сериясының байланстырғыш, номиналды коммутаторланған ток 25, қосымша байланыс
10, катушканың қорек кернеуі 220 VAC
Тұтас жапсырма, материалы металл қорытпалы, белағаш арасы 92 мм, жапсырманың
жалпақтығы 35 мм, жапсырма қалыңдығы 8 мм, түсі ақ.



Фалевалы ілмекті және кӛлденең тесікті құлып, 49Е/PZ/F16/35/92/8, дорнмасс 35 мм, штульп 16
мм, күміс түсті.



Есікке ең жоғары жүктеліс 120 кг, бұйырғы реттеулері + 5 мм/- 5 мм, нӛлдік күйіндегі
биіктігінің реттеулері + 4 мм/ - 3 мм, жапыруды үдейту реттеулері +/- 0,75 мм., түсі ақ + ілмекке
қалып

Рычаг тартпасы немесе жеткізушінің араласуымен тіреуіш подшибнигін бұрау арқылы жабылу
күшін сатылы реттеу, жабылу жылдамдығының реттелуі 180-15 (градус), соңғы тарсқа дейінгі
гидравликалық реттеулер 15-0 (градус), кӛлемі 220*53,5*45 (мм), жұмыс температурасының
диапазоны -30 дан + 40 (целсия бойынша градустер), түсі қара - қоңыр



Жиынтықта: база, трубкасы. Жұмыс жиілігі: 1880-1900 Мгц. Стандарт DECT/GAP. Ашық
жерлерде, бӛлмелерде жұмыс істеуі 50/300 м. кем емес. Ӛткізуші және қосымша трубка бар.
Дисплей: базалы блокта, трубкасында (монохромды жарық) Трубка түймелеріндегі жарық. Теру
алаңы базада. Сақтау: Телефонда орнатылған кітапшада 100 нӛмірлік. Қоңырау шалынған
нӛмірлерді сақтау: 5.
Функционалды қабілеттері: АОН, Callеr ID 50 нӛмірге журнал. Ішкі байланыс (интерком): трубка
және базалы блок арасында, бірнеше трубкалар арасында. Мәжіліс байланыс сыртқы абонент
және трубка/трубкалар, база арасында. Бір базаға қосылатын трубкалар саны: 6. Қорек:
Трубканың жұмыс істеу уақыты (сӛйлесу режимі/күту режимі): 18/170 сағат.
Қосымша: 20 полифониялық әуендер. Басқа да функциялары мен ерешеліктері: автоматикалық
байланысу, оятар, клавиатураның ӛзінен ӛзі басылуынан шектеу, трубканы кӛтере сала жауап
беру базадан. Тоқ ӛщкенде де жұмыс істейді (ӛткізгіш ғана телефон). Телефон анықтамасындағы
ақпараттарды кӛшіру. Дисплейде кириллица. Уақыт/күн дисплейде. Қайта теру/бір кнопкадан
нӛмірді теру. Қосымша трубкаларды қосу мүмкіндігі. Түсі қара. Кепілдік: 3 жылдан кем емес.




Электроэнергияны сатып алу



Телефон байланысы және байланыс оператордың басқа қызметтері



байланыс жылдамдығы – 512 кб/с, шексіз трафик. Ассиметриялық санды абоненттік желі




OW-40 мотор майы, алмастырумен, канистра 4 л - 3 канистра;
ATF-WS 4I трансмиссиялы май, алмастырумен, канистра 1 л - 7 канистра;
ATF-SHC руль гидро-күшейткіш май, алмастырумен, канистра 1 л - 1 канистра;
Май сүзгіш, алмастырумен - 2 дн;
Отын сүзгіш, алмастырумен - 2 дн;
Ауа сүзгіш, алмастырумен - 2 дн;
Салқындатқыштың сүзгіші, алмастырумен - 1 дн;
Автоматтық ауыспалы беріліс қораптың сүзгіші, алмастырумен - 1 дн;
Автоматтық ауыспалы беріліс қораптың теген тӛсемі, алмастырумен - 1 дн;
Дӛңгелектердің геометриясы- 2 қызмет;
Компьютердің жұмысындағы іркілісті жоюмен, электр жабдықтарды диагностика - 2 қызмет



ҚР заңнамалық нормаларына сәйкес жинақталған
Қызмет кӛрсетілмейтін, құйылған, корпустың материалы зарядталған: полипропилен,
екшегіштің материалы: полиэтилен, тоқты бұрып әкететін торлар материалы (анод/катод):
қорғасын - кальцийлі қорытпа, орнатылған жалау сӛндіргіш (сүзгіш жүйесі), тығындарсыз,
кепілдік пайдалану мерзімі 12 ай, номиналды кернеуі 12 В, номиналды сыйымдылығы 70 Ah,
салқын тоқты жүргізу 540 EN, габариттер (ұхжхб) 261х175х220 мм, үйектік 1/0, европалық
клеммалар


265/65/17, жаңа қысқы кертіктерімен дӛңгелектер. Протектордың үлкенденген жалпақтығы
және 6 қатар кертіктермен, монтаждау мен теңдестірумен



3 үлгідегі алифатиялық кӛмірсутектерді анықтау, ароматикалық және алифатикалық
кӛмірсутектердің жалпы құрамын анықтау, шайыр мен асфальтенді, қатты парафиндерді
анықтау. Химиялық талдауды жасау мерзімі үлгілерді алған күннен бастап 10 жұмыс күн, әр
үлгі үшін нәтижелердің есебін берумен (мәліметтердің интерпретациясы)



ХМС әдісімен алифатикалық фракцияларды талдау. Химиялық талдауды жасау мерзімі:
үлгілерді алған күннен бастап 15 жұмыс күн.



Экспресс әдісімен шайыр мен асфальтенді анықтау. Химиялық талдауды жасау мерзімі:
үлгілерді алған күннен бастап 15 жұмыс күн.



Қатты парафиндерді экстракциялау және сіңіру әдісімен талдау. Химиялық талдауды жасау
мерзімі: үлгілерді алған күннен бастап 15 жұмыс күн.



іс-шаралар: кӛрмелер, семинарлар, конференциялар, кеңестер, форумдар, симпозиумдар,
тренингтер



1 м х 2 м, материалы политекс, СТ РК 988-2008 "Қазақстан Республикасының Мемлемлекеттік
Туы. Жалпы техникалық жағдайлар." сәйкес дайындалған



Талдау үшін таза, марка П-11, МЕМСТ 11293 - 89 сәйкес дайындалған



Тазартылған - 96 %, сауыт - 50 мл, МЕМСТ 18300-87 сәйкес дайындалған



Бӛтелкедегі ауыз су, орташа газдалған. Ыдыс 0,5 литр полимерлық материалынан. Сақтау
мерзімі 1 жылдан кем емес.



Бӛтелкедегі ауыз су, газдалмаған. Ыдыс 0,5 литр полимерлық материалынан. Сақтау мерзімі 1
жылдан кем емес.



Мұнай ӛндіретін аймақтардағы қазіргі топырақ жағдайын бағалау және оны қалпына келтіретін
тәсілдер әзірлеу ғылыми бағыты бойынша "Мұнай ӛндіретін Каспий жағалауы ӛңірлерінің
қазіргі топырақ жабынының жағдайын бағалау" жобасы бойынша
Мұнай ӛндіретін аймақтардағы қазіргі топырақ жағдайын бағалау және оны қалпына келтіретін
тәсілдер әзірлеу ғылыми бағыты бойынша "Шанқанай кен орнының түрлендірілген цеолиттер
негізінде мұнаймен ластанған топырақтарды рекультивациялаудың биотехнологиялық әдістерін
әзірлеу" жобасы бойынша




Белсенді мұнай тотықтырғыш микроорганизмдер негізінде биопрепараттарды пайдалану
арқылы мұнаймен ластанған топырақты биоремедиациялау тәсілдерін әзірлеу ғылыми бағыты
"Мұнай ӛндіретін аймағындағы микробиоценоздың қазіргі ахуалын зерттеу және in situ
биоремедиациялық кешенді әдістерді әзірлеу" жобасы бойынша




Белсенді мұнай тотықтырғыш микроорганизмдер негізінде биопрепараттарды пайдалану
арқылы мұнаймен ластанған топырақты биоремедиациялау тәсілдерін әзірлеу ғылыми бағыты
"Интегралды улылық пен топырақ биоремедиациясын бағалау үшін мұнай тотықтырғыш
микроорганизмдер композициясы мен микробты экспресс-әдістерді жасау" жобасы бойынша




Белсенді мұнай тотықтырғыш микроорганизмдер негізінде биопрепараттарды пайдалану
арқылы мұнаймен ластанған топырақты биоремедиациялау тәсілдерін әзірлеу ғылыми бағыты
"Топырақты мұнай мен мұнай ӛнімдерінен биоремедиациялау үшін биопрепараттар жасау және
оларды ӛндіру технологиясын әзірлеу" жобасы бойынша




Мұнаймен ластанған топырақты биоремедиациялаудан кейін оларды фитомелиорациялау
жӛніндегі шараларды әзірлеу ғылыми бағыты бойынша "Мұнай ӛндіретін аймағындағы ӛсімдік
жабынын трансформациялау: қазіргі ахуалын бағалау және фитомелиорациялау жӛніндегі
шараларды әзірлеу"




Мұнаймен ластанған топырақтың фаунасын экологиялық бағалау және оны қалпына келтіру
жӛніндегі шараларды әзірлеу ғылыми бағыты бойынша "Мұнаймен ластанған аймақтардағы
жануарлар әлемінің ахуалын бағалау" жобасы бойынша




Мұнаймен ластанған топырақтың фаунасын экологиялық бағалау және оны қалпына келтіру
жӛніндегі шараларды әзірлеу ғылыми бағыты бойынша "Батыс Қазақстанның мұнай ӛндіретін
аймағындағы фаунаны ұзақ мерзімдік экологиялық мониторингтеудің әдістемелік негіздерін
әзірлеу" жобасы бойынша
Мұнаймен ластанған топырақтың фаунасын экологиялық бағалау және оны қалпына келтіру
жӛніндегі шараларды әзірлеу ғылыми бағыты бойынша "Мұнай ӛндіретін аймағындағы
экологиялық-химиялық зерттеулер және ұзақ мерзімдік мониторинг жүргізу әдістерін әзірлеу"
жобасы бойынша




"Қазақстан Республикасы халқының түрлі жыныс-жастағы, кәсіби және әлеуметтік топтары
үшін, адам организмінің қуатқа және негізгі қоректік заттарға деген физиологиялық қажеттілік
нормарын нақтылау негізінде негізгі азық-түлік түрлерін тұтынудың ғылыми-негізделген
нормаларын әзірлеу" жобасы бойынша




"Әлемдік стандартқа сәйкес негізгі азық-түлік түрлерін тұтынудың ғылыми-негізделген
нормаларын әзірлеу үшін Қазақстанның түрлі ӛңірлері халқының жыныс-жастық, кәсіби және
әлеуметтік жеке топтарында биохимиялық және гематологиялық кӛрсеткіштері бойынша
организмнің функционалды ахуалын бағалау" жобасы бойынша




"Қазақстанның түрлі ӛңірлері халқының жыныс-жастық, кәсіби және әлеуметтік жеке топтары
үшін әзірленген, үйлестірілген тағамды қолдану кезінде тіршіліктік маңызды жүйелердің
функционалды ерекшеліктерін бағалау" жобасы бойынша




01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Қазақстанның Бас ботаника бағындағы жинақтамалық қорларды сақтау,
толықтыру және дамыту" жобасы бойынша




01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Жезқазған ботаника бағының жинақтамалық қорын толықтыру, зерттеу және
сақтау" жобасы бойынша
01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Іле ботаника бағының жинақтамалық қорын толықтыру, зерттеу және сақтау"
жобасы бойынша




01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Алтай ботаника бағындағы отандық және әлемдік флоралардың ex-situ
ӛсімдіктердің жинақтамалық қорларын толықтыру, зерттеу және сақтау" жобасы бойынша




01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Биоалуантүрлілікті сақтау үшін Маңғышлақ эксперименталды ботаника
бағындағы интродуценттер ӛсімдіктер жинақтамаларын және жергілікті флораларын
толықтыру, зерттеу және қолдау" жобасы бойынша




01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Ӛсімдік, саңырауқұлақ және қыналардың кеппеӛсімдік қорларын сақтау,
толықтыру және сипаттау" жобасы бойынша




01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Биотехнологияда пайдалану және биоалуантүрлілікті сақтау үшін
микробалдырлардың шаруашылыққа құнды культураларының жинақтамаларын толықтыру"
жобасы бойынша
01 – Қазақстанның ботаникалық жинақтамаларын толықтыру, зерттеу және сақтау ғылыми
бағыты бойынша "Қазақстан Республикасының микробалдырлар жинақтамалық культураларын
толықтыру, сақтау және тӛлқұжаттау" жобасы бойынша




02 – Қазақстанның зоологиялық жинақтамаларын түгендеу, толықтыру және сипаттау ғылыми
бағыты бойынша "Қазақстанның зоологиялық жинақтамаларын түгендеу, толықтыру және
сипаттау" жобасы бойынша




03 –Микроорганизмдер және вирустер жинақтамаларын толықтыру, зерттеу және қолдау
ғылыми бағыты бойынша "Медицина, ауыл шаруашылығы және қоршаған ортаны қорғау үшін
тиімділігі жоғары препараттар алу мақсатында ӛндірістік-бағалы микроорганизмдерді
жинақтамасын зерттеу және дамыту" жобасы бойынша




03 –Микроорганизмдер және вирустер жинақтамаларын толықтыру, зерттеу және қолдау
ғылыми бағыты бойынша "Мемлекеттің Ұлттық игілігі ретінде биоалуантүрлілікті сақтау үшін
Республикалық микроорганизмдер культуралары жинақтамасының негізгі қорын толықтыру
және генетикалық тӛлқұжаттау" жобасы бойынша




03 –Микроорганизмдер және вирустер жинақтамаларын толықтыру, зерттеу және қолдау
ғылыми бағыты бойынша "Орто-парамиксовирустер жинақтамаларының ақпараттар деректер
базасын құру, қолдау, толықтыру және зерттеу" жобасы бойынша
04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Жабайы ӛсетін дәнділердің жинақтамасын толықтыру және зерттеу" жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Шаруашылық-бағалы, сирек және құрып бара жатқан жеміс пен жидек дақылдары
түрлерінің криогенді жасуша және ұлпалар жинақтамаларын толықтыру және қолдау" жобасы
бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Шаруашылық-бағалы, сирек және құрып бара жатқан жануарлар түрлері мен
тұқымдарын ex-situ сақтау биотехнологиясының ғылыми негіздерін әзірлеу" жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Радиацияның аз мӛлшерінің созылмалы әсеріне шалдыққан, уран кен орындарының
жұмысшыларының ДНҚ банкісін жасау және молекулярлық-генетикалық сипаттау.
Радиацияның аз мӛлшерінің созылмалы әсеріне шалдыққан адамдардың генотипі бойынша
электрондық деректер банкісін жасау" жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Адамның жасушасы мен ұлпаларының ДНҚ генбанкісін толықтыру, зерттеу және
сақтау" жобасы бойынша
04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Кейбір биотехнологиялық бағалы микроорганизмдердің 11 туысы ӛкілдерінің
генетикалық тӛлқұжаттарын жасау, генетикалық алуантүрлілігі мен геножүйелілігін
мониторингтеу. Кейбір Kluyveromyces туысы штамдарын генетикалық сәйкестендіру үшін
сынақ-жүйелерді әзірлеу" жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Қазақстан Республикасының Қызыл кітабына және халықаралық Қызыл кітапқа енген
Жоңғар Алатауының Ranodon sibiricus жетісулық бақатісінің ДНҚ жинақтамасын жасау және
толықтыру, гендік қорын сақтау және генетикалық мониторинг үшін олардың ДНҚ-
тӛлқұжаттауды ӛткізу" жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Сирек және құрып бара жатқан құстың гендік қорын сақтау мәселесін шешу үшін
микросателлиттік локустер полиморфизмі кӛмегімен Қазақстанда мекен ететін Falco cherrug
балобан қыранының түрлі популяциясының ДНҚ жинақтамасы мен ДНҚ-тӛлқұжатын жасау"
жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Қазақстанның перспективті коммерциялық дәрілік ӛсімдіктерінің гендік қорын
зерттеу, сақтау және генетикалық тӛлқұжаттарын жасау, Anabasis aphyllia L., Peganum harmala
L., Polypodium vulgare L. молекулярлық-генетикалық сәйкестендіру үшін сынақ-жүйелер әзірлеу"
жобасы бойынша




04 – Ғылыми және шаруашылық бағалы адам, жануарлар және ӛсімдіктердің жасуша мен
ұлпасының бірегей генетикалық ДНҚ банкісін толықтыру, зерттеу және сақтау ғылыми бағыты
бойынша "Қазақстандағы сирек және құрып бара жатқан қой тұқымдарының молекулярлық-
генетикалық сипаттамасы және цитогенетикалық аттестациясы" жобасы бойынша




Жиынтық кДНҚ-ны синтездеуде пайдаланылады. Кері транскрипцияға арналған жиынтық
келесі компоненттерден тұрады: рендом праймер, кері транскрипцияға арналған
оңтайландырылған буфер дНТФ, РНҚаза ингибиторы, МулВ кері транскриптаза (фермент),
жиынтық 1000 реакцияға
ПТР - ӛнімдерін амплификациялауда пайдаланылады. АмпиТаг ДНҚ полимераза ферменттің
түрі. Голд буфері мен MgCl2. ДНҚ полимераза массасы 94кДа, ультра таза, желатинсыз.
Ферменттің жартылай ыдырау кезеңі 40 мин 95 С-да. Жиынтық -белсеңділігі 1000 бірлік.



Генетикалық талдау ӛткізуде пайдаланылады. Жоғары деионизацияланған формамид.
Капиллярлық электрофорез кезінде электрокинетикалық инъекциялауда пайдаланылады. Сауыт
кӛлемі 25 мл.
Генетикалық талдау ӛткізуде пайдаланылады. ПЦР-секвенирлеуді ӛткізуде пайдаланылатын
негізгі реагент. Жиынтық: 800 мкл БигДайТерминатор дайын реакциялық қоспасы бар 10 шыны
түтіктен, М13 праймері бар шыны түтіктен, бақылау ДНК рГЭМ, 12 мл 5 х секвенирлейтін
буферден тұрады. Жиынтық 5000 реакцияға.

ДНҚ секвенатордың 3130 хl және 3730 хl үлгілерінде капиллярлық электрофорезді ӛткізуде,
сонымен қатар фрагментті талдауда пайдаланылады. 1 сауыт 2,5-3 мың үлгіге есептелген.
Қаптама 10 сауыт кӛлемі 25 мл.
3130 хl үлгілі генетикалық анализаторда фрагментті талдау және ДНК секвенирлеу ӛткізуде
пайдаланылады. 1 сауыт 960 үлгіге есептелген. Сауыт 7 мл.

3730 хl ДНҚ секвенаторында капиллярлы электрофорезде пайдаланылады. Сауыт 500 мл.



Секвенаторға келесі тиеумен, ПТР-секвенирлеуді қоюда пайдаланылады. Әрбір ұяшықтың
кӛлемі 100 мкл-ге дейін. Қаптама 10 дана.

Полиморфизмдер тапсырыс берушінің келісіммен. Жиынтық 35 кем емес полиморфизмдерді
анықтауға және 5 мыңнан кем емес реакция ӛткізуге есептелу керек.



қабырғаларды және тӛбелерді бояу үшін, құбыр тәрізді металл шыбықта, ұзындығы - 240 мм.,
диаметрі - 40 мм.,тоңның материалы - жасанды тері



Кішкентай білікшелер, бӛктерді бояу үшін, ұзындығы - 100 мм., диаметрі - 30 мм., құбыр тәрізді
металл шыбықта, тоңның материалы - жасанды тері, жиында - 5 білікше



ақ түсті, ішкі жұмыстар үшін, қабаттың қалындығы 10 мм. бастап 50 мм. дейін, қаптармада 25
кг (ҚРСТ 1168-2006)



Ғанышкартон қабырғалық, ылғалға тӛзімді, қалындығы - 12,5 мм., ӛлшемі 1,2м.х2,5м.




диаметрі - 6 мм., ұзындығы - 40 мм., пластмассалық гильзасы + металл бұрандашеге




қылқалам ені - 4 см., ағаш тұтқасы, табиғи қылшықтары




3 килограммды банка, сары түсті




Суға тӛзімді бояу, сылақталған, бетонды және кірпіш шалағайлық бойынша, ақ түсті, кебу
уақыты - 3 сағат, 20 кг қаптармаларда



мата негізінде (ірі)
Қиын жұмыстарға арналған, ӛлшемі "L"




"Уайт-Спирит" типтес еріткіш, 5 литрлі қаптармада (МЕМСТ -3134-78)




пластмассадан жасалған, ӛлшемі - 240 мм. Х 170 мм.




Ағаш шалағайлықтарға арналған, 0,5 кг-дық банкаларда




ақ түсті, цементті, суға тӛзімді, жоғары ұстасуымен, 20 кг-дық қаптармаларда




бояуға дайындалған, ағаш, металл, сылақталған шалағайлықтарды бояу үшін, 20 С
температурасында кебу уақыты 24 сағат, 25 кг - дық қаптармада



Қапсырма жасау үшін, формат А4, 1 орамада 100 дн, қаптарманың қалыңдығы 300 микрон




Қапсырма жасау үшін, пластикалық, 6 мм., А 4 форматты қағаздар үшін, қара түсті




Қапсырма жасау үшін, пластикалық, 8 мм., А 4 форматты қағаздар үшін, қара түсті




жад 2 Гб




ұзындығы - 180 см.




Антистеплер




қорапта 500 парақ, 80гр/м2, түсі ақ, 103% - ақшылдығымен




ӛлшемі 76мм.*76мм., жабысатын таспамен




ақ түсті, орамада - 25 м.




CD-R дискілері
DVD-R дискілері




Сызғышы бар тескіш, корпусы металлдан жасалған, жоғары қуаттылығы, 2 тесікке, тестіру - 10
парақ



2011 жылға, А5 форматты, ӛлшемі - 148*210 мм., қапсырмасы тігілген, 256 бетті




Ӛтініштерді тіркеуге арналған есепке алу журналы, форматы - А4, 60 беттік




100 парақ, 50*12 мм., неон жиынтығы, 4 түсті




Ине - 7 см., материал - тот баспайтын болат




үстелге қойылатын, 2010 жылға




бухгалтерлік, үстелге қойылатын, екі жақтык қоректену: батарейка + күн қӛзінің элементтері,
енгізетін сандарды ӛзгерту мүмкіндігі, 12 дәрежелі, пайыздарымен операциялар, үлкен сандар,
ӛлшемі 199 мм х 153 мм * 30,5 мм

Қарандаш жай ӛшіргішсіз




15 грамдық




35 грамдық




ПВА желімі




материал – болат




материал – болат




материал – болат




144 парақ, қатты қапсырмада, формат –А4
144 парақ, жұмсақ қапсырмада, формат –А4




229 мм х 324 мм, түсі-ақ, үзбелі таспамен




162 мм х 229 мм, түсі-ақ, үзбелі таспамен




110 мм х 220 мм түсі-ақ, үзбелі таспамен




Ӛшіргіш




30 см, материал-ағаш




түсі-қара, 4 бӛлімше, материал – пластмасс, ӛлшемі 310мм*292мм*81мм




суға тӛзімді, қаламның қалыңдығы 1 мм кем емес, қара




суға тӛзімді, қаламның қалыңдығы 3 мм кем емес, қара




суға тӛзімді, қаламның қалыңдығы 1 мм кем емес, қара




DDR400 1024МВ




DDR400 512 МВ




орама-50 м, қалыңдығы – 1-1,5 мм




16 см, материал -болат




ұзындығы-13см




пластикалық, А4, түтін түсті (орама -100 дана)
картон, ақ А4 (орама-100 дана)




пластиктен, формат А4




100 файлдары бар папка, материал – пластик, формат А4




20 файлдары бар папка, материал – пластик, формат А4




30 файлдары бар папка, материал – пластик, формат А4




10 файлдары бар папка, материал – пластик, формат А4




материал – пластик, формат - А4




материал –картон




материал - пластик




275мм*224мм*85мм, полистирол, қара




А 4 формат қағазды қапсырмалау үшін, 12,5 мм, кӛк, қаптарма -100 дана




А 4 формат қағазды қапсырмалау үшін, 14 мм, кӛк, қаптарма -100 дана




А 4 формат қағазды қапсырмалау үшін, 19 мм, қара, қаптарма -100 дана




А 4 формат қағазды қапсырмалау үшін, 25 мм, кӛк, қаптарма-100 дана




кӛлемі 20 мл ыдыста




сиясы - кӛк түсті, калпақшамен
сиясы - қызыл түсті, калпақшамен




сиясы - қара түсті, калпақшамен




5 м пластмассалық корпус, 6 розеткаға, «еуровилкаларды» қосу мүмкіндігімен. Айырғыш, қуат
және кернеу бойынша электронды бірнеше ретті қорғау. Еденге және қабырғаға орнату
мүмкіндігі.

UTP cat 5




8 порт 100 Mbps




RJ-45




орама-1000 дана




350г/м2 тығыздығы мелованды картон, металлдық механизм ,7 және 8 см перфорациямен
пластикті бекіткіш



350г/м2 пластик, металлдық механизм, 7 және 8 см перфорациямен пластикті бекіткіш




350г/м2 тығыздықты мелованды картон, металлдық механизм, 7 және 8 см перфорациямен
пластикті бекіткіш



19м*33мм түссіз




50м*66мм түссіз




50м*50мм түссіз




түсі –ақ, 48 мм* 50м




қаптармада - 100 дана, металлды пластикті жабынмен




Орысша-қазақша сӛздік (медициналық терминологиямен) 50 000 сӛз
20 парақты тестіретін




шарикті қалам үшін




шарикті қалам үшін




шарикті қалам үшін




жазатын бұрыш 1-5 мм, сары




жазатын бұрыш 1-5 мм, жасыл




жазатын бұрыш 1-5 мм, қызғылт




48 парақ формат А5




12 парақ, формат А5




қарандаш үшін




жұқа




қалың




қылқаламмен (кӛлемі - 20мл)




кӛлік құралдарының йелерінің АҚЖ, сақтандыру полисті беру, ГАЗ -31105-501 маркалы 1 авто
кӛлік

Қызметкер еңбек (қызмет) мiндеттерiн атқарған кезде оның ӛмiрi мен денсаулығына зиян
келтiргенi үшiн жұмыс берушiнiң азаматтық-құқықтық жауапкершiлiгiн мiндеттi сақтандыру 

Егістік учаскені жалдау- 500 кв.м.
Ӛнім берушімен бидай тұқымдарын беру - 3 кг
Ӛнім берушімен қызанақ кӛшетін беру - 300 дн
Қызанақ пен бидай ӛсімдіктерімен егістік сынауларын салу үшін учаскені бӛлу - 500 кв.м.
Әр-түрлі биопрепараттармен инокулирленген бидайды егу - 21 мӛлдек
Ұсынылған және жаңа биопрепараттарымен ӛңделген қызанақ кӛшетін егу - 15 мӛлдек
Топырақ үлгілерін сұрыптап алу - 12 түрі
Қызанақ ӛсімдіктерін суғару - 4 апта




4.2 - Адамның денсаулығын жақсартудың және қорғаудың биологиялық негіздері ғылыми
бағыты бойынша, "Бактериалды вагинозды алдын алу және емдеу үшін пробиотикалық
препараттарды жасаудың ғылыми және әдістемелік негіздерін әзірлеу" жобасы бойынша




4.2 - Адамның денсаулығын жақсартудың және қорғаудың биологиялық негіздері ғылыми
бағыты бойынша, "Ауыр бақыланбайтын демікпені емдеу, алдын алу мен диагностиканың
тиімділігін кӛтерудің ғылыми негізделген амалдарын әзірлеу" жобасы бойынша




Ауабаптағыштардың сыртқы және ішкі блоктарын жуу және тазарту - 15 ауабаптағыш, жүйедегі
фреонның қысымын тексеру - 15 ауабаптағыш, электротізбектерді тексеру - 15 ауабаптағыш,
фреонның кемуін анықтау және тұщыту - 15 ауабаптағыш, жүйеге фреон құю (ӛнім берушінің
фреонымен) - 15 ауабаптағыш, кәріз жүйесін герметизациялау, жуу - 15 ауабаптағыш,
автомұнара қызметі - 5 сағат.



Ӛнім берушінің қосалқы бӛлшектерімен желдеткіш моторын жӛндеу - 5 ауабаптағыш, ӛнім
берушінің моторымен желдеткіш моторын ауыстыру - 2 желдеткіш моторы, ӛнім берушінің
материалымен түтіктерді ауыстыру - 10 ұзындық метр, тақшаны (электрондық сызбанұсқаны)
жӛндеу - 5 ауабаптағыш, ӛнім берушінің қосалқы бӛлшектерімен ішкі блоктың жалюзиін жӛндеу
- 5 ауабаптағыш, ӛнім берушінің жалюзиімен ішкі блоктың жалюзиін ауыстыру - 2 ішкі блоктың
жалюзиі.


1. Ӛнім берушінің сығымдағышпен 21А23005Е сығымдағышқа тақылеттес сығымдағышты
ауыстыру - 1 дн. (хладон-12 жұмыс істейтін сығымдағыш. Электр қуаты 400 Вт; бірфазалық 220
В.)
2. Ӛнім берушінің сүзгішімен және дәнекермен ылғалды бӛлгіш сүзгішін ауыстыру- 1 дн.
(21А23005Е сығымдағышқа тақылеттес сығымдағыш үшін 6 мм диаметрлік түтікке
дәнекерлеуге сүзгіш)
3. Ӛнім берушінің клапанмен суытқыштармен толтыру үшін Шредер клапаны орнату - 1 дн.
(манифолд үшін толтыратын шлангқа)
4. Толтырғанша хладон - 12 және деңгейге дейін 160Р маркалы мұздатқыш сығымдағыштар
үшін майды құйып алу.
Қолданылатын дәнекер құрамында силикон -0,01-0,4%; фосфор - 6,0%-7,0%, қалайы -6,0%-7,0%,
қоспалар - 0,15 % мыс негізінде жезпен мысты флюссіз дәнекерлеу үшін болуы тиіс.
1. Ӛнім берушінің сығымдағышпен КС19В3Е сығымдағышқа тақылеттес сығымдағышты
ауыстыру - 1 дн. (хладон-12 жұмыс істейтін сығымдағыш. Электр қуаты 400 Вт; үш фазалық 380
В.)
2. Ӛнім берушінің сүзгішімен және дәнекермен ылғалды бӛлгіш сүзгішін ауыстыру- 1 дн.
(Оймалы қосылыспен КС19В3Е сығымдағышқа тақылеттес сығымдағыш үшін 9 мм диаметрлік
түтікке дәнекерлеуге сүзгіш)
3. Ӛнім берушінің бұрандамен бұранданы ауыстыру - 2 дн. (9 мм диаметрлік түтікке сүзгіш
үшін)
3. Ӛнім берушінің клапанмен суытқыштармен толтыру үшін Шредер клапаны орнату - 1 дн.
(манифолд үшін толтыратын шлангқа)
5. Толтырғанша хладон - 12 және деңгейге дейін 160Р маркалы мұздатқыш сығымдағыштар
үшін майды құйып алу.
Қолданылатын дәнекер құрамында силикон -0,01-0,4%; фосфор - 6,0%-7,0%, қалайы -6,0%-7,0%,
қоспалар - 0,15 % мыс негізінде жезпен мысты флюссіз дәнекерлеу үшін болуы тиіс.


1. Ӛнім берушінің сығымдағышпен НК 1,25 N 15-2 сығымдағышқа тақылеттес сығымдағышты
ауыстыру - 1 дн. (хладон-12 жұмыс істейтін сығымдағыш. Электр қуаты 230 Вт; бірфазалық 220
В.)
2. Ӛнім берушінің сүзгішімен және дәнекермен ылғалды бӛлгіш сүзгішін ауыстыру- 1 дн. (НК
1,25 N 15-2 сығымдағышқа тақылеттес сығымдағыш үшін 6 мм диаметрлік түтікке
дәнекерлеуге сүзгіш)
3. Ӛнім берушінің клапанмен суытқыштармен толтыру үшін Шредер клапаны орнату - 1 дн.
(манифолд үшін толтыратын шлангқа)
4. Толтырғанша хладон - 12 және деңгейге дейін 160Р маркалы мұздатқыш сығымдағыштар
үшін майды құйып алу.
Қолданылатын дәнекер құрамында силикон -0,01-0,4%; фосфор - 6,0%-7,0%, қалайы -6,0%-7,0%,
қоспалар - 0,15 % мыс негізінде жезпен мысты флюссіз дәнекерлеу үшін болуы тиіс.


ГТО ӛнім, қаптаманың ішінде - 2,5 кг



Магистральді су құбырындағы су беруді тоқтату/қосу, құдықтағы суды сорып тӛгу, д. 100
жапқышты (ысырманы) алып тастау/орнықтыру, д. 100 құбырын алып тастау, д. 100 ернемегі
бар құбырды орнықтыру, электрмен балқытып біріктіру жұмыстары
Сӛндіргіштің алдыңғы құбырын монтаждау және демонтаждау, катализаторды ауыстыру және
жӛндеу




Автомобильды тежегіш дисктерін жону үшін арналған арнайы аппаратта тежегіш дисктерін
жону -4 дн., алдыңғы тежегіш қалыптары, ауыстырумен - 1 жиын, артқы тежегіш қалыптары,
ауыстырумен - 1 жиын, 12V5W қызу шамы, ауыстырумен - 2 дн.




пішімі А 4, ӛлшемі 210 * 297 мм, тығыздығы 80 г/кв. м, қорапта - 500 парақ, ақшылдығы 103 %




Пішімі А 4, қапсырма - 100 дн, түсі мӛлдір, материал полипропилен, тығыздығы 60 мкр. кем
емес



үзілмелі шуылды ӛлшеу - 18 ӛлшеу, микроклиматын ӛлшеу - 48 ӛлшеу, жарықталуын ӛлшеу - 80
ӛлшеу, ауада зиянды заттарды ӛлшеу



ГАЗ-3307, ГАЗ-2410 автокӛліктік техникалық қаралуын қалыптастыру бойынша қызметтер




Қызмет кӛрсету нәтижесі: ангиогенин субстанциясының экспериментальды-зертханалық
сериясын жасаутуралы есеп беру
ГСХ әдісімен алифатикалық және ароматикалық фракцияларын анықтау. Химиялық талдауды
жасау мерзімі: үлгілерді алған күннен бастап 15 жұмыс күн

Шайыр мен асфальтенді экспресс әдісімен анықтау. Химиялық талдауды жасау мерзімі:
үлгілерді алған күннен бастап 15 жұмыс күн

Қатты парафиндерді экстракциялау және сіңіру әдісімен талдау. Химиялық талдауды жасау
мерзімі: үлгілерді алған күннен бастап 15 жұмыс күн.

Құжаттарды, хаттарды, пакеттерді және т.т. әр түрлі кӛлікпен халықаралық және ішкі экспресс
жеткізу қызметтері



Жай хаттар, бандерольдер, почта карточкалар



Кӛшеттерді таңбалау және жинақтау, жалпы ауданы - 60 000 м2; регенеранттарды сынау
кӛшеттігінде егістіктердің ӛнгіштігін есептеу; селекция кӛшеттіктерде - 1200 линияларға
фенологиялық бақылау жүргізу, жалпы ауданы - 60 000 м2; регенеранттарды сынау
кӛшеттерінде - 1200 линияларды гербицидтермен ӛңдеу, жалпы ауданы - 60 000 м2; егістердің
күтімі – 1200 линияларды күтіп баптау (егістегі жолдарды қолмен шыңдау және арамшӛптерді
отау), жалпы ауданы - 60 000 м2; 1200 линиялардың ауруға және зиянкестерге тӛзімділігін
бағалау; егістік жағдайда регенеранттардың 1200 линияларының құрғақшылыққа тӛзімділігін
бағалау; кӛшеттіктердегі 480 линиялардан элиталық масақтарды сұрыптау; сынау
кӛшеттіктеріндегі 720 регенеранттарды механикалық жинау; қолмен жиналған 480 регенерант
линияларын бастыру; ӛнімді 720 линиялардың дән сапасын бағалау және биохимиялық талдау;
кӛшеттіктердегі 384 линияларды құрылымдық талдау; ҒЗЖ нәтижелерін ӛңдеу, есеп жазу




Кӛшеттерді таңбалау және жинақтау, жалпы ауданы- 40 028 м2; регенеранттарды сынау
кӛшеттігінде егістердің ӛнгіштігін есептеу; селекция кӛшеттіктерде - 698 линияларға
фенологиялық бақылау жүргізу, жалпы ауданы- 40 028 м2; регенеранттарды сынау кӛшеттігінде -
 698 линияларды гербицидтермен ӛңдеу, жалпы ауданы - 40 028 м2; егістердің күтімі – 698
линияларды күтіп баптау (егістегі жолдарды қолмен шыңдау және арамшӛптерді отау), жалпы
ауданы - 40 028 м2; 698 линиялардың ауруға және зиянкестерге тӛзімділігін бағалау; егістік
жағдайда регенеранттардың 698 линияларының құрғақшылыққа тӛзімділігін бағалау; кӛшеттегі
279 линиялардан элиталық масақтарды сұрыптау; сынау кӛшеттіктеріндегі 419 регенеранттарды
механикалық жинау; қолмен жиналған 279 регенерант линияларын бастыру; ӛнімді 419
линиялардың дән сапасын бағалау және биохимиялық талдау; кӛшеттіктердегі 384 линияларды
құрылымдық талдау; ҒЗЖ нәтижелерін ӛңдеу, есеп жазу




Тізім бойынша - 12 адам




УАЗ-39094 жылжымалы зертхананың автокӛліктік техникалық қаралуын қалыптастыру
бойынша қызметтер




Кӛлік құралдарының йелерінің АҚЖ, сақтандыру полисін беру, УАЗ-39094 маркалы автомобиль
кӛлігі жылжымалы зертхана - бір дана

Астана - Бұрабай - Щучинск - Астана бағдары бойынша су, ӛсімдіктер және түптік шӛгінді
сынамаларын сұрыптап алу мақсатында экспедициялық жұмыстар жүргізу үшін автокӛлікті
жалдау. Жолаушылар орны - 12. Жалдау бағасына жанар-жағар маймен қамтамасыз ету
шығыны, техникалық қызметтер, транспорт құралын басқару қызметі, жүргізушінің тұру
орнымен тамақтануы кіреді. Жалдау мерзімі - 6 тәулік
Ерітінді құрамында 0,5 г/л трипсин (1:250), CaCl2, MgCl2 • 6H2O, және MgSO4 • 7H2O
қоспасынсыз теңестірілген Хэнкс ерітіндісінде 0,2 г/л EDTA•4Na. Құрамында фенол қызыл бар.
Ерітінді вирустар және микоплазмаларға тексерілді, қақпағы бұралып жабылатын пластик
сауыттарға құйылды, ерітінді кӛлемі 100 мл. орамада 20 сауыт бар.



Ерітінді құрамында 2,5 г/л трипсин (1:250), CaCl2, MgCl2 • 6H2O, және MgSO4 • 7H2O
қоспасынсыз теңестірілген Хэнкс ерітіндісінде 0,2 г/л EDTA•4Na. Құрамында фенол қызыл бар.
Ерітінді вирустар және микоплазмаларға тексерілді, қақпағы бұралып жабылатын пластик
сауытқа құйылды, ерітінді кӛлемі 100 мл. орамада 20 сауыт бар.



0,4% трипанды кӛк ерітіндісі. Зарарсызданған, жасуша ӛсінділерінде тексерілген. Сауыттағы
мӛлшері 20 мл.

Күкіртті сутекті ӛткір иісі бар түссіз сұйықтық. Тазалығы 99%. Концентрациясы 14,3 M.
Жасуша ӛсінділерде тексерілген. Сауыттағы реагент кӛлемі 100 мл.

SB 431542 гидраты ұнтақ түрінде берілген. TGF-β cупертұқымдастығының тип I мықты
селективті ингибиторы. Химиялық формуласы: C22H16N4O3 · xH2O. Молекулярлық салмағы:
384,39. Тазалығы:≥98% (ВЭЖХ). Ерігіштігі: ДМСО-да. Сауыт құрамында 5 мг зат бар.



65%, химиялық таза, МЕМСТ 4461-77



Азур II



Қан препараттарын бояу үшін, ТШ 9398-003-2508133-06



Аланинаминотрансферазаны кинетикалық әдіспен анықтау, 1 орама 1 қан жинағы үшін



97 %, орамада - 25г



Бейтарап сұйық сабын-концентрат, медициналық мақсаттар үшін, қол жууға арналған. Бояусыз
және иістендірушісіз. 1 шӛлмекте - 5 литр

Бұқа альбумині, сарысулық лиофилизирленген ұнтақ түрінде беріледі, протеазасы жоқ.
Молекулярлық биология үшін арналған. Сауыт құрамында 100 гр альбумин бар.

Шошқаның сарысулы альбумині, лиофилизденген ұнтақ түрінде. Тазалығы 98%. Сауытта 1 гр.
бар.

Альгинат қоңыр балдырлардан алынған. Химиялық таза. Орама буып-түюі 1 кг.



Жасуша ӛсінді ортасы құрамында рибонуклеозид, натрий бикорбонаты, фенол қызыл, L-
глютамин бар. Сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып
жабылатын қақпағы бар пластикалық сауытта, сауыттағы орта кӛлемі 500 мл

Жасуша ӛсінді ортасы құрамында рибонуклеозид, натрий бикорбонаты, фенол қызыл, L-
глютамин бар. Сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып
жабылатын қақпағы бар пластикалық сауытта; орама 6 сауыттан құралады



Таза, ТШ 6-09-426-75



Аммоний азотқышқылы
Хлорлы аммония, химиялық таза, тұз ретінде берілген, орама буып-түюі 0,5 кг.



1 млрд. жасушалардың сепарациясына арналған магнитті бӛлшектерімен конъюгирленген
тышқанға қарсы IgG1 моноклоналды антиденелері. Антиденелер құрамында азид натрии бар
бұқа сарысу альбумин ерітіндісінде сақталынады. Сауыттағы реагент мӛлшері 5 мл

Аспартатаминотрансферазаны кинетикалық әдіспен анықтау, 1 орама 1 қан жинағы үшін



Таза, анализ үшін, негізгі заттың массалық салмағы 99,75% кем емес. МЕМСТ 2603-79



Йендрасик - Гроф әдісімен жалпы және тікелей билирубиннің концентрациясын анықтау, 1
орамада 142 анықтау (1 жинау)

Етпептонді сорпа



Құрғақ қоректік сорпа



Хотингер сорпасы



Рулонда



1 шӛлмекте - 2500 мл-ден



Вальпроин қышқылы май қышқылдарына жатады. Натрий вальпроаты синонимы бар.
Химиялық формуласы: C8H15NaO2. Молекулярлық салмағы: 166,19. Тазалығы:≥98%.
Ерігіштігі:H2O: 50 mg/mL. Сауыт құрамында 10 грамм зат бар. Тырысуға қарсы қасиетке ие.
Индукцияланған плюрипотентті бағаналы жасушалардың шығуын жоғарылату мақсатында
қолданылады.
БҚ, цилиндрлік, 500 мл-ге



В-36х50



Хроматографияға арналған орамада 0,66кг, ТШ COMP 2-009-06 (6-09452-77 ТШ тәрізді)



Колориметриялық цианидтік әдіс, 1 орамада 1 жинақ



Хроматографияға арналған, орамада 1л = 0,68 кг. (99,9%), ТШ COMP 3-052-08



Бұқаның жұмыртқасынан алынған гиалуронидаза, Тип I-S. Лиофизирленген ұнтақ түрінде
берілген. Белсенділігі: 400-1000 Ед/мг. Сауыт буып-түюі 500 мг.

Бӛлініп алынатын қақпақшасымен, орамада - 500 дана



Таза, МЕМСТ 6259-75



Глюкозокзидаза әдісімен глюкоза концентрациясын анықтау, депротеинизациясыз, 1 орама 1
қанның жинағы үшін

Глютамакс 0,85% NaCl ерітіндісінде ерітілген. Концентрациясы: 200 mM. Сулы ерітінділерде
тұрақты. Құрамында дипептид L-Alanyl-L-Glutamine бар. Сауыттағы мӛлшері 100 мл.
Дексаметазон, ұнтақ түрінде . Жасуша ӛсінділерінде тексерілген. Сауыт буып-түюі 100 мг.



Натрий тұзының дихлоризоцианурон қышқылының 44,2 % тұратын белсенді хлорлы
залалсыздандырушы заттар, суда жақсы еритін таблеткалар

ДМСО - ≥99.9% полярлы апротонды еріткіш, химиялық реакцияларда қолданылады, ПТР,
сонымен қатар жасушаларды, ұлпа және мүшелерді қатыру үшін криопротектор ретінде де
қолданылады. Сауыттағы реагент кӛлемі 250 мл.
Химиялық таза, 12 бӛлшек суда еритін болуы тиіс, барлық қатынаста 95% спирт, бензол,
хлороформ мен эфир майларымен араласуы керек. ГОСТ 2600-001-43852015-02

Дульбекко фосфатты-тұзды буфер (1x), құрамында Са2+ және Mg2+ иондары жоқ, сұйық,
сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып жабылатын қақпағы
бар пластикалық сауытта, буфер кӛлемі 500 мл
Дульбекко фосфатты-тұзды буфер (1x), құрамында Са2+ және Mg2+ иондары бар, сұйық,
сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып жабылатын қақпағы
бар пластикалық сауытта, буфер кӛлемі 500 мл
Табиғи ӛскіндерден



П-11, азықтық



Шошқа терісінен алынған желатин, А Типі, Пішіні: ұнтақ. Жасушалық ӛсінділерге сәйкес келеді.
Жасушаларға субстрат ретінде қолданылуы ұсынылады. Орамада 100 гр. бар.

Химиялық таза, МЕМСТ 4148-78



Дифференциацияланбаған ұрықтық бағаналы жасушаларды ӛсіру және демеу үшін арналған
ұрықтық сарысу алмастырғышы. Сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде
тексерілген, бұралып жабылатын қақпағы бар пластикалық сауытта, сауыт кӛлемі 500 мл.



Streptomyces алынған флеомицин тұқымдастығының антибиотигі. Зеоцин бактерияларға,
саңырауқұлақтарға, ашытқыға, ӛсімдік жасушаларына және жануарлар жасушаларының
линиясына қарсы белсенділікке ие, сауыт буып-түюі - 1гр.

Изопропанол, химиялық таза, сауыт - 1 литр



Қан сарысуында CA15-3 онкомаркерін сандық анықтау үшін иммуноферметті тест-жүйесі.
Жиынтық 96 анықтауға есептелген.

Реагент лиофилизирленген ұнтақ түрінде берілген. Жасуша ӛсіндісі тексерілген. Сауыт кӛлемі -
50 мг.

Реагент, сұйық түрінде (100×). Сүзгілеу арқылы зарарсызданған. Жасуша ӛсінділерінде
тексерілген. Сауыттағы реагенттің мӛлшері 5 мл.

МЕМСТ 4217-77



Химиялық таза



МЕМСТ 4198-75, химиялық таза



Химиялық таза



Таза
Ақ түсті гранулалар түрінде берілген.



Диаметр 0,6 мм



Диаметр 1,0 мм



Таза



Сұйық және құрғақ стандартты ерітінділерді дайындау үшін. ТУ 2642-0013381273-97



Метафосфорлы, хроматографияға арналған, орамада 1 кг



Таза, анализ үшін



Металл сымнан жасалған торлар (тотталмайтын болат), 6 егеуқұйрыққа арналған астау, тор
ӛлшемі - 300мм х 400мм х 210мм

Хлорлы, 6-сулы, химиялық таза



Продуцент: Ешкі, Клондығы: поликлоналды; Тазалығы: IgG фракция; Конъюгация: түбір тамыр
пероксидазасы (HRP); Пішіні: сұйық; Концентрациясы: 2 мг/мл; сауыт құрамында 1 мг антидене
бар

КН-1-100-19/26 шыны үйкелісті тығын



2а-50-2 шыны тығынымен



2а-25-2 шыны тығынымен



2а-10-2 шыны тығынымен



Фермент Clostridium histolyticum – дан алынған. Ұлпа диссоциациясына арналған.
Лиофизирленген ұнтақ түрінде берілген. Сауыт құрамында 1 грамм зат бар.

Фермент Clostridium histolyticum –дан алынған. Ұйқы безі ұлпасының диссоциациясына
арналған. Лиофизирленген ұнтақ түрінде берілген. Сауыт құрамында 1 грамм зат бар.

60 мл, бұрамалы қызыл қақпақпен, жеке орамада, таңбалы панелмен (зарарсызданған)



100 заттық шыныларға қорап-абақ, қызыл, қабықты қақпағы бар, ӛлшемі 208х175х34 мм



Гимза ерітіндісі. Сауыт құрамында 100 мл бояушы зат бар



Кинетикалық әдіспен анықтау, Яффе реакциясы, депротеинизациясыз, 1 орамада 100 мл
(1жинау)

Крио шыны түтікшелер, кӛлемі 2,0 мл, коникалық, бұрылмалы қақпағымен, таңбаланған
панельмен, градуирленген, жұмыс температурасы - 170ºС дейін, ашық түс. орамада 500 дана.
ЛДГ-ны кинетикалық UV әдісімен анықтау, 1 орама 1 қанның жинағы үшін



Атом — абсорбциондық спектрофотометрге арналған газоразрядті дейтерилі шам.
Тұтандырғыш кернеуі 450В, жұмыс кернеуі 125В.

Cr-Co-Cu-Fe-Mn-Ni - ге (кодталған) кӛпэлементті



Химиялық таза, мұзды, негізгі заттың массалық салмағы 99,9%, тӛмен емес, МЕМСТ-61-75



Пластик, ромба тәрізді, 30мл



Химиялық таза, МЕМСТ 4523-77



Таза, талдау үшін, МЕМСТ 435-77



Кӛк түсті



Кӛлемі 50 мл, иілетін ауызымен, зарарсызданған. Жоғары сапалы полистиролдан жасалған.
Бұралатын қақпағы бар, моноқабатты жасуша ӛсіндісін ӛсіру үшін, желдетілмейтін қақпақпен.
Орама құрамында 20 дана

Жасушаларды ӛсіру үшін матрацтар, желдетілмейтін қақпағымен, иілетін мойны бар, 650 мл,
зарарсызданған. Гамма-сәулелерімен зарарсызданған. Жоғары сапалы полистеролдан жасалған.
Газ алмасу үшін 0,2 мм гидрофобты сүзгі мембранасы бар желдетілмейтін қақпақ. 2 ұстанымда
блокталу арқылы жүзеге асатын айналмалы қақпақ. Иілген мойнында anti-tip арнайы жиек.
Жабысатын жасушалардың оңтайлы байланысуы және ӛсуі үшін гидрофобты жабын. орамада 5
дана бар.



Жасушаларды ӛсіру үшін матрацтар, желдетілмейтін қақпақпен, иілетін мойынымен, 250 мл,
зарарсызданған. Гамма-сәулелерімен зарарсызданған. Жоғары сапалы полистеролдан жасалған.
Газ алмасу үшін 0,2 мм гидрофобты сүзгі мембранасы бар желдетілмейтін қақпақ. 2 позицияда
блокталу арқылы жүзеге асатын айналмалы қақпақ. Иілген мойнында anti-tip арнайы каемка.
Жабысатын жасушалардың оңтайлы байланысуы және ӛсуі үшін гидрофобты жабын. орамада 5
дана бар



Таза, талдау үшін, МЕМСТ 4165-78



Шыны, 100 мл-ге



Шыны, 250 мл-ге



Шыны, 500 мл-ге



Шыны, 1000 мл-ге



Таза, анализ үшін



Микро шыны түтікшелер, кӛлемі 1,5 мл Eppendorf центрифугаға арналған. орамада 500 дана бар
0,2 мл ПТР-ға арналған микротүтікшелер, жазық қақпақшамен, автоклавтанатын, ДНҚ-аза, РНҚ-
аза және пирогендерден бос. (орамада -1000 дана)

Жасуша ӛсінді үшін орта құрамында Эрл тұздары, натрий бикарбонаты, фенол қызыл, тұрақты
L-глютамин бар. Сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген,
бұралып жабылатын қақпағы бар пластикалық сауытта, сауыттағы орта кӛлемі 500 мл

Уреазды/глутаматдегирогеназды кинетикалық әдіспен анықтау, 1 орамада 1 жинақ



Осt3/4 қарсы тышқанның моноклоналды IgG антиденесі аффинді-тазаланған, Пішіні: сұйық,
Изотип: IgG1. Реактивтілігі: адам (Hu), тышқан (Ms). Қолданылуы: иммуноцитохимия,
иммуногистохимия. Сауыт құрамында 150 мкг антидене бар. Концентрациясы: 250 мкг/мл

Тип II коллагенге қарсы тышқанның моноклоналды IgG антиденесі, Пішіні: сұйық,
Концентрациясы: 1мг/мл. Реактивтілігі: адам (Hu), тышқан (Ms) Қолданылуы:
иммуноцитохимия, иммуногистохимия. Сауыт құрамында 100 мкл антидене бар
ErbB 2 қарсы тышқанның моноклоналды IgG антиденесі, Пішіні: сұйық, Реактивтілігі: адам
(Hu). Қолданылуы: иммуноцитохимия, иммуногистохимия. сауыт құрамында 100 мкг антидене
бар

Nanog қарсы тышқанның моноклоналды IgG антиденесі, аффинді-тазаланған, Пішіні: сұйық,
Изотип: IgG1 Реактивтілігі: адам (Hu), тышқан (Ms). Қолданылуы: иммуноцитохимия. Сауыт
құрамында 0.1 мг антидене бар. Концентрациясы: 0.5 мг/мл

SSEA-4 қарсы тышқанның моноклоналды IgG антиденесі протеин А арқылы тазаланған, Пішіні:
сұйық, Изотип: IgG3, Реактивтілігі: адам (Hu), тышқан (Ms). Қолданылуы: иммуноцитохимия.
Сауыт құрамында 100 мкг антидене бар

Адамның CD117 қарсы IgG1тышқан моноклоналды антиденелері. Концентрациясы 0,5 мг/мл.
Антиденелер, құрамында 0,09% азид натрийі бар буфер ерітіндісінде орналасқан.
Сауыт құрамында 0.1 мг антидене бар



TRA-1-60 қарсы тышқанның моноклоналды IgМ антиденесі, Пішіні: сұйық, Реактивтілігі: адам
(Hu). Қолданылуы: иммуноцитохимия. Сауыт құрамында 100 мкг антидене бар



Геномды толық РНҚ-ды жасушалар, ұлпалардың ӛсіндісінен және ақ қан түйіршіктерінен бӛліп
алу жиытығы. Шамамен 50 толық РНҚ-ды бӛліп алу ға есептелген.Құрамында: жинау үшін
арналған 10 тізбек орамасы және элюиция үшін шыны түтікшелер (бір орамада 5 дана); 50мл
лизисті буфері; 20мл еріткіш буфер (кӛк буфер); 2мл Меркаптоэтанол (48.7%); 1 сауыт ДНҚаза I
(лиофизирленген); 250мкл MnCl2, 0.09M; 2.5мл сары негізгі буфер; 5.3мл ДНҚаза тоқтатқыш
ерітінді (концентрацияланған); 58,8мл РНҚ жуғыш ерітінді (концентрацияланған); 13мл
нуклеазасыз су; 1 хаттама.



Жануарлардың қанын анықтауға арналған гематологиялық анализ жиынтығы,125 анализға



Адам эритропоэтинін мӛлшерлі түрде анықтау үшін арналған 96 тест



Толық жасушалық РНҚ-дан немесе полиА+мРНҚ немесе кері транскрипция реакциясынан
алынған синтетикалық транскрипті РНҚ-дан кДНҚ бірінші тізбегін алу және ПТР арқылы
амплификациясымен жалғасатын үрдіс үшін арналған жиынтық. Жиынтық әрқайсысы 20 мкл
болатын кДНҚ-ның бірінші тізбегінің синтезі үшін шамамен 100 реакцияға есептелген.
Қосымша әрбір жинақ құрамында 1,2кб РНҚ транскрипті – оң бақылау және ген-арнайы
праймерлері 5 бақылау ПТР-РУ амплификациясында қолдану үшін.Құрамында: 100мкл ImProm-
II™ кері транскриптаза; 600мкл ImProm-II™ 5X реакциялық буфер, 1.2мл MgCl2; 320мкл қоспа
dNTP; 50мг Олиго(дТ)15 праймерлері; 50мг кездейсоқ праймерлері; 5 мг 1,2кб оң РНҚ бақылау
Канамицин; 100мкл жоғарғы бақылау праймер, 100мкл тӛменгі бақылау праймер; 2,5 мл
нуклеазасыз су; 2,500u рекомбинантты RNasin рибонуклеаза ингибиторы; 1 хаттама.
Адам эритропоэтинін мӛлшерлі түрде анықтау үшін арналған 96 тест



Жиынтық қатты, түбі дӛңгелек 12×75 мм немесе 17×100 мм пластикті түтікшелерге арналған 6
ұяшығы бар пластиктен жасалған қорабымен қамалған, тұрақты сирек-жерлі магниттен тұрады

Жиынтық құрамында бромохлороиндолил фосфат (BCIP) және тетразолиум нитро кӛк (NBT)
бар негіз фосфотазасы үшін қоскомпонентті буферленген субстрат ретінде берілген. 2
компонентті жиынтық 400 мл жұмыс субстратын дайындау үшін есептелген.

Жиынтық ПТР-РУ талдауға оңтайланған. Құрамында: жасыл флуоресцентті бояғышы I, ДНҚ
полимеразасы, дНТП және дУТП, оңтайланған буферлік компоненттер




Стандартты-титрлар (фиксаналдар, нормадозалар) ТШ 6-09-2540-72



Кӛлемі 2-200 мкл мӛлшерлеуіш үшін, орамада 1000 дана



Мӛлшерлеуіш кӛлемі 200-1000 мкл, кӛк, Eppendorf тамызғышы үшін, 1 орамада - 500 дана



Eppendorf дозаторы үшін, кӛлемі 0,5-20 мкл, орамада - 1000 дана



Eppendorf дозаторы үшін, кӛлемі 0,1-10 мкл, орамада - 1000 дана



Eppendorf тамызғыш-мӛлшерлегіш үшін ұштықтар, 100-5000 мкл. орамада 100 дана



Кӛлемі 250 мкл, зарарсызданған, абақта 96 данадан



Кӛлемі 100-1000 мкл, зарарсызданған, абақта 100 данадан



Сусыз, химиялық таза, МЕМСТ 4166-76



Таза, талдау үшін



МЕМСТ 4233-77, химиялық таза



орамада 1 литр



Биуреттік әдіспен жалпы белок концентрациясын анықтау, 1 орамада 1 қанның жинағы үшін



0,01мм



Сұйық, коньюгат, 1мг, сауытта 0,5 мл



Орамада - 50 дана
OPTI-MEM I ортасы құрамында HEPES, 2,400 мг/л натрий бикорбонаты, гипоксантин, тимидин,
натрий пируваты, L-глютамин, микроэлементтер, ӛсу факторлары, 1,1 мг/ л фенол қызыл бар.
Сұйық. Сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып жабылатын
қақпағы бар пластикалық сауытта, сауыттағы орта кӛлемі 500 мл



Сауыт- 150 мл



Диаметрі - 4 мм, ұзындығы - 22 см



Ұзындығы - 250 мм



1 орамада - 5 кг-нан



Параформальдегид ақ ұнтақ түрінде берілген. Тазалығы 95%. Ұлпа және жасушаларды бекіту
үшін қолданылады. Сауыт буып-түюі 0,5 кг.

МЕМСТ 177-88, концентрациясы 30 % кем емес



Сутегі тотықтың салмақтық бӛлігі 37%, МЕМСТ 177-88



Тот баспайтын болат



1мл-ден 100мл аралығындағы тамызғыштар үшін пипетатор (автоматты нәк). Құрамында
тамызғыштар үшін силиконды адаптер, ауа сүзгіш, қуаттайтын құрылғы 2.8V/60mA,
аккумуляторды қайта зарядтау және сақтау үшін арнайы абақ бар

3-1-2-1 мл толық құйылмалы



Пастер тамызғыштары, шыны, Ұзындығы: 225 мм, Кӛлемі: 2 мл. орамада 250 дана бар.



Кӛлемі 500-5 000 мкл-ге



Толық құйылымды, градуирленген 0,01 мл, кӛлемі 1 мл полистиролды, зарарсызданған, жеке
орамада

Толық құйылымды, градуирленген 0,01 мл, кӛлемі 2 мл полистиролды, зарарсызданған, жеке
орамада

Толық құйылымды, градуирленген 0,1 мл, кӛлемі 5 мл полистиролды, зарарсызданған, жеке
орамада

Толық құйылымды, градуирленген 0,1 мл, кӛлемі 10 мл полистиролды, зарарсызданған, жеке
орамада

Сауыт кӛлемі 500 мл Қызғылт түсті сұйықтық, жасуша және ұлпа ӛсіндісі үшін, Эрл тұздарында
дайындалған біреселік ерітінді, L-глютамині бар, аустырылмайтын амин қышқылдарымен,
зарарсызданған, сүзгіленген, бұралып жабылатын қақпағы бар пластикалық сауытта

Сауыт кӛлемі 500 мл. Қызғылт түсті сұйықтық, жасуша және ұлпа ӛсіндісі үшін Эрл тұздарында
дайындалған біреселік ерітінді, L-глютамині бар, сүзгіленген, зарарсызданған, бұралып
жабылатын қақпағы бар пластикалық сауытта

Сауыт кӛлемі 500 мл. Қызғылт түсті сұйықтық, жасуша және ұлпа ӛсіндісі үшін, біреселік
ерітінді Эрл тұздарында дайындалған, L-глютамині және натрий пируваты бар,
ауыстырылмайтын амин қышқылдарымен, зарарсызданған, сүзгіленген,бұралып жабылатын
қақпағы бар пластикалық сауытта
Жасуша ӛсінді үшін орта құрамында 4,5 г/л глюкоза, L-глютамин, аминқышқылдары және
дәрумендердің 4-еселенген концентрациясы, натрий бикорбонаты, фенол қызыл, сұйық,
сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып жабылатын қақпағы
бар пластикалық сауытта, орта кӛлемі 500 мл

Жасуша ӛсінді үшін орта құрамында 4,5 г/л глюкоза, тұрақты L-глютамин, аминқышқылдары
және дәрумендердің 4-еселенген концентрациясы, натрий бикорбонаты, фенол қызыл, сұйық,
сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып жабылатын қақпағы
бар пластикалық сауытта, орта кӛлемі 500 мл

Жасуша ӛсінді үшін орта құрамында 1000 мг/л глюкоза, L-глютамин, бикорбонат натрия және
фенол қызыл бар. Сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген,
бұралып жабылатын қақпағы бар пластикалық сауытта, орамада орта кӛлемі 500 мл болатын 6
(алты) сауыт болуы тиіс

Жасуша ӛсінді үшін орта құрамында 1000 мг/л глюкоза, HEPES, L-глютамин, натрий
бикарбонаты және фенол қызыл бар. Сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде
тексерілген, бұралып жабылатын қақпағы бар пластикалық сауытта. Сауытта 500 мл

Ұрықтық және индукцияланған плюропотентті бағаналы жасушаларды ӛсіру үшін арналған
оңтайландырылған негізгі орта. Орта құрамында глютамині жоқ. Сұйық. Сүзгілеумен
зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып жабылатын қақпағы бар
пластикалық сауытта, сауыттағы орта кӛлемі 500 мл

Жасуша ӛсіндісінің ортасы екі ортаның араласуынан тұрады (1:1), ДMEM және Хэм F12
құрамында 3151 мг/л декстроза, 2,5 mM L-глутамин, 15mM HEPES, 55 мг/л натрий пируваты,
фенол қызыл, сұйық, сүзгілеумен зарарсызданған, жасуша ӛсінділерінде тексерілген, бұралып
жабылатын қақпағы бар пластикалық сауытта, сауыттағы орта кӛлемі 1000 мл

Ӛсіру үшін арналған 24 ұяшықты планшет,17,8/16мм, ұяшық V = 3,6мл, қақпағымен
(зарарсызданған), жеке орамада.

Бір қабатты жасушалардың ӛсіндісін ӛсіру үшін 4 ұяшықты планшет, түбі жазық,V=1мл,1,9
кв.см, ӛлшемі 66*66 мм (зарарсызданған). орамада 4 дана бар.

Бір қабатты жасушалардың ӛсіндісін ӛсіру үшін арналған 6 ұяшықты жазық түпті планшет,
зарарсызданған, жеке орамада.

Зарарсыздандырылған, жазық түбті, моноқабатты жасушалар культурасы үшін қақпағымен,
жеке орамада, 17,8/16мм, ұяшықтар V = 0,29мл, орамада – 50 дана

ПТР үшін 96 ұяшықты планшет, V=0,3мл, бортсыз, (зарарсызданған). орамада 25 дана.



Ӛлшемі 200ммх300ммх0,05мм, жұмыс температурасы 120 градус Цельси бойынша



Парафилмнен, ӛлшемі 10см х 38м, орамада 1 орам.



Химиялық зат орташа молекулярлық ӛлшемі 3500-4500 дальтон орамада 1 кг



DAP-60K автоклавы үшін, орамада – 25 дана



Градуирленген, конусты, центрифугаға арналған П-1-10-0,2, 1 орамада 100 дана



30мм х 115 мм, 50 мл, конустық, тұрақты, градуирленген, бұралатын қақпағы бар
(зарарсызданған) жеке орамада

16х100 мм, пластик, конусты, кӛлемі 10 мл бұралатын қақпағымен, градуирленген,
маркировкалық бекейімен, орамада -100 дана
ПБ-2-21-200



16 х 150 мм, 19 мл, бұралатын қақпақшасымен, цилиндрлі, орамада - 125 дана



97мм х 16 мм, 10 мл, бұралатын қақпағы бар, конустық, тұрақты, орамада – 100 дана



Пластик, 16 х 100мм, 10 мл, бұралатын қақпақшасымен, цилиндрлі



50мл, конусты, градуирленген, бұралатын қақпағымен, орамада - 40 дана



Фермент Tritirachium album Limber саңырауқұлақтан бӛлінген, лиофилизденген ұнтақ түрінде.
Сауыт буып-түюі 100 мг.

Микоплазманы анықтау үшін реал уақытта ПТР реакциясы жиынтығы (ПТР-РУ). Жиынтық
микоплазманы және басқа жақын туысты түрлер, яғни Acholeplasma laidlawii және Spiroplasma
citri сияқты түрлерін бақылау және анықтау үшін жасалған. Реакцияда SYBR Green бояу
технологиясы қолданылады. Жиынтық шамамен 25 реакцияға есептелген. Құрамында
праймерлер қоспасы бар (10х қоспа) 1 шыны түтікше – 100мкл; теріс бақылау (су) 1 шыны
түтікше – 1000мкл; мастер микс power SYBR Green (2х қоспа) 2 шыны түтікше – 500мкл; ДНҚ
бақылау 1 шыны түтікше, 1000 копия/мкл, 400мкл.



200 mM L-глютамин ерітіндісі, 0,85% NaCl құрамында 29,2 мг/мл концентрациясында. Сұйық,
зарарсызданған, бұралып жабылатын қақпағы бар пластикалық сауытта. Сауыттағы ерітінді
кӛлемі 100 мл.
Ерітінді дистилденген суда дайындалған. альфа-MEM ортасындағы ауыспайтын
аминқышқылдарының 100X концентрацияланған ерітіндісі. Сауыт100 мл кӛлемінде.

100 mM натрий пируват ерітіндісі, 0,85% NaCl құрамында 11мг/мл концентрациясында. Сұйық,
зарарсызданған, бұралып жабылатын қақпағы бар пластикалық сауытта. Сауыттағы ерітінді
кӛлемі 100 мл
Сауытта - 500 мл



1 сауытта - 100 мл. (1х) 0,05%/0,02% трипсин және этилендиаминтетрацетат (ЭДТА) ерітіндісі.
Фосфатты-тұзды ерітіндіде дайындалған, зарарсызданған, сүзгіленген, 1 орамада 3 сауыттан

1 сауытта - 100 мл. 0,5% трипсин және 0,2% этилендиаминтетрацетат (ЭДТА) 10-еселік
ерітіндісі. Зарарсызданған, трипсин және этилендиаминтетрацетаттың (ЭДТА) сүзгіленген
ерітіндісі, кальцийсыз және магнийсыз фосфатты-тұзды ерітіндіде дайындалған, біреселік
ерітінді, пластикалық сауытта бұралып жабылатын қақпағы бар

Трансфекциялауға арналған реагент, 1мл, 300 трансфекцияға дейін. Жануарлар және жәндіктер
жасушаларын уақытша (транзиторлы) және тұрақты трансфекциялау үшін. 1 сауытта 1мл
реагент бар. Тұжырымы: липидтердің және басқа компоненттердің патенттелген қоспасы,
құрамында 80% этанол, зарарсызданған, шыны сауытта сүзгіленген және буып-түйілген.
Құрамында адам немесе жануар компоненттері жоқ.

ТШ 6-09-2089-77, таза, анализ үшін



Ацетилендік 1 монометр: баллондағы рұқсат етілген қысым - (0 МПа...(2.5 МПа)...4 МПа); 2
монометр: баллоннан шығу кезіндегі рұқсат етілген қысым - (0 МПа... (0.15 МПа)...0.4 МПа);
Жұмыс қысымы - 0.12 МПа
Таза, анализ үшін, МЕМСТ 4236-77



Тот баспайтын болат
ГТО ӛнім, орамада - 2,5 кг



Кӛлемі 35 литр, биоматериалды сұйық азотта сақтау және тасымалдау үшін.



Қызғылт түсті сұйық, суспензиялы культуралар мен ұлпаларды ӛсіруге арналған, бір реттік
сұйықтық, L-глютамині қосылған, натрий бикорбонатымен, зарарсызданған, сүзгіленген,
бұралып жабылатын қақпағы бар пластикті сауытта, жеке целофанды орамада, орамада 25
сауыт, сауыт кӛлемі 500 мл
рН жұмыс эталоны үшінші разрядты рН-метрия буферлі ерітінділерді дайындау үшін (6 ампула)
1,65;3,56;4,01;6,86;9,18;12,45 МЕМСТ 8.135-2004; орамада - 6 ампула

Шыны, В-400 шкаламен



Шыны, В-150 шкаламен



Шыны, В-600 шкаламен



Шыны, негіз диаметрі 100мм, стакан диаметрі 60мм



Шыны, Н-50 шкаласыз



Шыны, Н-200 шкаласыз



Шыны, Н-400 шкаламен



Шыны, Н-150 шкаламен



Шыны, Н-200 шкаламен



Шыны, Н-800 шкаламен



Жабын шынылар 18*18 мм (орамада - 100 дана)



Жабын шынылар 24*48 мм (орамада - 100 дана)



Ӛлшемдері 24х50 мм, орамада - 100 дана



Заттық шынылар 76х26х1 мм, орамада - 50 дана



Бұлыңғыр шетімен, орамада - 50 дана



Термометртехникалық, сұйықталған (0...+200)
тұмсық мӛлшері: -163 мм

Бӛлмеге арналған (- 30…+50 град.С)



50*19 мм түтіктердің, құрал-саймандардың, қоректік орталардың зарарсызданғандығын бақылау
үшін арналған
Таза, талдауға арналған, 1 сауытта - 100 гр.



Адамның рекомбинантты, трансформацияланатын ӛсу β1-факторы, HEK 293 жасушаларында
экспрессияланған. Лиофилизирленген ұнтақ түрінде берілген. Жасуша ӛсінділерде тексерілген.
Эндотоксинге тексерілген. Тазалығы ≥97%. Мол.салмағы: 25 kDa. Сауыт құрамында 5 мкг ТӚФ-
β1 бар.

Фермент бұқаның ұйқы безінен алынған. Ұлпалар мен жасушалардың диссоциациясына
арналған Лиофизирленген ұнтақ түрінде берілген. Белсенділігі: ≥10,000 Ақуыз BAEE Ед./мг .
Сауыт құрамында 100 мг зат бар.
Химиялық таза



Минус 20 Цельсий температуралық құбылыммен жеткізу



Адамның негізгі, рекомбинантты, фибробласт ӛсу факторы (ФӚФ), Е. Coli экспрессияланған.
Лиофилизирленген ұнтақ түрінде берілген. Жасушалық ӛсінділерде тексерілген. Тазалығы
≥97%. Сауыт құрамында 10 мкг ФӚФ бар. Ұрықтық бағаналы жасушаларды, фибробластарды,
хондроциттерді, эндотелиальді жасушаларды ӛсіру үшін қолданылады.

Жасушалар үшін сүзгі (Сell-strainer) мықты найлон тордан жасалған, тесік ӛлшемі 40 мкм. Сүзгі
қабырғалары полипропиленен дайындалған. 50 мл коникалық шыны түтікшелерге арналған.
Сүзгі жеке орамада буып түйілген. Зарарсызданған. Қорапта (шартты жәшік) 50 сүзгі.



Жасушалар үшін сүзгі (Сell-strainer) мықты найлон тордан жасалған, тесік ӛлшемі 70 мкм. сүзгі
қабырғалары полипропиленен дайындалған. 50 мл коникалық шыны түтікшелерге арналған.
Сүзгі жеке орамада буып түйілген. Зарарсызданған. Қорапта (шартты жәшік) 50 сүзгі.



Кӛк лента, 1 орамада - 100 дн, D=110 мм, күлсізденген



Қызыл ленталы d=180мм



Ақ/қызыл/кӛк ленталы d=150 мм



Бейтарап шыны, 1 орамада-670 дана



1-10-2 тұмсықты шыны түбті, 10 мл



Таза



Шыны



Екі жақты металл ұзындығы 195мм



Полистиролдан жасалған, уытсыздандырылмаған, орама - 1000 дана



Бір рет қолданылатын пісік, уытсыздандырылған, 2гр инемен (0,6х30мм), үш бӛлімнен тұрады



Бір рет қолданылатын шприц, уытсыздандырылған,1мл инемен 30G х 12,5мм 3-топтама
ШФР-ММ металл табан-ұстауыштарымен



4 тамызғыш-мӛлшерлегіш үшін абақ, жан-жақты. Оргшыныдан дайындалған. Тамызгыштары
ретпен орналастырылған.

Ұштықтар үшін абақ 0-1000мкл, қақпақпен автоклавтанатын



Шыны түтік үшін 5-16 мм-лік, 40 ұяшықты орылған бетті агарлы қоректік орта алу үшін
285х115мм, 5 бұрышты немесе 20 градусты

Белсенділікті кинетикалық әдіспен анықтау, нитрофенил фосфат, АМП-буфер, 250 мл (1жинау) -
1 орама

Дигидраттың динатрилітұзы, 150°C-да қайнау температурасынан тӛмен кезіндеыдырайды,
салыстырмалы тығыздығы (су = 1):0,086. Судағыерігіштігі, г/100 мл:0,05 ТАҮ ТУ 6-09-11-1721-
85
Бұзаудың ұрықтық сарысуы, 56˚С температурада жылыту арқылы белсенденсіздендірілген, сүзгі
арқылы зарарсызданған, вирустар және микроорганизмдерге тексерілген, жасуша ӛсінділерінде
тексерілді, әртүрлі ферменттердің белсенділігі тӛмен. Сарысу кӛлемі 500 мл пластик сауытқа
құйылған.

Адамның рекомбинантты, эпидермалды ӛсу факторы, Е. coli экспрессияланған.
Лиофилизирленген ұнтақ түрінде берілген. Жасушалық ӛсінділерде тексерілген. Тазалығы
≥97%. Сауыт құрамында 0,1 мг ЭӚФ бар. Эпидермалды, эпителиальді жасушалар, фибробласт,
глиальді жасушалар, эндотелиальді жасушалар, хондроциттер үшін митоген ретінде
қолданылады.

5 мл., үшкомпонентті, зарарсызданған, жеке орамада



10 мл., үшкомпонентті, зарарсызданған, жеке орамада



Бекітетін лейкопластырь, мақталы-қағазды матаның негізінде, зарарсызданбаған. Ӛлшемі
2х300см.

Вертикалды - иілген үшкір біткен, 140 мм



Шоғырлануы - 28 гр/л., 1 сауытта - 500 гр.



ТШ 9398-020-78095326-2006



1 сауыт 500 гр.



Құрғақ



Сұйық ерітінді, шишада-0,95л



Eppendorf мӛлшерлеуіштеріне арналған, (0,5 - 5мл), орамада 100 данадан



Медициналық этил спирті, 90%. 100 мл. сауытта болуы тиіс.



Қызметкер еңбек (қызмет) мiндеттерiн атқарған кезде оның ӛмiрi мен денсаулығына зиян
келтiргенi үшiн жұмыс берушiнiң азаматтық-құқықтық жауапкершiлiгiн мiндеттi сақтандыру 

«Азық-түлік ӛндірісі үшін тікелей енгізу сүтқышқылды ашытқысын алу технологиясын
жетілдіру» тақырыбы бойынша тереңдігі 10 жыл патенттік ізденіс ӛткізу («Азық-түлік ӛндірісі
үшін тікелей енгізу сүтқышқылды ашытқысын алу технологиясын жетілдіру» тақырыбы
бойынша ӛнертабысқа сұранымды рәсімдеу үшін ӛңделген объекттің прототипы болуы керек.)

1 талдаудың ішіне: газдысұйыктық хроматография (ЖИД) (жалынды индукционды детектор)
және гравиметриялық талдау кіреді. Талдаулардың жалпы саны - 54




Парақтың ұзындығы 1,5 м, ені 1,0 м, маркасы - паронит жалпы мазмұнды, жанармайға тұрақты



Парақтың ұзындығы 1,5 м, ені 1,0 м, маркасы - паронит жалпы мазмұнды, жанармайға тұрақты



Резеңке МЖТ (майға, жанармайға тұрақты), рулонның ені 0,9-1м, қалыңдығы 3 мм




Резеңке МЖТ (майға, жанармайға тұрақты), рулонның ені 0,9-1м, қалыңдығы 4мм




Резеңке МЖТ (майға, жанармайға тұрақты), рулонның ені 0,9-1м, қалыңдығы 5мм




Мақта-маталы, сіңдірілген, маркасы ММ-31




Мақта-маталы, сіңдірілген, маркасы ММ-31




Жоғары тұтқыр мұнай майы, қальций сабынымен қоюландырылған, графит қосылған. ГОСТ
3333-80



Рампадан, желіден немесе балоннан келіп түсетін оттегінің — газдың қысымын реттеуге және
тӛмендетуге арналған. Сонымен қатар берілген газдың жұмыс қысымын бір қалыпта, автоматты
түрде ұстау үшін. Редукторға кірерде мүмкін болатын газдың ең үлкен қысымы - 200 кгс/см2 ,
ең кішісі - 26 кгс/см2, ең үлкен жұмыс қысымы - 12,5 кгс/см2 , ең кішісі - 1кгс/см2.



Микроағзалар штаммдарының патогенділігін анықтау және олардың әр қайсысына қорытынды
беру. Штаммдардың саны - 8 дана

ГСХ әдісімен алифатикалық және ароматикалық фракцияларды анықтау. Химиялық талдауды
жасау мерзімі: үлгілерді алған күннен бастап 15 жұмыс күн.
Байытылған 150 кг. топырақ алу. Қызанақ егістігін суару, бұтау - 500 дана, жалпы кӛлемі - 162 м
кв. Кӛшеттерді биопрепаратпен ӛңдеу. Бидай тұқымдарын биопрепаратпен инокуляциялау.
Жалпы кӛлемі 117 м2 жердегі бидайды баптау (жолдарды қолмен бӛлу, зиянкестерге қарсы
ӛңдеу, егістің арам шӛбін қолмен жұлу). Қызанақ ӛсімдігін баптау (пасынкілеу, бұтау, жолдарды
қолмен бӛлу, егістің арам шӛбін қолмен жұлу). Жалпы кӛлемі – 162 м2. Вегетация кезеңінде
қызанақ ӛсімдігін әр 5 тәулік сайын суару. Бидай ӛсімдігінің ӛсуі мен ӛнуіне фенологиялық
бақылау жасау (тұқымдардың ӛнгіштігі, гүлдену фазасы, масақтану, сүттік пісуі, балауыз пісуі
және толық пісуі). Барлығы 4500 дана. Бидай ӛсімдігінің фузариозды тамыр шірігіне
тұрақтылығын бағалау. Ӛсімдіктер саны 1500 дана. Зақымданған ӛсімдіктердің микологиялық
анализін жасау. Фузариозды қоздыратын 15 штамм бӛліп алу. Фузариоз инфекциясының түрдік
құрамын анықтау. Бидай ӛсімдігінің гельминтоспориозға тұрақтылығын бағалау. Ӛсімдіктер
саны 1500 дана. Bipolaris туысына жататын 12 штаммын бӛліп алу. Бидай тұқымының
альтернариозға инфициялануын бағалау. 15000 бидай тұқымына фитопатологиялық анализ
жүргізу. Alternaria туысына жататын 25 таза саңырауқұлақ дақылын бӛліп алу. Биопрепаратты
қолданған кездегі топырақтың фунгистазисін анықтау (300 нұсқа). Тәжірибеде 300 споралы
саңырауқұлақтардың уақытша прпараттары қолданылады. Қызанақтың фитофторға
тұрақтылығын бағалау. Ӛсімдіктер саны 100 дана. Микробиологиялық анализ үшін топырақ
үлгілерін алу. МПА, ККА және Чапека-Докс қоректік орталарын дайындау. Топырақтың негізгі
Анаэробты микроорганизмдер (жалпы микроб саны); Аэробты микроорганизмдер (жалпы
микроб саны); Бактероидтар; Бифидобактериялар; Лактобациллалар; Энтеробактериялар;
Proteus түрінің бактериялары; Стрептококтар (соның ішінде гемолитикалық стрептококтар);
Энтерококтар (соның ішінде энтерококтар гемолитикалық); Стафилококтар (соның ішінде
S.aureus); Клостридилер (соның ішінде лецитиназоғаоң клостридилер); Ашытқылар мен ашытқы
тәрізді саңырауқұлақтар; Зең саңырауқұлақтары; Жоғарыда кӛрсетілген микроағзалар тізімінің
сандық және сапалық құрамының мәліметтерін суреттеуді қоса, жасалған жұмыстың есебін
ұсыну.



1 500 м2 жалпы ауданда картоптың ӛсімдік- регенеранттарының қатар аралық культивациясын
жүргізу; Егістердің күтімі (егістегі жолдарды қолмен шыңдау, егісті зиянкестерге қарсы ӛңдеу
және арамшӛптерді қолмен қопсыту ) – 800 ӛсімдік, жалпы ауданы – 1 500 м2; Фенологиялық
бақылау жүргізу (шыққан ӛсімдіктер саны, жалғыз және жалпы кӛктеу уақыты, ӛсімдіктердің
старттық дамуы: 1 балл нашар, 5-орташа, 7- жақсы, 9- ӛте жақсы және т.б., жалғыз және жалпы
гүлдеуі, гүлдену кезіндегі бұта түрі, балл бойынша гүлдер бояуы, боялу қарқындылығы,
сабақтардың жойылуы); Ӛсімдіктің вирустық ауруларға тӛзімділігін (балл бойынша) бағалау,
ӛсімдіктер саны - 800 дана, ауру ӛсімдіктерді алып тастау; Фитофторға тӛзімділікті (балл
бойынша) бағалау, ӛсімдіктер саны - 800 дана; Ризоктонияға, қара аяққа және альтернариозға
(балл бойынша) бағалау, ӛсімдіктер саны - 800 дана; Ӛсімдіктердің зиянкестерге тӛзімділігін
бағалау (800 дана); Сабақтың физиологиялық күйін балл бойынша есепке алу (800 дана
ӛсімдік); Вегетация кезеңінде ерекше белгілерді есепке алу ( селекционерді қызықтырған
белгілерін белгілеу); Селекция кӛшеттіктеріндегі картоп линияларын суғару; Динамикалық
сынаманың 60-шы күн жылдам пісуінің селекциясы (әр қатарда 2 бұтадан); Жидек түзуді балл
бойынша есепке алу (ӛсімдіктегі жидек саны); Картоп линияларының жинау алдындағы
динамикалық сынамасы (әр қатарда 2 бұтадан), биометриялық есепке алу (тауарлық салмағы
және ұсақ түйнектер бӛліктері, тауарлығы %, тауарлық түйнектер саны); Анықтамалары: түйнек
Диаметрі 80 мм. жылыту жүйесінің тиек арматурасын, жылу жүйесін, кіруін; жылу енгізу
тораптарын тексеру (шойын суырманы толық бӛлшектеу, тазалау, сырлау, тегістеу және үйкелеу,
тығыздаманы алмастыру) - 10 дана. (Бойлер) ЖСЖ ысытқышының лас жинағышын тексеру.
Ішкі жылу жүйесін жуу және тұшыту. Жылу тораптарын тұшыту, (Бойлер) ЖСЖ ысытқышын
тұшыту. Жылу торабы және (бойлер) ЖСЖ ысытқышынның бӛлшектерімен конструкцияларын
сырлау.


4 дана суырманы (д-80мм.) демонтаждау. Д-80мм. дәнекерленген кран (ҚР МЕМСТ сәйкес)
монтаждаумен. 24 дана тіреушелердегі крандарды (д-20мм.) демонтаждау, 24 дана толық
ӛткізгішіті шар крандарын (д-20мм.) (ҚР МЕМСТ сәйкес) қадаушаға монтаждау. 28 дана
«Подача», «Обратка» тақтайшаларын тиек арматурасына орнату, тақтайшалар жанбайтын
материалдан жасалуы тиіс, кӛлемі - 5см. х 10см., орнатуымен. 2 дана бұрғышты (д-80мм)
демонтаждау және монтаждау.



Д-100 мм., 0-ден 10-ға дейінгі атмосфер (ҚР МЕМСТ сәйкес) ҚР заңнамаларына сәйкес
тексерулі, монтаждаумен



Корпусы болаттан, жұмыс диапазоны Цельсий бойынша 0-ден 150-ге дейін (ҚР МЕМСТ-қа
сәйкес) ҚР заңнамаларына сәйкес тексерулі, монтаждаумен
Ӛсімдік клеткаларын культивирлеуге арналған, химиялық таза фитогормон. Молекулалық
салмағы 225,3. Орамада - 5 г. Ӛсімдік клеткалары мен ұлпаларын культивирлеу үшін.

Сары түсті, ПТР ӛнімін еңгізу үшін. Қоректік орта мен ерітінді жасау үшін. Орамада 1000 дана



5х1 мл



ПТР ӛнімдерін амплификациялау үшін қолданылады.10хТаq буфер мен (NH4)2SO4 және 10хТаг
буфер мен KCl, сонымен қатар MgCl2 25мМ ерітіндісімен бірге жіберіледі. ДНҚ полимераза
94кДа массасымен. Ферменттің жартылай ыдырау кезеңі 40 мин 95С температурада.
Белсенділігі 5000 бірлік. Орамада (4 компонент: ДНҚ полимераза 10х500 дана, 5 дана/мкл
20х1,25 мл екі буфер, 20х1,25 мл магний хлорид ерітіндісі)

Фитогормон, молекулалық салмағы 186,2, химиялық таза. Орамада 25 г. Ӛсімдік клеткалары
мен ұлпаларын культивирлеу үшін.

Ӛсімдік клеткаларын культивирлеуге арналған, химиялық таза, 99% фитогормон, молекулалық
салмағы 264,3. Орамада - 100 мг. Ӛсімдік клеткалары мен ұлпаларын культиварторлау үшін.

ПТР нәтижелерін электрофорезде анықтау мақсатымен агарозды гелді жасау үшін
қолданылады. Орамада-1кг

Гельді дайындау үшін, тазалығы ≥ 99,5%



Бұқаның сарысу альбумині лиофилизацияланған ұнтақ түрінде, протеазадан босатылған. Ақуыз
концентрациясын анықтауға арналған (концентрациясы 10 mg/ml) 1 сауыт — 1 мл

Химиялық таза



2-ауыстырылған, азықтық. (Диаммоний фосфат)



ПТР ӛнімінің амплификациясы үшін қолданылады. Фермент ДНҚ полимеразаның химиялық
түрлендірілген моделін кӛрсетеді. Голд буфері мен MgCl2 ерітіндісімен жеткізіледі. ДНҚ
полимеразаның массасы 94 кДа, ультра таза, желатиннен бос. Ферменттің 95 С кезіндегі
жартылай ыдырау уақыты 40 мин. Белсенділігі 1 реакцияға 0,2 бірлік 5*1000 бірлік

Азықтық ӛнім мен жануарлар жемдеріндегі генетикалық түрлендірілген жүгеріні сандық
анықтауға арналған реагенттер жиынтығы «ДНК-сорб-С» реагент жинақталымымен нұсқа 50к
(«Rotor-Gene», «IQ5» құралы үшін)

Азықтық ӛнім мен жануарлар жеміндегі генетикалық түрлендірілген сояны сандық анықтауға
арналған реагенттер жиынтығы («ДНК-сорб-С» нұсқасы 50к жинақталымымен) («Rotor-Gene»,
«IQ5» құралы үшін)

Азықтық ӛнімдегі генетикалық түрлендірілген соя мен жүгерінің ингредиенттерін анықтауға
арналған реагенттер жиынтығы («Rotor-Cene», «IQ5» құралы үшін)

Азықтық ӛнім мен ӛсімдік шикізатындағы генетикалық түрлендірілген жүгеріні (промотор 35S
и терминатор Nos) анықтауға арналған реагенттер жиынтығы («Rotor-Cene», «IQ5»құралы үшін),
«ДНК-сорб-С» нұсқа 50к реагент жинақталымымен

Азықтық ӛнімдер мен жануарлар жемдеріндегі жүгерінің генетикалық түрлендірілген MON 810,
NK-603 и T-25 линияларын сәйкестендіруге арналған реагенттер жиынтығы («Rotor-Cene»,
«IQ5» құралдары үшін)
Азықтық ӛнімдер мен жануарлар жемдеріндегі жүгерінің генетикалық түрлендірілген GA-21,
MIR-604 және MON-863 линияларын сәйкестендіруге арналған реагенттер жиынтығы («Rotor-
Cene», «IQ5» құралдары үшін)
Азықтық ӛнімдер мен жануарлар жемдеріндегі жүгерінің генетикалық түрлендірілген 3272,
MON-88017 және Bt-11 линияларын сәйкестендіруге арналған реагенттер жиынтығы («Rotor-
Cene», «IQ5» құралы үшін)
Жүгерінің генетикалық түрлендірілген MON 810 линиясын сәйкестендіруге арналған реагенттер
жиынтығы. Нұсқа EPh 50R. 0,2 ПЦР- жинақталым пробиркалары («Gradient Palm Cycler» құралы
үшін)
ЭФ детекциясы бар тамақ ӛнімдерінде күріштің генетикалық түрлендірілген ингредиенттерін
анықтауға арналған реагенттер жиынтығы. Нұсқа EPh 50R. 0,2 ПЦР-жинақталым пробиркалары
(«Gradient Palm Cycler» құралы үшін)
Азықтық ӛнім мен ӛсімдік шикізатындағы генетикалық түрлендірілген сояны анықтауға
арналған реагенттер жиынтығы (промотор 35S және терминатор Nos) ( «Rotor-Cene», «IQ5»
құралы үшін), нұсқасы 50к «ДНК-сорб-С» реагенттер жинақталымымен

Азықтық ӛнім мен ӛсімдік шикізатындағы генетикалық түрлендірілген сояның линияларын
анықтауға арналған реагенттер жиынтығы («Rotor-Cene», «IQ5» құралы үшін)

Сояның генетикалық түрлендірілген 40-3-2 линиясын сәйкестендіруге арналған реагенттер
жиынтығы. Нұсқа EPh 50R. 0,2 ПЦР-жинақталым пробиркалары («Gradient Palm Cycler» құралы
үшін)
Тамақ ӛнімдерінде картоп және қызанақ ДНҚ-сы бар екенін анықтауға арналған реагенттер
жиынтығы. Нұсқа EPh 50R. 0,2 ПЦР-жинақталым пробиркалары («Gradient Palm Cycler» құралы
үшін)
Тамақ ӛнімдерінде соя мен жүгерінің генетикалық түрлендірілген ингридиенттерін анықтауға
арналған реагенттер жиынтығы, «ДНҚ-сорб-С» реагент жинақталымымен. Нұсқа EPh 50R.
Пробиркалар 0,2 ПЦР-жинақталым. («Gradient Palm Cycler» құралы үшін)

Генетикалық түрлендірілген кӛздердің геномында кездесетін Nos терминаторының тізбектілігін
сәйкестендіруге арналған реагенттер жиынтығы. Нұсқа EPh 50R. Пробиркалар 0,2 ПЦР-
жинақталым («Gradient Palm Cycler» құралы үшін)

Х-,S-,M-,Y-вирустар мен бақылауға моноерекшелікті антисарысулар



ДНҚ ны бӛліп алу үшін. Орамада 500 грамм



Ӛлшемі 50х50см парақта



250 мл, қара шыны, кең мойынды, тығыны бар



Автоклавталатын, 250 мл-лік, қоректік орта мен ерітінді дайындауға арналған, шыныдан
жасалған химиялық ыдыс

Автоклавталатын, 500 мл-лік, қоректік орта мен ерітінді дайындауға арналған, шыныдан
жасалған химиялық ыдыс

Автоклавталатын, 1000 мл-лік, қоректік орта мен ерітінді дайындауға арналған, шыныдан
жасалған химиялық ыдыс

5х1 мл



Шынылы, 100 х 150



Шынылы, В 56 х 80



Шынылы, В 75 х 110



ВИТ-2, температураның әсер ету аумағы +15...+40



Қоректік орта дайындауға арналған, түссіз, сұйықтық, иіссіз
Химиялық таза, моносахарид



Шыны спирт жанарғысы СЛ-2



Ӛсімдік жасушасын, микроскопиялық саңырауқұлақтарды қатыруға арналған, түссіз, мӛлдір
сұйықтық немесе түссіз кристаллдар (+18,5 С температурада балқиды) ӛзіне тән ерекше иісімен

Ақ немесе сарғыш кристалды ұнтақ, молекулярлық салмағы 221. Орамада 100 грамм



ДНК-маркерлер қоспасы 100 - 10000 жұп нуклеотидтер 50-200 анализ жүргізу үшін, 1 орамада -
100 мкл

ДНҚ ны бӛліп алу үшін



Қоректік орта дайындау үшін. Орамада 500 гр



Фитогормон, молекулалық салмағы 210,3, химиялық таза. Регенерацияға арналған қоректік
орталарда ӛсімдік клеткаларын культивирлеу үшін. Орамада 250 мг.

Зарарсыздандыруға арналған пакеттерді бекіту үшін



Ӛсімдік клеткаларын культивирлеуге арналған, трансизомер, кристалдық, тазалығы 97% кем
емес фитогормон. Молекулалық салмағы 219,2. Орамада - 50 мг.

Жалпыхирургиялық инеұстағыш - 200 мм, құралдарға арналған



Картоптың X-, S-, M-, Y-, A-, L- вирустарын сандық анықтауға арналған иммуноферменттік
диагностикалық жиынтықтар

Фитогормон, гетероауксин, химиялық таза, 99%, молекулалық салмағы 175,2. Орамада - 25 г.
Ӛсімдік клеткалары мен ұлпаларын культивирлеу үшін.

Селективті қоректік ортаны жасауға қажет, Инъекцияға үшін ұнтақ, 1 сауыт - 1 грамм



Қоректік орта дайындауға қажет. Зарарсыздандырылған кинетин ерітіндісі, Сауытта - 100мг



Конусты колбы КН-1-50-19/26 қиюластырылған қақпағымен, шыны (50 мл)



КН-1-500-29/32 қиюластырылған қақпағымен, шыны (500 мл)



Конусты колбы КН-1-1000-29/32 қиюластырылған қақпағымен, шыны (1000 мл)



Ӛлшеуіш, бір таңбамен 1-25-2 (25мл), шыны



Ӛлшеіуш, бір таңбамен 1-50-2 (50мл), шыны



Ӛлшеуіш, бір таңбамен 1-100-2 (100мл), шыны



Ӛлшеуіш, бір таңбамен 1-200-2 (200мл), шыны
50 мл-лік, қиюластырылған қақпағымен, градуирленген, шыны



100 мл-лік, қиюластырылған қақпағымен, градуирленген, шыны



250 мл-лік, қиюластырылған қақпағымен, градуирленген, шыны



500 мл-лік, қиюластырылған қақпағымен, градуирленген, шыны



1000 мл-лік, қиюластырылған қақпағымен, градуирленген, шыны



Жеке орамада, қызыл қақпағымен, зарарсыздандырылған, 120 мл-ге.



Жеке орамада, қызыл қақпағымен, зарарсыздандырылған, 200 мл-ге.



Жеке орамада, қызыл қақпағымен, қалағымен. 60 мл-ге.



Пайдаланылған бір жолғы құралдарды жинауға арналған, контейнер кӛлемі 0,5 литр



Пайдаланылған бір жолғы құралдарды жинауға арналған, контейнер кӛлемі 1 литр



2,0 мл, бұранбалы қақпағымен, таңбалы панелімен, резеңкелі шығыршықты, градуирленген,
жұм.t- минус 196С-ке дейін, 1 орамада - 100 дана



Жалпы ақуызды анықтау үшін, 1 орамада - 5 гр.



Ұзындығы 90 мм



Магниттер 40 х 8мм, цилиндрлік шығыршығымен, қоректік орта дайындауға



Магниттер 51 х 10мм, сегізқырлы, шығыршықпен, қоректік орта дайындау үшін



0,2 мл, жазық қақпағымен, пирогендерден және нуклеазадан бос, орамада - 1000 дана



1,5 мл, орамада - 1000 дана



1,5 мл, түсті ассорти, орамада - 500 дана



Минус 20 температурасында 60 минут сақтайды, кӛлемі - 1,5 мл, 12 түтікшеге



Амплифицирленген ДНҚ ны тазалау үшін, 70 реакцияға



30 үлгіге арналған комбинацияда 64 праймерден тұратын жиынтық, 2000 rxn



«СОРБ-ГМО-А» (гуанидин+сорбент) Ӛсімдік шикізаты мен азықтық ӛнімдерден ДНҚ бӛлуге
арналған реагенттер жиынтығы
«СОРБ-ГМО-Б» (ЦТАБ+сорбент), Ӛсімдік шикізаты мен азықтық ӛнімдерден ДНҚ бӛлуге
арналған реагенттер жиынтығы

Жиынтық ДНҚ амплификация ӛнімдерін, микромицеттерді агароздық гелден бӛліп алуға
арналған, 100 үлгілеріне

0,1-20 мкл, автоклавталынатын абақта, 1 орамада - 1 абақ - 96 ұштық



2-200 мкл, автоклавталынатын абақта, 1 орамада - 1 абақ - 96 ұштық



50-1000 мкл, автоклавталынатын абақта, 1 орамада - 1 абақ - 96 ұштық



ПТР ӛнімін еңгізу үшін. Орамада 1000 дана



ПТР ӛнімін еңгізу үшін. Орамада 2000 дана



ПТР ӛнімін еңгізу үшін. Қоректік орта мен ерітінді жасау үшін. Орамада 500 дана



Химиялық таза



Химиялық таза



Кӛлденең майысқан қайшы 160 мм



Таңғыш заттарға арналған, 160 мм



Жаңа ұсатылған шошқа асқазанының ферментативті гидролиз ӛнімі (тұз қышқылы
қатысуымен), қоректік орта дайындауға пайдаланылады

Ӛлшемі 315х365 мм



Қоян АД-нен дайындалған пероксидазды антивирусты және антибактериалды конъюгаттар.



Микротүтікшелердегі үлгілерді гомогенезациялау үшін



Құрал ӛлшемі 250мм х 2,5мм, тот баспайтын болат



Шыны тамызғыш бӛлшектеп құюға 2-1-2-1мл



Шыны тамызғыш бӛлшектеп құюға 2-1-2-10 мл



Шыны тамызғыш, бӛлшектеп құюға, 2-1-2-2 мл



0,1-2,5мкл,ауыспалы кӛлемді



0,5-10мкл,ауыспалы кӛлемді
2-20мкл,ауыспалы кӛлемді



10-100мкл,ауыспалы кӛлемді



20-200мкл,ауыспалы кӛлемді



100-1000мкл,ауыспалы кӛлемді



Жеке орамда, жазық түпті, 96 ұяшыққа



ПТР-ге арналған планшет, 96 ұяшықты, V=0,3 мл, зарарсыздандырылған



15 мл, конусты, градуирленген, тұрақты, бұранбалы қақпағымен, зарарсыздандырылған,
Орамада - 50 дана

50 мл, конусты, градуирленген, тұрақты, бұранбалы қақпағымен, зарарсыздандырылған,
Орамада - 50 дана

Ӛлшемі 300х500х0,05 мм., (балқу t-cы 134 С)



Ӛлшемі 700х1100х0,05 мм., (балқу t-сы 134 С)



Вирустар мен бактерияларды анықтауға арналған иммуноферментті жиынтықтарға оң және
теріс бақылаулар

Олигонуклеотидтердің ұзындығы – 22



Түзу праймер cfp10 генді амплификация үшін 5-GCTCTAGAATGGCAGAGATGAAGACC
    концентрациясы 10 нмоль

Кері праймер cfp10 генді амплификация үшін 5'-CGGGATCCGAATTCTCAGAAGCC
    концентрациясы 10 нмоль

Сat cgg cca cgt cga ctc tgg c, концентрациясы 10 нмоль/мкл



Gga agtacc agtgat cat gtt, соңғы концентрациясы 10 нмоль/мкл



Түзу праймер 5'-GCTCTAGAATGACAGAGCAGCAGTGGAATTTCGCGG концентрациясы 10
нмоль

Кері праймер 5'-CGGGATCCCTATGCGAACATCCC                        концентрациясы 10 нмоль



GGTCGCCGTAAGAGGGGTTGG-3 концентрациясы 10 нмоль/мкл



CGAGCCCGGTACCATGGACG-3, концентрациясы 10 нмоль/мкл



Түзу праймер 5'- ACGACGTTGTAAAA — TGCATCAAGAATAGTGTGGAAG-3' концентрациясы
10 нмоль

Кері праймер 5'- CATTAAGTTCCCATTA - TGAGAGGAAGGCTCACACCT -3', концентрациясы
10 нмоль
Түзу праймер 5' ACGACGTTGTAAAA - TCACCGTGGTCACCGAC-3', концентрациясы 10
нмоль

Кері праймер 5'- CATTAAGTTCCCATTA - CCACCGAGCCGATAATGTAC -3 концентрациясы
10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA — AGCCAGCAAGTCACCAAAAC-3 концентрациясы 10
нмоль

Кері праймер 5'- CATTAAGTTCCCATTA - GAAAACTTTGGGAACAAGAGCA 3' -
концентрациясы 10 нмоль

Түзу праймер 5'- ACGACGTTGTAAAA - ACTTCATTGTTGATCTTGCATG -3', концентрациясы
10 нмоль

Кері праймер 5'- CATTAAGTTCCCATTA - CGACGAATTCCCAGCTAAAC -3', концентрациясы
10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA — AGCCAAACACTCGCATCACG-3' концентрациясы 10
нмоль

Кері праймер 5'- CATTAAGTTCCCATTA - GACATCAATAACCGTGGATGG -3' концентрациясы
10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA — ACATTGTGTGTGCGGCC-3 концентрациясы 10 нмоль



Кері праймер 5'- CATTAAGTTCCCATTA - GATCCCTCTCCGCTAGAAGC -3 концентрациясы
10 нмоль

Cgg cca cag acc tcg cac ga, концентрациясы 10 нмоль/мкл



Taa cta tcg tgt gcc ggg gtt, концентрациясы 10 нмоль/мкл



GCTGCGTTCTTCATCGATGC, концентрациясы 10 нмоль/мкл



GCATCGATGAAGAACGCAGC, концентрациясы 10 нмоль/мкл



GGAAGTAAAAGTCGTAACAA, концентрациясы 10 нмоль/мкл



5-TGCCGAGCTG-3, концентрациясы 10 нмоль



5- AGTCAGCCAC-3,концентрациясы 10 нмоль



5'-CAGGCCCTTC-3', концентрациясы 10 нмоль



5-AGGGGTCTTG-3, концентрациясы 10 нмоль



5-GCTCCCTGAC-3,концентрациясы 10 нмоль



5-GAAACGGGTG -3, концентрациясы 10 нмоль



5-GTGACGTAGG-3, концентрациясы 10 нмоль
AATAggTgTACTgACTCTCAATg, концентрациясы 10 нмоль



TtgAAgTAAAAgTCCTAgTATgTg, концентрациясы 10 нмоль



ATgCgAATCTACTCgTCATgg, концентрациясы 10 нмоль



TCCAgCTgATTggTTAggTTg, концентрациясы 10 нмоль



GCTgTCCCAACTATCTTTgA, концентрациясы 10 нмоль



AATggCTCTCTCTgTATgCT, концентрациясы 10 нмоль



Кері:TCTTCCCTTCCATTTgTCA, концентрациясы 10 нмоль



CACCggAATAAgCggATCT, концентрациясы 10 нмоль



CTTTTTCTgACTgAgTTgCCTC, концентрациясы 10 нмоль



Түзу:TTCAAgAATAggCAAAACCA, концентрациясы 10 нмоль



ACCCCCACTTgCCATATTTT, концентрациясы 10 нмоль



CAgCCAACATTTgTACCCCT, концентрациясы 10 нмоль



GTTCATCACTACCgCCgACT, концентрациясы 10 нмоль



CgATCTCTgCTTTgCAggTA, концентрациясы 10 нмоль



ACCACCTCAggCACTTCATC, концентрациясы 10 нмоль



AgCTgCTCAgCATCAAgAgA, концентрациясы 10 нмоль



AggTTTTACCACTCgggCTT, концентрациясы 10 нмоль



TggAATCCgAATTACgCTCT, концентрациясы 10 нмоль



GgATCATCAAATTCACCgCT, концентрациясы 10 нмоль



CAgCAAAATCAgAACCCgAT, концентрациясы 10 нмоль



CTCATggATggTgTCATTgg, концентрациясы 10 нмоль



ACCATCCACCATgTCAATgC, концентрациясы 10 нмоль
AATAggTgTACTgACTCTCAATg, концентрациясы 10 нмоль



CAACTACAAgATTCCATCCACAg, концентрациясы 10 нмоль



GCTgCTAAACACTCAAgCAgAA, концентрациясы 10 нмоль



AAAgggAggAATAgAAACCAAAA, концентрациясы 10 нмоль



GAAgCgACTTCCAAAATCAgA, концентрациясы 10 нмоль



TCAACAgTCTCAgAAAACCCTCT, концентрациясы 10 нмоль



AgAAACTgAgTTgTgTTTgggA, концентрациясы 10 нмоль



TgACAACTTTAAAgCATATgTCAgC, концентрациясы 10 нмоль



TTgACCCTCCAACTATAgATTCTTC, концентрациясы 10 нмоль



TgCTCTACCAATTAACggCA, концентрациясы 10 нмоль



TgggAAgAATCCTgAAATgg, концентрациясы 10 нмоль



CATCCTTgCAACAACCTCCT, концентрациясы 10 нмоль



TgAgggTTTTCAgAAAgggA, концентрациясы 10 нмоль



ATTTggTTgggTATgATA, концентрациясы 10 нмоль



TTCAACCTATCATTTTgTgAgTCg, концентрациясы 10 нмоль



CATACgCACgCACgTACAC, концентрациясы 10 нмоль



TgATTCTCTTgCCTACTgTAATCg, концентрациясы 10 нмоль



CAAAgTggTgTgAAgCTgTgA, концентрациясы 10 нмоль



ATggCgTAATTTgATTTAATACgTAA, концентрациясы 10 нмоль



CAATTTCgTTTTTTCATgTgACAC, концентрациясы 10 нмоль



5'FAM-ACGACGTTGTAAAA, концентрациясы 300нмоль/мкл, флюоресцентті 6' FAM
бояғышпен белгiленгенi

CATTAAGTTCCCATTA, концентрациясы 300 нмоль/мкл
Cgt gtc cct ctg tac agc ttt ga, концентрациясы 10 нмоль/мкл



Gtg gtt acc tcccga tac tct, концентрациясы 10 нмоль/мкл



Түзу праймер 5' ACGACGTTGTAAAA - AGTTATGTATTCTCTCGAGCCTG -3', концентрациясы
10 нмоль

Түзу праймер 5' CATTAAGTTCCCATTA - GGTAACCACTAGAGTATGTCCTT -3',
концентрациясы 10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA - TGT CAA CAT CGT TTT GAA AAG G 3'
концентрациясы 10 нмоль

Кері праймер 5'-CATTAAGTTCCCATTA - ACA CTG TCA ACC TGG CAA TG 3'
концентрациясы 10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA - GAC AGC ACC TTG CCC TTT G 3' концентрациясы 10
нмоль

Кері праймер 5'-CATTAAGTTCCCATTA - CAT CGG CAA CAT GCT CAT C 3'
концентрациясы 10 нмоль

Түзу праймер 5'-ACGACGTTGTAAAAATG - GAG ATA TTT GGC CTA CAA C 3'
концентрациясы 10 нмоль

Кері праймер 5- CATTAAGTTCCCATTA - CTT GAC TTC AAG GCG TGA CA 3
концентрациясы 10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA - GAT CTC GTC ACC CGG AAT TC 3'
концентрациясы 10 нмоль

Кері праймер 5' CATTAAGTTCCCATTA - TGG TAG AGA AGG ACG GAG AG 3'
концентрациясы 10 нмоль

Түзу праймер 5'-ACGACGTTGTAAAA - CAA TCA TTT CCC CCT CCC 3'
концентрациясы 10 нмоль

Кері праймер 5'-CATTAAGTTCCCATTA - AAT CAT TGG AAA TCC ATA TGC C 3'
концентрациясы 10 нмоль

Түзу праймер 5'-ACGACGTTGTAAAA - AGT GGA TCG ACA AGG CTC TG
концентрациясы 10 нмоль

Кері праймер    5'CATTAAGTTCCCATTA - AGA AGA AGC AAA GCC TTC CC 3'
концентрациясы 10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA - ACA TTT CTC CCC CAT CGT C 3'      концентрациясы
10 нмоль

Кері праймер 5' CATTAAGTTCCCATTA - TTG TAA ACA AAT CGC ATG CG 3'
концентрациясы 10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA - TCA TTG GTA ATG AGG AGA GA 3' концентрациясы
10 нмоль

Кері праймер 5' CATTAAGTTCCCATTA - GAA CCA TTC ATG TGC ATG TC 3'
концентрациясы 10 нмоль

Түзу праймер    5' ACGACGTTGTAAAA - AGA CTG TTG TTT GCG GGC 3' концентрациясы
10 нмоль

Кері праймер 5' CATTAAGTTCCCATTA - TAG CAC GAC AGT TGT ATG CAT G 3'
концентрациясы 10 нмоль
Түзу праймер 5' ACGACGTTGTAAAA - TGC ATC AAG AAT AGT GTG GAA G 3'
концентрациясы 10 нмоль

Кері праймер 5' CATTAAGTTCCCATTA - TGA GAG GAA GGC TCA CAC CT 3'
концентрациясы 10 нмоль

Түзу праймер 5' ACGACGTTGTAAAA - GCA ATC TTT TTT CTG ACC ACG 3' концентрациясы
10 нмоль

Кері праймер 5' CATTAAGTTCCCATTA - ATG TGC ATG TCG GAC GC 3' концентрациясы 10
нмоль

Түзу праймер   5'-ACGACGTTGTAAAA - AGA GTG CAT GGT GGG ACG- 3', ',
концентрациясы 10 нмоль

Кері праймер 5'-CATTAAGTTCCCATTA - CCA AGA CGA TGC TGA AGT CA 3' ',
концентрациясы 10 нмоль

Түзу праймер      5'-ACGACGTTGTAAAA - GAT CTC CCA TGT CCG CC- 3',
концентрациясы 10 нмоль

Кері праймер   5'CATTAAGTTCCCATTA - CGA CAG TCG TCA CTT GCC TA-3',
концентрациясы 10 нмоль

Түзу праймер 5'-ACGACGTTGTAAAA - GTT GAG CTT TTC AGT TCG GC 3'
концентрациясы 10 нмоль

Кері праймер 5'-CATTAAGTTCCCATTA - ACT GGC ATC CAC TGA GCT G 3' концентрациясы
10 нмоль, 10 оптикалық бірлік

Түзу праймер 5' ACGACGTTGTAAAA - GTA GTG AAG ACA AGG GCA TТ концентрациясы 10
нмоль

Кері праймер 5'-CATTAAGTTCCCATTA - CCG AAA GTT GGG TGA TAT AC 3'
концентрациясы 10 нмоль

GGACGGCCCGCCGCAGGAACCTT-3, концентрациясы 10 нмоль/мкл



CGCGACGATTACCAGTAACGATA, концентрациясы 10 нмоль/мкл



ACTGGCAGAATCAACCAGGTA, концентрациясы 130 нмоль/мкл



GAACGCCTCTAAGTCAGAATCC, концентрациясы 130 нмоль/мкл



GGACGGCCCGCCGCAGGAACCCT, концентрациясы 10 нмоль/мкл



GGACGGCCCGCCGCAGGAACCTT- концентрациясы 10 нмоль/мкл



TTgAAgTAAAAgTCCTAgTATgTg, концентрациясы 10 нмоль



TTATTTCTCTgTTgTTgCTg, концентрациясы 10 нмоль



GTTCTTTTggTggTTTTCCT, концентрациясы 10 нмоль



ACgTTAAAgAAgTgAgAgTACgAC, концентрациясы 10 нмоль
TTgATgAAAggAATgCAgCTTgTg, концентрациясы 10 нмоль



CAACACAgCATACAgATCATC, концентрация 10 нмоль



TCTCCCCATCTTAATgTTTC, концентрация 10 нмоль



AATTTAACTTAgAAgATTAgTCTC, концентрациясы 10 нмоль



21х200, ПБ-21, шыныдан



Планшетте ПТР жүргізу үшін.1 орамада -100 дана



500 үлгіні тестілейтін жиынтық. 50-500 нуклеотид облысындағы ДНҚ-ны анықтау үшін
қолданылады.

100 еселік. Орамада - 50 мл. Ӛсімдік клеткалары мен ұлпаларын культивирлеу үшін.



Концентрациясы 10 е.а./мкл, орамада 4000 е.а.



Концентрациясы 10 е.а./мкл, орамада 1500 е.а.



Селективті қоректік орта жасау үшін, капсулаларда 150 мг-нан, 1 орамада - 20 капсула



Экстра таза категориялы сахароза, қоректік ерітінділерді, орталарды дайындайтын химиялық
реактив, орамада 500 грамм

Зарарсыздандырылған, бір жолы пайдаланатын, 36 мм, жүзімен, қорапта 10 дана



Гамборг В5 ортасы жазуы бойынша витаминдер ерітіндісі. 1000-еселік концентрацияда.
Орамада 50 мл. Ӛсімдік клеткалары мен ұлпаларын культивирлеу үшін.

Амплификация кезінде ДНҚ полимеризация реакциясы жүру үшін ДНҮР стандартты қоспасы
(10 мМ ерітінді, 1 орамада - 1 мл)

Мурасиге мен Скугтың жазуы бойынша макро және микротұздардың негізгі қоспасы, ӛсімдік
клеткаларын культивирлеу үшін. Орамада 10 л.

Гамборг жазуы бойынша (1968) негізгі тұздар қоспасы, ӛсімдік клеткаларын культивирлеу үшін.
Сауытта - 10 л. Ӛсімдік клеткалары мен ұлпаларын культивирлеу үшін.

А-ақуыз- сефарозада афинді-хроматографиямен тазаланған және 50% глицеринде 0,02%
мертиолят натримен консервіленген антидене (АД)

Жоғары стакан, В-100, шкаламен, 100 мл, шынылы



Жоғары стакан В-250 шкаламен, 250 мл,шынылы



Жоғары стакан В-1400 шкаламен, 400 мл, шынылы



Жоғары стакан В-800 шкаламен, 800 мл, шынылы
Тӛмен стакан Н-100 шкаламен, 100 мл, шынылы



Тӛмен стакан Н-1000 шкаламен, 1000 мл, шынылы



Фарфорлы стакан, тұмсықты, 150 мл-ге



Фарфорлы стакан, тұмсықты, 250 мл-ге



Жабын шыны 22*50*0,13-0,16 мм, 1 орамада - 100 дана



1 орамада -10 дана



Орамада — 5 мг, С24Н34О9, молекулалық салмағы 466,5. Хроматографиялық таза.
Ӛсімдіктердің тӛзімділігін бағалау, микромицеттердің фитотоксиндік белсенділігін бағалау және
селективті орталарды дайындау үшін.

Молекулярлы - биологиялық талдауға арналған, 1 орамада - 100 мл



Молекулярлы- биологиялық талдауға арналған, 1 орамада - 100 мл



Молекулярлы- биологиялық талдауға арналған, 1 орамада - 100 мл



Молекулярлы- биологиялық талдауға арналған, 1 орамада - 500 мл



Тоңазытқыштарға арналған (-30…+30°С)



Генетикалық түрлендірілген күріштің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген сояның линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген сояның линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Промотор 35S және терминатор NOS генетикалық түрлендірілген рапсты табуға арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Промотор 35S генетикалық түрлендірілген сояны сандық анықтауға арналған тест жүйесі
(«Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген сояны сандық анықтауға арналған тест жүйе («Rotor-Cene» құралы
үшін)

Генетикалық түрлендірілген сояның линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгеріні сандық анықтауға арналған тест жүйе («Rotor-Cene»
құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Промотор 35S генетикалық түрлендірілген жүгеріні сандық анықтауға арналған тест жүйесі
(«Rotor-Cene» құралы үшін)
Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген жүгерінің линияларын табуға және сәйкестендіруге арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Промотор 35S және терминатор NOS генетикалық түрлендірілген жүгеріні табуға арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Генетикалық түрлендірілген картопты табуға арналған тест-жүйе («Rotor-Cene» құралы үшін)



Промотор 35S және терминатор NOS, ӛсімдік ДНҚ-сының генетикалық түрлендірілген
организмдерін табуға арналған тест-жүйе («Rotor-Cene» құралы үшін)

Промотор 35S және терминатор NOS, генетикалық түрлендірілген сояны табуға арналған тест-
жүйе («Rotor-Cene» құралы үшін)

Ашытқы сығындысы бар соя сорпасы (TSYEB) қоректік орта дайындауға қолданылады



Электрофорез жүргізуге арналған химиялық реактив, химиялық таза, 99%, молекулалық массасы
121,14, ДНҚ-ны бӛліп алуға арналған буферлерді жасауға қажет.

Ӛлшемі 50х50см парақта



Экстра таза, 99%, 100 мл, генетикалық талдау жүргізуге арналған, орамада - 500 мл



ДНҚ ны бӛліп алу үшін арналған



Агробактериялардың ӛсуін басу үшін арналған. 1 сауытта - 1 грамм



3-25-2, тұмсықты, пластмассалы негізде, шыныдан жасалған



3-50-2, тұмсықты, пластмассалы негізде, шыныдан жасалған



3-100-2, тұмсықты, пластмассалы негізде, шыныдан жасалған



3-250-2, тұмсықты, пластмассалы негізде, шыныдан жасалған



1-25-2, тұмсықты, шынылы негізде
1-100-2, тұмсықты, шынылы негізде



1-1000-2, тұмсықты, шынылы негізде



Қоректік ортаны таратуға арналған, металды, ені - 9 см, ұзындығы - 203мм



Үшкомпонентті, 20 гр., инесімен (0,8х40мм), зарарсыздандырылған



Ш-10 түтіктерге арналған, металлды, 10 ұялы



Ш-20 шыны түтіктерге арналған, металлды, 20 ұялы



0,5, 1,5 (2,0) мл кӛлемді шыны түтікшелерге арналған, 96 ұяшықты, қақпағымен,
автоклавталатын

Микро шыны түтікшелерге арналған 1,5-2,0 мл, 20 ұялы, ӛлшемі 213х90х50мм,
автоклавталынатын

Микро шыны түтіктерге арналған 1,5-2,0 мл, 50 ұялы, ӛлшемі 141х92х56мм



Микро шыны түтікшелерге арналған 1,5-2,0 мл, 80 ұялы, қатыру үшін, ӛлшемдері 225х67х28мм,
автоклавталынатын

Қақпағы бар микро шыны түтікшелерге арналған, 0,2 мл, 96 ұялы, автоклавталынатын



Шыны түтіктерге арналған, металлды, 265х165х75, түтік диаметрі - 18 мм, 55 ұялы



ШМБ-40 шыны түтіктерге арналған, 40 ұялы



Металды, Ш-40 шыны түтіктерге арналған, 40 ұялы



ПТР ӛнімдерін тазалау үшін (ас шаяннан дайындалған сілтілік фосфатаза), саны 500 е.а., 1
е.а/мкл., 1000 реакцияға

ПТР ӛнімдерін тазалау үшін. Концентрациясы 20 е.а./мкл. Орамада 4000 е.а. 1000 реакцияға



Электрод РР-20 рН-метрге арналған, конструкциясы - пластикті корпус, электролиті: КСI 3
моль/л, күміс ионы жоқ, ұлпалы қосылыс. Қондырылған температуралы датчигі бар. Ӛлшем
диапазоны рН -0....14.
30.12.2010 жыл мерзіміне дейін (кӛлемі 722 шаршы шақырым) болатын жұмыс зонасы бар
далалық учаскені ұсыну.
Ақтау-Жетібай-Жаңа Ӛзен-Ақтау торабы бойынша КҚ-на техникалық қызмет кӛрсетумен және
басқару бойынша қызметтермен кемінде 5 орындық және ЖЖМ-мен камтамасыз етумен
автокӛлікті ұсыну (28 жүріс).
Учаскені арнайы техникалармен қопсыту және тегістеу.
Биопрепараттарды сумен араластыруға арналған 2 араластырғышты 2 ай мерзімге жалға беру.
Кӛлемі 3 куб. м. 2 дана бӛшкелерді 2 ай мерзімге жалға беру.
12 карта мен 60 мӛлдектерді ӛлшеп белгілеу қашылау және орналастыру, карталар мен
мӛлдектерге 140 т мазутпен ластанған топырақтарды салу және араластыру.
Сайн п., УМГ, ММГ+60 мӛлдектерді 3 ай ішінде қопсыту учаскелерді суару (60 куб. м.),
тырмалау.
Учаскелерді минералды және органикалық тыңайтқыштармен (кӛң-7650 кг., ағаш ұнтағы-500
кг., нитроаммофос-70 кг.) қамтамасыз ету.
Учаскелерді жарық шығылыстырғыш пленкалармен қамтамасыз ету (600 м2).
Бізбен белгілеуге арналған белгішелерді учаскелерге орналастыру – 12 дана.




Учаскеде келесі жұмыстарды жүргізу: 1. Бізбен белгілеуге арналған белгішелерді учаскелерге
орналастыру -17 дана. Олардың 16-сы 30х20 см, 1-уі 70х50 см.
2. Барлық учаскені минералды тыңайтқыштар-1 тонна, навоз-130 тонна, гипс – 1,5 тоннамен
қамту.
3. Ауданы 0,5 га учаскені жыртып, тырмалап, тегістеу үшін арнайы техниканы жүргізушімен
ұсыну, ЖММ Ӛнім берушінің есебінен.
4. Учаскені биопрепаратпен ӛңдегеннен соң, қопсыту 5 рет, тегістеу 5 рет агротехникалық
шаралар жүргізу.
5. Биопрепараттарды араластыруға арналған жалпы кӛлемі 2000 л кем емес араластырғыш және
540 м3 су ұсыну.
6. Далалық тәжірибе учаскесінде жұмыстар жүргізу үшін 6 жұмысшы ұсыну, жұмыстарды
жүргізу кезінде тұрағы, тамақтануы Ӛнім берушінің есебінен. 



Топырақ үлгілерін мұнайдың сандық мӛлшеріне талдау, топырақ құрамын және оның сипатын
анықтау:
1. 20 дана топырақ үлгісін алу. 1) қарашіріндіге, 2) механикалық құрамына, 3) сульфатына, 4)
хлоридіне, 5) карбонатына, 6) қальцийге, 7) жылжымалы фосфорға, 8) қорғасынға, 9) мысқа, 10)
мыршқа, 11) рН-қа, 12) мұнай ӛнімдеріне талдау жүргізу.
2. 32 дана топырақ үлгілерін алу.
1) рН-қа, 2) мұнай ӛнімдеріне талдау жүргізу.
3. Жаңадан 32 дана топырақ үлгісін алу. 1) рН-қа, 2) мұнай ӛнімдеріне талдау жүргізу.
4. 34 дана топырақ үлгілерін алу. 1) қарашіріндіге, 2) механикалық құрамына, 3) сульфатына, 4)
хлоридіне, 5) карбонатына, 6) қальцийге, 7) жылжымалы фосфорға, 8) қорғасынға, 9) мысқа, 10)
мыршқа, 11) рН-қа, 12) мұнай ӛнімдеріне талдау жүргізу.




Атырау қаласының аумағында лизиметриялық сынақтар жүргізу үшін барлық коммуникациямен
(су құбыры, электр, газ) 10 м2 кем емес тұрғын жай беру, және сынақтар ӛткізу үшін ӛлшемі 1х1
м 50 ағаш мӛлдектерді ұсыну.

Капиллярлы түтікті азотпен үрлеу, жӛндеу жиынтығын ауыстыру, фреонмен толтыру
Бактериалдық масса таза концентрациялы түрде болуы тиіс, Тапсырыс берушінің
лабораторияларында әзірленген бактериалдық массаны ӛндіру технологиялық нұсқаулығы
бойынша коллекциялық 8 кӛмірсутекоксидті микроағзалар штаммдарынан ӛндірілген,
бактериалдық масса саны, мынадай штаммдардан:
1 Bacillus thuringiensis A1- 9 кг. 1012 кл/г. жасуша титрімен;
2 Bacillus polymyxa ДН- 9 кг. 1012 кл/г. жасуша титрімен;
3 Bacillus aguimaris AE1 - 3 кг. 1012 кл/г. жасуша титрімен;
4 Bacillus firmus AE 2- 3 кг. 1012 кл/г. жасуша титрімен;
5 Bacillus polymyxa AE3 - 3 кг. 1012 кл/г. жасуша титрімен;
6 Bacillus thuringiensis AE4 - 3 кг. 1012 кл/г. жасуша титрімен;
7 Dietzia maris KU1- 9 кг. 1012 кл/г. жасуша титрімен;
8 Rhodococcus erythopolis Кл1 -9 кг. 1012 кл/г жасуша титрімен.


Жылыту мезгіліне дайындық үшін энергияжабдықтарды комплексті тексеруден ӛткізу (күзгі-
қысқы мерзіміне барынша энерго қондырғыны жүктеп, 10,1-20,0 кВт аралығында)
Объектілердің мекен-жайы: Степногорск қ., 7 ш.а., 21 ғимарат және 6 ш.а., 6 ғимарат. 





Жылу энергия шаруашылығына жауапты 2 адамның емтихан тапсыруы 09.07.2004ж. № 588-II
"Энергетика туралы", 25.12.1997ж. № 210-I "Энергияны сақтау туралы" ҚР Заңдарына және
Жылу энергияны қолдану Ережелеріне сәйкес ӛткізіледі



Қазақстан Республикасының 2006 жылғы тұтынушылардың электроқондырғыларды техникалық
пайдалану Ережелерінің 519 тармағына сәйкес, стационарлық жабдықтардың және апаттық
және жұмыс жарықтандыру электро ӛткізгіштердің жағдайын тексеру - 110 орын.

Қазақстан Республикасының 2006 жылғы тұтынушылардың электроқондырғыларды
техникалық пайдалану Ережелерінің 519 тармағына сәйкес, стационарлық жабдықтардың,
электро ӛткізгіштердің және жұмыс жарықтандырудың жағдайын тексеру.
Қабылдауыштардың «фазаноль» тоқ арқанның қарсылық күшін ӛлшеу - 40 нүкте;
Электро құрал-жабдықтардың жерге тұйықтайтын контурмен металлдық байланысын ӛлшеу -
20 нүкте;
Степногорск қаласындағы 6 шағын ауданданы 6 ғимаратындағы және 7 шағын ауданы 21
ғимаратындағы электро құрал-жабдықтар жӛнінде екі сараптаманың қорытындысын беру
бойынша қызметтер




Манометрлер (ОБМ, МТП, МП, ОБВ, МТИ, МЗИ, WIKA, DIH-S) - 30 дана



МВТИ бақылау мановакуумметрі - 2 дана



ОБВ вакуумметрі - 2 дана



ЭКМ электроконтактілі манометрі - 7 дана



ВСКМ 90-10/32 суық судың санауышы - 1 дана




ТТ техникалық термометрі - 2 дана



Электрондық таразы (AR3130) - 1 дана
ВЛР-1 кг лабораториялық таразы - 1 дана, дәріханалық, гір жиынтығымен



Электрондық таразы (MW 1200, MW-2000) - 6 дана



РНЦ1, 10Ц13У сауда таразысы - 1 дана




ВЛР 200 лабораториялық таразы - 1 дана



ВЛК500 лабораториялық таразы - 1 дана



Талдау таразы (LB-105, LB-801) - 2 дана



РП-150 медициналық таразы - 1 дана



РП-150 Ц 13 Т платформалық таразы - 1 дана



РП-200-ш-8 таразы - 1 дана



MWII - 2000 B электрондық таразы - 1 дана



6110 BALANCE электрондық таразы - 1 дана



М4100/4 мегаомметрі - 1 дана



(150м, С931, Seven Multi, Consort) РН-метрлер - 6 дана



ЭВ 74 әмбебап ионометрі - 2 дана



NT 124 S лабораториялық таразы - 1 дана



(ДКГОЗД "Грач", ДКГ-РМ 1203 М) дозиметрлері - 3 дана



Маховиктің тісті тәжін, стартерді, ұстасу дискін, КПП бекіту жастықшаларын, резеңке
патрубкалар жиынын, блоктың бастиегін ауыстыру.
Қозғалтқышты бӛлшектеу - буынды кӛшерді алу, қозғалтқыш блогының барлық элементтерін
алу, буынды кӛшерді және қозғалтқыш блогын ажарлауға және қырнап-жонып тегістеуге беру.
Буынды кӛшерді ажарлаудан және қозғалтқыштың блогын қырнап жонып тегістеуден кейін
қозғалтқышты жинау, жаңа қосалқы бӛлшектерді қойып және қосылыстарды герметизациялау.
Буынды кӛшерді жиынтығын ажарлау
Қозғалтқыштың блогын қырнап жонып тегістеу
Екі артқы бағаналарды, екі алдыңғы бағаналарды, екі алдыңғы серіппені, ілгіштің алдыңғы
рычагтардың екі жиынтығын, алдыңғы шарлы тіректердің екі жиынтығын, алдыңғы тежеу
дискілердің жиынтығын, екі алдыңғы тежеу қалыптарды, екі артқы тежеу қалыптарды, екі
алдыңғы тежеу шлангтарды ауыстыру, алдыңғы оң фараны, рульдік ұштықтарды ауыстыру.
Алдыңғы доңғалақтарға қиралу және қауысу бұрыштарын орнату (екі рет кӛктем, күз)
Компьютерлік диагностика
Болаттан, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Қозғалтқыштың буынды кӛшерін айналдыру үшін, ВАЗ 21150 автокӛлігіне, кӛлік қорабының №
ХТА 21150043804895



Болаттан жасалған сфикционнды жапсырмалармен, ВАЗ 21150 автокӛлігіне, кӛлік қорабының
№ ХТА 21150043804895



Резеңке-металлды, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Армирленген резеңкеден, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Клапандық механизм бӛлшектермен, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА
21150043804895



Дюральді, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Болаттан, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Түбегейлі және шатунды, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Металлдыасбест, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Майға, жанармайға тұрақты резеңке, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА
21150043804895



Қағаздан жасалған сүзгіш элементімен, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА
21150043804895



Қағаздан жасалған сүзгіш элементімен, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА
21150043804895



Қағаздан жасалған сүзгіш элементімен, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА
21150043804895



SAE-10/40




Серіппесі бар амортизаторлар, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА
21150043804895
Амортизаторлар, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Болаттан, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Болаттан, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Жиында тозаңдықпен, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Болаттан, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Құрамдастырылған, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Құрамдастырылған, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Армирленген резеңкеден, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Құрамдастырылған, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Құрамдастырылған, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Болаттан, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895




Жанармай деңгейін кӛрсететін датчигі бар электробензосорғы, 2112-1139007 моделі, ВАЗ 21150
автокӛлігіне, кӛлік қорабының № ХТА 21150043804895



А-40




Металлдан жасалған




Желім




Құрамдастырылған, ВАЗ 21150 автокӛлігіне, кӛлік қорабының № ХТА 21150043804895
20 картридж (HP Lazer Jet лазер принтерлері)




4-х фотобарабанды ауыстыру (HP Laserjet 1000 принтерлерінде)




HP 3015 принтерлерінде - 4 дана




3 НР Laserjet 1320n принтерлерін жӛндеу




Номиналды кіру кернеуі - 230В, 50 ГЦ жиілігімен, ең жоғары ток жүктілігі - 10 А-ден кем емес,
баудың ұзындығы 1,5 - 2,0 м., корпусы пластиктен, шығу разъемдардың саны - 2 еуровилка, кіру
разъемы - евровилка, қысқа тұйықталудан қорғайтын балқитын салғы, токтың артық
жүктелуінен қорғайтын автоматты термоүзгіш

Ең жоғары жүктілігі - 500 вт, кіру кернеу деңгейі — 150-280 В, шығу кернеу деңгейі — 195-248
В, жиілігі 50/60 ГЦ, енгізу разъемы еуровилка, шығу разъемдары - 2 еуровилка, 10-90%
ылғалдықта қоршаған ортаның жұмыс жағдайлары 0-40С, бір фазалы, үзілмейтін әсерлі,
индикаторлы панельмен, ең жоғары артық жүктелу мағынасы 2мс-та 320Дж.



АИ 93 (92) Талондық жүйе арқылы.



«Евразиялық патент конвенциясына және Қазақстан Республикасының заңнамасына сәйкес
ӛнеркәсіптік меншік объектілерін құқықтық қорғау» семинарында бір кісінің оқуы. Сертификат
берілуі тиіс.

Шамның түрі: UHE
Шамның қуаттылығы: 175 Вт кем емес
Шамдардың саны: 1
Матрица: 3 P-Si TFT
Технология: LCD
Қолданылатын рұқсат: SVGA (800 x 600), XGA (1024 x 768), WXGA (1280 x 800), SXGA (1280 x
1024), WSXGA (1440 x 900), SXGA+ (1400 x 1050)
Жолдық жаймалау тазалығы: 69 КГц
Кадрдық жаймалау тазалығы: 85 КГц
Видеостандарттар: PAL, PAL-M/N, PAL60, SECAM, NTSC, NTSC4.43, HDTV
Жарық ағыны: 2200 lm кем емес
Шамның қоры: 5000 сағ кем емес
Диагональ бойынша бейненің ӛлшемi: 0.76 - 7.62 м
Қарама-қарсылық 2000:1 кем емес
Функциялары: 16:9 форматын қолдау, 16:10 форматын қолдау, перде менюсы, Инверсия
ДУ Пульті
Кірудер/Шыгулар: Композитті кіру (RCA), S-Video кіру, VGA кіру (D-sub), VGA шығу (D-sub),
Аудиокіру (RCA)
Кепіл мерзімі (ай): 12
Толықты жинақ: ұсынылған проектор үшін резервті шам (Шамның түрі UHE, шамның
қуаттылығы: 175 Вт кем емес, шамның қоры: 5000 сағ кем емес) - 2 дн.




Елтаңба мӛрді жасау: Қазақстан Республикасының Мемлекеттік елтаңбасы бейнесі бар,
автоматтық жабдықтауда орналасқан, тапсырыс берушінің үлгісіне сәйкес және ҚР СТ 1430-
2005 бойынша жасалуы тиіс

Мӛрді жою туралы актісін берумен ҚР заңнамасына сәйкес екі елтаңба мӛрді жою
Атмосфераны ластайтын заттар шығарындыларының кӛздерiн кешенді тексеру жүргізу




Қолда бар ластану кӛздерінің атмосфераға ластайтын заттардың шығарындыларын есептеу және
кәдеге жарату тәсілін анықтау. 11 қалдықтар тӛлқұжаттарын жасау



Қазақстан Республикасында пестицидтердің (улы химикаттардың) тіркеулік сынақтарын және
мемлекеттік тіркеуін жүргізудің Ережелеріне сәйкес препаратты сынау



Іштен тұтанатын двигателді жуу - 2 канистра (бір канистрадан әрбір автокӛлік үшін);
Моторлық майы (ІТД) - синтетикалық, кин. тұтқырлығы 40 С:91, кин. тұтқырлығы 100 С:14,
тұтқырлық индексі: 166, қату температурасы: С: -48, SAE: 5W-40, API: SJ-CF, ACEA: А3-98 В3 В-
4, әрбір автокӛлікте ауыстыруымен;
Май сүзгіші - 2 дн. (әрбір автокӛлікте біреуден, 2 данасын ауыстыру);
Отын сүзгіші- 2 дн. (әрбір автокӛлікте біреуден, 2 данасын ауыстыру);
Ауа сүзгіші- 2 дн. (әрбір автокӛлікте біреуден, 2 данасын ауыстыру);
Ауабаптағыш сүзгіші - 2 дн. (әрбір автокӛлікте біреуден, 2 данасын ауыстыру);
Дӛңгелектердің геометриясын (күйреу/қосылу) реттеу - 2 қызмет (әрбір автокӛлікте бір
геометриясын реттеумен);
Жүріс бӛлшектерін диагностикасы - 2 қызмет (әрбір автокӛлікте бір диагностикамен);
Компьютер жұмысында бұзулуын жоюмен электр жабдықтарының диагностикасы - 2 қызмет
(әрбір автокӛлікте бір диагностикамен).




Қалдықтар паспортына сәйкес мазуттенген топырақты қайта ӛңдеу (жою) - 1,5 тонна, қайта
ӛңдеу (жою) орнына дейін қалдықтарды шығарылуы ӛнім берушімен жүргізіледі



Қалдықтар паспортына сәйкес пайдаланылған майларды қайта ӛңдеу (жою)- 0,06 тонна, қайта
ӛңдеу (жою) орнына дейін қалдықтарды шығарылуы ӛнім берушімен жүргізіледі



Қалдықтар паспортына сәйкес сүзгіш материалдарын (сүзгіштер) қайта ӛңдеу (жою) - 0,015
тонн, қайта ӛңдеу (жою) орнына дейін қалдықтарды шығарылуы ӛнім берушімен жүргізіледі



Қалдықтар паспортына сәйкес пайдаланылған аккумуляторларын қайта ӛңдеу (жою) - 0,04
тонн, қайта ӛңдеу (жою) орнына дейін қалдықтарды шығарылуы ӛнім берушімен жүргізіледі



Қалдықтар паспортына сәйкес шыны ыдыстарын қайта ӛңдеу (жою) - 0,01 тонн, қайта ӛңдеу
(жою) орнына дейін қалдықтарды шығарылуы ӛнім берушімен жүргізіледі



Қалдықтар паспортына сәйкес жуылған ағындыларды (ластанған сулар) қайта ӛңдеу (жою) - 1,5
тонн, қайта ӛңдеу (жою) орнына дейін қалдықтарды шығарылуы ӛнім берушімен жүргізіледі



Ду. 76, монтаждаумен



Ду. 76



Ду.15



Ду.15
монтаждаумен



монтаждаумен



Ду. 76, монтаждаумен



Ду 80 тартпаларды демонтаждау - 8 дана



монтаждаумен



монтаждаумен



Бойлерді демонтаждау



Ду.15, монтаждаумен



шойын фланецтік, монтаждаумен



жезді фланецтік, монтаждаумен



2 жылу алмастырғышты сығымдау



шарлы, диаметр - 15 мм.




шарлы, диаметр - 20 мм.




шарлы, диаметр - 25 мм.




шарлы, диаметр - 32 мм.




шойын құбыр желісінің жабдықтары, қайсысындағы жабатын немесе реттеуші орган жұмыс
ортаның ағымына перпендикуляр бағытта қайтарылмалы-ілгерілемелі қозғалады



шойын құбыр желісінің жабдықтары, қайсысындағы жабатын немесе реттеуші орган жұмыс
ортаның ағымына перпендикуляр бағытта қайтарылмалы-ілгерілемелі қозғалады



Құбырлы рычагты кілт, құбырлардың диаметрі 20-50 мм, кілттің ұзындығы 40 см




таза табиғи ӛнім, зығыр сабағынан алынатын жіңішке, бертекті, ұзынталшықты, таралған
зығырдан жасалынады.
Тӛмен кӛміртекті болаттан, тігіссіз. Бұрыш: 90°. Шартты қысым: 16 Мпа дейін.




Тӛмен кӛміртекті болаттан, тігіссіз. Бұрыш: 90°. Шартты қысым: 16 Мпа дейін.




Тӛмен кӛміртекті болаттан, тігіссіз. Бұрыш: 90°. Шартты қысым: 16 Мпа дейін.




Фторопластты тығыздатқыш материал, стандартты бобиналарда




Шойын жылу радиаторы, сылақталған, 7-8 секциялы.




Болатты суды, газды ӛткізетін кұбырдан МЕМСТ 3262-75




Болатты суды, газды ӛткізетін кұбырдан МЕМСТ 3262-75




Болатты суды, газды ӛткізетін кұбырдан МЕМСТ 3262-75




раковина құйылысының элементі, пластикті




Екі кернейлі қоспалауыш, «Елочка» түрлі үштіксіз. Су құбырдың жалғасудың ойма ӛлшемі-
1/2 дюйм. Құрамдастырылған



полипропиленді PN 20 50 мм ыстық су үшін.




Болаттан, тігісзіз, қабырғасы 2,2-3,2 мм




Болаттан, тігісзіз, қабырғасы 2,2-2,8 мм




Болаттан, тігісзіз, қабырғасы 3,2 мм




Болаттан, тігісзіз, қабырғасы 3,2 мм




Болаттан, тігісзіз, қабырғасы 3-3,5 мм
Болаттан, тігісзіз, қабырғасы 3,5-4 мм




Полипропиленненді PN 20 20*3,4 мм




полипропиленді PN 20 25*4,2 мм




полипропиленді PN 20 32*5,4 мм




полипропиленді d-50мм




КТСП-Н қарсылық термотүрлендіргіштерді салыстырып тексеру, құралдарды демонтаждау және
монтаждау, электр монтаж және іске қосу - баптау



ТВА-1 жылу есептегішті салыстырып тексеру, құралдарды демонтаждау және монтаждау, электр
монтаж және іске қосу - баптау



электр энергиясын сатып алу



жылу энергиясын сатып алу



ауыз су



суды бұру



суды бұру



жай хаттар, бандерольдер, почта карточкалары



Enterobacteriaceae тұқымдастары ӛкілдерінің жаңа штаммдарымен микроағзалар
жинақтамаларын толықтыру және оларды тӛлқұжаттау
Алматы облысының ауылдық аудандарда тұратын ересек тұрғындардың ӛмірін қамтамасыз
ететін физиологиялық ерекшеліктерін зерттеу:
1. Алматы облысының ауылдық аудандарда тұратын ересек тұрғындардың денсаулық деңгейіне
экспресс-бағалауын жүргізу.
2. Алматы облысының ауылдық аудандарда тұратын ересек тұрғындардың психо-эмоциялық
жағдайын зерттеу.
3. Алматы облысының ауылдық аудандарда тұратын ересек тұрғындардың
кардиореспираторлық жүйесіне бақылау жүргізу.



Жиынтық құрамында 10 праймер. Әрбір праймер концентрациясы 10 nMol
Остеокальцин
F TGCAGAGTCCAGCAAAGGTG, R GATGTGGTCAGCCAACTCGTC
Нестин
F CAGCTGGCGCACCTCAAGATG, R AGGGAAGTTGGGCTCAGGACTGG
NSE
F CCCACTGATCCTTCCCGATACAT, R CCGATCTGGTTGACCTTGAGCA
MyoD
F AGCACTACAGCGGCGACT, R GCGACTCAGAAGGCACGTC
Desmin
F TGATGGAATACCGACACCAGA, R GGTAGGTGGCAATCTCCACA
PPAR-gamma2
F GCTGAATCCAGAGTCCGCTG, R GCAAACTCAAACTTGGGCTCC
Oct4
F ACATGTGTAAGCTGCGGCC, R GTTGTGCATAGTCGCTGCTTG
Sox2
F ACCAGAAAAACAGCCCGGA, R TCATGAGCGTCTTGGTTTTCC
Rex1
F AAACATGAGCCAGCAACTGAAG, R AGAAATCATCCCCTCCGAGAG
GAPDH
F GCTTGTCATCAATGGAAATCCC, R TCCACACCCATGACGAACATG


рН 5.0-6.0. Суда ерігіштігі 0.1 М Н2О, түссіз сұйықтық. Зарарсыздырылған, бұралатын
қақпағымен пластикалық сауытта. Кӛлемі 100 мл.


Құрамында глютаминсіз, зарарсыздырылған, сүзгіленген. Жасушалық ӛсінділерде тексерілген.
Сақтау температурасы 2-8С. Кӛлемі 100 мл.

Орамада 5 сауыт 100 мл ден



Фермент Clostridium histolyticum алынған. Ұлпа диссоциациясы үшін арналған.
Лиофилизирленген ұнтақ түрінде берілген. Сауыт құрамында 1 грамм зат бар

Фибробласт ӛсу факторы-негізгі адамдыкі рекомбинантты, Е. Coli экспрессияланған.
Лиофилизирленген ұнтақ түрінде берілген. Жасушалық ӛсінділерде тексерілген. Тазалығы
≥97%. Флакон құрамында 25 мкг ФӚФ. Эмбрионалды бағаналы жасушаларды,
фибробластарды, хондроциттерді, эндотелиальді жасушаларды ӛсіру үшін қолданылады

Тромбоцит-ВВ ӛсу факторы, адамдыкі рекомбинантты
 (PDGF-BB), Е. сoli экспрессияланған. Лиофилизирленген ұнтақ түрінде берілген. Жасушалық
ӛсінділерде тексерілген Тазалығы ≥97%. Флакон құрамында 10 мкг 


Нейрон-β ӛсу факторы, адамдыкі рекомбинантты, тышқандардың NSO жасушаларында
экспрессияланған. Лиофилизирленген ұнтақ түрінде берілген. Жасушалық ӛсінділерде
тексерілген. Флакон құрамында 100 мкг
Лиофилизирленген ұнтақ түрінде берілген Тазалығы 96-99% Бума құрамында 1 гр.



Тазалығы 99% Орамада 100 мг.



Тазалығы 99% Орамада 5 гр.
Орама 100 гр.



Ұнтақ түрінде берілген. Тазалығы 95% Орамада 5 гр.



Орамада 25 гр.



Орамада 25 гр.



Сауытта 100 мг



Сауыт 5 гр.



Сауыт 25 гр.



Сауыт 500 мл



Анти – тышқан IgG 1 антиденелері, магнитті бӛлшектермен конъюгацияланған, 1 млрд.
жасушаны сепарациялау үшін. Антидене құрамында натрий азиді бар бұқа сарысуы
альбуминінің буферлі ерітіндісінде орналасқан. Реагенттің флакондағы кӛлемі 5 мл

Қоянның поликлоналды LYVE-1 антиденесі , аффино – тазартылған. Пішіні: сұйық, Изотип: IgG
Реактивтілігі: адам (Hu), егеуқұйрық (Rt). Қолданылуы: иммуногистохимия. Сауыт құрамында
100 мкг антидене бар.
Реагент сұйық түрде берілген (100×). Ерітінді құрамында 1 мг/мл инсулин, 0.55 мг/мл адам
трансферині (темір ионы жоқ), 0.5 мкг/мл натрий селениті, 50 мг/мл бұқа сарысуы альбумині
және 470 мкг/мл линол қышқылы бар. Фильтрлеу арқылы стерилизацияланған. Жасушалық
ӛсінділерді тексерілген. Реагенттің сауыттағы кӛлемі 5 мл.

ПТР нәтижелерін электрофорезде анықтау           мақсатымен агарозды гелді жасау үшін
қолданылады. Орамада- 100 г

ПТР қосындысын жасау үшін қолданылады, орама 5 x 1 ml (200 µmol барлығы) құрайды



Фермент ПТР ӛнімдерін амплификациялау үшін қолданылады.10хТаq буфер мен (NH4)2SO4
және 10хТаг буфер мен KCl, сонымен қатар MgCl2 25мМ ерітіндісімен бірге жіберіледі. ДНҚ
полимераза 94кДа массасымен. Ферменттің жартылай ыдырау кезеңі 40 мин 95С температурада.
Белсенділігі 5000 бірлік. Орамада (4 компонент: ДНҚ полимераза 100 бірлік (5 бір/мкл), 0,6 мл
екі буфер, 0,6 мл магний хлорид ерітіндісі)


реттілігі 5'-3': (CAC)7, OD   7 кем емес, АТСХ тазалау


реттілігі 5'-3':(GA)9C,   е 7 кем емес, АТСХ тазалау


реттілігі 5'-3': GT)9G,   е 7 кем емес, АТСХ тазалау


реттілігі 5'-3':(CAC)7G,   е 7 кем емес, АТСХ тазалау


реттілігі 5'-3':GT(CAC)7, е 7 кем емес, АТСХ тазалау



реттілігі 5'-3': GTG)7C
реттілігі 5'-3':(CA)10G



реттілігі 5'-3':(CT)9G



реттілігі 5'-3':(AG)8T



реттілігі 5'-3':(AG)8Gе   7 кем емес, АТСХ тазалау


реттілігі 5'-3':(ACC)6, е 7 кем емес, АТСХ тазалау



реттілігі 5'-3':(ATG)8е 7 кем емес, АТСХ тазалау



реттілігі 5'-3':(GAA)6е 7 кем емес, АТСХ тазалау



реттілігі 5'-3':(GACA)6


Қыздырып жапсыратын аппарат, тасымалды, тұрақты токты, кернеуі 220 В, шығуда ток күші
200 А дейін



Тоқ - 16А




Тоқ - 25А




Полихлорвинил шеттеуі бар алюминий ӛткізгіші 2*2,5 мм2




Тұрмыстық электроайырғыш. Жұмыс тогы 6А, жасырын ӛктізбе, ішкі орнату үшін.
Контакттардың материалы - жез. Корпусы пластмассадан жасалған. Бір клавишалы



Иілгіш сымжелі (мыс), талшығы қимасы - 3*2,5 мм2. Полихлорвинил оқшауламамен




Пластик қорабы, ӛлшемі 10 х 20 х 2 000 мм




Пластик қорабы, ӛлшемі 16 х 25 х 2 000 мм




Доға тәрізді, жоғары қысымды сынап шамы




Жоғары жарық бергіш және электр энергиясын аз қажет ететін люминесцентті шам. Құбырлы.
Ұзындығы 1200 мм. Қуаттылығы 40 Вт
Есептік кернеуі 235В, диаметрі 61,2 мм, ұзындығы 110,7 мм, салмағы 50 гр




Есептік кернеуі 235В, диаметрі 61,2 мм, ұзындығы 110,7 мм, массасы 50 гр




Қуатты жерге қосу түйіспелерімен. Бір фазалы желі үшін пластмассалы корпусы бар




Қуаттылығы 40 Вт екі ЛБ шамға арналған пластикты плафоны бар тӛбеге ілетін шырақ, жабық
бӛлмелерді жарықтандыруға арналған



ЛД-40 шамдары бар шырақтар үшін 220 В стартер




Қуаттылығы: 1200 Вт. Айналымдардың саны: 0-1100 және 0-3000 айн/мин. Соғу саны: 0-30000
с/мин. Патроны: 1,5-13мм. Бұрғылау диаметрі: болат 10мм /бетон 16мм /ағаш 25мм. Бұрғылар
жиыны керек жоқ

Түрі - «Еуровилка», жинамалы, материалы - пластмасса




Тот баспайтын, диаметрі 3 мм




Қара металлдарды тұрақты токпен дәнекерлеу үшін, диаметрі 3 мм.




5'-TTC-gTT-gCT-TAC-CTA-CTA-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-CCC-AAg-ATT-ACC-ACA-TTC-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-TCT-CTT-gAC-ACg-TgT-CAC-TgA-AAC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TCA-CCg-ATT-ACA-gTA-ggC-AAg-AgA-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-gCA-TTg-ATT-gAA-CTT-CAT-TCT-CgT-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ATT-TTT-gTC-CAC-ACC-AAC-TAA-CCg-3', (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5'-AAC-ATT-ACA-ACA-CAT-TAg-CA-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-AAC-TTA-TCT-gAA-ACT-CTC-gT-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ggg-ACA-TCA-CAg-TCT-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-ggT-gCT-CCT-ATT-ggT-g-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі
5'-AAT-TCA-TgT-TTg-Cgg-TAC-gTC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ATg-CAg-AAA-gAT-gTC-AAA-ATT-gA-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-gCA-AAA-TAC-Agg-CTC-CAT-Ag-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTC-TCA-ACA-ACT-TCC-CAT-CC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTg-CgT-gAA-gCA-gCC-gTA-AA-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-gCC-CAg-TAA-gTA-AAA-CAT-Tg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ATA-AAC-CgC-ATg-AgA-AgC-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-ATg-ggA-TAg-ATT-TgT-TAg-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-CTT-gCA-ACT-TgT-TAg-TAC-CCC-C-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-AAA-TCC-TTT-gTg-ACC-TCC-CC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-CAT-ACg-CAC-gCA-CgT-ACA-C-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTC-AAC-CTA-TCA-TTT-TgT-gAg-TCg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ATg-CCT-CTT-ACg-AAT-AAC-TCg-g-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-CAg-CTA-ACg-Tgg-TTg-ggg-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-TTC-TgA-TTT-CAT-gCA-TgT-TTC-C-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ATg-CTT-gCC-ATg-TgA-TgT-gT-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TAg-ATT-TTA-TTA-TTC-CCA-ACA-AgC-A-3', (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5'-CAA-CTA-CCT-TCT-CCC-CAC-ATA-g-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-AAT-Agg-TgT-ACT-gAC-TCT-CAA-Tg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTg-AAg-TAA-AAg-TCC-TAg-TAT-gTg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTA-TgT-TTC-ggT-TAA-AAT-gTA-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-AAA-TTA-AAT-ggA-AgA-CAA-CC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі
5'-TgA-TTT-AgT-TgC-TTg-TTT-g-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-gCT-TTC-gAT-CCT-AAT-ACA-CC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTT-AAg-TTC-TCA-gTT-CTg-CAg-gg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-gTC-ATA-ACC-TTT-ACC-ATT-gCT-ggg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-TTC-ggA-ATT-ACC-CTC-TgC-C-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-AAA-AAA-AgA-ACg-CgC-ACg-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-AAA-CCT-gCT-ACA-AAT-AAg-gC-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-CAg-AAA-TAA-TTg-gAg-gAg-ATg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-ACT-ggC-ggA-Cgg-gTg-AgT-AA-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-CgT-ATT-ACC-gCg-gCT-gCT-gg-3', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5′-CAg-CAg-CCg-Cgg-TAA-TAC-3′, (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5′-CCg-TCA-ATT-CCT-TTg-AgT-TT-3′, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5'-CgC-CCg-ggg-CgC-gCC-CCg -3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5'-TAg-CgA-TTC-CgA-CTT-CA-3', (20 оптикалық бірліктің жоғары концентрациясы), жасанды
синтезделген нуклеотидтердің реттілігі

5’- AAA-ACA-ggA-TTC-ggA-CAC – 3’', (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TAg-TAT-TgT-gCT-TgC-TTA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – gAC-CAA-TAA-TTC-AgA-CCA-AgA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – gTg-CCA-gAg-AAA-ggT-gTT – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – CTA-TTC-AAA-gCT-ggA-Tgg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – ACT-ggC-ggg-AgC-ACA-Agg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TgC-AAT-gTg-TCg-AAC-AAT-CA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TAA-TTg-gAT-Agg-TCg-gCC-Tg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі
5’ – TgT-gTT-TgT-TTT-TCT-gTA-T – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – AAT-TCT-ATC-CTC-ATC-TCT-A – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TgT-ACT-ggg-gAg-CCT-CAA-Ag – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – AAT-TTT-AAC-CTC-gTg-ACA-Tgg-g – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TAT-TCC-CCC-TTC-CTA-CTC-AA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TCT-TCC-ACA-TTC-CTA-ACC-Tg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – AAT-Cgg-TgA-TAA-ATg-TgA-ATg-C – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – ATg-CTT-gCC-ATg-TgA-TgT-gT – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – gAA-gTT-TTA-TCA-gAA-TCC – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – ATC-ACC-TCA-TCA-gCA-ATC – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – CCC-ATA-ATA-CTg-TCg-ATg-AgC-A – 3’, (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5’ – gAA-TgT-Agg-gAA-ACA-TgC-ATg-A – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TgA-TTC-TCT-TgC-CTA-CTg-TAA-TCg – 3’, (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5’ – AgT-CAg-AgT-ATg-gTT-CCT-gAg-TCC – 3', (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5’ – TTC-TgA-TTT-CAT-gCA-TgT-TTC-C – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – ATg-TgT-ggT-CTA-CAA-AAA-ggg-g – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TTC-AgA-gAC-ATC-ATg-gCA-ACT-T – 3’, (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5’ – ATC-CTT-CAT-CAg-Agg-AAg-AAT-CC – 3’, (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5’ – gAC-ACg-TTC-ACC-ATA-AAA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – AgA-AgA-ATA-gCA-AAg-CAA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – AAT-TCA-TgT-TTg-Cgg-TAC-gTC – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – ATg-CAg-AAA-gAT-gTC-AAA-ATT-gA – 3’, (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі
5’ – gAA-ATC-gAC-ACA-gAC-ggA-AAT – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – CgA-ggg-ACT-TTA-ATT-TgT-Tgg-A – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – AAT-AAT-ACT-gTg-ATg-CCA-CAA-Tgg – 3’, (20 оптикалық бірліктің жоғары
концентрациясы), жасанды синтезделген нуклеотидтердің реттілігі

5’ – gTg-gCA-TgT-CTT-CgA-Agg-TAC – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – gCT-ATg-TTA-ggg-TCA-Agg-gCT-A – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – ATA-Tgg-gAT-gCT-Tgg-TAT-ACC-g – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TAT-TCC-CCC-TTC-CTA-CTC-AA – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TCT-TCC-ACA-TTC-CTA-ACC-Tg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – TTA-TgA-ATC-gTg-TTA-Tgg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’ – CAA-AAA-ggg-gAA-TCT-ACC – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

жасанды синтезделген нуклеотидтердің реттілігі



5’ – AgAgTTTgATCCTggCTCAg – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

5’TACggCTACCTTgTTACgACTT – 3’, (20 оптикалық бірліктің жоғары концентрациясы),
жасанды синтезделген нуклеотидтердің реттілігі

50 кг ӛлшемі 55 см х105 см



25 кг ӛлшемі 45 см х85 см



Азық қоспасы түйіршіктелген, ӛлшеп буылған



Учаскеде келесі жұмыстарды жүргізу: 1. Белгішелерді учаскелерге орналастыру -16 дана, ӛлшемі
1 м.
2. Суға тӛзімді ажырату жазбаларды орнату - 4 дн., оның ішінде 3 дн 20*30 см, 1 дн 50*70 см.
3. Барлық учаскені минералды (100 кг) және органикалық (10 т) тыңайтқыштармен қамту.
4. Арнайы техниканы жүргізушімен және ЖММ ұсыну, учаскені жыртып тастау.
5. Препараттарды араластыруға арналған жалпы кӛлемі 500 л кем емес араластырғыш (1 дн)
ұсыну.
6. Биопрепараттарды дайындау мен далалық учаскенің топырағын ылғалдандыру үшін сумен
қамту. 7. Мұнаймен ластанған топырақтар рН ортасын қалыптандыру үшін гипспен (100 кг)
және ізбеспен (100 кг) қамту.



Нашар тұқымды ақ зертханалық егеуқұйрықтар, бір егеуқұйрықтың салмағы 160-200 грамм.
Эксперимент үшін

Нашар тұқымды ақ зертханалық тышқандар, бір тышканның салмағы 18-20 грамм. Эксперимент
үшін
кӛлік құралдарының йелерінің АҚЖ, сақтандыру полисі беру, ГАЗ -3307 және ВАЗ 2115
маркалы 2 авто кӛлік

«Биотехнология – ӛсімдіктерінің генетикалық ресурстары мен селекция саласындағы қазіргі
заман әдістері мен құралдары» семинарды ӛткізу кезінде ӛкілдік ету шығыстарына байланысты
қызметтер
Оқыту семинарын ӛткізу кезінде ӛкілдік ету шығыстарына байланысты қызметтер



Шыны, Къельдаль жұмыр шыныдан құралған, сыйымдылығы 250 мл; түбі дӛңгелек жұмыр,
сыйымдылығы 500 мл, тоңазытқыштың былғары киімі тікелей түтікшемен, ұзындығы 300 мл

Сүзгі қағаз



Медициналық хирургиялық гигроскопиялық зарарсыздандырылмаған мақтадан



Жоғарыда кең аузы және астында жіңішке түтікшесі бар жабдық



Жоғарыда кең аузы және астында жіңішке түтікшесі бар жабдық



Айналдырылған металлдан жасалған арнайы қылқалам, қылшықтар ось айнала орналасқан



Конус тәрізді шыныдан жасалған, түбі дӛңгелек жұмыр шыны, сыйымдылығы 750 мл



Медициналық мақта-матадан ағартылған



Флезилиннен жасалған резеңкемен



Спонбондтан жасалған біржолғы қалпақтар



Біржолғы бахилалар тоқылымсыз полиэтилен материалдан жасалған, жоғарыда резеңкемен
жабдықталған және текстурирленген жалағайлығы бар. Тӛзімділігімен ажырасады, қажетті ауа
алмасуды қамтамасыздандырады және кафель шалағайлықтарда сырғамайды.

Ақсӛл қолғаптары



Талькзіз табиғи латекстен жасалған. Зарарсыздандырылмаған, ӛлшемдері L, M (орташа және
үлкен). Кӛк (нитрилді)

Жалпы шаруашылық латекстен жасалған резеңке қолғаптар L, M (орташа және үлкен)



Цилиндр тәрізді П2 шыны түтікше (биологиялық), диаметр 16 мм, биіктілігі 200 мм, шыныдан



Шыныдан жасалған жабдық жұмыр шыныдан, саптамадан және тоңазытқыштан тұрады,
ӛлшемдері 85х440х460 мм

Кеуектігі тығыз қағаздан жасалған (ең тығыз), d=7,0мм немесе 9,0 мм (1орама -100 дана)



Ақ ұнтақ, орамада 1 г



Кеуелік пластинкаларда, қалыңдығы 20 мм артық емес. Талшықтар, қабыршықтар,
бӛлшектелген кеспешелер, қалыңдығы 0,5 мм артық емес, ұнтақ.
Ақ немесе әлсіз-сары кристаллдар, сульфат амонийге қайта есептегенде массалық үлесі - 90%
кем емес.

Сары кристаллдар, маркировка «ТҮТ» (1 орама -25г)



Тиамин- В1 дәрумен. В1 дәруменнің биологиялық әсері: жасушалық энергетик, ӛсуге және
дамуға кӛмектеседі. Ақыл-ой және физикалық жұмысқа қабілеттіліген үлкейтеді,
детоксикациялық, жүйке тамырларының метоболизмын жақсартады, антидепрессанттық,
ауыртпаулық қасиеті бар, жара жазылатын және т.б.

Ақ ұсақ кристаллды ұнтақ, суда жақсы ериді. Қоспалардың құрамында болуы; су 0,1% артық
емес, хлоридтер — 0,001% артық емес, ауыр металлдар — 0,0005% артық емес.

Наубайханалық ашытқылар



Темір сульфаттың кристаллдары (ΙΙ) жетісулы гидраттан тұрады, ақшыл жасыл түсті. Суда
жақсы ериді, ӛзіне тән ерекшеліктерімен ажырасады; суда ол гидратирлейді, ауада
дегидроирлейді және тотығады.

Химиялық таза



Түссіз мӛлдір кристаллдар



МСТ 4198-75, химиялық таза



Ақ түсті түйіршіктерден тұрады



Ақ түсті ұнтақ, «Т» таңбаламасы



Химиялық таза, МЕМСТ 4523-77



Кӛк кристаллды ұнтақ, «Т» таңбаламасы



Зертханалық ерітінділерді дайындауға арналған құрғақ, ақ, ұнтақ тәрізді реактив



Химиялық таза



Буфер, рН 7,5- Фосфат-150 ммоль/л, фенол-10 ммоль/л; Лиофилизат - (глюкозооксидаза) - 25 000
белсенді бірлік, пероксидаза - 1 500 белсенді бірлік, хромогендер, стабилизаторлар; Калибратор -
 глюкоза-10 ммоль/л. № 1 Реагенті - буфер, фосфаттан құралған-150 ммоль/л, фенол 10 ммоль/л -
2 сауыт. №2 Реагенті -лиофилизат, глюкооксидазадан құралған, пероксидаза -2 сауыт.,
антикоагулянт құрғақ -1 сауыт

Шыныдан жасалған фиксаналдар. (0,1 нормалы) (орама- 10 ампула х 15 мл )



Ақ, сұр немесе сары ұнтақ, орамада -100 мг



Суландырғыш. Ақшыл-сары түстен бастап ақшыл- қоңыр түсте дейін май тәрізді сұйықтық
немесе сықпа. Суда жақсы ериді.

«Металл» дәмі бар түссіз сұйықтық, суда, спиртте бейпіл еритін.
Шошқа асқазандардың бӛлшектерінен жасалған ферментативті гидролиз ӛнімі (тұз қышқылы
бар болғанда), жұғымтал орталарды дайындау үшін қолданады.

Сусымалы ақшыл-қоңыр түсті ұнтақ, орама – 300 г



Сарғыш-қоңыр түсті ұнтақ тәрізді. Сауыт 500 г



90 % спирт шоғырлануы. Сауытта 50 мл



Шыныдан жасалған фиксаналдар (орамада -10 ампула 12 г-нан)



Құрғақ дайын жұғымтал орта сарғыш түсті ұнтақ тәрізді, бұрылатын қақпағы бар пластик
сауытта оңтайландырылған, сауыт - 500 г

Ақ ұнтақ (1орама - 25 г)



Жоғары сорт, түссіз мӛлдір сұйықтық, «ТЕХ» таңбаламасы



Бекітілген бұрышпен ротерге 6 дана х 85 мм, модельдер F 34-6-38 , 5804R центрифуга үшін



Кӛрсетілген диапазонда рН анықтауға арналған әр түрлі индикаторлар комбинациялардан
құралған. рН=0-12 (орама -200 дана)

МЕМСТ 25336-82



Шыныдан жасалған, 5000 мл, ақшыл шыны



Мақта-матадан қалың мата, маталы ӛрімделген, қағаз кенеп, бурметь. 220 мм мақта 100%



Жоғарыда кең аузы және астында жіңішке түтікшесі бар жабдық



Б 12 немесе Б13 резеңкеден пластик қатты ұштықпен. Кӛлемі 360-483 мл.



Б 12 немесе Б13 резеңкеден қатты ұштықпен, медициналық груша. Кӛлемі 360-483 мл.



Жұмыр шынылар шыныдан жасалған ТХТ МЕМСТ 21400-75 бӛлшектеумен



Жылуға және химияға тұрақты шыныдан жасалған



Жылуға және химияға тұрақты шыныдан жасалған



Жылуға және химияға тұрақты шыныдан жасалған



Жылуға тұрақты шыны



Жұмыр шынылар шыныдан жасалған ТХТ МЕМСТ 21400-75 бӛлшектеумен
Кӛлемі 1 л, негізінің диаметрі 19 см, биіктігі 26 см.



Жылуға тұрақты шыны



Жылуға тұрақты шыны



Ӛлшеуіш жұмыр шыны бір белгімен және тілімтасталған тығынмен 1-25-2



Ӛлшеуіш жұмыр шыны бір белгімен және тілімтасталған тығынмен 1-50-2



Ӛлшеуіш жұмыр шыны бір белгімен және тілімтасталған тығынмен 1-100-2



Шыныдан жасалған 10 мл



К1-100-29/32



Жұқа алюминийден жасалған тығындар



Микробиологиялық манипуляцияларды жасаған кезде шашты ұстайтын және қорғайтын
біржолғы бас киім

50 пенициллин сауыттарды сақтауға есептелген картон қораптар



Крафт қағаз ақ целлюлозадан жасалған, түс бойынша ақ немесе қоңыр болуға мүмкін



Кварцтан жасалған, марка S10C-1EA, квадрат пішінді, кювета қалыңдығы 1 см



Пластмасстан жасалған



Дӛңгелек, цилиндр пішінді



ПТР микро шыны түтікшелер 0,2 мл жалпақ қақпағымен, автоклавирлейтін, ДНҚ-аз , РНҚ-аз
және пирогендерден бос (орамада -1000 дана)

Пластиктен, «Еппендорф» түрлі 1,5 мл (1орама-500 дана)



Шыныдан, конус тәрізді тұмсықпен



Пластиктен (орама -200 дана)



Пластиктен, (орама -1000 дана)



Пластиктен, (орама -1000 дана)



Пластиктен, (орама -1000 дана)
Пластиктен, (орама -1000 дана)



Пластиктен, CappAero мӛлшерлеуішпен үйлесімді, орамада 1000 дана



Пластиктен, CappAero мӛлшерлеуішпен үйлесімді, CappAero, абақ (орама)– 96 дана



(беруштер)



Жұқа қабатты хромотографияға арналған пластиналар (алюминий тӛсеніш) жоғары тиімді УФ
254, 8-12 мкм, ПТСХ-А Ф-В-УФ, 10ч10 (орама - 50 дана)

ЖҚХ үшін пластиналар (полимерлік тӛсеніш) аналитикалық УФ 254, 5-17 мкм, ПТСХ-П-А-УФ,
10ч20 (орама - 50 дана)

ЖҚХ үшін пластиналар (алюминий тӛсеніш), қабаттың қалыңдығы 0,25 мкм, байланыстыратын
SiO2 (орама - 50 дана)

Металл таяқша ұзындығы 20 см сым ілгекті ұстау үшін арналған жабдық



Нихромнан жасалған ілгек, ілгек ұстатқышта фиксирленген. (орама -20 дана)



Шыныдан градуирленген тамызғыш 0,01 бӛлшектелген. Кез келген белгіден құятын ұштыққа
дейін сұйықтықты құюға ӛлшенетін тамызғыш

Шыныдан градуирленген тамызғыш 0,01 бӛлшектелген. Кез келген белгіден құятын ұштыққа
дейін сұйықтықты құюға ӛлшенетін тамызғыш

Шыныдан градуирленген тамызғыш 0,01 бӛлшектелген. Кез келген белгіден құятын ұштыққа
дейін сұйықтықты құюға ӛлшенетін тамызғыш

Шыны



20 -200 мкл, ауыспалы кӛлемді



100 -1000 мкл ауыспалы кӛлемді



Диапазон: 1000 -10000 мкл. Кӛлемнің қадамы:±6,0 ±0.6 %



Кӛлемі 500 -5000 мкл



Цилиндр тәрізді шыны түтікше П2 (биологиялық), диаметр 21 мм, биіктігі 200 мм шыныдан



Цилиндр тәрізді шыны түтікше П2 (биологиялық), диаметр 19 мм, биіктігі 180 мм шыныдан



Центрифугалық шыны түтікшелер бұрылатын қақпақтарымен (50 дана -орама)



Пенициллин флакондарға арналған резеңке тығындар



Пульверизатор агрессиялық сұйықтықтармен жұмыс жасаған кезде қауіпсіз. Пульверизатормен
резеңке грушаны (тұтқыр сұйықтықтар) және де сығылған ауаны қолданып жұмыс істеуге
болады. Шыныдан.
Сұйықтықтарды шашырату үшін



Шыныдан



Шыныдан



Стакан В-1-250 шыныдан жасалған ЖТ шкаламен



Стақан В-1-1000 шыныдан жасалған ЖТ шкаламен



Стақан В-1-100 шыныдан жасалған ЖТ шкаламен



Стақан В-1-50 шыныдан жасалған ЖТ шкаламен



Жылу және химиялық тұрақты шыныдан жасалған.



Сұйықтықтарды оңай тӛгу үшін тұмсықтың бар болуы. Магниттік былғауышта оңай қолдану
үшін химиялық стақанның түбі жалпақ болуы керек. Жылуға тұрақты шыныдан.

Сұйықтықтарды оңай тӛгу үшін тұмсықтың бар болуы. Магниттік былғауышта оңай қолдану
үшін химиялық стақанның түбі жалпақ болуы керек. Жылуға тұрақты шыныдан.

Шыныдан



Жамылғы шынылар 18*18 мм, орама-100 дана



Жамылғы шынылар 24*24 мм орама - 100 дана



Жұқа шыныдан жасалған (0,1 мм)



Спиртке арналған шыны резервуар, қақпағымен және айналдырылмаған жіп білтелімен. Спирт
шығымы 25-30 мл/сағ, жылу қуаттылығы 160-200 вт

Берілген уақыт интервалын ӛлшейтін жабдық (қолмен немесе электрикалық импульспен) кері
есептеуіш секундомер, таймердің құрамында сағат немесе уақытты сақтайтын жабдық болуға
тиіс

Резеңке силиконнан құбыр. Ішкі диаметр диаметр - 6 мм, қабырғаның қалыңдығы - 2 мм.



Резеңке силиконнан құбыр. Ішкі диаметр диаметр — 8 мм, қабырғаның қалыңдығы - 2 мм. Ауа
және су орталарда, әлсіз қышқыл және сілтілер ерітінділерде, май және мұнай ӛнімдер
орталарда жұмыс істей алады, жоғары және тӛмен температураларға тұрақта (-60 oC бастап +
280 oC дейін). Физиологиялық бейтарап, усыз, электро оңашалау қасиеттері бар.



Ауа және су орталарда, әлсіз қышқыл және сілтілер ерітінділерде, май және мұнай ӛнімдер
орталарда жұмыс істей алады, жоғары және тӛмен температураларға тұрақта (-60 oC бастап +
280 oC дейін). Физиологиялық бейтарап, усыз, электро оңашалау қасиеттері бар.



Металлдан екі жақты, ұзындығы 195 мм.
Шыныдан жасалған ыдыс, кӛлемі – 10мл



Бұл қағаз сүзгілерді жандырғанда күл санның аз пайда болуын береді. Кӛк таспа бар сүзгілер
ақырын сүзеді, олар ұсақ тұқымдар тұнбаларды сүзуге арналған. d=15 мм (1 орама-100 дана)



Ақ немесе кӛк түсті шапандар, ұзын жеңді. Микробиологиялық манипуляцияларды ӛткізу үшін
арнайы киім, әйел ӛлшемі: 44 - 2 дана, ӛлшем 46 - 2 дана, ӛлшем 48-11 дана, ӛлшем 50 — 8 дана,
ӛлшем 52 — 2 дана, ӛлшем 54-56 – 1 дана., ӛлшем 58 – 1 дана. Ерлер: ӛлшем 48 – 4 дана, ӛлшем
50 – 3 дана, ӛлшем 52 – 1 дана.

Биологиялық тӛмен шыны аяқтар ЧБН-2 (ПЕТРИ). Нейтралды шыныдан жасалған. Химиялық
және жылулық зарарсыздандыру тәртіптеріне шыдайды.

Шыныдан жасалған электродтар, қажетті ӛлшемдердің дәлдіген қаматмасыздандырады.



Ақ-кӛк селекцияны ӛткізу үшін субстрат, сауыт - 0,5 г



Ақ ұнтақ, химиялық формула C7H10N2O2, молекулярлық масса 154,17, арнайы электрофорез
үшін

Дайын құрғақ жұғымтал орта сарғыш түсті ақ ұнтақ, оңтайландырылған.



Дайын құрғақ жұғымтал орта сарғыш түсті ақ ұнтақ, оңтайландырылған.



Термотұрақты, ДНҚ синтез катализын ӛткізеді, қоюландыруы 5б/мкл, орамада 1 мл (5000
белсенді бірлік)

Ақ ұнтақ, химиялық формула C3H5NO, молекулярлық масса 71,1, арнайы электрофорез үшін



Бұқалық альбумин іркіт түрлі кептірілген ұнтақ, протеазадан бос. Молекулярлық биология үшін
арналған. Сауыттың ішінде 100 гр. альбумин.

Ақ түсті ұнтақ. Суда жақсы ериді. Белсенді заттардың болуы 500 мг. Сауыт 0,5 г



Мӛлдір түссіз немесе сары түсті қатты иісті сұйықтық. Пайыздық ӛлшемді аммиактың массалық
үлесі 25 кем емес.

Азотқышқылды аммоний



Химиялық таза



Ақ ұнтақ, молекулярлық масса 228,20



Ақ кептірілген кристаллды ұнтақ.



Ӛсіруге арналған культуралды орталарды дайындау үшін



Ақ ұнтақ, молекулярлық масса 61,84



Иісі бар түссіз сұйықтық
Буфер полимеразалық жүйелік реакцияға арналған, 1 сауыт-0,5 мл



Үшфенилметанды бояғыш, суда аз еритін, қышқыл-негізгі индикатор, сары түсті ұнтақ



Электофорез үшін үлгілерді салу үшін буфер ретінде қолданылады, орама-5г



Плазмиданы кӛбінен E.coli клондау үшін вектор ретінде қолданады, ол шеңберлі екі жүйелік
ДНҚ молекула, ұзындығы 2997 жұп негізі, оның кұрамында ампицилинге тұрақты гендер және
ақ-кӛк селекцияны ӛткізу үшін lacZ аймағы бар. (орама -20 мкг)

Ферментті препарат — ақшыл-сары ұнтақ, түйіршіктер немесе сұйықтық. (орама-100мг)



Кристаллды ақ ұнтақ



ДНҚ қамау үшін, орама- 100 г



Ақшыл-сары түстен бастап сұр-қоңыр түске дейін ұнтақ немесе түйіршіктер, ашытқыраға тән
иісімен. Ылғалдың массалық үлесі 10 % артық емес.

Ампуланың ішінде кептірілген саңырауқұлақтық дақыл



Бұл - агарозды гель-электрофорезде молекулярлық ӛлшеуіштің стандарды ретінде қолдану
болатын жарамды 10 фрагмент жасалуымен арнайы ферменттермен гидролизденген плазмид
қоспа. Келесі ұзындықты 10 ДНҚ фрагменттері (нуклеатидтер жұптары): 1000, 900, 800, 700,
600, 500, 400, 300, 200, 100 (1 орама- 250 мкг)

 E.coli штаммынан фермент, бактериофаг Т4-дан ДНҚ лигаза клондалған генін апартын лигазы
из 4, қоюландыруы 50-200 б/мкл, 5’-фосфатты және 3’-гидроксильды соңғы ДНҚ (РНҚ)
топтардың арасындағы фосфодиэфирды байланыс құрылымдарының катализын жасайды сауыт-
1 мл
Суда дезоксиаденозинүшфосфат, дезоксигуанидинүшфосфат, дезоксицитозинүшфосфат,
дезокситимидинүшфосфат ерітінділер қоспасы, әрқайсысынан 10 мМ, 1 орама -1 мл

2'-дезоксиаденозин -5'үшфосфор қышқылы натрий тұзы, 100 милимоль су ерітіндісі, сауыт- 1 мл



Түссіз, жарықта қараятын, әлсіз иісі бар кристаллдар. Суда ерімейді.



Ақ-кӛк селекцияны ӛткізуге арналған субстрат, сауыт - 1 г



ДНҚ қамау үшін спирт



Мӛлдір емес қара-қоңыр түсті, тұнбасыз, ӛзіне тән иісі бар сұйықтық.



Химиялық таза, МЕМСТ 4148-78



Кристаллды ақ түсті ұнтақ



Түссіз кристалдар, жиында ақ ұнтақ құрайды. Ұнтақ ауада сары түске боянады. Суда жақсы
ериді.

Сары-сұр реңді ақ түсті кристаллдар. Азотқышқылды калийдің массалық үлесі 99,9% кем емес.
Сарғылт түсті ұнтақ. Гигроскопиялық



Түссіз кристалдардан ӛте ақ ұнтақ. Иіссіз, суда жақсы ериді.



Химиялық таза



Ақ түсті кристалл ұнтақ



Ақ түсті ұнтақ иіссіз. Араласпалар құрамы: Na2O— 0,016% кӛп емес, MgO — 1,115% кӛп емес,
CaO- 34,3% кӛп емес, SO3 — 45,5% кӛп емес.

Таза



Лавина тәрізді түрлі-түсті сиымдар



Шыны фиксандар (10 дана, кӛлемі-12,6 г, орамада). Мӛлдір түссіз кристаллдар.



Екі негізді, шекті карбон қышқылы, түссіз кристалдар, суда және спиртте жақсы ериді.



Құрамдас жасушалар, орама - 10 микро шыны түтікше 100 мкл, ДНҚ ӛнімдерін клондау үшін
қолданады.

Ұсақ ақ серпінді ұнтақ, суда жаман ериді. Жоғары сорт. Ылғалдылығы 17-10 %.



Ақ түсті үнтақ, «Т» таңбаламасы



Ақыл-сұр түсті ұсақ ұнтақ



Қара-қоңыр түсті ӛзіндік иісі бар сұйықтық ретінде кӛрсетілген



Бояғыш, электрофорез үшін үлгілерді салу үшін буфер ретінде қолданылады



Ферментті препарат, ұнтақ, ксиландарды ыдырайтын, орама -50г



Орташа ұнтақталған, ӛзіндік иісі бар сары ұнтақ



Жүгері қиыршықтары



Ақ түсті ұнтақ. Суда жақсы ериді.



Ақ кристаллды ұнтақ (моногидрат)



Ақшыл-сары түсті кептірілген кристаллдар массасы



Ақ түсті ұнтақ
Амплификация кезінде үлгілердің алдын ала булануын болдырмау үшін, сауыт - 5 мл



Микроскопияға арналған иммерсиондық терпенді май, қара түсті сауыттарда. Сары түстен
бастап қара-қоңыр түске дейін біртекті ақпалы мӛлдір емес сұйықтық. Марка КМ тығыздығы
0,9-1,0 г/см3, (сауыт-0,1л)
Түссіз, призматикалық кристаллдар, суда еритін (NH4)6[Mo7O24]x4H2O, (орама 100 г)



Мӛлдір емес ақ түсті сұйықтық, тұнбасыз.



Негізгі заттың массалық үлесі 98 % кем есем. Квалификациясы Т. Ақ түсті түйіршіктер ретінде
кӛрсетідген. Орамы 1 кг.

2 сорт



Шашыратылған, тығыз кесексіз, ұсақ талшықты болуы мүмкін, балыққа тән ӛзіндік иісі бар.
Ылғалдығы 12 % артық емес. Майдың массалық үлесі 18% артық емес. Шикі протеиннің үлесі
36 % артық емес.
100 П/п РНК реакцияға арналған жиын



Сұр немесе сары реңді ақ кристаллдар.



Сұр-ақ түсті кристаллды ұнтақ.



Иіссіз ақ кристаллдар, суда жақсы ериді. Құрамы: хлоридтер — 0,005% артық емес, сульфаттар
— 0,015% артық емес, ауыр металлдар - 0,0001% артық емес.

Ақшыл, сарғыш иіссіз ұнтақ немесе түйіршіктер.



Шыны тәріді ақ кристаллдар, «ХТ» таңбаламасы



Ақ кристаллды ұнтақ, гигроскопиялық



Жиын 20 реақцияға есептелген, бӛлмелі температурада (25°C) 5 минуттың арасында ДНҚ
жабысатын және доғал фрагменттерді тігуге жол береді, жиынның құрамында: жоғары белсенді
Т4 ДНҚ лигаза - 20 мкл, реакцияға арналған екі мәртебелі буфер (132 милимоль трис –
гидрохлорид, 20 милимоль магний хлориды, 2 милимоль DL-Дитиотреитол, 2 милимоль
аденинүшфосфаты, 15% полиэтиленгликоль 6000) - 200 мкл

Карболды генциан күлгін жиыны, 50 мл — 1 фл; Люголь ерітіндісі, 50 мл — 1 фл; фуксин
Цильсу ерітіндісі, 5 мл — 1 фл; Нұсқаулық — 1 дана. (1000 бояуға арналған)

Әр түрлі материалдан ПЖР үшін ДНҚ бӛліп шығару және тазартуға арналған жиын (100 сынау
үшін)

Сіркеқышқылды натрий (Натрий ацетат) дегеніміз сірке қышқылының натрий тұз үшгидраты,
қабыршық немесі дұрыс емес пішінді кесек түрде шығарылады. Химиялық формула:
CH3COONa*3H2O
Сарғыш-қоңыр түсті түйішіктер ретінде кӛрсетілген. 1 кг ӛлшеп буылған.



Олеин қышқылы СН3(СН2)7СН=СН(СН2)7СООН —қанық майлы қышқыл. Молекулярлық
масса 282,47; балқу t α-форма 13,4°С. Суда ерімейді. Ериді: ( 20 °С 100 г ерітіндіде) 4,0
метанолда , 5,2 ацетонда, 5.9 этилацетатте, 17,9 диэтилдық эфирде.
Сары-қоңыр түсті ұнтақ



Мӛлдір жабысқақ сұйықтық, фосфор қышқылының массалық үлесі 85%



Сары-қоңыр ұнтақ, гигроскопялық орама-500 г



1 кг ӛлшеп буылған қоңыр түсті сықпа ретінде немесе сарғыш-қоңыр түсті ұнтақ ретінде
кӛрсетілген.

Ниоген П-1000. Қою жабысқақ сұйықтық. Мӛлдірлігі 5 оптикалық бірліктен артық емес.



Сыра суслосы- эксрактивты ашытқы және құлмақ заттарының су ерітіндісі. Экстрактивты
(немесе сіріңді) дегеніміз ысқылаған кезде еріп, ашытқыға ауыса алатын заттар.

Tritirachium album Limber саңырауқұлақтан бӛлінген фермент. Кептірілген ұнтақ ретінде
кӛрсетілген. Сауыт- 100 мг.

Ақ түсті ұнтақ (орама-50 г)



Ақ түсті ұнтақ, орама-25 г



Ақ немесе сары не қызғылт реңкі ақ түсті кристаллды ұнтақ, ӛзіндік иісі бар. Суда ӛте жақсы
ериді (1:1) және спиртте (1:1), майлы майларда ериді (1:20) және де глицеринде. Балқу
температурасы. 109—110 °C, Т. жану. 127 °C, Т. қайнау. 280,8 °C. Этанолда диэтилдіқ эфирде,
ацетонда, суда жақсы ериді; СНСl3, CS2, бензолде ( 100 г 2,2 г 20 °C-да, 14,1 г 60 °C-да) қиын
ериді. Балқу температурасы 89-90 °C.Ӛзіндік иісі бар.



Arthrobacter luteus ферменттен, рестрикция сайты AG^CT (TC^GA) қоюландыруы 1-3 б/мкл,
буферге әкелінеді 10х (33 mM Tris-ацетат (pH 7.9 25o C-та); 10 mM магний ацетат; 66 mM калий
ацетат; 1 mM DTT), (орама- 1мл) (1000 белсенді бірлік)

Bacillus stearothermophilus MB ферменттен, рестрикция сайты ^GATC (CTAG^) қоюландыруы 5-
10 б/мкл, буферге әкелінеді 10х (50 mM Tris-HCl (pH 7.6 25o C-та); 10 mM MgCl2; 100 mM NaCl;
1 mM DTT), (орама- 1мл) (1000 белсенді бірлік)

Bacillus subtilis R ферменттен, рестрикция сайты GG^CC (CC^GG) қоюландыруы 20 б/мкл,
буферге әкелінеді 10х (10 mM Tris-HCl (pH 7.6 25o C-та); 10 mM MgCl2; 50 mM NaCl; 1 mM
DTT), (орама- 1мл) (5000 белсенді бірлік)

Rhodopseudomonas sphaeroides ферменттен, рестрикция сайты GТ^АС (CА^ТG) қоюландыруы
10-30 б/мкл, буферге әкелінеді 10х (10 mM Tris-HCl (pH 7.6 25o C-та); 10 mM MgCl2; 1 mM
DTT), (орама- 1мл) (5000 белсенді бірлік)

E.coli штаммның ферментінен, Serratia marcescens клондау SmaI генін апаратын, рестрикция
сайты ССС^GGG (GGG^CCC) қоюландыруы 20 б/мкл, буферге әкелінеді 10х (33 mM Tris-ацетат
(pH 7.9 25o C-та); 10 mM магний ацетат; 66 mM калий ацетат; 1 mM DTT), (сауыт - 100 мкл)

E.coli штаммның ферментінен Thermus rubber 9 Tru9I генін апаратын, рестрикция сайты Т^ТАА
(ААТ^Т) қоюландыруы 20 б/мкл, буферге әкелінеді 10х (10 mM Tris-HCl (pH 8.5 25o C-та); 10
mM MgCl2; 100 mM NaCl; 1 mM DTT), (орама- 1мл) (2 500 белсенді бірлік)

Ақ түсті ұнтақ, орама-25г



Сахароза- категориясы экстра таза, жұғымтал орталарды, ерітінділерді дайындауға арналған
химиялық реактив, орамада 500 грамм

«Алматы» немесе басқа Қазақстандағы аудандастырылған сорт
Силикаге́ль дегеніміз кремний қышқылдардың аса қанық ерітінділерден пайда болған
(nSiO2·mH2O) pH > 5—6. Қатты гидрофильденген сорбент.

Ақ түсті ұнтақ, электрофорез кезінде ДНҚ бояу үшін арналған



Ақ түсті ұнтақ



Сарғыш түсті ұнтақ, ұсақ тұқымды, қолға ұстағанда майлы, ӛзіндік иісі бар. Ылғалдығы 19%
артық емес, шикі май 8-10% (5-8%). Шикі протеин <43% кем емес, металл қоспалары 3 мг/кг
артық емес, Елеуіште қалдық №25 3% артық емс.

Ақ түсті ұнтақ.



Гигроскопиялық сары-жасыл түсті ұнтақ



Ақ түсті ұнтақ, суда жақсы ериді. сауыт-1г



Аминоқышқылдардың стандартты жиыны (орама -10 ампул 1г-нан)



Жиынның құрамына әр түрлі молекулярлық массамен 5 виала кіреді: (Рибонуклеаза,
химотрипсиноген, овальбумин, бұқалық альбумин іркіті, кӛк декстран) мӛлшері - 50 мг-нан
(орама — 5 ақуыз)
Шыны фиксаналдар (орама -10 ампул 10мл-ден), түссіз мӛлдір кристаллдар.



Ақшыл-сары түстен бастап сары түске дейін ұнтақ тәрізді ірі тұқымды зат.



E.coli штаммның ферменті ,бактериофаг Т4, клондалған генполинуклеотидкиназаны апаратын,
қоюландыруы 10 б/мкл, соңғы фосфатты АТФ тобын 5’-гидроксильді тобына ДНҚ (РНҚ)
аударуын (және алмасуын) катализін жасайды. (сауыт-1 мл) 2500 б.б.

E.coli штаммның ферменті, Alteromonas undina P2 клондалған сілті фосфотаза генін апаратын,
қоюландыруы 5 б/мкл, ДНҚ, РНҚ, рибо- және дезоксирибонуклеозидүшфосфаттардан 5’-фосфат
топтарының жою катализін жасайды. (сауыт-1 мл) 1000 б.б.

Ақ түсті ұнтақ. Суда жақсы ериді. сауыт-10мкг



Электрофорез үшін, молекулярлық масса 116,21, молярлығы 6,6, мӛлдір ұнтақ, ӛткір иісті сары
түсті, сауыт - 25 мл

Электрофорез ӛткізу үшін химиялық реактив, химиялық таза 99%, молекулярлық масса 121,14,
ДНҚ бӛліп шығару үшін буферлік ерітінділерді қолдануға арналған.

Ақ түсті ұнтақ. (орама-50 г)



Ақ түсті ұнтақ



Сары-қоңыр кристаллдар, суда жақсы ериді. орама 250 г



Органикалық мӛлдір сұйықтық, ӛзіндік ӛткір иісі бар, химиялық формула СHCl3. Суда ерімейді,
органикалық еріткіштермен араластырылады. Жанбайды.
Ферментті препарат, белсенділігі 200-2000 б/г, Trichoderma reesei (viride) саңырауқұлақты терең
культивирленген кезде бӛлініп шығатын жасушадан тыс ақуызды ультрасүзу кӛмегімен
шашыратқыш кептіргіште ферментті препарат алынады. Біртекті, ақшыл- ақшыл сары түстен
баста ақшыл-қоңыр түске дейін ұнтақ.

Ақ түсті ұсақ ұнтақ



Ақ немесе аз боянған кристаллдар және қабыршақтар. Гигроскопиялық,суда жақсы ериді.



Синтетикалық немесе табиғи алюмосиликат NaХ марка А (NaА—У фракция (3,5±0,5) мм)



Культуралды орталарды дайындауға арналған жемдік ашытқылар сіріңдісі. Ӛзіндік иісі бар,
қоңыр ұнтақ.

3'-гидроксильды соңынан екі жүйелі ДНҚ мононуклеотидтерді сатылық жою катализін жасайды,
4000 б.б.

Ақ түсті ұнтақ, суда жақсы ериді. сауыт-10мкг



Динатрий тұзы дигидраты, 150°C болғанда қайнау температурасынан тӛмен ыдырайды,
салыстырмалы тығыздығы (су=1):0,086. Суда еруі г/100 мл:0,05 ТҮТ ТШ 6-09-11-1721-85

Ақшыл-арғыш түсті ұнтақ, банкаларда 1 кг



Экстра таза, 99%, 100 мл, генетикалық талдауларды ӛткізу үшін, орама - 500 мл



Жылу энергия шаруашылығы бойынша жауаптыны аттестациялау және қысқа дайындылығы
бойынша жылу қондырғыларын тексеру



Кӛлік құралдарының йелерінің АҚЖ, сақтандыру полисті беру



Астана - Бұрабай - Щучинск - Астана бағдары бойынша су және ӛсімдіктер сынамаларын
сұрыптап алу мақсатында экспедициялық жұмыстар жүргізу үшін автокӛлікті жалдау.
Жолаушылар орны - 12. Жалдау бағасына жанар-жағар маймен қамтамасыз ету шығыны,
техникалық қызметтер, транспорт құралын басқару қызметі, жүргізушінің тұру орнымен
тамақтануы кіреді. Жалдау мерзімі - 3 тәулік

Таблеткалар (орама-10 дана)




Дәретханаға арналған, күл-қоқыр салатын жәшік 60 л, пластмасстан




Икемді, медициналық 1,0 м х 80 мм




Икемді, медициналық 2,0 м х 80 мм




Икемді, медициналық 3,0 м х 80 мм
Болаттан, ұзындығы 35 мм, орамада -100 дана




Бетон бойынша болаттан жасалған екі жапырақты победитті дәнекері бар ұзындығы 200 мм,
диаметрі 16 мм бұрғы-тестіргіш.



Бетон бойынша болаттан жасалған екі жапырақты победитті дәнекері бар ұзындығы 80 мм,
диаметрі 6 мм.



Майдың құрамы: ланолин, глицерин, 75 мл




Мақта-мата матадан 1,5м*100м




Орамада 10 қорап




Таблеткалар (орама -10дана)




Мырышталған, кӛлемі 5 л




Мырышталған, кӛлемі 12 л




Полиэтиленнен, 12л ыдыс, әдеттегі цилиндр пішінді, сұйықтықтарға және сусымалыға арналған
доға тәрізді тұтқасымен



Эмальденген 12л




Пластмасстан қақпағымен. Дӛңгелек шелек сыйымдылығы 10 л тұтқасымен.




Пластмасстан қақпағымен. Дӛңгелек шелек сыйымдылығы 5 л тұтқасымен.




Ақ жүгері, шаруашылық қашеттіліктер үшін.




Еден үстілік түрлі. Қуаттылығы 40 ВТ. Жылдамдықтар саны: 3. Қалақтардың диаметрі: 40 см.
Механикалық басқару. Қорғау торы бар. Биіктік бойынша реттеу: 1,25 м дейін. Желі лі баудың
ұзындығы: 1,3 м. Салмағы: 4,5 кг.

Металлдан, ұзындығы 100 мм
Металлдан, ұзындығы 50 мм




Ысқыштың ӛлшемі 43*67*90 мм кем емес




Ғаныш — ұсақ ұнтақ, ғаныш тастан алынатын, күйдіру және ұнтақтау, күйдіру немесе ұнтақтау
жолымен жасалған.



Зарарсыздандыратын зат (орама-300дана)




Бӛтелке тәрізді, айналдырылған металлдан жасалған арнайы қылқалам, қылшықтар ось айнала
орналасқан.



Металлдан, түтікшелерге арналған, ыдыс жууға арналған. 290х95х15мм (синтетикалық қылшық)




Поливинилхлоридті пленка ПВХ-композициясынан жасалған.




Сауыт-5 г




Пластмасстан жасалған канистра, кӛлемі 20 л




Металлдан 2 л кастрӛл тұтқасымен, эмальденген




Металлдан 5 л кастрӛл тұтқасымен, эмальденген




Металлдан 3 л кастрӛл тұтқасымен, эмальденген




Мақта-мата костюм, металл ӛңдеумен байланысты жұмысшы мамандар үшін. Р-р : 50-2 дана, 52-
2 дана, 54-2 дана,



Пластмасс қақпағымен 10 л, пластмасстан жасалған




Пластмасс қақпағымен 5 л, пластмасстан жасалған




Таблеткалар (орама-10 дана 1,5 мг-нан)
Вулканитты, металл бойынша армирленген, сыртқы диаметр 150 мм, қалыңдығы -1,6 мм,
отырғызылатын диаметр -22 мм



Вулканитты, металл бойынша армирленген, сыртқы диаметр -230мм, қалыңдығы -2,5мм,
отырғызылатын диаметр -22мм



Мақталы, ӛлшемдер: 52, 54 Тапсырыс берушінің таңдауы бойынша




Полиэтилентерефталат (ПЭТФ, ПЭТ) термопластик, қатты, түссіз, мӛлдір зат амфорлық
қалпында және ақ, мӛлдір емес, кристалл қалпында. Шыны балқыту температурасына жеткізген
уақытында мӛлдір қалпына ауыстырылады және тез суытқан кезде сол қалпында қалады және
«кристалдау аймақтан» тез ӛткен кезінде.

Бактерицидты 2,5 см х 7,2 см




Бактерицидты 3,8см х 3,8 см




Ені 3 м, қалыңдығы 3 ,0 мм




Вакуумды ВМ-1




Комперессорлық, вакуум сорғыштарда, LZ-9, LZ5 қондырғыларда және ратоционды
буландырғышта ауыстыру үшін.



МС-20




Қоқыстар үшін, 30л, орамада-30 дана




Таблеткалар (орама -10 дана)




Аспаптық болаттан дюйм оймасымен




Аспаптық болаттан дюйм оймасымен




Аспаптық болаттан дюйм оймасымен




Полипропиленнен (25кг)
Полиэтиленнен 25кг




Жоғары майсыздандыру қасиеті бар, суық суда да. Сумен оңай шайылады, ыдыста ешқандай
иісті, әшекейлерді қалдырмайды. Уландырғыш емес. Экологиялық қауіпсіз.



Сұйық, пластиктен жасалған флаконда мӛлшерлеуішпен




Сұйық зат, құрамында белсенді компоненттер жиыны бар, бӛтелке 500 мл




Жиынды құрал, кедергіні, кернеуді, тоқтың күшін ӛлшейтін.




Аспаптық болаттан,6мм бастап 32мм дейін, свараток және зырылдауық жиынымен




Аспаптық болаттан, кернейлі 8-10, 10-12, 12-13, 12-14, 14-17, 17-19, 19-22, 22-24. (8 дана)




Аспаптық болаттан (6 дана), пластмасс тұтқасымен: жалпақ безбездің ені: 4мм,6мм,8мм және
крест тәрізді диаметрмен 3мм,4мм,6мм.



Ұстауыш, 1/2-2 дюйм ауыспалы қақпашалар, аспаптық болаттан.




Ағашты ӛңдеу үшін. Пластмасс тұтқалармен 5мм, 10мм, 15мм, 20мм, 25мм ұзындығы 200-250мм




Таблеткалар (орама -40 дана)




Ағаш құрылыстарды ӛңдеу үшін, марка КСД немесе КОРД




Кӛмірқышқыл, сыйымдылығы 5 литр, болаттан жасалған баллонда.




Ауаны сергітуші 300 мл, әрекеттесу әдісі- шашырату




Суға, зарарсыздандыратын заттарға сонымен қатар спиртке тұрақты, жалпақ ӛкше, баусыз және
ілгексіз, матадан жасалған аяқ киім, 37 ӛлшем. Дезинфектанттар әрекеттеріне қарсы тұрақты
материалдан жасалған аяқ киім.

Суға, зарарсыздандыратын заттарға сонымен қатар спиртке тұрақты, жалпақ ӛкше, баусыз және
ілгексіз, матадан жасалған аяқ киім, 39 ӛлшем. Дезинфектанттар әрекеттеріне қарсы тұрақты
материалдан жасалған аяқ киім.
Ағартқыш және зарарсыздандыратын зат 1 л




Электр тұрмыстық дәнекерлейтін аспап, қуаттылығы 40 Вт




Құрылыс жұмыстар үшін. Нетто 600 гр




Диэлектрикалық қолғаптар




Аспаптық болаттан дюйм оймасымен




Аспаптық болаттан дюйм оймасымен




Аспаптық болаттан дюйм оймасымен




Поливинилхлоридты пленка, ПВХ-композициясынан жасалған, қалыңдығы 0,2 мм




Қап матадан, зығырдан, ақ орамалдар.




Марка 180106, Lz-9 қондырғының вакуум сорғышына




Аспаптық болаттан жасалған металл бойынша пышақтық мата




Орама 900 грамм, қолмен жууға арналған




Мақта-матадан, ӛлшемдері L,S (орташа және үлкен)




Латекстен, м/м шаңдатуымен, ӛлшемдері S, M, L, XL




Бензин-еріткіш, алифатикалық және ароматикалық , кӛмірқышқыл сұйық қоспалар, қайнап
кетудің деңгейі 155—200°С, мұнайды тура айыру кейде бірге қосымша гидротазарту арқылы
жасайды.

10 % (1 сауыт- 10мл)
Бриллиантты жасыл ерітіндісі 1% (1 сауыт-10 мл)




5% (1 сауыт-10 мл)




Кол аспабы, ағашты қол сүргімен сүргілеуге арналған.




Брезенттен отқа тұрақты сіңумен.




Резеңкеден жасалған, диаметрі 18 мм




Резеңкеден жасалған, диаметрі 30 мм




Ылғалды жинау ӛткізу үшін 30*40см (орама -3 дана)




2 қабатты майлықтар, ылғал ӛтпейтін 35х40м, Ламинирленген спанбонд (орамада 100 дана)




Металлдан, ұзындығы 35 мм




Металл бойынша аспаптық болаттан. Диаметрі 2 мм бастап 12 мм дейін




Қоңыр түсті қою, тұтқыз сұйықтық (банка – 0,8 кг)




Су құбырына эксцентрик қосудың ойма ӛлшемі - 1/2 дюйм. Геометриялық параметрлер
бойынша тобы — бірінші. Ыстық су және суық су қысымдардың ең жоғары жіберілетін
айырмашылығы: - 1,5 Бара. Осьтердің аралығы - 150+24мм.

Плассмасстан жасалған қалақ




Кирз жұмыс бәтеңкелер 43-3 жұп, 44-1 жұп, 42-2 жұп




Құрғақ хлорка




Су сүзгілермен, шартты диаметр 15 мм, метрологиялық класс В, қошаған ауаның температуры
50-500 С бастап, салыстырмалы ылғалдылығы 80%, судың шығымы м3/ сағ ең жоғары
3,0,номиналды, 1,5, ең кіші 0,03, сезімталдығының ақаулығы,015., судың ең үлкен кӛлемі м 3 37,5
бір тәулік үшін, бір ай үшін 1125 м3. Ортаинтегралды салыстырмалық шегі % +/-1,8.
Дӛңгелек, плассмасстан жасалған.




Плассмасстан жасалған




(-50С…+50С)




Рулондағы қағаздың ұзындығы 53 ±2 м рулонның ені 92 ±2 мм БТ-53-92-БГ-С1-БП-К-Е
МЕМСТР 52354-2005 жасалуы



Қатты, салмағы 100 г артық емес




Қатты, салмағы 200 г артық емес




Орама -10 дана




Үтіктің түрі қуаттылығы 1700 Вт, бу соғу 80 г/мин, бу беру 20 г/мин дейін, суға арналған
резервуар 180 мл. Ерекшеліктер — буды тігінен беру, түймелерге арналған астау, бу соғу, үнемі
бу беру, шашыратқыш, бу берудің деңгейін реттегіш, қақ басудан қорғау функциясы, айнала
шарнирлы сымжелі бекітуі, Электроқоректендіру - 220 В (айнымлы тоқ) • 50 / 60 Гц ,
қоректендіру баудың ұзындығы 1.8 м Ӛлшемдер, салмағы 11.5 x 13.6 x 26.1 см, 1.12 кг
(шапандарды үтіктеу үшін)


Металлдан жасалған баллонда




Ағаштан жасалған




Резеңкеден, майға, жанармайға тұрақты армирленген d-9мм




Резеңкеден, майға, жанармайға тұрақты армирленген d-20мм




Резеңкеден, майға, жанармайға тұрақты армирленген d-25мм




Инъекционды, біржолғы, инемен колдану үшін 5 мл, 2 компонентті




Резеңкелген кӛкірекшемен МЕМСТ 12.4.029-76




Жоғары жуатын қасиетті сұйықтық.
Ыдыстарды, бақалшықтарды тазартуға арналған зат.




Кӛлік құралдары йелерінің АҚЖ, сақтандыру полисті беру. Toyota Land Cruiser кӛлік құралы м/н
А 472 КР

2 жақты түрлі түсті, (90 мм*50 мм), зығыр, тапсырыс берушінің үлгісі бойынша, бұл ретте
деректеме карточкаларының дизайны ӛнім берушімен әзірленеді және тапсырыс берушімен
келісіледі, 1600 дана деректеме карточкалары

Техникалық реттеу саласындағы нормативтік құжаттар бойынша сараптама жүргізу және
сараптамалық қорытындыларды беру тәртібі 1.33-2008 ҚР СТ-ына сәйкес бруцеллез бойынша
ИХТ-сынақтар бойынша ТШ-на ұйым стандартын сараптау.

Түрі: мұздатқыш-шкаф, тік. Түсі/Жабынның материалы: ақ/бояу. Басқару: электромеханикалық.
Энергия тұтыну: В класы (328 кВтч/жыл). Сығымдағыштар саны: 1. Хладагент: R600a
(изобутан). Камералар саны: 1. Есіктер саны: 1. Габариті (Е*Т*Б) 57,4 см*61 см*148 см. Жалпы
кӛлемі: 210 л. Мұздатқыш камераның ерітуі: қолдық. Мұздатқыш камерадағы ең тӛмен
температурасы -24 С. Есіктердің алып ілу мүмкіндігі.



Атомды-абсорбциялы спектрометр үшін, жалынды атомизаторда қолданылады. 3 баллон 40
литрден

Экологиялық заңнамасына сәйкес бекітілген нысаны бойынша пропиленнен ұштықтарына мен
түтіктеріне қалдықтар тӛлқұжатын жасау



Тальксіз табиғи латекстен медициналық қолбақтар. Зарарсыздандырылмаған. Орамада 50 жұп
(100 дана). Ӛлшемі ХS -20 орама, S - 34 орама, M - 20 орама

Ақ, мата мен материал МЕМСТ 24760-81 сәйкес, ұзын жеңді, алдыңғы жағында түймелері бар,
сыртқы шеткі қалталары және сол жақта тӛс деңгейінде қалтасы бар, қайырма жағасы бар,
белдігімен. Әйелдерге арналған ӛлшемі 44 - 2 дн., ерлерге арналған 58- 1 дн., 52 - 1 дн.

Бір жолғы қолдануға, полиэтиленді



Зарарсыздандырылмаған, ауа ӛткізгіш. Тоқылмаған гидрофобты материалдан пропиленді жіптен
жасалған.

alpha_Fs4 - GTAGCCTGGAATGTAGCAATTGGT. 10 о.е. кем емес



alpha_Rs4 - AAGCGCTCATTGCCAATAGTG. 10 о.е. кем емес



FusA - CCG TAA TAT CGG GAT CAT GGC TCA CAT CGA (түзу праймер). 10 о.е. кем емес



fusA - CAA CAA CAT CTG AAC ACC CTT GTT (кері праймер). 10 о.е. кем емес



IleS - TCC TGG TTG GGA TAC TCA CGG (түзу). 10 о.е. кем емес



IleS - AGG AAC CGG AAT CGA ACC ACA CAT (кері). 10 о.е. кем емес



LepA-CAT CGC CCA CAT TGA TCA CGG GAA (түзу). 10 о.е. кем емес



LepA CAT ATG CAG CAA GCC TAA GAA CCC (кері). 10 о.е. кем емес
LeuS-GGG ACG GTT GTT GCA AAC GAA GAA GT (түзу). 10 о.е. кем емес



LeuS - CGG TTC ACC CCA ATA ACG CT (кері). 10 о.е. кем емес



PyrG - GGG GTC GTA TCG TCA TTG GGT AAA (түзу). 10 о.е. кем емес



PyrG GGA ATG GCA ATG ATT CGA TAT CGC CAA (кері). 10 о.е. кем емес



RecA CCG GAA AGT TCC GGC AAA ACA AC (түзу). 10 о.е. кем емес



RecA CGC GAC CAC CTG GTG TCG TTT (кері). 10 о.е. кем емес



RecG - AGG CGA TGT TGG GAG CGG TAA AAC (түзу). 10 о.е. кем емес



RecG -GTG TTC GGG GAA TAG GCG TCG C (кері). 10 о.е. кем емес



RlpB - CAA CAG TTA AAG CAA TCG AAT ACG ATC C (түзу). 10 о.е. кем емес



RlpB - CAC CAC CAC CAT GCG GGT GAT C (кері). 10 о.е. кем емес



Gmk -CTGGTGGTGTCAAGAAGATG (түзу). 10 о.е. кем емес



Gmk - GTGGTATGCTGGAGTATGC (кері). 10 о.е. кем емес.



LC16 - GCTGTCTGGTCTGTAACTG (түзу). 10 о.е. кем емес



LC16 - AGGCGGAATGCTTAATGC (кері). 10 о.е. кем емес



RpL2 - GCCAACCTTGAGACCCTTAG (түзу). 10 о.е. кем емес



RpL2 - CATCACCGTGCGTCATCG (кері). 10 о.е. кем емес



Для молекулярной биологии, с чистотой ≥98.5% (GC) 500 g



Rep-lc - AAATGGCTGGGCTTTGGC (прямой)



Rep-lc -TTGAAAGGGAATCTGAGCCTAAG (обратный) Не менее 10 о.е.



Молекулярлы биология үшін, тазалығы ≥99% кем емес, сауыт- 1л



Агарозды сірнені дайындау үшін қолданылады, Электрофорез әдісімен ПТР нәтижелерін
детекциялау үшін қажет. Орамада - 500 г

Молекулярлы биология үшін орамада - 25 г
тазалығы 99,5% кем емес, орамада - 500г



тазалығы 95,5% кем емес, орамада -500г



C14H15BrClNO6, молекулярлық салмағы - 408.6,5- β-галактозидазаның белсеңділігін анықтау
үшін қолданылады орамада - 100 мг 2 мл-де.

C9H18O5S молекулярлық салмағы - 238.3 5 г. Диоксаннан бос. Тазалығы 99% кӛп. Ақ-кӛк
селекцияда қолданылады. Лактозды промотрдың бақылауында клондалған гендер бейнелілігін
индукциялайды. орамада - 5 г

Қаннан және басқа организм сұйықтарынан геномды, митохондриалық немесе вирус ДНҚ-ны
эктракцияға арнлаған жиынтық. Жиынтық 250 реакцияға. 12 мкг дейін ДНҚ-ны 200 мкл тұтас
адамның қанынан.
10 мкг дейін ПТР ӛнімін тазалау үшін, ӛлшемі 100 п.о.-нан 10 т.п.о. дейін. Жиынтық 250
реакцияға.

Аз мӛлшердегі жаңа және мұздатылған қан, ұлпалар, кептірілген қан дақтарынан ДНҚ-ны
бӛлуге мүмкіндік береді. Жиынтық 50 реакцияға

Агарозды сірнеден бӛлуге немесе ферментативті қоспадан 10 мкг ДНҚ-ға (70 ж.н.-нан 10 м.ж.н.
дейін) дейін тазалауға мүмкіндік береді. Жиынтық колонка, буфер,фракцияларды жинауға
арналған түтіктерден (кӛлемі 2 мл) тұрады. Жиынтық 250 реакцияға

Жиынтық құрамында фермент- ДНҚ-полимераза, 10 мМ дНТФ қоспасы, 25 мМ магний хлорид,
10х ПЦР буфер, ыңғайландыратын еріткіш бар. Ферменттің белсеңділігі - 250 бірлік. Жиынтық
200 реакцияға.
ДНҚ-ны тез және жоғары спецификалық амплификациясында қолданылатын фермент. Буфер,
25мМ магний хлоридімен жеткізіледі. Фермент белсеңділігі - 1000 бірлік. Орама - 1000 бірлік



Жиынтық құрамында ыстық стартпен фермент- ДНҚ-полимераза, 25 мМ магний сульфаты,
дНТФ бар 5х ПЦР буфер, Q-ерітінді, РНҚаздан бос су . Ферменттің белсеңділігі - 1000 бірлік.

1орама - 250 мкл 4 түтік. 100мМ әрқайсысы бӛлек дАТФ, дЦТФ, дГТФ, дТТФ .



жеке орамада (зарарсыздалған) (ПТР-зонд). 1 орама=250 дн.



16х100 мм 10 мл ЕДТА - мен, 9 мл қанға.



Кӛлемі 0,2 мл мӛлдір дӛңес қақпағымен, автокланатын, ДНҚ-аз, РНҚ-аз және пирогендерден
бос. 1 орама=1000 дн.

Кӛлемі 2 мл, 20 С болғанда 20 мин. ішінде 20.000 ай/мин. дейін центрифугиялау. 1 орама=500 дн



Кӛлемі 2 мл бұралатын қақпағымен. 1 орама=500 дн.



ӛлшемі 410х210х190мм



ақ түсті, кӛлемі 20 л



кӛлемі - 2,3 л



0-200 мкл абақта (зарарсыздалған). 1 орамада=96 дн
0-1000 мкл абақта (зарарсыздалған). 1 орамада=96 дн



0-20 мкл абақта (зарарсыздалған). 1 орамада=96 дн



0-10 мкл: 10 кассет 96 данадан 1 орамада= 960 дн



0-200 мкл: 10 кассет 96 данадан 1 орамада= 960 дн



ауыспалы кӛлемі, 0,5-тен 10 мкл дейін



ауыспалы кӛлемі, 2-20 мкл



ауыспалы кӛлемі, 10-100 мкл



ауыспалы кӛлемі, 20-200 мкл



ауыспалы кӛлемі, 100-1000 мкл ұштықтар жиынтығымен



ауыспалы кӛлемі, 500-5000 мкл



6 тамызғыш үшін



Қызмет пәтерлерге техникалық тӛлқұжаттарды рәсімдеу: 4 шағын аудан. 17 үй, 25 п., 4 шағын
аудан. 88 үй, 17 п., 3 шағын аудан. 104 үй, 38 п., 5 шағын аудан, 9 үй, 162 п., 7 шағын аудан, 33
үй, 47 п.



5 баллон



10 баллон



ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448
ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448




ГАЗ -3307 автокӛлік үшін шасси № 1583448
ГАЗ -3307 автокӛлік үшін шасси № 1583448




Бумвинил, пішімі А 4, 70 мм, арка механизммен




Кітапша қазақ және орыс тілдерінде, цифрлі басылым, толық түсті 4+4, 60 бет, А5 форматты,
қағазы жылтыр, 100-120 гр., мұқаба толық түсті (4+0) жылтыр, 200 гр. 600 дана




Люминесценттік (құрамында сынап) саны 500 дн. шам.




1 фазалық, 25 А




1 фазалық, 32 А




1 фазалық, 16 А




3 фазалық, 63 А




3 фазалық, 40 А




3 фазалық, 32 А




3 фазалық, 16 А




ЛПО 2*36 Вт




ЛПО 4*36 Вт




НСП
КШ 36 W




КШ 18 W




Қабырғалық 16 топқа




Қабырғалық3 топқа




Қабырғалық 2 топқа




Қуатты 100 А




тӛмендететін 36 Вт




S10




S2




Энергия сақтайтын 22 W E27




Энергия сақтайтын 9 W E14




Энергия сақтайтын 18 W E27




16 А жермемен




2 ұялы жермемен және ішкі орнатылуымен




2 ұялы жермемен және сыртқы орнатылуымен




А56-134 екі клавишты
60 вт




36 вт




ПВХ




40 мм*25 мм




5 кг буып оралған, бактериологиялық, құрғақ



Химиялық таза



0,10-0,25 гр. ерекше таза



БМК кӛрсету үшін дәрі қобдиша



Бір-жолғы бахилалар, жұп



Медициналық бинт ені 5 см, ұзындығы 3 м кем емес



Крафт қағазы ӛнімді орау үшін, ені 70 см, ұзындығы 85 см



Жуғыш бӛтелкесі 0,5 л



Шүмекті бӛтелкесі бұрама қақпағымен, шӛлмек ауызы 54 мм, 10 л



1 бӛтелкесі 0,8 л. Т



10 ұялы, кӛлемі 105х85х70 мм, 88х70х40 мм шыны поднос 10 заттық шыныға, поднос үшін
болаттан тұтқасы

В-75-110 зертханалық ұрасы



Ерекше таза гексан



Талдау үшін таза глицин



Ұнтақ түрінде сусыз 500 г глюкоза, химиялық таза



1 банкада - 300 таблекалар. Натрий тұзының дихлоризоцианурон қышқылының 44,2 % тұратын
белсенді хлорлы залалсыздандырушы заттар, суда жақсы еритін таблеткалар

Қоректі ортаны дайындау үшін ашытқы сығынды
d = 70мм



Биологиялық түтіктер үшін, d = 10 мм



500 г ӛлшеп буылған



Кристалды йод



2-50 мл тамшуырмен жағындыны бояу үшін тамызғыш - мӛлшерлеуіш



250 мл-ге тілімтассыз



Түтіктер үшін 2 мм -1 дн., 3 мм -1 дн.



Түтіктер үшін 5 мм -2 дн



8-10 мм (МЕМСТ 8309-75)



Ақ, ұсақ ұялы



Евротүрлі, резеңкелер



Ақ, зарарсыздырылмаған



Резеңке, жұп, кішкене 6/S



Резеңке, жұп, орташа 7/м



1орама-1000 дн., 500-5000 мкл



хт



2-ауыс., 12 -сулы, талдау үшін таза



2-ауыс., 2 -сулы, талдау үшін таза



Боксты зарарсыздандыру үшін



500 г ӛлшеп буылған



1-100 мл кӛлемі тамшуырлар үшін



Пласмасты тұтқамен, микробиологиялық жұмыстар үшін
Нихромды № 3 мм



Нихромды № 2 мм



1 мм



5 мм



10 мм



Контейнерде ыдысты жабу үшін, 100 см х 38 м



П2-16-150 ХТ



Қауіпті және ұшқыш заттармен жұмыс жасаған кезде қауіпсіздік техникасын сақтау үшін



Аласа Н-1, 50 мл, бӛлгіштерімен



Аласа Н-100, 100 мл, бӛлгіштерімен шыны



Горяев камерасы үшін жамылғы шынылар жасушаны санауға арналған, 1 орама – 10 дн.



Үкімен ӛлшемі 25х75х2



қоректік ортаны дайындау үшін (38 г ұнтақ 1 л суға)



Сауыт - 500 г, қоректік ортаны дайындау үшін



Тұрмыстық, ванналы моделі, 0+50 ºС



Термометр -30+70 ºС



Тоңазытқыш үшін термометр -30+30 ºС



(қайың кӛмір активте) 250 г ӛлшеп буылған, хт



3-сулы, т.



Қабат, диаметр 9 см, 100 дн. орамада.



Қабат, диаметр 12,5 см, 100 дн. орамада.



Қабат, диаметр 7 см, 100 дн. орамада.
медициналық ӛлшемі 42 әйлерде - 3 дн, ӛлшемі 44 әйелдер - 5 дн, ӛлшемі 46 әйелдер - 6 дн,
ӛлшему 48 еркекті - 3 дн, ӛлшемі 50 еркектігі. - 3 дн

Химиялық таза хлороформ



Фарфорлы шүмегімен, диаметр 74/30 см



90 мм, 1 орама-36 дн



Бір -жолғы телпек



Сыртқы пішіні: - ATX ӛлшемі 244х244. Микрокесте жиынтығы: Чипсет : Intel H55 Express;
Процессор ажырату қосылыс: LGA1156. Пайдалынатын жады: DDR3 1066 / 1333 МГц. Диска
бағыныңқы жүйені қолдау керек: 6 x Serial ATA 3.0 Гб/с. LAN қолдауы: Гигабиттік желілік
контроллер. Сыртқы порты I/O: 1 x PS/2 клавиатура және тышқан порты; 1 x VGA; 1 x DVI; 1
x HDMI; 6 x USB 2.0/1.1 порты; 1 x LAN (RJ45); 1 х Audio In; 1 х Audio Out. Процессор және
жиілігі: Intel Core i5 750/2,66Ghz, 8мб кем емес (Физ екі ядро, және қосымша екі виртуалдык).
ОСЖ: 2 GB DDR2-800 PC2-6400 DIMM * 2 кем емес.
Оптикалык жетегі: DVD-RW. Қатты диск: 500 ГБ кем емес SATA Hard Drive (5400/7200 rpm) 3
дн.
Қатты дискілер контроллері: қатты дискілер үшін 4-х Serial-ATA (қолдау 3.0 Gb/s) ажырату
қосылыстар. Слот PCI: 2 кең кӛлемді PCI слоттар кемінде 1 толық кӛлемді PCI Express x 16
слоттар. Еңгізу-шығару порттары: USB 2.0 8 порттан кем емес болуы (2-алдынан, 4-артында, 2-
ішінде) , 1 дәйекті порт, 1 VGA, 1 RJ-45, 2 PS/2, Audio In, Audio Out , алдында микрофон және
дыбысқағар үшін шығыс. Видеобағыңынқы жүйесі: Интегралдык Intel GMA x 4500(HD). Қуат
кӛзі: Номинальды қуаты: 600 Вт, Шыңдық қуаты, Вт: 650, Сыртқы пішін: ATX. Кіріс кернеу:
90 ~ 264 В, кіріс жиілігі: 47 ~ 63 Гц. Клавиатура: PS/2 немесе USB , Ағылшынша, орысша,
қазақша Манипулятор ―тышқан‖ PS/2 немес USB , 2х батырмалы оптикалық скроллингпен.
Жеткізгенде жүйелік блокқа электрондық таратушыларында орнатылған құрылғыларына
драйверлердің толық жиынтығы қосылу керек (компакт дискілер). Қоректендіру: 220 В, 50 Гц.
Шығу қуаты VA – 2000.
Шығу қуаты Вт - 1340.
Номиналды кіріс кернеуі - 220/230/240 В +/- 30% («Кең диапазоны» әлпіде).
Кернеу дипазоны - 154-288 В.
Шығу жиілігі 50/60 Гц +/- 3 Гц (автотаңдау).
Шығу кернеу пішіні, кіру кернеу пішіні қайталайды.
Номиналды кіріс кернеуі 220/230/240 В +/- 5%.
Батарейге ауысы уакыты, мс Типті уақыты 2-6 мс, және «генератор» әлпіде 13 мс.
Шолпылдаудан/шуылдан қорғау. Шолпылдау мен шуылдан тұрақты қорғау.
Жайылу энергия саны Дж/2мс 230 250 640.
Тізбекті жүктемеден қорғау, кысқа тұйықталудан қорғау.
Жүктемеден қорғау, желіден жұмыс істегенде егер рауалы жүктеме 110-120% болғанда ҮҚК
автоматты түрде ӛшірілуі қажет.
180 сек. ішінде және 150-165 % 10 цикл ішінде
Батарея (АКБ) Герметикалык, ӛңдеуге келмейтін, корғасынды – қышқылды.
Заряд уақыты әдетте 3 сағат (90 % толық сыйымдылығына дейін).
100 % жүктемеде батареядан жұмыс уақыты ең кемінде 5 минут.
ҮҚҚ ӛлшеміі, mm - 217x86,2x413,5.
Батереяның сыртқы блок ӛлшемі, mm - 217x86.2x413,7. ҮҚК кепілдік мерзімі 1 жылдан кем
болмауы тиіс. Ӛнім беруші кепілдік жӛндеуді Тапсырушыдан пошта бойынша немесе e-mail
бойынша жіберілген жазбаша сұраныс тіркеленгеннен кейін 7 күнтізбелік күннің ішінде, Ӛнім
берушімен жӛндетілетін жабдықты Тапсырушыдан сервис орталығына және кері қарай
тасымалдау уақытын ескере отырып орындау қажет. Ӛнім берушіге ҮҚК конфигурациясымен
файлды міндетті түрде жүктеу.
ААА LR 03/1,5 V. Жарамдылық мерзімі 2013 жылдан ертерек АССU (аккумуляторлық) 1 ор./2
дн.



"Міндетті медициналық тексеріп-қараулар ӛткізілетін зиянды ӛндірістік факторлардың,
кәсіптердің тізбесін, сондай-ақ осындай тексеріп-қарауларды ӛткізу ережесі" сәйкес
медициналық тексеріп-қараулар ӛткізу. Медициналық тексеріп-қарауларға міндетті
жұмысшылардың саны 33 адам құрайды.
5000 бірлік номиналы бір тӛлем картасы



Қызметкер еңбек (қызмет) мiндеттерiн атқарған кезде оның ӛмiрi мен денсаулығына зиян
келтiргенi үшiн жұмыс берушiнiң азаматтық-құқықтық жауапкершiлiгiн мiндеттi сақтандыру

Микроклимат ӛлшеу - 12 ӛлшеу, жарықтандыруды ӛлшеу - 22 ӛлшеу, шуылды ӛлшеу - 2 ӛлшеу.
Ауада анықтау: уылы сілтілер - 8 ӛлшеу, сірке қышқылы - 4 ӛлшеу, күкірт қышқылы - 4 ӛлшеу,
ацетон - 4 ӛлшеу, хлороформ- 4 ӛлшеу, озон - 4 ӛлшеу. Саниталық-эпидемиологиялық
қортынды беруімен

Жабдықтаушы тапсырыс берушінің территориясынан 120 дана жалпы кӛлемінде ЛД-40, ЛБ-40
шамдарды тасып шығаруға және кәдеге жаратуға міндетті.



18 кӛмірқышқыл ӛрт сӛндіргіштер




«Қазан бақылау объектілерді техникалық куәландыру және тексеру бойынша әдістемелік
нұсқаулық» БҚ-05-07 сәйкес куәландыру



Алматы - Степногорск маршруты бойынша шейкер-инкубатор ES-20/60 жүкті тасымалдау
бойынша қызметтер. Шейкер -инкубаторды Алматыдан жеткізу пункті Ақмола облысы,
Степногорск қаласы, 6 шағын аудан, 6 ғимарат. Шейкер-инкубатордың салмағы 500 кг,
ұзындығы - 90 см, ені - 60 см., биіктігі - 90 см. Міндетті талаптар: жүкті автокӛлікпен
тасымалдау; қадағалау; жеткізу пунктіне әкелу мерзімі 5 тәулік; жүкті сақтандыруды; жүкті арту -
 түсіру жұмыстары. Жүк қауіпсіз болып саналады.



АИ 93 (92) этилденбеген. Талондық жүйе арқылы.
ЖҚС қайсысында талон иесі бензинді алу құқылы:
1. Астана қ. (5 ЖҚС кем емес);
2. Ақмола облысында Степногорск қ. (1 ЖҚС кем емес);
3. Ақмола облысында Астана қ. - Степногорск қ. Жолы бойынша (1 ЖҚС кем емес)
орналасқан болу тиіс.


Қатты мұқаба, бумвинил, жіппен тігу, 48 есептер



Аспалы аралық валмен ішпек, алмастыруымен - 1 дн., ШРУС-тың сыртқы шаңдық, жиынтықта
қамытпен және майлауымен, алмастыруымен - 2 дн., ШРУС-тың ішкі шаңдық, жиынтықта
қамытпен және майлауымен, алмастыруымен - 2 дн.




синтетикалық, кин. тұтқырлығы 40 ºС:91, кин. тұтқырлығы 100 ºС:14, тұтқырлық индексі: 166,
қату температурасы: ºС: -48, SAE: 5W-40, API: SJ-CF, ACEA: А3-98 В3 В-4, құты - 1 л



5 л құтыда, температуралық шегі - 30 ºС, метанолсыз. Құрамы: изопропил спирты, сүзілген су,
ҮАЗ, ароматизатор



Жұмсақ тұтқамен ыңғайлы конструкциясы, мұздан тазалау үшін қырғыш, шашақты қыл, қыл
жасанды материалдан орташа қатаңдығы, қырғыш тӛзімді пластиктен, мұзды тазалау үшін
шығыңқылармен, ұзындығы 60 см
1. 3-ші деңгейдегі СМЖ құжаттамаларды жасау.
2. Бӛлімшелердің іс номенклатурасын қалыптастыру.
3. «Сапа бойынша басшылық» жасау.
4. «Құжаттамалармен басқару» Құжаттау рәсімін жасау.
5. «Жазбалармен басқару» Құжаттау рәсімін жасау.
6. «Ішкі аудит» Құжаттау рәсімін жасау.
7. «Сәйкессіздік ӛніммен басқару» Құжаттау рәсімін жасау.
8. «Түзетулер әрекеттерін жүргізу» Құжаттау рәсімін жасау.
9. «Ескерту әрекеттерін жүргізу» Құжаттау рәсімін жасау.
10. «Қызметкерлермен басқару» сапа жүйесі Рәсімін жасау.
11. «Әрдайым жетілдірулер процессі» сапа жүйесі рәсімін жасау.
12. «Басшылық жағынан СМЖ талдауының процессі» сапа жүйесі рәсімін жасау.
13. Менеджмент сапасы жүйесінің жазулар формаларын жасау.
14. Менеджмент сапасы жүйесінің ішкі аудитін, түзетулер және ескерту әрекеттерін ӛткізу
мәселелері бойынша консультативтік-әдістемелік жұмыстарды ӛткізу.




Әбзелі автомат, резеңке ӛлшемі 55мм*32мм




1 сағат ішінде 1000-1500 капсула шығара алады. Ӛлшемі: 210 х 270 х 100 мм артық емес.
Жанасқан шалағайлықтар материалы - тот баспайтын болат.
Жиында (бағаның ішіне кіргізілген):
-№3 ӛлшемі капсулалар пішімді бӛлшекпен бағыттайтын құрал;
- №3 ӛлшемі капсулалар пішімді бӛлшек жиынмен толтыратын құрал;
- Баспақтаушы 50 капсулаға;
- Ұнтақты тегістеу үшін күрекше;
- Ұнтақ үшін жинаушы рамка;
- Техникалық қамтамасыздандыруға арналған жиын (қалақша және майлағыш);
- Машинаның жұмыс істегенін видео кӛрсетілуімен СD диск;
- Капсулалар қатты, желатиннен, ішекте еритін 5000 дана.
Кепіл мерзімі - 12 ай. Құжаттар: ӛндірушінің сертификаты, нұсқау орыс тілінде. Қосымша
мүмкіндіктер: Пішімді бӛлшектерді ауыстырып капсуланың басқа ӛлшемдерімен жұмыс істеу
мүмкіндігімен.




95мм*64 мм, ӛз желімдейтін қағаз, басып шығару түсті, жапсырмалар 800 дн




95мм*64 мм Oracal қабықша, 45 андатпа




730мм*173мм баннерлік матада басып шығару, дизайнерлік қызметтер міндетті түрде, басып
шығару түсті, басып шығару ӛлшемі - 350dpi, 6 баннер



95мм*64 мм, шрифт түсі — қара, қара-кӛк немесе қара-жасыл түсті болу мүмкін. Фонның түсі
— тек қана ақшыл түс, кӛкшіл-ақшыл түстен бастап ақшыл сары түске дейін. Жылтыр емес
қағаз, тығыздығы 280 г/м2., екі жақты, бұрыштары жұмырланбаған, 1000 дн. деректеме
карточкалар
95мм*64 мм, ӛз желімдейтін қағаз, басып шығару түсті, ламинирленген, 100 дн. Андатпалар




Кадрларды есебі бойынша жеке қағаздар 50 дана А3, мәтін мемлекеттік және орыс тілдерінде
Карточкалар Т2 түрі 50 дана




"Егемен Казахстан" газеті



"Казахстанская правда" газеті



"Справочник кадровика" журналы



"В мире науки/Scientific" журналы



"Вечерняя Астана" газеті



"Научный мир Казахстана" журналы - 1 шт/2 мес



Орама=2 орам




24х24, орама=100 дана.




500 мл кем емес




500 мл кем емес




500 г кем емес




Иіс сабын салмағы 100 г кем емес




Шаруашылық сабыны 65%, салмағы 250 г кем емес




Кір жуу ұнтағы 450 г кем емес, қол жууға үшін




Ағартқыш 1 л кем емес




Қоқысқа арналған қап 72х95, 7 л кем емес




Әжетхана қағазы 1 орама-4 дана
Сұйық сабын 400 мл кем емес




250 мл шаңға қарсы полироль




Бір -жолғы пакет-майка




300 мл кем емес ауа сергіткіш




Люминисцент шамы 12 ватт, 40 см




Шаруашылық қолғабы, матадан, жұп




Ағаштан жасалған швабра, шаруашылық




Шаруашылық сыпыртқы




Полиэтиленді пленка, қалындығы 3 мм кем емес, мӛлдір




Болат күрек, найзалы дӛңгелек жүзімен сабымен, ЛКО-8




Шелек мырышты 20 л




Бақтық қалақ, отырғызатын, 50 см кӛп емес




Қысқа сапты, 3-4 тісті




Бақтық тырмауыш сирек тісті, ұзын сапты




Мырышты су сепкіш, 10 л




Шапқы сапты
Еден жууға арналған




Суға арналған пластмассалы бак, 30-40 л.




Шланг, резеңке, диаметр 20 мм




Дала жұмыстарына арналған арнаулы киімі, жиынтығында комбинезон, кеудеше, дулыға, аяқ
киім; 1) кеудеше: ӛлшемдері 44 – 2 дана, 46- 2 дана, 48 – 3 дана, 50 – 1 дана, 54 – 2 дана; 2) аяқ
киім: ӛлшемі 36-1 дана, 37 -1 дана, 38-3 дана, 39-2 дана, 42 -2 дана, 43- 1 дана. 3) дулыға:
ӛлшемдері 52 – 5 дана, 53 – 3 дана, 54 – 2 дана.
"ҰБО" логотипі кеудешенің артқы жағынан үлкен шрифтпен және алдынан оң жағынан
кішкентай шрифтпен



Кӛлемі 12 л, сұр




Бәтелкедегі ауыз суы 20 л., ӛнім берушінің жеткізуімен




1 буда - 500 бет, 80г/м2 кеңсе техникасы үшiн, ақ түсті, 103% ақтықтығы




1 буда 250 бет ақ түсті, 86% ақтықтығы, тығыздығы – 65 г




Кӛк сырық




Қара сырық




Қызыл сырық



Кӛк сырық




Қара сырық




Тығыз




Пішіні А4, қағаздар үшін, пластиктен жасалған бір қалталы
Пластиктен жасалған пішіні А4, 40 файлға




Ақ картонды, пішіні А4




25 см кем емес, ағаштан жасалған




А5 48 бет, тор сызықты




А4 48 бет, тор сызықты




12 бет, тор сызықты




Перманентті, шыны бойынша, кӛк түсті, суға тӛзімді, 1 мм




Перманентті, шыны бойынша, қара түсті, суға тӛзімді, 1 мм




Перманентті, шыны бойынша, жасыл түсті, суға тӛзімді, 1 мм




Орама 100 дана, металдан жасалған




Орама 100 дана, түрлі түсті




65 г. қарындаш-желімі




Қатты, жұмсақ грифельді




21 см




20х50мм, ақ-сұр




А4 пішіні, қатты мұқаба, шығыс корреспонденция
Түрлі түсті қарындаштар жиынтығы 18 түсті




Степлер № 24/6




Степлер № 26/6




Степлер №10




Үлкен степлер 100 параққа, №23/8




Пластмассалы, А4 қағаздар үшін




25 мм 12 дана орамада, металдан жасалған




32 мм 12 дана орамада, металдан жасалған




Неонды 45мм х12 мм, бір түсте 25 дн




Стикер 7,6х7,6 см, орамада 100 дана




75х75 100 парақ




140 m 13/5 kg жіп арқан, орамада - 6 дана




Түзеткіш таспасы 4,2 мм




2011 ж күні кӛрсетілуімен




192 парақ, А4 пішіні




96 парақ, А4 пішіні
Қатты мұқаба, торлы




144 парақ, торлы




Қатты мұқаба, 96 парақ




Үлкен 18 мм




Кішкентай 13 мм




Пружинді қысқышпен А4, пластиктан жасалған




1 орама 2 дана




С4 229х324




Флешка 2Гб




Калькулятор 14 таңбалы, 2 қорек кӛзімен, дисплеймен, бухгалтерлік режимі




Пошталық, DL/E65 110х220 мм




Пластмассалы, мӛлдір мұқабасымен А4 пішіні




Ақ, орамды




Түсті, мәтінге арналған, орамада - 2 дн.




Қатты мұқабасымен А4 пішіні




Шыртылдақпен, қалталы
10 заттық; 1 дана – тӛсем, 2 дана лоток, 1 дана сағат, 1 дана күнтізбелік үшін тұғырық, 1 дана
жазу қағаздарға арналған тұғырық, 1 дана қаламдарға арналған тұғырық, 1 дана қағаз
кысқыштарға арналған тұғырық, 1 дана скотчқа арналған ұстаушы, 2 дана қалам

12 заттық; органайзер – 1 дана, қаламдар – 2 дана, степлер – 1 дана, қайшы – 1 дана, сызғыш - 1
дана, ӛшіргіш – 2 дана, антистеплер – 1 дана, ұш шығырғыш – 1 дана



А5, 50 бет, торлы




А4




А5




5 розеткалы, евровилкаларға арналған




50х80 см




Қызметкер еңбек (қызмет) мiндеттерiн атқарған кезде оның ӛмiрi мен денсаулығына зиян
келтiргенi үшiн жұмыс берушiнiң азаматтық-құқықтық жауапкершiлiгiн мiндеттi сақтандыру
  Краткая характеристика (описание) товаров, работ и услуг (на русском языке)         Способ          Вид       Единица
                                                                                      закупок      предмета    измерения
                                                                                                    закупок   (в соответст-
                                                                                                              вии с ОКЕИ)




                                          12                                             13           14             15
АИ 93 (92) неэтилированный. По талонной системе.                                    Запрос        товар       Литр
АЗС на которых владелец талона вправе получить бензин должны быть расположены:      ценовых
1. в г. Астане (не менее 5 АЗС);                                                    предложений
2. в Акмолинской области г. Степногорск (не менее 1 АЗС);
3. в Акмолинской области по трассе г. Астана – г. Степногорск (не менее 1 АЗС).



АИ 96 (95) неэтилированный. По талонной системе                                     Запрос        товар       Литр
АЗС на которых владелец талона вправе получить бензин должны быть расположены:      ценовых
1. в г. Астане (не менее 5 АЗС);                                                    предложений
2. в Акмолинской области г. Степногорск (не менее 1 АЗС);
3. в Акмолинской области по трассе г. Астана – г. Степногорск (не менее 1 АЗС).



Скорость соединения – 1024 кб/с, неограниченный трафик. Аренда блока из 4-х IP-     Запрос        услуга
адресов                                                                             ценовых
                                                                                    предложений

Места на диске - 3 Гб, кол-во почтовых ящиков - не менее 100 шт., домены второго    Запрос        услуга
уровня - не менее 3 шт., FTP-аккаунты - не менее 5 шт., база данных MySQL, панель   ценовых
управления (cpanel), место под MySQL базы - не менее 100 Мб                         предложений

1. Контроль за работоспособностью контрольно-приемного прибора "Верс-16ПК" -1      Запрос         услуга
шт., 2. Контроль и поддержание в работоспособном состоянии пожарных извещателей ценовых
(дымовой ИП 212-45, ИП 212-41М, тепловой ИП 101-1А) путем продувки- 75 шт., 3.     предложений
Контроль и поддержание в работоспособном состоянии сирены "Маяк-12КП" - 7 шт. 4.
Внешний осмотр состояния светого табло "ВЫХОД"-7 шт. 5. Контроль и поддержание в
работоспособном состоянии пожарных извещателей ИПР - 514 - 2 ручной - 6шт. 6.
Контроль системы автоматической пожарной сигнализации путем проверки на
работоспособность (ручным или путем дымовой завесы)- поэтажно, выборочная
проверка - 4 этажа. 7. Технический осмотр аккумуляторной батареи РВ 12-7.0 - 1 шт.



40 человеко/часов работы                                                            Запрос        услуга
                                                                                    ценовых
                                                                                    предложений
Вахтовая охрана административного здания и прилегающей территории по адресу: г.       Запрос        услуга
Астана, ул. Валиханова, 13/1. Физическая охрана с обмундированием, резиновой          ценовых
палкой, рацией и удостоверением установленного образца.                               предложений

Проведение дератизации помещений (химическая обработка помещений от грызунов) в Запрос              услуга
здании по адресу: г. Астана, ул. Валиханова, 13/1 общей площадью 1416,20 кв.м.  ценовых
                                                                                предложений

Проведение уборки помещений в здании по адресу: г. Астана, ул. Валиханова, 13/1       Запрос        услуга
общей площадью 1416,20 кв.м., и прилегающей к нему территории                         ценовых
                                                                                      предложений

Снятие и сдача показаний приборов учета тепловой энергии производится ежемесячно Запрос             услуга
согласно установленным правилам энергоснабжающей организации                     ценовых
                                                                                 предложений




Внутренняя и международная экспресс доставка различными видами транспорта писем, Запрос             услуга
документов, пакетов и т.п.                                                       ценовых
                                                                                 предложений

Вывоз твердо-бытовых отходов с контейнеров и их последующая утилизация                Запрос        услуга
                                                                                      ценовых
                                                                                      предложений

Заправка картриджа, ремонт картриджа, ремонт принтера                                 Запрос        услуга
                                                                                      ценовых
                                                                                      предложений

• 2 точки подключения                                                                 Запрос        услуга
• Аренда 2 ресиверов                                                                  ценовых
                                                                                      предложений

Формат С4 с отрывной лентой                                                           Запрос        товар    шт
                                                                                      ценовых
                                                                                      предложений

Питьевая, столовая, озонированная, негазированная вода Полимерная посуда емкостью     Запрос        товар    бутыль
19 л. Вода в емкости (бутыль) 18,9 л. Вода должна соответствовать требованиям СТ РК   ценовых
1432-2005 «Воды питьевые, расфасованные в емкости, включая природные                  предложений
минеральные и питьевые столовые. Общие технические условия»

Технический осмотр № 6 с проведением диагностики узлов и агрегатов автомобиля,     Запрос           услуга
масло моторное 5/40 в канистре объемом 4 л в количестве 1 канистры с ее заменой,   ценовых
трансмиссионное масло в канистре объемом 1 л в количестве 2 канистр с ее заменой,  предложений
антифриз зеленый в канистре объемом 5 л в количестве 1 канистры с его заменой,
фильтр топливный с его заменой (гарантия на 19 500 км пробега), фильтр воздушный с
его заменой (гарантия на 19 500 км пробега), фильтр маслянный с его заменой
(гарантия на 5 500 км пробега). Фильтры и масла должны быть для легкового
автомобиля DAEWOO Nexia Gle (VIN XWB3L32BD8A010728).


Курсы должны проводится на базе Заказчика в рабочие дни (понедельник -пятница) в      Запрос        услуга
течение срока не превышающего один месяц с момента заключения договора. Занятия       ценовых
должны начинаться не ранее 17.00 часов и заканчиваться не позднее 19.00 часов.        предложений
Обучение должно вестись на русском языке по согласованной с уполномоченным
органом в области промышленной безопасности или его территориальным
подразделением программе. Программа должна включать не менее 40 академических
(учебных) часов обучения. Обеспечить приемку экзаменов на базе Заказчика. После
окончанию курсов лицам сдавшим экзамены должны быть выданы удостоверения на
право обслуживание сосудов. Количество слушателей 7 человек.
АА, LR 6, 1,5 V, срок годности не ранее 2012 г.                                        Запрос        товар    шт
                                                                                       ценовых
                                                                                       предложений

ААА, LR 03, 1,5 V, срок годности не ранее 2012 г.                                      Запрос        товар    шт
                                                                                       ценовых
                                                                                       предложений

Материал ПВХ, цвет белый, двухуровневый (верхний уровень 50 ячеек, нижний              Запрос        услуга
уровень 50 ячеек), габаритные размеры (см) 150*20*10,5 (длина, высота, глубина)        ценовых
толщина ПВХ внешнего каркаса 8 мм, размеры ячейки (см) 2,5*7*9                         предложений
(ширина*высота*глубина) толщина ПВХ перегородки ячеек 0,3 мм, межуровневая
планка высота 4 см., толщина 0,8 мм. Количество - 1 ящик

Материал - ЛДСП, толщина 16 мм., кромка ПВХ 0,4 мм, габаритные размеры (мм)            Запрос        услуга
1400*600*750 (длина*ширина*высота), на крышке стола отверстия д.45-50 мм. кол-во       ценовых
50 шт. по горизонтали 5 рядов по 10 отверстий (по вертикали 10 рядов по 5 отверстий)   предложений
расстояние между отверстиями по горизонтали 20 мм по вертикали 50 мм, под
отверстиями встроенная полка - держатель контейнеров (мм) 55*810*600
(высота*ширина*глубина), фурнитура кабельный проход 50 штук, цвет ЛДСП по
согласованию с заказчиком.


Перемотка обмотки электродвигателя 5,5 кВт, 3000 об/мин                                Запрос        услуга
                                                                                       ценовых
                                                                                       предложений

Тип смесителя для раковины, тип управления двухвентельный, материал корпуса            Запрос        товар    шт
латунь хромированная, материал ручки металл, аэратор (рассеиватель) металл, кран -     ценовых
букса керамика                                                                         предложений

Гибкий, под сместитель, в металлической оболочке, длина 0,5 м                          Запрос        товар    шт
                                                                                       ценовых
                                                                                       предложений

канализационная, ПВХ, д. 50 мм, с уплотнителем                                         Запрос        товар    м.п.
                                                                                       ценовых
                                                                                       предложений

канализационный, ПВХ, д. 50 мм                                                         Запрос        товар    шт
                                                                                       ценовых
                                                                                       предложений

канализационный, ПВХ, д. 50 мм, с уплотнителем                                         Запрос        товар    шт
                                                                                       ценовых
                                                                                       предложений

канализационный, ПВХ, д. 50 мм, с уплотнителем                                         Запрос        товар    шт
                                                                                       ценовых
                                                                                       предложений

канализационный, ПВХ, д. 50 мм,