Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>

01 - (UEM PR) by HC11121515320

VIEWS: 63 PAGES: 23

									01 - (UEM PR)
    Considerando os componentes inorgânicos que são encontrados no organismo
    humano, assinale o que for correto.

   01. A perda excessiva de água por transpiração devida ao calor exagerado ou ao
       clima muito seco é uma das causas de desidratação.
   02. O hábito de fumar e de ingerir bebidas alcoólicas, a falta de exercícios físicos e
       uma alimentação deficiente em cálcio são fatores que favorecem o surgimento
       da osteoporose.
   04. O bócio endêmico, popularmente conhecido como papo, é uma doença que se
       estabelece no organismo quando a dieta é pobre em sais de ferro.
   08. O sal mineral mais conhecido popularmente é o cloreto de sódio (NaCl), solúvel
       em água e muito utilizado no preparo de alimentos.
   16. Os sais de iodo são necessários para a produção de hormônios na glândula
       tireoide. Esses hormônios aceleram o metabolismo celular e têm papel
       fundamental no crescimento e desenvolvimento do organismo humano.

02 - (CEFET PR)
    Muitos sais minerais são importantes para os seres vivos, atuando na forma de íons
    ou participando da composição de moléculas orgânicas. Assinale a alternativa
    correta sobre esta atuação.

   a)   Os íons cálcio e potássio são importantes na formação da hemoglobina.
   b)   Os íons sódio e potássio são importantes nos impulsos nervosos.
   c)   O magnésio participa na formação de um hormônio produzido pela tireóide.
   d)   O iodo participa na formação da clorofila.
   e)   Os íons de ferro são importantes no transporte ativo através da membrana
        plasmática.

03 - (UEM PR)
    Com relação aos constituintes químicos da matéria orgânica, assinale o que for
    correto.

   01. O mineral cálcio, presente nos vegetais verdes e no leite, é essencial à
       coagulação do sangue e à contração muscular no organismo humano.
   02. A união entre dois aminoácidos se dá por uma reação de síntese por desidratação
       e as moléculas resultantes são genericamente chamadas de peptídeos.
   04. A vida na Terra baseia-se essencialmente no elemento hidrogênio, átomo
       tetravalente, que constitui a estrutura básica de todas as moléculas orgânicas.
   08. Na espécie humana, os íons de sódio (Na+) e de potássio (K+) são responsáveis
       pelas alterações elétricas na membrana plasmática do neurônio durante o
       impulso nervoso.
   16. Os seres humanos são capazes de produzir todos os vinte tipos de aminoácidos
       necessários para a composição das proteínas.

04 - (UFAC)
    Os seres vivos necessitam de diversos tipos de sais minerais para o funcionamento
    eficaz das células. Na espécie humana, por exemplo, os íons de cálcio, dentre outras
    funções, participam da:
    a)      Contração muscular e da formação do ácido clorídrico no estômago
    b)      Coagulação do sangue e da molécula dos ácidos nucléicos
    c)      Coagulação do sangue e da contração muscular
    d)      Composição do osso e da forma da hemoglobina
    e)      Forma da hemoglobina e da constituição dos hormônios da tireóide

05 - (UFMS)
    Os sais minerais, em função da quantidade necessária ao organismo, são
    classificados    em    macrominerais  (macroelementos)    e   microminerais
    (microelementos). Assinale a(s) proposição(ões) que indica(m) os elementos
    classificados como microminerais:

    01. Fósforo e Cloro.
    02. Ferro e Zinco.
    04. Enxofre e Magnésio.
    08. Flúor e Iodo.
    16. Sódio e Potássio.
    32. Cobre e Manganês.

06 - (UFAM)
     Os sais minerais são fundamentais para a matéria viva, são encontrados nos organismos sob formas insolúveis e
     solúveis. relacione os papeis biológicos desses sais com as proposições dadas.
     1. participa da constituição da hemoglobina do sangue e dos citocromos, substâncias indispensáveis para a
          ocorrência da fotossíntese e da respiração celular.
     2. participa da constituição do esqueleto e de moléculas como os ácidos nucléicos e o ATP.
     3. participa da constituição do esqueleto. Atua na coagulação sanguínea e na contração muscular.
     4. participam da regulação osmótica nas células e associam-se com o mecanismo de transporte do impulso
          nervoso nos neurônios.

    (   )   Potássio (K+), Sódio (Na+) e Cloro (Cl)
    (   )   Cálcio (Ca++)
    (   )   Ferro (Fe++)
    (   )   Fósforo (PO4)

    A seqüência correta de relacionamento é:
    a) 1; 3; 4; 2
    b) 2; 3; 1; 4
    c) 3; 4; 1; 2
    d) 4; 3; 1; 2
    e) 2; 1; 3; 4


07 - (UFU MG)
    Na composição celular são encontrados vários elementos, entre os quais, os sais
    minerais. Por serem fundamentais ao adequado funcionamento de diversas células e
    órgãos, esses sais aparecem em diferentes regiões do corpo humano e em diversos
    alimentos. Faça a correlação entre os sais minerais apresentados na COLUNA A
    com as informações descritas na COLUNA B.
                        COLUNA A COLUNA B
                        1 - Ferro a - Sua maior reserva está nos ossos; é importante na
                                          contração muscular e na cascata de coagulação
                                          sanguínea; é encontrado em folhas verdes e casca
                                           do ovo.
                        2 - Potássio   b - É um dos componente s da hemoglobina; é
                                           encontrado no fígado e carnes.
                        3 - Iodo       c - Faz parte do esqueleto de vários animais, do
                                           processo de transferê ncia de energia no interior
                                          da célula e da molécula de ácidos nucléicos; é
                                           encontrado em carnes, feijão, ervilha e peixes.
                        4 - Cálcio     d - Atua na transmissão de impulsos nervosos; é
                                          encontrado em frutas, verduras e cereais.
                        5 - Fósforo    e - É um importante componente de um hormônio,
                                          cuja carência pode levar à obesidade; é encontrado
                                          em frutos do mar e peixes.



   Assinale a alternativa que apresenta a correlação correta.
   a) 1-b; 2-d; 3-e; 4-a; 5-c.
   b) 1-b; 2-d; 3-e; 4-c; 5-a.
   c) 1-d; 2-b; 3-e; 4-c; 5-a.
   d) 1-a; 2-d; 3-c; 4-b; 5-e.

08 - (UEPG PR)
    O cálcio desempenha papel importante em vários processos fisiológicos do homem.
    Por isso, é indispensável a manutenção dos níveis plasmáticos de cálcio em estreitos
    limites, o que ocorre com a participação de alguns hormônios. Acerca do exposto,
    assinale o que for correto.
    01. A diminuição da concentração plasmática de cálcio é um fator de estímulo para
        a liberação de calcitonina pelas células parafoliculares da tireóide.
    02. A diminuição da concentração plasmática de cálcio é um fator de estímulo para
        a liberação do paratormônio pelas paratireóides.
    04. A elevação da concentração plasmática de cálcio é um fator de estímulo para a
        liberação de triiodotironina e tiroxina pela tireóide.
    08. A elevação da concentração plasmática de cálcio é um fator de estímulo para a
        liberação de aldosterona pelo córtex das adrenais.
    16. O cálcio, além de entrar na composição dos ossos, participa da contração dos
        músculos e da coagulação do sangue.

09 - (UEM PR)
    Com relação à nutrição e às necessidades energéticas da espécie humana, assinale o
    que for correto.

   01. Os sais minerais, como os cloretos e os fosfatos, por serem inorgânicos, não são
       considerados nutrientes.
   02. Alimentos de origem vegetal, como a soja e o feijão, são desprovidos de
       nutrientes plásticos, ou seja, de proteínas.
   04. Vitaminas são substâncias orgânicas necessárias em quantidades relativamente
       pequenas, mas que exercem grandes efeitos no organismo.
   08. Glicídios e lipídios são nutrientes orgânicos cuja função principal é fornecer
       energia às células.
   16. Uma dieta balanceada é aquela que fornece a quantidade de energia necessária,
       dispensando as gorduras e os carboidratos.

10 - (UEM PR)
    Sabendo-se que a maior parte da energia de que o corpo humano necessita vem dos
    carboidratos e das gorduras, assinale a(s) alternativa(s) correta(s).

    01. O amido, um carboidrato, é hidrolisado no intestino humano, formando glicose e
        frutose.
    02. A decomposição dos carboidratos é rápida, portanto sua energia é fornecida
        rapidamente ao corpo.
    04. As gorduras são os melhores acumuladores de energia no corpo humano, pois
        são solúveis em água, o que facilita o transporte até as células.
    08. A energia liberada quando 1 grama de uma substância sofre combustão é
        chamada de calor específico de combustão.
    16. A celulose, por apresentar estrutura química similar à do amido, serve como
        alimento rico em energia para a dieta humana.

11 - (UFMS)
     Os carboidratos apresentam importantes funções, entre as quais destacam-se as energéticas e as estruturais.
     Classificam-se em: monossacarídeos, oligossacarídeos (os dissacarídeos são os mais conhecidos nesse grupo) e
     polissacarídeos. Em relação aos carboidratos, é correto afirmar:
     01. A glicose é classificada como dissacarídeo.
     02. A celulose exerce importante função estrutural, participando da parede celular dos vegetais.
     04. O amido é classificado como polissacarídeo e desempenha importante função de reserva energética em
          vegetais.
     08. A sacarose, encontrada na cana-de-açúcar e na beterraba, é classificada como monossacarídeo.
     16. A quitina, classificada como polissacarídeo, exerce importante função estrutural, a exemplo do
          exoesqueleto dos artrópodes e da parede celular dos fungos.
     32. O glicogênio é classificado como oligossacarídeo e apresenta funções energéticas e estruturais em animais
          e vegetais.


12 - (UPE)
    A celulose vegetal, o açúcar da cana-de-açúcar e a glicose do mel são
    respectivamente:
    a) um polissacarídeo, um dissacarídeo e um monossacarídeo.
    b) um monossacarídeo, um dissacarídeo e um polissacarídeo.
    c) um carboidrato, um polissacarídeo e uma pentose.
    d) um glicídeo, um carboidrato e uma pentose.
    e) um fosfolipídeo, um glicídeo e uma proteína.

13 - (UFMS)
    Uma das principais formas de armazenagem de glicose pelas células é o polímero
    denominado glicogênio. Sobre esse polissacarídeo, é correto afirmar:
    01.        Constitui a principal forma de armazenagem de glicose em células
        animais e de fungos; em células vegetais, esse papel é do amido.
    02.        Na verdade, corretamente, é um monossacarídeo com diversos isômeros,
        composto por uma única molécula, cuja fórmula é: C6H12O6.
    04.        Constitui a principal forma de armazenagem em células vegetais e não-
        animais, sob a forma de um amido.
    08.        Participa das reações conhecidas como glicólise, sendo seu principal
        substrato e reduzido a piruvato.
    16.        Pode ser armazenado no fígado e nos músculos, sob a forma de
        glicogênio hepático e muscular, respectivamente.
    32.        Sua hidrólise, que pode ser estimulada pelos hormônios do córtex
        supra-renal, provoca o aumento da taxa de glicose no sangue.
14 - (UFAL)
    A matéria que constitui os seres vivos revela abundância em água, cerca de 75% a
    85%, além de proteínas (10 a 15%), lipídios (2 a 3%), glicídios (1%), ácidos
    nucléicos (1%), e de sais minerais diversos (1%). Com relação a alguns
    componentes químicos do corpo humano, assinale a alternativa incorreta.

   a) Na composição química das membranas celulares, há fosfolipídios organizados
      em duas camadas; há também moléculas de proteína.
   b) O colesterol, conhecido principalmente por estar associado ao enfarte e a
      doenças do sistema circulatório, é um importante componente de membranas
      celulares.
   c) Um importante polissacarídeo, o amido, é armazenado no fígado e, quando o
      organismo necessitar, esse polissacarídeo pode ser quebrado, originando
      moléculas de glicose para o metabolismo energético.
   d) Os íons de cálcio (Ca++) participam das reações de coagulação do sangue e da
      contração muscular, além de serem componentes fundamentais dos ossos.
   e) Os íons de sódio (Na+) e de potássio (K+), entre outras funções, são responsáveis
      pelo funcionamento das células nervosas.

15 - (UPE)
    Os rótulos dos alimentos trazem informações sobre as substâncias neles contidas e
    que devem ser observadas com cuidado, principalmente para quem tem restrições
    alimentares. Os alimentos diet e light, por exemplo, atestam que reduzem,
    respectivamente, os teores de açúcar e de gordura. Outros alertam: contêm
    fenilalanina e assim por diante. Sobre esses componentes químicos, analise as
    alternativas e assinale a CORRETA.

   a) Sendo a fenilalanina um aminoácido não essencial, pode ser removida da dieta,
      entretanto para os fenilcetonúricos, faz-se necessária uma dieta balanceada desse
      aminoácido.
   b) Alimentos de origem animal, como ovos e leite, são mais pobres em
      aminoácidos que os de origem vegetal, como arroz e feijão.
   c) As gorduras são lipídios formados, principalmente, por ácidos graxos saturados.
      Dietas ricas em ácidos graxos contribuem para doenças cardiovasculares, pois há
      depósito de placas de gorduras na parede das artérias, que dificultam a
      circulação de sangue.
   d) A digestão de carboidratos no trato digestório dos seres humanos produz
      monossacarídeos, como a glicose e o glicogênio. A glicose é usada na
      respiração, e o glicogênio é armazenado nos músculos e no fígado.
   e) Os seres humanos e outros mamíferos armazenam gorduras, como triglicerídeos,
      em células do tecido conjuntivo frouxo que constitui fonte de reserva de energia
      e isolante térmico.

16 - (UEL PR)
    No alvorecer da humanidade, e durante muito tempo da nossa história, as refeições
    foram literalmente um vale tudo. Pelo fato dos seres humanos terem evoluído num
    mundo onde a disponibilidade de alimentos era apenas intermitente, a sobrevivência
    exigiu que tivéssemos a capacidade de armazenar energia para épocas de escassez.
    O tecido adiposo, familiarmente conhecido como gordura, é o órgão especializado
    para essa tarefa. Nossa capacidade de armazenar gordura continua essencial à vida e
   pode permitir que uma pessoa sobreviva à fome por meses. Na história humana
   recente, contudo, a quantidade de energia acumulada como gordura está aumentando
   em muitas populações. Obesidade é o nome que damos quando o armazenamento de
   gordura se aproxima de um nível que compromete a saúde de uma pessoa.
     (SCIENTIFIC American. Especial: Alimentos, saúde e nutrição. Out. 2007. p. 46.)

   Com base no texto e nos conhecimentos sobre o tema, analise as afirmativas a
   seguir:
   I. Restringir as gorduras insaturadas – encontradas, por exemplo, na carne bovina,
        nos embutidos, na margarina, assim como nas gorduras de laticínios – diminuem
        o risco de doença cardíaca coronariana.
   II. O glicogênio é uma forma importante de armazenamento de energia, o que se
        justifica por dois motivos básicos: ele pode fornecer combustível para o
        metabolismo de carboidrato muito rapidamente, enquanto a mobilização de
        gordura é lenta; e, talvez o mais importante, o glicogênio pode prover energia
        sob condições anóxicas.
   III. A totalidade de depósitos de gordura em adipócitos é capaz de extensa variação,
        conseqüentemente, permitindo mudanças de necessidades do crescimento,
        reprodução e envelhecimento, assim como flutuações nas circunstâncias
        ambientais e fisiológicas, tais como a disponibilidade de alimentos e a
        necessidade do exercício físico.
   IV. O tecido adiposo aumenta: pelo aumento do tamanho das células já presentes
        quando o lipídeo é adicionado, fenômeno este conhecido como hiperplasia; ou
        pelo aumento do número de células, fenômeno conhecido como hipertrofia.

   Assinale a alternativa que contém todas as afirmativas corretas.
   a) I e III.
   b) II e III.
   c) III e IV.
   d) I, II e IV.
   e) I, III e IV.

17 - (UEL PR)
    Os triglicerídeos são substâncias orgânicas presentes na composição de óleos e
    gorduras vegetais. O gráfico a seguir fornece algumas informações a respeito de
    alguns produtos usados no cotidiano em nossa alimentação.
    Observe o gráfico e analise as afirmativas.




   I. Todos os óleos vegetais citados no gráfico são substâncias puras.
   II. Entre todos os produtos citados, o de coco está no estado sólido a 20 ºC.
   III. Entre todos os óleos citados, o de girassol é o que possui a maior porcentagem
        de ácidos graxos com duas ou mais duplas ligações.
   IV. Entre todos os óleos citados, o de canola e o de oliva são líquidos a −12ºC.

   Assinale a alternativa que contém todas as afirmativas corretas.
   a) I e II.
   b) II e III.
   c) III e IV.
   d) I, II e IV.
   e) I, III e IV.

18 - (UEPG PR)
    Os lipídios constituem um dos grupos formados pelas principais substâncias
    orgânicas que compõem a matéria viva. Dentre as suas várias funções destacam-se a
    energética e a estrutural. Com base nestas informações, analise as alternativas
    abaixo e assinale o que for correto.
    01. São formados pela reação entre ácido graxo (longa cadeia de átomos de carbono
        ligados a átomos de hidrogênio apresentando um grupamento ácido carboxílico
        na extremidade terminal) e álcool (uma ou mais hidroxilas ligadas a átomos de
        carbono saturados).
    02. Um dos álcoois mais comumente encontrados na formação dos lipídios é o
        glicerol.
    04. Na formação de um lipídio, álcool e ácido graxo estabelecem uma ligação na
        qual uma hidroxila do primeiro reage com o grupo ácido carboxílico do
        segundo, liberando uma molécula de água. Esse processo é conhecido como
        reação de esterificação.
    08. Na reação de esterificação, se o álcool for o glicerol, o produto será um
        glicerídeo (óleo ou gordura). Caso se trate de um outro álcool de cadeia aberta, o
        lipídio formado será um cerídeo (cera). Álcoois de cadeia fechada caracterizam
        os lipídios classificados como esteróides ou esterídeos.
    16. Ao serem degradados, os lipídios liberam grandes quantidades de energia. Cada
        grama fornece o dobro da energia que a mesma quantidade de glicídio.

19 - (UFG)
    Leia as informações abaixo.
    A ingestão de gordura trans promove um aumento mais significativo na razão:
    lipoproteína de baixa densidade/lipoproteína de alta densidade (LDL/HDL), do que
    a ingestão de gordura saturada.
         Aued-Pimentel, S. et al. Revista do Instituto Adolfo Lutz, 62 (2):131-137, 2003.
                                                                              [Adaptado].

   Para a Agência Nacional de Vigilância Sanitária, um alimento só pode ser
   considerado “zero trans” quando contiver quantidade menor ou igual a 0,2 g desse
   nutriente, não sendo recomendado consumir mais que 2 g de gordura trans por dia.
   O quadro abaixo representa um rótulo de um biscoito comercialmente vendido que
   atende às especificações do porcentual de gorduras trans, exigidas pela nova
   legislação brasileira.
   As informações apresentadas permitem concluir que o consumo diário excessivo do
   biscoito poderia provocar alteração de
   a) triglicéride, reduzindo sua concentração plasmática.
   b) triacilglicerol, diminuindo sua síntese no tecido adiposo.
   c) LDL-colesterol, aumentando sua concentração plasmática.
   d) HDL-colesterol, elevando sua concentração plasmática.
   e) colesterol, reduzindo sua concentração plasmática.

20 - (UFMS)
    Quando é analisada a matéria que constitui os organismos vivos, são encontrados
    principalmente os elementos carbono, hidrogênio, oxigênio, nitrogênio, fósforo e
    enxofre (os quatro primeiros são os mais abundantes), embora uma série de outros
    elementos químicos sejam funcionalmente necessários. Com relação à matéria viva
    e seus constituintes, assinale a(s) alternativa(s) correta(s).
    01. Os carboidratos (glicídios, açúcares ou hidratos de carbono) são moléculas
        orgânicas constituídas fundamentalmente por átomos de carbono, hidrogênio e
        oxigênio; os dois últimos elementos estão sempre na proporção de 1:1 na
        molécula.
    02. Aminoácidos naturais (ou não-essenciais) são aqueles que um organismo
        consegue produzir a partir de outras substâncias; aminoácidos essenciais são
        aqueles que um organismo não consegue produzir.
    04. O termo lipídio é usado de forma genérica para designar alguns tipos de
        substâncias orgânicas que têm solubilidade em água e em diversos solventes
        orgânicos.
    08. Duas proteínas que possuam o mesmo número e os mesmos tipos de
        aminoácidos podem ser diferentes, dependendo da seqüência em que os
        aminoácidos estiverem inseridos na cadeia polipeptídica.
    16. Os glicídios têm nos seres vivos uma única função (energética), ou seja,
        constituem a principal fonte de energia para os organismos vivos.
    32. Nas células humanas, podem ser produzidos todos os diferentes tipos de
        aminoácidos que constituem as nossas proteínas.

21 - (UFMS)
    As proteínas, formadas pela união de aminoácidos, são componentes químicos
    fundamentais na fisiologia e na estrutura celular dos organismos. Em relação às
    proteínas, assinale a(s) proposição(ões) correta(s).

   01. O colágeno é a proteína menos abundante no corpo humano apresentando forma
       globular como a maioria das proteínas.
   02. A ligação peptídica entre dois aminoácidos acontece pela reação do grupo
       carboxila de um aminoácido com o grupo amino de outro aminoácido.
   04. A ptialina, enzima produzida pelas glândulas salivares, atua na digestão de
       proteínas.
   08. A anemia falciforme, causada por fatores nutricionais, é atribuída ao
       rompimento das hemácias em função da desnaturação da molécula protéica de
       hemoglobina em decorrência do aumento da temperatura corporal.
   16. A insulina, envolvida no metabolismo da glicose, é um exemplo de hormônio
       protéico.
   32. As proteínas caseína e albumina são encontradas no leite e na clara do ovo,
       respectivamente.

22 - (UDESC SC)
    Os aminoácidos apresentam quimicamente um carbono central onde eles estão
    ligados.
    Em relação a isso, assinale a alternativa correta.

   a) 1 grupo   amina (NH2), 3 hidrogênio (H), 1 grupo carboxila (COOH), 4 Radical
      (R)
   b) 2 grupo   amina (NH2), 1 hidrogênio (H), 2 grupo carboxila (COOH), 1 Radical
      (R)
   c) 1 grupo   amina (NH2), 1 hidrogênio (H), 1 grupo carboxila (COOH), 1 Radical
      (R)
   d) 1 grupo   amina (NH2), 1 hidrogênio (H), 3 grupo carboxila (COOH), 2 Radical
      (R)
   e) 2 grupo   amina (NH2), 1 hidrogênio (H), 1 grupo carboxila (COOH), 3 Radical
      (R)

23 - (UEPG PR)
    As proteínas, que são moléculas grandes, apresentam estrutura complexa, já que
    uma molécula de proteína é constituída por várias unidades menores, ligadas entre
    si, que são os aminoácidos. A respeito dos aminoácidos, assinale o que for correto.
    01. São exemplos de aminoácidos naturais: glicina, alanina, serina, cisteína, tirosina,
         fenilalanina, valina, lisina e leucina.
    02. Os seres vivos necessitam de 20 aminoácidos para promover a síntese de suas
         proteínas. Os vegetais são capazes de produzir todos eles, ao passo que os
         animais, tendo em vista que suas células só sintetizam 12 deles, obtêm os 8
         restantes a partir dos alimentos.
    04. Toda molécula de aminoácido tem um grupo ácido carboxílico (–COOH) e um
         grupo amina (–NH2) ligado a um átomo de carbono. A esse mesmo carbono se
         liga ainda um átomo de hidrogênio e um radical (R), que pode ser um simples
         átomo de hidrogênio (na glicina), um –CH3 (na alanina), ou grupos mais
         complexos (em outros aminoácidos). Assim, os aminoácidos existentes na
         natureza diferem entre si apenas quanto aos seus radicais.
    08. Na molécula de proteína, dois aminoácidos se unem por meio de uma ligação
         peptídica entre as suas carboxilas, com a perda de uma molécula de água,
         caracterizando uma síntese por desidratação.

24 - (FEI SP)
    O "teste do pezinho", utilizado para identificação de fenilcetonúricos, foi
    desenvolvido em 1967 pelo Dr. Robert Guthrie. O teste consiste em tirar gotas de
    sangue do pé do recém-nascido e colocar em um meio de cultura contendo bactérias
    específicas. O resultado é positivo quando ocorre inibição do crescimento das
    bactérias e negativo quando ocorre o crescimento das bactérias.
    Com relação ao exposto acima é correto afirmar:

    a) A ausência do aminoácido fenilalanina no sangue da criança provocou a inibição
       do crescimento das bactérias.
    b) A ausência do glicídio alanina no sangue da criança provocou a inibição do
       crescimento das bactérias.
    c) A ausência do glicídio fenilalanina no sangue da criança provocou a inibição do
       crescimento das bactérias.
    d) A presença do glicídio alanina no sangue da criança provocou a inibição do
       crescimento das bactérias.
    e) A presença do aminoácido fenilalanina no sangue da criança provocou a inibição
       do crescimento das bactérias.

25 - (UNESP SP)
    As proteínas são moléculas complexas formadas por unidades denominadas
    ...........……........, que se unem umas às outras por meio de ........……….....…......
    Cada unidade é formada por um átomo de carbono, ao qual se ligam um grupo
    ....…..............., um grupo ......…............., que apresenta um átomo de nitrogênio, e
    um radical de estrutura variável.
    Os termos que completam corretamente os espaços em branco são, pela ordem,
    a) monopeptídeos … ligação glicosídica … carboxila …amina
    b) monopeptídeos … ligação peptídica … amina … carboxila
    c) aminoácidos … ligação peptídica … carboxila … amina
    d) aminoácidos … ligação glicosídica … amina … carboxila
    e) nucleotídeos … reação de desidratação … carboxila … amina

26 - (UNIOESTE PR)
    Relativo aos componentes químicos das células é correto afirmar que:
    01. O teor de água nos tecidos de animais superiores é maior quanto maior seu
        metabolismo e menor com o aumento da idade.
    02. Os lipídeos são moléculas orgânicas formadas da associação entre ácidos graxos
        e álcool e formam um material de isolamento térmico nas aves e mamíferos.
    04. O amido é o polissacarídeo que representa a principal forma de armazenamento
        intracelular de glicídios nas células animais.
    08. Os carboidratos são os compostos orgânicos mais abundantes da matéria viva,
        constituídos de unidades denominadas aminoácidos e são responsáveis pela
        estruturação dos tecidos.
    16. Os ácidos nucléicos são as maiores moléculas intracelulares encontradas em
        todos os seres vivos, e são responsáveis pelo controle dos processos metabólicos
        vegetais.
    32. Os sais minerais presentes na célula apresentam-se sob a forma imobilizada
        como principais componentes de estruturas esqueléticas.
    64. Algumas proteínas atuam como enzimas catalisando uma reação biológica e
        apresentando especificidade de substratos e dependência de temperatura.

27 - (UFSC)
    Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios,
    anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos cabelos,
    na lã, na seda, em unhas, carapaças, chifres e penas dos seres vivos.
    Em relação às proteínas é CORRETO afirmar que:
   01. são biopolímeros constituídos de aminoácidos, os quais são unidos entre si por
       meio de ligações peptídicas.
   02. a produção destas moléculas se dá sem gasto de energia pelos organismos, já
       que os aminoácidos provêm da alimentação.
   04. todas as proteínas possuem peso molecular idêntico, característica especial
       dessas moléculas.
   08. a insulina, que foi o primeiro hormônio a ter sua seqüência de aminoácidos
       conhecida, é produzida por células especializadas do pâncreas.
   16. apesar da diversidade na constituição e estruturação de seus aminoácidos, essas
       moléculas apresentam, no seu conjunto, a mesma velocidade de degradação no
       meio ambiente.
   32. a grande variabilidade biológica dessas moléculas permite sua utilização para
       fins de identificação pessoal, da mesma forma e com a mesma precisão que os
       exames de DNA.

28 - (UEM PR)
    Sobre a expressão dos genes, assinale o que for correto.
    01.        As proteínas podem ser formadas por mais de uma cadeia polipeptídica.
    02.        Com os recursos da tecnologia do DNA recombinante, os cientistas
        conseguiram produzir o hormônio de crescimento humano em bactérias.
        Independentemente dos recursos tecnológicos utilizados, esse feito só foi
        possível porque o código genético das bactérias é idêntico ao código genético
        humano.
    04.        A seqüência completa das bases do genoma é o código genético de uma
        espécie.
    08.        Nos organismos multicelulares adultos, as células são geneticamente
        idênticas, mas são encontrados muitos tipos de células diferenciadas, isto é,
        especializadas em diferentes funções. A forma e a função da célula dependem
        dos grupos de genes que entram em funcionamento ou que são desativados
        durante o desenvolvimento.
    16.        A síntese de uma molécula de DNA necessita de um molde que
        determina a seqüência de bases da nova molécula. Na natureza, a regra é uma
        molécula de DNA servir de molde para a síntese de outro DNA. Os retrovírus
        constituem uma exceção, pois, na sua reprodução, o DNA é sintetizado a partir
        de um molde de RNA.
    32.        Na célula, as proteínas enzimáticas, ou enzimas, catalisam as reações
        químicas do anabolismo e as reações químicas do catabolismo.
    64.        Os anticorpos são produzidos por células sangüíneas nos vertebrados e
        por células foliares nas plantas fanerógamas.

29 - (UEM PR)
    Identifique o que for correto sobre a molécula do DNA e do RNA.

   01. A duplicação do DNA é semiconservativa.
   02. Se em uma molécula de DNA 30% dos nucleotídeos apresentam a guanina, 20%
       dos nucleotídeos apresentarão a timina.
   04. As quatro bases nitrogenadas do RNA mensageiro, reunidas três a três, formam
       64 trincas distintas.
   08. Na molécula de RNA, o pareamento das bases nitrogenadas é descrito pela
       relação (U+C) + (G+A) = 1.
   16. O fluxo da informação genética nas células eucarióticas ocorre do DNA para o
       RNA e, na maioria das vezes, do RNA para um polipeptídio ou uma proteína.

30 - (UESPI)
    Considerando a estrutura do ácido desoxiribonucleico, representada abaixo, e sua
    função, é correto afirmar que esse ácido:




   a) é formado por nucleosídeos arranjados em fitas duplas antiparalelas conectadas
      entre si por pontes de hidrogênio.
   b) se replica de forma semiconservativa e se inicia a partir da região 3’terminal
      para a região 5’terminal.
   c) compreende nucleotídeos, composto por grupos fosfato, uma hexose e uma base
      nitrogenada.
   d) tem a maioria do DNA composto de regiões chamadas introns, sem informação
      gênica.
   e) em sua tradução, produz fitas simples de RNA mensageiro.

31 - (UNIOESTE PR)
    O material genético tem a função de armazenar, transmitir e expressar as
    informações nele contido. Sobre estes processos e seus constituintes, assinale a
    alternativa em que as todas as correlações estão corretas.

   I- DNA.
   II- RNA.
   III- Proteína.

   a-   Ligações peptídicas.
   b-   Pontes de hidrogênio.
   c-   Pontes dissulfeto.
   d-   Anticódon.
   e-   Ligações fosfodiéster.
   f- Bases nitrogenadas.

   a)   I-e, II-d, III-c.
   b)   I-b, II-a, III-f.
   c)   I-f, II-c, III-a.
   d)   I-e, II-f, III-d.
   e)   I-d, II-b, III-a.

32 - (UEPG PR)
    A respeito do DNA e do RNA, assinale o que for correto.

   01. Os dois se originam a partir da união dos nucleotídeos compostos por ácido
       fosfórico, açúcar e base nitrogenada.
   02. Embora o DNA e o RNA sejam estruturalmente bem distintos, a união entre os
       nucleotídeos dessas duas moléculas ocorre por meio da radical fosfato (ácido
       fosfórico) com a pentose.
   04. As bases nitrogenadas que compõem os nucleosídeos do DNA são adenina,
       guanina, citosina e uracila, e as bases nitrogenadas que compõem os
       nucleosídeos do RNA são adenina, guanina, citosina e timina.
   08. Eles podem ser distinguidos por meio de suas bases piramídicas. A timina é
       exclusiva do RNA e a uracila só aparece no DNA.
   16. O RNA é geralmente composto por uma fita simples, e o DNA se apresenta
       como uma dupla hélice numa configuração espacial denominada helicoidal.

33 - (UDESC SC)
    O esquema abaixo representa um filamento de DNA e, a partir dele, ocorre a síntese
    do RNA-mensageiro.




   Assinale a alternativa correta sobre a transcrição deste filamento.

   a) A transcrição da mensagem genética significa passar o código da sequência de
      letras do RNA para uma sequência de aminoácidos da proteína.
   b) A sequência AUGCCU GAU CGA AUC no RNA-mensageiro formou-se a partir
      desta transcrição.
   c) A sequência UACGGA CUAGCU UAG no RNA-mensageiro formou-se a partir
      desta transcrição.
   d) O processo de transcrição ocorre no citoplasma da célula.
   e) Um grupo de três letras no RNA-mensageiro constitui o aticódon, a partir desta
      transcrição.

34 - (UEM PR)
    Assinale o que for correto sobre a constituição das células.

   01. O átomo de carbono faz parte da constituição das moléculas de vitaminas e dos
       fosfolipídios.
   02. As unidades básicas formadoras de enzimas, de polissacarídeos e de ácidos
       nucleicos são aminoácidos, monossacarídeos e nucleotídeos, respectivamente.
   04. A autoduplicação de moléculas de DNA e de RNA origina cópia exata de si
       mesma.
   08. As bases nitrogenadas adenina, citosina e timina constituem tanto o DNA quanto
       o RNA.
   16. Os triglicerídeos são lipídios solúveis em água e formados por glicerol e ácidos
       graxos.

35 - (UFSC)
    O DNA é a molécula biológica responsável pela codificação da informação genética
    nos seres vivos.

   Sobre esse assunto, é CORRETO afirmar que:

   01. a molécula de DNA é formada por duas cadeias caracterizadas por seqüências de
       bases nitrogenadas.
   02. na molécula de DNA podem existir oito diferentes tipos de complementação de
       bases nitrogenadas.
   04. a quantidade de adenina presente em uma das cadeias é exatamente igual à
       quantidade de timina da cadeia complementar.
   08. na molécula de DNA podem existir cinco diferentes tipos de bases nitrogenadas.
   16. no processo de mitose, cada molécula de DNA dá origem a quatro moléculas de
       DNA exatamente iguais.

36 - (UEPG PR)
    A respeito da molécula de DNA, assinale o que for correto.
    01. Durante a duplicação do DNA, as pontes de hidrogênio que ligam as bases
        nitrogenadas se rompem, e as duas fitas se separam. Cada uma das fitas
        originais, então separadas, serve agora como molde para a produção de fitas
        novas.
    02. Além da capacidade de se duplicar, o DNA também fabrica RNA. A duplicação
        é uma propriedade que permite a transmissão da informação genética às células-
        filhas, ao passo que a produção de RNA relaciona-se à síntese de proteínas, no
        citoplasma.
    04. O DNA é uma molécula constituída por duas cadeias de nucleotídeos, em cada
        uma das quais os nucleotídeos estão ligados uns aos outros pelos fosfatos. As
        duas cadeias estão ligadas uma à outra pelas suas bases nitrogenadas, por meio
        de pontes de hidrogênio, e essas ligações ocorrem entre pares de bases
        específicas. Sendo assim, a adenina liga-se somente à timina, e a citosina liga-se
        sempre à guanina. Toda essa estrutura apresenta-se torcida e em forma de dupla-
        hélice.
    08. O DNA sempre tem a forma de dupla-hélice e sempre é constituído por apenas
        quatro tipos de nucleotídeos. Na verdade, uma molécula de DNA pode diferir da
        outra pelo numero total de nucleotídeos. Embora o menor DNA conhecido tenha
        ao redor de 5.500 nucleotídeos, a maioria das moléculas de DNA tem algumas
        centenas de milhares de nucleotídeos. Assim, varia muito o tamanho de uma
        molécula para outra. Além do tamanho, as moléculas de DNA diferem pela
        seqüência dos pares de bases.

37 - (UDESC SC)
    Os organismos vivos são constituídos de várias macromoléculas orgânicas,
    conhecidas como polímeros biológicos.
    Sobre essas macromoléculas, é incorreto afirmar:

    a) Ácidos nucléicos são polímeros de monossacarídeos unidos por ligações
       glicosídicas, com funções estruturais.
    b) Os lipídeos são compostos formados por ácidos graxos, que podem constituir
       membranas celulares e exercer papéis importantes como hormônios.
    c) Proteínas são polímeros de aminoácidos unidos por ligações peptídicas e que
       podem exercer funções enzimáticas, estruturais e energéticas.
    d) Carboidratos são conhecidos como açúcares, constituídos por carbono,
       hidrogênio e oxigênio, sendo as principais fontes de energia da célula.
    e) Alguns tipos de polissacarídeos podem ser encontrados na estrutura da parede
       celular dos vegetais e também ser estocados como reservas energéticas em
       vegetais.

38 - (UNCISAL AL)
    O esquema representa um monômero constituinte de uma macromolécula.




    Esse monômero está presente nas seguintes estruturas citoplasmáticas de células
    eucarióticas:

    a)   complexo golgiense e vacúolos.
    b)   condriomas e cloroplastos.
    c)   cromossomos e condriomas.
    d)   cloroplastos e nucléolos.
    e)   ribossomos e nucléolos.

39 - (UFSC)
     Todas as formas de vida do nosso planeta têm suas informações genéticas codificadas nas seqüências de bases
     nitrogenadas dos ácidos nucléicos. Assinale a(s) proposição(ões) correta(s), considerando as informações
     abaixo:
                        Seqüência 1  AAAGATCCCGAATCGGTCGGCGATTTATCG
                        Seqüência 2  TTTCTAGGGCTTAGCCAGCCGCTAAATAGC

    01. As seqüências 1 e 2 são complementares no DNA e, juntas, representam um segmento de molécula de
        DNA.
    02. Se considerarmos 1 a seqüência molde, o RNAm formado por esta seqüência conterá as mesmas bases
        nitrogenadas da seqüência 2, trocando-se a timina pela uracila.
    04. Na seqüência 1 estão representados 30 códons e 10 nucleotídeos.
    08. A seqüência 1 pode ser a representação de um DNA ou de um RNA, dependendo de como for lida.
    16. O código genético é exclusivo de cada espécie. Prova disso é que determinados aminoácidos, como
        por exemplo a fenilalanina, são encontrados apenas na espécie humana.
    32. Adenina, timina, citosina e guanina são aminoácidos essenciais, presentes em todos os seres vivos.
   64. Com o seqüenciamento do genoma humano foi possível determinar a seqüência de aminoácidos de
       todas as proteínas humanas.


40 - (UFSM)
    Em relação ao pareamento típico de bases na molécula de DNA, assinale a
    alternativa correta.
    a) C  G; A  T; A  T; C  G; T  A; C  G; G  C
    b) A  G; C  T; C  T; A  C; T  T; C  C; G  G
    c) A  G; C  T; C  T; A  G; T  C; A  G; G  A
    d) T  G; A  C; T  G; C  A; T  G; G  T; A  C
    e) A  C; C  A; C  T; T  C; G  A; A  G; A  T

41 - (UNIOESTE PR)
    O esquema abaixo representa o modelo da estrutura do DNA proposto por Watson e
    Crick em 1953. Relativo às estruturas indicadas no esquema abaixo, assinale a(s)
    alternativa(s) correta(s).




   01. 1 representa uma base pirimídica.
   02. 2 representa a ligação iônica que ocorre entre os dois filamentos de DNA.
   04. 3 representa uma base púrica.
   08. 4 representa a pentose, que no DNA pode ser tanto a ribose quanto a
       desoxirribose.
   16. 5 representa um grupo fosfato, responsável pela carga negativa do DNA.
   32. 6 e 7 estão emparelhados mas em sentidos opostos.
   64) Um par de nucleotídeos é composto apenas pelas estruturas 1, 2 e 3.

42 - (UFMS)
    Considerando que os 4 nucleotídeos A, U, C e G podem constituir 64 diferentes
    códons (ou trincas de bases) do RNA mensageiro, os números de códons que
    poderiam ser formados com: a) os nucleotídeos A, U e G; e, b) os 4 nucleotídeos,
    com um ou mais Cs em cada códon, correspondem respectivamente a
    a) 27/64 e 37/64.
    b) 37/64 e 27/64.
    c) 16/64 e 48/64.
    d) 48/64 e 16/64.
    e) 9/54 e 55/64.

43 - (UEM PR)
    Vitaminas são substâncias orgânicas necessárias ao funcionamento adequado do
    organismo humano. Assim, identifique o que for correto sobre os seus sintomas de
    deficiência e as suas fontes alimentares.

   01. A coagulação do sangue é prejudicada pela carência da vitamina K, cuja fonte
       alimentar são os vegetais verdes, entre outros exemplos.
   02. O escorbuto surge no organismo humano em consequência de alimentação
       deficitária em vitamina C.
   04. Vegetais vermelhos, como a beterraba e o pimentão, são as principais fontes
       alimentares da vitamina D.
   08. A vitamina E previne a doença conhecida como pelagra.
   16. A doença conhecida por beribéri surge em decorrência da deficiência de
       vitamina A.

44 - (UFMS)
    As vitaminas podem ser classificadas, quanto à solubilidade, em hidrossolúveis ou
    lipossolúveis.
    Considerando tal classificação e observando que as deficiências vitamínicas, ou seja,
    as hipoavitaminoses ou avitaminoses, podem causar doenças, assinale a(s)
    proposição(ões) correta(s).

   01. A deficiência de vitamina B1 (tiamina), classificada como hidrossolúvel, causa o
       beribéri.
   02. A pelagra é causada pela deficiência de vitamina E (tocoferol), classificada
       como hidrossolúvel.
   04. O escorbuto é causado pela deficiência de vitamina B9 (ácido fólico),
       classificada como lipossolúvel.
   08. A vitamina A (retinol), classificada como hidrossolúvel, previne a anemia
       perniciosa.
   16. A deficiência de vitamina D (calciferol), classificada como lipossolúvel, causa o
       raquitismo.
   32. A vitamina C (ácido ascórbico), classificada como lipossolúvel, previne a
       cegueira noturna.

45 - (UDESC SC)
    Assinale a alternativa correta, quanto ao resultado da carência das vitaminas K, D,
    B1, C e A, respectivamente.

   a) Beribéri – dificuldade na coagulação sanguínea – raquitismo – escorbuto e
      cegueira noturna
   b) Raquitismo – dificuldade na coagulação sanguínea – cegueira noturna – beribéri
      e escorbuto
   c) Cegueira noturna – dificuldade na coagulação sanguínea – raquitismo –
      escorbuto e beribéri
   d) Dificuldade na coagulação sanguínea – raquitismo – beribéri – escorbuto e
      cegueira noturna
   e) Escorbuto – beribéri – dificuldade na coagulação sanguínea – raquitismo e
      cegueira noturna

46 - (UEL PR)
    As vitaminas são usualmente classificadas em dois grupos, com base em sua
    solubilidade, o que, para alguns graus determina sua estabilidade, ocorrência em
    alimentos, distribuição nos fluídos corpóreos e sua capacidade de armazenamento
    no tecidos.
            (MAHAN, L. K. & ESCOTT-STUMP, S. Alimentos, nutrição e dietoterapia.
                                                    9.ed. São Paulo: Roca, 1998. p. 78.)

   Com base no texto e nos conhecimentos sobre o tema, assinale a alternativa correta.
   a) A vitamina E é lipossolúvel, age como um antioxidante, protege as hemácias da
      hemólise, atua na reprodução animal e na manutenção do tecido epitelial.
   b) A vitamina A é hidrossolúvel, auxilia na produção de protrombina – um
      composto necessário para a coagulação do sangue – e apresenta baixa toxicidade
      quando consumida em grande quantidade.
   c) A vitamina D é hidrossolúvel, auxilia no crescimento normal, melhora a visão
      noturna, auxilia o desenvolvimento ósseo e influencia a formação normal dos
      dentes.
   d) A vitamina B6 é lipossolúvel, auxilia na resposta imunológica, na cicatrização
      de feridas e reações alérgicas, além de estar envolvida na glicólise, na síntese de
      gordura e na respiração tecidual.
   e) A vitamina C é lipossolúvel, auxilia na resposta imunológica, na cicatrização de
      feridas e reações alérgicas, na síntese e quebra de aminoácidos e na síntese de
      ácidos graxos insaturados.

47 - (UFMS)
    Em relação as vitaminas, que previnem diversas doenças e são classificadas,
    conforme sua solubilidade, em hidrossolúveis ou lipossolúveis, assinale a(s)
    proposição(ões) correta(s).
    01. As vitaminas A e D são hidrossolúveis.
    02. A vitamina C previne o escorbuto.
    04. As vitaminas do complexo B são classificadas como lipossolúveis.
    08. A cegueira noturna, conhecida como xeroftalmia, é prevenida pela vitamina A.
    16. O raquitismo e o beribéri são prevenidos pelas vitaminas D e B1,
        respectivamente.
    32. A pelagra é uma doença decorrente da deficiência de vitamina K.

48 - (UFMS)
    Em relação às vitaminas humanas, leia atentamente as afirmativas abaixo e assinale
    a(s) proposição(ões) correta(s).
    01. A vitamina C tem a função de manter os epitélios e de formar os pigmentos
        visuais.
   02. A vitamina B1 pode ser encontrada nos levedos, na gema de ovo, nas cascas dos
       cereais e é responsável pelo metabolismo dos açúcares.
   04. A vitamina D é responsável pela oxidação celular.
   08. A vitamina cuja deficiência causa o raquitismo em crianças de 4 meses a 2 anos
       de idade é a vitamina K.
   16. A vitamina E previne infecções e mantém a integridade dos vasos sangüíneos.
   32. A deficiência da vitamina D causa raquitismo.

49 - (UFMS)
    Embora sejam exigidas em quantidades mínimas na química da célula, as vitaminas
    são substâncias orgânicas de grande importância para o metabolismo dos seres
    vivos. A falta de determinada vitamina no organismo causa distúrbios que
    caracterizam sempre uma avitaminose. Se tomarmos como exemplo a vitamina mais
    conhecida (vitamina C), sabemos que sua carência provoca o escorbuto. Nas
    afirmativas a seguir, assinale aquelas que mostram as relações corretas entre as
    vitaminas e suas carências.
    01. A xeroftalmia é causada pela falta de vitamina A no organismo.
    02. O raquitismo e a formação defeituosa dos ossos estão relacionados com a
        carência de vitamina B6 .
    04. Uma dieta carente em vitamina B1 tem como conseqüência o beribéri.
    08. A carência de vitamina B12 provoca a anemia perniciosa.
    16. A esterilidade masculina pode ser causada pela deficiência conjunta das
        vitaminas D e E.
    32. Uma dieta deficiente em vitamina B9 determina a ocorrência freqüente de
        hemorragias.

50 - (UEM PR)
    A química da vida é conduzida por moléculas que permitem a organização e a
    funcionalidade das células. Identifique o que for correto sobre algumas dessas
    moléculas.

   01. A semipermeabilidade da membrana plasmática a gases, como o O2 e o CO2, é
       atribuída ao caráter hidrofílico dos componentes da sua dupla camada lipídica.
   02. Frutose, ribose e sacarose são carboidratos classificados como dissacarídeos.
   04. Apesar de a água ser o componente químico mais abundante na matéria viva, a
       sua quantidade é variável nas diferentes partes de um organismo. Nos humanos,
       as células nervosas, por apresentarem maior atividade metabólica, contêm mais
       água do que as células ósseas.
   08. Aminoácidos, amido e clorofila exercem funções distintas nas células. Porém,
       todos apresentam os átomos de C e de H em suas moléculas.
   16. Cada enzima apresenta um pH ótimo para a sua atividade. Assim, uma enzima X
       qualquer pode apresentar o pH ótimo igual a 2,0 (meio ácido) e outra enzima Z
       pH 8,0 (meio básico).

51 - (UEM PR)
    A planta de cenoura, o homem e os artrópodes utilizam diversos componentes
    químicos comuns para a formação e o funcionamento de seus organismos. A esse
    respeito, assinale o que for correto.
   01. As membranas celulares da cenoura apresentam duas vezes menos colesterol do
       que as membranas celulares do homem.
   02. Amido, glicogênio e quitina são polissacarídeos de reserva, respectivamente, na
       cenoura, no homem e nos artrópodes.
   04. Nos ácidos nucleicos, presentes em todos os seres vivos, os monossacarídeos são
       a desoxirribose e a ribose.
   08. O -caroteno, pigmento alaranjado da cenoura, no organismo humano é
       precursor da vitamina B1, essencial para o bom funcionamento dos olhos.
   16. As enzimas presentes na cenoura, no homem e nos artrópodes catalisam reações
       químicas. Ao término das reações, apresentam-se quimicamente inalteradas.

52 - (UFPR)
    Um experimento foi realizado para demonstrar a atividade da enzima catalase,
    também conhecida como peroxidase: em um recipiente foi colocado um pedaço de
    fígado bovino fresco (condição A), enquanto que em outro foi colocado um pedaço
    de fígado bovino cozido (condição B). A seguir, peróxido de hidrogênio (água
    oxigenada) foi adicionado a cada um dos recipientes. Na condição A, muitas bolhas
    foram observadas saindo do pedaço de fígado; na condição B não foi observada a
    formação de bolhas. A partir dessas informações, assinale a alternativa correta.
    a) A catalase está ativa na condição A, promovendo a formação de gás oxigênio
        pela quebra do peróxido de hidrogênio.
    b) As bolhas que apareceram na condição A são conseqüência da formação de
        vitamina C, pela reação conhecida como peroxidação hepática.
    c) A catalase aumentou a energia de ativação da reação do peróxido de hidrogênio,
        produzindo calor e conseqüentemente as bolhas no fígado fresco.
    d) As bolhas formadas na condição A são de gás hidrogênio, produzido pelo
        contato do peróxido de hidrogênio com o ar.
    e) A água oxigenada foi convertida em gases na condição A e convertida em água
        pura na condição B.

TEXTO: 1 - Comum à questão: 53




                               Figura 1: Cristalografia

53 - (UEL PR)
    A cristalografia de raios X auxiliou a desvendar a estrutura do DNA, cujo modelo
    foi construído por Watson e Crick, em 1953.

   Com base na figura 1 e nos conhecimentos sobre os principais aspectos da estrutura
   do DNA, é correto afirmar:
    a) A determinação dos átomos que compõem o DNA foi possível porque o
       comprimento de onda dos raios X é da mesma ordem de grandeza que o
       comprimento médio da molécula do DNA.
    b) As posições dos átomos em uma substância química cristalizada podem ser
       inferidas pelo padrão de refração resultante dos raios X que a atravessam.
    c) As ligações que ocorrem entre as bases nitrogenadas no interior da hélice do
       DNA são possíveis devido à diferença de eletronegatividade entre os átomos de
       nitrogênio ligados a átomos de hidrogênio nas bases.
    d) Os fosfatos se ligam às pentoses pelos átomos de fósforo por meio de ligações
       de hidrogênio.
    e) Na estrutura do DNA as ligações de oxigênio ocorrem entre pares de bases
       específicos: a adenina liga-se à citosina e a timina liga-se à guanina.

GABARITO:

1) Gab: 27

2) Gab: B

3) Gab: 11

4) Gab: C

5) Gab: 42

6) Gab: D

7) Gab: A

8) Gab: 18

9) Gab: 12

10) Gab: 10

11) Gab: 22

12) Gab: A

13) Gab: VFFFVV

14) Gab: C

15) Gab: C

16) Gab: B

17) Gab: B

18) Gab: 31
19) Gab: C

20) Gab: 10

21) Gab: 50

22) Gab: C

23) Gab: 06

24) Gab: E

25) Gab: C

26) Gab: 83

27) Gab: 09

28) Gab: 59

29) Gab: 23

30) Gab: D

31) Gab: A

32) Gab: 19

33) Gab: B

34) Gab: 03

35) Gab: 05

36) Gab: 15

37) Gab: A

38) Gab: B

39) Gab: 03

40) Gab: A

41) Gab: 48

42) Gab: A

43) Gab: 03
44) Gab: 17

45) Gab: D

46) Gab: A

47) Gab: 26

48) Gab: 34

49) Gab: 13

50) Gab: 28

51) Gab: 20

52) Gab: A

53) Gab: C

								
To top