Docstoc

Genetics - Shaw High Students

Document Sample
Genetics - Shaw High Students Powered By Docstoc
					Genetics
Genetics


                                        What is DNA?
Understand the relationship of the structure and function of DNA to protein synthesis and the
characteristics of an organism.


True or False?
           1.   Every cell in your body has roughly the same exact DNA. T / F
           2.   DNA is made up of the bases A, U, C and G. T / F
           3.   Codons are four bases in a row. T / F
           4.   Proteins are sequences of amino acids. T / F
           5.   mRNA turns into DNA in the process of transcription. T / F
           6.   One gene forms one protein. T / F



About DNA
       “It's in your genes!”
       Have you ever been told that you look just like your
mother, or that you act just like your brother or sister? You
may not think it's true, but there's a good reason that people
say that. It's because, in every cell in your body, you have
(more or less) the same DNA. As you already know, you get
one copy of your DNA from your mother and one from your
father. Also, you know that the DNA is split up into strands
called chromosomes, and that the ribosomes use the DNA in
order to make proteins.
       But what does it really mean that this DNA is in every
single one of your cells? After considering this for a while,
                                      many       people      ask
                                      themselves things like,
                                      “Why do the cells in my
                                      heart need to have the
                                      same information as the
                                      cells in my stomach?”
                                      It's true that all of the
                                      100 trillion cells in your
                                      body have all of the
                                      genetic information to be
                                      or do anything that your
                                      body does. It's also true            Structure of DNA
                                      that your DNA is 3 billion
                                      “letters” long; in other
                                      words each one of those 100 trillion cells contains 3 billion
                                      pieces of information!
                                              Each cell in your body only uses the information that it
                                      needs from the DNA; in other words, your heart cells only use
                                      the heart information, the stomach cells the stomach
                                      information. But the cells carry everything around in case they
                                      need to become something else, a power which scientists are
                                      just beginning to use for themselves!



    RNA is made up of codons
2009 – 2010                                        2
                                                                                     What is DNA?

        So, how does that DNA actually do anything? The trick is that DNA is turned into proteins,
and it's the proteins that make a heart cell beat, a nerve cell send messages, and a lung cell take
up air. You can think of the relationship between DNA and protein like this: the DNA is like a page
of instructions to build a house and the proteins are the wood, steel, nails, screws and glass that
actually make up the house. Clearly, to get from the instructions (DNA) to the building materials




                             An overview of how DNA becomes proteins
(proteins), something needs to put it all together – so in steps the ribosomes to actually make the
protein!
        The instructions contained in DNA are made up of only four bases: the chemicals
adenosine (A), thymine (T), cytosine (C) and guanine (G). Each base (or “letter”) has a pair:
every A is paired with a T, every T with an A, every C with a G, and every G with a C. Different
combinations of these chemicals make “words”, otherwise known as codons. Codons are made up
of three letters in a row: ATG, GCC, ATC, etc. Ribosomes look at each codon and grab a different
amino acid. The ribosomes keep adding amino acids until they get to the end of a gene. The
string of amino acids that has been made is called a protein.
        There is one step in the diagram
which has not been mentioned yet. You
may have already noticed that the DNA
stays in the nucleus but the ribosomes
stay outside the nucleus. So, how is it
that the ribosomes make proteins from
the DNA? There is a messenger that                            A closer look at DNA
takes the instructions from the nucleus to
the ribosomes: it's called messenger RNA (mRNA). As in our example from before, the

                                                3                                Shaw High School
Genetics

instructions are contained by the DNA and the actual building materials are the proteins. Often,
just like building a house, the instructions cannot be read by simply anyone. It's the job of the
mRNA to put the bases into a language that the ribosomes can understand, which is called
transcription.
        RNA, as we saw with viruses, is very similar to DNA. There is one major difference: where
DNA has thiamine (T), RNA has uracil (U). This means that, if a DNA codon reads “ATA”, then the
                                                                       same codon in RNA will be
                                                                       “AUA”.
                                                                              In summary, DNA
                                                                       contains the instructions in
                                                                       sets called genes.      One
                                                                       gene    is   converted    to
                                                                       mRNA, which goes outside
                                                                       the nucleus of the cell.
                                                                       Outside of the nucleus, the
                                                                       ribosomes read the mRNA,
                                                                       attaching one amino acid
                                                                       for every three base pairs
                                                                       (codon). This sequence of
                                                                       amino acids is a protein.
                                                                       For every gene of DNA,
                                                                       there is one and exactly
                     Transcription of DNA into mRNA                    one protein.


True or False?
           1.   Every cell in your body has roughly the same exact DNA. T / F
           2.   DNA is made up of the bases A, U, C and G. T / F
           3.   Codons are four bases in a row. T / F
           4.   Proteins are sequences of amino acids. T / F
           5.   mRNA turns into DNA in the process of transcription. T / F
           6.   One gene forms one protein. T / F




Questions
Do you remember?
   1. What are the four bases in DNA? What are they in RNA?
   2. What takes the instructions in DNA from the nucleus to the ribosomes?
   3. What is a gene?

Think about it!
       CTACGCCATATTCGGCGATAC
   4. Convert the above DNA sequence into the opposite pair of each base. How many codons
      does it have?
   5. Convert the above DNA sequence into RNA.

Do something!
   6. Draw the following steps of how DNA becomes a protein in a Four Door foldable (page Error!
      Bookmark not defined.Error: Reference source not found). The four doors should contain:
      a) A gene of DNA is transcribed into mRNA
      b) mRNA leaves the nucleus


2009 – 2010                                        4
                                                                                        What is DNA?

      c) Ribosomes read the mRNA, adding amino acids
      d) The amino acids form a protein

Remember?
   7. What are the five kingdoms of living things?
   8. Differentiate prokaryotes and eukaryotes in three ways (from this chapter).
   9. What are homologous chromosomes?
   10. What is cell differentiation?


Human Genome Project
Implications of the Genome Project for Medical Science
By Francis S. Collins, M.D., Ph.D., Victor A. McKusick, M.D., Karin Jegalian, Ph.D.

        Virtually every human ailment, except perhaps trauma, has some genetic basis. In the past,
doctors took genetics into consideration only in cases like birth defect syndromes and a limited set
of illnesses - like cystic fibrosis, sickle cell anemia, and Huntington disease - that are caused by
changes in single genes and are inherited according to predictable Mendelian rules.
        Common diseases like diabetes, heart disease, cancer, and the major mental illnesses are
not inherited in simple ways. But studies comparing disease risk among families show that heredity
does influence who develops these conditions. As a result, many doctors are careful to ask patients
about their family histories of such illnesses.
        Now, with the genome project releasing a torrent of data about human DNA and promoting
growing understanding of human genes, the role of genetics in medicine will change profoundly.
Genetics will no longer be limited to guiding medical surveillance based on family histories, or
classifying the numerous but relatively rare conditions that stem from changes in single genes.
        It is true that for many of the most common illnesses, like heart disease, heredity is clearly
only one of several factors that contribute to people's overall risk of developing that disease. The
most common diseases in developed countries today generally arise from a complex interplay of
causes, including diet, lifestyle, and environmental exposures, as well as heredity.

Genetics in the Twentieth Century
       The twentieth century saw enormous, even revolutionary, development in the field of
genetics. In the spring of 1900, three different scientists brought Mendel's laws of inheritance to a
wide audience. This marked the founding of genetics as a scientific discipline. In the middle of the
century, Watson and Crick revealed the chemical basis of heredity with their discovery of the
double helical structure of DNA. Over the next fifteen years, scientists began to understand the role
of RNA as a messenger molecule copied from DNA, and they elucidated the genetic code that
allows RNA to be translated to protein.
       In 1980 scientists began mapping genes whose variants cause disease. In 1983, for
example, mapping localized the Huntington disease gene to chromosome 4. But even after
mapping them, finding the genes actually responsible for diseases remained an arduous task. Years
of work were required to develop detailed maps over the regions containing long-sought genes,
and then to search among the genes in these areas to find the ones specifically desired.

The Human Genome Project
        The Human Genome Project (HGP) plan included the decision to map and sequence the
genomes of other organisms that have been important to the study of biology: bacteria, yeast,
roundworm, fruit fly, and mouse. In addition, the project sought to improve sequencing technology.
        From its inception, the HGP has been an international effort. The United States has made
the largest investment, but important contributions have come from many countries, including
Britain, France, Germany, Japan, China, and Canada. When the project began, the complete human
genome sequence was expected by the year 2005, though there was certainly very little reason to
be confident then that this goal could be achieved. But one by one, the intermediate milestones

                                                 5                                  Shaw High School
Genetics

were accomplished.
        The HGP participants had agreed all along to release all maps and all DNA sequence data
into public databases. With access to increasingly detailed maps of the genome, the research
community began to identify genes involved in diseases more and more quickly. While less than 10
genes had been identified by the technique known as positional cloning in 1990, that number grew
to more than 100 by 1997.
        By 1996, with complete genome sequences obtained for several species of bacteria and for
yeast, HGP participants decided to attempt sequencing human DNA, at least on a trial scale. The
availability of new kinds of sequencing machines and the effort by a newly formed private company
to sequence the human genome further spurred the effort. By 1999, confidence grew that HGP
participants were ready to sequence the three billion base pairs of the human genome. In June
2000, both the private company and the Human Genome Project's international consortium
announced the completion of "working drafts" of the human genome sequence.

Current Genomic Research
       The human genome must be sequenced completely. Gaps that remain in the draft sequence
must be clarified. This finishing process had been accomplished for chromosomes 21 and 22 by the
summer of 2000, and will be carried out for the rest of the genome by 2002.
       Genome sequences will be obtained for other organisms. Comparing genome sequences
from different species will be a great aid in revealing the genes, since the stretches of DNA that
code for protein and the regions in genes that regulate their expression tend to be conserved
among species. Large-scale sequencing of laboratory mouse DNA has already started. Projects to
sequence rat and zebrafish DNA will not be far behind. Scientists in both the public and private
sectors are seriously considering sequencing other large vertebrates' genomes, including those of
the pig, dog, cow, and chimpanzee.

Genetics in the Medical Mainstream
        Over the next quarter century, the practice of medicine will increasingly depend on an
understanding of molecules and genetics.
        By the year 2010, predictive genetic tests are likely to be available for many common
conditions, allowing individuals who wish to know this information to learn what their individual
susceptibilities are, and to take steps to reduce those risks for which interventions are available.
The interventions could take the form of medical surveillance, life style modifications, changes in
diet, or drug therapy. For example, those at highest risk for colon cancer could undergo frequent
colonoscopies for screening, which would prevent many premature deaths. Predictive genetic tests
are likely to be applied first in cases where individuals have a strong family history of a particular
condition; in fact, such testing is already available for a few conditions, including breast cancer and
colon cancer.
        But with increasing genetic information available about common illnesses, this kind of
genetic risk assessment will become more generally available. Many primary care providers will
need to practice genomic medicine; they will need to explain complex statistical risk information to
healthy patients who are seeking to maximize their chances of staying well. This will require
substantial advances in the understanding of genetics by health care providers. Another crucial
step is the passage of legislation that bans the use of genetic information that predicts future risk
in decisions about health insurance and employment. Individuals should not have to forgo acquiring
genetic information about themselves out of fear of discrimination. Although more than two dozen
states have taken some action on the issues of genetic privacy and genetic discrimination, an
effective Federal law would help eliminate the patchwork of different levels of protection across the
U.S.

Respond
   1. What does “genome” mean?
   2. What is the purpose of the HGP?
   3. Explain, in one paragraph, the role of heredity in developing diseases.

2009 – 2010                                       6
                                                                                        What is DNA?

  4. Why is it important that genomes be sequenced for other species than humans?
  5. What is the purpose of offering genetic tests to patients?
  6. Predict three different things that might happen in your life if you tested positive for a
     genetic disease that limited your ability to walk.


Activities


                                 Whatt a Diifffferrence an ““A”” Makes
                                 Wha a D e ence an A Makes
In this activity, you will be creating a sequence of amino acids from a sequence of DNA. Then,
you will investigate what happens when you make mutations (changes) to that sequence of DNA.

 DNA      DNA Replicates               mRNA                    tRNA              Amino Acids
   T
   A
   C
   A
   C
   C
   C
   G
   A
   A
   T
   A
   A
   T
   T

   1. Fill in the second column (DNA Replicates) with the complementary base pairs of DNA for
      the DNA in the first column.
   2. Fill in the third column (mRNA) with the transcribed mRNA base pairs for the DNA in the
      first column.
   3. Fill in the fourth column (tRNA) with the three-base codons from the mRNA using the chart
      below.
   4. For the last column (Amino Acids), translate the codons into the amino acids that the tRNA
      adds using the chart below.
   5. Assume that the base in position 6 of the original DNA strand mutates to an "A." How will
      the sequence of #1,2,3, and 4 be affected?
   6. Suppose the base in position 2 gets shifted to position 16; how will the sequence of #1,2,3
      and 4 (above) be affected?
   7. If the base in position 12 is changed to a "T," how will the sequence of #1,2,3 and 4
      (above) be affected?
   8. Write a paragraph discussing what happened in #5, 6, and 7.




                                                 7                                  Shaw High School
Genetics


                                Whatt a Diifffferrence an ““A”” Makes
                                Wha a D e ence an A Makes
                     Amino acid                  Associated codon(s)
                                Alanine GCA, GCC, GCG, GCU
                               Arginine AGA, AGG, CGA, CGC, CGG, CGU
                            Asparagine AAC, AAU, GAC, GAU
                               Cysteine UGC, UGU
                          Glutamic acid GAA, GAG
                             Glutamine CAA, CAG
                                Glycine GGA, GGC, GGG, GGU
                               Histidine CAC, CAU
                             Isoleucine AUA, AUC, AUU
                                Leucine UUA, UUG, CUA, CUC, CUG, CUU
                                  Lysine AAA, AAG
                   Methionine (“Start”) AUG
                          Phenylalanine UUC, UUU
                                Proline CCA, CCC, CCG, CCU
                                 Serine AGC, AGU, UCA, UCC, UCG, UCU
                             Threonine ACA, ACC, ACG, ACU
                            Tryptophan UGG
                                  Valine GUA, GUC, GUG, GUU
                          "Stop" codon UAA, UAG, UGA




                                       DNA ffrrom Kiiwii Frruiitt
                                       DNA om K w F u
 Materials:
       One small Ziploc® bag
       Jar or beaker that fits strainer or funnel
       Funnel
       A #6 coffee filter
       Ice-water bath
       Water
       25% soap solution (1 teaspoon dish soap or shampoo + 3 teaspoons of water)
       Kiwifruit, half a kiwi per group of students
       Table salt
       1 – 20ml test tube per group, preferably with a cap
       1 – 10ml test tube per group, preferably with a cap
       Ice cold rubbing alcohol stored in freezer or on ice until use

 Group Procedure:
    1. Get six pieces of kiwi and put them in a Ziploc® bag.
    2. Add 20ml of shampoo solution to the Ziploc® bag. Make sure the bag is closed with extra
       air. (The shampoo solution breaks the cell membrane because the membrane is made of


2009 – 2010                                      8
                                                                                     What is DNA?


                                       DNA ffrrom Kiiwii Frruiitt
                                       DNA om K w F u
      fats.)
   3. Mush the kiwi thoroughly but carefully so the bag doesn’t break, for about five minutes.
   4. Cool the kiwi mixture in the ice bath for a minute. Then mush the kiwi more. Cool, then
      mush. Repeat several times.
   5. Filter the mixture through cheesecloth. All groups can combine their mixtures at this point,
      to filter together.
   6. Dispense approximately 3 ml of kiwi solution to each test tube, one for each student.
   7. Being careful not to shake the tubes, add approximately 2 ml of cold 95% ethanol to each
      tube. The cooling protects the DNA from being destroyed. In the nuclear membrane it is
      protected from the DNases in the cell membrane. DNases are in our cells to protect us
      from viruses.


                                      DNA ffrrom Cheek Cellls
                                      DNA om Cheek Ce s
Materials:
      Clear Gatorade OR 0.9% salt water (approx. ½ teaspoon in 8 oz. water)
      Small cups (4-8 oz)
      30-50 ml test tube or other small container (such as a clear film canister)
      25% soap solution (1 teaspoon dish soap or shampoo + 3 teaspoons of water)
      Ice cold rubbing alcohol stored in freezer or on ice until use
      Teaspoons for measuring

Procedure:
   1. Swish 2 teaspoons (10ml) of the Gatorade or salt water from the small cup in your mouth
      vigorously for 30 seconds. Your goal is to slough off as many cheek cells as possible. Your
      teacher will time you to make sure you have swished long enough.
   2. Spit the water with cheek cells back into the small cup.
   3. Pour this solution into a tube containing 1 teaspoon (5ml) of soap solution.
   4. Gently mix this solution for 2-3 minutes. Try to avoid creating too many bubbles.
   5. The soap solution breaks the cell membranes that are made up of fats, just like the soap
      breaks down the grease on your dishes.
   6. Tilt the tube of soap solution/cells. Pour 2-3 teaspoons (10-15ml) of ice cold alcohol
      (ETOH) down the side of the tube so that it forms a layer on top of your soapy solution.
      DO NOT MIX THIS.
   7. Let the tube stand for 1-2 minutes.
   8. Record your findings.


                                           Codon Biingo
                                           Codon B ngo




                                                 9                                Shaw High School
Genetics




 How to play:
    1. Fill in your bingo card with amino acids, but don't repeat any of them.
    2. When a DNA codon is read off, transcribe it to RNA, then translate it into the amino acid.
       Place a marker on the square that corresponds to that amino acid.




2009 – 2010                                     10
                                                                              What is on Our Genes?


                             What is on Our Genes?
A gene is a piece of information passed from parents to offspring, and genes often are in different
forms called alleles. For example, the gene for pea plant height has two alleles, tall and short.


True or False?
        1.   A dominant allele dominates a recessive allele. T / F
        2.   Alleles come in forms called genes. T / F
        3.   Homozygous means that two things are different. T / F
        4.   A Punnett square shows exactly how each offspring will look. T / F



About Genes
        As we saw in the previous chapter, every gene on a chromosome in our DNA makes a
different protein. There are 20,500 of these genes in every human. 99.9% of these genes are the
same from person to person, which means that the vast majority of these genes contain
information for our lungs, heart, liver, kidneys, bones, brain and more. There are only a handful of
genes that contain information for the color of our skin, hair, eyes, and the shapes of our faces,
hands and feet.

   Allele from mother        Allele from father             Gene that turns into a protein
       Dominant                  Dominant                             Dominant
       Dominant                  Recessive                            Dominant
       Recessive                 Dominant                             Dominant
       Recessive                 Recessive                            Recessive

       Since we have two copies of (almost) every gene in our body, we call these copies alleles.
We get one allele from our father and one from our mother. Since only one of those alleles can
turn into a protein, it is the more dominant allele that gets turned into a protein by our cells. If
both alleles are dominant, then it is clear that the dominant protein is made. If one allele is
                                                       dominant, then the other trait, the
                                                       recessive trait, is ignored and the
                                                       dominant protein is made. Only if both
                                                       alleles are recessive then the recessive
                                                       protein is made.
                                                               In order to try and figure out what
                                                       the chances are of having a child with a
                                                       dominant or recessive trait for a particular
                                                       gene, something can be done called a
                                                       Punnett square. A Punnett square is used
                                                       to predict the probabilities and possibilities
                                                       of traits in offspring. Along the top of the
                                                       Punnett square, the alleles that could come
                                                       from the father are listed, and the alleles
                                                       from the mother are listed along the side.
                                                       In the middle of the Punnett square, the
                                                       possibilities for offspring are listed. Each
                                                       square represents a 25% chance of getting
  A Punnett square showing a cross between two pea that type of offspring. If an offspring has
                          plants
                                               11                                  Shaw High School
Genetics

two of the same allele, it is called homozygous.           If it has two different alleles, it is called
heterozygous.


True or False?
           1.   A dominant allele dominates a recessive allele. T / F
           2.   Alleles come in forms called genes. T / F
           3.   Homozygous means that two things are different. T / F
           4.   A Punnett square shows exactly how each offspring will look. T / F




Questions
Do you remember?
   1. What does dominant mean? Recessive?
   2. Define, in your own words:
      a) Homozygous:
      b) Heterozygous:
   3. In terms of homozygous, heterozygous, dominant and recessive, label:
      a) HH –
      b) Mm –
      c) bb –

Think about it!
   4. Give names and percentages for the following Punnett square:

                                                R    r
                                          R    RR    Rr
                                           r   Rr    rr

  Genotype               Homozygous or heterozygous AND              %
                             Dominant or recessive
      RR                     Homozygous dominant
      Rr
      rr                                                            25%

   5. As you did above, complete the Punnett square and percentages for the following:
      a) Between homozygous dominant for round peas and heterozygous
      b) Between homozygous dominant for unattached earlobes and homozygous recessive for
         attached earlobes
      c) Between homozygous recessive for green eyes and heterozygous

Do something!
   6. With a partner, agree on a gene for making a Punnett square. Also, agree on the dominant
      and recessive alleles. Independently, come up with the genotype of both parents (one of
      you should be the mother, the other the father), then create a Punnett square for the
      combination of the two parents. If these two parents have six children, what would be the
      most likely numbers of dominant and recessive traits in the children?

Remember?
   7. What can radiometric dating tell scientists?

2009 – 2010                                         12
                                                                             What is on Our Genes?

  8. Identify one word for each phase of mitosis that will help you remember what happens in
     that phase.
  9. What is the difference between a cell that is haploid and a cell that is diploid?
  10. What are the four bases in DNA? What are they in RNA?


Activities

                                              Alllelles
                                              A e es
   1. With the genetic model kit, put together a cell that has three pairs of homologous
      chromosomes. Each chromosome has three shapes on it, in three different colors: red,
      white and blue. Each one of those shapes represents one allele. When you join a
      chromosome with its partner, then the matching alleles form genes. Therefore, it takes
      two alleles (that can be dominant or recessive) to get one gene.
   2. How many alleles does this cell have? How many genes does it have? How many total
      chromosomes does it have?
   3. Describe the relationship between genes, alleles and chromosomes, in your own words.
   4. Design your own bacteria:
      a) What is it called?
      b) What does it do?
      c) Choose one of the pairs of chromosomes. For each gene, make up a characteristic that
         this gene represents – this is the dominant trait. For each gene, also specify the
         recessive trait.


                                        Karryottype Puzzlle
                                        Ka yo ype Puzz e
Errors can occur during meiosis as an organism creates gametes.                Sometimes, extra
chromosomes are copied and other times they are deleted. This means that the organism can
have too many or too few chromosomes and usually will not make it to birth. Other times, the
organism is born with physical or mental differences. In this activity, you will be given the
chromosomes of an individual and it is up to you to discover what the genetic disorder is.
    1. Get a packet of chromosomes and a karyotype reference sheet. Order the chromosomes
       by size, remembering that the Y chromosome (if present) is smaller than the X
       chromosome.
    2. Once you have a complete karyotype that matches one of the karyotypes in the reference
       sheet, identify the karyotype and call the teacher over.
    3. What effects do you think that this disorder has on the individual? Make a hypothesis
       based on what you know about genetics and chromosomes.
    4. Use the reference materials available to research the disorder. What effects does this
       disorder have on the individual?


                                          Makiing Genes
                                          Mak ng Genes
   1. Ask a friend or family member for a genetic trait that they are familiar with. Write this
      trait down as the dominant trait. Also, figure out what the opposite (recessive) trait would
      be and write it down.
   2. Make a gene of DNA that is five codons long. Label each codon. This is the dominant
      trait.
   3. Change one of the bases of DNA from the dominant trait. Label each codon. This is the
      recessive trait.
   4. Combine someone who is homozygous recessive for this trait with someone who is
      heterozygous. Show the Punnett square.
   5. Show the probabilities and percentages for each of the genotypes that result. Also, write
      down the mRNA that results for each offspring.

                                               13                                 Shaw High School
Genetics


                      How do We Pass on Our Genes?
Use the concepts of Mendelian and non-Mendelian genetics to explain inheritance. For example,
incomplete dominance, independent assortment, sex-linked traits and linkage.


True or False?
           7. Mendel studied pea plant inheritance in order to come up with a theory about
               genes. T / F
           8. Mendel found that he could breed short plants from two tall plants. T / F
           9. The F2 generation is the offspring of the F1 generation. T / F
           10. Mendel theorized that genes are inherited independent of other genes in offspring.
               T/F
           11. Linkage is when two genes are inherited together more often than Mendel thought.
               T/F
           12. Sex-linked traits are more commonly found in men than in women. T / F



About Inheritance
        Once upon a time there was a monk named
Gregor Mendel. He was born in 1822 in (what is
now) the Czech Republic, in Europe. He came from
a farming family and was very interested in not only
the family business, but also in beekeeping. When
he joined a monastery in order to become a monk,
he was sent to college to learn more science.
        While he was at the University of Vienna, he
was inspired to perform a few experiments on pea
plants. He was particularly interested in how it was
that some pea plants were different from one
another.
        Mendel had a lot of time on his hands – and
peas. So he separated the pea plants that he had
into several groups. Two of these groups were tall
pea plants and short (dwarf) pea plants. The tall
ones were actually taller than him, about 6 feet tall!
The short ones were only about a foot tall, so it was
easy to tell which was which. The interesting thing
that he had noticed, though, was that there were no
pea plants that were in between one and six feet
tall. This is part of what told Mendel that there had
to be something else going on inside the pea plant.
        Remember, at this point in time, nobody knew
anything about DNA, genes or chromosomes. So,                       Mendel in his garden
Mendel took his two groups of pea plants, the tall
plants and the short plants, and separated them completely. From his work in beekeeping, he
knew that bees could carry the pollen from one plant to another, so he made sure there was no
way the tall plants could breed with the short plants. After a few generations, there was nothing
but tall plants in the one group and nothing but short plants in the second group.
        After this, he started a third group. He bred the two groups together in this third group,
making sure that every new plant was a combination of a tall and a short plant. What surprised
him was that every single one of the resulting pea plants was tall! What was going on here?

2009 – 2010                                       14
                                                                    How do We Pass on Our Genes?

       Mendel needed to know more. So he called these new tall plants the F1 generation (after
the Latin for the first children). He wanted more information: specifically, he wanted to know what
would happen when these tall plants were bred. Would they have all tall offspring? Was the




                           A diagram of Mendel's pea plant experiments

shortness of the one parent completely lost?
        Mendel then combined the F1 generation (the tall plants) with each other. The results were
incredible: 75% of the offspring were tall, and 25% of them were dwarfs! Somehow, these plants
had “remembered” their short grandparents – but how? So Mendel made a hypothesis that traits
are carried from generation to generation in genes. Each individual has one copy from each of
their parents, and the trait can either be dominant or recessive. In this case, he thought that the
trait for being tall (for a pea plant) was the dominant trait and being short was recessive. But
here's the tricky part of what he figured out.

                                               15                                Shaw High School
Genetics

       Mendel figured that each plant in the F1 generation got one tall trait from one parent and
one short trait from the other parent. Since the tall trait (or allele) was dominant, then it hid the
recessive trait for being short. All the F1 plants were tall because of the dominant allele. But then
when the F1 plants had offspring, called the F2 generation, these plants had gotten either a tall or
a short allele from each of their parents. Even though he didn't use a Punnett square, he figured
out that the cross between the two F1 plants went like this (T = tall, t = short):

                                             T    t
                                       T    TT    Tt
                                       t    Tt    tt

He repeated this experiment with many more traits and many more plants, coming up with roughly
the same results each time.
         Mendel looked at a total of seven traits.
One of the other traits was whether the seed of
the pea was smooth or wrinkled. He observed
that when he did the same experiment with this
trait, the results were the same. So he decided to
take the experiment one step further. He then
combined the two traits: he took tall plants that
made smooth seeds, tall plants that made
wrinkled seeds, short plants that made smooth
seeds, and short plants that made wrinkled seeds.
He combined them in every way that he could
think, but he found that no matter what he did,
when he combined purely smooth seeds with
purely wrinkled seeds, the offspring were all
smooth. It didn't matter if they were tall or short
at all. After trying this with several more traits,
he found a pattern. One trait didn't affect any of
the others. This came to be called the Law of
Independent Assortment.          All of the genes     A karyotype of a male human showing all of
seemed to mix themselves up completely                              the chromosomes
independently.
                                                            Later scientists came to find that things
                                                    weren't so simple.       They actually saw that
                                                    there were some traits that did depend on
                                                    other traits. For instance, plants with yellow
                                                    flowers were usually tall and plants with blue
                                                    flowers were usually short. They explained this
                                                    by saying that when genes are close together
                                                    on a chromosome, they can sometimes show
                                                    linkage. This means that some genes are
                                                    “linked” together and are not independent.
                                                            There's another type of linkage, called
                                                    sex-linked traits, that Mendel did not
                                                    describe. These traits are not necessarily traits
                                                    that have anything to do with sex organs or
                                                    sex cells. Traits that are sex-linked are on the
                                                    sex    chromosomes.         It's  important    to
                                                    understand that male humans and female
                                                    humans have one major difference in their
                                                    chromosomes: the 23rd and final pair of


2009 – 2010                                      16
    Actual X and Y chromosomes side-by-side
                                                                       How do We Pass on Our Genes?

chromosomes is “XX” in females and “XY” in males. The “Y” in males is actually just a small
chromosome (see picture on this page) and contains much less information than the “X”
chromosome. Because of this, there are alleles on the X chromosome that are not on the Y
chromosome. For the alleles that are on the X chromosome but not the Y, they will always show
up, dominant or recessive! Examples of sex-linked traits include hemophilia and color blindness.
These traits, since they can be dominated in a female but not a male, often show up much more
often in males than in females.
        Well after Mendel passed, other scientists looked at his work and figured out that it fit in
with their theories of inheritance. In fact, it wasn't until the 1930's that Mendel was recognized for
his efforts and people began to accept that genes could be responsible for evolution! But Mendel's
work still didn't explain quite a few things about genetics.


True or False?
        1. Mendel studied pea plant inheritance in order to come up with a theory about
           genes. T / F
        2. Mendel found that he could breed short plants from two tall plants. T / F
        3. The F2 generation is the offspring of the F1 generation. T / F
        4. Mendel theorized that genes are inherited independent of other genes in offspring.
           T/F
        5. Linkage is when two genes are inherited together more often than Mendel thought.
           T/F
        6. Sex-linked traits are more commonly found in men than in women. T / F




Questions
Do you remember?
   1. Why did the F2 generation of pea plants include short plants?
   2. Define a sex-linked trait in your own words.
   3. List all of the possible crosses among plants in the F2 generation.

Think about it!
   4. Paraphrase the main experiment that Mendel performed in one paragraph.
   5. Compare and contrast the Law of Independent Assortment and linkage in at least two ways.

Do something!
   6. Ask two thoughtful (not just factual) questions about Mendel's life to three other people.
      Record your results and underline your most difficult question.

Remember?
   7. Differentiate (tell the difference between) a cell and a virus in two ways.
   8. Identify five organ systems and the problems that they solve.
   9. What takes the instructions in DNA from the nucleus to the ribosomes?
   10. What does dominant mean? Recessive?




                                                 17                                 Shaw High School
Genetics

Activities

                                          Drragon Genettiics
                                          D agon Gene cs
 In this activity you will study the patterns of inheritance of multiple genes in (imaginary)
 dragons. These dragons have two pairs of homologous chromosomes in each cell. You will see
 that, since genes are carried on chromosomes, the patterns of inheritance are determined by the
 behavior of chromosomes during meiosis and fertilization. For this activity, we will only consider
 one gene on each chromosome. These genes are described in the following table.
                       Dominant Alleles    Recessive Alleles
  Chromosome 1         W = has wings       w = no wings
  Chromosome 2         H = big horns       h = small horns

 The mother dragon is heterozygous for the wing gene (Ww) and the horn gene (Hh). The father
 is homozygous recessive for the wing gene (ww) and the horn gene (hh).
     1. What phenotypic traits will each parent have? Phenotypic traits are the observable
        bodily characteristics.
     2. Draw the appropriate characteristics for each parent below in your book:
 Mother                                            Father




    3. On average, what percentage of the baby dragons will have big horns? _______

 To predict the inheritance of the wing and horn genes, you first need to determine the genotypes
 of the eggs produced by the heterozygous (WwHh) mother dragon and the sperm produced by
 the homozygous (wwhh) father dragon. Use the figure below to answer the next questions:

    4. C
       o
       n
       s
       i
       d
       e
       r
       i
       n
       g

       b
       o
       t
       h

       t
       he wing and horn genes, what different genotypes of eggs could the heterozygous mother


2009 – 2010                                     18
                                                                   How do We Pass on Our Genes?


                                        Drragon Genettiics
                                        D agon Gene cs
      dragon produce?
   5. What genotypes or genotype of sperm can the homozygous (wwhh) father dragon
      produce?

The next step in predicting the inheritance of the wing and horn genes is to predict the outcome
of fertilization between these eggs and sperm. In the following chart, label the gene on each
chromosome in each type of zygote that could be produced by a mating between this mother
and father. Then, fill in the genotypes of the baby dragons that result from each zygote and
sketch in the characteristics of each baby dragon to show the phenotype for each genotype.




This type of mating involving two different genes is more typically shown as a Punnett square
with four rows and four columns (see below). Notice that, because the father is homozygous for
both genes, all his sperm have the same genotype, so all four rows are identical.

                     Mother (WwHh)
                     wh       wH         Wh        WH
 Father    wh        wwhh     wwHh       Wwhh      WwHh
 (wwhh)    wh        wwhh     wwHh       Wwhh      WwHh
           wh        wwhh      wwHh      Wwhh      WwHh
           wh        wwhh      wwHh      Wwhh      WwHh

   6. Considering only the baby dragons with wings, what fraction do you expect to have big
      horns? (To answer this question, it may be helpful to begin by shading in the two columns
      of the above Punnett square that include all the baby dragons with wings.)
   7. Considering only the baby dragons without wings, what fraction do you expect to have big
      horns?
   8. Do you expect that baby dragons with wings and without wings will be equally likely to
      have big horns?



                                              19                                Shaw High School
Genetics


                               Drragon Genettiics
                               D agon Gene cs
 Procedure to Test Inheritance of Two Genes on Different Chromosomes
 To test whether baby dragons with wings and baby dragons without wings will be equally likely to
 have big horns, you will carry out a simulation of the simultaneous inheritance of the genes for
 wings and horns. Since the father is homozygous (wwhh), you know that all of the father's
 sperm will be wh. Therefore, to determine the genetic makeup of each baby dragon produced in
 your simulation, you will only need to determine the genetic makeup of the egg which is
 fertilized to become the zygote that develops into the baby dragon. During meiosis, each egg
 randomly receives one from each pair of homologous chromosomes. Your simulation will mimic
 this process.
 For this simulation, each of the mother's pairs of homologous chromosomes will be represented
 by a popsicle stick with the genes of one chromosome shown on one side and the genes of the
 other homologous chromosome shown on the other side.             Since the mother dragon is
 heterozygous for both genes (WwHh), you will have one Popsicle stick representing a pair of
 homologous chromosomes which are heterozygous for the wing gene (Ww) and another Popsicle
 stick representing a pair of homologous chromosomes which are heterozygous for the horn gene
 (Hh).

    9. Hold one Popsicle stick in each hand about 6 inches above the desk. Hold each Popsicle
       stick horizontally with one side facing toward you and the other facing away (with one
       edge of the Popsicle stick on the bottom and the other edge on the top). The two Popsicle
       sticks should be lined up end-to-end, simulating the way pairs of homologous
       chromosomes line up in the center of the cell during the first meiotic division.
       Simultaneously drop both Popsicle sticks on the desk. The side of each Popsicle stick that
       is up represents the chromosome that is contained in the egg. This indicates which alleles
       are passed on to the baby dragon. Put a I in the appropriate box in the chart below to
       record the genotype of the resulting baby dragon.
                                                  Mother (WwHh)
                         wh                 wH                 Wh                      WH
  Father          Genotype       of Genotype       of Genotype of baby Genotype of baby =
  wwhh            baby = wwhh        baby = wwHh       = Wwhh                WwHh
             wh
                  Number         of Number         of Number of babies Number of           babies
                  babies with this babies with this with this genotype with this genotype
                  genotype           genotype          =____                 =____
                  =____              =____
    10. Repeat step 1 three times to make and record three more baby dragons.

 Summary and Interpretation of Data
    11. Compile the data for the baby dragons produced by all students in the following chart.
                                           Mother (WwHh)
                        wh                 wH                 Wh                   WH




2009 – 2010                                    20
                                                                 How do We Pass on Our Genes?


                                      Drragon Genettiics
                                      D agon Gene cs
Father        Genotype of        Genotype of         Genotype of        Genotype of
wwhh          baby =________     baby =________      baby =________     baby =________
         wh
              Number of          Number of           Number of          Number of
              babies with this   babies with this    babies with this   babies with this
              genotype =___      genotype =___       genotype =___      genotype =___

              Phenotype:         Phenotype:          Phenotype:         Phenotype:
              Wings __           Wings __            Wings __           Wings __
                or no wings __     or no wings __      or no wings __     or no wings __
              Horns big __       Horns big __        Horns big __       Horns big __
                or small __        or small __         or small __        or small __

  12. Do any of the baby dragons with wings have small horns?
  13. Does either parent have the combination of wings and small horns?
  14. Considering only the baby dragons with wings, what fraction has big horns?
  15. Considering only the baby dragons without wings, what fraction has big horns?
  16. Are baby dragons with wings and without wings about equally likely to have big horns?
  17. Explain these results, based on what happens during meiosis and fertilization.




                                            21                                Shaw High School
Genetics


                            Why do We Look Different?
Changes in DNA are mutations which create variation between different organisms. When
mutations happen in sex cells (sperm and eggs), they may be passed on to future generations;
mutations that occur in body cells may affect the cell or the entire organism. Mutations influence
natural selection and other ways that evolution works (e.g. genetic drift, immigration, emigration).


True or False?
           1.   A mutation is an increase in natural selection. T / F
           2.   Substitutions are mutations where one base takes the place of another. T / F
           3.   Insertions are mutations where bases are removed from DNA. T / F
           4.   Genetic drift happens when genes move from one chromosome to another. T / F



About Mutations and Natural Selection
        DNA doesn't always stay the same. Often, there are changes that happen to the DNA inside
of a cell because of asbestos, cigarette smoking, ultraviolet radiation, or just random chance.
                      These changes to DNA are called mutations. Some mutations in DNA are
                      harmless and cause no problems for the organism or its offspring. Many
                      mutations are harmful and can cause cancers in the organism or birth defects
                      in offspring. Even other mutations cause the death of the cell because it can't
                      survive any more.
                              There are three main types of mutations: substitutions, insertions and
                      deletions. Substitutions are mutations where one base is
     Substitution
                      substituted for another, such as G for A. These can often be
                      harmless because the protein that the gene ends up producing
can be exactly the same.
        If a gene suffers from an insertion mutation, then the entire gene can be
affected or even destroyed. An insertion is when one or more bases are inserted into
the gene and it shifts all of the codons down by one or                                          Insertion
                     more bases.
                             Lastly, a deletion mutation
                     is when one or more bases are
                     removed from the gene.         This
                     again can destroy the entire gene
                     because it can shift all of the
      Deletion       codons up by one or more bases.
                             When      any    of  these
mutations happen in a body cell, they only affect the
organism itself.    However, when these mutations
happen in a sex cell, they can affect the offspring.
This is one of the key concepts behind natural
selection – yes, back to evolution! See, if it weren't
for mutations, there would be no new genes, and all
life would look just like the first, simple one-celled
bacteria.
        Mutations are the source of new genes: it's
thought that all humans started off having brown eyes.
A mutation in the gene for eye color caused some
humans to have blue eyes. In the bright sun of Africa,
it made no sense to have blue eyes, which are more
                                                                           Different eye colors
2009 – 2010                                       22
                                                                          Why do We Look Different?

sensitive to light. But when humans immigrated into Europe, which receives less direct sunlight,
individuals with blue eyes were more fit and survived to reproduce more than the brown-eyed
individuals. In fact, the emigration from Africa would have been impossible without mutations to
the genes for skin color, hair type, digestion of different foods, and more!
        However, the only way that these mutations were passed on from generation to generation
is that the initial mutation happened in either a sperm or egg cell. If the gene for eye color had
changed in a body cell, that only would have affected the individual – not its offspring!
        Even though most mutations result in offspring that don't survive to reproduce, the “good”
mutations more than make up for the “bad” ones. These mutations that take hold in a population
cause the genes of the population to change. To continue our example, when Africans first
immigrated to Europe, the percentage of individuals with blue eyes was around 0%, and these
individuals were limited to the southernmost areas of the continent. However, as time went on and
the mutation for blue eyes spread through the population, the percentage went up; in some areas
in northern Europe, 100% of the population had blue eyes. This change over time in the
percentage of a particular gene in a population is called genetic drift. As you can see, peoples'
genes “drifted” from brown to blue eyes over time.


True or False?
        1.   A mutation is an increase in natural selection. T / F
        2.   Substitutions are mutations where one base takes the place of another. T / F
        3.   Insertions are mutations where bases are removed from DNA. T / F
        4.   Genetic drift happens when genes move from one chromosome to another. T / F




Questions

Do you remember?
   1. How can you avoid mutations that can cause cancer?
   2. Describe genetic drift in your own words.
   3. Differentiate a substitution, insertion and deletion.

Think about it!
   4. Summarize the relationship between mutations and natural selection.
   5. Why is it that mutations in body cells do not affect offspring?

Do something!
   6. Predict a mutation in humans that will spread through the population over the next fifty
      years. What is the mutation? Where did it start? How is it advantageous?

Remember?
   7. Differentiate prokaryotes and eukaryotes in three ways.
   8. What is a gene?
   9. Define, in your own words:
      a) Homozygous:
      b) Heterozygous:
   10. Define a sex-linked trait in your own words.




                                               23                                 Shaw High School
Genetics

Activities

                                   Muttattiions and Punnetttt Squarres
                                   Mu a ons and Punne Squa es
    1. Come up with a dominant human trait, give it a letter
    2. Complete a Punnett's square for two homozygous dominant people
    3. There's a nuclear accident and radioactive spiders bite 10 people. This causes a mutation
       and one allele becomes recessive for these people.
    4. What's the name of this recessive trait?
    5. Complete a Punnett’s square between normal and mutant - what are the chances of a
       mutant?
    6. Do Punnett’s square between two mutants
       a) What are the chances that they'll show the mutation?
       b) What are the chances that they'll carry the mutant allele?


                                            Pediigrrees
                                            Ped g ees
                               1. This is a pedigree to the left. It shows males (squares), females
                                  (circles), and the individuals who have the trait that we’re
                                  studying are shaded in.
                                  a) How many males? Females?
                                  b) How many have the trait? How many do
                                     not?
                               2. To the right is a pedigree for a recessive
                                  trait. This means that the individual who is
       Pedigree 1                 shaded in shows the recessive trait.
                                  a) Using the letters “A” and “a”, write the
          possible genotypes of each individual next to their shape. You
          will notice that for the male child, there is more than one
          possibility! Hint: Start with what you know for sure!
       b) Show the Punnett’s square for the two parents, with
          percentages.                                                                 Pedigree 2
                                                  3. In this pedigree to the
                                                     left, two generations have been skipped by
                                                     the recessive trait. With a pen or pencil, trace
                                                     the path of the recessive allele from the 1st
                                                     generation to the fourth.
                                                     a) What does this line tell you about the
                                                         genotypes of these individuals?
                                                     b) What can you conclude about recessive
                                                         traits skipping generations?




                                           P
                  edigree 3




2009 – 2010                                      24
                                                                         Why do We Look Different?


                                            Bllood Typiing
                                            B ood Typ ng
For this activity, you will be determining the possible blood types of individuals. What you need
to know about blood types is that there are four major types, A, B, AB and O. Alleles A and B
are co-dominant, meaning that they are equally dominant. The recessive allele is O. The chart
below shows the possible genotypes and phenotypes for the ABO blood groups:

                                   Genotype         Phenotype
                                      AA
                                                        A
                                      AO
                                      BB
                                                        B
                                      BO
                                      AB               AB
                                      OO               O




                                                                                              1. I
                                                                                                 d
                                                                                                 e
                                                                                                 n
                                                                                                 t
                                                                                                 i
                                                                                                 f
                                                                                                 y

                                                                                                    t
                                                                                                    h
                                                                                                    e

                                                                                                    g
                                                                                                    e
                                                                                                    n
                                                                                                    o
                                                                                                    t
                                                                                                    y
                                                                                                    p
                                                                                                    e
        s of the individuals above:
        a) John
        b) Harry
        c) Howie
        d) Len
   2.   Complete a Punnett square between Bob and Melanie. What must their genotypes be in
        order to have Howie, who has blood type O? You may have to try different genotypes for
        Bob (who could be AA or AO) and Melanie (who could be BB or BO).
   3.   Use the same process that you used in #2 to figure out what Claire's genotype must be.
   4.   What are the genotypic and phenotypic possibilities for Ron?
   5.   What is the probability that Bob and Melanie have a child who has AB blood?




                                               25                                Shaw High School
Genetics


                            Can We Change our Genes?
Analyze and investigate emerging scientific issues. For example, genetically modified food, stem
                                                                                            cell
                                                                                            researc
                                                                                            h,
                                                                                            genetic
                                                                                            researc
                                                                                            h and
                                                                                            cloning.




True or False?
           1.   It's important to know about genetic issues because you will be tested on it. T / F
           2.   Cloning is the copying of organisms. T / F
           3.   Stem cells can be used to make new organs. T / F
           4.   Genetically modified food is always bad for you. T / F
           5.   Genetic research could result in people being discriminated against. T / F




2009 – 2010                                          26
                                                                           Can We Change our Genes?

About Genetic Issues
        Genetics is a relatively new field of scientific study,
only having been around for about the last 60 years. With
new technology, scientists are able to do more and more to
help improve our lives, but they are often controversial.
Cloning can result in new organs, stem cells can be used
to do research on many diseases, the DNA of our food can
be changed so that it grows better, and genetic research
can tell us what diseases we or our offspring might develop.
        It is important to stay informed of these issues
because they will form many of the political and ethical
issues of the future, if not the present! Many people take a
side on these issues based on fear and misinformation; if
you understand what these issues are actually about, you
can make more informed decisions that could ultimately
lead to a better life for you and your children.
        Cloning is not all about making copies of oneself.          Dolly, the sheep, and her clone
Scary movies and sci-fi television series would have us
believe that scientists would like to make armies of super-intelligent humans that could dominate
the entire world. However, that's completely untrue! Cloning is mainly the use of DNA to make
organs that can be used to treat diseases and to replace organs that have failed. If someone has a
                                        heart attack and needs a new heart, their own DNA could be
                                        used to create that new organ!
                                                 As we have previously seen, a zygote starts dividing
                                        and the cells differentiate. This power to divide into any
                                        other cell of the body is used by scientists in stem cell
                                        research. Stem cells can be taken from aborted embryos,
                                        but can also be taken from adult cells through often
                                        complicated and painful procedures through the bone
                                        marrow. Stem cells can be used to create organs, like
                                        cloning, that can replace failed or diseased organs in a
                                        patient. Stem cells can also be used to research human
                                        diseases, as they do not harm living humans, instead of
                                        performing those experiments on mice.
                                                 Genetically modified food (GM) is food that has
                                        been genetically changed so that it will be resistant to pests,
                                        will grow bigger, taller or otherwise be more healthy and
                                        more valuable when it is sold. In a way, GM has been
                                        happening for thousands of years, as farmers choose the
                                        most healthy crops to plant for the next year. GM food is a
                                        more technical, and less understood, way of making changes
 Scientists have raised concerns over to crops so that farmers can get the most out of their land.
  the dangers of GM food: the mouse              In general, genetic research that is done on humans
     on the right was fed GM food       allows us to see inside ourselves and truly figure out who
                                        and what we are. Many people argue that this information
can be misused; for example, an insurance company may deny health insurance to someone who
has a certain genetic disease that they will only suffer from in 20 years. On the other hand, if we
know what diseases we may get, we can start treatment for those diseases before it even becomes
an issue.


True or False?
        1. It's important to know about genetic issues because you will be tested on it. T / F
        2. Cloning is the copying of organisms. T / F

                                                 27                                  Shaw High School
Genetics

           3. Stem cells can be used to make new organs. T / F
           4. Genetically modified food is always bad for you. T / F
           5. Genetic research could result in people being discriminated against. T / F




Questions
Do you remember?
   1. What is genetic research?
   2. Are stem cells differentiated? How do you know?
   3. Why could GM food be bad for you?

Think about it!
   4. Choose one of the issues and make a one paragraph argument in support of it.
   5. Choose one of the issues and make a one paragraph argument against it.

Do something!
   6. Watch the Franken Foods! Video. Take the viewpoint of a company that wants to patent a
      new tomato that doesn't ever go rotten. Write a two paragraph complaint to the people who
      made this video about how they should remove this video from their web site.

Remember?
   7. Identify one word for each phase of mitosis that will help you remember what happens in
      that phase.
   8. In terms of homozygous, heterozygous, dominant and recessive, label:
      a) HH –
      b) Mm –
      c) bb –
   9. Compare and contrast the Law of Independent Assortment and linkage in at least two ways.
   10. Describe genetic drift in your own words.



The Controversy Over Genetically Engineered Food
Adapted from an article by Rick Weiss

        On a recent day in the English countryside, a handful of people dressed in white
decontamination suits trudged to the center of a brilliant green plot of canola plants. Working
methodically, knowing the police would soon arrive, the team members cordoned off part of the
plot with plastic tape. They opened large bags bearing biohazard symbols and, to the cheering of
friends and supporters around the field’s perimeter, began uprooting the lush plants. The plants
were engineered by the Monsanto Company, a giant biotechnology firm based in St. Louis,
Missouri, to contain a gene from a soil bacterium. That gene protects the plants from a popular
weed killer made by Monsanto. Within minutes on that morning in July 1998, more than two dozen
constables arrived at the scene. A police helicopter hovered overhead. The protesters were ordered
to stop their destructive act. “We can’t,” one explained. “We have work to do.” “Arrest Monsanto!”
another exclaimed. “They’re causing criminal damage to other farmers’ crops through genetic
pollution!”
        The arrests took just 20 minutes, but the group had made its point. Other activists would
soon follow in their muddy steps, convinced that a new generation of genetically altered plants
being studied on scattered test plots constitute a serious threat to human health and the
environment.


2009 – 2010                                       28
                                                                            Can We Change our Genes?

        Human efforts to modify food crops are not new. In the first 10,000 years or so that people
planted and harvested crops, they steadily cultivated hardier varieties by saving and replanting
seeds from their best plants. Selective breeding, in use by about 5000 BC, gave farmers another
tool to improve their crops. Improvements came slowly but were eventually substantial. The
scientific revolution ushered in by the Renaissance encouraged experimentation in selective
breeding and quickened the pace of change. Many of the world’s global food staples have changed
so much that they would not be recognizable to ancient tillers of the soil.
        In the new world of agricultural biotechnology, scientists are no longer constrained by
barriers between species. They can take genes from entirely unrelated organisms—viruses,
bacteria, even fish and other animals—and splice them directly into plants. In doing so, they are
redefining the very nature of the crops upon which humanity has long depended.
        Supporters of genetically engineered food have put forward a bold vision for the new
agricultural biotechnology. They see a world in which key food crops will be genetically altered to
offer better nutrition, repel pests, and flourish in hostile environments—a world in which food is
plentiful and hunger scarce. This vision, however, is not universally shared. Some farmers,
consumers, environmentalists, and governments have expressed concern that genetically
engineered crops pose substantial risks to human health, the environment, and rural economies.
        The first genetically engineered field crop to be marketed for human consumption in the
United States was the Flavr Savr tomato, which was endowed with genes that delayed ripening.
The tomato was approved by the Food and Drug Administration (FDA) in 1994 after years of
development by Calgene, a California biotechnology company. The tomato failed commercially,
however, in part because of its high retail price. Later that year, Asgrow Seed Company’s virus-
resistant squash became the second genetically engineered crop to gain approval in the United
States.
        Agricultural biotechnology received a major boost in late 1996, when researchers at
Monsanto began marketing a new kind of soybean. The soybean was engineered to contain a
bacterial gene that allows the soybean plants to withstand the toxins in Monsanto’s popular
herbicide, Roundup. Until then, many farmers had relied on hand tilling to control weeds in
soybean fields—a tedious, expensive, and time-consuming task. The new variety, known as
Roundup Ready soybeans, enabled farmers to spray the weed killer as needed without worrying
about killing their crop. The modified soybeans were an instant hit. By 2000 more than 14 million
hectares (35 million acres) of Roundup Ready soybeans had been planted in the United States,
accounting for more than 55 percent of the nation’s total soybean plantings.
        Scientists have also added nutritional genes to crops to increase levels of healthy fats, oils,
key vitamins, and other nutrients. In one development with vast medical potential, researchers
developed a strain of rice with three extra genes that allow the rice to make beta carotene, which
the body converts to vitamin A. Vitamin A deficiency affects 250 million children globally and is the
world’s leading cause of blindness.
        The agricultural biotechnology revolution is not limited to food crops. Researchers have used
gene transfer techniques to make plants that can decontaminate environmental pollutants, such as
poisons in the soil around old munitions sites. For example, tobacco plants were given bacteria
genes that allowed them to break down TNT, an explosive, into nontoxic byproducts. Researchers
have even engineered plants to produce human antibodies or polymer plastics in their cells—
advances that could someday revolutionize medicine and industry.
        One issue voiced by opponents concerned the possible human health risks of genetically
modified food. A 1996 study published in the New England Journal of Medicine, for example, found
that a soybean engineered to contain a gene from the Brazil nut to boost the bean’s nutritional
value could trigger harmful reactions in people allergic to Brazil nuts. This finding raised the specter
of consumers eating potentially life-threatening ingredients in their genetically altered food without
knowing about it until it was too late.
        Another concern among opponents was that crops engineered for herbicide resistance, such
as the Roundup Ready soybean, might create “superweeds” by cross-pollinating with wild, weedy
relatives growing nearby. Cross-pollination could give those weeds unprecedented resistance to the
very weed killers that farmers were counting on to control pest plants. This type of gene transfer
was evident in Canadian canola plants in 1999, when farmers in the province of Saskatchewan

                                                  29                                  Shaw High School
Genetics

discovered that multiple applications of Roundup failed to kill wild canola plants growing along
roadsides. Experts continue to disagree about the extent of the problem and the environmental
impact. The discovery, however, has served as a potent reminder that herbicide-resistant genes can
spread to pest plants.


Scientists Reprogram Human Skin Cells Into Stem Cells
        U.S. scientists say they've reprogrammed human skin cells into ones with the same blank-
slate properties as embryonic stem cells, a breakthrough that could aid in treating many diseases
while sidestepping controversy.
        Human embryonic stem cells have the ability to become every cell type found in the human
body. Being able to create these cells en masse and without using human eggs or embryos could
generate a potentially limitless source of immune-compatible cells for tissue engineering and
transplantation medicine, said the scientists, from the University of California, Los Angeles.
        The researchers genetically altered human skin cells using four regulator genes, according
to findings published online in the Feb. 11 edition of the journal Proceedings of the National
Academy of the Sciences.
        The result produced cells called induced pluripotent stem cells, or iPS cells, that are almost
identical to human embryonic stem cells in function and biological structure. The reprogrammed
cells also expressed the same genes and could be coaxed into giving rise to the same cell types as
human embryonic stem cells, the researchers said.
        "Our reprogrammed human skin cells were virtually indistinguishable from human
embryonic stem cells," lead author Kathrin Plath, an assistant professor of biological chemistry and
a researcher with the Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell
Research, said in a prepared statement. "Our findings are an important step towards manipulating
differentiated human cells to generate an unlimited supply of patient specific pluripotent stem cells.
We are very excited about the potential implications."
        The UCLA findings confirm similar work first reported in late November by researcher Shinya
Yamanaka at Kyoto University and James Thompson at the University of Wisconsin. Together, the
studies demonstrate that human iPS cells can be easily created by different laboratories and are
likely to mark a milestone in stem cell-based regenerative medicine, Plath said.
        Reprogramming adult stem cells into embryonic stem cells has significant implications for
disease treatment. A patient's skin cells, for example, could be reprogrammed into embryonic stem
cells that could be prodded into becoming beta islet cells to treat diabetes, hematopoetic cells to
create a new blood supply for a leukemia patient, or motor neuron cells to treat Parkinson's
disease, the researchers said.
        These new techniques to develop stem cells could potentially replace a controversial method
to reprogram cells called somatic cell nuclear transfer (SCNT), sometimes referred to as
therapeutic cloning. To date, therapeutic cloning has not been successful in humans.
        "Reprogramming normal human cells into cells with identical properties to those in
embryonic stem cells without SCNT may have important therapeutic ramifications and provide us
with another valuable method to develop human stem cell lines," study first author William Lowry,
an assistant professor of molecular, cell and developmental biology, said in a prepared statement.
"It is important to remember that our research does not eliminate the need for embryo-based
human embryonic stem cell research, but rather provides another avenue of worthwhile
investigation."
        However, top stem cell scientists worldwide stress further research comparing
reprogrammed cells with stem cells derived from embryos -- considered the gold standard -- is
necessary.


Human Cloning Controversy
       Yesterday's announcement of the successful creation of a human embryo using a cloning
technique in the United States has refuelled debate about the regulation of stem cell research.


2009 – 2010                                      30
                                                                           Can We Change our Genes?

        The technique, undertaken by Advanced Cell Technology (ACT) in Massachusetts, paves the
way to produce human embryonic stem cells that exactly match a particular patient, eliminating
the risk of an immune response.
        Advanced Cell Technology's research, which is published in the online journal E-biomed: the
Journal of Regenerative Medicine, is privately funded. Publicly-funded research into human cloning
has been outlawed in America.
        But the Australian Academy of Science is supportive of such work, with certain restrictions.
        "We do believe this sort of research should be done, but under strictly regulated conditions,"
said Professor John White, the Academy's spokesman on cloning matters.
        "We believe that it is a debate that has to be had in public."
        The researchers at Advanced Cell Technology successfully replaced the DNA in a human egg
with that removed from the nucleus of an adult skin cell, a process called somatic cell nuclear
transfer.
        The egg began dividing as if it had been fertilised by a sperm, to become a ball of cells.
        "The contentious matter is the use of a human egg and the transfer of human DNA into that
egg," said Professor White. "That is new."
        After several days, the ball of cells grows to a stage at which stem cells can be obtained.
        "That's the stage where there are totally potent cells which can become any cell in the
body."
        Advanced Cell Technology has been at pains to point out that their research is for
'therapeutic cloning' — that is, for medical purposes — rather than 'reproductive cloning', which
would aim to develop a new individual.
        The distinction between the two is in the treatment of the embryo once somatic nuclear
transfer has occurred.
        Therapeutic cloning destroys the embryo in the process of deriving stem cells. With
reproductive cloning, the embryo would be implanted into a womb for gestation into a baby.
        Stem cells can be kept in culture and continually replenished.
        "The whole purpose of doing this [research] would be to add to the cell lines that presently
exist," explained Professor White.
        "At the moment stem cell lines already exist that are being continued in culture in many
countries."
        Stem cells are a type of cell that can be transformed into virtually any of the 200 kinds of
cell in the human body. This means that, in theory at least, they can be grown 'to order' to help
people suffering from degenerative diseases.
        In a treatment situation, the DNA from the patient would be injected into a woman's egg
that had had its DNA extracted.
        "The egg is grown to the stage where in the blastocyst you could harvest and then grow up
in culture, some of those stem cells which would be useful for you personally," explained Professor
White. "That is the hope."
        Stems cells can also be harvested from adults.
        "There are many places where stem cells must be present because bone and other tissues
regenerate," said Professor White.
        "But whether those cells are totally potent — that is, they can become any other cell — is
not in my view proven."
        A House of Representatives report tabled earlier this year in Australia did not support the
creation of embryos for experimentation.
        Currently, embryos being used for stem cell research are from miscarriages or abortions, or
left over from in-vitro fertilization.
        But there was an escape clause in the report, said Professor White.
        "It didn't rule out the cell nuclear transfer technique at all, but said it should be held over
for three years to see if something else came up in the meantime."
        "I think that things are moving so quickly there may be a case for looking at that three-year
moratorium, but that is a matter for discussion."



                                                 31                                  Shaw High School
Genetics

OGT Review
   1. Color blindness is a sex-linked trait that is carried on the X chromosome. If a boy is born
      color-blind, what would have to be true?

      a)   His   father had normal vision.
      b)   His   grandmother was color-blind.
      c)   His   mother carried at least one gene for color blindness.
      d)   His   grandfather passed on the color-blind trait to his father.

   2. The pedigree below shows the inheritance pattern of a recessive allele (z) that results in a
      genetic disease.

                                                                                           Based on
                                                                                           the
                                                                                           inheritanc
                                                                                           e pattern,
                                                                                           what are
                                                                                           all the
                                                                                           possible
                                                                                           genotypes
                                                                                           for
                                                                                           individual
                                                                                           6?

      a)   Zz
      b)   ZZ and zz
      c)   ZZ and Zz
      d)   ZZ, Zz and zz

   3. Significant progress has been made in the development of oxygen-carrying solutions that
      may replace whole blood. Describe two reasons why researchers are so interested in
      developing artificial blood to replace the use of whole blood.

      Respond in the space provided in your Answer Document. (2 points)

   4. A student takes a herbicide-resistant weed from plot 3 and a herbicide-resistant weed from
      plot 4. He determines that both plants have dominant mutations in the gene that is
      responsible for herbicide resistance (H). The genotype of each plant is indicated below.




      In a cross between these two weeds, what percentage of the offspring would be resistant to
      the herbicide?

      a)   0%
      b)   25%
      c)   50%
      d)   100%

   5. Geneticists have determined that the majority of individuals in an isolated island population
      have blood type B. Type A blood is found to be more common in the mainland population
      from which the island was settled.

2009 – 2010                                          32
                                                                                    Can We Change our Genes?


       How could a geneticist best explain the dominance of blood type B in the island population?

       a) Random mutations have occurred in the island population.
       b) Genetic drift has reduced the frequency of type A individuals.
       c) Natural selection has only occurred in the mainland population.
Environmental conditions on the island are less favorable for type B individuals.




                                                      33                                    Shaw High School

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:12
posted:12/15/2011
language:English
pages:33