Get documents about "J. Biol. Chem.-2009-Kaneko-3739-49
Document Sample
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 6, pp. 3739 –3749, February 6, 2009
Printed in the U.S.A.
A Binding Domain on Mesothelin for CA125/MUC16*
Received for publication, September 2, 2008, and in revised form, December 4, 2008 Published, JBC Papers in Press, December 15, 2008, DOI 10.1074/jbc.M806776200
Osamu Kaneko, Lucy Gong, Jingli Zhang, Johanna K. Hansen, Raffit Hassan, Byungkook Lee, and Mitchell Ho1
From the Laboratory of Molecular Biology, Center for Cancer Research, NCI, National Institutes of Health,
Bethesda, Maryland 20892
Ovarian cancer and malignant mesothelioma frequently mice with human ovarian carcinoma (OVCAR-3) cells (3). The
express both mesothelin and CA125 (also known as MUC16) at mesothelin gene encodes a 71-kDa precursor protein that is
high levels on the cell surface. The interaction between processed to a 40-kDa protein termed mesothelin, which is a
mesothelin and CA125 may facilitate the implantation and peri- glycosylphosphatidylinositol (GPI)-anchored glycoprotein
toneal spread of tumors by cell adhesion, whereas the detailed present on the cell surface (4). Mesothelin is a differentiation
nature of this interaction is still unknown. Here, we used trun- antigen that is present on a restricted set of normal adult tissues
cated mutagenesis and alanine replacement techniques to iden- such as the mesothelium. In contrast, it is overexpressed in a
tify a binding site on mesothelin for CA125. We examined the variety of cancers including mesothelioma, ovarian cancer, and
molecular interaction by Western blot overlay assays and fur- pancreatic cancer (5). In addition, mesothelin is also expressed
ther quantitatively analyzed by enzyme-linked immunosorbent on the surface of non-small cell lung cancer cells (6, 7), espe-
Downloaded from www.jbc.org by guest, on November 28, 2011
assay. We also evaluated the binding on cancer cells by flow cially most lung adenocarcinomas (8).
cytometry. We identified the region (296 –359) consisting of 64 We and others have shown that mesothelin is shed from
amino acids at the N-terminal of cell surface mesothelin as the tumor cells (9, 10), and antibodies specific for mesothelin are
minimum fragment for complete binding activity to CA125. We elevated in the sera of patients with mesothelioma and ovarian
found that substitution of tyrosine 318 with an alanine abolished cancer (11). Shed serum mesothelin has been approved by the
CA125 binding. Replacement of tryptophan 321 and glutamic acid United States Food and Drug Administration (FDA) as a new
324 with alanine could partially decrease binding to CA125, diagnostic biomarker in mesothelioma. In a Phase I clinical
whereas mutation of histidine 354 had no effect. These results indi- study of an intrapleural interferon- gene transfer using an
cate that a conformation-sensitive structure of the region (296 – adenoviral vector in patients with mesotheliomas, we found
359) is required and sufficient for the binding of mesothelin to that antitumor immune responses targeting mesothelin were
CA125. In addition, we have shown that a single chain monoclonal elicited in several patients (12). A recent study indicated that
antibody (SS1) recognizes this CA125-binding domain and blocks anti-mesothelin antibodies and circulating mesothelin relate to
the mesothelin-CA125 interaction on cancer cells. The identified the clinical state in ovarian cancer patients (13). Pastan and
CA125-binding domain significantly inhibits cancer cell adhesion colleagues (14) developed an immunotoxin (SS1P) with a Fv for
and merits evaluation as a new therapeutic agent for preventing or mesothelin. Two Phase I clinical trials were completed at the
treating peritoneal malignant tumors. National Cancer Institute (National Institutes of Health,
Bethesda, MD) and there was sufficient antitumor activity of
SS1P to justify a Phase II trial. A chimeric antibody containing
Ovarian cancer largely is confined to the peritoneal cavity for the mouse SS1 Fv for mesothelin was also developed and is
much of its natural history (1). Peritoneal mesothelioma is a currently examined in a Phase I clinical trial for ovarian cancer,
highly invasive tumor originating from the mesothelial linings mesothelioma, pancreatic cancer, and non-small cell lung can-
of the peritoneum (2). The development of effective drug regi- cer (15).
mens against ovarian cancer and mesothelioma has proven Mucins are heavily glycosylated proteins found in the mucus
extremely difficult. layer or at the cell surface of many epitheliums (16). There are
Mesothelin was first identified in 1992 by the monoclonal two structurally distinct families of mucins, secreted and mem-
antibody (mAb)2 K1 that was generated by the immunization of brane-bound forms. CA125 (also known as MUC16) was first
identified in 1981 by OC125, a mAb that had been developed
from mice immunized with human ovarian cancer cells (17).
* This work was supported, in whole or in part, by the National Institutes of The first cDNA clones were reported in 2001 (18, 19). CA125 is
Health Intramural Research Program of the NCI, Center for Cancer
Research. This work was also supported in part by a Ovarian Cancer
a very large membrane-bound cell surface mucin, with an aver-
Research Fund Individual Investigator Award (M. H.) and an Mesothelioma age molecular mass between 2.5 and 5 million daltons. It is also
Applied Research Foundation Grant in Honor of Craig Kozicki (M. H.). The heavily glycosylated with both O-linked and N-linked oligosac-
costs of publication of this article were defrayed in part by the payment of charides (20). The peptide backbone of CA125 is composed of
page charges. This article must therefore be hereby marked “advertise-
ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. the N-terminal region, extensive Ser/Thr/Pro-rich tandem
1
To whom correspondence should be addressed: Antibody Therapy Unit, repeats (TR) with 156 amino acids each with both N- and O-gly-
Laboratory of Molecular Biology, NCI, National Institues of Health, 37 Con-
vent Dr., Rm. 5002C, Bethesda, MD 20892-4264. Tel.: 301-451-8727; Fax:
301-402-1344; E-mail: homi@mail.nih.gov. bent assay; rFc, rabbit Fc; hnMSLN, human mesothelin; scFv, single chain
2
The abbreviations used are: mAb, monoclonal antibody; GPI, glycosylphos- variable fragment; mnMSLN, mouse mesothelin; PE, phycoerythrin; HEK,
phatidylinositol; TR, tandem repeat; ELISA, enzyme-linked immunosor- human embryonic kidney.
FEBRUARY 6, 2009 • VOLUME 284 • NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3739
Mesothelin and CA125/MUC16
cosylations, a SEA domain with high levels of O-glycosylation abundant N-glycans on CA125, presumably in the TR region,
and a C-terminal region with a short cytoplasmic tail (19). The are required for binding to both glycosylated and non-glyco-
SEA domain was first identified as a module commonly found sylated mesothelin (28).
in sea urchin sperm protein, enterokinase and agrin (21, 22). Here, we identified the binding site of CA125 on mesothelin
The significance of the SEA domain in CA125 is not clear. by use of truncated mutagenesis and alanine replacement
CA125 was originally used as a biomarker in ovarian cancer approaches. We measured binding qualitatively by Western
due to its high expression in ovarian carcinomas and that it is blot overlay assays and quantitatively by enzyme-linked immu-
shed into the serum (23). A majority (88%) of mesotheliomas nosorbent assay (ELISA). We also evaluated the interaction of
are also CA125 positive on the cell membrane (24). It was CA125 and mesothelin on cancer cells by flow cytometry.
shown that 25% of peritoneal mesotheliomas have high CA125 Furthermore, we have shown that a single chain mAb (SS1)
expression (25). The intensity of CA125 membranous expres- recognized the CA125-binding domain and blocked the
sion is indistinguishable between ovarian carcinomas and peri- mesothelin-CA125 interaction on cancer cells. The identified
toneal mesotheliomas. Gene expression analysis using the CA125-binding domain-Fc fusion protein also significantly
SAGE tag data base has shown that mesothelioma has the sec- inhibited cancer cell adhesion. Our results suggest that confor-
ond highest co-expression of CA125 and mesothelin after ovar- mation-sensitive structures of the region (296 –359) are
ian cancer (26). Rump and colleagues (26) have shown that required and sufficient for specific binding of mesothelin to
mesothelin binds to CA125 and that this interaction may medi- CA125. The domain proteins or the antibodies that block the
ate cell adhesion. Scholler et al. (27) recently showed that mesothelin-CA125 interaction merit evaluation as new thera-
CA125/mesothelin-dependent cell attachment could be peutic agents in treating peritoneal malignant tumors.
Downloaded from www.jbc.org by guest, on November 28, 2011
blocked with anti-CA125 antibodies. Because mesothelin is
present on peritoneal mesothelium, there may be an important EXPERIMENTAL PROCEDURES
role for the mesothelin-CA125 interaction in the tumorigenesis Cell Culture—OVCAR-3 (ovarian) cells were grown in RPMI
of ovarian cancer and mesothelioma in the peritoneal cavity. 1640 (Dulbecco) supplemented with 20% fetal bovine serum,
The mesothelin binding site on CA125 may lie within the 156- 1% penicillin/streptomycin, 1% L-glutamine, and 0.2% human
amino acid TR units, indicating multimeric binding of insulin. YOU (mesothelioma) cells were grown in RPMI 1640
mesothelin to CA125. It has been found that the extraordinarily (Dulbecco) supplemented with 10% fetal bovine serum, 1% pen-
TABLE 1
icillin/streptomycin, and 1% L-glutamine. HEK 293T cells were
Primers used to construct truncated mutants of mesothelin grown in 100-mm tissue culture dishes (Falcon) with Dulbec-
The restriction enzyme sites are underlined. co’s modified Eagle’s medium and supplemented with 10% fetal
Fragments Primers (5 3 3 ) bovine serum, 1% penicillin/streptomycin, and 1% L-glutamine.
Region I Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT Truncated Mutant Constructs—Full-length and fragments of
(296–390) Reverse: CTCTTCTTCTGCGGCCGCCGTCACATTCCACTTGCGAAT mesothelin were amplified by PCR from pMH107 (GenBankTM
Region II Forward: AGAAGAAGAGAATTCTCCCTGGAGACCCTGAAGGCT
(391–486) Reverse: CTCTTCTTCTGCGGCCGCCTGGAAAGCAAGGCGGGCCTT accession number AY743922) (29). Primers were designed to
Region III Forward: AGAAGAAGAGAATTCAACATGAACGGGTCCGAATAC
(487–581) Reverse: CTCTTCTTCTGCGGCCGCGCCCTGTAGCCCCAGCCCCAG
incorporate flanking EcoRI and NotI restriction enzyme sites to
Region IAB Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT facilitate in-frame cloning into a modified pSecTag2 vector
(296–359) Reverse: CTCTTCTTCTGCGGCCGCGAGCTCATCCAGTTTATGCTT
Region IBC Forward: AGAAGAAGAGAATTCGATGCGGCCCTGCTGGCCACC (Invitrogen) (Table 1). Constructs contained an Ig- leader
(328–405) Reverse: CTCTTCTTCTGCGGCCGCGTGCCCTTTGTTGACTTCAAG sequence followed by the rabbit IgG Fc and the full-length
Region IA Forward: AGAAGAAGAAAGCTTGAAGTGGAGAAGACAGCCTGT
(296–337) Reverse: TCTTCTTCTGGATCCGTCCATCTGGGTGGCCAGCAG sequence of the extracellular domain of mesothelin (pMH113)
Region IB Forward: AGAAGAAGAGAATTCGATGCGGCCCTGCTGGCCACC or its fragments, followed by a Myc epitope and His6 tag. The
(328–369) Reverse: CTCTTCTTCTGCGGCCGCGATCACAGACTCGGGGTAACC
Region IC Forward: AGAAGAAGAGAATTCTACCCACAAGGTTACCCCGAG rabbit IgG Fc (rFc) and mesothelin fragments were separated by
(360–405) Reverse: CTCTTCTTCTGCGGCCGCGTGCCCTTTGTTGACTTCAAG
a thrombin cleavage site and a flexible linker. The rFc-mouse
TABLE 2
Primers used to generate alanine replacement mutants of mesothelin
The restriction enzyme sites are underlined.
Mutants Primers (5 3 3 )
Y318A Forward: AGAAGAGAATTCGAAGTGGAGAAGACAGCCTGTCCTTCAGGCAAGAAGGCCCGCGAGATAGACGAGAGCCTCATCTTCGCCAAGAAGTGGGAG
Reverse: CTCTTCTTCTGCGGCCGCGAGCTCATCCAGTTTATGCTT
W321A Forward: tcatcttctacaagaaggcggagctggaagcctgcgtgg
Reverse: ccacgcaggcttccagctccgccttcttgtagaagatga
E324A Forward: AGAAGAGAATTCGAAGTGGAGAAGACAGCCTGTCCTTCAGGCAAGAAGGCCCGCGAGATAGACGAGAGCCTCATCTTCTACAAGAAGTGGGAG
CTGGCAGCCTGCGTG
Reverse: CTCTTCTTCTGCGGCCGCGAGCTCATCCAGTTTATGCTT
F344A Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT
Reverse: TTCTTCTGCGGCCGCGAGCTCATCCAGTTTATGCTTTAGGACGTCCAGCTGCTCGTAGGT GGCGGGGATGGCGTT
E347A Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT
Reverse: TTCTTCTGCGGCCGCGAGCTCATCCAGTTTATGCTTTAGGACG TCCAGCTGCGCGTAGGTGAAGGG
K353A Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT
Reverse: TTCTTCTGCGGCCGCGAGCTCATCCAGTTTATGCGCTAGGACGTCCAG
H354A Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT
Reverse: CTCTTCTTCTGCGGCCGCGAGCTCATCCAGTTTAGCCTTTAGGACGTC
K355A Forward: AGAAGAAGAGAATTCGAAGTGGAGAAGACAGCCTGT
Reverse: CTCTTCTTCTGCGGCCGCGAGCTCATCCAGTGCATGCTTTAGGACGTC
3740 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 6 • FEBRUARY 6, 2009
Mesothelin and CA125/MUC16
from the media using columns
containing Protein A-Sepharose
(Amersham Biosciences). One-ml
columns were loaded, washed with
citrate/phosphate buffer, pH 5.0,
and eluted with 100 mM glycine-
HCl, pH 3.0, and neutralized in 1 M
Tris, pH 8.0. Fractions were col-
lected using the AKTA FPLC sys-
tem (GE Healthcare) and pooled
and concentrated. Final protein
concentration was measured using
Coomassie Plus Protein Assay Rea-
gent (Pierce). Fractions of the dom-
inant peak were run on a SDS-
PAGE gel under non-reducing and
reducing conditions. To verify that
generated proteins were not aggre-
gated, mesothelin and its mutants
Downloaded from www.jbc.org by guest, on November 28, 2011
were subsequently run over a TSK
gel filtration size exclusion column
(TOSOH Bioscience LLC, Mont-
gomeryville) at 0.5 ml/min in phos-
phate-buffered saline, pH 7.5.
Flow Cytometry—To determine
binding of mesothelin fragments
to CA125 on the cell surface,
OVCAR-3 or YOU cells were grown
until confluent, detached, and then
incubated with 1 g/ml of mesothe-
FIGURE 1. Generation of truncated and alanine replacement mutants of mesothelin. A, the mesothelin lin or its fragments in FACS buffer
(MSLN) gene encodes a precursor protein of 622 amino acids. On translocation into the endoplasmic reticulum (5% bovine serum albumin, 0.01%
the N-terminal signal peptide (red, residues 1–33) and the C-terminal GPI anchor addition signal (blue, a pre- NaN ) for 1 h on ice. Bound frag-
dicted cleavage site: Ser598) are removed and the latter replaced with a GPI anchor. The MSLN precursor 3
(71-kDa) is cleaved into two products, the 30-kDa megakaryocyte potentiating factor (MPF; residues Ser34– ments were detected by incubat-
Arg286) (31) and the 41-kDa GPI-anchored membrane-bound mature MSLN (orange) starting from Glu296. The ing with a 1:200 dilution of goat
proteolytic cleavage region (green) contains a furin cleavage site at Arg295, and other protease cleavage sites
including a trypsin cleavage site at Arg286. The four predicted N-linked glycans (black lollipops; Asn57, Asn388, anti-rabbit IgG-PE (BIOSOURCE)
Asn488, and Asn515) on mesothelin are indicated. Truncated mutants (Regions I, II, III, IAB, IBC, IA, IB, and IC) were secondary antibody in FACS
generated as rabbit Fc fusion proteins to sequentially narrow down the CA125-binding domain of mesothelin. buffer for 0.5 h on ice. Cells were
B, mesothelin and truncated mutants were generated using a modified pSecTag2B vector that when trans-
fected into HEK 293T cells created secreted rabbit Fc fusion proteins. A CMV promoter (PCMV) drove the expres- analyzed using FACSCalibur (BD
sion of an Ig- signal, followed by a rabbit Fc fragment, a thrombin cleavage site, and the desired portion of Biosciences). Each binding experi-
mesothelin. A His6 tag was added at the C-terminal of the construct.
ment was repeated three to five
times.
mesothelin fusion (pMH117) was constructed using the same In inhibition assays, cells were incubated with FLAG-tagged
strategy. mesothelin and an excess amount (10-fold) of mesothelin or
Alanine mutants were generated by PCR mutagenesis of mesothelin fragments without a FLAG tag for 1 h on ice. Bound
pMH107-derived human mesothelin (hnMSLN) cDNA fol- FLAG-tagged mesothelin proteins were detected by incubating
lowed by cloning into the modified pSecTag2 vector. Mutations with 1:100 dilution of an anti-FLAG tag mAb (Sigma) followed
were introduced in either forward or reverse primers or by by PE-conjugated goat anti-mouse IgG (BIOSOURCE).
using a two-step overlap-extension PCR (Table 2). Sandwich ELISA—Nunc MaxiSorp 96-well flat-bottomed
Transfections and Mesothelin Mutant-Fc Fusion Protein plates were incubated overnight with 5 g/ml goat anti-rabbit
Production—HEK 293T cells were grown until 60% confluent IgG (Jackson ImmunoResearch Laboratories) in phosphate-
on 100-mm tissue culture dishes (Falcon). Constructs encoding buffered saline, followed by an overnight block with 5% bovine
mesothelin-Fc fusion proteins were transiently transfected serum albumin, 0.01% NaN3 in phosphate-buffered saline.
using Lipofectamine (Invitrogen) in 6 ml of serum-free media. Purified Fc mesothelin fragments were diluted to 1 g/ml in
Three to 5 h later, 6 ml of 20% fetal bovine serum, Dulbecco’s ELISA buffer (0.01% Tween 20, 10% Pierce SuperBlock) and incu-
modified Eagle’s medium was added to each dish and incubated bated on a plate for 1 h at room temperature. Plates were then
for 48 h. Media was harvested subsequently on a daily basis and incubated with OVCAR-3 supernatant containing CA125 for 1 h
replaced with fresh medium. Fc fusion proteins were purified at room temperature. To detect bound CA125 a 1:200 dilution of
FEBRUARY 6, 2009 • VOLUME 284 • NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3741
Mesothelin and CA125/MUC16
determined by using the Mar-
quardt-Levenberg algorithm for
nonlinear regression with Prism
software (version 5.0, GraphPad
Software, San Diego, CA).
Mammalian Cell Display—As
previously described (30), single
chain Fv antibody (scFv) SS1 was
cloned into an expression vector
(pMH112) for cell surface expres-
sion of scFv on HEK 293 cells.
Heterotypic Cancer Cell Adhesion
Assay—We followed a recently
developed protocol (15). Briefly,
OVCAR-3 or YOU cells (1 105)
were seeded in triplicate in micro-
plates, incubated overnight at 37 °C,
in 5% CO2. The following day, H9
(A431-Mesothelin ) (11) were har-
Downloaded from www.jbc.org by guest, on November 28, 2011
vested and loaded with Calcein AM
cell dye (Invitrogen) as per the
instruction manual. The OVCAR-3
or YOU monolayers were washed
once with 200 l of 10% complete
RPMI and preincubated for 1 h at
4 °C with purified mesothelin Fc
fusion proteins. The labeled H9 (2
105) cells were added to triplicate
wells for 1 h at 4 °C. Wells were
FIGURE 2. Key residues proposed for alanine mutations. A, OVCAR-3 cells were incubated with 1 g/ml of
human mesothelin (hnMSLN) or mouse mesothelin (mnMSLN) rFc fusion proteins. The mesothelin binding on gently washed five times with 200 l
OVCAR-3 cells was detected by a goat anti-rabbit IgG Fc PE conjugate. B, eight residues identical between of phosphate-buffered saline by
hnMSLN and mnMSLN in Region IAB were selected for alanine replacement. Region IAB starts at Glu296 and
ends at Leu359 (*) in hnMSLN. Alanine mutants within Region IAB (296 –359) were expressed. Alanine mutants inverting the plate on paper towels.
Y318A, W321A, E324A, and H354A (arrows) were secreted and purified for analysis. The other four mutants, Cell adherence and its inhibition
F344A, E347A, K353A, and K355A, were not secreted and found aggregated inside transfected HEK 293T cells. were quantitated using VICTOR3
Multilabel Counter model 1420
anti-CA125 OC125 mAb (Zymed Laboratories Inc.) was incu- (PerkinElmer Life Sciences).
bated for an additional hour at room temperature; subsequently a Statistical Analysis—The data obtained were entered in
1:1500 dilution of goat anti-mouse IgG horseradish peroxidase Prism (version 5) for Windows (GraphPad Software) for statis-
conjugate (BIOSOURCE) was added for 1 h at room temperature. tical analysis. Flow cytometry raw data were analyzed by anal-
The plates were washed four times with ELISA buffer between ysis of variance with Dunnett’s and Newman-Keuls multiple
each coating. Visualization was achieved with 3,3 ,5,5 -tetrameth- comparison post tests. p values 0.05 were considered statis-
ylbenzidine detection reagent (KPL) and absorbance was read at tically significant.
450 nm with SpectraMax Plus plate reader (Molecular Devices).
Western Blots—Purified Fc mesothelin fragments (500 ng) RESULTS
were mixed with Laemmli sample buffer (Bio-Rad) supple- Generation of Mesothelin Mutants—Truncated mutants of
mented with 5% -mercaptoethanol. Samples were boiled for 2 mesothelin were generated to sequentially narrow down the
min and separated on 4 –20% SDS-PAGE gels (Invitrogen). binding domain to CA125. As shown in Fig. 1, portions of
After transfer for 4 h at 30 V, the polyvinylidene difluoride mesothelin were PCR amplified to incorporate NotI and EcoRI
membrane was blocked overnight at 4 °C in 1% Western Block- restriction sites and cloned into a modified pSecTag 2B vector
ing Reagent (Roche) in Tris-buffered saline (50 mM Tris-HCl, containing an N-terminal rFc fragment. HEK 293T cells were
150 mM NaCl). The membrane was then incubated with transfected and Fc mesothelin proteins were collected and
OVCAR-3 supernatant 0.5% blocking solution for 1 h at purified from the supernatant over the course of 8 –10 days.
room temperature. This was followed by incubation with 1:200 Constructs encoding amino acid residues 296 –390 (Region I),
dilution of OC125 mAb for 1 h at room temperature. Detection 391– 486 (Region II), and 487–581 (Region III) of mesothelin
was performed with goat anti-mouse IgG-horseradish peroxi- were initially generated and tested. Constructs encoding
dase conjugate (BIOSOURCE) at 1:1000 for 1 h. smaller fragments within Region I, Region IAB (296 –359),
Determination of Affinity Constants (KD)—As previously Region IBC (328 – 405), Region IA (296 –337), Region IB (328 –
described (29), equilibrium constants and Scatchard plots were 369), and Region IC (360 – 405) were also generated. It was
3742 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 6 • FEBRUARY 6, 2009
Mesothelin and CA125/MUC16
based on the homology between
human and murine mesothelin (Fig.
2B). In addition, we hypothesized
that these residues are likely to be
involved in the carbohydrate bind-
ing. In total, eight alanine mutant
constructs were made: Y318A,
W321A, E324A, F344A, E347A,
K353A, H354A, and K355A. Of
these mutants, four were secreted at
high enough levels to purify using a
Protein A column, Y318A, W321A,
E324A, and H354A. The purity and
molecular weight of each purified
protein was confirmed on SDS-
PAGE. The other four mutants,
F344A, E347A, K353A, and K355A,
were not secreted into the culture
supernatants due to aggregation
Downloaded from www.jbc.org by guest, on November 28, 2011
inside cells according to immuno-
blotting of whole cell lysates (data
not shown), indicating that muta-
tions of these residues may cause
misfolding of mesothelin. For all
proteins purified, a distinct peak
was found on a TSK size exclusion
column (Fig. 3). The rFc-extracellu-
lar portion of mesothelin-(296 –
581) fusion protein (full-length) was
estimated to be 75 kDa, whereas
truncated mutants were relatively
smaller in molecular mass ( 50 kDa
for Regions I, II, and III and 40
kDa for IAB, IBC, and alanine
mutants of IAB).
Binding of CA125 to Mesothelin
and Its Mutants—To examine the
interaction of CA125 and mesothe-
lin mutants, we used Western blot
overlay analysis. We ran equal
amounts (500 ng) of each protein on
FIGURE 3. Chromatograms from TSK size exclusion columns. Purified mesothelin (A) and truncated mutants an SDS-PAGE gel and transferred
of mesothelin (B–I) and alanine mutants within Region IAB (J--K) were run over a TSK size exclusion column to the protein to a polyvinylidene
verify that the generated proteins were not aggregated. Truncated mutants and alanine mutants had a dom- difluoride membrane. Membrane
inant peak that matched with the wild-type fragment, indicating that there was minimal aggregation. A, full-
length mature MSLN (296 –581); B, Region I (296 –390); C, Region II (391– 486); D, Region III (487–581); E, Region was blotted with OVCAR-3 super-
IAB (296 –359); F, Region IBC)328 – 405); G, Region IA (296 –337); H, Region IB (328 –369); I, Region IC (360 – 405); natant containing CA125 followed
J, Y318A; K, W321A; L, E324A; and M, H354A.
by OC125, an anti-CA125 mAb. As
shown in Fig. 4, the full-length
found that secretion of the IA (296 –337) fragment was pre- extracellular domain of mesothelin (296 –581), Region I (296 –
vented by protein aggregation; however, this problem was cir- 390), and Region IAB (296 –359) bound CA125. A 64-amino
cumvented by moving the rFc to the C terminus of the acid fragment (Region IAB) at the N terminus of mesothelin
mesothelin fragment. (296 –359) retained 100% binding capability to CA125. How-
PCR mutagenesis was used to generate a panel of alanine ever, three smaller fragments, Region IA (296 –337), Region IB
mutants within region 296 –359 (Region IAB). As shown in Fig. (328 –369), and Region IC (360 – 405), consisting of 42 amino
2A, both human and mouse mesothelin (mnMSLN) proteins acids covering all the residues within Region I showed no bind-
bind human CA125. It was reasoned that those residues con- ing to CA125 in Western blot. The alanine mutation at His354
served between the two species would be more likely to be did not change the mesothelin-CA125 interaction. Interest-
involved in the interaction. Specific amino acids were targeted ingly, alanine mutations at Tyr318 (Y318A) and Glu324 (E324A)
FEBRUARY 6, 2009 • VOLUME 284 • NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3743
Mesothelin and CA125/MUC16
FIGURE 5. Binding kinetics of mesothelin mutants and CA125. Scatchard
plots (left) were made. ELISA plates captured the Fc mesothelin mutant fusion
proteins at various concentrations (x axis; see “Experimental Procedures”).
OVCAR-3 supernatant containing soluble CA125 was then added, followed
by the OC125 mAb and a goat anti-mouse IgG horseradish peroxidase. Visu-
alization was achieved with 3,3 ,5,5 -tetramethylbenzidine detection rea-
gent and absorbance was read at 450 nm (y axis). The full-length mature form
of mesothelin (FULL) bound to CA125 with an approximate affinity of 1.54 nM.
Region IAB wild-type (wt) (296 –359) had a KD of 3.35 nM. Substitution of the
tyrosine at position 318 with an alanine (Y318A) completely disrupted the
interaction with CA125. Alanine mutation at Glu324 (E324A; KD 42.4 nM) and
Downloaded from www.jbc.org by guest, on November 28, 2011
Trp321 (W321A; KD 19.5 nM) reduce the binding of mesothelin to CA125. The
alanine mutation at His354 (H354A) does not change the mesothelin-CA125
interaction (KD 2.71 nM).
binding of the Fc fusion protein of wild-type mature mesothelin
(296 –598), Region I (296 –390), and IAB (296 –359) to CA125
was 3 nM. The KD for the mesothelin-CA125 interaction is
consistent with the value ( 5 nM) previously obtained on
OVCAR-3 cells by flow cytometry (28). Three smaller frag-
ments (296 –337, 328 –369, and 360 – 405) within Region I
showed no binding to CA125 in ELISA (data not shown), indi-
cating the first 64 residues at the N terminus of cell surface
mesothelin is the irreducible binding domain on mesothelin for
the CA125 protein. It is striking that substitution of the tyrosine
at position 318 with an alanine (Y318A) completely disrupted
the interaction with CA125. Alanine mutations at Glu324
FIGURE 4. Western blots of mesothelin fragments and alanine mutants. (E324A; KD 42.4 nM) and Trp321 (W321A; KD 19.5 nM)
Each protein (500 ng) was run on an SDS-PAGE gel and transferred to a poly-
vinylidene difluoride membrane. Membrane was blotted with OVCAR-3 partially reduced the binding of mesothelin to CA125. The ala-
supernatant containing CA125 followed by OC125 (anti-CA125 mAb). A, full- nine mutation at His354 (H354A) did not change the mesothe-
length extracellular domain of mesothelin (FULL, 296 –581), Region I (296 –
390), and Region IAB (296 –359) bind CA125. Regions II (391– 486), III (487–
lin-CA125 interaction (KD 2.71 nM).
581), IBC (327–390), IA (296 –337), IB (328 –369), and IC (360 – 405) do not bind To verify that fragments were specifically binding to CA125,
CA125. B, alanine mutants within Region IAB (296 –359) show differential an ELISA was employed wherein captured mesothelin frag-
binding. Alanine mutations at Tyr318 (Y318A) and Glu324 (E324A) abolish the
binding of mesothelin to CA125. Alanine mutation at Trp321 (W321A) partially ments were incubated with either OVCAR-3 supernatant con-
reduce the binding of mesothelin to CA125. The alanine mutation at His354 taining CA125 or supernatant from the OVCAR-3 with knock-
does not change the mesothelin-CA125 interaction. down of CA125 expression. No signal was detected from those
fragments incubated with the supernatant from CA125-knock-
abolished the binding of mesothelin to CA125. Alanine muta- down cells (data not shown), indicating that the binding
tion at Trp321 (W321A) partially reduced the binding of between mesothelin and CA125 in ELISA was specific.
mesothelin to CA125. Cell Binding Assays by Flow Cytometry—To assess binding to
Kinetic Studies by ELISA—To precisely characterize the CA125 on cancer cells, wild-type mesothelin and its mutants
interaction between CA125 and mesothelin and to determine a were incubated with cells. As shown in Fig. 6, Region I (a 95-
binding affinity (KD) for each mesothelin fragment, we used a amino acid fragment consisting of residues 296 –390 at the N
quantitative ELISA-based assay. ELISA plates were coated with terminus) of mesothelin was found to bind to OVCAR-3 cells,
a goat anti-rabbit IgG antibody overnight for capturing the Fc whereas fragments Region II (391– 486) and Region III (487–
mesothelin mutant fusion proteins. OVCAR-3 supernatant 581) showed no binding. The smallest fragment that still con-
containing soluble CA125 was then added, followed by the tained most ( 90%) of binding activity to CA125 was Region
OC125 mAb. Overall results from the ELISA were consistent IAB. Three smaller fragments within Region I, Region IA (296 –
with those seen in the Western blot overlay assays except for 337), IB (328 –369), and IC (360 – 405), were also tested. Only
the E324A mutant of mesothelin (Fig. 5). The average KD for the Region IB had modest ( 10%) CA125-binding activity. These
3744 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 6 • FEBRUARY 6, 2009
Mesothelin and CA125/MUC16
Downloaded from www.jbc.org by guest, on November 28, 2011
FIGURE 7. Binding of truncated mutants and alanine mutants to CA125 on
the cell surface of YOU cells. A, YOU mesothelioma cells were incubated
with the full-length extracellular domain of mesothelin (FULL) or a mutant of
mesothelin. The binding was visualized with a goat anti-rabbit IgG PE-conju-
FIGURE 6. Binding of truncated mutants and alanine mutants to CA125 on gated secondary antibody by flow cytometry (gray line). Light gray shaded
the cell surface of OVCAR-3 cells. A, OVCAR-3 ovarian cancer cells were plot, secondary antibody only. B, a mean fluorescence intensity (geometrical
incubated with the full-length extracellular domain of mesothelin (FULL), mean) was used to quantitatively measure the CA125 binding on YOU cells. In
Regions I, IAB, or IBC. The binding was visualized with a goat anti-rabbit IgG each experiment, the binding of the full-length mesothelin (FULL) to CA125
PE-conjugated secondary antibody by flow cytometry (gray line). Light gray was determined as 100% of binding. The secondary antibody only was used
shaded plot, secondary antibody only. B, a fluorescence intensity (geometrical as a negative (0%) control. Full-length extracellular domain of mesothelin
mean) was used to quantitatively measure the CA125 binding. In each exper- (296 –581), Region I (296 –390), Region IAB (296 –359), and the H354A mutant
iment, the binding of the full-length mature form of mesothelin (FULL) to of IAB bound to CA125 on YOU cells significantly stronger than any other
CA125 was determined as 100% of binding. The secondary antibody only was fragments or mutants on the figure (*, p 0.05).
used as a negative (0%) control. Full-length extracellular domain of mesothe-
lin (296 –581), Region I (296 –390), Region IAB (296 –359), and the H354A Four alanine mutants (Y318A, W321A, E324A, and
mutant of IAB bound to CA125 on OVCAR-3 cells significantly stronger than H354A) generated within the region 296 –359 were similarly
any other fragments or mutants on the figure (*, p 0.05). assessed for their ability to bind to CA125 on the surface of
OVCAR-3 cells. It was found that the substitution of alanine
data indicate that IAB, the first 64 residues at the N terminus of for tyrosine at residue 318 completely ablated binding (Fig.
cell surface mesothelin, is the minimum region that retains the 6). The H354A mutant conversely showed comparable bind-
most binding activity to CA125. The IAB-binding domain was ing to CA125 as wild-type region 296 –359. Alanine mutants
found to bind with comparable affinity, when compared with of the tryptophan at 321 and glutamic acid at 324 also dem-
the full-length mesothelin (FULL). This suggests that it is pri- onstrated a decrease in binding (10 –20%) to CA125 on the
marily the N terminus of cell surface mesothelin that is involved surface of OVCAR-3 cells.
in the interaction with CA125 and the minimum sequence for Using analysis of variance with Dunnett’s and Newman-
CA125 binding activity is Region IAB (328 – 405). Keuls multiple comparison post tests, we have demonstrated
FEBRUARY 6, 2009 • VOLUME 284 • NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3745
Mesothelin and CA125/MUC16
FIGURE 8. Inhibition of the mesothelin-CA125 interaction by mesothelin
mutants. OVCAR-3 cells were incubated with mesothelin or each mutant and
the FLAG-tagged mesothelin (see “Experimental Procedures”). The binding of
FLAG-mesothelin (FLAG-MSLN) to CA125 was detected by an anti-FLAG mAb.
Full-length extracellular domain of mesothelin (296 –581), Region I (296 –
390), CA125-binding domain or Region IAB (296 –359) and the H354A mutant
Downloaded from www.jbc.org by guest, on November 28, 2011
of IAB (dark gray shading) can significantly block the binding of FLAG-tagged
MSLN to CA125 on OVCAR-3 cells (*, p 0.05). FIGURE 9. Epitope mapping of single chain SS1 monoclonal antibody by
mammalian cell display. HEK 293 cells expressing the anti-mesothelin SS1
single chain Fv were incubated with 5 g/ml of full-length extracellular
that full-length mesothelin (FULL), Region I, IAB, and the domain of human mesothelin (100% binding), mouse mesothelin (mnMSLN),
or a mutant of human mesothelin. The binding was visualized with a goat
H354A mutant significantly bound to CA125 on OVCAR-3 anti-rabbit IgG PE-conjugated secondary antibody by flow cytometry. SS1
cells, as compared with Regions II, III, IBC, IA, IB, IC, and the recognized the CA125-binding domain in mesothelin.
Y318A, W321A, and E324A mutants (p 0.05). As compared
with Region IAB, the binding by full-length mesothelin (FULL),
the H354A mutant, and Region I was not significant (p 0.05),
indicating that IAB is the minimal sequence of CA125-binding
domain.
Because surface protein expression of mesothelin and CA125
are also found frequently in malignant mesothelioma, we then
examined the binding of mesothelin and its mutants to the
YOU mesothelioma cell line (Fig. 7). The binding patterns were
similar to those seen in OVCAR-3 cells except for Region I. As
shown in Fig. 7, wild-type mesothelin (FULL), Regions I and
IAB bound CA125 on YOU cells significantly stronger than
Regions II, III, and IBC (p 0.05). Unlike what we saw in
OVCAR-3 cells, Region I retained about 40% of the CA125 binding
activity on YOU cells. Nevertheless, the binding of Region IAB to
CA125 on YOU cells is comparable with the full-length mesothe-
lin (FULL) (p 0.05). We also found that Region IB had modest
( 10%) binding activity. The alanine replacements at positions
318, 321, and 324 showed a significant decrease of CA125 binding
activities (10–30%) on YOU cells.
Inhibition of the Mesothelin-CA125 Interaction by the
CA125-binding Domain—The molecular mechanisms under-
lying the cell adhesion and signaling induced by the mesothe-
lin-CA125 interaction are not clear. An ideal antagonist drug
would disrupt the mesothelin-CA125 interaction but not FIGURE 10. Single chain Fv (scFv) SS1 blocks the mesothelin-CA125 inter-
action. OVCAR-3 (A and B) or YOU (C and D) were incubated with an equimo-
induce cell adhesion and signaling. To this end, we examined if lar concentration of mesothelin and a scFv-PE38 fusion protein (HA22 or
any of the mesothelin truncated or alanine mutants reported SS1P). HA22 contains Fv specific for CD22. SS1P contains the SS1 Fv specific for
mesothelin. SS1P significantly blocked the binding of mesothelin to CA125 on
here can compete with the binding of wild-type mesothelin to OVCAR-3 cells (B) or YOU cells (D), whereas HA22 did not (A and C).
CA125. We co-incubated a FLAG-tagged wild-type mesothelin
with a panel of our mesothelin mutants (Fig. 8). Region IAB can
effectively inhibit the mesothelin-CA125 interaction. Other IBC, mutants Y318A, E324A, and W321A cannot. We have
constructs such as Region I and H354A can also inhibit the demonstrated that full-length mesothelin (FULL), Region I,
mesothelin-CA125 interaction, whereas Regions II, III, and IAB, and the H354A mutant significantly inhibited the binding
3746 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 6 • FEBRUARY 6, 2009
Mesothelin and CA125/MUC16
the SS1 or HA22, a scFv-PE38 spe-
cific for CD22 (29) with mesothelin
and OVCAR-3 or YOU cells. As
shown in Fig. 10, the SS1 scFv
remarkably inhibited the mesothe-
lin-CA125 interaction, whereas the
HA22 scFv did not.
Inhibition of Cancer Cell Adhe-
sion by the CA125-binding Do-
main—Finally we explored the pos-
sibility that the CA125-binding
domain can functionally block can-
cer cell adhesion. We used the assay
system recently established by
Hassan et al. (15). We measured
adhesion of fluorescently labeled
mesothelin-expressing H9 cells (11)
onto CA125 positive OVCAR-3 or
YOU cancer cells. Fig. 11 shows the
Downloaded from www.jbc.org by guest, on November 28, 2011
results of this study. Significant het-
erotypic cell binding was seen on a
monolayer of OVCAR-3 or YOU
cells with the control CD22-Fc
fusion protein or a control fragment
(Region IBC). The CA125-binding
domain (IAB)-Fc fusion protein
completely abolished H9 cell adhe-
sion onto OVCAR-3 or YOU cells.
A statistically significant inhibition
with the CA125 domain was
detected with concentrations as low
FIGURE 11. The CA125-binding domain blocks the mesothelin/CA125-mediated cancer cell adhesion. as 1 g/ml (Fig. 11).
OVCAR-3 (A and C) or YOU cancer cells (B and D) formed monolayers. The OVCAR3 or YOU cancer cell monolayer Structure of CA125-binding Do-
was preincubated with full-length mesothelin, the CA125-binding domain (IAB), IBC, or CD22 Fc fusion pro-
teins before fluorescently labeled mesothelin-expressing H9 cells were added. Mesothelin or IAB significantly main—Because a three-dimen-
blocked cancer cell adhesion with concentrations as low as 10 g/ml on OVCAR3 cells (A and C) or 1 g/ml on sional structure of mesothelin is
YOU cells (B and D) as compared with the control protein (CD22 or IBC) (*, p 0.05). currently not available, the second-
ary structure was evaluated by the
of mesothelin with a FLAG tag to CA125 on OVCAR-3 cells, as algorithms PROF (predictprotein.org) and APSSP2 (imtech.
compared with Regions II, III, IBC, and the Y318A, W321A, and res.in/raghava/apssp2). The CA125-binding domain is primar-
E324A mutants (p 0.05). As compared with Region IAB, the ily composed of helix-turn-helix repeats (Fig. 12). Interestingly,
inhibition of the methelin-CA125 interaction by full-length Tyr318 whose alanine replacement significantly reduces the
mesothelin (FULL) and Region I was not significant (p 0.05), CA125 binding is located at the coil between two helical sec-
clearly indicating that IAB is the minimal sequence (296 –359) ondary structures. The tyrosine seems to be a critical residue
of the CA125-binding domain. that either directly binds the N-glycan on CA125 or indirectly
Epitope Mapping of scFv SS1 by Mammalian Cell Display— plays an important role by maintaining a conformation
Because Fv SS1-derived antibody drugs are currently in several required for CA125 binding. The partial loss of CA125 binding
multi-center clinical trials to treat mesothelioma and ovarian activities of the W321A and E324A mutants may indicate that
cancer, we decided to examine its epitope using the mesothelin other residues near 318 are also involved. The fact that Region
fragments we have made. To this end, we used a new method IB alone had only a modest CA125-binding activity ( 10%)
(called “mammalian cell display”) recently developed in the labo- indicates that the CA125-binding domain requires Region IA
ratory (30) to express the SS1 scFv on HEK 293 cells. We incubated for its full activity.
the HEK 293 cells expressing scFv SS1 with the mesothelin and its
fragments or mutants. As shown in Fig. 9, the epitope of scFv SS1 DISCUSSION
overlaps the CA125-binding site on mesothelin. Cancer cells commonly spread within the peritoneal cavity
Inhibition of the Mesothelin-CA125 Interaction by the SS1 via seeding to mesothelium-lined structures. The interaction
scFv—We investigated whether or not the SS1 scFv could block between CA125, a mucin present on a majority of ovarian can-
the mesothelin-CA125 interaction. We made the SS1 in the cer and mesothelioma cells, and mesothelin, a GPI-anchored
format of a scFv SS1-PE38 fusion protein (8). We co-incubated glycoprotein present on the mesothelial cells lining along the
FEBRUARY 6, 2009 • VOLUME 284 • NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3747
Mesothelin and CA125/MUC16
mesothelin to allow binding to occur. Alanine mutants of
Trp321 and Glu324 in the vicinity of the tyrosine at 318 also
showed decreased binding to CA125 in all assays but were not
nearly as dramatic. Mutating the histidine at 354 had no effect
on the mesothelin-CA125 interaction.
During the preparation of SDS-PAGE, proteins are typically
reduced and denatured by treatment with the Laemmli sample
buffer. Many protein functions depend on protein secondary
and tertiary structures, which could be disrupted under reduc-
ing and denaturing conditions. The fact that CA125 bound to
mesothelin (296 –581), Region I (296 –390), and IAB (296 –359)
in Western blot overlay assays may indicate that the mesothelin
proteins were renatured rapidly during the polyvinylidene
difluoride membrane transfer. The renaturing may allow
mesothelin to recover their secondary and tertiary structures
specific for CA125 binding.
FIGURE 12. Interaction of CA125 and mesothelin. A, CA125 is heavily glyco- Mesothelin is predicted to be primarily composed of helix-
sylated with both O-linked and N-linked oligosaccharides. The peptide back- turn-helix repeats. Interestingly, Tyr318 whose alanine replace-
bone of CA125 is composed of the N-terminal region, extensive Ser/Thr/Pro-
rich tandem repeat (TR) containing 165 amino acids each with both N- and
ment abolishes the CA125 binding of IAB is located at the coil
Downloaded from www.jbc.org by guest, on November 28, 2011
O-glycosylations, a SEA domain with high levels of O-glycosylation, and a between two helical secondary structures (Fig. 12), indicating
C-terminal region with a short cytoplasmic tail. Previous studies have shown that binding could be dependent on the conformation of this
that the N-glycan (28) in the TR region (27) is required for the binding of
CA125 to mesothelin. B, the secondary structure of mesothelin was evaluated region.
by the algorithms PROF and APSSP2. The N-glycan moiety of CA125 repeat We further showed that the CA125-binding domain (IAB) or
units binds to the CA125-binding domain (Region IAB), likely the helical struc- its alanine mutant could effectively block the binding of wild-
tures around Tyr318 at the N-terminal of the cell surface mesothelin. Line, coil.
Tube, helix. type mesothelin to CA125, indicating the CA125-binding
domain Fc-fusion protein is a good candidate to be used as a
peritoneal cavity, has been suggested to facilitate implantation potential antagonist to inhibit the mesothelin-CA125 interac-
and metastasis of tumors (26, 28). Blocking the mesothelin- tion. Moreover, the Fc portion of the molecule with antibody-
CA125 interaction may prevent or reverse metastasis and lead dependent cell-mediated cytotoxicity or complement-depend-
to overall improved survival in cancer patients. A better under- ent cytotoxicity could recruit NK cells or complements to kill
standing of how these two proteins interact may eventually aid the CA125-positive tumor cells. Because of Enbel (TNFR-Fc),
in developing such a therapy. an FDA-approved Fc fusion drug, many peptide-Fc fusion pro-
Here we have shown that it is primarily the N terminus of the teins are currently in clinical trials (32).
extracellular domain of mesothelin (residues 296 –359) that is Furthermore, we have shown that a single chain mAb (SS1)
sufficient and necessary for binding to CA125. A fragment recognizes the CA125-binding domain and blocks the
(IAB) consisting of the first 64 amino acids displayed binding to mesothelin-CA125 interaction on cancer cells. Most interest-
CA125 on ovarian cancer and mesothelioma cells as detected ingly, the CA125-binding domain-Fc fusion significantly inhib-
by flow cytometry as well as in ELISA and Western blot assays. its heterotypic cancer cell adhesion. The SS1 Fv-derived immu-
Other regions of mesothelin (391– 486 and 487–581) showed notoxin and a chimeric (the SS1 mouse Fv/human Fc) antibody
no affinity for CA125. Efforts to further narrow down the bind- are currently in clinical trials for mesothelioma, ovarian cancer,
ing domain with the truncated mutant approach, however, pancreatic cancer, and non-small cell lung cancer.
showed that this fragment was irreducible; smaller fragments Here, we have shown that mesothelin binds to CA125 pri-
296 –337, 328 –369, and 360 – 405 showed no or only modest marily with the N-terminal portion of cell surface mesothelin.
binding to CA125. This may be due to a specific conformation The CA125-binding domain of 64 residues, likely a helical
that is required for binding that is lost when mesothelin is trun- structure, is irreducible. We have further shown that a tyrosine
cated smaller than the 64-amino acid length. at position 318 is critical for binding to CA125. The CA125-
Our efforts to further find specific amino acids within the binding domain significantly inhibits cancer cell adhesion and
CA125-binding domain (296 –359) of mesothelin that are merits evaluation as a new therapeutic agent in preventing or
involved in the interaction with CA125 led us to mutate several treating peritoneal malignant tumors.
suspected amino acid residues to alanine to see if it would affect
binding affinity. We chose residues that were homologous Acknowledgments—We thank Ira Pastan for helpful discussions and
between mouse and human and those likely to be involved in Anna Mazzuca for editorial assistance.
the carbohydrate binding. The replacement of tyrosine with
alanine in the IAB fragment resulted in no binding to CA125 on REFERENCES
ELISA and Western blot and significantly reduced most
1. Runowicz, C. D. (2008) Cancer J. 14, 7–9
CA125-binding activity on cancer cells by flow cytometry indi- 2. Palumbo, C., Bei, R., Procopio, A., and Modesti, A. (2008) Curr. Med.
cating the tyrosine at position 318 is critical for either direct Chem. 15, 855– 867
binding to CA125 or maintaining the conformation of 3. Chang, K., Pastan, I., and Willingham, M. C. (1992) Int. J. Cancer 50,
3748 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 6 • FEBRUARY 6, 2009
Mesothelin and CA125/MUC16
373–381 18. Yin, B. W. T., and Lloyd, K. O. (2001) J. Biol. Chem. 276, 27371–27375
4. Chang, K., and Pastan, I. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 136 –140 19. O’Brien, T. J., Beard, J. B., Underwood, L. J., Dennis, R. A., Santin, A. D.,
5. Hassan, R., and Ho, M. (2008) Eur. J. Cancer 44, 46 –53 and York, L. (2001) Tumour Biol. 22, 348 –366
6. Miettinen, M., and Sarlomo-Rikala, M. (2003) Am. J. Surg. Pathol. 27, 20. O’Brien, T. J., Beard, J. B., Underwood, L. J., and Shigemasa, K. (2002)
150 –158 Tumour Biol. 23, 154 –169
7. Ordonez, N. G. (2003) Am. J. Surg. Pathol. 27, 1418 –1428 21. Bork, P., and Patthy, L. (1995) Protein Sci. 4, 1421–1425
8. Ho, M., Bera, T. K., Willingham, M. C., Onda, M., Hassan, R., FitzGerald, 22. Maeda, T., Inoue, M., Kshiba, S., Yabuk, T., Aoki, M., Nunokawa, E., Seki,
D., and Pastan, I. (2007) Clin. Cancer Res. 13, 1571–1575 E., Matsuda, T., Motoda, Y., Kobayashi, A., Hiroysau, F., Shirouzu, M.,
9. Hellstrom, I., Raycraft, J., Kanan, S., Sardesai, N. Y., Verch, T., Yang, Y., Tereda, T., Hayami, N., Ishizuka, Y., Shinya, N., Tatsuguchi, A., Yoshida,
and Hellstrom, K. E. (2006) Cancer Epidemiol. Biomark. Prev. 15, M., Hirota, H., Matsuo, Y., Tani, K., Arakawa, T., Carninci, P., Kawai, J.,
1014 –1020 Hayashizaki, Y., Kigawa, T., and Yokoyama, S. (2004) J. Biol. Chem. 279,
10. Ho, M., Onda, M., Wang, Q., Hassan, R., and Pastan, I. (2006) Cancer 13174 –13182
Epidemiol. Biomark. Prev. 15, 1751 23. Bast, R. C., Klug, T. L., St. John, E., Jenison, E., Niloff, J. M., Lazarus, H.,
11. Ho, M., Hassan, R., Zhang, J., Wang, Q. C., Onda, M., Bera, T., and Pastan, Berkowitz, R. S., Leavitt, T., Griffiths, C. T., Parker, L., Zurawski, V. R., and
I. (2005) Clin. Cancer Res. 11, 3814 –3820 Knapp, R. C. (1983) N. Engl. J. Med. 309, 883– 887
12. Sterman, D. H., Recio, A., Carroll, R. G., Gillespie, C. T., Haas, A., Vachani, 24. Bateman, A. C., al-Talib, R. K., Newman, T., Williams, J. H., and Herbert,
A., Kapoor, V., Sun, J., Hodinka, R., Brown, J. L., Corbley, M. J., Parr, M., A. (1997) Histopathology 30, 49 –56
Ho, M., Pastan, I., Machuzak, M., Benedict, W., Zhang, X. Q., Lord, E. M., 25. Attanoos, R. L., Webb, R., Dojcinov, S. D., and Gibbs, A. R. (2002) Histopa-
Litzky, L. A., Heitjan, D. F., June, C. H., Kaiser, L. R., Vonderheide, R. H., thology 40, 237–244
Albelda, S. M., and Kanther, M. (2007) Clin. Cancer Res. 13, 4456 – 4466 26. Rump, A., Morikawa, Y., Tanaka, M., Minami, S., Umesaki, N., Takeuchi,
13. Hellstrom, I., Friedman, E., Verch, T., Yang, Y., Korach, J., Jaffar, J., M., and Miyajima, A. (2004) J. Biol. Chem. 279, 9190 –9198
Swisher, E., Zhang, B., Ben-Baruch, G., Tan, M. C., Goedegebuure, P., and 27. Scholler, N., Garvik, B., Hayden-Ledbetter, M., Kline, T., and Urban, N.
Downloaded from www.jbc.org by guest, on November 28, 2011
Hellstrom, K. E. (2008) Cancer Epidemiol. Biomark. Prev. 17, 1520 –1526 (2007) Cancer Lett. 247, 130 –136
14. Pastan, I., Hassan, R., Fitzgerald, D. J., and Kreitman, R. J. (2006) Nat. Rev. 28. Gubbels, J. A., Belisle, J., Onda, M., Rancourt, C., Migneault, M., Ho, M.,
Cancer 6, 559 –565 Bera, T. K., Connor, J., Sathyanarayana, B. K., Lee, B., Pastan, I., and Pa-
15. Hassan, R., Ebel, W., Routhier, E. L., Patel, R., Kline, J. B., Zhang, J., Chao, tankar, M. S. (2006) Mol. Cancer 5, 50
Q., Jacob, S., Turchin, H., Gibbs, L., Phillips, M. D., Mudali, S., Iacobuzio- 29. Ho, M., Kreitman, R. J., Onda, M., and Pastan, I. (2005) J. Biol. Chem. 280,
Donahue, C., Jaffee, E. M., Moreno, M., Pastan, I., Sass, P. M., Nicolaides, 607– 617
N. C., and Grasso, L. (2007) Cancer Immun. 7, 20 30. Ho, M., Nagata, S., and Pastan, I. (2006) Proc. Natl. Acad. Sci. U. S. A. 103,
16. Desseyn, J. L., Tetaert, D., and Gouyer, V. (2008) Gene (Amst.) 410, 9637–9642
215–222 31. Kojima, T., Oh-eda, M., Hattori, K., Taniguchi, Y., Tamura, M., Ochi, N.,
17. Bast, R. C., Jr., Feeney, M., Lazarus, H., Nadler, L. M., Colvin, R. B., and and Yamaguchi, N. (1995) J. Biol. Chem. 270, 21984 –21990
Knapp, R. C. (1981) J. Clin. Investig. 68, 1331–1337 32. McGregor, D. P. (2008) Curr. Opin. Pharmacol. 8, 616 – 619
FEBRUARY 6, 2009 • VOLUME 284 • NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3749
