1
)fdp.ecnecil/arofi/moc.jmb.ojb//:ptth( ecnecil OJB ni tuo tes sa ,sthgir
yraidisbus lla tiolpxe dna esu hcus secnecilbus dna stcudorp LGPJMB
rehto yna dna OJB ni dehsilbup eb ot )detpecca fi( elcitra siht timrep ot
dtL puorG gnihsilbuP JMB eht ot sisab ediwdlrow a no ecnecil evisulcxe na
,srohtua lla fo flaheb no tnarg seod dna srohtua lla fo flaheb no tnarg ot
thgir eht sah )M tnreK( rohtuA gnidnopserroC ehT :noitacilbuP rof ecneciL
.yduts siht ni desu sdohtem dna slairetam eht fo yna ni tseretni laicnanif
ro laicremmoc yna evah ton od srohtua ehT :serusolcsiD laicnaniF
enon :troppuS/gnidnuF
FGEV ,binefaros ,bamuzibinar
,FGlP ,FGDP ,srotibihni esanikitlum ,VNC ,bamuzicaveb ,DMA :sdroW yeK
1 :slebat fo rebmuN
5 :serugif fo rebmuN
3922 :tnuoc droW
ed.nehcneum-inu.dem@tnrek.sucram :liam-E
0615-0615-98-94+ :xaF
1183-0615-98-94+ :enohP
ynamreG ,hcinuM 63308
8 tS nedlihtaM
ytisrevinU-snailimixaM-giwduL
ygolomlahthpO fo tnemtrapeD
DM ,tnreK sucraM :ot ecnednopserroC
rohtua gnidnopserroC 2
ynamreG
,hcinuM ,ytisrevinU nailimixaM giwduL ,ygolomlahthpO fo tnemtrapeD 1
1
kipmaK .A , giblU .W .M , floW
1 1
.A , eglA .S .C , ssienriH .C , lgeiL .G .R , reuabueN .S .A , tnreK .M
1 1 1 1 2,1
FGlP dna ,FGDP ,FGEV fo noisserpxerevO decudnI-thgiL
morf slleC muilehtipE tnemgiP laniteR namuH stneverP binefaroS
2
.DMA rof tnemtaert cinegoignaitna laitnetop a
sa seitreporp gnisimorp sah binefaros taht wohs stluser ehT :noisulcnoC
.Lm/gµ 1 fo esod
a ta binefaros htiw detaert erew sllec nehw decuder yltnacifingis erew
stceffe decudni-thgil esehT .FGlP dna ,BB-FGDP ,A-FGEV fo noiterces dna
noisserpxe desaercni dna ytilibaiv llec desaerced erusopxe thgiL :stluseR
.syassa tnebrosonummi deknil-emyzne
dna ,yrtsimehcotsihonummi ,snoitcaer niahc esaremylop-noitpircsnart
esrever yb denimreted erew ANRm rieht dna FGlP dna ,BB-FGDP
,A-FGEV fo noiterces dna ,noisserpxe ,ytilibaiV .binefaros htiw detabucni
dna thgil etihw ot desopxe erew sllec EPR namuh yramirP :sdohteM
.sllec )EPR( lailehtipe tnemgip laniter namuh ni
srotcaf htworg fo noisserpxerevo decudni-thgil no binefaros fo stceffe eht
setagitsevni yduts sihT .DMA evitaduxe no stceffe laicifeneb evah thgim
,rotibihni esanikitlum laro na ,binefaros taht etacidni stroper suoiverP
.DMA fo tnempoleved no tcapmi laitnatsbus a evah ,)FGlP( rotcaf htworg
atnecalp dna )FGDP( rotcaf htworg devired-teletalp sa hcus ,srotcaf
htworg rehto ,revewoH .DMA ni seigetarts tnemtaert cinegoignaitna
tnerruc fo tegrat niam eht si )FGEV( rotcaf htworg lailehtodne ralucsav
fo noitibihnI .)DMA( noitareneged ralucam detaler-ega fo noissergorp
htiw detaicossa yltnacifingis si erusopxe thgil evitalumuC :dnuorgkcaB
tcartsbA
3
suounitnoc tuohtiw dna enola noitibihni FGEV htiw sserger ton seod
yllacipyt eussit ralucsavoen eht ,ytiuca lausiv ni tnemevorpmi na etipsed
taht delaever slairt dezimodnar evitcepsorp rojam ,revewoH . evitceffe
21-01
dna efas si srotibihni FGEV htiw DMA fo tnemtaert taht detartsnomed
evah seidutS . rotpecer sti ot ssecca gnitneverp ybereht dna ecaps
9
ralullecartxe eht ni FGEV gnikcolb si )bamuzibinar dna bamuzicaveb ,.g.e(
srotibihni FGEV eseht fo noitca fo msinahcem ehT . DMA fo tnemtaert
8
eht ni stnega cinegoignaitna desu yltnerruc eht fo tegrat niam eht
si FGEV fo noitibihni ,eroferehT . VNC fo tnempoleved eht ni tneve lacitirc
7
rojam a si )FGEV( rotcaf htworg lailehtodne ralucsav fo noitaluger-pU
. evird dna ,secaf ezingocer ,daer ot ytiliba eht fo ssol elbisreverri
6 5
ot dael nac DMA ,tnemtaert tuohtiW . esaesid siht gniylrednu ssecorp
6 5
cigoloisyhpohtap latnemadnuf eht si dna ytiuca lausiv noituloser-hgih dna
noisiv lartnec fo ssol tnacifingis ni stluser netfo noiger ralucam eht ni VNC
. erusopxe thgilnus dna ,teid ,sciteneg ,noisnetrepyh
4-1
,gnikoms ,redneg ,yticinhte gnidulcni ,noissergorp dna tnempoleved
rof srotcaf ksir lareves htiw esaesid lairotcafitlum a si DMA . noisiv fo ssol
1
dipar a ot sdael netfo taht )VNC( noitaziralucsavoen ladiorohc ot eud DMA
fo smrof ”tew“ poleved stneitap fo %01 ,esaesid eht fo noissergorp htiW
. )EPR( muilehtipe tnemgip laniter eht ni segnahc cihporta dna nesurd fo
1
noitamrof eht yb deziretcarahc era esaesid siht fo segats ylraE . seirtnuoc
1
depoleved ni 06 ega revo elpoep ni ssendnilb lagel dna noitaroireted lausiv
fo esuac gnidael a si )DMA( noitareneged ralucam detaler-ega evitaduxE
noitcudortnI
4
sdohteM
.denimreted saw FGlP dna ,BB
-FGDP ,A-FGEV fo noisserpxE .detagitsevni erew erusopxe thgil retfa sllec
eht fo ytilibaiv no stceffe s’gurd eht dna binefaros htiw detaert erew slleC
.)mn 007-004 egnar lartceps( thgil etihw dnab-ediw ot sllec EPR namuh
yramirp desopxe ew ,eroferehT . DMA fo noissergorp dna tnempoleved
1
eht ni elor yek a syalp hcihw ,EPR eht ni noisserpxe rotcaf htworg decudni
-thgil no binefaros fo tceffe eht etagitsevni ot dengised saw yduts sihT
. DMA evitaduxe no tceffe laicifeneb a evah thgim ,sgurd citatsoigna
91 81
rehto htiw noitanibmoc ni ro enola ,binefaros taht etacidni stroper
esac suoiverP . recnac fo smrof lareves fo tnemtaert eht rof devorppa
71
,rotibihni esanikitlum laro na si )6009-34 YAB ,ravaxeN( binefaroS
.syawhtap evitanretla
fo esaercni yrotalumits ni esaercni yrotasnepmoc a ecudni dluoc
elucelom elgnis a fo noitibihni ,noitidda nI .eussit ralucsavoen no tceffe
detimil ylno evah thgim enola ecaps ralullecartxe eht ni FGEV gnidnib dna
evitca niamer syawhtap ralucelom rehto taht eb dluoc siht rof nosaer ehT
. DMA fo noissergorp dna tnempoleved eht ni elor laicurc a yalp dna
61-31
esaesid laniter evitarefilorp ni saniter dna suoertiv eht ni desserpxerevo
era ,)FGlP( rotcaf htworg atnecalp dna )FGDP( rotcaf htworg
devired-teletalp gnidulcni ,srotcaf htworg cinegoigna lareves taht detacidni
seiduts suoiverP .syawhtap tnadnuder ot eud eb thgim tceffe deniatsus
fo kcal siht rof nosaer ehT . 11 01
srucco noissergorp-er netfo tnemtaert
5
fo stceffe eht etagitsevni oT .32-12
DMA fo noissergorp dna tnempoleved
eht ni elor niatrec a yalp ot detacilpmi neeb sah tI .rezitisnesotohp a
sa tca ot nwonk si nicsufopil dna oviv ni sllec EPR gniega fo citsiretcarahc
nommoc a si nicsufopil fo noitalumucca desaercni nA .muidem
erutluc llec eht sa desu saw )ynamreG ,nilreB ,morhcoiB ;SCF( mures
flac latef %01 htiw detnemelppus )ynamreG ,nilreB ,morhcoiB ;MEMD(
muidem elgaE deifidom occebluD . debircsed ylsuoiverp sa deraperp
02
erew dna ytisrevinU nailimixaM giwduL fo knaB eyE eht morf deniatbo
erew esaesid eye fo yrotsih yna tuohtiw )metromtsop h 01-3 deniatbo
,dlo sraey 47 dna ,65 ,25 ,84( sronod namuh ruof morf sllec EPR yramirP
erutluC lleC EPR namuH
.eettimmoc scihte lacol eht yb devorppa
erew dna ,iknisleH fo noitaralceD eht htiw deilpmoc ,lavorppa dna tnesnoc
reporp dedulcni ,enamuh erew eussit namuh gniruces fo sdohtem ehT
scihtE
.lortnoc tnevlos a sa )v/v( %1.0 ta serutluc
ot dedda saw OSMD .seiduts ortiv ni rof %1.0 fo noitartnecnoc OSMD lanif
a htiw noitartnecnoc derised eht ot muidem erutluc llec eht dna OSMD
htiw detulid dna )OM ,siuoL .tS ,amgiS ;OSMD( edixoflus lyhtemid %001
ni devlossid saw )]aeru)lynehpyxo)ly-4-nidiryp lyomabraclyhtem-2(-4(-N
-)lynehporolhc-4-lyhtemoroulfirt-3(-N[ 6009-34 YAB ,ravaxeN( binefaroS
slairetaM
6
saw SBP ,noitanimulli retfa yltceriD .)scinotohP ustamamaH ;DM38001C(
retemortceps a htiw derusaem erew egnar lartceps dna rewop noitanimulli
ehT .nim 06 rof ) mc/Wm 003( detanimulli erew yehT .evoba morf
2
detanimulli erew sllec eht dna ,devomer saw llew erutluc llec detanimulli
eht fo revoc citsalp ehT .noitanimulli erofeb tsuj SBP htiw decalper saw
muidem erutluc llec ehT .noitanimulli rof desu saw )mn 007-004 :egnar
lartceps( ediug thgil eht sa rebif citpo na htiw deppiuqe pmal nonex
-yrucrem a morf )napaJ ,scinotohP ustamamaH ;8-CL( ecruos thgil-tops A
slleC fo noitanimullI
.Lm/gµ 1 fo noitartnecnoc lanif a htiw dedda saw binefaros dna muidem
erutluc llec eerf-mures htiw decalper saw SBP ,noitanimulli retfa yltceriD
.nim 06 rof detanimulli erew yeht ,)SBP( enilas dereffub-etahpsohp
htiw dehsaw erew sllec eht retfA .snoitidnoc eerf-mures ni h 42 rof
tpek erew sllec EPR .ssenkrad ni ecneulfnoc no derutluc dna sehsid erutluc
eussit mm-53 ni dedees erew sllec EPR ,stnemirepxe erutluc llec lla roF
tnemtaerT erutluC lleC
.
62-42
sdoirep mret-gnol rof derutluc
era sllec EPR nehw sraeppasid citsiretcarahc sihT .nicsufopil fo tnuoma
niatrec a ,stnemgip rehto dna ninalem sediseb ,niatnoc selunarg esehT
.ypocsorcim tsartnoc-esahp ni selunarg detnemgip ralullecartni detneserp
serutluc llec EPR detagitsevni llA .stnemirepxe ruo rof 3 dna 2 segassap
fo sllec EPR yramirp desu ew ,noisserpxe rotcaf htworg sEPR no thgil etihw
7
42 rehtona rof Lm/gµ 05 dna ,52 ,51 ,5.21 ,01 ,5.7 ,5 ,5.2 ,52.1 ,1 ,5.0 fo
snoitartnecnoc binefaros htiw detaert erew neht dna ,h 42 rof snoitidnoc
eerf-mures rednu tpek ,ecneulfnoc ot thguorb erew sllec ,ytilibaiv
llec EPR no snoitartnecnoc binefaros tnereffid fo stceffe eht etagitsevni oT
.lortnoc
eht ni noitarefilorp fo egatnecrep naem eht sa desserpxe erew stluser
ehT .)seborP raluceloM( mn 055 ta retemotohportceps llewitlum gninnacs
a yb derusaem saw noitprosbA .llew rep OSMD Lm 0001 fo noitidda
eht yb devlossid erew demrof taht slatsyrc nazamrof ehT .h 1 rof C°73
ta detabucni erew sllec EPR .llew hcae ot dedda saw )MEM Lm 5.82 sulp
,SBP ni Lm/gm 2 ,kcots TTM Lm 5.1( noitulos TTM fo Lm 0001 dna ;SBP
htiw dehsaw erew sllec eht ;devomer saw muidem ehT .snoitacifidom
emos htiw ,nnamsoM yb debircsed sa demrofrep saw ,ytilibaiv
72
llec fo tnemssessa eht rof dehsilbatse-llew si hcihw ,tset TTM ehT .etar
lavivrus llec eht enimreted ot desu saw )edimorb muilozartet lynehpid-5,2
-]ly-2-lozaihtlyhtemid-5,4[-3 ;TTM( yassa noitcuder–eyd muilozartet ehT
yassA TTM
.demrofrep erew noitalosi ANR dna ,ypocsorcim tsartnoc-esahp
,ypocsorcim ecnecseroulfipe ,stnanrepus erutluc llec ni snoitartnecnoc
rotcaf htworg fo noitceted rof )ASILE( yassa tnebrosonummi
deknil-emyzne ,yassa )TTM( elozartetoihtlyhtem eht ,nehT .h 42 rehtona
rof ssenkrad ni tpek erew sllec eht dna ,Lm/gµ 1 fo noitartnecnoc lanif
a htiw dedda saw binefaros ,muidem erutluc llec eerf-mures yb decalper
8
eht retfA .ANRm fo stnuoma llams fo noitceted evitatitnauq selbane )RCP(
noitcaer niahc esaremylop emit-laeR .)ynamreG ,grubmaH ,frodneppE
;retemotohPoiB( yllacirtemotohp denimreted erew ytirup dna dleiy
ehT .sleg esoraga ATDE-etateca-sirT %1 ni siserohportcele yb demrifnoc
saw selpmas ANR eht fo ytirgetni larutcurts ehT .)ynamreG ,grebledieH
,enegatartS( dohtem noitcartxe mroforolhc-lonehp-etanaycoiht
muidinaug eht yb sehsid irteP mc-01 morf detalosi saw ANR latoT
RCP emiT-laeR dna noitalosI ANR
.snoitcurtsni s’rerutcafunam eht ot
gnidrocca )smetsyS D & R( tiK yassA ASILE enikitnauQ FGlP ro ,BB-FGDP
,A-FGEV a gnisu deifitnauq erew FGlP dna ,BB-FGDP ,A-FGEV fo slevel
eht dna ,h 42 retfa detcelloc erew stnatanrepus ehT .ASILE yb denimreted
erew stnatanrepus erutluc eht ni FGlP dna ,BB-FGDP ,A-FGEV fo sleveL
.debircsed sa detaert dna ecneulfnoc ot nworg erew serutluc llec EPR
slleC EPR yb noiterceS FGlP dna ,BB-FGDP ,A-FGEV fo noitceteD
.noitaidar yna ot erusopxe tuohtiw ,ssenkrad
ni tpek erew yeht ;egassap emas eht fo sllec EPR erew sllec lortnoc ehT
.semit eerht detaeper dna etacilpirt ni demrofrep erew stnemirepxe ehT
.demrofrep saw
yassa TTM eht noitanimulli retfa h 42 tA .evoba debircsed sa detaert dna
detanimulli erew sllec ,erusopxe thgil retfa ytilibaiv llec EPR no binefaros
fo stceffe eht etagitsevni oT .demrofrep saw yassa TTM eht nehT .h
9
desu erew selcyc eseht dna ,selcyc tnereffid ni desaercni ytisnetni langis
eht ,seneg tegrat fo noitartnecnoc laitini eht no gnidnepeD .pets noisnetxe
eht gnirud decalpsid erew seborp noitazidirbyH .tnemurtsni relcyCthgiL
eht yb derusaem neht saw ecnecseroulf dettime ehT .serohporoulf owt
eht neewteb depoleved )TERF( refsnart ygrene ecnanoser ecnecseroulf
,ytimixorp esolc ni emac seborp owt eht nehW .esahp gnilaenna
eht gnirud tnemgarf deifilpma eht ot dezidirbyh erew serohporoulf
delebal tnereffid htiw seditoelcunogilo owT .selcyc 04 rof sremirp cificeps
htiw deifilpma saw ,thgil ot desopxe neht dna detaertnu ro binefaros htiw
noitabucni retfa rehtie ,sllec EPR fo ANDc ehT .RCP fo esahp noitacifilpma
laitnenopxe eht gnirud ylisae slangis tceles nac metsys eht esuaceb
,etalpmet ANR laitini eht fo stnuoma eht fo noitacifitnauq etarucca
dewolla hcihw ,emit laer ni detceted erew slangis noitacifilpma ehT
.ANDc Lµ 2 dna ,eborp naMqaT Mm 2.0 ,remirp hcae
2
fo Mm 5.0 , lCgM Mm 4 ,)scitsongaiD ehcoR( xiM seborP noitazidirbyH
retsaM AND tratStsaF ×1 deniatnoc emulov noitcaer Lµ-41 hcaE .ytidilav
tcudorp erusne ot decneuqes erew stcudorp RCP llA .AND cimoneg
fo noitacifilpma diova ot seiradnuob noxe/nortni ssorc ot dengised erew
seborp dna sremirp llA .40.2 redniFeborP htiw detceted erew seborp dna
sremirP .)ynamreG ,miehnnaM ,scitsongaiD ehcoR ;metsyS relcyCthgiL(
tnemurtsni relcyCthgiL a htiw sremirp cificeps htiw demrofrep saw
ANRm FGlP dna ,BB-FGDP ,A-FGEV fo noitacifitnauQ .RCP cificeps eht rof
desu neht saw ANDc sihT .)TR( esatpircsnart esrever hguorht )ANDc( AND
yratnemelpmoc ot derrefsnart saw ANRm siht ,ANRm fo noitalosi lausu
01
yllej enirecylg s'resiaK htiw detnuom dna ,SBP ni desnir ,erutarepmet
moor ta h 1 rof )ygolonhcetoiB zurC atnaS ;SBP ni 005:1 detulid(
ydobitna yradnoces taog-itna tibbar detagujnoc-niecseroulf a ro ydobitna
yradnoces esuom-itna tibbar detagujnoc-der saxeT a htiw dessecorp
rehtruf erew snoitces dna sehsid erutluc eht ,semit eerht gnihsaw retfA
.erutarepmet moor ta h 4 rof SBP ni 002:1 detulid ,)ygolonhcetoiB zurC
atnaS( ydobitna FGlP namuh-itna taog a dna ,)ygolonhcetoiB zurC atnaS(
ydobitna B-FGDP namuh-itna esuom a ,)AC ,zurC atnaS ,ygolonhcetoiB
zurC atnaS( ydobitna A-FGEV namuh-itna esuom a htiw demrofrep saw
selpmas lla fo noitabucni yramirP .001-X notirT %1.0 gniniatnoc SBP htiw
eciwt dehsaw yltneuqesbus dna nim 51 rof )AFP( dica cimrofonohpsohp
%4 htiw dexif erew sllec ,noitabucni retfA .evoba debircsed
sa detaert dna sedils epocsorcim no nworg erew sllec EPR derutluC
serutluC lleC EPR fo yrtsimehcotsihonummI
.RCP-TR rof desu sremirp eht stsil
1 elbaT .semit eerht detaeper dna etacilpirt ni tsael ta demrofrep erew
stnemirepxe llA .slamiced sa desserpxe era soitar ehT .selpmas emas eht
ni eneg gnipeekesuoh ANRr S81 eht fo level eht yb ANRm FGlP dna ,BB
-FGDP ,A-FGEV fo level eht gnidivid yb detaluclac saw hcihw ,)RR( oitar
evitaler eht sa denimreted saw ANRm FGlP dna ,BB-FGDP ,A-FGEV fo level
ehT .lortnoc lanretni na sa elpmas emas eht ni dessecorp ylsuoenatlumis
saw ANRr S81 ,noitcaer hcae ot dedda ANR latot fo tnuoma
eht ni secnereffid fo noitazilamron roF .sllec EPR detaertnu fo seborp
tnereffid eerht htiw edam saw evruc dradnats ehT .tniop gnissorc eht sa
11
ni detnuoc sllec fo rebmun ehT .tnemtaert h 42 retfa sllec EPR yramirp
ni binefaros Lm/gµ 5.21 fo noitartnecnoc a ot pu ypocsorcim tsartnoc
-esahp htiw detceted erew ,seitilamronba rehto ro ,htaed ralullec ,sisyl
ralullec ,ecnaraeppa dna epahs lamronba sa hcus ,seitilamronba ssorg oN
sllec EPR yramirp ni binefaros fo snoitartnecnoc gnitseT
slleC fo ytilibaiV
stluseR
.semit eerht detaeper dna
etacilpirt ni tsael ta demrofrep erew stnemirepxe lla ;deilppa saw gnitset
yentihW-nnaM ,niagA .ANRr S81 dna ANRm detagitsevni eht fo soitar )DS(
naem sa detneserp era RCP-TR eht fo stluseR .lortnoc eht ot dezilamron
erew hcihw ,eborp detset hcae fo soitar )DS( naem sa detneserp era
ASILE FGlP dna ,BB-FGDP ,A-FGEV morf stluseR .desu saw tset yentihW
-nnaM ehT .etacilpirt ni derusaem erew puorg rep selpmas laudividni
neT .ecnabrosba fo stinu )DS( naem sa detneserp era yassa TTM eht fo
stluseR .tnacifingis deredisnoc saw 50.0 llits tub ,ytilibaiv llec fo noitcuder gnisaercni
na dewohs Lm/gµ 52 dna 51 neewteb binefaros fo snoitartnecnoC
.lortnoc eht htiw derapmoc sllec EPR htiw detceted saw ytilibaiv ralullec
ni )gnitset elpitlum rof noitcerroc α htiw noxocliW( esaerced tnacifingis oN
.Lm/gµ 5.21 dna 5.0 neewteb snoitartnecnoc ta )erusopxe h-42( serutluc
llec EPR detagitsevni eht ni stceffe cixot tnacifingis on dewohs binefaroS
yassa TTM
.tset TTM eht
fo stluser evitatitnauq eht htiw llew detalerroc ypocsorcim tsartnoc-esahp
31
-FGDP ,A-FGEV fo noitceted evitatitnauq a ,erusopxe thgil retfa noiterces
FGlP dna ,BB-FGDP ,A-FGEV no binefaros fo tceffe eht etagitsevni oT
slleC
EPR namuH fo noiterceS FGlP dna ,B-FGDP ,A-FGEV fo noitceteD
.)4 .giF( slortnoc detanimulli-non sa devres taht sllec esoht ot elbarapmoc
saw hcihw ,FGlP dna ,B-FGDP ,A-FGEV fo noisserpxe kaew a ylno dewohs
gniniats ,noitanimulli retfa yltcerid dedda Lm/gµ 1 fo esod a ta binefaros
dah dna nim 06 rof detanimulli erew taht sllec EPR rof ,tsartnoc nI
.desaercni yldekram
saw FGlP dna ,B-FGDP ,A-FGEV fo noisserpxe eht ,erusopxe thgil fo nim
06 retfA .)4 .giF( devresbo saw FGlP dna ,B-FGDP ,A-FGEV rof gniniats
tniaf a ylno ,noitanimulli on dah dna ,Lm/gµ 1 ,binefaros htiw detaert
erew taht sllec dna sllec lortnoc detanimulli-non dna detaertnu htob nI
.noitanimulli retfa h 42 demrofrep saw yrtsimehcotsihonummi
,sisehtnys nietorp desaercni otni setalsnart noitpircsnart ANRm FGlP
dna ,B-FGDP ,A-FGEV fo esaercni decudni-thgil eht taht noitacifirev roF
slleC EPR ni noisserpxE
FGlP dna ,B-FGDP ,A-FGEV fo noitceteD lacimehcotsihonummI
.)3 .giF( h 42 retfa ANRm FGlP dna ,BB-FGDP ,A-FGEV ni esaercni
decudni-thgil siht decuder yltnacifingis erusopxe thgil retfa yltcerid ,Lm/gµ
1 ,binefaros htiw sllec EPR fo tnemtaerT .)3 .giF( sllec EPR ni noisserpxe
ANRm FGlP dna ,B-FGDP ,A-FGEV ni esaercni tnacifingis a ot del nim 06
41
thgim enarbmem s’hcurB ni nesurd fo noitamrof eht ,eromrehtruF
.
03-82
egamad noitaidar ot ytivitisnes rehgih a ni gnitluser yllaitnetop
22
noitcnuf ralullec ni noitaroireted htiw detaicossa eb ot smees noitalumucca
nicsufopil sihT .emit revo sllec EPR eht ni nicsufopil ralullecartni ni
esaercni suounitnoc a ni stluser senarbmem rotpecerotohp dezitycogahp
fo noitadarged etelpmocni ehT . senarbmem enoc dna dor dezitycogahp
12 1
fo noitadarged etelpmocni fo stnanmer morf sirbed cilobatem
etalumucca dna msihpromoelp ni esaercni na ogrednu sllec EPR ,ega
gnicnavda htiW . esaesid siht rof cinomongohtap si ,retnec ralucam
12 1
eht ni ylralucitrap ,sllec EPR fo noitareneged dna ssoL . noitalupop ylredle
1
eht fo esaesid a si DMA . ytirgetni rotpecerotohp enoc dna dor ni elor
1
rojam a syalp dna srotpecerotohp fo lawener eht rof laitnesse si ti metsys
citycogahp a sA .aniter retuo eht dna slessev doolb ladiorohc eht neewteb
tropsnart evitceles etatilicaf ot reirrab aniter–doolb retuo eht smrof EPR
noissucsiD
.)5 .giF( noitanimulli
retfa binefaros htiw detaert ton erew taht sllec esoht ot derapmoc
yltnacifingis FGlP dna ,BB-FGDP ,A-FGEV fo tnuoma eht desaerced
tnemtaert binefaros ,erusopxe thgil retfa yltcerid ,Lm/gµ 1 ,binefaros htiw
detaert erew sllec nehw ,tsartnoc nI .erusopxe thgil fo nim 06 retfa sllec
EPR derutluc ni FGlP dna ,BB-FGDP ,A-FGEV fo esaercni tnacifingis a ot del
erusopxe thgil ,pu-tes latnemirepxe ruo nI .noitanimulli retfa h 42 dohtem
ASILE eht gnisu detcudnoc saw stnanrepus erutluc llec ni FGlP dna ,BB
51
,eroferehT . 93 83
stcejbus lortnoc yhtlaeh ot derapmoc ,VNC dna DMA htiw
stneitap ni rehgih yltnacifingis era slevel A-FGEV suoertiv dna ,desaercni
yltnacifingis si A-FGEV DMA htiw stneitap fo noiger ralucam eht fo tuo
sllec EPR nI . ytilibaemrep ralucsav desaercni fo noitcudni eht si
61 51 7 6 1
A-FGEV fo elor tnatropmi yradnoces A . DMA ni sisenegoigna cigolohtap
7 1
fo tnempoleved eht ni elor tnanimoderp a htiw nietorp detalysocylg
aDk-64–63 ciremid a si ,ylimaf FGEV eht fo rebmem a ,A-FGEV
.sllec EPR namuh
yramirp ni FGlP dna BB-FGDP fo noiterces dna noisserpxe desaercni
na ot osla tub A-FGEV fo noitaluger-pu na ot sdael ylno ton erusopxe
thgil taht etacidni ylraelc stluser ruo ,sgnidnif eseht htiw ecnadrocca nI
. noiterces A-FGEV cinegoignaorp fo noitaluger-pu na ni stluser hcihw
63
,sserts ralullec lahtelbus secudni erusopxe thgil suounitnoc taht eb dluoc
siht rof nosaer ehT . sllec EPR ni A-FGEV fo noitcudorp desaercni
73 63 02
na ot dael nac erusopxe thgil taht detartsnomed evah seiduts suoiverP
.
53 61
DMA evitaduxe fo tnempoleved eht etomorp ot dna sllec EPR
ni srotcaf cinegoignaorp ecudni ot thguoht si erusopxe thgil evitalumuC
. VNC dna slessev
43
doolb lanoitcnufsyd fo noitamrof eht ni gnitluser sisenegoigna tnarreba
ot sdael yllaitnetop eye eht ni srotcaf htworg eseht neewteb ecnalabmi
nA . srehto dna ,FGlP ,FGDP ,FGEV sa hcus ,srotcaf htworg fo stnuoma
61-31
etauqedani eterces sllec EPR ,degamad ecnO . VNC dna DMA fo
33-13
tnempoleved eht ni detacilpmi neeb evah hcihw ,sesnopser yrotammalfni
gnicudni dna tropsnart diulf gnidepmi yb noitcnuf llec EPR esimorpmoc
61
. VNC ni esnopser
44 34 51
gnilaeh dnuow a sa aisalporbif ni elor tnatropmi na evah ot thguoht
si FGDP ,noitidda nI . 34-14
stnega FGEV-itna fo noitartenep eht timil
51
ot thguoht era dna slessev fo noitazilibats gnidivorp ,xelpmoc ralucsavoen
ladiorohc eht fo tnenopmoc tnatropmi na era setycireP . VN C 34-14 51
fo tnempoleved eht ni setycirep tiurcer ot nwonk dna dnob lailehtodne
etycirep eht fo rotaluger yek eht si BB-FGDP .setycirep laniter rof rotcaf
lavivrus a sa stca ,EPR eht yb desserpxe rotcaf htworg rehtona ,BB-FGDP
. seirallipac gnituorps fo
14 04 61
trap largetni na sa tca srotcaf htworg htob erehw ,sisenegoigna fo esahp
ylrae eht ni llew sa tub ,sebut lailehtodne fo ssecorp noitarutam eht ni
rehtie ,sisenegoigna gnirud setycirep no tceffe gnitiurcer a evah FGlP dna
A-FGEV htoB . VNC fo tnempoleved eht ni A-FGEV htiw yllacitsigrenys
61 51
tca yam dna sisenegoigna dna ,sixatomehc ,noitarefilorp ,ytilibaemrep
ralucsav desaercni secudni ,ylimaf FGEV eht fo rebmem a ,FGlP
. xirtam ralullecartxe tnecsan eht fo gniledomer eht
61 51
dna ,EPR eht fo egamad ,stsalborbif ot detaler era VNC htiw detaicossa
seitilamronba larutcurts eht fo ynam tub ,slessev ot detaler era VNC fo
setubirtta lla ton ,noitidda nI . seirallipac gnitsixe no tceffe elttil evah
61 51
ot mees stnega FGEV-itna desu yltnerruc dna enola noitibihni A-FGEV
ot dnopser ot ton mees eussit ralucsavoen fo erutcurts eht mrof taht
setycirep dna sllec lailehtodne ,revewoH . DMA fo tnemtaert eht ni stnega
8
cinegoignaitna desu yltnerruc eht fo tegrat niam eht emoceb sah A-FGEV
71
serefretni osla tub ,noitaluger rotcaf htworg htiw tcaretni ylno ton seod
binefaros taht eb thgim siht rof nosaer laitnetop enO .ytilibaiv llec EPR
ni esaerced decudni-thgil fo tnemevorpmi tnacifingis a yb deinapmocca
saw noisserpxerevo rotcaf htworg decudni-thgil fo noitaunetta
siht ,revoeroM .sllec EPR namuh yramirp ni FGDP dna ,FGlP ,FGEV
fo noiterces dna noisserpxe ni esaercni decudni-thgil eht fo noitcuder
tnacifingis a ot del Lm/gµ 1 fo noitartnecnoc a ta binefaros ,yduts siht nI
. FGDP dna FGEV sa hcus ,srotcaf htworg
84-64 71
fo noisserpxe no ecneulfni na evah ot smees dna 2 dna 1 srotcaf elbicudni
-aixopyh htiw stcaretni binefaros ,eromrehtruF . tiK-c dna ,teR ,3TLF
94-64 71
,rotpecer FGDP ,3RFGEV ,)2RFGEV( 2 rotpecer FGEV gnidulcni ,sesanik
enisoryt rotpecer no tceffe sti dna edacsac )KRE/KEM/FAR( KRE/)KEM(
esanik )KRE( esanik detaluger-langis ralullecartxe/)PAM( nietorp detavitca
-negotim/FAR eht fo ytilibapac gnikcolb sti morf devired eb ot smees
ycaciffe cinegoignaitna dna evitarefilorpitna s’binefaroS .sisenegoigna
ni devlovni sesanik enisoryt rotpecer lareves stibihni osla ti tub ,rotibihni
esanik FAR na sa deifitnedi yllaitini saw binefaros rotibihni esanikitlum ehT
. elihwhtrow eb ot smees dna emoctuo ni stnemevorpmi
54
tnacifingis ot dael thgim DMA sa etats esaesid xelpmoc a ni syawhtap
ro selucelom yek lareves gnitegrat fo hcaorppa denibmoc a ,eroferehT
. enola tnemtaert FGEV-itna ot derapmoc VNC dna noitaziralucsavoen
34 24
laenroc fo noisserger dna noitibihni decudorp dna lavivrus llec lailehtodne
detaidem-etycirep htiw gnirefretni yb noisserger lessev secrofne
FGDP dna FGEV fo noitibihni denibmoc taht detartsnomed seiduts tneceR
81
.tnemtaert esod wol a htiw neve elbaveihca eb thgim ,stnemirepxe ruo ni
evitceffe Lm/gµ 1 fo noitartnecnoc binefaros eht ,revewoH .noitagitsevni
rehtruf sdeen eussi siht dna elbaliava ,noitacilppa cipot retfa ron ,cimetsys
retfa rehtien ,eussit raluco otni binefaros fo noitartenep eht gnidrager
atad on si ereht ,etad oT . dehcaer eb nac Lm/gµ5.4 dnuora yad rep
45-25
gm002 retfa ,Lm/gµ01 fo egnar eht nihtiw era slevel amsalp ,binefaros
gm008 fo esod yliad a retfa taht wonk ew slairt lacinilc lareves morF .yad
rep gm008 si CCR rof tnemtaert laro sa binefaros fo egasod dradnats ehT
.stnemirepxe
ruo ni evitceffe Lm/gµ 1 fo noitartnecnoc binefaros eht naht rehgih dlof
-01 naht erom si sihT .Lm/gµ 5.21 fo noitartnecnoc a ot pu erusopxe h-42
a retfa ytilibaiv llec EPR no ecneulfni tnacifingis a evah ton did binefaros
,pu-tes latnemirepxe ruo ni ,noitidda nI . erar era tub debircsed
15 05
neeb evah stneve esrevda ereveS .noisnetrepyh edarg-wol dna ,aehrraid
,snoitcaer niks toof–dnah ro hsar sa hcus smotpmys cigolotamred
erew )CCR( amonicrac llec laner rof detaert stneitap ni noitartsinimda
laro retfa stceffe edis nommoc tsom ehT . eliforp ytefas sti
05 11
ni snoitacidem FGEV-itna cimetsys ot elbarapmoc eb ot sraeppa binefaroS
.detnarraw si hcraeser rehtruF
.
84 71
ylimaf 2-lcB eht os rebmem gnidulcni ,sANRm fo rebmun egral
a fo noitalsnart eht etaluger ot nwonk si hcihw E4FIe rotcaf noitaitini eht
fo noitalyrohpsohp eht elpmaxe rof stibihni binefaros taht detartsnomed
neeb sah ti ,revewoh ,dootsrednu yletelpmoc ton era smsinahcem
tcaxe ehT .edacsac citotpopa cisnirtni eht nihtiw snietorp niatrec htiw
91
rotcaf htworg decudni-thgil ecuder ot seitreporp sedivorp binefaros taht
etacidni yduts ortiv ni siht ni detneserp atad eht ,revewoH .noitagitsevni
rehtruf deen DMA fo tnempoleved eht ni devlovni sepyt llec rehto dna
sesanik enisoryt rotpecer no stceffe lanoitidda stI .dootsrednu yletelpmoc
era gnilangis dna noisserpxe rotcaf htworg gnidrager binefaros fo
noitca fo smsinahcem fo stcepsa lla ton dna esaesid ralucsavoen laniter ni
gnitcaretni tnenopmoc eno ylno si EPR ehT .EPR namuh eht ni noisserpxe
rotcaf-htworg no tcapmi tnacifingis a dah binefaros yduts ortiv ni siht nI
. bamuzibinar laertivartni htiw
81
noitanibmoc ni ro enola tnemtaert binefaros esod-wol rednu ytiuca lausiv
ni tnemevorpmi ebircsed stroper rehtO . deliaf tnemtaert bamuzicaveb
91
laertivartni erehw ,CCR decnavda ot eud tnemtaert binefaros laro
rednu amede ralucam fo noituloser dna tnemevorpmi lausiv decneirepxe
ohw VNC tlucco htiw tneitap a tuoba detroper la te tnreK .tnemtaert
DMA ni binefaros fo stceffe laicifeneb detartsnomed evah stroper tneceR
. devired era yeht erehw morf eussit eht ni srotcaf htworg
55 71
fo noitcudorp nietorp dna noitpircsnart stneverp yllaitnetop erofereht
dna edacsac cinegoigna eht ni maertsnwod dna maertspu stca yllaitnetop
ecnatsbus eht taht eb thgim srotibihni FGEV ralullecartxe desu yltnerruc
eht ot binefaros neewteb ecnereffid laitnatsbus rehtonA . DMA rof
55
tnemtaert laitnetop a sa gnisimorp eb ot smees binefaros ,sisenegoigna ni
syawhtap dna stegrat elpitlum tsniaga ytivitca sti ot euD .FGDP dna ,FGlP
,FGEV :tnemtaert DMA fo stegrat tnatropmi eerht htiw sllec EPR namuh
ni stcaretni ylevitceffe binefaros taht ecnedive tsrif eht edivorp atad ruO
02
.DMA htiw stneitap rof tnemtaert evitcnujda gnisimorp a eb ot smees
binefaros ,sselehtreveN .sgnidnif ortiv ni ruo etaitnatsbus ot evah lliw
seiduts lacinilc dna latnemirepxe rehtruF .oviv ni VNC fo noissergorp dna
tnempoleved tneverp thgim ,erofereht ,dna EPR namuh ni noisserpxerevo
12
.ecnatsissa lacinhcet tnellecxe rof rezlohbO ajtaK knaht srohtua ehT
stnemgdelwonkcA
22
.16-75401:)32(29;5991
A S U icS dacA ltaN corP .snietorp ciremihc rotpecer
-FGEV elbulos gnisu )FGEV( rotcaf htworg lailehtodne ralucsav
fo noitibihni yb oviv ni noitaziralucsavoen laniter fo noisserppuS
.la te ,L elddiR ,H nehC ,H igakaT ,DE yeloF ,AE ecreiP ,PL olleiA .7
.71-6062:)42(853;8002 deM J lgnE
N .noitareneged ralucam detaler-egA .WJ relliM ,FW releiM ,DR regaJ .6
.29-384:)7(243;0002 deM J lgnE N .noitareneged
ralucam detaler-egA .CA oH ,GM eriugaM ,WJ regreB ,LS eniF .5
.7-057:)5(221;4002 lomlahthpO hcrA .ydutS eyE maD
revaeB eht :yhtapolucam detaler-ega fo ecnedicni raey-01 eht dna
thgilnuS .DM nostdunK ,EB nielK ,R nielK ,JK sknahskciurC ,CS ynamoT .4
.05-642:)2(911;1002 lomlahthpO hcrA .yduts eye
mad revaeb eht :yhtapolucam detaler-ega ylrae fo ecnedicni raey
-5 eht dna thgilnuS .MD lhadnoN ,EB nielK ,R nielK ,JK sknahskciurC .3
.8-415:)4(111;3991
lomlahthpO hcrA .ydutS eyE maD revaeB ehT .noitareneged
ralucam detaler-ega dna thgilnuS .EB nielK ,R nielK ,JK sknahskciurC .2
.28-374:)3(3;8002 gnigA
vretnI nilC .eye gniga eht dna noitareneged ralucam detaler-egA
.B oktsoriW ,AT alluiC ,MD notsniW ,SN ayidarehK ,A sirraH ,R hcilrhE .1
secnerefeR
32
.36-9463:)01(53;4991 icS siV
lomlahthpO tsevnI .sesaesid laniter evitarefilorp ni dezilacolonummi
srotpecer dna sdnagil rotcaf htworg devired-teletalP .la
te ,I artseW ,EJ nostreboR ,EC traH ,JD nosliW ,NR noxiM ,GS snibboR .41
.9-601:)2(801;0002 setebaiD lonircodnE
nilC pxE .yhtaponiter citebaid evitarefilorp htiw stneitap fo diulf
suoertiv ni rotcaf htworg devired-teletalp fo slevel desaercnI .la te ,E
rekcedreffihcS ,R treffE ,J remmaH ,H tukaY ,M rekcorB ,H regrebyerF .31
.9-633:)4(63;5002 gnigamI sresaL
gruS cimlahthpO .noisulcco niev laniter lartnec morf amede ralucam
rof )nitsava( bamuzicaveb fo noitcejni laertivartni na retfa sgnidnif
yhpargomot ecnerehoc lacitpO .AC otifailuP ,EA gnuF ,JP dlefnesoR .21
.13-9141:)41(553;6002 deM J lgnE N
.noitareneged ralucam detaler-ega ralucsavoen rof bamuzibinaR .la
te ,YC gnuhC ,KP resiaK ,SD reyoB ,SJ reieH ,MD nworB ,JP dlefnesoR .11
.842-932:)2(541;8002 lomlahthpO J mA .1 raey ydutS REIP
:noitareneged ralucam detaler-ega ralucsavoen rof bamuzibinar
fo lairt dellortnoc-mahs ,deksam-elbuod ,dezimodnaR .la te
,S redienhcS ,T veluhcnaI ,H euY ,P maharbA ,MD nworB ,DC olligeR .01
.31-9051:)21(392;5002
amaJ .smelborp laitnetop dna sesimorp :noitaziralucsavoen
raluco fo srotibihnI .AK smailliW ,JD retsoC ,P nedraagnjiW nav .9
.9-769:)9(953;8002 deM J lgnE N .emit a ta pord
eno--amede dna noitaziralucsavoen ralucoartni gnitegraT .PL olleiA .8
42
.5 1
-4:)1(48;6002 dnacS lomlahthpO atcA .drazah thgil eulb fo tcapmi
eht dna yhtapolucam detaler-egA .S dragereS ,J llahsraM ,VP erevglA .12
.26-453:)2(53;9002 gruS tcarfeR tcarataC J
.noisserpxe 2-lcB dna ,xaB ,ahpla-rotcaf htworg lailehtodne ralucsav
no stceffe cixototohp gnicuder yb muilehtipe tnemgip laniter namuh
no snel ralucoartni gniretlif-thgil eulb a fo stceffe evitcetorpotyC .la
te ,AC reuabrekcaL ,SC eglA ,HK lbiE ,R lgeiL ,SA reuabueN ,M tnreK .02
.8-654:)4(68;8002 lomlahthpO atcA .tnemtaert binefaroS
laro rednu noitaziralucsavoen ladiorohc tlucco ni amedeo ralucam
fo noituloseR .SA reuabueN ,A kipmaK ,C feitS ,M relheatS ,M tnreK .91
.4-132:)2(38;8002 corP nilC oyaM .noitareneged ralucam detaler
-ega evitaduxe rof binefaros esod-wol htiw denibmoc bamuzibinaR
.rJ ,HE nayR ,PT kniL ,CL ttelloC ,RJ aniloM ,SJ odiluP ,T ogaiD .81
.04-9213:)01(7;8002 rehT recnaC
loM .gnilangis esanik enisoryt rotpecer FGDP dna FGEV dna faR htob
stegrat taht rotibihni esanikitlum a ,binefaros fo weivrevo lacinilcerP
.M hcnyL ,MJ tevolL ,A aveunalliV ,P lleweN ,L enandA ,MS mlehliW .71
.92-1:)1(22;3002 seR eyE niteR
gorP .esaesid eye ni sisenegoigna dna srotcaf htworg lailehtodne
ralucsaV .OR nnamegnilhcS ,JC nedrooN naV ,FG nesnerV ,NA remtiW .61
.101-19:)1(242;4002 lomlahthpO pxE
nilC hcrA sefearG .noitareneged ralucam detaler-ega ni esnopser
gnilaeh dnuow eht dna srotcaf htworg fo eloR .OR nnamegnilhcS .51
52
eht ni ecnecseroulfotua sudnuf oviv ni desaercni fo snrettaP
.EH rekcloV ,PT ottO ,F ttuhcS ,M siditiragraM ,C nnamlleB ,GF zloH .92
.6-017:)8(242;4002
lomlahthpO pxE nilC hcrA sefearG .esaesid ralucam detaler
-ega ni syawhtap cigoloisyhpohtapyeK .GF zloH ,A dlawedniB ,F htoR .82
.36-55:)2-1(56;3891 sdohteM
lonummI J .syassa yticixototyc dna noitarefilorp ot noitacilppa
:lavivrus dna htworg ralullec rof yassa cirtemiroloc dipaR .T nnamsoM .72
.6
-31:)1(601;3002 lomlahthpO coD .egamad thgil eulb dna noitamrof
nicsufopil ,snoitcaer evitadixo :sllec lailehtipe tnemgip laniter
derutluc fo gnigA .TU knurB ,U kramlhiW ,PS nilednuS ,ES nossliN .62
.02-9031:)11(91;0891 icS siV lomlahthpO
tsevnI .ortiv ni muilehtipe tnemgip laniter namuh fo erutcurtsartlu
dna scitsiretcarahc htworG .H eybdlejK ,P saruoG ,TM doolF .52
.64-933:83;0691
)hnepoC( lomlahthpO atcA .eye namuh tluda eht fo aevu dna
aniter eht fo sllec detnemgip eht fo ruoivaheb ortiv nI .RY kahsiraB .42
.0 1
-405:)3(731;4002 lomlahthpO J mA .esaesid ralucam detaler-ega
etal ni snoisel fo sisenegohtaP .CA driB ,R nielK ,D ffohkieluaP ,GF zloH .32
.34-631:)2(08;2002
dnacS lomlahthpO atcA .seitiladom tnemtaert wen dna serutaef
citenegohtap :yhtapolucam detaler-egA .S dragereS ,VP erevglA .22
62
EGAR ,stcudda-EGA dna -ADM -ENH fo noitcudni eht rof smsinahceM
.RJ worrapS ,MA tdimhcS ,S ikadyhcaP ,PY gnaJ ,B iaC ,J uohZ .53
.011-99:)1(28;6002 seR eyE pxE .noitareneged ralucam detaler
-ega htiw seye dna diorohc namuh dega ni )FGEV( rotcaf htworg
lailehtodne ralucsav dna )FDEP( rotcaf devired-muilehtipe tnemgiP
.la te ,P gnoT ,C segreM ,YS miK ,T awagesaH ,SD doeLcM ,AI ottuhB .43
.57-962:)3(72;7002
aniteR .noitareneged ralucam detaler-ega ni noitammalfni
dna srotcaf citeneg fo eloR .SM znarknemulB ,MD ihgefhsoM .33
.7-267:)3(83;7991 icS siV lomlahthpO
tsevnI .enarbmem s'hcurB ni tropsnart diulf ot ecnatsiser rojam
fo etis eht fo noitazilacoL .J llahsraM ,A eromtaP ,AA niassuH ,C atiratS .23
.23-507:)6(02;1002 seR eyE niteR gorP
.noitareneged ralucam detaler-ega dna gniga ni ecafretni enarbmem
s'hcurB-EPR eht ta sessecorp detaidem-enummi fo srekramoib
sa nesurd sredisnoc taht sisehtopyh detargetni nA .FR snilluM
,HD nosrednA ,VL nosnhoJ ,HN gnohC rotciV ,JP trehtuL ,SG namegaH .13
.8-389:)21(042;2002 lomlahthpO
pxE nilC hcrA sefearG .senarbmem ralullec rehto dna lamososyl
eht fo ytirgetni eht no E-2A fo stceffe dna sllec EPR namuh morf
semososyl tcatni fo noitalosI .J ztipoK ,GF zloH ,M nnamgreB ,F ttuhcS .03
.25-541:)2(732;9991 lomlahthpO pxE nilC hcrA sefearG
.noitareneged ralucam detaler-ega htiw detaicossa muilehtipe
tnemgip laniter eht fo yhporta cihpargoeg fo enoz lanoitcnuj
72
.04-833:)2(81;4002 J besaF .smsinahcem lavivrus llec
lailehtodne detaidem-etycirep htiw gnirefretni yb noisserger lessev
romut secrofne gnilangis FGDP dna FGEV fo noitibihni denibmoC .la
te ,PH semmaH ,H regreK ,G htorG ,DA nestaK ,A rehnruhT ,R rebrE .24
.24-634:)4(971;6991 lohtaP J .sisenegoigna
ni setycirep detavitca fo tneutitsnoc a si a esaditpeponimA
.JD retiuR ,JF dlevteiR ,P gnilesseW ,E kjiwretsoO ,OR nnamegnilhcS .14
.56-15:)1(31;0791 lohtaP loM pxE .yduts larutcurtsartlu nA
.gnilaeh dnuow ni etycirep eht fo eloR .CJ reeG ,MT daruM ,JD rekcorC .04
.6-363:)4(08;6991 lomlahthpO
J rB .noitasiralucsavoen laniterbus htiw stneitap fo suoertiv
eht ni detavele era rotcaf htworg lailehtodne ralucsav fo sleveL
.la te ,ME renhoK ,AP ittaniloM ,A nnuN ,R rebbihC ,R yhtruM ,AJ slleW .93
.22-601:)2(63;7991
hceT seR csorciM .yhtapolucam detaler-ega ni segnahc
cigolohproM .TP gnoJ ed ,MC yooM ,LT tfahcS red nav ,M neffilK .83
.9002 egolomlahthpO .la
te ,A floW ,HK lbiE ,AC reuabrekcaL ,SA reuabueN ,C ssienriH ,M tnreK .73
.4-0451:)9(23;6002 gruS tcarfeR tcarataC J .rotcaf
htworg lailehtodne ralucsav fo noitalugerpu decudni-thgil no sesnel
ralucoartni wolley fo stceffE .DW gnaJ ,A amayirI ,Y euonI ,Y iganaY .63
.08-765:)4(08;5002
seR eyE pxE .sllec lailehtipe tnemgip laniter ni FGEV dna
82
.901-9907:)91(46;4002
seR recnaC .sisenegoigna dna noissergorp romut ni devlovni
sesanik enisoryt rotpecer dna yawhtap KRE/KEM/FAR eht stegrat
dna ytivitca romutitna laro murtceps daorb stibihxe 6009-34 YAB
.la te ,H gnoR ,A alobaNcM ,D eikliW ,L gnaT ,C retraC ,MS mlehliW .84
.8-15811:)42(66;6002 seR recnaC .5/FRP/CLP
ledom amonicrac ralullecotapeh ni sisotpopa llec romut secudni
dna ,sisenegoigna romut stibihni ,yawhtap KRE/KEM/FAR eht skcolb
binefaroS .la te ,D eikliW ,A alobaNcM ,X gnahZ ,C nehC ,Y oaC ,L uiL .74
.216-795:704;6002 lomyznE sdohteM .erutalucsav
romut ni RFGDP/RFGEV sesanik enisoryt dna sllec romut ni
yawhtap KRE/KEM/FAR stegrat taht rotibihni noitca-laud a ,)ravaxeN
,6009-34 YAB( binefaroS .MS mlehliW ,I rolyaT ,AP liarT ,L enandA .64
.7-5S:)lppuS 6(92;9002 aniteR .noitareneged
ralucam detaler-ega ni ypareht noitanibmoc rof elanoitaR .FR ediapS .54
.07-538:)3(38;3002 veR loisyhP .senikotyc
dna srotcaf htworg yb gnilaeh dnuow fo noitalugeR .R esorG ,S renreW .44
.35-6302:)6(861;6002
lohtaP J mA .noitaziralucsavoen raluco fo sledom elpitlum
ni ypareht rotcaf htworg lailehtodne ralucsav-itna fo ycaciffe
eht secnahne gnilangis B rotcaf htworg devired-teletalp fo noitibihnI
.la te ,K amijihsiN ,J yeldarB ,E gnuehC ,M uJ ,C sohliaM ,N oJ .34
92
02-81S:)lppuS 6(92;9002 aniteR .sutats tnerruc
:seipareht citatsoigna noitanibmoC .M yawnoC ,R allecsiF ,AG namyeP .55
.6 9
-881:)3(5;5002 recnaC latceroloC nilC .recnac latceroloc gnidulcni
,sromut dilos yrotcarfer htiw stneitap ni nitalpilaxo htiw noitanibmoc
ni )6009-34 YAB( binefaros fo lairt I esahp a fo stluseR .la te
,AR regliH ,K nnameseiW ,H ylhciR ,K egrassaP ,FB gninneH ,P hcspuK .45
.04-334:)2(8;9002 rehT recnaC loM .binefaros rotibihni esanikitlum
eht yb sesnopser llec-T fo tnemriapmi tnednepedni-KPAM
.D amarhcS ,CJ rekceB ,V retsiemfoH ,C ekleoN ,H tgioV ,R nebuoH .35
.003-3924:)62(42;6002 locnO nilC J .amonicrac ralullecotapeh
decnavda htiw stneitap ni binefaros fo yduts II esahP .la
te ,A regiF ,A orotnaS ,D irodamA ,S icciR ,L ztrawhcS ,KG aflA-uobA .25
.21-5052:)61(42;6002 locnO
nilC J .amonicrac llec laner citatsatem htiw stneitap ni binefaros
fo lairt noitaunitnocsid dezimodnar dellortnoc-obecalp II esahP .la
te ,LG rensoR ,BS eyaK ,TK ytrehalF ,MW reldatS ,T nesiE ,JM niataR .15
.43-521:)2(653;7002 deM
J lgnE N .amonicrac llec-laner llec-raelc decnavda ni binefaroS .la
te ,M slebeiS ,S draduO ,C kilyzczS ,MW reldatS ,T nesiE ,B reiducsE .05
.43-623:)5(89;6002 tsnI recnaC
ltaN J .stnatum TER cinegocno fo noitibihni 6009-34 YAB .la te ,MS
mlehliW ,G enocnorT ,G erotavlaS ,T adiuG ,S itnaganA ,F ongamolraC .94
03
sllec lortnoc detanimulli-non dna detaertnu htoB .sllec EPR ni noisserpxe
FGlP dna ,B-FGDP ,A-FGEV fo gniniats lacimehcotsihonummI .4 .giF
.noitanimulli fo emit :sixa
-Y .tamrof lamiced ni desserpxe ,ANRr s81 ot dezilamron ANRm FGlP ro
,BB-FGDP ,A-FGEV fo )RR( oitar evitaler :sixa-X .RCP-TR evitatitnauq yb
detagitsevni sa ,)snmuloc yarg thgil( Lm/gµ 1 ta binefaros htiw noitabucni
retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli retfa
sllec EPR yramirp fo noisserpxe ANRm FGlP dna ,BB-FGDP ,A-FGEV .3 .giF
.DS :srab rorrE .noitanimulli fo
nim 06 retfa binefaros htiw detabucni yllanoitidda erew sllec nehw decuder
yltnacifingis saw ytilibaiv ralullec ni esaerced ehT .)TTM( tset cirtemiroloc
a yb derusaem sa ,)nmuloc yarg thgil( Lm/gµ 1 fo noitartnecnoc
a ta binefaros htiw noitabucni retfa dna )nmuloc kcalb( thgil etihw
nialp htiw noitanimulli retfa sllec EPR namuh yramirp fo ytilibaiV .2 .giF
.slortnoc ot derapmoc
)gnitset elpitlum rof noitcerroc α htiw noxocliW( ytilibaiv ni noitcuder
tnacifingis on dewohs Lm/gm 5.21 ot pu fo snoitartnecnoc binefaroS
.MES gnitacidni srab rorre htiw etacilpirt ni demrofrep hcae ,stnemirepxe
eerht morf lavivrus llec lortnoc fo egatnecrep naem eht era nwohs stluser
ehT .slortnoc sa devres egassap emas eht fo sllec EPR detaertnU .)TTM(
tset cirtemiroloc a yb derusaem ,binefaros fo snoitartnecnoc suoirav
eht htiw tnemtaert retfa sllec EPR namuh yramirp fo ytilibaiV .1 .giF
sdnegeL erugiF
13
.DS ± snaem era seulav ataD .retilillim rep smargonan ni noitartnecnoc
sa desserpxe dna FGlP ro ,BB-FGDP ,A-FGEV fo evruc dradnats a ot
dezilamron saw eulav hcaE .)snmuloc yarg thgil( binefaros htiw tnemtaert
lanoitidda retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli
retfa sllec EPR detaertnu :ASILE yb detagitsevni sa ,FGlP dna ,BB-FGDP
,A-FGEV fo noiterces decudni-thgil no binefaros fo tceffe yrotibihnI .5 .giF
.slortnoc detanimulli-non sa devres taht sllec
esoht ot elbarapmoc saw hcihw ,FGlP dna ,B-FGDP ,A-FGEV fo gniniats
kaew a ylno dewohs noitanimulli retfa yltcerid dedda binefaros dah dna
detanimulli erew taht sllec EPR ,tsartnoc nI .desaercni yldekram saw FGlP
dna ,B-FGDP ,A-FGEV fo noisserpxe eht ,erusopxe thgil fo nim 06 retfA
.FGlP dna ,B-FGDP ,A-FGEV rof gniniats tniaf a ylno detneserp noitanimulli
on dah dna ,Lm/gµ 1 ,binefaros htiw detaert erew taht sllec dna
.slortnoc ot derapmoc
)gnitset elpitlum rof noitcerroc α htiw noxocliW( ytilibaiv ni noitcuder
tnacifingis on dewohs Lm/gm 5.21 ot pu fo snoitartnecnoc binefaroS
.MES gnitacidni srab rorre htiw etacilpirt ni demrofrep hcae ,stnemirepxe
eerht morf lavivrus llec lortnoc fo egatnecrep naem eht era nwohs
stluser ehT .slortnoc sa devres egassap emas eht fo sllec EPR detaertnU
.)TTM( tset cirtemiroloc a yb derusaem ,binefaros fo snoitartnecnoc
suoirav eht htiw tnemtaert retfa sllec EPR namuh yramirp fo ytilibaiV
:1 .giF
.DS :srab
rorrE .noitanimulli fo nim 06 retfa binefaros htiw detabucni yllanoitidda
erew sllec nehw decuder yltnacifingis saw ytilibaiv ralullec ni esaerced ehT
.)TTM( tset cirtemiroloc a yb derusaem sa ,)nmuloc yarg thgil( Lm/gµ 1 fo
noitartnecnoc a ta binefaros htiw noitabucni retfa dna )nmuloc kcalb( thgil
etihw nialp htiw noitanimulli retfa sllec EPR namuh yramirp fo ytilibaiV
:.2 .giF
.noitanimulli fo emit
:sixa-Y .tamrof lamiced ni desserpxe ,ANRr s81 ot dezilamron ANRm FGlP
ro ,BB-FGDP ,A-FGEV fo )RR( oitar evitaler :sixa-X .RCP-TR evitatitnauq
yb detagitsevni sa ,)snmuloc yarg thgil( Lm/gµ 1 ta binefaros htiw
noitabucni retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli
retfa sllec EPR yramirp fo noisserpxe ANRm FGlP dna ,BB-FGDP ,A-FGEV
:3 .giF
.slortnoc detanimulli-non
sa devres taht sllec esoht ot elbarapmoc saw hcihw ,FGlP dna ,B-FGDP
,A-FGEV fo gniniats kaew a ylno dewohs noitanimulli retfa yltcerid dedda
binefaros dah dna detanimulli erew taht sllec EPR ,tsartnoc nI .desaercni
yldekram saw FGlP dna ,B-FGDP ,A-FGEV fo noisserpxe eht ,erusopxe
thgil fo nim 06 retfA .FGlP dna ,B-FGDP ,A-FGEV rof gniniats tniaf a ylno
detneserp noitanimulli on dah dna ,Lm/gµ 1 ,binefaros htiw detaert erew
taht sllec dna sllec lortnoc detanimulli-non dna detaertnu htoB .sllec EPR
ni noisserpxe FGlP dna ,B-FGDP ,A-FGEV fo gniniats lacimehcotsihonummI
:4 .giF
.DS ± snaem
era seulav ataD .retilillim rep smargonan ni noitartnecnoc sa desserpxe
dna FGlP ro ,BB-FGDP ,A-FGEV fo evruc dradnats a ot dezilamron
saw eulav hcaE .)snmuloc yarg thgil( binefaros htiw tnemtaert lanoitidda
retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli retfa
sllec EPR detaertnu :dohtem ASILE na yb detagitsevni sa ,FGlP dna ,BB
-FGDP ,A-FGEV fo noiterces decudni-thgil no binefaros fo tceffe yrotibihnI
:5 .giF
:1 elbaT
RCP-TR rof desu sremirP
Target Length Position AT (°C) % GC Sequence
VEGF-A 18 1540-1557 60 56 tgcccgctgctgtctaat
18 1592-1609 60 61 tctccgctctgagcaagg
PlGF 18 335-352 60 61 ggctgttcccttgcttcc
18 395-412 59 61 cagacaaggcccactgct
PDGF-BB 18 1108-1125 60 56 tgatctccaacgcctgct
20 1156-1175 59 50 tcatgttcaggtccaactcg