Embed
Email

Sorafenib Prevents Human Retinal Pigment Epithelium Cells from ...

Document Sample

Shared by: xiuliliaofz
Categories
Tags
Stats
views:
2
posted:
12/4/2011
language:
Lithuanian
pages:
39
1

)fdp.ecnecil/arofi/moc.jmb.ojb//:ptth( ecnecil OJB ni tuo tes sa ,sthgir

yraidisbus lla tiolpxe dna esu hcus secnecilbus dna stcudorp LGPJMB

rehto yna dna OJB ni dehsilbup eb ot )detpecca fi( elcitra siht timrep ot

dtL puorG gnihsilbuP JMB eht ot sisab ediwdlrow a no ecnecil evisulcxe na

,srohtua lla fo flaheb no tnarg seod dna srohtua lla fo flaheb no tnarg ot

thgir eht sah )M tnreK( rohtuA gnidnopserroC ehT :noitacilbuP rof ecneciL

.yduts siht ni desu sdohtem dna slairetam eht fo yna ni tseretni laicnanif

ro laicremmoc yna evah ton od srohtua ehT :serusolcsiD laicnaniF

enon :troppuS/gnidnuF

FGEV ,binefaros ,bamuzibinar

,FGlP ,FGDP ,srotibihni esanikitlum ,VNC ,bamuzicaveb ,DMA :sdroW yeK

1 :slebat fo rebmuN

5 :serugif fo rebmuN

3922 :tnuoc droW

ed.nehcneum-inu.dem@tnrek.sucram :liam-E

0615-0615-98-94+ :xaF

1183-0615-98-94+ :enohP

ynamreG ,hcinuM 63308

8 tS nedlihtaM

ytisrevinU-snailimixaM-giwduL

ygolomlahthpO fo tnemtrapeD

DM ,tnreK sucraM :ot ecnednopserroC

rohtua gnidnopserroC 2

ynamreG

,hcinuM ,ytisrevinU nailimixaM giwduL ,ygolomlahthpO fo tnemtrapeD 1

1

kipmaK .A , giblU .W .M , floW

1 1

.A , eglA .S .C , ssienriH .C , lgeiL .G .R , reuabueN .S .A , tnreK .M

1 1 1 1 2,1

FGlP dna ,FGDP ,FGEV fo noisserpxerevO decudnI-thgiL

morf slleC muilehtipE tnemgiP laniteR namuH stneverP binefaroS

2

.DMA rof tnemtaert cinegoignaitna laitnetop a

sa seitreporp gnisimorp sah binefaros taht wohs stluser ehT :noisulcnoC

.Lm/gµ 1 fo esod

a ta binefaros htiw detaert erew sllec nehw decuder yltnacifingis erew

stceffe decudni-thgil esehT .FGlP dna ,BB-FGDP ,A-FGEV fo noiterces dna

noisserpxe desaercni dna ytilibaiv llec desaerced erusopxe thgiL :stluseR

.syassa tnebrosonummi deknil-emyzne

dna ,yrtsimehcotsihonummi ,snoitcaer niahc esaremylop-noitpircsnart

esrever yb denimreted erew ANRm rieht dna FGlP dna ,BB-FGDP

,A-FGEV fo noiterces dna ,noisserpxe ,ytilibaiV .binefaros htiw detabucni

dna thgil etihw ot desopxe erew sllec EPR namuh yramirP :sdohteM

.sllec )EPR( lailehtipe tnemgip laniter namuh ni

srotcaf htworg fo noisserpxerevo decudni-thgil no binefaros fo stceffe eht

setagitsevni yduts sihT .DMA evitaduxe no stceffe laicifeneb evah thgim

,rotibihni esanikitlum laro na ,binefaros taht etacidni stroper suoiverP

.DMA fo tnempoleved no tcapmi laitnatsbus a evah ,)FGlP( rotcaf htworg

atnecalp dna )FGDP( rotcaf htworg devired-teletalp sa hcus ,srotcaf

htworg rehto ,revewoH .DMA ni seigetarts tnemtaert cinegoignaitna

tnerruc fo tegrat niam eht si )FGEV( rotcaf htworg lailehtodne ralucsav

fo noitibihnI .)DMA( noitareneged ralucam detaler-ega fo noissergorp

htiw detaicossa yltnacifingis si erusopxe thgil evitalumuC :dnuorgkcaB

tcartsbA

3

suounitnoc tuohtiw dna enola noitibihni FGEV htiw sserger ton seod

yllacipyt eussit ralucsavoen eht ,ytiuca lausiv ni tnemevorpmi na etipsed

taht delaever slairt dezimodnar evitcepsorp rojam ,revewoH . evitceffe

21-01

dna efas si srotibihni FGEV htiw DMA fo tnemtaert taht detartsnomed

evah seidutS . rotpecer sti ot ssecca gnitneverp ybereht dna ecaps

9

ralullecartxe eht ni FGEV gnikcolb si )bamuzibinar dna bamuzicaveb ,.g.e(

srotibihni FGEV eseht fo noitca fo msinahcem ehT . DMA fo tnemtaert

8

eht ni stnega cinegoignaitna desu yltnerruc eht fo tegrat niam eht

si FGEV fo noitibihni ,eroferehT . VNC fo tnempoleved eht ni tneve lacitirc

7

rojam a si )FGEV( rotcaf htworg lailehtodne ralucsav fo noitaluger-pU

. evird dna ,secaf ezingocer ,daer ot ytiliba eht fo ssol elbisreverri

6 5

ot dael nac DMA ,tnemtaert tuohtiW . esaesid siht gniylrednu ssecorp

6 5

cigoloisyhpohtap latnemadnuf eht si dna ytiuca lausiv noituloser-hgih dna

noisiv lartnec fo ssol tnacifingis ni stluser netfo noiger ralucam eht ni VNC

. erusopxe thgilnus dna ,teid ,sciteneg ,noisnetrepyh

4-1

,gnikoms ,redneg ,yticinhte gnidulcni ,noissergorp dna tnempoleved

rof srotcaf ksir lareves htiw esaesid lairotcafitlum a si DMA . noisiv fo ssol

1

dipar a ot sdael netfo taht )VNC( noitaziralucsavoen ladiorohc ot eud DMA

fo smrof ”tew“ poleved stneitap fo %01 ,esaesid eht fo noissergorp htiW

. )EPR( muilehtipe tnemgip laniter eht ni segnahc cihporta dna nesurd fo

1

noitamrof eht yb deziretcarahc era esaesid siht fo segats ylraE . seirtnuoc

1

depoleved ni 06 ega revo elpoep ni ssendnilb lagel dna noitaroireted lausiv

fo esuac gnidael a si )DMA( noitareneged ralucam detaler-ega evitaduxE

noitcudortnI

4

sdohteM

.denimreted saw FGlP dna ,BB

-FGDP ,A-FGEV fo noisserpxE .detagitsevni erew erusopxe thgil retfa sllec

eht fo ytilibaiv no stceffe s’gurd eht dna binefaros htiw detaert erew slleC

.)mn 007-004 egnar lartceps( thgil etihw dnab-ediw ot sllec EPR namuh

yramirp desopxe ew ,eroferehT . DMA fo noissergorp dna tnempoleved

1

eht ni elor yek a syalp hcihw ,EPR eht ni noisserpxe rotcaf htworg decudni

-thgil no binefaros fo tceffe eht etagitsevni ot dengised saw yduts sihT

. DMA evitaduxe no tceffe laicifeneb a evah thgim ,sgurd citatsoigna

91 81

rehto htiw noitanibmoc ni ro enola ,binefaros taht etacidni stroper

esac suoiverP . recnac fo smrof lareves fo tnemtaert eht rof devorppa

71

,rotibihni esanikitlum laro na si )6009-34 YAB ,ravaxeN( binefaroS

.syawhtap evitanretla

fo esaercni yrotalumits ni esaercni yrotasnepmoc a ecudni dluoc

elucelom elgnis a fo noitibihni ,noitidda nI .eussit ralucsavoen no tceffe

detimil ylno evah thgim enola ecaps ralullecartxe eht ni FGEV gnidnib dna

evitca niamer syawhtap ralucelom rehto taht eb dluoc siht rof nosaer ehT

. DMA fo noissergorp dna tnempoleved eht ni elor laicurc a yalp dna

61-31

esaesid laniter evitarefilorp ni saniter dna suoertiv eht ni desserpxerevo

era ,)FGlP( rotcaf htworg atnecalp dna )FGDP( rotcaf htworg

devired-teletalp gnidulcni ,srotcaf htworg cinegoigna lareves taht detacidni

seiduts suoiverP .syawhtap tnadnuder ot eud eb thgim tceffe deniatsus

fo kcal siht rof nosaer ehT . 11 01

srucco noissergorp-er netfo tnemtaert

5

fo stceffe eht etagitsevni oT .32-12

DMA fo noissergorp dna tnempoleved

eht ni elor niatrec a yalp ot detacilpmi neeb sah tI .rezitisnesotohp a

sa tca ot nwonk si nicsufopil dna oviv ni sllec EPR gniega fo citsiretcarahc

nommoc a si nicsufopil fo noitalumucca desaercni nA .muidem

erutluc llec eht sa desu saw )ynamreG ,nilreB ,morhcoiB ;SCF( mures

flac latef %01 htiw detnemelppus )ynamreG ,nilreB ,morhcoiB ;MEMD(

muidem elgaE deifidom occebluD . debircsed ylsuoiverp sa deraperp

02

erew dna ytisrevinU nailimixaM giwduL fo knaB eyE eht morf deniatbo

erew esaesid eye fo yrotsih yna tuohtiw )metromtsop h 01-3 deniatbo

,dlo sraey 47 dna ,65 ,25 ,84( sronod namuh ruof morf sllec EPR yramirP

erutluC lleC EPR namuH

.eettimmoc scihte lacol eht yb devorppa

erew dna ,iknisleH fo noitaralceD eht htiw deilpmoc ,lavorppa dna tnesnoc

reporp dedulcni ,enamuh erew eussit namuh gniruces fo sdohtem ehT

scihtE

.lortnoc tnevlos a sa )v/v( %1.0 ta serutluc

ot dedda saw OSMD .seiduts ortiv ni rof %1.0 fo noitartnecnoc OSMD lanif

a htiw noitartnecnoc derised eht ot muidem erutluc llec eht dna OSMD

htiw detulid dna )OM ,siuoL .tS ,amgiS ;OSMD( edixoflus lyhtemid %001

ni devlossid saw )]aeru)lynehpyxo)ly-4-nidiryp lyomabraclyhtem-2(-4(-N

-)lynehporolhc-4-lyhtemoroulfirt-3(-N[ 6009-34 YAB ,ravaxeN( binefaroS

slairetaM

6

saw SBP ,noitanimulli retfa yltceriD .)scinotohP ustamamaH ;DM38001C(

retemortceps a htiw derusaem erew egnar lartceps dna rewop noitanimulli

ehT .nim 06 rof ) mc/Wm 003( detanimulli erew yehT .evoba morf

2

detanimulli erew sllec eht dna ,devomer saw llew erutluc llec detanimulli

eht fo revoc citsalp ehT .noitanimulli erofeb tsuj SBP htiw decalper saw

muidem erutluc llec ehT .noitanimulli rof desu saw )mn 007-004 :egnar

lartceps( ediug thgil eht sa rebif citpo na htiw deppiuqe pmal nonex

-yrucrem a morf )napaJ ,scinotohP ustamamaH ;8-CL( ecruos thgil-tops A

slleC fo noitanimullI

.Lm/gµ 1 fo noitartnecnoc lanif a htiw dedda saw binefaros dna muidem

erutluc llec eerf-mures htiw decalper saw SBP ,noitanimulli retfa yltceriD

.nim 06 rof detanimulli erew yeht ,)SBP( enilas dereffub-etahpsohp

htiw dehsaw erew sllec eht retfA .snoitidnoc eerf-mures ni h 42 rof

tpek erew sllec EPR .ssenkrad ni ecneulfnoc no derutluc dna sehsid erutluc

eussit mm-53 ni dedees erew sllec EPR ,stnemirepxe erutluc llec lla roF

tnemtaerT erutluC lleC

.

62-42

sdoirep mret-gnol rof derutluc

era sllec EPR nehw sraeppasid citsiretcarahc sihT .nicsufopil fo tnuoma

niatrec a ,stnemgip rehto dna ninalem sediseb ,niatnoc selunarg esehT

.ypocsorcim tsartnoc-esahp ni selunarg detnemgip ralullecartni detneserp

serutluc llec EPR detagitsevni llA .stnemirepxe ruo rof 3 dna 2 segassap

fo sllec EPR yramirp desu ew ,noisserpxe rotcaf htworg sEPR no thgil etihw

7

42 rehtona rof Lm/gµ 05 dna ,52 ,51 ,5.21 ,01 ,5.7 ,5 ,5.2 ,52.1 ,1 ,5.0 fo

snoitartnecnoc binefaros htiw detaert erew neht dna ,h 42 rof snoitidnoc

eerf-mures rednu tpek ,ecneulfnoc ot thguorb erew sllec ,ytilibaiv

llec EPR no snoitartnecnoc binefaros tnereffid fo stceffe eht etagitsevni oT

.lortnoc

eht ni noitarefilorp fo egatnecrep naem eht sa desserpxe erew stluser

ehT .)seborP raluceloM( mn 055 ta retemotohportceps llewitlum gninnacs

a yb derusaem saw noitprosbA .llew rep OSMD Lm 0001 fo noitidda

eht yb devlossid erew demrof taht slatsyrc nazamrof ehT .h 1 rof C°73

ta detabucni erew sllec EPR .llew hcae ot dedda saw )MEM Lm 5.82 sulp

,SBP ni Lm/gm 2 ,kcots TTM Lm 5.1( noitulos TTM fo Lm 0001 dna ;SBP

htiw dehsaw erew sllec eht ;devomer saw muidem ehT .snoitacifidom

emos htiw ,nnamsoM yb debircsed sa demrofrep saw ,ytilibaiv

72

llec fo tnemssessa eht rof dehsilbatse-llew si hcihw ,tset TTM ehT .etar

lavivrus llec eht enimreted ot desu saw )edimorb muilozartet lynehpid-5,2

-]ly-2-lozaihtlyhtemid-5,4[-3 ;TTM( yassa noitcuder–eyd muilozartet ehT

yassA TTM

.demrofrep erew noitalosi ANR dna ,ypocsorcim tsartnoc-esahp

,ypocsorcim ecnecseroulfipe ,stnanrepus erutluc llec ni snoitartnecnoc

rotcaf htworg fo noitceted rof )ASILE( yassa tnebrosonummi

deknil-emyzne ,yassa )TTM( elozartetoihtlyhtem eht ,nehT .h 42 rehtona

rof ssenkrad ni tpek erew sllec eht dna ,Lm/gµ 1 fo noitartnecnoc lanif

a htiw dedda saw binefaros ,muidem erutluc llec eerf-mures yb decalper

8

eht retfA .ANRm fo stnuoma llams fo noitceted evitatitnauq selbane )RCP(

noitcaer niahc esaremylop emit-laeR .)ynamreG ,grubmaH ,frodneppE

;retemotohPoiB( yllacirtemotohp denimreted erew ytirup dna dleiy

ehT .sleg esoraga ATDE-etateca-sirT %1 ni siserohportcele yb demrifnoc

saw selpmas ANR eht fo ytirgetni larutcurts ehT .)ynamreG ,grebledieH

,enegatartS( dohtem noitcartxe mroforolhc-lonehp-etanaycoiht

muidinaug eht yb sehsid irteP mc-01 morf detalosi saw ANR latoT

RCP emiT-laeR dna noitalosI ANR

.snoitcurtsni s’rerutcafunam eht ot

gnidrocca )smetsyS D & R( tiK yassA ASILE enikitnauQ FGlP ro ,BB-FGDP

,A-FGEV a gnisu deifitnauq erew FGlP dna ,BB-FGDP ,A-FGEV fo slevel

eht dna ,h 42 retfa detcelloc erew stnatanrepus ehT .ASILE yb denimreted

erew stnatanrepus erutluc eht ni FGlP dna ,BB-FGDP ,A-FGEV fo sleveL

.debircsed sa detaert dna ecneulfnoc ot nworg erew serutluc llec EPR

slleC EPR yb noiterceS FGlP dna ,BB-FGDP ,A-FGEV fo noitceteD

.noitaidar yna ot erusopxe tuohtiw ,ssenkrad

ni tpek erew yeht ;egassap emas eht fo sllec EPR erew sllec lortnoc ehT

.semit eerht detaeper dna etacilpirt ni demrofrep erew stnemirepxe ehT

.demrofrep saw

yassa TTM eht noitanimulli retfa h 42 tA .evoba debircsed sa detaert dna

detanimulli erew sllec ,erusopxe thgil retfa ytilibaiv llec EPR no binefaros

fo stceffe eht etagitsevni oT .demrofrep saw yassa TTM eht nehT .h

9

desu erew selcyc eseht dna ,selcyc tnereffid ni desaercni ytisnetni langis

eht ,seneg tegrat fo noitartnecnoc laitini eht no gnidnepeD .pets noisnetxe

eht gnirud decalpsid erew seborp noitazidirbyH .tnemurtsni relcyCthgiL

eht yb derusaem neht saw ecnecseroulf dettime ehT .serohporoulf owt

eht neewteb depoleved )TERF( refsnart ygrene ecnanoser ecnecseroulf

,ytimixorp esolc ni emac seborp owt eht nehW .esahp gnilaenna

eht gnirud tnemgarf deifilpma eht ot dezidirbyh erew serohporoulf

delebal tnereffid htiw seditoelcunogilo owT .selcyc 04 rof sremirp cificeps

htiw deifilpma saw ,thgil ot desopxe neht dna detaertnu ro binefaros htiw

noitabucni retfa rehtie ,sllec EPR fo ANDc ehT .RCP fo esahp noitacifilpma

laitnenopxe eht gnirud ylisae slangis tceles nac metsys eht esuaceb

,etalpmet ANR laitini eht fo stnuoma eht fo noitacifitnauq etarucca

dewolla hcihw ,emit laer ni detceted erew slangis noitacifilpma ehT

.ANDc Lµ 2 dna ,eborp naMqaT Mm 2.0 ,remirp hcae

2

fo Mm 5.0 , lCgM Mm 4 ,)scitsongaiD ehcoR( xiM seborP noitazidirbyH

retsaM AND tratStsaF ×1 deniatnoc emulov noitcaer Lµ-41 hcaE .ytidilav

tcudorp erusne ot decneuqes erew stcudorp RCP llA .AND cimoneg

fo noitacifilpma diova ot seiradnuob noxe/nortni ssorc ot dengised erew

seborp dna sremirp llA .40.2 redniFeborP htiw detceted erew seborp dna

sremirP .)ynamreG ,miehnnaM ,scitsongaiD ehcoR ;metsyS relcyCthgiL(

tnemurtsni relcyCthgiL a htiw sremirp cificeps htiw demrofrep saw

ANRm FGlP dna ,BB-FGDP ,A-FGEV fo noitacifitnauQ .RCP cificeps eht rof

desu neht saw ANDc sihT .)TR( esatpircsnart esrever hguorht )ANDc( AND

yratnemelpmoc ot derrefsnart saw ANRm siht ,ANRm fo noitalosi lausu

01

yllej enirecylg s'resiaK htiw detnuom dna ,SBP ni desnir ,erutarepmet

moor ta h 1 rof )ygolonhcetoiB zurC atnaS ;SBP ni 005:1 detulid(

ydobitna yradnoces taog-itna tibbar detagujnoc-niecseroulf a ro ydobitna

yradnoces esuom-itna tibbar detagujnoc-der saxeT a htiw dessecorp

rehtruf erew snoitces dna sehsid erutluc eht ,semit eerht gnihsaw retfA

.erutarepmet moor ta h 4 rof SBP ni 002:1 detulid ,)ygolonhcetoiB zurC

atnaS( ydobitna FGlP namuh-itna taog a dna ,)ygolonhcetoiB zurC atnaS(

ydobitna B-FGDP namuh-itna esuom a ,)AC ,zurC atnaS ,ygolonhcetoiB

zurC atnaS( ydobitna A-FGEV namuh-itna esuom a htiw demrofrep saw

selpmas lla fo noitabucni yramirP .001-X notirT %1.0 gniniatnoc SBP htiw

eciwt dehsaw yltneuqesbus dna nim 51 rof )AFP( dica cimrofonohpsohp

%4 htiw dexif erew sllec ,noitabucni retfA .evoba debircsed

sa detaert dna sedils epocsorcim no nworg erew sllec EPR derutluC

serutluC lleC EPR fo yrtsimehcotsihonummI

.RCP-TR rof desu sremirp eht stsil

1 elbaT .semit eerht detaeper dna etacilpirt ni tsael ta demrofrep erew

stnemirepxe llA .slamiced sa desserpxe era soitar ehT .selpmas emas eht

ni eneg gnipeekesuoh ANRr S81 eht fo level eht yb ANRm FGlP dna ,BB

-FGDP ,A-FGEV fo level eht gnidivid yb detaluclac saw hcihw ,)RR( oitar

evitaler eht sa denimreted saw ANRm FGlP dna ,BB-FGDP ,A-FGEV fo level

ehT .lortnoc lanretni na sa elpmas emas eht ni dessecorp ylsuoenatlumis

saw ANRr S81 ,noitcaer hcae ot dedda ANR latot fo tnuoma

eht ni secnereffid fo noitazilamron roF .sllec EPR detaertnu fo seborp

tnereffid eerht htiw edam saw evruc dradnats ehT .tniop gnissorc eht sa

11

ni detnuoc sllec fo rebmun ehT .tnemtaert h 42 retfa sllec EPR yramirp

ni binefaros Lm/gµ 5.21 fo noitartnecnoc a ot pu ypocsorcim tsartnoc

-esahp htiw detceted erew ,seitilamronba rehto ro ,htaed ralullec ,sisyl

ralullec ,ecnaraeppa dna epahs lamronba sa hcus ,seitilamronba ssorg oN

sllec EPR yramirp ni binefaros fo snoitartnecnoc gnitseT

slleC fo ytilibaiV

stluseR

.semit eerht detaeper dna

etacilpirt ni tsael ta demrofrep erew stnemirepxe lla ;deilppa saw gnitset

yentihW-nnaM ,niagA .ANRr S81 dna ANRm detagitsevni eht fo soitar )DS(

naem sa detneserp era RCP-TR eht fo stluseR .lortnoc eht ot dezilamron

erew hcihw ,eborp detset hcae fo soitar )DS( naem sa detneserp era

ASILE FGlP dna ,BB-FGDP ,A-FGEV morf stluseR .desu saw tset yentihW

-nnaM ehT .etacilpirt ni derusaem erew puorg rep selpmas laudividni

neT .ecnabrosba fo stinu )DS( naem sa detneserp era yassa TTM eht fo

stluseR .tnacifingis deredisnoc saw 50.0 llits tub ,ytilibaiv llec fo noitcuder gnisaercni

na dewohs Lm/gµ 52 dna 51 neewteb binefaros fo snoitartnecnoC

.lortnoc eht htiw derapmoc sllec EPR htiw detceted saw ytilibaiv ralullec

ni )gnitset elpitlum rof noitcerroc α htiw noxocliW( esaerced tnacifingis oN

.Lm/gµ 5.21 dna 5.0 neewteb snoitartnecnoc ta )erusopxe h-42( serutluc

llec EPR detagitsevni eht ni stceffe cixot tnacifingis on dewohs binefaroS

yassa TTM

.tset TTM eht

fo stluser evitatitnauq eht htiw llew detalerroc ypocsorcim tsartnoc-esahp

31

-FGDP ,A-FGEV fo noitceted evitatitnauq a ,erusopxe thgil retfa noiterces

FGlP dna ,BB-FGDP ,A-FGEV no binefaros fo tceffe eht etagitsevni oT

slleC

EPR namuH fo noiterceS FGlP dna ,B-FGDP ,A-FGEV fo noitceteD

.)4 .giF( slortnoc detanimulli-non sa devres taht sllec esoht ot elbarapmoc

saw hcihw ,FGlP dna ,B-FGDP ,A-FGEV fo noisserpxe kaew a ylno dewohs

gniniats ,noitanimulli retfa yltcerid dedda Lm/gµ 1 fo esod a ta binefaros

dah dna nim 06 rof detanimulli erew taht sllec EPR rof ,tsartnoc nI

.desaercni yldekram

saw FGlP dna ,B-FGDP ,A-FGEV fo noisserpxe eht ,erusopxe thgil fo nim

06 retfA .)4 .giF( devresbo saw FGlP dna ,B-FGDP ,A-FGEV rof gniniats

tniaf a ylno ,noitanimulli on dah dna ,Lm/gµ 1 ,binefaros htiw detaert

erew taht sllec dna sllec lortnoc detanimulli-non dna detaertnu htob nI

.noitanimulli retfa h 42 demrofrep saw yrtsimehcotsihonummi

,sisehtnys nietorp desaercni otni setalsnart noitpircsnart ANRm FGlP

dna ,B-FGDP ,A-FGEV fo esaercni decudni-thgil eht taht noitacifirev roF

slleC EPR ni noisserpxE

FGlP dna ,B-FGDP ,A-FGEV fo noitceteD lacimehcotsihonummI

.)3 .giF( h 42 retfa ANRm FGlP dna ,BB-FGDP ,A-FGEV ni esaercni

decudni-thgil siht decuder yltnacifingis erusopxe thgil retfa yltcerid ,Lm/gµ

1 ,binefaros htiw sllec EPR fo tnemtaerT .)3 .giF( sllec EPR ni noisserpxe

ANRm FGlP dna ,B-FGDP ,A-FGEV ni esaercni tnacifingis a ot del nim 06

41

thgim enarbmem s’hcurB ni nesurd fo noitamrof eht ,eromrehtruF

.

03-82

egamad noitaidar ot ytivitisnes rehgih a ni gnitluser yllaitnetop

22

noitcnuf ralullec ni noitaroireted htiw detaicossa eb ot smees noitalumucca

nicsufopil sihT .emit revo sllec EPR eht ni nicsufopil ralullecartni ni

esaercni suounitnoc a ni stluser senarbmem rotpecerotohp dezitycogahp

fo noitadarged etelpmocni ehT . senarbmem enoc dna dor dezitycogahp

12 1

fo noitadarged etelpmocni fo stnanmer morf sirbed cilobatem

etalumucca dna msihpromoelp ni esaercni na ogrednu sllec EPR ,ega

gnicnavda htiW . esaesid siht rof cinomongohtap si ,retnec ralucam

12 1

eht ni ylralucitrap ,sllec EPR fo noitareneged dna ssoL . noitalupop ylredle

1

eht fo esaesid a si DMA . ytirgetni rotpecerotohp enoc dna dor ni elor

1

rojam a syalp dna srotpecerotohp fo lawener eht rof laitnesse si ti metsys

citycogahp a sA .aniter retuo eht dna slessev doolb ladiorohc eht neewteb

tropsnart evitceles etatilicaf ot reirrab aniter–doolb retuo eht smrof EPR

noissucsiD

.)5 .giF( noitanimulli

retfa binefaros htiw detaert ton erew taht sllec esoht ot derapmoc

yltnacifingis FGlP dna ,BB-FGDP ,A-FGEV fo tnuoma eht desaerced

tnemtaert binefaros ,erusopxe thgil retfa yltcerid ,Lm/gµ 1 ,binefaros htiw

detaert erew sllec nehw ,tsartnoc nI .erusopxe thgil fo nim 06 retfa sllec

EPR derutluc ni FGlP dna ,BB-FGDP ,A-FGEV fo esaercni tnacifingis a ot del

erusopxe thgil ,pu-tes latnemirepxe ruo nI .noitanimulli retfa h 42 dohtem

ASILE eht gnisu detcudnoc saw stnanrepus erutluc llec ni FGlP dna ,BB

51

,eroferehT . 93 83

stcejbus lortnoc yhtlaeh ot derapmoc ,VNC dna DMA htiw

stneitap ni rehgih yltnacifingis era slevel A-FGEV suoertiv dna ,desaercni

yltnacifingis si A-FGEV DMA htiw stneitap fo noiger ralucam eht fo tuo

sllec EPR nI . ytilibaemrep ralucsav desaercni fo noitcudni eht si

61 51 7 6 1

A-FGEV fo elor tnatropmi yradnoces A . DMA ni sisenegoigna cigolohtap

7 1

fo tnempoleved eht ni elor tnanimoderp a htiw nietorp detalysocylg

aDk-64–63 ciremid a si ,ylimaf FGEV eht fo rebmem a ,A-FGEV

.sllec EPR namuh

yramirp ni FGlP dna BB-FGDP fo noiterces dna noisserpxe desaercni

na ot osla tub A-FGEV fo noitaluger-pu na ot sdael ylno ton erusopxe

thgil taht etacidni ylraelc stluser ruo ,sgnidnif eseht htiw ecnadrocca nI

. noiterces A-FGEV cinegoignaorp fo noitaluger-pu na ni stluser hcihw

63

,sserts ralullec lahtelbus secudni erusopxe thgil suounitnoc taht eb dluoc

siht rof nosaer ehT . sllec EPR ni A-FGEV fo noitcudorp desaercni

73 63 02

na ot dael nac erusopxe thgil taht detartsnomed evah seiduts suoiverP

.

53 61

DMA evitaduxe fo tnempoleved eht etomorp ot dna sllec EPR

ni srotcaf cinegoignaorp ecudni ot thguoht si erusopxe thgil evitalumuC

. VNC dna slessev

43

doolb lanoitcnufsyd fo noitamrof eht ni gnitluser sisenegoigna tnarreba

ot sdael yllaitnetop eye eht ni srotcaf htworg eseht neewteb ecnalabmi

nA . srehto dna ,FGlP ,FGDP ,FGEV sa hcus ,srotcaf htworg fo stnuoma

61-31

etauqedani eterces sllec EPR ,degamad ecnO . VNC dna DMA fo

33-13

tnempoleved eht ni detacilpmi neeb evah hcihw ,sesnopser yrotammalfni

gnicudni dna tropsnart diulf gnidepmi yb noitcnuf llec EPR esimorpmoc

61

. VNC ni esnopser

44 34 51

gnilaeh dnuow a sa aisalporbif ni elor tnatropmi na evah ot thguoht

si FGDP ,noitidda nI . 34-14

stnega FGEV-itna fo noitartenep eht timil

51

ot thguoht era dna slessev fo noitazilibats gnidivorp ,xelpmoc ralucsavoen

ladiorohc eht fo tnenopmoc tnatropmi na era setycireP . VN C 34-14 51

fo tnempoleved eht ni setycirep tiurcer ot nwonk dna dnob lailehtodne

etycirep eht fo rotaluger yek eht si BB-FGDP .setycirep laniter rof rotcaf

lavivrus a sa stca ,EPR eht yb desserpxe rotcaf htworg rehtona ,BB-FGDP

. seirallipac gnituorps fo

14 04 61

trap largetni na sa tca srotcaf htworg htob erehw ,sisenegoigna fo esahp

ylrae eht ni llew sa tub ,sebut lailehtodne fo ssecorp noitarutam eht ni

rehtie ,sisenegoigna gnirud setycirep no tceffe gnitiurcer a evah FGlP dna

A-FGEV htoB . VNC fo tnempoleved eht ni A-FGEV htiw yllacitsigrenys

61 51

tca yam dna sisenegoigna dna ,sixatomehc ,noitarefilorp ,ytilibaemrep

ralucsav desaercni secudni ,ylimaf FGEV eht fo rebmem a ,FGlP

. xirtam ralullecartxe tnecsan eht fo gniledomer eht

61 51

dna ,EPR eht fo egamad ,stsalborbif ot detaler era VNC htiw detaicossa

seitilamronba larutcurts eht fo ynam tub ,slessev ot detaler era VNC fo

setubirtta lla ton ,noitidda nI . seirallipac gnitsixe no tceffe elttil evah

61 51

ot mees stnega FGEV-itna desu yltnerruc dna enola noitibihni A-FGEV

ot dnopser ot ton mees eussit ralucsavoen fo erutcurts eht mrof taht

setycirep dna sllec lailehtodne ,revewoH . DMA fo tnemtaert eht ni stnega

8

cinegoignaitna desu yltnerruc eht fo tegrat niam eht emoceb sah A-FGEV

71

serefretni osla tub ,noitaluger rotcaf htworg htiw tcaretni ylno ton seod

binefaros taht eb thgim siht rof nosaer laitnetop enO .ytilibaiv llec EPR

ni esaerced decudni-thgil fo tnemevorpmi tnacifingis a yb deinapmocca

saw noisserpxerevo rotcaf htworg decudni-thgil fo noitaunetta

siht ,revoeroM .sllec EPR namuh yramirp ni FGDP dna ,FGlP ,FGEV

fo noiterces dna noisserpxe ni esaercni decudni-thgil eht fo noitcuder

tnacifingis a ot del Lm/gµ 1 fo noitartnecnoc a ta binefaros ,yduts siht nI

. FGDP dna FGEV sa hcus ,srotcaf htworg

84-64 71

fo noisserpxe no ecneulfni na evah ot smees dna 2 dna 1 srotcaf elbicudni

-aixopyh htiw stcaretni binefaros ,eromrehtruF . tiK-c dna ,teR ,3TLF

94-64 71

,rotpecer FGDP ,3RFGEV ,)2RFGEV( 2 rotpecer FGEV gnidulcni ,sesanik

enisoryt rotpecer no tceffe sti dna edacsac )KRE/KEM/FAR( KRE/)KEM(

esanik )KRE( esanik detaluger-langis ralullecartxe/)PAM( nietorp detavitca

-negotim/FAR eht fo ytilibapac gnikcolb sti morf devired eb ot smees

ycaciffe cinegoignaitna dna evitarefilorpitna s’binefaroS .sisenegoigna

ni devlovni sesanik enisoryt rotpecer lareves stibihni osla ti tub ,rotibihni

esanik FAR na sa deifitnedi yllaitini saw binefaros rotibihni esanikitlum ehT

. elihwhtrow eb ot smees dna emoctuo ni stnemevorpmi

54

tnacifingis ot dael thgim DMA sa etats esaesid xelpmoc a ni syawhtap

ro selucelom yek lareves gnitegrat fo hcaorppa denibmoc a ,eroferehT

. enola tnemtaert FGEV-itna ot derapmoc VNC dna noitaziralucsavoen

34 24

laenroc fo noisserger dna noitibihni decudorp dna lavivrus llec lailehtodne

detaidem-etycirep htiw gnirefretni yb noisserger lessev secrofne

FGDP dna FGEV fo noitibihni denibmoc taht detartsnomed seiduts tneceR

81

.tnemtaert esod wol a htiw neve elbaveihca eb thgim ,stnemirepxe ruo ni

evitceffe Lm/gµ 1 fo noitartnecnoc binefaros eht ,revewoH .noitagitsevni

rehtruf sdeen eussi siht dna elbaliava ,noitacilppa cipot retfa ron ,cimetsys

retfa rehtien ,eussit raluco otni binefaros fo noitartenep eht gnidrager

atad on si ereht ,etad oT . dehcaer eb nac Lm/gµ5.4 dnuora yad rep

45-25

gm002 retfa ,Lm/gµ01 fo egnar eht nihtiw era slevel amsalp ,binefaros

gm008 fo esod yliad a retfa taht wonk ew slairt lacinilc lareves morF .yad

rep gm008 si CCR rof tnemtaert laro sa binefaros fo egasod dradnats ehT

.stnemirepxe

ruo ni evitceffe Lm/gµ 1 fo noitartnecnoc binefaros eht naht rehgih dlof

-01 naht erom si sihT .Lm/gµ 5.21 fo noitartnecnoc a ot pu erusopxe h-42

a retfa ytilibaiv llec EPR no ecneulfni tnacifingis a evah ton did binefaros

,pu-tes latnemirepxe ruo ni ,noitidda nI . erar era tub debircsed

15 05

neeb evah stneve esrevda ereveS .noisnetrepyh edarg-wol dna ,aehrraid

,snoitcaer niks toof–dnah ro hsar sa hcus smotpmys cigolotamred

erew )CCR( amonicrac llec laner rof detaert stneitap ni noitartsinimda

laro retfa stceffe edis nommoc tsom ehT . eliforp ytefas sti

05 11

ni snoitacidem FGEV-itna cimetsys ot elbarapmoc eb ot sraeppa binefaroS

.detnarraw si hcraeser rehtruF

.

84 71

ylimaf 2-lcB eht os rebmem gnidulcni ,sANRm fo rebmun egral

a fo noitalsnart eht etaluger ot nwonk si hcihw E4FIe rotcaf noitaitini eht

fo noitalyrohpsohp eht elpmaxe rof stibihni binefaros taht detartsnomed

neeb sah ti ,revewoh ,dootsrednu yletelpmoc ton era smsinahcem

tcaxe ehT .edacsac citotpopa cisnirtni eht nihtiw snietorp niatrec htiw

91

rotcaf htworg decudni-thgil ecuder ot seitreporp sedivorp binefaros taht

etacidni yduts ortiv ni siht ni detneserp atad eht ,revewoH .noitagitsevni

rehtruf deen DMA fo tnempoleved eht ni devlovni sepyt llec rehto dna

sesanik enisoryt rotpecer no stceffe lanoitidda stI .dootsrednu yletelpmoc

era gnilangis dna noisserpxe rotcaf htworg gnidrager binefaros fo

noitca fo smsinahcem fo stcepsa lla ton dna esaesid ralucsavoen laniter ni

gnitcaretni tnenopmoc eno ylno si EPR ehT .EPR namuh eht ni noisserpxe

rotcaf-htworg no tcapmi tnacifingis a dah binefaros yduts ortiv ni siht nI

. bamuzibinar laertivartni htiw

81

noitanibmoc ni ro enola tnemtaert binefaros esod-wol rednu ytiuca lausiv

ni tnemevorpmi ebircsed stroper rehtO . deliaf tnemtaert bamuzicaveb

91

laertivartni erehw ,CCR decnavda ot eud tnemtaert binefaros laro

rednu amede ralucam fo noituloser dna tnemevorpmi lausiv decneirepxe

ohw VNC tlucco htiw tneitap a tuoba detroper la te tnreK .tnemtaert

DMA ni binefaros fo stceffe laicifeneb detartsnomed evah stroper tneceR

. devired era yeht erehw morf eussit eht ni srotcaf htworg

55 71

fo noitcudorp nietorp dna noitpircsnart stneverp yllaitnetop erofereht

dna edacsac cinegoigna eht ni maertsnwod dna maertspu stca yllaitnetop

ecnatsbus eht taht eb thgim srotibihni FGEV ralullecartxe desu yltnerruc

eht ot binefaros neewteb ecnereffid laitnatsbus rehtonA . DMA rof

55

tnemtaert laitnetop a sa gnisimorp eb ot smees binefaros ,sisenegoigna ni

syawhtap dna stegrat elpitlum tsniaga ytivitca sti ot euD .FGDP dna ,FGlP

,FGEV :tnemtaert DMA fo stegrat tnatropmi eerht htiw sllec EPR namuh

ni stcaretni ylevitceffe binefaros taht ecnedive tsrif eht edivorp atad ruO

02

.DMA htiw stneitap rof tnemtaert evitcnujda gnisimorp a eb ot smees

binefaros ,sselehtreveN .sgnidnif ortiv ni ruo etaitnatsbus ot evah lliw

seiduts lacinilc dna latnemirepxe rehtruF .oviv ni VNC fo noissergorp dna

tnempoleved tneverp thgim ,erofereht ,dna EPR namuh ni noisserpxerevo

12

.ecnatsissa lacinhcet tnellecxe rof rezlohbO ajtaK knaht srohtua ehT

stnemgdelwonkcA

22

.16-75401:)32(29;5991

A S U icS dacA ltaN corP .snietorp ciremihc rotpecer

-FGEV elbulos gnisu )FGEV( rotcaf htworg lailehtodne ralucsav

fo noitibihni yb oviv ni noitaziralucsavoen laniter fo noisserppuS

.la te ,L elddiR ,H nehC ,H igakaT ,DE yeloF ,AE ecreiP ,PL olleiA .7

.71-6062:)42(853;8002 deM J lgnE

N .noitareneged ralucam detaler-egA .WJ relliM ,FW releiM ,DR regaJ .6

.29-384:)7(243;0002 deM J lgnE N .noitareneged

ralucam detaler-egA .CA oH ,GM eriugaM ,WJ regreB ,LS eniF .5

.7-057:)5(221;4002 lomlahthpO hcrA .ydutS eyE maD

revaeB eht :yhtapolucam detaler-ega fo ecnedicni raey-01 eht dna

thgilnuS .DM nostdunK ,EB nielK ,R nielK ,JK sknahskciurC ,CS ynamoT .4

.05-642:)2(911;1002 lomlahthpO hcrA .yduts eye

mad revaeb eht :yhtapolucam detaler-ega ylrae fo ecnedicni raey

-5 eht dna thgilnuS .MD lhadnoN ,EB nielK ,R nielK ,JK sknahskciurC .3

.8-415:)4(111;3991

lomlahthpO hcrA .ydutS eyE maD revaeB ehT .noitareneged

ralucam detaler-ega dna thgilnuS .EB nielK ,R nielK ,JK sknahskciurC .2

.28-374:)3(3;8002 gnigA

vretnI nilC .eye gniga eht dna noitareneged ralucam detaler-egA

.B oktsoriW ,AT alluiC ,MD notsniW ,SN ayidarehK ,A sirraH ,R hcilrhE .1

secnerefeR

32

.36-9463:)01(53;4991 icS siV

lomlahthpO tsevnI .sesaesid laniter evitarefilorp ni dezilacolonummi

srotpecer dna sdnagil rotcaf htworg devired-teletalP .la

te ,I artseW ,EJ nostreboR ,EC traH ,JD nosliW ,NR noxiM ,GS snibboR .41

.9-601:)2(801;0002 setebaiD lonircodnE

nilC pxE .yhtaponiter citebaid evitarefilorp htiw stneitap fo diulf

suoertiv ni rotcaf htworg devired-teletalp fo slevel desaercnI .la te ,E

rekcedreffihcS ,R treffE ,J remmaH ,H tukaY ,M rekcorB ,H regrebyerF .31

.9-633:)4(63;5002 gnigamI sresaL

gruS cimlahthpO .noisulcco niev laniter lartnec morf amede ralucam

rof )nitsava( bamuzicaveb fo noitcejni laertivartni na retfa sgnidnif

yhpargomot ecnerehoc lacitpO .AC otifailuP ,EA gnuF ,JP dlefnesoR .21

.13-9141:)41(553;6002 deM J lgnE N

.noitareneged ralucam detaler-ega ralucsavoen rof bamuzibinaR .la

te ,YC gnuhC ,KP resiaK ,SD reyoB ,SJ reieH ,MD nworB ,JP dlefnesoR .11

.842-932:)2(541;8002 lomlahthpO J mA .1 raey ydutS REIP

:noitareneged ralucam detaler-ega ralucsavoen rof bamuzibinar

fo lairt dellortnoc-mahs ,deksam-elbuod ,dezimodnaR .la te

,S redienhcS ,T veluhcnaI ,H euY ,P maharbA ,MD nworB ,DC olligeR .01

.31-9051:)21(392;5002

amaJ .smelborp laitnetop dna sesimorp :noitaziralucsavoen

raluco fo srotibihnI .AK smailliW ,JD retsoC ,P nedraagnjiW nav .9

.9-769:)9(953;8002 deM J lgnE N .emit a ta pord

eno--amede dna noitaziralucsavoen ralucoartni gnitegraT .PL olleiA .8

42

.5 1

-4:)1(48;6002 dnacS lomlahthpO atcA .drazah thgil eulb fo tcapmi

eht dna yhtapolucam detaler-egA .S dragereS ,J llahsraM ,VP erevglA .12

.26-453:)2(53;9002 gruS tcarfeR tcarataC J

.noisserpxe 2-lcB dna ,xaB ,ahpla-rotcaf htworg lailehtodne ralucsav

no stceffe cixototohp gnicuder yb muilehtipe tnemgip laniter namuh

no snel ralucoartni gniretlif-thgil eulb a fo stceffe evitcetorpotyC .la

te ,AC reuabrekcaL ,SC eglA ,HK lbiE ,R lgeiL ,SA reuabueN ,M tnreK .02

.8-654:)4(68;8002 lomlahthpO atcA .tnemtaert binefaroS

laro rednu noitaziralucsavoen ladiorohc tlucco ni amedeo ralucam

fo noituloseR .SA reuabueN ,A kipmaK ,C feitS ,M relheatS ,M tnreK .91

.4-132:)2(38;8002 corP nilC oyaM .noitareneged ralucam detaler

-ega evitaduxe rof binefaros esod-wol htiw denibmoc bamuzibinaR

.rJ ,HE nayR ,PT kniL ,CL ttelloC ,RJ aniloM ,SJ odiluP ,T ogaiD .81

.04-9213:)01(7;8002 rehT recnaC

loM .gnilangis esanik enisoryt rotpecer FGDP dna FGEV dna faR htob

stegrat taht rotibihni esanikitlum a ,binefaros fo weivrevo lacinilcerP

.M hcnyL ,MJ tevolL ,A aveunalliV ,P lleweN ,L enandA ,MS mlehliW .71

.92-1:)1(22;3002 seR eyE niteR

gorP .esaesid eye ni sisenegoigna dna srotcaf htworg lailehtodne

ralucsaV .OR nnamegnilhcS ,JC nedrooN naV ,FG nesnerV ,NA remtiW .61

.101-19:)1(242;4002 lomlahthpO pxE

nilC hcrA sefearG .noitareneged ralucam detaler-ega ni esnopser

gnilaeh dnuow eht dna srotcaf htworg fo eloR .OR nnamegnilhcS .51

52

eht ni ecnecseroulfotua sudnuf oviv ni desaercni fo snrettaP

.EH rekcloV ,PT ottO ,F ttuhcS ,M siditiragraM ,C nnamlleB ,GF zloH .92

.6-017:)8(242;4002

lomlahthpO pxE nilC hcrA sefearG .esaesid ralucam detaler

-ega ni syawhtap cigoloisyhpohtapyeK .GF zloH ,A dlawedniB ,F htoR .82

.36-55:)2-1(56;3891 sdohteM

lonummI J .syassa yticixototyc dna noitarefilorp ot noitacilppa

:lavivrus dna htworg ralullec rof yassa cirtemiroloc dipaR .T nnamsoM .72

.6

-31:)1(601;3002 lomlahthpO coD .egamad thgil eulb dna noitamrof

nicsufopil ,snoitcaer evitadixo :sllec lailehtipe tnemgip laniter

derutluc fo gnigA .TU knurB ,U kramlhiW ,PS nilednuS ,ES nossliN .62

.02-9031:)11(91;0891 icS siV lomlahthpO

tsevnI .ortiv ni muilehtipe tnemgip laniter namuh fo erutcurtsartlu

dna scitsiretcarahc htworG .H eybdlejK ,P saruoG ,TM doolF .52

.64-933:83;0691

)hnepoC( lomlahthpO atcA .eye namuh tluda eht fo aevu dna

aniter eht fo sllec detnemgip eht fo ruoivaheb ortiv nI .RY kahsiraB .42

.0 1

-405:)3(731;4002 lomlahthpO J mA .esaesid ralucam detaler-ega

etal ni snoisel fo sisenegohtaP .CA driB ,R nielK ,D ffohkieluaP ,GF zloH .32

.34-631:)2(08;2002

dnacS lomlahthpO atcA .seitiladom tnemtaert wen dna serutaef

citenegohtap :yhtapolucam detaler-egA .S dragereS ,VP erevglA .22

62

EGAR ,stcudda-EGA dna -ADM -ENH fo noitcudni eht rof smsinahceM

.RJ worrapS ,MA tdimhcS ,S ikadyhcaP ,PY gnaJ ,B iaC ,J uohZ .53

.011-99:)1(28;6002 seR eyE pxE .noitareneged ralucam detaler

-ega htiw seye dna diorohc namuh dega ni )FGEV( rotcaf htworg

lailehtodne ralucsav dna )FDEP( rotcaf devired-muilehtipe tnemgiP

.la te ,P gnoT ,C segreM ,YS miK ,T awagesaH ,SD doeLcM ,AI ottuhB .43

.57-962:)3(72;7002

aniteR .noitareneged ralucam detaler-ega ni noitammalfni

dna srotcaf citeneg fo eloR .SM znarknemulB ,MD ihgefhsoM .33

.7-267:)3(83;7991 icS siV lomlahthpO

tsevnI .enarbmem s'hcurB ni tropsnart diulf ot ecnatsiser rojam

fo etis eht fo noitazilacoL .J llahsraM ,A eromtaP ,AA niassuH ,C atiratS .23

.23-507:)6(02;1002 seR eyE niteR gorP

.noitareneged ralucam detaler-ega dna gniga ni ecafretni enarbmem

s'hcurB-EPR eht ta sessecorp detaidem-enummi fo srekramoib

sa nesurd sredisnoc taht sisehtopyh detargetni nA .FR snilluM

,HD nosrednA ,VL nosnhoJ ,HN gnohC rotciV ,JP trehtuL ,SG namegaH .13

.8-389:)21(042;2002 lomlahthpO

pxE nilC hcrA sefearG .senarbmem ralullec rehto dna lamososyl

eht fo ytirgetni eht no E-2A fo stceffe dna sllec EPR namuh morf

semososyl tcatni fo noitalosI .J ztipoK ,GF zloH ,M nnamgreB ,F ttuhcS .03

.25-541:)2(732;9991 lomlahthpO pxE nilC hcrA sefearG

.noitareneged ralucam detaler-ega htiw detaicossa muilehtipe

tnemgip laniter eht fo yhporta cihpargoeg fo enoz lanoitcnuj

72

.04-833:)2(81;4002 J besaF .smsinahcem lavivrus llec

lailehtodne detaidem-etycirep htiw gnirefretni yb noisserger lessev

romut secrofne gnilangis FGDP dna FGEV fo noitibihni denibmoC .la

te ,PH semmaH ,H regreK ,G htorG ,DA nestaK ,A rehnruhT ,R rebrE .24

.24-634:)4(971;6991 lohtaP J .sisenegoigna

ni setycirep detavitca fo tneutitsnoc a si a esaditpeponimA

.JD retiuR ,JF dlevteiR ,P gnilesseW ,E kjiwretsoO ,OR nnamegnilhcS .14

.56-15:)1(31;0791 lohtaP loM pxE .yduts larutcurtsartlu nA

.gnilaeh dnuow ni etycirep eht fo eloR .CJ reeG ,MT daruM ,JD rekcorC .04

.6-363:)4(08;6991 lomlahthpO

J rB .noitasiralucsavoen laniterbus htiw stneitap fo suoertiv

eht ni detavele era rotcaf htworg lailehtodne ralucsav fo sleveL

.la te ,ME renhoK ,AP ittaniloM ,A nnuN ,R rebbihC ,R yhtruM ,AJ slleW .93

.22-601:)2(63;7991

hceT seR csorciM .yhtapolucam detaler-ega ni segnahc

cigolohproM .TP gnoJ ed ,MC yooM ,LT tfahcS red nav ,M neffilK .83

.9002 egolomlahthpO .la

te ,A floW ,HK lbiE ,AC reuabrekcaL ,SA reuabueN ,C ssienriH ,M tnreK .73

.4-0451:)9(23;6002 gruS tcarfeR tcarataC J .rotcaf

htworg lailehtodne ralucsav fo noitalugerpu decudni-thgil no sesnel

ralucoartni wolley fo stceffE .DW gnaJ ,A amayirI ,Y euonI ,Y iganaY .63

.08-765:)4(08;5002

seR eyE pxE .sllec lailehtipe tnemgip laniter ni FGEV dna

82

.901-9907:)91(46;4002

seR recnaC .sisenegoigna dna noissergorp romut ni devlovni

sesanik enisoryt rotpecer dna yawhtap KRE/KEM/FAR eht stegrat

dna ytivitca romutitna laro murtceps daorb stibihxe 6009-34 YAB

.la te ,H gnoR ,A alobaNcM ,D eikliW ,L gnaT ,C retraC ,MS mlehliW .84

.8-15811:)42(66;6002 seR recnaC .5/FRP/CLP

ledom amonicrac ralullecotapeh ni sisotpopa llec romut secudni

dna ,sisenegoigna romut stibihni ,yawhtap KRE/KEM/FAR eht skcolb

binefaroS .la te ,D eikliW ,A alobaNcM ,X gnahZ ,C nehC ,Y oaC ,L uiL .74

.216-795:704;6002 lomyznE sdohteM .erutalucsav

romut ni RFGDP/RFGEV sesanik enisoryt dna sllec romut ni

yawhtap KRE/KEM/FAR stegrat taht rotibihni noitca-laud a ,)ravaxeN

,6009-34 YAB( binefaroS .MS mlehliW ,I rolyaT ,AP liarT ,L enandA .64

.7-5S:)lppuS 6(92;9002 aniteR .noitareneged

ralucam detaler-ega ni ypareht noitanibmoc rof elanoitaR .FR ediapS .54

.07-538:)3(38;3002 veR loisyhP .senikotyc

dna srotcaf htworg yb gnilaeh dnuow fo noitalugeR .R esorG ,S renreW .44

.35-6302:)6(861;6002

lohtaP J mA .noitaziralucsavoen raluco fo sledom elpitlum

ni ypareht rotcaf htworg lailehtodne ralucsav-itna fo ycaciffe

eht secnahne gnilangis B rotcaf htworg devired-teletalp fo noitibihnI

.la te ,K amijihsiN ,J yeldarB ,E gnuehC ,M uJ ,C sohliaM ,N oJ .34

92

02-81S:)lppuS 6(92;9002 aniteR .sutats tnerruc

:seipareht citatsoigna noitanibmoC .M yawnoC ,R allecsiF ,AG namyeP .55

.6 9

-881:)3(5;5002 recnaC latceroloC nilC .recnac latceroloc gnidulcni

,sromut dilos yrotcarfer htiw stneitap ni nitalpilaxo htiw noitanibmoc

ni )6009-34 YAB( binefaros fo lairt I esahp a fo stluseR .la te

,AR regliH ,K nnameseiW ,H ylhciR ,K egrassaP ,FB gninneH ,P hcspuK .45

.04-334:)2(8;9002 rehT recnaC loM .binefaros rotibihni esanikitlum

eht yb sesnopser llec-T fo tnemriapmi tnednepedni-KPAM

.D amarhcS ,CJ rekceB ,V retsiemfoH ,C ekleoN ,H tgioV ,R nebuoH .35

.003-3924:)62(42;6002 locnO nilC J .amonicrac ralullecotapeh

decnavda htiw stneitap ni binefaros fo yduts II esahP .la

te ,A regiF ,A orotnaS ,D irodamA ,S icciR ,L ztrawhcS ,KG aflA-uobA .25

.21-5052:)61(42;6002 locnO

nilC J .amonicrac llec laner citatsatem htiw stneitap ni binefaros

fo lairt noitaunitnocsid dezimodnar dellortnoc-obecalp II esahP .la

te ,LG rensoR ,BS eyaK ,TK ytrehalF ,MW reldatS ,T nesiE ,JM niataR .15

.43-521:)2(653;7002 deM

J lgnE N .amonicrac llec-laner llec-raelc decnavda ni binefaroS .la

te ,M slebeiS ,S draduO ,C kilyzczS ,MW reldatS ,T nesiE ,B reiducsE .05

.43-623:)5(89;6002 tsnI recnaC

ltaN J .stnatum TER cinegocno fo noitibihni 6009-34 YAB .la te ,MS

mlehliW ,G enocnorT ,G erotavlaS ,T adiuG ,S itnaganA ,F ongamolraC .94

03

sllec lortnoc detanimulli-non dna detaertnu htoB .sllec EPR ni noisserpxe

FGlP dna ,B-FGDP ,A-FGEV fo gniniats lacimehcotsihonummI .4 .giF

.noitanimulli fo emit :sixa

-Y .tamrof lamiced ni desserpxe ,ANRr s81 ot dezilamron ANRm FGlP ro

,BB-FGDP ,A-FGEV fo )RR( oitar evitaler :sixa-X .RCP-TR evitatitnauq yb

detagitsevni sa ,)snmuloc yarg thgil( Lm/gµ 1 ta binefaros htiw noitabucni

retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli retfa

sllec EPR yramirp fo noisserpxe ANRm FGlP dna ,BB-FGDP ,A-FGEV .3 .giF

.DS :srab rorrE .noitanimulli fo

nim 06 retfa binefaros htiw detabucni yllanoitidda erew sllec nehw decuder

yltnacifingis saw ytilibaiv ralullec ni esaerced ehT .)TTM( tset cirtemiroloc

a yb derusaem sa ,)nmuloc yarg thgil( Lm/gµ 1 fo noitartnecnoc

a ta binefaros htiw noitabucni retfa dna )nmuloc kcalb( thgil etihw

nialp htiw noitanimulli retfa sllec EPR namuh yramirp fo ytilibaiV .2 .giF

.slortnoc ot derapmoc

)gnitset elpitlum rof noitcerroc α htiw noxocliW( ytilibaiv ni noitcuder

tnacifingis on dewohs Lm/gm 5.21 ot pu fo snoitartnecnoc binefaroS

.MES gnitacidni srab rorre htiw etacilpirt ni demrofrep hcae ,stnemirepxe

eerht morf lavivrus llec lortnoc fo egatnecrep naem eht era nwohs stluser

ehT .slortnoc sa devres egassap emas eht fo sllec EPR detaertnU .)TTM(

tset cirtemiroloc a yb derusaem ,binefaros fo snoitartnecnoc suoirav

eht htiw tnemtaert retfa sllec EPR namuh yramirp fo ytilibaiV .1 .giF

sdnegeL erugiF

13

.DS ± snaem era seulav ataD .retilillim rep smargonan ni noitartnecnoc

sa desserpxe dna FGlP ro ,BB-FGDP ,A-FGEV fo evruc dradnats a ot

dezilamron saw eulav hcaE .)snmuloc yarg thgil( binefaros htiw tnemtaert

lanoitidda retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli

retfa sllec EPR detaertnu :ASILE yb detagitsevni sa ,FGlP dna ,BB-FGDP

,A-FGEV fo noiterces decudni-thgil no binefaros fo tceffe yrotibihnI .5 .giF

.slortnoc detanimulli-non sa devres taht sllec

esoht ot elbarapmoc saw hcihw ,FGlP dna ,B-FGDP ,A-FGEV fo gniniats

kaew a ylno dewohs noitanimulli retfa yltcerid dedda binefaros dah dna

detanimulli erew taht sllec EPR ,tsartnoc nI .desaercni yldekram saw FGlP

dna ,B-FGDP ,A-FGEV fo noisserpxe eht ,erusopxe thgil fo nim 06 retfA

.FGlP dna ,B-FGDP ,A-FGEV rof gniniats tniaf a ylno detneserp noitanimulli

on dah dna ,Lm/gµ 1 ,binefaros htiw detaert erew taht sllec dna

.slortnoc ot derapmoc

)gnitset elpitlum rof noitcerroc α htiw noxocliW( ytilibaiv ni noitcuder

tnacifingis on dewohs Lm/gm 5.21 ot pu fo snoitartnecnoc binefaroS

.MES gnitacidni srab rorre htiw etacilpirt ni demrofrep hcae ,stnemirepxe

eerht morf lavivrus llec lortnoc fo egatnecrep naem eht era nwohs

stluser ehT .slortnoc sa devres egassap emas eht fo sllec EPR detaertnU

.)TTM( tset cirtemiroloc a yb derusaem ,binefaros fo snoitartnecnoc

suoirav eht htiw tnemtaert retfa sllec EPR namuh yramirp fo ytilibaiV

:1 .giF

.DS :srab

rorrE .noitanimulli fo nim 06 retfa binefaros htiw detabucni yllanoitidda

erew sllec nehw decuder yltnacifingis saw ytilibaiv ralullec ni esaerced ehT

.)TTM( tset cirtemiroloc a yb derusaem sa ,)nmuloc yarg thgil( Lm/gµ 1 fo

noitartnecnoc a ta binefaros htiw noitabucni retfa dna )nmuloc kcalb( thgil

etihw nialp htiw noitanimulli retfa sllec EPR namuh yramirp fo ytilibaiV

:.2 .giF

.noitanimulli fo emit

:sixa-Y .tamrof lamiced ni desserpxe ,ANRr s81 ot dezilamron ANRm FGlP

ro ,BB-FGDP ,A-FGEV fo )RR( oitar evitaler :sixa-X .RCP-TR evitatitnauq

yb detagitsevni sa ,)snmuloc yarg thgil( Lm/gµ 1 ta binefaros htiw

noitabucni retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli

retfa sllec EPR yramirp fo noisserpxe ANRm FGlP dna ,BB-FGDP ,A-FGEV

:3 .giF

.slortnoc detanimulli-non

sa devres taht sllec esoht ot elbarapmoc saw hcihw ,FGlP dna ,B-FGDP

,A-FGEV fo gniniats kaew a ylno dewohs noitanimulli retfa yltcerid dedda

binefaros dah dna detanimulli erew taht sllec EPR ,tsartnoc nI .desaercni

yldekram saw FGlP dna ,B-FGDP ,A-FGEV fo noisserpxe eht ,erusopxe

thgil fo nim 06 retfA .FGlP dna ,B-FGDP ,A-FGEV rof gniniats tniaf a ylno

detneserp noitanimulli on dah dna ,Lm/gµ 1 ,binefaros htiw detaert erew

taht sllec dna sllec lortnoc detanimulli-non dna detaertnu htoB .sllec EPR

ni noisserpxe FGlP dna ,B-FGDP ,A-FGEV fo gniniats lacimehcotsihonummI

:4 .giF

.DS ± snaem

era seulav ataD .retilillim rep smargonan ni noitartnecnoc sa desserpxe

dna FGlP ro ,BB-FGDP ,A-FGEV fo evruc dradnats a ot dezilamron

saw eulav hcaE .)snmuloc yarg thgil( binefaros htiw tnemtaert lanoitidda

retfa dna )snmuloc kcalb( thgil etihw nialp htiw noitanimulli retfa

sllec EPR detaertnu :dohtem ASILE na yb detagitsevni sa ,FGlP dna ,BB

-FGDP ,A-FGEV fo noiterces decudni-thgil no binefaros fo tceffe yrotibihnI

:5 .giF

:1 elbaT

RCP-TR rof desu sremirP

Target Length Position AT (°C) % GC Sequence



VEGF-A 18 1540-1557 60 56 tgcccgctgctgtctaat



18 1592-1609 60 61 tctccgctctgagcaagg



PlGF 18 335-352 60 61 ggctgttcccttgcttcc



18 395-412 59 61 cagacaaggcccactgct



PDGF-BB 18 1108-1125 60 56 tgatctccaacgcctgct



20 1156-1175 59 50 tcatgttcaggtccaactcg



Related docs
Other docs by xiuliliaofz
APIR080108.xlsx
Views: 0  |  Downloads: 0
Presentación de PowerPoint
Views: 1  |  Downloads: 0
Planning Intertextual Studies
Views: 0  |  Downloads: 0
Fox Racing_ and thus racing
Views: 1  |  Downloads: 0
CareerNewsNo82011
Views: 0  |  Downloads: 0
minkowitz-pres
Views: 0  |  Downloads: 0
Copyof2011-12NeedsAddendum1.10212011
Views: 1  |  Downloads: 0
DB420809
Views: 0  |  Downloads: 0
GST Cash Book - Kohlhagen Group
Views: 1  |  Downloads: 0
Gr6B_25Aug2010
Views: 4  |  Downloads: 0
By registering with docstoc.com you agree to our
privacy policy

You are almost ready to download!

You are almost ready to download!