NCBI_Entrez_14Januar by liamei12345


									NCBI Resources
                 Entrez System
             Entrez Databases:

                                                                                       NCBI Resources
                                                   Tight Integration

     Cancer Chromosome         Books               Word weight
            OMIM                       PubMed
                                                   Related Articles       PubChem
Phylogeny                                                              3D domain

                                                            3 -D
                                            Gene                        Neighbors
                                   Genome                               Related Structures
Genome Project
     GEO                                                                    SNP

      BLAST                                                           BLAST
                      Nucleotide                    Protein
                      Sequences                    Sequences          Neighbors
          Neighbors                                                   Related Sequences
 Related Sequences                                                    BLink
                                    Hard Link                         Domains
        GenBank:       NCBI’s Primary Sequence Database

                                                                        NCBI Resources
• Nucleotide only sequence database
• Archival in nature
   – Historical                     PRI   primate
   – Subjective: submitter’s view   PLN   plant and fungal
   – Redundant                      BCT   bacterial and archeal
                                    INV   invertebrate
• GenBank data sources              ROD   rodent
   – Direct submissions             VRL   viral
   – Batch: EST, GSS, STS           VRT   other vertebrates
                                    MAM   mammalian
   – ftp upload (genome data)
                                    PHG   phage
• Three collaborating databases     SYN   synthetic (cloning vectors)
   – GenBank (77.6%)                UNA   un-annotated
   – DDBJ (14.1%)                   EST   Expressed Sequence Tag
   – EMBL (8.3%)                    GSS   Genome Survey Sequence
                                   HTG    High Throughput Genomic
                                   STS    Sequence Tagged Site
                                   HTC    High Throughput cDNA
                                   PAT    Patent
    RefSeq:          NCBI’s Derivative Sequence Database

                                                                             NCBI Resources
• Curated transcripts and proteins (NM_, NP_)
     – reviewed
     – Most model organisms and more
• Model transcripts and proteins (XM_, XP_)
• Assembled Genomic Regions (contigs) (NT_, NW_)
     – higher genomes
• Chromosome records (NC_)
     – Higher genomes
     – Microbial genomes
     – Organelle genomes
Benefits :
• non-redundant
•   explicitly linked nucleotide and protein sequences
•   regular update
•   validated data
•   consistent format
•   distinctive accession series
•   stewardship by NCBI staff and collaborators
   Sequence Record:        different formats

                                               NCBI Resources
Sequence records are kept in ASN.1 format.
They are translated “on the fly” to others
upon request.

  GenBank/GenPept    useful for scientists
  FASTA              the simplest format
  ASN.1              useful for programmers
  XML                useful for programmers
         Other Entrez Databases

                                                   NCBI Resources
• Gene:         Gene centric records

• PubMed:       Biomedical literatures

• OMIM:         Genetic disorder/phenotype

• Structure:    Structures (PDB)
                Cn3D viewer, NCBI curation

• CDD:          Conserved Domain Database
                Protein families (COGs)
                Single domains (PFAM, SMART, CD)

• SNP:          Nucleotide Polymorphism
                          NCBI Resources
Using the Entrez System
Global Entrez: Overview of the database landscape

                                                                        NCBI Resources
                                  All [filter]
                                  Human [organism]

                                                 As of April 13, 2007
                            Entrez Databases:

                                                                               NCBI Resources
          Search with Boolean Operator Connected Text Terms
                                                               A           B


Query terms are searched against “All Databases” by default

Terms are boolean AND’ed by default

Other operators need to be specified explicitly with OR, NOT

Forced phrase search needs to be quoted
Field limiter makes the search more specific
                         Entrez Databases:                                                      Literatures

                                                                                                              NCBI Resources
   PubMed: mostly abstracts from over 50K journals
   PMC: full text article, close to 300 journals
   Books: indexed book chapters from over 40 titles with
     over 150K entries
   OMIM: over 17K human genetic disorders/phenotypes

     - Get more specific records using limiter such as
         [au], [ptyp], [mesh], [pdat], and [title]
     - Explore the field limiter using “Preview/Index” tab
     - Combine different sets of results using “History” tab
     - See the term mapping using “Details” tab
Example: Nematode microarray in pubmed, first hit, book link, RNAi, first book, first section
    Entrez Literature Databases:                  Sample search

                                                                  NCBI Resources
PubMed to PMC with Free PDF

•   Search with restriction-modification system

•   Refine it by adding AND regulation

•   Find specific articles by adding: AND Blumenthal RM[au]

•   Click “Free in PMC”, what do we get there?

•   Click “Cited in PMC” to see the other papers
    Entrez Databases:

                                                                     NCBI Resources
                                      sequence  gene  disease

Search for sequences:

•   Search with phenylalanine hydroxylase

•   click RefSeq tab and the tack to get only refseq entries

•   click mRNAs tab and the tack to get only mRNA entries

•   Use field limit to get only human entries (AND human[orgn])

•   Getting the Gene record through Links

•   Getting the genetic disorder information in OMIM through Links
                    NCBI Tools

                                                            NCBI Resources
•   Cn3D
•   Splign, Spidey
•   MapViewer
•   AceView BLAST: a sequence comparison tool used to:
•   etc          – Identify sequence
                   – Cluster sequences from the same gene
                   – Find related or similar sequences
                   – Map mRNA to its genomic counterpart
                   – Verify primer annealing site
                   – Identify functional domain

                                                                                                                             NCBI Resources
                                          identify unknown sequence

PCR fragment amplified from a clinical sample

Copy the sequence
Go to                     >Unknown RT-PCR Products

                                                                                       Source sequence: >gi|9629378:c6907-4953
            BLAST:      interpreting the result

                                                          NCBI Resources
The matches are all from Herpes Simplex Virus,
  strongly indicating query’s viral origin.

The patient will be diagnosed as HSV infected, even
  though he/she shows no sign of infection.

  Once infected, the virus stays with host for life and
  periodically reemerge (cold sore). During latent
  stage, the viral genome is kept as an episome. The
  LAT region of the genome is transcribed during this
  stage. The presence of this transcript indicates HSV
    BLAST:           mapping primer to the human genome

                                                                                       NCBI Resources
Upstream primer      5´-CCATGGCGACCCTGGAAAAGC-3´   >Primer Pair
Convert input primers to suitable format a         CAGCAGCGGCTGTGCCTGCGG

 Go to this page:

 Adjustments needed:
 - Paste in converted primers
 - Change database to: genome (reference only)
 - Change program to blastn
 - Change filter to “None”
 - Increase Expect to 10
 - Hit submit to search
                                                    See the adjusted page with input

 Information from such a search:                      saved result for this search.
  - Find the genomic location
  - Check for secondary annealing sites
  - Identify target gene
  - See amplicon sequence and feature
  - Link to other resources with additional info
                     BLAST :           sample domain search

                                                                              NCBI Resources
>Transmembrane Protein
                 Copy the sequence

                  Go to

                  Paste the sequence in “Query” box
                  Click “Submit Query” button to get the result

                  See the cartoon to get the summary
                  Click on cartoon of interest to see details

                 BLAST:            CDD search result analysis

                                                                                         NCBI Resources
                                                                               See the

• Hydrolase domain (partial match)
     – Click the cartoon to go to domain record
     – Click on “Show Structure”
     – This launches Cn3D to display the structure with sequence alignment

• MgtA Domain (first match to the “whole” query)
     – Covering the whole domain
     – Highly conserved, broken into segments (with 10-membrane domains)

It is important to master the power of this interlinked collection of resources,
which may allow you to see that hidden pot of virtual gold ...
         Other Databases & Tools

                                                            NCBI Resources
• Small molecules: PubChem Compound, Substance, BioAssey
• Expression: GEO dataset, GEO profile
• Large Scale genetic study: dbGAP
• SNP: single nucleotide polymorphism, haplotype, gentype
• Probe: Probes, RNAi, primers

• Splign (exon/intron boundary mapping)
• Genome Workbench
     Outside Tools:                   complementing NCBI Resources

                                                                        NCBI Resources
•   Tools for membrane domain, signal peptide prediction:

•   Tools for multiple sequence alignment:

•   Tools for transcriptional factor binding sites identification:

•   Tools for transcriptional factor binding sites identification:

•   Tools for restriction mapping:
Source Of Help When Needed

                                          NCBI Resources
NCBI User Service

Help Session for NIH staff

To top