S_pneumoniae_genelist

Document Sample
S_pneumoniae_genelist Powered By Docstoc
					The Streptococcus genelist was generated based on the following
Genbank accessions and associate annotations. If an oligo has
97% identity or greater to a transcript/feature sequence, the oligo
is considered to represent that transcript/feature.
Organism/strain                                                       Genbank accession
Streptococcus pneumoniae R6                                           NC_003098.1
Streptococcus pneumoniae R6                                           AE007317.1
Streptococcus pneumoniae TIGR4                                        NC_003028.1
Streptococcus pneumoniae TIGR4                                        AE005672.2
Sequence type     Date
complete genome      2-Dec-05
complete genome    25-Nov-02
complete genome      2-Dec-05
complete genome     26-Jan-06
                       oligo_id
plate_name well_position                 oligo_sequence      R6.sequence_idR6.genome_id
Spr_1      A01         EMPTY             -                   -             -
Spr_1      A03         opSpV0100000001                       -             -
                                         ATTGTACCAGGTCATGATTATGTGACCTTGCTGACTTGTACGCCATACATG
Spr_1      A05         opSpV0100000002                       ref|NC_003098.1|:c1053594-1053436
                                                                           NC_003098.1
                                         CTTAAAAATGGTGACTGATTTCAGTGATAAAAGTATCATCATCAACAGGGT
Spr_1      A07         opSpV0100000003                       -             -
                                         GAAGACACTTGATTTAACGGATATAGCAGGAACTTACCCTTATCCAACCTT
Spr_1      A09         opSpV0100000004                       ref|NC_003098.1|:c1953396-1951630
                                                                           NC_003098.1
                                         GTCTGTCTATGACGTCATGAATAATTGGGGAGCTAATCACGGAGCCATAA
Spr_1      A11         opSpV0100000005                       ref|NC_003098.1|:24122-24589
                                                                           NC_003098.1
                                         AAATTATGGCTATAGAGGATGCGAACTTGAGTGAGGAGAGCTGGCGCTTG
Spr_1      A13         opSpV0100000006                       -             -
                                         TTAGACATGGGGGTAGAACCTCTAAGGATTATGCAAAACCTGAGGCATGG
Spr_1      A15         opSpV0100000007                       gb|AE007317|:1151028-1151362
                                                                           AE007317
                                         TACTGGTCCTCCCCTTCTAGAATAGGAGAATTATGCAGTTCTATTATTCAA
Spr_1      A17         opSpV0100000008                       ref|NC_003098.1|:275987-276226
                                                                           NC_003098.1
                                         TGCATTGTGGCTTGCTCATGGTATTCGTATAGGAGACTTGCCTTTGATTTT
Spr_1      A19         opSpV0100000009                       ref|NC_003098.1|:c659376-658531
                                                                           NC_003098.1
                                         GTAAGTGTCCCCTTAACCATTCAAGTAGCTGATCAGGTCTTTGTTGATGAC
Spr_1      A21         opSpV0100000010                       ref|NC_003098.1|:1496473-1497324
                                                                           NC_003098.1
                                         CCTATACAGAGACTGTTCTTGTAGCCACCCACAGCCAACCCTCCTATATCC
Spr_1      A23         opSpV0100000011                       -             -
                                         TAAAACTTGTCATATAATCCCTTTTGCACAGTCAGAGATGGTTGAGACGAT
Spr_1      C01         opSpV0100000012                       gb|AE007317|:1281808-1282333
                                                                           AE007317
                                         CTGAAACACTGATTTCAAAGCATTTTTTGTTAGTTTAAAATTACTCCCATTC
Spr_1      C03         opSpV0100000013                       gb|AE007317|:1947971-1948267
                                                                           AE007317
                                         TCAAAAAGATTTGGTGTGGATGTTTCTGGTCTAAAGTCATCTGAATCTTTG
Spr_1      C05         opSpV0100000014                       ref|NC_003098.1|:c1338289-1337591
                                                                           NC_003098.1
                                         GGGGAATTGACACTATTCCAAGAGGACAGTATGAGGCCGCCAAGGTCTTG
Spr_1      C07         opSpV0100000015                       ref|NC_003098.1|:c456366-454903
                                                                           NC_003098.1
                                         GACCTTGCTTGCGGAACAGGAGGCTTCTTGACTTCGACTCTGAACCGTTT
Spr_1      C09         opSpV0100000016                       ref|NC_003098.1|:385546-386313
                                                                           NC_003098.1
                                         AAAATTCTATCTATGCCATTCTCAGTCCAGAAGGCTTTGCTTCCATTTTATG
Spr_1      C11         opSpV0100000017                       gb|AE007317|:719811-720198
                                                                           AE007317
                                         ATCAACTAAAGAAGAAATCCAAACCATCAAAACACTTTTAAAAGACTCTCGT
Spr_1      C13         opSpV0100000018                       ref|NC_003098.1|:1176610-1176852
                                                                           NC_003098.1
                                         CGAAACAGTTGAGTTCGAAGGCGAAACTTACCCATTGATCCGTGTGGAAA
Spr_1      C15         opSpV0100000019                       ref|NC_003098.1|:c1406569-1406396
                                                                           NC_003098.1
                                         TGGACTAGGATAGGGAAAAAAATGCCAGAAAATGGTATAATAGGACGAAA
Spr_1      C17         opSpV0100000020                       ref|NC_003098.1|:c807036-806221
                                                                           NC_003098.1
                                         TCCACTGTATCGCAGATTCTGGTGTCTATGGATTGCTGACCAAGGGCAAT
Spr_1      C19         opSpV0100000021                       -             -
                                         TAAAAGAAATTTCACAAAATAAAAAAGAAAACCCCGTGAAAACAAGGGATT
Spr_1      C21         opSpV0100000022                       ref|NC_003098.1|:642193-642885
                                                                           NC_003098.1
                                         CTCATATTTATAGGCAATTTGCAGAACCGAACTTAGCCATCGCTTTTGCAA
Spr_1      C23         opSpV0100000023                       ref|NC_003098.1|:c1998756-1998466
                                                                           NC_003098.1
                                         GAAGTGGCAGGGCAGGAGGCAGACAATGTCTTTGCCAATGTCAAAATAAA
Spr_1      E01         opSpV0100000024                       ref|NC_003098.1|:c1906887-1905946
                                                                           NC_003098.1
                                         CAAAACGAATTAAGCGGTGGCGCTATTATCTGCGCCGCTTTGCTTATCAG
Spr_1      E03         opSpV0100000025                       ref|NC_003098.1|:646614-646985
                                                                           NC_003098.1
                                         AAGAGATTCGAGTGGAAGTCATGGGAGGCTATACTCCTGAGTTGATTGTC
Spr_1      E05         opSpV0100000026                       ref|NC_003098.1|:c1969116-1968412
                                                                           NC_003098.1
                                         TTTTCCAAGTACGGTCTATGAATTTGTCAAGTCGGGTCGCTATCCGAGAAA
Spr_1      E07         opSpV0100000027                       ref|NC_003098.1|:c1936767-1935463
                                                                           NC_003098.1
                                         CGAGTGATGACTGTTGCCAGTATAGTTACTTGATTCCGTCAAATATGTTTG
Spr_1      E09         opSpV0100000028                       gb|AE007317|:1774274-1774529
                                                                           AE007317
                                         TGAGAAGGTGACCACAGTCACTGCGATGTTAAGAAGCTTATTAAGTTCTTT
Spr_1      E11         opSpV0100000029                       ref|NC_003098.1|:1641933-1642940
                                                                           NC_003098.1
                                         TGTATTTCTAGACAGCGATACACTTTCCCTGGGACATACCTGTATTATCAC
Spr_1      E13         opSpV0100000030                       ref|NC_003098.1|:c1237222-1236416
                                                                           NC_003098.1
                                         GGATCCCCAGGCTGCCTTTGATTTGAAACAGATGATGAAGGAACATGCAC
Spr_1      E15         opSpV0100000031                       ref|NC_003098.1|:1903858-1904658
                                                                           NC_003098.1
                                         CAGATAAGGTTGTCCAGGATCTCTCTGAACATGCTACAATTGTCGATGGC
Spr_1      E17         opSpV0100000032                       ref|NC_003098.1|:c1319616-1318774
                                                                           NC_003098.1
                                         TTTGTATTTGATTCATTGGCCGAACCCAAAACCGCTCAGAGAAAATGACGC
Spr_1      E19         opSpV0100000033                       ref|NC_003098.1|:1280075-1280257
                                                                           NC_003098.1
                                         AAGAGCCATTATTTGATATACAGAGTTTTAGGTATTTCATTTGAAGAAGGA
Spr_1      E21         opSpV0100000034                       ref|NC_003098.1|:c409090-408542
                                                                           NC_003098.1
                                         TAAAATTCAGGATATCCTCTCAGTCGCACCTCGTTCTATCGGAACAACATC
Spr_1      E23         opSpV0100000035                       -             -
                                         GCCGCAAAGGTAGCTGGACATGTGATTCATGTTGAGACTCAGGGGACAAT
Spr_1      G01         opSpV0100000036                       ref|NC_003098.1|:c1093387-1092272
                                                                           NC_003098.1
                                         GCTTCAGGGAAATTCCCTCAATTTGTTGACGAGAGTCCAAGCTGCCACAA
Spr_1      G03         opSpV0100000037                       ref|NC_003098.1|:481913-484705
                                                                           NC_003098.1
                                         GCTTCAAATGCCTTTATCGTTGGTTTCAACGTACGCCCTACACCACAAGCT
Spr_1      G05         opSpV0100000038                       ref|NC_003098.1|:960704-961738
                                                                           NC_003098.1
                                         TCAACAACAAGTTGAACTCATCAAGGCTCTGACACCGAATGTGAAAACAAT
Spr_1      G07         opSpV0100000039                       ref|NC_003098.1|:c216707-216513
                                                                           NC_003098.1
                                         CCCAGCAAACTCTTCTAGCGCCTTTGCTCAATTAACAAATATGCTACAAGC
Spr_1      G09         opHsV04NC000001                       -
                                         TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_1      G11         opSpV0100000040                       ref|NC_003098.1|:976908-977768
                                                                           NC_003098.1
                                         GTTGGGCGCATAAGACCATTGACGGTGGATTGTCATGTCAGTATGAACAC
Spr_1   G13   opSpV0100000041                        ref|NC_003098.1|:c1332869-1332570
                                                                   NC_003098.1
                                AGTGGTTCAAAACGCAACTCCTACCTGCTTTGAAGACACCTCATGTTATTG
Spr_1   G15   opSpV0100000042                        ref|NC_003098.1|:315715-316872
                                                                   NC_003098.1
                                ACATCTGATATATCATCGGGAGCTACCCGGTCATTGTTACGATTAGTTTCG
Spr_1   G17   opSpV0100000043                        ref|NC_003098.1|:863435-863830
                                                                   NC_003098.1
                                GAAAATGTGGTGGATTTGGCCAGTCACTATCACTTTTCCATGCTGGCTAAA
Spr_1   G19   opSpV0100000044                        ref|NC_003098.1|:701973-702452
                                                                   NC_003098.1
                                AGGCAGTCAGCAACTTGGTGAAGGACTGACGGAAACGCTGACTAGAGAA
Spr_1   G21   opSpV0100000045                        ref|NC_003098.1|:963503-965278
                                                                   NC_003098.1
                                GAAAAGCTAGTGAGATTTACCTGATGGAAGGATTCATGGATGTTATTGCAG
Spr_1   G23   opSpV0100000046                        gb|AE007317|:127803-128355
                                                                   AE007317
                                TTCGTAAAACAGATGTGAAAGAAATGAAATGGCTATAAAGATTGTCCGCAG
Spr_1   I01   opSpV0100000047                        ref|NC_003098.1|:c1051483-1050815
                                                                   NC_003098.1
                                ATGGAACACTCGTCTTGGCATGCTTTGATTAAGGCGCAATTACCTGAGGG
Spr_1   I03   opSpV0100000048                        ref|NC_003098.1|:91678-92664
                                                                   NC_003098.1
                                GAAGACAAGTACCTTCGTGGATGCTCACACGAGTGCCGTGTTCACCCACG
Spr_1   I05   opSpV0100000049                        ref|NC_003098.1|:c1842903-1842688
                                                                   NC_003098.1
                                GGAACAGGTGGTGAACAGACAGACTATTCCAGCTATGAGTTTAGTGGATA
Spr_1   I07   opSpV0100000050                        ref|NC_003098.1|:c1956569-1953453
                                                                   NC_003098.1
                                TATGTATACTAATAATACAAAGTCGTTATCGTTAGATTTGACGCCACATACT
Spr_1   I09   opSpV0100000051                        ref|NC_003098.1|:602140-602328
                                                                   NC_003098.1
                                TGCTCTTCTGGTTCGATTACTTTCTTTTTAAATGCGTATACTGCACCTGCA
Spr_1   I11   opSpV0100000052                        ref|NC_003098.1|:632576-632722
                                                                   NC_003098.1
                                CAAGTTATTCCTAAAGCAGCATTTGGCTATATCGCTAGTGGGGCGGAAGA
Spr_1   I13   opSpV0100000053                        -             -
                                GCCTGCCTTGCCCCTTCGGTGCCTTTACGGTCTCTCCAGAGTTCCGTCCA
Spr_1   I15   opSpV0100000054                        ref|NC_003098.1|:c1704025-1702403
                                                                   NC_003098.1
                                AATCAAAAACGTCACAGCAGGTGCAAATCCAATCGGTATTCGTCGTGGGA
Spr_1   I17   opSpV0100000055                        ref|NC_003098.1|:c1408527-1407616
                                                                   NC_003098.1
                                TGACCTATCTCCAGCGAGCAGAAGACATTATGGACTTCTTGATAGTAATAG
Spr_1   I19   opSpV0100000056                        ref|NC_003098.1|:1447154-1447948
                                                                   NC_003098.1
                                AGATGAAAATTATATTTTAGTTGCGCCTCACCGTACCTGGTGGGATCCTGT
Spr_1   I21   opSpV0100000057                        ref|NC_003098.1|:324751-324909
                                                                   NC_003098.1
                                CTTATTGGAAACAGCTAAACGTCATCAACTAAATAGCGAGAAATATCTATC
Spr_1   I23   opSpV0100000058                        gb|AE007317|:955475-956375
                                                                   AE007317
                                GCATCACGTGGAGTGTGTAAGCTTGTTGCTAAAAGCGTAAAAACCTTGGA
Spr_1   K01   opSpV0100000059                        gb|AE007317|:475643-475925
                                                                   AE007317
                                GAGGTGGCTTGAAATAAAAAAGCTAATTCAAGACGTTTCGATGACAATTCA
Spr_1   K03   opSpV0100000060                        ref|NC_003098.1|:570343-571818
                                                                   NC_003098.1
                                CTCCGTATGATTATCTTCGGAACACTCTTGTTGCCACTCTTCCTTCTTTCA
Spr_1   K05   opSpV0100000061                        -             -
                                ACAAGAGAAACTTGGAAAAAAACTTGGTATATCTAAGCAGAGTTATTACAA
Spr_1   K07   opSpV0100000062                        ref|NC_003098.1|:1112468-1113019
                                                                   NC_003098.1
                                TGCTCCTAAGGAATCCCTACTAGCTTGTGGAGACCACGGACGAGGAGCTT
Spr_1   K09   opSpV0100000063                        ref|NC_003098.1|:430192-431874
                                                                   NC_003098.1
                                AGTCTCATCTGGTTAGCACAGTTTTGCAGGATACAGATGGGCAGTTTATTG
Spr_1   K11   opSpV0100000064                        -             -
                                GATTTTTTACATCAAAACTAAGATTTTTCTTAGTTTTTTCTTATTTTTGTTGA
Spr_1   K13   opSpV0100000065                        ref|NC_003098.1|:527330-527986
                                                                   NC_003098.1
                                TCTTACAAGGATACCAAGGTGGACTTTGAAAGCTACAGTGCAAGCCTCGC
Spr_1   K15   opSpV0100000066                        ref|NC_003098.1|:182039-183100
                                                                   NC_003098.1
                                AAGCTAAGGCAGGCTTAGGTTTCCGTGACTTTGACAAAATCCCTCGTGAT
Spr_1   K17   opSpV0100000067                        -             -
                                TGATAGTTTTACAATAGAAGTCCCTATAGAAGAAAAGATCTTAGATGTTATC
Spr_1   K19   opSpV0100000068                        gb|AE007317|:130216-130561
                                                                   AE007317
                                ATAAGGTTCGATTGAATAGATTTATGTTCGTATTCTTTAGGTACCTATCTTA
Spr_1   K21   opSpV0100000069                        ref|NC_003098.1|:1451642-1451821
                                                                   NC_003098.1
                                GACAAAGCAAGGACGCTACTATGATGAAACACCCTACACACTGGAACAAA
Spr_1   K23   opSpV0100000070                        gb|AE007317|:1374276-1374569
                                                                   AE007317
                                TTATGAAAAAGCTCCATCGTGCTTTTAATGTGTTCTCTTGTTTTCAAACTCG
Spr_1   M01   opSpV0100000071                        ref|NC_003098.1|:919628-919846
                                                                   NC_003098.1
                                GCAGGACTTACAACAAATGTTATGGCACAAATGGGAAAGGATAAACCAATT
Spr_1   M03   opSpV0100000072                        -             -
                                ATCTTCCAAGGGTAGACAAATTTTCGCTAAACGTAAGATTGATATGAAATC
Spr_1   M05   opSpV0100000073                        -             -
                                CCCTTTCTGCCACCATTTACTCCTACAGATAAAAGAGTAGCCTCGACTTAT
Spr_1   M07   opSpV0100000074                        gb|AE007317|:1735558-1735906
                                                                   AE007317
                                TAGTGTAGCTTTTCGTTGAGATAATAATATAATAAAGAAAAGTTCTATTCTA
Spr_1   M09   opSpV0100000075                        ref|NC_003098.1|:1098125-1099111
                                                                   NC_003098.1
                                GTGATGCGCTTGACCTTAGTCACGCCCTTGCCTTCACTTCACCTAAAAAAA
Spr_1   M11   opSpV0100000076                        ref|NC_003098.1|:c1303097-1302186
                                                                   NC_003098.1
                                TGACTCGTTTTGCTAAGACTGTTACCATTGTTCACCGTCGTGACCAACTTC
Spr_1   M13   opSpV0100000077                        ref|NC_003098.1|:c1333304-1333089
                                                                   NC_003098.1
                                CGTGAACAAGAACACATAGAGAGGAAAAAGCGAGTCGTCAAAAACCGAAA
Spr_1   M15   opSpV0100000078                        ref|NC_003098.1|:c983501-982860
                                                                   NC_003098.1
                                GCTAATCTCTTGGTTGATGCTGGTGTGAAAGGAATTCTCAGTTTTTCACCA
Spr_1   M17   opSpV0100000079                        ref|NC_003098.1|:943148-943798
                                                                   NC_003098.1
                                AAGCTGTGCAGTCCTCTAGTAGGTGTCATTCGTTTACTTTTCTATCGTTTT
Spr_1   M19   opSpV0100000080                        -             -
                                ATGCTGCTGGAGTAACTAACGTATCATTTCATGGTTTCCGCCATACACATA
Spr_1   M21   opSpV0100000081                        ref|NC_003098.1|:1459595-1460017
                                                                   NC_003098.1
                                TTCGCAAGAAGGCAGACCCAACCAAATGAGCCAAAAACAGGTAAAATTGG
Spr_1   M23   opSpV0100000082                        ref|NC_003098.1|:196727-197350
                                                                   NC_003098.1
                                ATGAATCAGTTGTGTTTGATGTAATCATCAGCCAACGCGCAAGCCTTCGTC
Spr_1   O01   opSpV0100000083                        ref|NC_003098.1|:1113794-1114375
                                                                   NC_003098.1
                                GAGATTCTTGTGAATACACGGAAAAAGACACAATTTATGACAATGACAGCC
Spr_1   O03   opSpV0100000084                        ref|NC_003098.1|:733045-733854
                                                                   NC_003098.1
                                AAACTGCTACTTTCCTGAAAGAAAAGGGAATTGCAGCCCCTGAGTTCGGT
Spr_1   O05   opSpV0100000085                        ref|NC_003098.1|:c102989-102117
                                                                   NC_003098.1
                                AACGCAATCTGGAAGTTATGAAAGCCTCTGTCCAACTTGGCCTCAATGAAA
Spr_1   O07   opSpV0100000086                        gb|AE007317|:1756204-1756514
                                                                   AE007317
                                TTCTCCCATCTAACAAGATCCTTTAAAAGGTAAAAACTCACATAAATAAAGA
Spr_1   O09   opSpV0100000087                        -             -
                                TGTCCTGATTGTTTTATCCTATTTCTATTTCATTTCTCTATATAATTGCTATT
Spr_1   O11   opSpV0100000088                        ref|NC_003098.1|:735335-735847
                                                                   NC_003098.1
                                ATAGATGGCAAACAATCTATGAAAACAGACCAATTTTAGCTCAACCCCACC
Spr_1   O13   opSpV0100000089                        ref|NC_003098.1|:c1276346-1275624
                                                                   NC_003098.1
                                ATCAACCGACTTCAGGTAATATTATAAGCAGTGATAATGTTGGGTATTTAA
Spr_1   O15   opSpV0100000090                        ref|NC_003098.1|:c373548-372211
                                                                   NC_003098.1
                                GGAAGTGTGGATTCCAGCACAAAACAATTACCGTGAAATCTCAAGCTGTTC
Spr_1   O17   opSpV0100000091                        ref|NC_003098.1|:c1252240-1251587
                                                                   NC_003098.1
                                CAGTTCTACGCTATGGGACAAGAAGTGCTCTCACAAATCAATCGTACGGT
Spr_1   O19   opSpV0100000092                        ref|NC_003098.1|:c1708821-1708372
                                                                   NC_003098.1
                                TGAAACAGAAGGGAGCAAGATCTACGCTCATAACCAGAAGGAAGCTTATG
Spr_1   O21   opSpV0100000093                        ref|NC_003098.1|:1451840-1453822
                                                                   NC_003098.1
                                ATGGGTGACGGGGAAGAATTTGTCCTTCGTCCAATGAACTGTCCGCACCA
Spr_1   O23   opSpV0100000094                        ref|NC_003098.1|:c1420080-1419322
                                                                   NC_003098.1
                                CTAGAGGTTGCGTGTAATAGGGGAACTACAGCAATTGAGTTGGCACAGCG
Spr_1   A02   EMPTY             -                    -             -
Spr_1   A04   opSpV0100000095                        ref|NC_003098.1|:c1347331-1346837
                                                                   NC_003098.1
                                TGAGGTCGCAGATTTGACCATCAGCTTAGCTGGTAAAATCATCTCACAAAA
Spr_1   A06   opSpV0100000096                        ref|NC_003098.1|:c1860480-1859131
                                                                   NC_003098.1
                                GACCAAAAAGGTATCTACCCAACTTCAGCCAACTTCTCAACTGACTTGCAC
Spr_1   A08   opSpV0100000097                        ref|NC_003098.1|:c1434752-1433979
                                                                   NC_003098.1
                                TTTTTAGTGGTGGTGGACTGTCAGCTGATTTGGCTACCTATACCTTGAACG
Spr_1   A10   opSpV0100000098                        gb|AE007317|:522837-523124
                                                                   AE007317
                                AGAGCATGCAAATGATATTGTAGCAACTTATTCAGATGGTACAACTTATTA
Spr_1   A12   opSpV0100000099                        ref|NC_003098.1|:999368-1001269
                                                                   NC_003098.1
                                CGAGCCAACTAACCACTTGGATATTGAAACCATCGCCTGGCTAGAGAATT
Spr_1   A14   opSpV0100000100                        ref|NC_003098.1|:1065778-1066539
                                                                   NC_003098.1
                                AAATTTTAGAGATAGTAAATAGTAAAGGAACCATAACAGTTAAACAGATTAT
Spr_1   A16   opSpV0100000101                        ref|NC_003098.1|:927958-928569
                                                                   NC_003098.1
                                CGATTCTTTACAGAAAAAAAGGGATCGAAGTTTGGCATTTCTTGTGTCACT
Spr_1   A18   opSpV0100000102                        gb|AE007317|:273258-273502
                                                                   AE007317
                                AGAGCACCTTTCGGGGTGTTCTTTTTTTATACTTTCTTACTAAATTGGTGC
Spr_1   A20   opSpV0100000103                        gb|AE007317|:2010489-2010733
                                                                   AE007317
                                ATTTGAAGTATAGTCTCCTAAATGCACTTAGCCCTTATTATAGGGCTTTTTG
Spr_1   A22   opSpV0100000104                        -             -
                                AATTATCCTATTTTTAGGTATCATATTGTTTGGGCACCTCTTTTAGAGGTCG
Spr_1   A24   opSpV0100000105                        gb|AE007317|:305821-306051
                                                                   AE007317
                                AAGCCTTACTAGAACACTTATTTAAAGTAAAATAGAAAGAGGTGGGTCTAT
Spr_1   C02   opSpV0100000106                        ref|NC_003098.1|:187730-189262
                                                                   NC_003098.1
                                CACCCCTTACATACCAGATAAGAAGTTCATTCAGTTAGTCACGAGAGGAG
Spr_1   C04   opSpV0100000107                        ref|NC_003098.1|:c579598-579191
                                                                   NC_003098.1
                                AATTCTCCGCCAAACTTCAAGAACAGATACAGGTCTATTTTCAAGAAGAAA
Spr_1   C06   opSpV0100000108                        ref|NC_003098.1|:c214295-213261
                                                                   NC_003098.1
                                GAATTTGTTTACAAACTTAATTGACAGCCTCAGTATGGTACCTTATATTGTA
Spr_1   C08   opSpV0100000109                        ref|NC_003098.1|:c1676927-1675431
                                                                   NC_003098.1
                                AACAGTCAGTTCCCATTTGTTCATCAAAACTTTGTGAACTTGAATTTAGGTG
Spr_1   C10   opSpV0100000110                        gb|AE007317|:733855-734317
                                                                   AE007317
                                CTTATAACTGAAAGAAGCGGAAGAATAGGTATGTCTGATCTGATAGCCAG
Spr_1   C12   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_1   C14   opSpV0100000111                        ref|NC_003098.1|:628681-629328
                                                                   NC_003098.1
                                TAAACAGGGGGAAATTATAGGAATTACTGGTGCGAATGGCTCAGGGAAAA
Spr_1   C16   opSpV0100000112                        ref|NC_003098.1|:c1716851-1716369
                                                                   NC_003098.1
                                AGGAGTTACGAATATGACGCCAGAAGAAATGTACCTGACAGAGCGATTAG
Spr_1   C18   opSpV0100000113                        ref|NC_003098.1|:c1056805-1054238
                                                                   NC_003098.1
                                AAGTCCAATGCCAAAGAGACTCTCACAGGATTAAAAAATAATTTACTATTTG
Spr_1   C20   opSpV0100000114                        ref|NC_003098.1|:744090-745625
                                                                   NC_003098.1
                                ATCGAGATCCTGATCTCCTTATCGTTAGCCAGCCAACTCGTGGGTTGGAT
Spr_1   C22   opSpV0100000115                        ref|NC_003098.1|:c534610-534266
                                                                   NC_003098.1
                                AGAAGTTTTAGTAGATACGACAGATGTCGATAACTTTTTTGACAATCCAAG
Spr_1   C24   opSpV0100000116                        -             -
                                TCTTGGTCCGGGAGAACCTGTTGTTACAACTGGAGAACCTCTCTCGGTTG
Spr_1   E02   opSpV0100000117                        ref|NC_003098.1|:1175567-1176514
                                                                   NC_003098.1
                                TACGGTGACCTGTCTTGGGTCGATACTAGTTCAAGTAGCGCTAGCGAGAT
Spr_1   E04   opSpV0100000118                        ref|NC_003098.1|:795966-799094
                                                                   NC_003098.1
                                GGGAGAAAACTTGGTCAGTCCTGTCCCAGTACCTGGAGGATATCGCGGT
Spr_1   E06   opSpV0100000119                        ref|NC_003098.1|:c475642-475049
                                                                   NC_003098.1
                                TAGATGCGAGAGACTGTGGTGTCGCTGCCTTAGCCTCGATTGCTAAATTC
Spr_1   E08   opSpV0100000120                        ref|NC_003098.1|:c1884064-1882934
                                                                   NC_003098.1
                                CATGATTTTCATATGACCATTGCCTTAGGCTGTCTTGAGCGCGCCCTTGAG
Spr_1   E10   opSpV0100000121                        gb|AE007317|:620574-620915
                                                                   AE007317
                                AAGAAGGTATAATGTATTTACGTGGTCGGAGTATGCGGGAAATAGCTATA
Spr_1   E12   opSpV0100000122                        ref|NC_003098.1|:676119-677309
                                                                   NC_003098.1
                                TAAAGATGCGACTAAGGTGGATCGTTCAGCCTCTTATGCGGCTCGCTATA
Spr_1   E14   opSpV0100000123                        gb|AE007317|:667187-667599
                                                                   AE007317
                                TCTACATTGAAAGCTTAATTTCTAATAATTGAAAAAATCGAATGAAAAATTT
Spr_1   E16   opSpV0100000124                        ref|NC_003098.1|:1880756-1881655
                                                                   NC_003098.1
                                TGCTGGACTAGGAACTCGATTTTTACCAGCAACCAAGGCCCTTGCCAAAG
Spr_1   E18   opSpV0100000125                        -             -
                                ACTTATGATAAAATAGCAGAAAGTGAATGTTTCCTAAGAGCAATTGGAGGT
Spr_1   E20   opSpV0100000126                        ref|NC_003098.1|:1688139-1688999
                                                                   NC_003098.1
                                ATCTCATCCAATCTGAAACTTGTCATACCCAGACTACTGCAAAACTCATCT
Spr_1   E22   opSpV0100000127                        gb|AE007317|:1518522-1518803
                                                                   AE007317
                                TAAGCTTCAATCCCTTCTCTCTATCTGTTATTTCGCATAGCTACTACTATTT
Spr_1   E24   opSpV0100000128                        ref|NC_003098.1|:c1229161-1228058
                                                                   NC_003098.1
                                GTTTTCGAGATATGACCCGAATTGCGGAAAGCGAGCCAGGAATGTGGACC
Spr_1   G02   opSpV0100000129                        ref|NC_003098.1|:c1951484-1950333
                                                                   NC_003098.1
                                ATATTTTACCTAAGACTTTAAAACCACTGGATACAGAAGGAATCGAATATG
Spr_1   G04   opSpV0100000130                        ref|NC_003098.1|:c1831438-1831058
                                                                   NC_003098.1
                                GAAAACAAGCTAATTGAGCATGGTTTTTCATCTGTGCATAGTCAGATTCTC
Spr_1   G06   opSpV0100000131                        gb|AE007317|:928570-928881
                                                                   AE007317
                                TTTCTTGTTTAGAGGGAAAGTATTAGAGTAGCCGCTCATAATTTATACTAG
Spr_1   G08   opSpV0100000132                        ref|NC_003098.1|:210885-212222
                                                                   NC_003098.1
                                ACTGCCTTTAAAATCACTCGTATCGGTCAATTGGTTGGTCAAATGGCCAGT
Spr_1   G10   opSpV0100000133                        gb|AE007317|:1948666-1949094
                                                                   AE007317
                                GTATATCAGAAATAGTTTGTATTCACAAATCTTTCTAGTTATTCCCTTATCA
Spr_1   G12   opSpV0100000134                        gb|AE007317|:150363-150652
                                                                   AE007317
                                TCGTGTTATACTGTACTTGTAAAGCACTTGAAGCAAATCCTAGGTCGCAGA
Spr_1   G14   opSpV0100000135                        -             -
                                CATAATTTTAGTAGAAAATGAAATACATATTCCCACAATAAAACGCATCATA
Spr_1   G16   opSpV0100000136                        -             -
                                GACATTGCTTCAATGATATTAGATACAATTCGCCATTATGATTCCCAAGTTG
Spr_1   G18   opSpV0100000137                        ref|NC_003098.1|:c1909210-1908980
                                                                   NC_003098.1
                                AGCAGTGATTCAGGCAGTCGTTCTATTTTTCATCATTGGAGCGCTAGCTTA
Spr_1   G20   opSpV0100000138                        ref|NC_003098.1|:304515-305495
                                                                   NC_003098.1
                                AATTAGCTCTTCAGCTTCTAGGTGGAGTTATCTTCTATCTTTTCTATGAGC
Spr_1   G22   opSpV0100000139                        ref|NC_003098.1|:232128-233126
                                                                   NC_003098.1
                                TGATTGAGATGTACAGTGGAGGACCTGTTGGTCTAGGAACTCTTTCTGTG
Spr_1   G24   opSpV0100000140                        gb|AE007317|:2012620-2012842
                                                                   AE007317
                                TTTTTCCTCTTCTTGACTTCAACTCGCAAAACGACCCAAGGGCAACTGCTT
Spr_1   I02   opSpV0100000141                        gb|AE007317|:1899538-1900086
                                                                   AE007317
                                AGACGCAAACGTTTGCGTTACTTATAAGTATACTCCTTTTCAAGCATAATTG
Spr_1   I04   opSpV0100000142                        ref|NC_003098.1|:975615-976892
                                                                   NC_003098.1
                                TTGTGACGCGACGAGATGTCATGGAGAAGATGAGCCGTTCCCAAGTTTCG
Spr_1   I06   opSpV0100000143                        -             -
                                ATACCATGATTAGCCTCGTAAATCTGTTAAAATATTTAGGCCATCCTTTCTT
Spr_1   I08   opSpV0100000144                        gb|AE007317|:226980-227268
                                                                   AE007317
                                CTTGACTTACTCCTTGATTTACTGCATAACAATGGGATAAAAAGTGGGAGA
Spr_1   I10   opSpV0100000145                        ref|NC_003098.1|:377074-378048
                                                                   NC_003098.1
                                CCAATGATGAGTGGATTTCAAGTCGAACGGGAATACGACAAAGGCATATT
Spr_1   I12   opSpV0100000146                        -             -
                                TGTCTTTCTTCTTTATCCCTTGGGATAAACCACTTCTGGGGATAAGGATTG
Spr_1   I14   opSpV0100000147                        ref|NC_003098.1|:149499-150362
                                                                   NC_003098.1
                                AGTTGTCCAAGTTTGAACTAGGGCAGTCTATGCTGTCTGCGGATAAGTTG
Spr_1   I16   opSpV0100000148                        gb|AE007317|:440821-441112
                                                                   AE007317
                                AATCGCGGAATATCTCCTATTCTATTTTAAAGGATAAAAGTAAATCTAACAA
Spr_1   I18   opSpV0100000149                        ref|NC_003098.1|:1471711-1472229
                                                                   NC_003098.1
                                GCTTTACAGGTAAACAACTACAAGTCGGCGACAAGGCGCTTGATTTTTCTC
Spr_1   I20   opSpV0100000150                        ref|NC_003098.1|:c1365468-1363510
                                                                   NC_003098.1
                                GCAAAGGGTGTTCAATTCCCAATCCACTTGGATAAGACTGTGGAAGTAAC
Spr_1   I22   opSpV0100000151                        ref|NC_003098.1|:273609-273815, ref|NC_0030
                                                                   NC_003098.1
                                AAGCTAGAACTCTTGTGTGAAGAGTTTGGGTATAAACTTTTACCTCTTCCT
Spr_1   I24   opSpV0100000152                        ref|NC_003098.1|:c1526310-1525279
                                                                   NC_003098.1
                                GTGGCAGATCGTATCTTTATGGTTATGCGTGTTTATACTGCCAAACCCCGT
Spr_1   K02   opSpV0100000153                        ref|NC_003098.1|:c1434001-1433540
                                                                   NC_003098.1
                                TAAAATCGCCCTTGTATCCCTATTAACCGCCCTTTCTGTGGTTCTAGGTTA
Spr_1   K04   opSpV0100000154                        ref|NC_003098.1|:c1194193-1193495
                                                                   NC_003098.1
                                GAGGCATCGTTGTTGGTGGCGCTATTACTAGACCAAAAGAGATTACAGAA
Spr_1   K06   opSpV0100000155                        ref|NC_003098.1|:c1227629-1226334
                                                                   NC_003098.1
                                CTTCCACTGAAAAAAATGGGCGTCAGCATTTCAGGGCAAACTGAACGAGA
Spr_1   K08   opSpV0100000156                        ref|NC_003098.1|:561441-561686
                                                                   NC_003098.1
                                CAATTGCTTGCTACTTTAGAGAGTGAAGCTCGTAAAAAAGTTGGTTATCTG
Spr_1   K10   opSpV0100000157                        ref|NC_003098.1|:1735907-1736611
                                                                   NC_003098.1
                                TAACGGCTCTGATAATGTGTCAGAATATCTTAGAGATATATTTTCATATATG
Spr_1   K12   opSpV0100000158                        ref|NC_003098.1|:c1411424-1410831
                                                                   NC_003098.1
                                AAAAGTGGGGGTGCATGATTGAGGAGTACTTAACGACTCGGGAAAATCTC
Spr_1   K14   opSpV0100000159                        ref|NC_003098.1|:c440820-439189
                                                                   NC_003098.1
                                CAAAACCTCTACGCCGGCAATCTAATTGATCTACAGGGAGCTTTGCCAGT
Spr_1   K16   opSpV0100000160                        -             -
                                GTTTCTATTCTAGTTTTTCAAAAAGGGCAAAAAGGCCTCAATATCATAAAAA
Spr_1   K18   opSpV0100000161                        -             -
                                TAAACTTTCCTAGAAACTTTAGTTTCTTCGTCAAGTTTCCTATTTTTACTTG
Spr_1   K20   opSpV0100000162                        -             -
                                AAAAATATCCGAATCAATTGCTGATGGCGGATGTAAGTAATTTAGATGAAG
Spr_1   K22   opSpV0100000163                        ref|NC_003098.1|:947648-948958
                                                                   NC_003098.1
                                TGATGATGTGTTGTATCTCCCCTCCCACATTGCTTTCATTCAATCTCTCTG
Spr_1   K24   opSpV0100000164                        ref|NC_003098.1|:c1106260-1105451
                                                                   NC_003098.1
                                TTCTTACGCTTGGCGACTCAAACAACGAATCCTATCTGACCTTGGTCACCT
Spr_1   M02   opSpV0100000165                        ref|NC_003098.1|:c2036223-2035744
                                                                   NC_003098.1
                                AAAAAATAGAGCCAATCTTTCTGTCAGTTTTGGTCGCCTAACCTTACCCCA
Spr_1   M04   opSpV0100000166                        gb|AE007317|:925120-925802
                                                                   AE007317
                                CCAAGACAAGACGTTAATTATTTTTGGAGCGTAATAACCTATCCGTCAAGA
Spr_1   M06   opSpV0100000167                        ref|NC_003098.1|:c1150333-1149293
                                                                   NC_003098.1
                                CCAACTACATGGCTGTCTGTCATGCGGATCAGCGTTACTATCAGGGAAAA
Spr_1   M08   opSpV0100000168                        -             -
                                GAGTGGCAGGGCCACGGTTCCATCCAACTTCACAGGTGTGCACTTGATTG
Spr_1   M10   opSpV0100000169                        ref|NC_003098.1|:c2026203-2025178
                                                                   NC_003098.1
                                AATTGCTGATATGAAAGAACGTTATCAACGAGGTGGTCTTGGTGATGTGA
Spr_1   M12   opSpV0100000170                        ref|NC_003098.1|:c1416833-1416054
                                                                   NC_003098.1
                                ATACGGTGGTTCTGTTAAACCTGAAAATGTTGCTTCATACATGGCTTGCCC
Spr_1   M14   opSpV0100000171                        -             -
                                AAATTAAGCAAGGAAATGCTCTTACAATTACTGAACCTAGCATGACACGTT
Spr_1   M16   opSpV0100000172                        ref|NC_003098.1|:c817001-816411
                                                                   NC_003098.1
                                TTTGCCTCCAATGCTGTCAGTGACCATTTTTCCAAGTGATTACCGCATCCC
Spr_1   M18   opSpV0100000173                        ref|NC_003098.1|:120067-120279
                                                                   NC_003098.1
                                CCTGTATCATAAAATTACAGAGTATGTCAACAACAGGAAAATTGATATTGTT
Spr_1   M20   opSpV0100000174                        ref|NC_003098.1|:175326-176003
                                                                   NC_003098.1
                                GACAAGGTCTAAATCAGTCTAATATTCAAAGTACCTTTCAAGAACAACCAC
Spr_1   M22   opSpV0100000175                        ref|NC_003098.1|:723400-723483
                                                                   NC_003098.1
                                TGCAGGTCTAACCAATGGTGAGTTAATCGCTCCAATGACTTACGAAGAGA
Spr_1   M24   opSpV0100000176                        ref|NC_003098.1|:936148-936924
                                                                   NC_003098.1
                                AAGAGAAATTCGGTAGCTTTCACAAGACTTTAATTCATTTGCATACACCTG
Spr_1   O02   opSpV0100000177                        gb|AE007317|:1647157-1647555
                                                                   AE007317
                                AGCCGTGTCTGGATAGACTTTCGGACGCAACGCTCTATTAGATAATGAAC
Spr_1   O04   opSpV0100000178                        ref|NC_003098.1|:c1533596-1533243
                                                                   NC_003098.1
                                TGAGAAATTTGACAGATATCAAGTTATGGGGTATTTGGCTATTATTACTAC
Spr_1   O06   opSpV0100000179                        ref|NC_003098.1|:268022-268966
                                                                   NC_003098.1
                                CTTTTACGGGACCTGGATAAACTACATCAGAAGGGCTATCCAATCTTTCTC
Spr_1   O08   opSpV0100000180                        ref|NC_003098.1|:c1353557-1353063
                                                                   NC_003098.1
                                TACAGAAGAAATAAAAGACTATAGTCATGAGCCTGGTGGTTATATCTCTGT
Spr_1   O10   opSpV0100000181                        ref|NC_003098.1|:c1291616-1291422
                                                                   NC_003098.1
                                ACTTTCCCTTCTGTGTGAACAAGTGGCTTATCTAACGCAAAAGCTCTCTGG
Spr_1   O12   opSpV0100000182                        ref|NC_003098.1|:c1970994-1969711
                                                                   NC_003098.1
                                ACGGTGCTCATCCTGCGGTATTAGCTGAGAAATACAATCGTTCCTACCGT
Spr_1   O14   opSpV0100000183                        ref|NC_003098.1|:c1181484-1181314
                                                                   NC_003098.1
                                GAAAGAAAATGAATATGTAATTTTAACAACAGCCTCACTAGGGGTGATGAT
Spr_1   O16   opSpV0100000184                        gb|AE007317|:231088-232127
                                                                   AE007317
                                TGATTTTGCTTGTCTAGTAGTGGCGTATTAAATGAGAAGTGACATGTAAGA
Spr_1   O18   opSpV0100000185                        ref|NC_003098.1|:c2002563-2002111
                                                                   NC_003098.1
                                TGCAAAAGCAATTTGGAATTAAGATTGATAAACGTCATATTCAAGTACAAG
Spr_1   O20   opSpV0100000186                        ref|NC_003098.1|:c531856-530654
                                                                   NC_003098.1
                                CGAAGCTTGGCGATGGATTCACCGCCTGGTTTACCTAGCCTATATTTTAG
Spr_1   O22   opSpV0100000187                        gb|AE007317|:56907-57275
                                                                   AE007317
                                TTCACAAAATACGTTAATGATCGTATGGTTTGCGAGCGTTAGCGAGCTAAT
Spr_1   O24   opSpV0100000188                        ref|NC_003098.1|:c1504560-1503232
                                                                   NC_003098.1
                                GAAGACAAACGCATGGAAACAATCAGCGGCTGGACTCAATACTACTCACC
Spr_1   B02   EMPTY             -                    -             -
Spr_1   B04   opSpV0100000189                        ref|NC_003098.1|:899263-899811
                                                                   NC_003098.1
                                TATATTCCTAAGTCATCTCTTAACAATCCCCCATCACACTCTAACACGGAA
Spr_1   B06   opSpV0100000190                        gb|AE007317|:409091-409665
                                                                   AE007317
                                AAATTGTTCACGATTGGGGTCAGAAAGAAGTTTAAGAGCGATGAGACAGT
Spr_1   B08   opSpV0100000191                        ref|NC_003098.1|:1879718-1880734
                                                                   NC_003098.1
                                GTTATCATCATGCACGCATCAAAGGGATTAGAACCTGATAGCCATAAACGA
Spr_1   B10   opSpV0100000192                        ref|NC_003098.1|:c631721-631044
                                                                   NC_003098.1
                                CTCTGGGGAACAGCTGAAATGGGAGACTTGGTACGTGGAGCTATCACTTC
Spr_1   B12   opSpV0100000193                        -             -
                                AAAAGGTCCCCCAGACCTTTTCACTCTGTAGAGAACTAGGTGAACTAACAG
Spr_1   B14   opSpV0100000194                        ref|NC_003098.1|:c1707003-1706704
                                                                   NC_003098.1
                                CCGTAAGCTCATGAAGACTCAGGAAGAGTTGACAGAGATTGTGCGAGACC
Spr_1   B16   opSpV0100000195                        ref|NC_003098.1|:c214906-214280
                                                                   NC_003098.1
                                TCAGCTCCTTTCGTAGGAGCCTACTCCTGGGTTCTCTTGCTGGGACGAAA
Spr_1   B18   opSpV0100000196                        ref|NC_003098.1|:1539872-1540720
                                                                   NC_003098.1
                                TTTTCTTCAATCTTAGTTCTAATTTCTATGTCAATTCACTGGTAGGACTCAA
Spr_1   B20   opSpV0100000197                        ref|NC_003098.1|:327393-332696
                                                                   NC_003098.1
                                AAAATGGTACACCGGTGACTATGACCGATAACGGTAGCACCTATAAATGG
Spr_1   B22   opSpV0100000198                        gb|AE007317|:1157926-1158237
                                                                   AE007317
                                TCTTTTTAGCACCGTCCGTAGCCCGTATTCAGTTCAGCAAATACGGAGCA
Spr_1   B24   opSpV0100000199                        -             -
                                TTGATTAATTTGAACCGAGTTACTCGGTCTGTTTCTCTATATTCACCCTTCT
Spr_1   D02   opSpV0100000200                        ref|NC_003098.1|:830981-832864
                                                                   NC_003098.1
                                TGCATATGGGAACTGGTGGTATCAAGCGCCTGATTCTACAGGAGAGTATG
Spr_1   D04   opSpV0100000201                        ref|NC_003098.1|:c1673463-1672492
                                                                   NC_003098.1
                                TGCGGAATTGATTCGTCGAATCCAGATGATTTTCCAAGACCCTGCCGCAA
Spr_1   D06   opSpV0100000202                        ref|NC_003098.1|:1307118-1307765
                                                                   NC_003098.1
                                ATCCATCTATAGTTATGAAGCACACGGATTTTTATCCTCTATCGGCGTTTC
Spr_1   D08   opSpV0100000203                        ref|NC_003098.1|:c1716363-1715755
                                                                   NC_003098.1
                                TATTTTTCTTTTACTATCAAATGTTTGAGCTCTTATTTGCTAGAGAAAGCGA
Spr_1   D10   opSpV0100000204                        ref|NC_003098.1|:686482-686754
                                                                   NC_003098.1
                                AGCAGATTCACGTTCACCACGTGACGGACGTTTCATCGAAACAGTTGGAA
Spr_1   D12   opSpV0100000205                        ref|NC_003098.1|:c662449-662219
                                                                   NC_003098.1
                                TGTCAATGTTTTCCTTGAACTTTTTCGATGATAGCGTTTTCCTATCGATAAA
Spr_1   D14   opSpV0100000206                        gb|AE007317|:312761-313114, ref|NC_003098.
                                                                   AE007317
                                GAAATCCTCTGATATCTTCTTCCAGATACTTTACCTCTTATTAACTGACCTT
Spr_1   D16   opSpV0100000207                        -             -
                                CAACGATACTATTTGTCCAATTGATAAAGAAGCATGTTTTTGCTAATGCTAA
Spr_1   D18   opSpV0100000208                        ref|NC_003098.1|:916211-917185
                                                                   NC_003098.1
                                GACTAGCGCTGCGATCTTGTGGGCAGTAACAGCTATGAATAGCGTCCATG
Spr_1   D20   opSpV0100000209                        ref|NC_003098.1|:c1835499-1834558
                                                                   NC_003098.1
                                ATGCCTATGACCATAAGATAGCGTCTCTACGTTTATCTACTGTAGGCGATT
Spr_1   D22   opSpV0100000210                        -             -
                                GCTAGATATTTCCAATTGTGGAACTCTAGCTTTTTAATTTTGAGTCATTCTC
Spr_1   D24   opSpV0100000211                        ref|NC_003098.1|:c795761-793374
                                                                   NC_003098.1
                                AAATCTCTGTGAATTGCCATTTAGACCAGAGGCACAACGAGTCGTGACAA
Spr_1   F02   opSpV0100000212                        ref|NC_003098.1|:c992497-992198
                                                                   NC_003098.1
                                GAAAGTTGTCAGCATTGATTTCAATCCAGCTGTCGTTGACCCAGAGGACC
Spr_1   F04   opSpV0100000213                        ref|NC_003098.1|:272399-272845
                                                                   NC_003098.1
                                CAAAACAACATTTATGGCTAAACCAGGCCAAGTTGAACGTAAATGGTACGT
Spr_1   F06   opSpV0100000214                        gb|AE007317|:415634-416024
                                                                   AE007317
                                AGTTTTTCTTAATTAGCTCGTATCTATAGGATGATACTGAAAATCTTCTTGT
Spr_1   F08   opSpV0100000215                        ref|NC_003098.1|:1280629-1281807
                                                                   NC_003098.1
                                AACTATATTCTAGCAAAAGAGAAAAATGGAGTTCCCCTTTCAGATGTTTGG
Spr_1   F10   opSpV0100000216                        gb|AE007317|:1548388-1548763
                                                                   AE007317
                                ATTCTATCCACTTAGTGGGCAAGTTTTAGATTGATTGTTTTTGACTGTTTCA
Spr_1   F12   opSpV0100000217                        -             -
                                TTTACGTTGGCAGGCTGAACGGTCAGAAGTATCATTGTATATCATTTGTAT
Spr_1   F14   opSpV0100000218                        gb|AE007317|:1448856-1449588
                                                                   AE007317
                                TGTTACCGATAAAACCTCAATAAAAAAGCCCTCTGAAGTCAGAGAGCTGAT
Spr_1   F16   opSpV0100000219                        ref|NC_003098.1|:c1475745-1475035
                                                                   NC_003098.1
                                GGTGTTAATATTGCGGATTATAGTTCCCACCAGCGCACCAATTACCGTAG
Spr_1   F18   opSpV0100000220                        ref|NC_003098.1|:168072-170021
                                                                   NC_003098.1
                                TTCTCCCACTCAAAGAAAATACGCTCTACTATGAGAAAACTGAGCCGTCAA
Spr_1   F20   opSpV0100000221                        -             -
                                AAGGACATATAGAGACTGTAAAAATATACTTTTGAAAATCTTTTTAGTCTGG
Spr_1   F22   opSpV0100000222                        ref|NC_003098.1|:2008230-2009150
                                                                   NC_003098.1
                                TTTCATGGGTAGGTGCTGCTAAAGGGTATAAAGTCGTCATCGTTATGCCT
Spr_1   F24   opSpV0100000223                        ref|NC_003098.1|:c1440863-1439772
                                                                   NC_003098.1
                                TTGTTGTGGTTCGGACCCTCATTTTGGGCAATCCGACATCTGGTTGGACC
Spr_1   H02   opSpV0100000224                        ref|NC_003098.1|:292900-293334
                                                                   NC_003098.1
                                GAAGTTTTAATCCTAAGTGATCTCTTGGGAGGATCGCCATTCAAGGTTTCT
Spr_1   H04   opSpV0100000225                        -             -
                                AGTAGCAAAGTGATTAGCGTACTTCGCAACCGTTTCAGGGTATACTCTATT
Spr_1   H06   opSpV0100000226                        -             -
                                GGCAAGTTTTTGATGAATTTTCTGAAAAATATGATAAAATGAAGAAAATACG
Spr_1   H08   opSpV0100000227                        gb|AE007317|:1242025-1242286
                                                                   AE007317
                                TTGTATGATTGAGTAGCATGACTTCCTAGCTTAGATGGCTCGCAGCACCG
Spr_1   H10   opSpV0100000228                        ref|NC_003098.1|:913285-914541
                                                                   NC_003098.1
                                AATATGCCGAGGGTTACCCAGGACGCCGTTATTATGGTGGAACTGATGTA
Spr_1   H12   opSpV0100000229                        ref|NC_003098.1|:c179083-178139
                                                                   NC_003098.1
                                GAGGAAACCATTATCACTACGTGTTTGGAACCACTACCTGTCCTTGATGTC
Spr_1   H14   opSpV0100000230                        ref|NC_003098.1|:1936914-1938998
                                                                   NC_003098.1
                                CATTCAAGCTACTTTAGGCGTTCTCCACGACATCCCTGGCTTAATCCAACT
Spr_1   H16   opSpV0100000231                        ref|NC_003098.1|:c1969616-1969116
                                                                   NC_003098.1
                                AAATCCTAATAGGTCATTGCACTAGCGAGGTGGCCCTGACCAATACTCAG
Spr_1   H18   opSpV0100000232                        ref|NC_003098.1|:c1611091-1610936
                                                                   NC_003098.1
                                AAAATTACAGTTCTTTCTCTCACAGAGAGCTTGTGGTTGCTGGAAACAAGC
Spr_1   H20   opSpV0100000233                        ref|NC_003098.1|:459085-459285
                                                                   NC_003098.1
                                GGGTTTTATTGATAGTTTTTGCGATTCAGATTTCTTATATTTTTTGGAGATT
Spr_1   H22   opSpV0100000234                        gb|AE007317|:1289588-1290168
                                                                   AE007317
                                TCTTTAGGGAAATTATTTATTTACTTACCATAATTAAAGAGATGAGAGATAA
Spr_1   H24   opSpV0100000235                        -             -
                                ATACACTGCCTTACTAGCTATACTGAACGAGTCAACAAAAACGATATATAT
Spr_1   J02   opSpV0100000236                        ref|NC_003098.1|:c1685777-1684518
                                                                   NC_003098.1
                                TTCTTGCAACTACAGGTTTAGCTTTGTTTGGGCTCGGCGCTTGCTCCAAC
Spr_1   J04   opSpV0100000237                        ref|NC_003098.1|:478869-479504
                                                                   NC_003098.1
                                CGCTTGTATCTGAACTTTTCAGATCCATGGCCGAAAAAACGCCATGAAAAG
Spr_1   J06   opSpV0100000238                        -             -
                                AACTATGTCAGAAAAATCACAATGGGGGTCGAAACTTGGTTTTATTCTAGC
Spr_1   J08   opSpV0100000239                        ref|NC_003098.1|:401601-402851
                                                                   NC_003098.1
                                CCTTTACTCTAAGCAAGGGATAGTCGCAGAACCTGCTGGAGCGGCTAGTA
Spr_1   J10   opSpV0100000240                        ref|NC_003098.1|:238727-240106
                                                                   NC_003098.1
                                TGGTGTGAACTACTATCAACCTTTGCGTGTTATGGCTCCTCGATTTGCTAA
Spr_1   J12   opSpV0100000241                        ref|NC_003098.1|:1945106-1946617
                                                                   NC_003098.1
                                TTTTGATAGCCTGACTGGTGTTGCAATTATTTTGCTCGGTTCTCAAATCGG
Spr_1   J14   opSpV0100000242                        ref|NC_003098.1|:c1711719-1711072
                                                                   NC_003098.1
                                TCTTATACTAGTAGGCTGAGAAGTGATATTTTTAACCGAGTTTTGGATTAC
Spr_1   J16   opSpV0100000243                        ref|NC_003098.1|:823191-824318
                                                                   NC_003098.1
                                TTTTAGACGCCTCTGCGACCTGCCATATGCCTGATGTACTTGAGATGCCC
Spr_1   J18   opSpV0100000244                        -             -
                                ATAATTTCTTGCGACACGAGTCTGCCTCGTCGATTATACGAGGCAAGACG
Spr_1   J20   opSpV0100000245                        -             -
                                CCTAAGTGAGAAAATCACTTGGGATTTTTTTAATCAAGAAAATAGTTCTCAT
Spr_1   J22   opSpV0100000246                       ref|NC_003098.1|:501729-503567
                                                                  NC_003098.1
                                TTTGGCGGCATCTATTGCTACTCCAGACGTATTAATTCTTCCAGCAATGTT
Spr_1   J24   opSpV0100000247                       ref|NC_003098.1|:c1846453-1845833
                                                                  NC_003098.1
                                AGAAGGTGAGAGAGTTTATCTTCAAGTATTCGGTGCAAGATTTGCTTGTGC
Spr_1   L02   opSpV0100000248                       ref|NC_003098.1|:c1242024-1241527
                                                                  NC_003098.1
                                GGGATGGCTCGAGTTTTGTCATTCGTAAGAAGTTGACCTTCTGGCGAGAT
Spr_1   L04   opSpV0100000249                       ref|NC_003098.1|:704074-704514
                                                                  NC_003098.1
                                TAGAAGACGAACCACTTCCCCAAGTAGGGACCTTCGATGTCATTTTAGATA
Spr_1   L06   opSpV0100000250                       ref|NC_003098.1|:883412-883903
                                                                  NC_003098.1
                                GGTCTTAGGATTATCTCGCCAAGCAATCAATAACCGTGTCAAAGAATTACC
Spr_1   L08   opSpV0100000251                       ref|NC_003098.1|:1005556-1007835
                                                                  NC_003098.1
                                AATCCTAGGAAGTCGTGAATTAGGAAGCTATACACATCCAAATCAGGTGC
Spr_1   L10   opSpV0100000252                       ref|NC_003098.1|:c1352982-1351327
                                                                  NC_003098.1
                                TTTGCCTGTAAAAGACAGCGGTGCGCGTTATCGTTTGGAAGGATACCTTT
Spr_1   L12   opSpV0100000253                       ref|NC_003098.1|:204829-205011
                                                                  NC_003098.1
                                AATCGGACGCATTCCATCACAACGTAAAACTGTTGTAGCACTTGGACTTGG
Spr_1   L14   opSpV0100000254                       ref|NC_003098.1|:c1184090-1183359
                                                                  NC_003098.1
                                ACCATATCGTCTTTAATGGTCCTGATGAGCAGTTTCTAGGAGGACGCCTC
Spr_1   L16   opSpV0100000255                       -             -
                                TTGGCAGTTAGCTTGAGACTGCCAGTACAATCCTCCTATTCTGCAATATTG
Spr_1   L18   opSpV0100000256                       ref|NC_003098.1|:15161-16674, ref|NC_003098
                                                                  NC_003098.1
                                CAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACC
Spr_1   L20   opSpV0100000257                       ref|NC_003098.1|:314551-315585
                                                                  NC_003098.1
                                ACTTTATCGTTATGGACTGGCTGATGGTTCTCTAGGTCAACGTATTGGAAC
Spr_1   L22   opSpV0100000258                       ref|NC_003098.1|:c1111537-1109867
                                                                  NC_003098.1
                                ACTTGAAACGTCGTTTGGCGAATATCGTTATTGGTTATCGCTATGACCGTA
Spr_1   L24   opSpV0100000259                       ref|NC_003098.1|:1942769-1943785
                                                                  NC_003098.1
                                TGAAGATACTGCTAAAGTATTGGGACGTATGTTTGACGGGATTGAATTCCG
Spr_1   N02   opSpV0100000260                       ref|NC_003098.1|:c986925-986356
                                                                  NC_003098.1
                                AAATGAAAACAGCTATTGGTCTCATGGCACTGGATCAGAGCCGATACTTTG
Spr_1   N04   opSpV0100000261                       ref|NC_003098.1|:835350-836147
                                                                  NC_003098.1
                                CAGATGTGATTTTTCTAGGAGTTAAGCCTGCTCAGTTTTCTGAACTGCTTT
Spr_1   N06   opSpV0100000262                       ref|NC_003098.1|:1925154-1925303
                                                                  NC_003098.1
                                TGAACACAAAGAATCTGGTGAACGCTTGTACCTTACTTCTAAAAACAAACG
Spr_1   N08   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_1   N10   opSpV0100000263                       ref|NC_003098.1|:c1601562-1601116
                                                                  NC_003098.1
                                AAAGGTGAGCACAGAAAACGCTCAATTTGTATGCCAGTGGTCCAACTCCC
Spr_1   N12   opSpV0100000264                       ref|NC_003098.1|:924964-925119
                                                                  NC_003098.1
                                TGGTAAGACCTATCAAAACCACTATGTGACAATCTTAAAATGGTATGAAGA
Spr_1   N14   opSpV0100000265                       ref|NC_003098.1|:788261-788872
                                                                  NC_003098.1
                                GCTAATGCAGGAACAGTTGGTTATGGATTATCGGGAGCTGTTGGTAGTAC
Spr_1   N16   opSpV0100000266                       ref|NC_003098.1|:720608-721261
                                                                  NC_003098.1
                                ATCTCAATTCAAGAAGATAAGAAAGCGCTTTAAATATAGTAGACGTTTTCG
Spr_1   N18   opSpV0100000267                       ref|NC_003098.1|:c1392826-1392416
                                                                  NC_003098.1
                                CTTGCCAGAGATTTGCAGGATACACTCTTAGCAAATCGTGATACCTGTGTT
Spr_1   N20   opSpV0100000268                       ref|NC_003098.1|:c1165554-1164646
                                                                  NC_003098.1
                                TTTCTGGCAGATGCATCTAGTGTCGAGCTGACTCGCAATCCCCAGGGAAT
Spr_1   N22   opSpV0100000269                       ref|NC_003098.1|:726847-727536
                                                                  NC_003098.1
                                CTATTGGGGTCATGGAGTTGTGGAATGGGGCTACAACAGTTTCTACAACA
Spr_1   N24   opSpV0100000270                       ref|NC_003098.1|:394175-394660
                                                                  NC_003098.1
                                TTGTAAGAAAATCGATAGATGAGCTGTGGGATTTGGACTTGACGGCTATA
Spr_1   P02   opSpV0100000271                       ref|NC_003098.1|:1470686-1471615
                                                                  NC_003098.1
                                CTCTTTGTAGAATCAAGTGTGGATGACCGTCCAATGAAAACTGTTTCTCAA
Spr_1   P04   opSpV0100000272                       ref|NC_003098.1|:c1396442-1393746
                                                                  NC_003098.1
                                ACCTGGTGTCATGAATCATAAACCACGTGGACGCAAGGCAAGCTTCTTCT
Spr_1   P06   opSpV0100000273                       -             -
                                AACAGTCCTCAGGGGCTGTTTTTCTATGCTTTGTACTCAAAAATCTAATAC
Spr_1   P08   opSpV0100000274                       ref|NC_003098.1|:c807938-807033
                                                                  NC_003098.1
                                TTTTTGCGACCTATTCTGCCTTTGGCAACTCCTTCCATGTCGCCCTATTAC
Spr_1   P10   opSpV0100000275                       gb|AE007317|:751831-752240
                                                                  AE007317
                                GAAAATAATATGTTAGTAAACTGGAAATTAGAGTCGGATGTGAATGACTAT
Spr_1   P12   opSpV0100000276                       gb|AE007317|:1465787-1466007
                                                                  AE007317
                                CTCTAAACATCACGTCTATCAAACAAGCTAATGACGGAGTTTATGCAACCT
Spr_1   P14   opSpV0100000277                       ref|NC_003098.1|:c1068443-1067037
                                                                  NC_003098.1
                                CTATTGCTTGGTCACGTATTTTCCCGACTGGTTACGGCCAAGTAAATGCTA
Spr_1   P16   opSpV0100000278                       ref|NC_003098.1|:1113003-1113566
                                                                  NC_003098.1
                                CTTTTTTGCTACCATGCTCGTGATACACTTTCTGAGCTCACTTATCTTTAAC
Spr_1   P18   opSpV0100000279                       -             -
                                CTAGTTTCCTACAGATTTTAGTTGGAACTCGATTCAATTCATGTGACAACG
Spr_1   P20   opSpV0100000280                       ref|NC_003098.1|:c1207172-1206960
                                                                  NC_003098.1
                                ATTACAATCATCATGCTATATTGTCATTTCATTTTTAGTACGTGAAATGGGA
Spr_1   P22   opSpV0100000281                       -             -
                                AAGTTTAAAGAGCCAATCCAATATCTTAAACACTATCTTGTAAAACAGCAAT
Spr_1   P24   opSpV0100000282                       ref|NC_003098.1|:c1105420-1105118
                                                                  NC_003098.1
                                CAATGGTGTTACCATTAAAAAAGGGAGCACAAAAGATGACTACTATTACAT
Spr_1   B01   EMPTY             -                   -             -
Spr_1   B03   opSpV0100000283                       ref|NC_003098.1|:1002215-1003393
                                                                  NC_003098.1
                                GGGAAATATGCTCTATGATTATGGAAATAGTGTCTGGTTGGCTTCTATGGG
Spr_1   B05   opSpV0100000284                       ref|NC_003098.1|:1548764-1550218
                                                                  NC_003098.1
                                AACAGTATGCCCAAGAATTTGGGACAACTCGTTCTTGCCCTATCGAGAATC
Spr_1   B07   opSpV0100000285                       -             -
                                TGTGACTATCACCAATAGGAGCACACAAACAATCAGAAAAATCATGAAAAA
Spr_1   B09   opSpV0100000286                       ref|NC_003098.1|:376640-377074
                                                                  NC_003098.1
                                CGAGTTCGGTCAGAACAGGATCGTCGTGTGGTGCATCTGCATTTGACAAA
Spr_1   B11   opSpV0100000287                       ref|NC_003098.1|:940146-940742
                                                                  NC_003098.1
                                ACATGGATAATAATTGTTTCATCAAGGGTAGGACCTTAATCAGACAATTGA
Spr_1   B13   opSpV0100000288                       ref|NC_003098.1|:627173-627976
                                                                  NC_003098.1
                                GCAGTATTGGTTTATTTTATATTACTGCTATCCTGTGTTTTATCTAGTACAG
Spr_1   B15   opSpV0100000289                       gb|AE007317|:918891-919627
                                                                  AE007317
                                TGAACTTGCTTGTTGGTTTCGTGTCATAACAGTTATAGAGGCAAATAGTTA
Spr_1   B17   opSpV0100000290                       ref|NC_003098.1|:741766-742428
                                                                  NC_003098.1
                                GAAGGCACAGATGTTAAGGTTTGCACAGTAGTAGGTTTCCCTTTGGGAGC
Spr_1   B19   opSpV0100000291                       ref|NC_003098.1|:c160128-159559
                                                                  NC_003098.1
                                CTTTTTCTTGGGAACTAAACACGGTGCTGGTTCCTTCCTTCCTGGAATTAT
Spr_1   B21   opSpV0100000292                       ref|NC_003098.1|:c1260687-1260037
                                                                  NC_003098.1
                                ATCCTTTTAGTCAGGTCTTACAGATGCCTGATTTTCGTTCGTCAGCAGCTG
Spr_1   B23   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_1   D01   opSpV0100000293                       gb|AE007317|:561687-561997
                                                                  AE007317
                                CTGGTAGTTGTTCAAGTTTATTGCTACTATTTTTGATGGTATGAATGTGCT
Spr_1   D03   opSpV0100000294                       ref|NC_003098.1|:c1242526-1242287
                                                                  NC_003098.1
                                AAAGGATGGCTTGGATCGACAATACCTAACAACTGAGTCCATATATTGGG
Spr_1   D05   opSpV0100000295                        ref|NC_003098.1|:934826-935359
                                                                   NC_003098.1
                                AGAAAGAGGTGCTAATCTATTATCTCGACTCTATCGTTATCAAGATAGTCA
Spr_1   D07   opSpV0100000296                        gb|AE007317|:1277911-1278164
                                                                   AE007317
                                TTTTACAATCATAGCATTGTAAAGCAATAATATCCAGCTTGCTATGGTAATG
Spr_1   D09   opSpV0100000297                        gb|AE007317|:1596446-1596788
                                                                   AE007317
                                TGGCCAGATCATTTATCCCATCATGAATAAAATCACTCCAATTAGCTTTTGA
Spr_1   D11   opSpV0100000298                        ref|NC_003098.1|:203947-204303
                                                                   NC_003098.1
                                CTCTGGAACTGCTGATCGCCCACGTTTGAACGTATTCCGTTCTAATACAGG
Spr_1   D13   opSpV0100000299                        ref|NC_003098.1|:c1566259-1564646
                                                                   NC_003098.1
                                TTGGTTCAAGCTATGCAACGTATCGCTGGTGAATATGTAGCGGAGTCAAC
Spr_1   D15   opSpV0100000300                        ref|NC_003098.1|:904183-904764
                                                                   NC_003098.1
                                TTTCAGAAATGATGAACTTTATGGCTTTTTACAATCCTAAGTACATCATCGG
Spr_1   D17   opSpV0100000301                        gb|AE007317|:1423525-1423787
                                                                   AE007317
                                CATTATAACATAAAAACGTCTCTTTTTCAATAATTATCTGAAAATTCCTTATT
Spr_1   D19   opSpV0100000302                        ref|NC_003098.1|:c1483257-1480465
                                                                   NC_003098.1
                                ACTCAAAGACACCCTTAATCTTGGGAAAACTGAATTCCCAATGCGTGCAGG
Spr_1   D21   opSpV0100000303                        ref|NC_003098.1|:c1632900-1632631
                                                                   NC_003098.1
                                GTGAGCCAGACAAGTACCTGTTAGAGAAAGTCGAATTGTATAAGACAGAC
Spr_1   D23   opSpV0100000304                        ref|NC_003098.1|:379418-380338
                                                                   NC_003098.1
                                GATTTTACTTGTCCCCTAGTCGGCAATACAGAAGCTGCTGTGATGCAAAAA
Spr_1   F01   opSpV0100000305                        ref|NC_003098.1|:767190-768416
                                                                   NC_003098.1
                                AACCACTAGTAGTTCTGAAAGCTATTAACAGCTACTATGAGCAGGACAATG
Spr_1   F03   opSpV0100000306                        gb|AE007317|:1689932-1690138
                                                                   AE007317
                                TTCAATTAAGTTTTACGGATCTGAAGTTTTATTGTCTCTATAATATTTGTAG
Spr_1   F05   opSpV0100000307                        -             -
                                AAATGAGGAAGCAGCAGAAAAGCAAGTAAAAAGCCTCTTCCTTTAAGGAA
Spr_1   F07   opSpV0100000308                        ref|NC_003098.1|:1807407-1808858
                                                                   NC_003098.1
                                CTTGTAGCCAGTAACTTTTTTCATACTTACACCGAAGATTTCCACTTGATG
Spr_1   F09   opSpV0100000309                        ref|NC_003098.1|:78058-78744
                                                                   NC_003098.1
                                AAAATTCCTCAGTCTTGGGCAGGTCAAAGTCTGAGTAAATTAGACCTCCG
Spr_1   F11   opSpV0100000310                        ref|NC_003098.1|:1340907-1341920
                                                                   NC_003098.1
                                CCCCCATGTTCACTATACAGATTTAACACCTGACCACTATCTAGTGACCTG
Spr_1   F13   opSpV0100000311                        ref|NC_003098.1|:c1275608-1274880
                                                                   NC_003098.1
                                CATTATTTATGCTTTGAATGGCATTGTGTTACTAGTCATAGTAAGTAAATTG
Spr_1   F15   opSpV0100000312                        ref|NC_003098.1|:c1829993-1828803
                                                                   NC_003098.1
                                ACTTGAAGTTAATTACCTGTCATATTGGTAACGGAGGCTCAATTACAGCTG
Spr_1   F17   opSpV0100000313                        ref|NC_003098.1|:79054-79593
                                                                   NC_003098.1
                                TGACGGGTCTCAGGATCAGACTCAGGAAATCGCTGAGTGTTTAGCTAGCA
Spr_1   F19   opSpV0100000314                        ref|NC_003098.1|:c1707555-1707340
                                                                   NC_003098.1
                                GGACAGTTTTTTTGCCTTTAATTGCTCAGGAACCATGAAAGTCAGTACTTG
Spr_1   F21   opSpV0100000315                        ref|NC_003098.1|:c1188897-1186915
                                                                   NC_003098.1
                                TTTCCAAGATCCAATGTCTGCATTGAATCCAGTATATACAATTGGTAATCAA
Spr_1   F23   opSpV0100000316                        ref|NC_003098.1|:c737762-737238
                                                                   NC_003098.1
                                TTGACCTGTCTCTTTAGAGCCTTTAAGCGTTATCTTAAATACCGTGGAAAA
Spr_1   H01   opSpV0100000317                        ref|NC_003098.1|:450637-451917
                                                                   NC_003098.1
                                TGCTATCAAAGGGAAAACATTAAATAGTACCAGTATCTCCGAATTATTAATC
Spr_1   H03   opSpV0100000318                        gb|AE007317|:677512-677861
                                                                   AE007317
                                GTCATGGAATGGACTCATGGTTGAGATTTCTCCTTGTTGCTTGGACTTCAT
Spr_1   H05   opSpV0100000319                        ref|NC_003098.1|:c1709435-1708932
                                                                   NC_003098.1
                                TATTCCTGCATCAGGTTTTGTGGCCTTGTCCCTGTTTCGTAAGAAAATCAA
Spr_1   H07   opSpV0100000320                        -             -
                                CAGATTCAGTCTACTATATATCATAATGGACAAAGGGCAAGCTGTCAAGAA
Spr_1   H09   opSpV0100000321                        -             -
                                TGAACGATTTGCCCTATTCTTGTTTCATTTTACTATATAAACCAGAGACTGT
Spr_1   H11   opSpV0100000322                        ref|NC_003098.1|:522381-522836
                                                                   NC_003098.1
                                TGATAATCAACCTGCTACTGAAGTTCCTAGTTCAGGAATTACTGTAAAATT
Spr_1   H13   opSpV0100000323                        gb|AE007317|:292630-292899
                                                                   AE007317
                                ACTTCCTTTCAAATTTGTTAAGACTTCTCTATAACCAAATTATATTCTAGTAA
Spr_1   H15   opSpV0100000324                        ref|NC_003098.1|:1306669-1307121
                                                                   NC_003098.1
                                CTATGTCAATCAGGTCTGCGCCCCTATCTCTCCTAATAAAGACAAGGGCC
Spr_1   H17   opSpV0100000325                        ref|NC_003098.1|:620916-621929
                                                                   NC_003098.1
                                ATTGTCAATCAATTTGCTGTATCGCATAAGATATCCTACATATCAGGAGGG
Spr_1   H19   opSpV0100000326                        ref|NC_003098.1|:586941-588053
                                                                   NC_003098.1
                                TAAGTCCTACAATATGACGCGTATGGAAGTGCGGAGCCGAGTAGGAGATT
Spr_1   H21   opSpV0100000327                        -             -
                                AGATTGCAAGAATGTTGCTTAACTCATTACAAGATGATAACTTTCCATTTTC
Spr_1   H23   opSpV0100000328                        ref|NC_003098.1|:84533-85585
                                                                   NC_003098.1
                                TTGCAGGTAAGCTTTGATTCCTTGGAAGAAAGCGAACGAGAAAAGGGCTT
Spr_1   J01   opSpV0100000329                        -             -
                                CTTCAAGAGTTTTGGTTCTTAAGAAATTTCATGGTATAATGGATGGTAACC
Spr_1   J03   opSpV0100000330                        ref|NC_003098.1|:888261-888968
                                                                   NC_003098.1
                                GAAAGGTTCTCTGGTCAGGCTTGATTCGAACACTTTGCTTTATCGCTGGTA
Spr_1   J05   opSpV0100000331                        ref|NC_003098.1|:569990-570295
                                                                   NC_003098.1
                                GTATCCCAGCAATGAGCGCTCCAGTATTTGACAATATTGAAGCAGCTATTA
Spr_1   J07   opSpV0100000332                        gb|AE007317|:556440-556663
                                                                   AE007317
                                GAGGGGCTAGAGATTATCCCCTACTCGATTTCGAAATCTAGTGGAATGAA
Spr_1   J09   opSpV0100000333                        ref|NC_003098.1|:614626-615267
                                                                   NC_003098.1
                                TCTATGATGGCACTTCTCTTAAGGACATCAAGCCTTCTGTTTTCTTTAGAG
Spr_1   J11   opSpV0100000334                        gb|AE007317|:1259828-1260036
                                                                   AE007317
                                ACGATTGACACAATTGGATTTGGTTAATTCACTCTTAACGATGGTTTTAAAC
Spr_1   J13   opSpV0100000335                        ref|NC_003098.1|:c2005959-2005297
                                                                   NC_003098.1
                                TTCATTTTTAAGTGAGGAGTTGAAAAAGTACAAAGAGTATCAATTTGTTGTA
Spr_1   J15   opSpV0100000336                        -             -
                                CTATCCACAACCTCAAAACCATGTTTTGAGCTGACTTCGTCAGTTCTATCC
Spr_1   J17   opSpV0100000337                        ref|NC_003098.1|:c80040-79471
                                                                   NC_003098.1
                                AGACGACATTGGACAGTTTGCGATCTGGCAAGACAGAATGTTTGGTCAAA
Spr_1   J19   opSpV0100000338                        -             -
                                TTCACTAATCTGGAGATTTTTCAATAGACTTCGTTATTGGGCGGTTACGAT
Spr_1   J21   opSpV0100000339                        ref|NC_003098.1|:c1706374-1705748
                                                                   NC_003098.1
                                AACGTGGGGTGCTTGAATTATCAGAAGACCAAGTTGTCGGAACACCGTTC
Spr_1   J23   opSpV0100000340                        ref|NC_003098.1|:c1346286-1344781
                                                                   NC_003098.1
                                ACTACACAATCGTTGTGACAGCCTCTGCTTCACAACCATCTCCATTGCTCT
Spr_1   L01   opSpV0100000341                        ref|NC_003098.1|:1575376-1576335
                                                                   NC_003098.1
                                CAGGTATTGCCGGAGGTTCCCTCCTTCTTATCCCAGTTGCTTGTAGCCTT
Spr_1   L03   opSpV0100000342                        -             -
                                TGTTAAGCCAACATGGAACACGCGCAGGCGAACCATATATTAAGCATTTAG
Spr_1   L05   opSpV0100000343                        ref|NC_003098.1|:c1787227-1786460
                                                                   NC_003098.1
                                CAGTTGATGTCTGTCGTGGGCAATCTTCTTTATCTAGGGTTGGCTGTTTTA
Spr_1   L07   opSpV0100000344                        ref|NC_003098.1|:c738066-737815
                                                                   NC_003098.1
                                GAAGCAAACCCATCTGAAGAACTTTTCCGTGCTGCTAGCTCAGCTATCGA
Spr_1   L09   opSpV0100000345                        ref|NC_003098.1|:c1796676-1796524
                                                                   NC_003098.1
                                ACTAAAAAAAGCAAGCCTAGCTTGTGCGGTTTGTGGTTCGAGAAACTATTC
Spr_1   L11   opSpV0100000346                        ref|NC_003098.1|:c1457643-1457206
                                                                   NC_003098.1
                                GACAGGTCAACTCTTCAGTTTCCATGACAATCCGAATCCAAATTGCCCTGT
Spr_1   L13   opSpV0100000347                        ref|NC_003098.1|:c64466-60528
                                                                   NC_003098.1
                                AGCTATTTTGGGAAGAAATCAGCCCGTACTGTCGATCTTGACAACGAACA
Spr_1   L15   opSpV0100000348                        ref|NC_003098.1|:912179-912790
                                                                   NC_003098.1
                                CATTATTCTCGAAGCCAATGACCGAGTTCCCTATTGGGTAAATTCTGACCT
Spr_1   L17   opSpV0100000349                        ref|NC_003098.1|:989463-990437
                                                                   NC_003098.1
                                ACTCGTCCAAATGTAACTCGTACTTCAGGAGCCTTCCTCATGGTTCGTGG
Spr_1   L19   opSpV0100000350                        -             -
                                ATGAGTCTAGTGTTTATTTCAGTAATGGCTAGCTCCATAAGTTACGTGATA
Spr_1   L21   opSpV0100000351                        gb|AE007317|:1531844-1532169
                                                                   AE007317
                                CTAAACGATGGTATATCATACAAATTCCTCCTTTACTTATTATGTATAGACT
Spr_1   L23   opSpV0100000352                        gb|AE007317|:624096-624412
                                                                   AE007317
                                GGTTAGACGGTGAAAGGGTGGAGACTACCCATTTTTCGTGGAACCTTGCT
Spr_1   N01   opSpV0100000353                        ref|NC_003098.1|:748235-748603, ref|NC_0030
                                                                   NC_003098.1
                                TTATCGAACACAAGGGAAATTATGCTTATCGTCGGATTTATTTAGAACTAA
Spr_1   N03   opSpV0100000354                        ref|NC_003098.1|:c655971-654580
                                                                   NC_003098.1
                                GAAATTGTTCCAACTTGGTGGAACGGGTGATTATGCTCAGTTATTTACTTC
Spr_1   N05   opSpV0100000355                        ref|NC_003098.1|:846911-847411
                                                                   NC_003098.1
                                GGACATGCTTTGTCTACCTGAAGGTAAAGCTAAGGCTGATAAGTTTTTTGT
Spr_1   N07   opSpV0100000356                        -             -
                                CATATATTTCTAGCAATGATCATGGCGAATCTTGGTCTGCACCAACTTTAT
Spr_1   N09   opSpV0100000357                        ref|NC_003098.1|:c1569509-1569156
                                                                   NC_003098.1
                                CTGATGAGAAACGTGCGGAGGATATCCTCGCACTTGATGTACAAGATTTG
Spr_1   N11   opSpV0100000358                        ref|NC_003098.1|:c1917703-1916000
                                                                   NC_003098.1
                                GAAACATCGATTGTGGGAGTGATTTCGACTTGGGCGGAAAATACACCATG
Spr_1   N13   opSpV0100000359                        ref|NC_003098.1|:c1531429-1530638
                                                                   NC_003098.1
                                ATGACGAGTTTGATGCAAGCTAGCTATGGGGATGTAAGTTTGATGAAACT
Spr_1   N15   opSpV0100000360                        -             -
                                CACTTTTGTTCACTAGCAGAAACTAGAGAGCAGAAGTGTTTTTCTGTTCAG
Spr_1   N17   opSpV0100000361                        ref|NC_003098.1|:800243-801748
                                                                   NC_003098.1
                                ACATCTTAGCATTGACATTTGACGAATTGACAGAACGTGGCTTGATGTTGA
Spr_1   N19   opSpV0100000362                        ref|NC_003098.1|:707956-709290
                                                                   NC_003098.1
                                GATTTTGTCTTTACTTGCCAGTCTCTATCTAGCTAGGGTCAGTGTTAGGCC
Spr_1   N21   opSpV0100000363                        ref|NC_003098.1|:c1081668-1080001
                                                                   NC_003098.1
                                AAGATTAGTAATGACCATTCAACGGTTTCGACTGTTCGTCTCTTGACGGTC
Spr_1   N23   opSpV0100000364                        ref|NC_003098.1|:c1419252-1418722
                                                                   NC_003098.1
                                TCGATACCTTGACTATGCACGCGGATGCCATTAAGCCAGGTCAACGTGTT
Spr_1   P01   opSpV0100000365                        ref|NC_003098.1|:c1149276-1148407
                                                                   NC_003098.1
                                GTCTTCTCCTTAGAGAAAAGACTGGCTGACTTAGGTGTTGACAGAAAATCT
Spr_1   P03   opSpV0100000366                        -             -
                                TTGAAAATCTCTTCAAACCACGTCAGCTTCGCCTTGCTGTATATATGGTTA
Spr_1   P05   opSpV0100000367                        ref|NC_003098.1|:353760-355529
                                                                   NC_003098.1
                                ACTTCTCAGCTGGTCTCGTTGGTTTTGCATTATTGCTTTTGGCTTTCTACG
Spr_1   P07   opSpV0100000368                        ref|NC_003098.1|:14827-14898, ref|NC_003098
                                                                   NC_003098.1
                                CGTTGGTCAAGGGGTTAAGACACCGCCTTTTCACGGCGGTAACACGGGT
Spr_1   P09   opSpV0100000369                        ref|NC_003098.1|:c1537087-1536191
                                                                   NC_003098.1
                                TGAGATTAAGCTGTCTGAGGTCCTGATTTTAGATGATATTGGCGCCGAGC
Spr_1   P11   opSpV0100000370                        ref|NC_003098.1|:c1485447-1485184
                                                                   NC_003098.1
                                TAATTCGTATGATTTATAATGCAGTGGATATTTACTCCCTGATTTTGGTAGC
Spr_1   P13   opSpV0100000371                        ref|NC_003098.1|:c216368-216000
                                                                   NC_003098.1
                                ATTTTATTATCTCTCAAGAAGTACAAGATACACTTGGTACAACCACTACTAA
Spr_1   P15   opSpV0100000372                        ref|NC_003098.1|:601207-602046
                                                                   NC_003098.1
                                AACCAATCCTTGGAACCGCCGCAATATTATTTCGCTCTGGGATTACCAAGC
Spr_1   P17   opSpV0100000373                        gb|AE007317|:1806104-1806562
                                                                   AE007317
                                AACTAAATAACTATAAGAAGTAGATCAGGTGAACAATTTCAGTACCTACTC
Spr_1   P19   opSpV0100000374                        ref|NC_003098.1|:c1423524-1422736
                                                                   NC_003098.1
                                GAAAAATATTCGTCGTCGTACTGCTGTCACCATGGCGGTCAATACCCTTTC
Spr_1   P21   opSpV0100000375                        -             -
                                CTGACCAGTTTGTTCTACACTTTCAGGGATGGAATAGACAGCAAAAAGAAC
Spr_1   P23   opSpV0100000376                        ref|NC_003098.1|:c1776061-1775501
                                                                   NC_003098.1
                                ACAATTTGAACATGAGAGTCAGTTTGACATTAGTCGTAGCGATTTGATTCG
Spr_2   A01   EMPTY             -                    -             -
Spr_2   A03   opSpV0100000377                        ref|NC_003098.1|:c1588733-1588494
                                                                   NC_003098.1
                                TTTCAGGGAAAAGAAAACTTTTCTTCCGGGAAGATACTCCAAAAGAGATTT
Spr_2   A05   opSpV0100000378                        ref|NC_003098.1|:123810-124184
                                                                   NC_003098.1
                                GGGGTACGAGTTGCAAATAGAGTGGCAGGATTTGCACTGTCTGCTATTAA
Spr_2   A07   opSpV0100000379                        ref|NC_003098.1|:312433-312606
                                                                   NC_003098.1
                                GCTGCTTGCGGCCAATCAGGTTCAGATACAAAAACTTACTCATCAACCTTT
Spr_2   A09   opSpV0100000380                        ref|NC_003098.1|:690411-690650
                                                                   NC_003098.1
                                TTAATGGTGCCCCTGCAAAGTTTGATATTCGTGCTTGGAGTCCAGACCAT
Spr_2   A11   opSpV0100000381                        ref|NC_003098.1|:523650-524927
                                                                   NC_003098.1
                                TAGCCAAACCCTTTTGGGCAATAGTGAAGCTCAAGTCAGTGCAGCACGCT
Spr_2   A13   opSpV0100000382                        ref|NC_003098.1|:569431-569952
                                                                   NC_003098.1
                                GCTTAGAAGCGGATAATCAAGAACAACTCTTTGATCAGGTTGCAACTTTAT
Spr_2   A15   opSpV0100000383                        ref|NC_003098.1|:c2000713-2000447
                                                                   NC_003098.1
                                GGGACAAGTCGTAGAAATGACTTTGGAGAATGGTCGTAAGCGCCAAAAAA
Spr_2   A17   opSpV0100000384                        ref|NC_003098.1|:c1623082-1622786
                                                                   NC_003098.1
                                TTCACAAAATCAGTATTTTTGGATTATTGGTGGAGCTACAGATTTATATAAT
Spr_2   A19   opSpV0100000385                        ref|NC_003098.1|:480153-481289
                                                                   NC_003098.1
                                TGGATGCTATCGGTACAATCGTTGGACGTGGTGGTGCTAATATCAAGAAG
Spr_2   A21   opSpV0100000386                        ref|NC_003098.1|:c1691148-1691076, ref|NC_0
                                                                   NC_003098.1
                                CGGTAGCTCAGTTGGTAGAGCAATGGATTGAAGCTCCATGTGTCGGCGG
Spr_2   A23   opSpV0100000387                        ref|NC_003098.1|:c1708366-1707692
                                                                   NC_003098.1
                                TTTGCTTATAAGTCCATTGAGTCCATCCTTAGACGTCATCTCACTTCGGCA
Spr_2   C01   opSpV0100000388                        ref|NC_003098.1|:1450858-1451067
                                                                   NC_003098.1
                                GTCATATTATTCTTTTATTGGCCACTTTATGAGTTGTTCTTACTAGTTGTTT
Spr_2   C03   opSpV0100000389                        ref|NC_003098.1|:37744-38736
                                                                   NC_003098.1
                                AGACTCATGGCTCAAGCGATGCCAAGGCTGTTTATAGTACGATTCGTCAG
Spr_2   C05   opSpV0100000390                        gb|AE007317|:56907-57275
                                                                   AE007317
                                AAGACCTTGGGTTTCCAATTTAGGCATGAGACACCTTTGGTGGCTGCTGC
Spr_2   C07   opSpV0100000391                        ref|NC_003098.1|:c1819132-1818041
                                                                   NC_003098.1
                                TTGGAAAATGCGAAAAGATCGCTTGCAATACGATTTCCATCCATTTATCTG
Spr_2   C09   opSpV0100000392                        gb|AE007317|:739678-739883
                                                                   AE007317
                                ATAATCTGCCTGATTATAGATGATAAACTTTTTGTTTTTATCTGGACTGTGA
Spr_2   C11   opSpV0100000393                        gb|AE007317|:1804024-1804232
                                                                   AE007317
                                TTGTCAAGACAATTGTATTTTTTTTGTGTATAATAGTCAAGTACCAATAGGA
Spr_2   C13   opSpV0100000394                        gb|AE007317|:1179038-1179471
                                                                   AE007317
                                GAAAGAATTTTTAGAAAATTTCTGTTTTTTCTTTACAGTGAAAAAAAATTCTG
Spr_2   C15   opSpV0100000395                        ref|NC_003098.1|:1037929-1039494
                                                                   NC_003098.1
                                CCTCATCGTTGGAATTATCGTCGGATCCTTTCGTTTCTTAATTGAAAAGGG
Spr_2   C17   opSpV0100000396                        ref|NC_003098.1|:1901454-1902761
                                                                   NC_003098.1
                                AGGAGTTAATATGGAAAAGCAACAACCTAGTAAAGCAGCCCTGCTGTCTA
Spr_2   C19   opSpV0100000397                        ref|NC_003098.1|:c1573522-1572932
                                                                   NC_003098.1
                                TTCGGGACGCGGGTATTGGCATTATCGTAGTGTCAAATAACACCAAAAAA
Spr_2   C21   opSpV0100000398                       ref|NC_003098.1|:c1450628-1449999
                                                                  NC_003098.1
                                ATCAGCTTCTTGCTGGAACACAGACACGTTTTCTAGTTGTAGGGGGAGCA
Spr_2   C23   opSpV0100000399                       -             -
                                ATCATCTTCAACTCATCAACGACCAATGGTGACAAGGTGGATTTCAATCCC
Spr_2   E01   opSpV0100000400                       ref|NC_003098.1|:977840-978547, ref|NC_0030
                                                                  NC_003098.1
                                CAGCGTACCACTTTTGAAGAGATGTTAGCTGTATTAAAAACAGCTTATCAA
Spr_2   E03   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_2   E05   opSpV0100000401                       gb|AE007317|:393907-394174
                                                                  AE007317
                                AAAAATTGTAAACCGTAATGGGACTTCATCTAAAATCTCCACTGGTATGGT
Spr_2   E07   opSpV0100000402                       ref|NC_003098.1|:1003486-1005444
                                                                  NC_003098.1
                                TATCCAGAGCAAGTGCTAGCAGACAGTCCGACTCATCGTGTTGGTGGCAA
Spr_2   E09   opSpV0100000403                       ref|NC_003098.1|:553724-554440
                                                                  NC_003098.1
                                ATAAAGGTGATTACTACAGCATTCAAGGGAAATACGATGAAATCATCGTAG
Spr_2   E11   opSpV0100000404                       ref|NC_003098.1|:c426918-425479
                                                                  NC_003098.1
                                AACGACGGAATTGCCCACTATGGCAGCTCACTGATTACCTATCTGGTCAG
Spr_2   E13   opSpV0100000405                       ref|NC_003098.1|:c1225023-1223749
                                                                  NC_003098.1
                                TTGGCCATGGTATTCATGTTTTTGCGTGGTTACCAAGATGCTAGCGCAAAG
Spr_2   E15   opSpV0100000406                       ref|NC_003098.1|:764775-764969
                                                                  NC_003098.1
                                CTATTTTTTCAATGAAGCCTGGATGACTGGCCGCTATATTATGGCAGCCTT
Spr_2   E17   opSpV0100000407                       ref|NC_003098.1|:824315-825400
                                                                  NC_003098.1
                                CGATACGCAGGTGAACGACTAGCAGCTTCCTACGTAAACTTTTATATCGC
Spr_2   E19   opSpV0100000408                       ref|NC_003098.1|:219268-220248
                                                                  NC_003098.1
                                GATTTAATTCACAGTAAAAGTGTCCGAAATGTTCACTTCTATCCTCTAGCA
Spr_2   E21   opSpV0100000409                       ref|NC_003098.1|:233107-233679
                                                                  NC_003098.1
                                GGAATTGAAAAATCAGGTCTATATGCATCAGCACAGTCCTCACACTGCTTC
Spr_2   E23   opSpV0100000410                       ref|NC_003098.1|:c1371351-1370416
                                                                  NC_003098.1
                                GAAACTGCAAGCCCACTTTACATGCGTTTGGAGCCAGTTGGATCAGCGTC
Spr_2   G01   opSpV0100000411                       ref|NC_003098.1|:646986-649238
                                                                  NC_003098.1
                                CATATCCAGCTTCAAAAGGGAATTCCAGCTGAGATTACCTTTCATCGTGCT
Spr_2   G03   opSpV0100000412                       ref|NC_003098.1|:240298-242106
                                                                  NC_003098.1
                                AATGGGAATTCCAAGCTTAACAGTGACAAACGTTCCAGGTTCAACCCTCTC
Spr_2   G05   opSpV0100000413                       ref|NC_003098.1|:2022029-2022397
                                                                  NC_003098.1
                                TTGGAATTACACATAGCGGAGGAGCTATTAAATCATTTCTCTCTGAACATT
Spr_2   G07   opSpV0100000414                       gb|AE007317|:1870743-1871056
                                                                  AE007317
                                AACGCCAAATCCTATTCGGACTTTGGCTAGGCGCTTCACTAGTTTTAGGAC
Spr_2   G09   opSpV0100000415                       ref|NC_003098.1|:c1609443-1608877
                                                                  NC_003098.1
                                TCGTTCGACTGATGACCAAGCCATCATGGGGATTCAACATAAAAACCTACC
Spr_2   G11   opSpV0100000416                       ref|NC_003098.1|:c454903-453335
                                                                  NC_003098.1
                                TATGAGGAAGTACCTTGTGAAATACCAGAAAGTTGGGAATGGGTGAGGTT
Spr_2   G13   opSpV0100000417                       -             -
                                GCTATTACTAAAATTACAGCTACTATAAAACAATGTAAGGCTTACAGAACG
Spr_2   G15   opSpV0100000418                       ref|NC_003098.1|:416025-416195
                                                                  NC_003098.1
                                CTATCTTATCCTGTTCCTAAATATGTTGGTAGAAAAATGAAGCAGTTGTTAC
Spr_2   G17   opSpV0100000419                       ref|NC_003098.1|:124191-124373
                                                                  NC_003098.1
                                AGCGAAGAAATAAAAAAGTTGATTATTTGGATGAATGTCGTTTTTTTGATTT
Spr_2   G19   opSpV0100000420                       ref|NC_003098.1|:470513-471853
                                                                  NC_003098.1
                                ATCGATATTTCTGAAATCTTCTCCTTTGGAGCAAGTTCTAAAGGGGAGGAG
Spr_2   G21   opSpV0100000421                       ref|NC_003098.1|:c1664941-1663931
                                                                  NC_003098.1
                                GTGAGTCATCAGCTGAATTAACCCTGGAAGAAAAAAATAGTCAATCTCACC
Spr_2   G23   opSpV0100000422                       ref|NC_003098.1|:c828742-828545
                                                                  NC_003098.1
                                TAGAAGTTTTCCAAAAAGGAAAAAAGAACATCCTATTCTTCTTAACTATCTT
Spr_2   I01   opSpV0100000423                       ref|NC_003098.1|:1114387-1114902
                                                                  NC_003098.1
                                CCGAAACACAACAAGACCTCCACTATATCGAGGAGGCCTTGGATCAGCTA
Spr_2   I03   opSpV0100000424                       ref|NC_003098.1|:108506-109303
                                                                  NC_003098.1
                                GCGAAAGATTTGCTACAAAATTCTTCCCTCGTATCTCTGCCTAAAAATGGG
Spr_2   I05   opSpV0100000425                       ref|NC_003098.1|:c496857-496468
                                                                  NC_003098.1
                                CAACTTAGAACAAGTGAAGAGTATGTTAGAACAGGCCTTTACAGAGAAATA
Spr_2   I07   opSpV0100000426                       gb|AE007317|:1717899-1718121
                                                                  AE007317
                                GTTTTGAAAAGCAAAAAACGCATAATATCAGGTCTTGAAAAACCTTGATAC
Spr_2   I09   opSpV0100000427                       ref|NC_003098.1|:c1269159-1268770
                                                                  NC_003098.1
                                CTGAGCAATCATCTATTCCTTCGTATCCTGTATCTGTTACATCTAACCAAG
Spr_2   I11   opSpV0100000428                       ref|NC_003098.1|:1761235-1761513
                                                                  NC_003098.1
                                GTGGCATCACAGGTCGAGTATGGAATAACGACGATGGCACAGTGGAAATC
Spr_2   I13   opSpV0100000429                       ref|NC_003098.1|:c1868445-1865872
                                                                  NC_003098.1
                                ATCAAGGAACAGAGAGTCCTCCTCCCATGAGACAAACTAGTGCTGTCACT
Spr_2   I15   opSpV0100000430                       gb|AE007317|:1940790-1941477
                                                                  AE007317
                                TTTTATCCTTTCACACAAACATTTCTCTTTATACAGATCCAAGTGATAACCA
Spr_2   I17   opSpV0100000431                       ref|NC_003098.1|:c1086485-1086183
                                                                  NC_003098.1
                                ATGGCCAATTTGAGTCAAGGGTTGTCACTTTACCTCATGACGCATCATTAC
Spr_2   I19   opSpV0100000432                       ref|NC_003098.1|:142595-143809
                                                                  NC_003098.1
                                AGATAGTTGCAATAAATAACGGAATTAATGTATCAAATAGCGATTTAGATG
Spr_2   I21   opSpV0100000433                       ref|NC_003098.1|:20207-20554, ref|NC_003098
                                                                  NC_003098.1
                                AAACTATCTTACTGACAATCCAGATGCTTATTTGACTGAAATAGCTTCTGAC
Spr_2   I23   opSpV0100000434                       ref|NC_003098.1|:620916-621929
                                                                  NC_003098.1
                                TCAGGAGGAGTAGCTTTTTTATCTGCTATTGGGCAGTTCACTGTTATAGAA
Spr_2   K01   opSpV0100000435                       ref|NC_003098.1|:1062287-1064446
                                                                  NC_003098.1
                                GGCCTTTACGAATGGAAGAGGGAAAATAAACAAACGACACGTGACTTGTC
Spr_2   K03   opSpV0100000436                       -             -
                                CCAATTTCTTTTAGTAGTTATTAACTTGGCTTCTATTTTGGTTACTGTTTAT
Spr_2   K05   opSpV0100000437                       -             -
                                AAAGGAATTTCACAACGTTTTATCTAGTGGTCAGTTGCTTGCAGACAAAAG
Spr_2   K07   opSpV0100000438                       ref|NC_003098.1|:c1104793-1102916
                                                                  NC_003098.1
                                TAAAAGATCGAACGACAAAGAAATCAATTGTTTGGGCTACGCATTCTTATG
Spr_2   K09   opSpV0100000439                       -             -
                                GCTTATCCATGAGGCGTTAAAAGAGGCTGTCAGTCAGGGTAAAGCAAACT
Spr_2   K11   opSpV0100000440                       ref|NC_003098.1|:c1682433-1680991
                                                                  NC_003098.1
                                TAGTGCCGAGTATAACAACTTAGATATCTACCAAATCAATTCAACCTACTAT
Spr_2   K13   opSpV0100000441                       -             -
                                GAAACAGCTTAAAATAAGGCTTTCCGAGTTTTCGGAGAGCCTGTTTTTTTG
Spr_2   K15   opSpV0100000442                       ref|NC_003098.1|:c290112-289483
                                                                  NC_003098.1
                                TGTGCAATCTCTACAGCACACCGTACATTCCAGGCTGTATTACCCTCACAG
Spr_2   K17   opSpV0100000443                       ref|NC_003098.1|:c1691762-1691677, ref|NC_0
                                                                  NC_003098.1
                                GGGTGGCGGAACTGGCAGACGCACAGGACTTAAAATCCTGCGATTGGTA
Spr_2   K19   opSpV0100000444                       -             -
                                TGTTTAAGAAAATAGTTGCTGTATTAGTTATTGGCTTAATTCTGTTAGGAAT
Spr_2   K21   opSpV0100000445                       ref|NC_003098.1|:612603-614624
                                                                  NC_003098.1
                                ATATTTATATGCAAGCTATGATTCCGTTTCTTTACTTCGTGTCAAAAAAGAT
Spr_2   K23   opSpV0100000446                       -             -
                                ACAGCTTTCTCTGCTTGTTTTCAGCAACCACAAGCTCTCTGTGAGAGAAAG
Spr_2   M01   opSpV0100000447                       -             -
                                CCACGGGGATTTGCTCTACCACGATGGACTTTTCTTTTCAGCTAAAAAAGA
Spr_2   M03   opSpV0100000448                       gb|AE007317|:1316371-1316629
                                                                  AE007317
                                TTTGATATGCACCTTAGGTACTGGGGACGTCGCTAACTAACTCTGTGAGT
Spr_2   M05   opSpV0100000449                       ref|NC_003098.1|:c2025026-2023548
                                                                  NC_003098.1
                                TTGTTACTGCTCCTGTGGGTACGGATCTTGCAACGGCTGAGAGTATTCTT
Spr_2   M07   opSpV0100000450                       gb|AE007317|:387127-387423
                                                                  AE007317
                                ACCGACAATCTGAGATTAACGATTCTCTGCCATAGTTTTTTTAACTTTCTCA
Spr_2   M09   opSpV0100000451                       ref|NC_003098.1|:905279-906355
                                                                  NC_003098.1
                                TTGGTTGTTCCAGAGGTCAATGCTCATGCACTTGATGCTCACAACGGAAT
Spr_2   M11   opSpV0100000452                       ref|NC_003098.1|:c862879-861197
                                                                  NC_003098.1
                                GAAAAACTTTCCGCTTTCCGAAATTTTTTCAATCAAGAAACCAAGCCATGC
Spr_2   M13   opSpV0100000453                       ref|NC_003098.1|:c1222689-1221532
                                                                  NC_003098.1
                                CAAATCATTGAGAGCAATCAAGAGGCAGCTCAGGCGATTACTAATTACATG
Spr_2   M15   opSpV0100000454                       ref|NC_003098.1|:997722-998561
                                                                  NC_003098.1
                                GACCTATGCAAAGATGGTGGCCAGATTCTTGCTATTCATATGTCCCATGCT
Spr_2   M17   opSpV0100000455                       ref|NC_003098.1|:c2033994-2033242
                                                                  NC_003098.1
                                CCATGACAGATATTCAGGAAAAGGACAAACATACTCAGCGATTTTATTCTC
Spr_2   M19   opSpV0100000456                       ref|NC_003098.1|:c1662245-1661517
                                                                  NC_003098.1
                                TTTTGAAGGACCCCTGGACTTGCTCTTGCATCTGGTTTCTAAGTACCAGAT
Spr_2   M21   opSpV0100000457                       ref|NC_003098.1|:c880222-879422
                                                                  NC_003098.1
                                TATCACTGAACTTCAAAAGCGGAATGTCCCAGTTGCTGTCTACGCTTATGT
Spr_2   M23   opSpV0100000458                       ref|NC_003098.1|:c1404831-1403479
                                                                  NC_003098.1
                                TGTTCTTAGTCAACATGAAACGGAAGCGCCGAAAGTCTTTGTAGGACGTG
Spr_2   O01   opSpV0100000459                       -             -
                                GGATGCCACTAGTAATATTGGTAAACCAAGCTACTGGCAGAGCAACACCT
Spr_2   O03   opSpV0100000460                       ref|NC_003098.1|:c1859007-1857547
                                                                  NC_003098.1
                                GAACGTTCACAACTTGAAAACCTTCGCTGGTTAGGCATGGATTGGGATGA
Spr_2   O05   opSpV0100000461                       ref|NC_003098.1|:748235-748603, ref|NC_0030
                                                                  NC_003098.1
                                GGACCAAGAGCTTAAAGCTGAAATTCAATCCATTTTTATCGAACACAAGGG
Spr_2   O07   opSpV0100000462                       gb|AE007317|:1618842-1619050
                                                                  AE007317
                                TTTATATTTGACATCGGTGTCACTATGTTTACATTATACAATGAAACCGTTT
Spr_2   O09   opSpV0100000463                       gb|AE007317|:1048776-1049059
                                                                  AE007317
                                TTTGAAGTAGTATGCCAACACGCACATGTACGACAATAATAGCTTCTAACT
Spr_2   O11   opSpV0100000464                       ref|NC_003098.1|:500872-501711
                                                                  NC_003098.1
                                AGAGTTAGGTATTGAACTTCCAATTGACGAAGCTGCATTCATAGCGCTACA
Spr_2   O13   opSpV0100000465                       ref|NC_003098.1|:c1860646-1860467
                                                                  NC_003098.1
                                TTTTAGAATGTGGCATTTTACGCAAACGTTTGAATTCTGATAAAAATTGGAG
Spr_2   O15   opSpV0100000466                       ref|NC_003098.1|:c1277576-1276851
                                                                  NC_003098.1
                                ACGTGAACTGGCTACAGGATTTTACTATGGTACACCATCTGAAAATGAGCA
Spr_2   O17   opSpV0100000467                       -             -
                                ACTTGAGCGTAAGTTCGCAGCCAAAGAACGTAAGCGTAACAAACCAGGTG
Spr_2   O19   opSpV0100000468                       ref|NC_003098.1|:915523-916137
                                                                  NC_003098.1
                                GAAACAAAAGGAAAAGAAGGCGATGTTATGCAGTCTAGTGAGTCTGCAAG
Spr_2   O21   opSpV0100000469                       -             -
                                ACAAGGCTTGTTTAAGAAAGAATTCAAAGACCTTGACAAATAAAAATAAAAT
Spr_2   O23   opSpV0100000470                       ref|NC_003098.1|:c1140473-1139817
                                                                  NC_003098.1
                                TTTATCCAGCCTTCCATATGAGCAAGCGCTACTGGATTAGTGTGTCCCTTG
Spr_2   A02   EMPTY             -                   -             -
Spr_2   A04   opSpV0100000471                       ref|NC_003098.1|:c1678973-1676994
                                                                  NC_003098.1
                                AGGTGTACTTGCAGCATGCAGTTCTTCAAAATCATCTGATTCATCAGCCCC
Spr_2   A06   opSpV0100000472                       -             -
                                CATTTCTTGATTAAGCATGTCTACCACAAAGGAGAACAAACGGTAGATAGA
Spr_2   A08   opSpV0100000473                       -             -
                                GATGATAATATAAAGATGTATCACTTGGTATAGAAGCTTTGGTATTAAGTTT
Spr_2   A10   opSpV0100000474                       ref|NC_003098.1|:392362-393906
                                                                  NC_003098.1
                                TAGCTACCCTATGAACTGGCCTATCGGGATGGGGAAAGCCTTTGAGGGC
Spr_2   A12   opSpV0100000475                       -             -
                                TCCAACTCAAGGGGCATGCGGAACTTTCGCAGATTTATAGCCAGTATGAG
Spr_2   A14   opSpV0100000476                       ref|NC_003098.1|:1923594-1924601
                                                                  NC_003098.1
                                ATGTGATAGCGCCCTCCGTAATATTGTCCGCATCTATCCTTACGATGTGTC
Spr_2   A16   opSpV0100000477                       ref|NC_003098.1|:c1796514-1796338
                                                                  NC_003098.1
                                TTTTAGACTTCTTAAAGACACAACATGGCCAACTCGCAAGGAAAGCTGGAG
Spr_2   A18   opSpV0100000478                       ref|NC_003098.1|:862957-863454
                                                                  NC_003098.1
                                TCACAGCTTTGAGCGTGAGATGGGCTTCTTGGCAGTACACGGCTTTTTAC
Spr_2   A20   opSpV0100000479                       ref|NC_003098.1|:38742-38975
                                                                  NC_003098.1
                                CATTATCCAAGAGCGACAGGGAGAGGACTTTGTCGTGACAGAATCCTTGA
Spr_2   A22   opSpV0100000480                       gb|AE007317|:104786-105241
                                                                  AE007317
                                AAATTCACTTCAGATACTTGACAGTTATTATATTTTCGCTTATGCTTATTAT
Spr_2   A24   opSpV0100000481                       ref|NC_003098.1|:10335-11612
                                                                  NC_003098.1
                                ACCATGCTGATGATCAGGTGGAAACGATTTTTATGCGCTTGATTCGAGGA
Spr_2   C02   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_2   C04   opSpV0100000482                       ref|NC_003098.1|:c1072746-1071766
                                                                  NC_003098.1
                                CAGGTTATGACACAACAAGCACAAAACGCTTGCCAGACTGCTTGGATGTT
Spr_2   C06   opSpV0100000483                       ref|NC_003098.1|:1064634-1065596
                                                                  NC_003098.1
                                TTTGGCTCGATACACGTATTCCCTTATCAAACGACTTGGATGACTGGAGAA
Spr_2   C08   opSpV0100000484                       ref|NC_003098.1|:527198-527281
                                                                  NC_003098.1
                                AAAGGAATTTCACAACGTTTTATCTAGTGATCAGTTACTTACAGACAAAAG
Spr_2   C10   opSpV0100000485                       ref|NC_003098.1|:c1718995-1718441
                                                                  NC_003098.1
                                AGAATTGGGAGAGTATCAAGGAAGTCAGAAAGATGAGAAAGCGCAGCTTT
Spr_2   C12   opSpV0100000486                       ref|NC_003098.1|:3000-4115
                                                                  NC_003098.1
                                AGGCTTTATTCGTGCAGTAACCATGTCATATGAAGATCTAGTGAAATACGG
Spr_2   C14   opSpV0100000487                       ref|NC_003098.1|:1717094-1717357
                                                                  NC_003098.1
                                CTCAAGCACAAACTCCACGTAAATCCAGCAAACTCAAGCCACTAACAGTTG
Spr_2   C16   opSpV0100000488                       ref|NC_003098.1|:c1595308-1593995
                                                                  NC_003098.1
                                GTTATCTGTTGTTGCGGGGCTATCGTTAGCTATACTTGCAGGTTGTAGTG
Spr_2   C18   opSpV0100000489                       -             -
                                GAATTAATGGATCTGCTAGGTATAAGTGCTACAACCCTTGATAACTGGGAG
Spr_2   C20   opSpV0100000490                       -             -
                                GCTGTAAAGTAAGAATTACAAAGGATTTGAGACGTTTGCTTCAAGTCTTTT
Spr_2   C22   opSpV0100000491                       ref|NC_003098.1|:c1744200-1743787
                                                                  NC_003098.1
                                AACCAGATGGTGTAAAAAGAGGGCTAGTGGGTGAAGTGTTAAAGCGCATC
Spr_2   C24   opSpV0100000492                       ref|NC_003098.1|:788951-792301
                                                                  NC_003098.1
                                AATGGGTTGAAGCACTATATACTTGATGGTCCGAACCGCCGCCAGATTGC
Spr_2   E02   opSpV0100000493                       ref|NC_003098.1|:c1698919-1697564
                                                                  NC_003098.1
                                AGATTCCAATCACGGATGAGAGAAAAGTTCTAGGTGTCCGTACTATTATGG
Spr_2   E04   opSpV0100000494                       ref|NC_003098.1|:272865-273257
                                                                  NC_003098.1
                                AAGTAGACCCAGACTTCCGCGATTCATTGAAACGCGCAGGACTTCTTACA
Spr_2   E06   opSpV0100000495                       ref|NC_003098.1|:c1844119-1843781
                                                                  NC_003098.1
                                ACGGTATCAGATTTTACTGTTTTTGCTGGAGCATTCTCCTTGTAACCAAAT
Spr_2   E08   opSpV0100000496                       -             -
                                AAGTCTTGGAAAATGGTATGTCTCGACTGGTAAAGAATGGATTTGTCATTC
Spr_2   E10   opSpV0100000497                       ref|NC_003098.1|:c1283326-1282334
                                                                  NC_003098.1
                                AATATTAAATTGTAAGATGGACGCTCCTGCCGCTGATTTTTTCTTTAAAGC
Spr_2   E12   opSpV0100000498                       ref|NC_003098.1|:914516-915523
                                                                  NC_003098.1
                                CAATCATATTACAGACGATTTGTTGGAGACATCAGTAACGCTGGCTAATCT
Spr_2   E14   opSpV0100000499                        ref|NC_003098.1|:821075-821935
                                                                   NC_003098.1
                                GCTGGAAAAAACGCCAGCTTTTCACAGAATACTACACTGCAAACTTACACG
Spr_2   E16   opSpV0100000500                        gb|AE007317|:2007946-2008229
                                                                   AE007317
                                ATATACTAGAAAATGAAGCAATTCAAACGAAACCTGATATCGTTTTCCTTCA
Spr_2   E18   opSpV0100000501                        ref|NC_003098.1|:c1721710-1721537
                                                                   NC_003098.1
                                GTATGTGATGTTGGAAAAAGAATAAAAGAACTTAGAATATCTTCAAATCTTA
Spr_2   E20   opSpV0100000502                        ref|NC_003098.1|:1544531-1545148
                                                                   NC_003098.1
                                TCTCCCCTTCTGCAGCGAGTTATCAATATCTCATCGATTGTCGGTGGGGT
Spr_2   E22   opSpV0100000503                        -             -
                                ATAAAATACTTTTTAACCAAGGTTTCAAACTTATTTTTCAAGGAATTCCTGA
Spr_2   E24   opSpV0100000504                        ref|NC_003098.1|:c1506919-1506221
                                                                   NC_003098.1
                                GAGGCATCGTTGTTGGTGGCGCCATTACTAGACCAAAAGAGATTACAGAA
Spr_2   G02   opSpV0100000505                        ref|NC_003098.1|:c1422079-1421994
                                                                   NC_003098.1
                                GCAGGACTAAGGATCCTGTGACCGCTTTAGGTCGTGAGGGTTCAAGTCCC
Spr_2   G04   opSpV0100000506                        ref|NC_003098.1|:8323-8589
                                                                   NC_003098.1
                                AAAAGTATCGCGAATTATCAAGCGTCGTACAGTCGCAAAGGAAGTAGCAG
Spr_2   G06   opSpV0100000507                        ref|NC_003098.1|:229964-230659
                                                                   NC_003098.1
                                AAGGGGTACACGGATAGGAACTGAAGCTCAGTATCTCCTAGCTCGCTATG
Spr_2   G08   opSpV0100000508                        gb|AE007317|:185363-185812
                                                                   AE007317
                                TGTTTTTAGCCCAGTTCCTTTAAATAAGAGAGAACTGGTAAGTCCAGTGGA
Spr_2   G10   opSpV0100000509                        ref|NC_003098.1|:1578217-1578531
                                                                   NC_003098.1
                                ACAGATGCAACATTCGAACAAGAAACAAAAGACGGTTTGGTCTTAGTAGAC
Spr_2   G12   opSpV0100000510                        gb|AE007317|:1279470-1280074
                                                                   AE007317
                                ACTCGTAAAAATACATAAATTAGTCCTTAGATGACTACTCCCACTCTGTTG
Spr_2   G14   opSpV0100000511                        gb|AE007317|:772962-773162
                                                                   AE007317
                                TTACTGGAAGTGGCCTTTAGATTAGAAGACTGAAAATAAGTTAAAGTCTTA
Spr_2   G16   opSpV0100000512                        ref|NC_003098.1|:c1993104-1992961
                                                                   NC_003098.1
                                CCCTGCAAACAGAAGTGGAGGACAAGTTGGCAGAACTTCTTCTTAAGGGA
Spr_2   G18   opSpV0100000513                        ref|NC_003098.1|:c1979381-1979178
                                                                   NC_003098.1
                                TGATTATGTCAACGAATTAGACCCAAAAATCGTTGATATGCTAGTAGAATT
Spr_2   G20   opSpV0100000514                        ref|NC_003098.1|:c1882402-1881722
                                                                   NC_003098.1
                                GTATGGGCCAGCTATTCGCCTCTTTCCCGAGCAGGTTTGGCGTCTCTTGT
Spr_2   G22   opSpV0100000515                        ref|NC_003098.1|:856133-856492
                                                                   NC_003098.1
                                TTAAAGGTGGCGTTGTATCACGCAAACGTCGTAAACGTATTCTTAAATTAG
Spr_2   G24   opSpV0100000516                        ref|NC_003098.1|:c2014609-2014115
                                                                   NC_003098.1
                                TTTGTTCTAATTGACGCCCATATTAGCCAGCTTCTGGGCTCATTTTTCCCC
Spr_2   I02   opSpV0100000517                        ref|NC_003098.1|:324231-324680
                                                                   NC_003098.1
                                GAAGGGCAATTGAATACAGCCTCAAGTATAAAGAAACCTTTAAGACCATTT
Spr_2   I04   opSpV0100000518                        gb|AE007317|:1499807-1500092
                                                                   AE007317
                                ACTCCAAGTATGCTCATTAAATCCATCTAGCCCTCCACGGACTATCATTGC
Spr_2   I06   opSpV0100000519                        ref|NC_003098.1|:194667-195284
                                                                   NC_003098.1
                                TTAAAGCGACGCCTTGCTAGAGATACGACTGTGAGAAATCGCGATGCATC
Spr_2   I08   opSpV0100000520                        ref|NC_003098.1|:1014454-1015887
                                                                   NC_003098.1
                                ACCCTTCGATGGAACAACTGTCTGAACTGGATGAAGGCAGGTATTCTCTA
Spr_2   I10   opSpV0100000521                        ref|NC_003098.1|:c1200055-1198448
                                                                   NC_003098.1
                                ATGAAGAAGATGTTGTCTAATTCAGCTAATGAGTACTCTAACAGCAATGCA
Spr_2   I12   opSpV0100000522                        -             -
                                GGGGCTAGTCTTATCTGCAATCTCAAATCAGTGTTTTGAGCTGAATGGCA
Spr_2   I14   opSpV0100000523                        gb|AE007317|:288340-289172
                                                                   AE007317
                                TCATCATCTAGATGAATTACATGAAACTGTGGAAAATAGAAAAAATCCGAA
Spr_2   I16   opSpV0100000524                        ref|NC_003098.1|:c820819-820292
                                                                   NC_003098.1
                                CGGATAAGAAAGACGCTCATGGCATCGCTCTTAAACTTCTTTCTGACCCCA
Spr_2   I18   opSpV0100000525                        ref|NC_003098.1|:c1145383-1145198
                                                                   NC_003098.1
                                TAAAAAAATGGTCTGAAATAGATGATGATACTTTTCGAAAATCTCTTCAAAC
Spr_2   I20   opSpV0100000526                        ref|NC_003098.1|:622965-623678
                                                                   NC_003098.1
                                TATAAATATCTTATGGAAACACAGGGGAAGGTCAACGATCAACAGGCATTA
Spr_2   I22   opSpV0100000527                        gb|AE007317|:557877-558588
                                                                   AE007317
                                TTCTGGATAGAGGGAGTATCCGATTTTATGATCAAAGTTAATACCGCCCTC
Spr_2   I24   opSpV0100000528                        ref|NC_003098.1|:c1387920-1380265
                                                                   NC_003098.1
                                AATCAAAATCTATTAGTCAGGGTGCCAACTACGTATCTCACTCAGGATACA
Spr_2   K02   opSpV0100000529                        ref|NC_003098.1|:c1784367-1783327
                                                                   NC_003098.1
                                GCAGGTGTTTCCATGGCGACGGTCAGCCGTGTGGTCAATGGCAATAAAAA
Spr_2   K04   opSpV0100000530                        ref|NC_003098.1|:c1231414-1230347
                                                                   NC_003098.1
                                TCTATGAATTTCTAGTCAAGCAAGGTCTGACTCGTAGCGATGGAATCGTTG
Spr_2   K06   opSpV0100000531                        ref|NC_003098.1|:92633-93646
                                                                   NC_003098.1
                                CTTGGACTATGCAAAATTCTTAGAGGTATTACCCCCATCTTTTTACCACCA
Spr_2   K08   opSpV0100000532                        ref|NC_003098.1|:305635-305820
                                                                   NC_003098.1
                                TATTTCATTTTACTATACAGTTTCGAGGTTGTAGATAAGGCGAAGCTGATG
Spr_2   K10   opSpV0100000533                        gb|AE007317|:894931-895139
                                                                   AE007317
                                GTAACCTTTCGTGTTACTTCTCTTTTTTAGAAAAACGTAACAGAAACTTGAC
Spr_2   K12   opSpV0100000534                        ref|NC_003098.1|:c1691056-1690986, ref|NC_0
                                                                   NC_003098.1
                                GTGTAGTTTAGTGGTAAAACTACAGCCTTCCAAGCTGTTGTCGCGAGTTC
Spr_2   K14   opSpV0100000535                        -             -
                                CAGTTTTTGACACCCCTCCATCCACTAGATCCACAGGAACGCAATTCAGG
Spr_2   K16   opSpV0100000536                        ref|NC_003098.1|:c1372900-1372514
                                                                   NC_003098.1
                                AAAGCCAGTCTTTCTATCCGCACTTTGGAGGAAGAAAAGTACCAGTTTCCT
Spr_2   K18   opSpV0100000537                        ref|NC_003098.1|:c1332448-1332206
                                                                   NC_003098.1
                                GGTTTGAATGTTGAACTTGCGCACCAACAAATTAAGGGATTTTTTGAAGCA
Spr_2   K20   opSpV0100000538                        ref|NC_003098.1|:c1201992-1200052
                                                                   NC_003098.1
                                TTTGTAAAGTCAGTAGACTTTCAGAAAGGCAGGATTTTTCTATACAGTTTC
Spr_2   K22   opSpV0100000539                        ref|NC_003098.1|:1171103-1172503
                                                                   NC_003098.1
                                GGAGAACACAGTCGCTTCTCTCACTGTCTAGGAGTCTATGAAATTGCACG
Spr_2   K24   opSpV0100000540                        -             -
                                TACTCTGAACATGCACGTAAGTATTTACATGAGTGTGGTTTACCTAAAGAG
Spr_2   M02   opSpV0100000541                        ref|NC_003098.1|:196076-196702
                                                                   NC_003098.1
                                GAATCTTAGGGAAAAAAGTGGGAATGACTCAAATCTTCACTGAAGCTGGC
Spr_2   M04   opSpV0100000542                        ref|NC_003098.1|:c472050-471895
                                                                   NC_003098.1
                                TAAGAAACAAAACCTAACTTCATTTCAAGAACTAACAACTACCGAACTCAAC
Spr_2   M06   opSpV0100000543                        gb|AE007317|:1503011-1503231
                                                                   AE007317
                                TATGATTCGCTTATGTAAGAACTTCATTTTAATTTCGTGACAGTTTCTTACA
Spr_2   M08   opSpV0100000544                        ref|NC_003098.1|:c1614271-1613561
                                                                   NC_003098.1
                                GATGTTAATTCTGACAGAATTGAATACTTTGATGTTCCGGACAAAAAAATA
Spr_2   M10   opSpV0100000545                        ref|NC_003098.1|:c1075728-1075330
                                                                   NC_003098.1
                                AAGCGATTGTCACAAGTCAAGGGAGATTGTTTCTTTGGATATCACTGTGAA
Spr_2   M12   opSpV0100000546                        -             -
                                ACGCCTCTAGCTATGCGTAGTGAGGGAATTGAAAAGCATTTTATCCTTCCT
Spr_2   M14   opSpV0100000547                        ref|NC_003098.1|:1460276-1460713
                                                                   NC_003098.1
                                TCTCTTAGCCTTCATTAGTTCTCAGCGTTTTTCATCTCTTATGCCAATCATC
Spr_2   M16   opSpV0100000548                        ref|NC_003098.1|:773607-773951
                                                                   NC_003098.1
                                GACCCGATTTGGATTGCTCGTGTTCAATGACAGGTCTTATTATTAGCGAGA
Spr_2   M18   opSpV0100000549                        ref|NC_003098.1|:549483-550061
                                                                   NC_003098.1
                                GACCGCTTGCGGGACTGGCTAGGTGTGGATGAAGATACCTTTTACAATTC
Spr_2   M20   opSpV0100000550                        ref|NC_003098.1|:519634-520977
                                                                   NC_003098.1
                                CGTAGGAAACGCCCGTTCGACGGTAGCTTTTGATACGATTCGTCGCTATT
Spr_2   M22   opSpV0100000551                        gb|AE007317|:639027-639418
                                                                   AE007317
                                CATCAAACAGGTCATTTGTTTTTTGCAAAAGAAAGATCTGCTGTCTTTGTG
Spr_2   M24   opSpV0100000552                        gb|AE007317|:730296-730519
                                                                   AE007317
                                ACAGATAAATCTACTTCCTTCTCTTAATTTATGATTCTTGAAATGCGCCTGC
Spr_2   O02   opSpV0100000553                        ref|NC_003098.1|:c1618841-1618182
                                                                   NC_003098.1
                                TCATGATAGATATCAATTCCATATTTCAATTGGGTATCTTCGGATTCCTCTA
Spr_2   O04   opSpV0100000554                        ref|NC_003098.1|:c1170315-1168744
                                                                   NC_003098.1
                                CCAGATTTGTTAAATCCAAGCCGTCGCCGTCGTATTGCTGCTGGTTCTGG
Spr_2   O06   opSpV0100000555                        ref|NC_003098.1|:c1851074-1851004
                                                                   NC_003098.1
                                GCATAGTTTAAAGGTAGAACTAAGGTCTCCAAAACCTTCAGTGTGGGTTCA
Spr_2   O08   opSpV0100000556                        ref|NC_003098.1|:200331-200537
                                                                   NC_003098.1
                                CTCGCGAAGCGCGAAAACGAATTGAAAAAAGAATTGTTTGAACTTCGTTTC
Spr_2   O10   opSpV0100000557                        ref|NC_003098.1|:c1094476-1093679
                                                                   NC_003098.1
                                GATTAATAAAATTGCACCAGGTAGTGGACGCTTCCTCTTTCCATTCGTTTT
Spr_2   O12   opSpV0100000558                        ref|NC_003098.1|:c1837149-1836091
                                                                   NC_003098.1
                                TGGTGTGCATGGTAAACCAGTTGAATTCGATTTAGATAAACTTTGGATTCG
Spr_2   O14   opSpV0100000559                        ref|NC_003098.1|:1978504-1979091
                                                                   NC_003098.1
                                ATGGAAGTGTAGACACTATTGAACGACGTGCTGACGGCGTCTATATCAAT
Spr_2   O16   opSpV0100000560                        -             -
                                AAAACAGTACTTAAAGCTATCCGACTCGGTTTACATTGTCAAATTTAGATTT
Spr_2   O18   opSpV0100000561                        ref|NC_003098.1|:382363-382848
                                                                   NC_003098.1
                                TTATAAAAATGGGACGGATGAGTTGCAGTTTAGCAAGAATGAAGCAAGAC
Spr_2   O20   opSpV0100000562                        ref|NC_003098.1|:702460-703188
                                                                   NC_003098.1
                                ATACTAATTGGCAAGATTTTCTGCATCGAAAAGTGGGGCTAAATTCTTTTA
Spr_2   O22   opSpV0100000563                        ref|NC_003098.1|:c1061637-1061374
                                                                   NC_003098.1
                                TTCCACGTAGTGGCAGAAACAGGTATTCACGCACGTCCAGCAACATTGTT
Spr_2   O24   opSpV0100000564                        ref|NC_003098.1|:c30481-30143
                                                                   NC_003098.1
                                GCAGAAAGGAAACTTTTTGCCTTCCTAGACATAGTACGCCAAGGTCTTCTG
Spr_2   B02   EMPTY             -                    -             -
Spr_2   B04   opSpV0100000565                        ref|NC_003098.1|:187066-187584
                                                                   NC_003098.1
                                TATACTGGTCAGGATGACGGAGACCGTATCACTTTAGTGGTAACTGGAAC
Spr_2   B06   opSpV0100000566                        ref|NC_003098.1|:c1843770-1843471
                                                                   NC_003098.1
                                GCTCATCCGTCAGTAAGTTCATTGTTCAAAAATCAAGGAATTTATAAGGCT
Spr_2   B08   opSpV0100000567                        -             -
                                GATTCCCTTCATCTTGGTCAAGTATAAGGGCCTGCCTGCGATTGTTGAGC
Spr_2   B10   opSpV0100000568                        gb|AE007317|:1648075-1648354
                                                                   AE007317
                                TCGCTACGATAGAGCCGTCCGATGTCGCGTCAAAATCATTACTATGGATA
Spr_2   B12   opSpV0100000569                        ref|NC_003098.1|:c1083782-1082907
                                                                   NC_003098.1
                                TCAGACTATTCATGCCAATAAGACTGGGAAGTTACTAGCCTATCCCTTCCA
Spr_2   B14   opSpV0100000570                        ref|NC_003098.1|:987696-988526
                                                                   NC_003098.1
                                GTGTTCCCTTTGAACGTTTTCGTGGAGACGGGCTAACAGTTTCGACACCG
Spr_2   B16   opSpV0100000571                        ref|NC_003098.1|:316869-318278
                                                                   NC_003098.1
                                GATATCTCAATATAACATTAAGTACACTAGCCTTCAGAATAAAAAGTTACAG
Spr_2   B18   opSpV0100000572                        ref|NC_003098.1|:617795-618985
                                                                   NC_003098.1
                                ACCAGCCAAAGCAAAGATTCCTGGTATCCATATCTTGCGAGCCTTCACGA
Spr_2   B20   opSpV0100000573                        ref|NC_003098.1|:562418-568852
                                                                   NC_003098.1
                                GTATTAATGTCGGCTTTGGACGGCTTTAACATTATAAGGTATCAAGTGTTT
Spr_2   B22   opSpV0100000574                        ref|NC_003098.1|:c1719977-1719183
                                                                   NC_003098.1
                                CTTCAAGCTAGAGTTCCGTTTGTAGACTTTAAGGGAAACCTCTTCTTCCCT
Spr_2   B24   opSpV0100000575                        ref|NC_003098.1|:c312760-312599
                                                                   NC_003098.1
                                ATGCGAAAAGTTTGGCATAAACTTTTACCTCTTCTTCCCTACTCACCTGAG
Spr_2   D02   opSpV0100000576                        ref|NC_003098.1|:446182-447378
                                                                   NC_003098.1
                                GTCCTCGTTCGTGTTGACTTCAACGTACCATTGAAAGATGGCGTAATCACT
Spr_2   D04   opSpV0100000577                        ref|NC_003098.1|:423672-425351
                                                                   NC_003098.1
                                GCAGCCATATGTAGTTATCTGGTATTAACTGTAACGCTTGTAGTTGATGAG
Spr_2   D06   opSpV0100000578                        ref|NC_003098.1|:1892472-1893320
                                                                   NC_003098.1
                                CAAACTGCCTCTCTGACTAAGACTATCACAGCAGAACAACTCCAAGCCCTA
Spr_2   D08   opSpV0100000579                        ref|NC_003098.1|:1333648-1335366
                                                                   NC_003098.1
                                CTTACGTATTTGAAAGCCTTCGTCCGACTCCAGAACTATCATTTGCAGTTC
Spr_2   D10   opSpV0100000580                        ref|NC_003098.1|:c1571608-1571297
                                                                   NC_003098.1
                                ATTAACATCAAAACAACGTGCCTTCCTCAACAGCCAGGCACACACCCTCAA
Spr_2   D12   opSpV0100000581                        -             -
                                GGCTATCTTCCTAGTTTACTTTTTGATTTTTATTGAGTATAAGAGGTCTTTC
Spr_2   D14   opSpV0100000582                        ref|NC_003098.1|:c1500437-1500093
                                                                   NC_003098.1
                                CTAAGTATGCTGCAAGAGCTAGTTTCTTAGATGGACAGGGGATTACAGTT
Spr_2   D16   opSpV0100000583                        gb|AE007317|:233680-233891
                                                                   AE007317
                                TAATCTCCCTATAAAAATAAAGTCGCCCAATCAGGCGGCTTATTTTTTTGA
Spr_2   D18   opSpV0100000584                        ref|NC_003098.1|:412113-414437
                                                                   NC_003098.1
                                CAGTTCTTTGGACTGACAAATTGCCATACAACTTCCGTCGCTACTGTATGC
Spr_2   D20   opSpV0100000585                        gb|AE007317|:1917704-1917935
                                                                   AE007317
                                ATATTTAAAATTAAAAACAACAAAGCGGATTAGTGCACTTTCTGATGACCAG
Spr_2   D22   opSpV0100000586                        ref|NC_003098.1|:c388810-388250
                                                                   NC_003098.1
                                ACAAGCTATTATCGAGACTGTCCCAGCTCAATACTTGTACAAAATGGATGA
Spr_2   D24   opSpV0100000587                        -             -
                                CTCTTTGATTTTCATTGAGTATAAAAAAGAAAACTTCAGACCAATCCACAAA
Spr_2   F02   opSpV0100000588                        ref|NC_003098.1|:c1630241-1628490
                                                                   NC_003098.1
                                CTGGTCTACTATGGTCTCTACATCCTACAAACTGTAGTTCAGTATGTCGGC
Spr_2   F04   opSpV0100000589                        ref|NC_003098.1|:c1959732-1958932
                                                                   NC_003098.1
                                ACAAAAGGAACATTGAATCGCGTTACGAGTATGGCGACAGCATTAGGGCT
Spr_2   F06   opSpV0100000590                        ref|NC_003098.1|:550225-550377
                                                                   NC_003098.1
                                CAGCTTTACCAAAACGACCAGCTTTCTTTAGTGGATGTGAGAGAAGTGGA
Spr_2   F08   opSpV0100000591                        ref|NC_003098.1|:c30481-30143
                                                                   NC_003098.1
                                TACAAGAGCTGGTCCGAGGAGGACAGGAAAATGTTTAGTCAACTACATAT
Spr_2   F10   opSpV0100000592                        ref|NC_003098.1|:582064-582318
                                                                   NC_003098.1
                                CAAGAAAAAATTAGTTGCTCTTGAAATGGAACGGTGCCAGAGAAAAATTGA
Spr_2   F12   opSpV0100000593                        ref|NC_003098.1|:c848576-848313
                                                                   NC_003098.1
                                CAAATTCAAACTCTTATGTCTAATTCATTCAACATTGAAGCAAGTGTGAGAG
Spr_2   F14   opSpV0100000594                        ref|NC_003098.1|:c1246568-1245411
                                                                   NC_003098.1
                                ATGCAGTACGAATTGCGTGAATTACAACAACGATTGGGCATTACCTTTGTC
Spr_2   F16   opSpV0100000595                        gb|AE007317|:1396443-1396745
                                                                   AE007317
                                TATCACAGGTTTCTGCCAGCTACTCCCTTGAGTAGTACCATTATACCAAAT
Spr_2   F18   opSpV0100000596                        ref|NC_003098.1|:649445-651220
                                                                   NC_003098.1
                                ACTCATACTACGGTTCAGGTTCATACGAACGCTCATTCATCGCTCCTGCTT
Spr_2   F20   opSpV0100000597                        ref|NC_003098.1|:c1449858-1449589
                                                                   NC_003098.1
                                CAGTAGAGGTTCAAGTTGCTGTCCTTACTTGGGAAATCAACCACCTTAACG
Spr_2   F22   opSpV0100000598                        ref|NC_003098.1|:1946639-1947970
                                                                   NC_003098.1
                                AGAGTTGCTTACAAGATGTGCACAAAACTACCAACTCCGCTACGAAGAGT
Spr_2   F24   opSpV0100000599                        ref|NC_003098.1|:1871577-1872086
                                                                   NC_003098.1
                                ACTACGAAGCAGTCACTTTAGGCCTGGACATATCCAAAGGGCAACAACTT
Spr_2   H02   opSpV0100000600                        ref|NC_003098.1|:891426-892361
                                                                   NC_003098.1
                                TTTCTTATCTAGCGAAGAGATTTGGGCTTAATCAACTTGGTATTGCAGGTA
Spr_2   H04   opSpV0100000601                        ref|NC_003098.1|:953383-954594
                                                                   NC_003098.1
                                TGTTTGACTTTGCGAATAATACCTTTCTTGCAGGATTAAATCCAACATCTTT
Spr_2   H06   opSpV0100000602                       ref|NC_003098.1|:267187-267897
                                                                  NC_003098.1
                                GATTTGTAGTCGGTACGATTGTGTTTGCTTTATTGCATCAACCAAGTAATT
Spr_2   H08   opSpV0100000603                       ref|NC_003098.1|:c1073677-1072748
                                                                  NC_003098.1
                                CTCAGGTAGTCTGCCAGCTGGCCTTCCAGTTGATTACTATGCGAGCTTGG
Spr_2   H10   opSpV0100000604                       ref|NC_003098.1|:c2000358-1999012
                                                                  NC_003098.1
                                AGTGGTTGAGTTATACGGCTTATAACGGAAGTCGTCGCTATATACAGCTAG
Spr_2   H12   opSpV0100000605                       ref|NC_003098.1|:c1272235-1271411
                                                                  NC_003098.1
                                TGAAGCGACAGGTAGTCCTGTTTCAGACTTCAACAAGGGGAATATCAAGG
Spr_2   H14   opSpV0100000606                       ref|NC_003098.1|:c1817927-1815951
                                                                  NC_003098.1
                                AACCAAACTGGATTAACCGCGACCGCTTTATTCTTTCAGCAGGTCATGGTT
Spr_2   H16   opSpV0100000607                       ref|NC_003098.1|:c1712205-1711861
                                                                  NC_003098.1
                                GGATAATCGCGAGAAAAACCAAGACTTGGTCTTGATTAAAGATATCGAGC
Spr_2   H18   opSpV0100000608                       ref|NC_003098.1|:c1296894-1295956
                                                                  NC_003098.1
                                GGGTTGGCACAGTTTGTACCTTCTTGTGGGAAATAGGTCAATTAGATATTG
Spr_2   H20   opSpV0100000609                       ref|NC_003098.1|:c1992319-1991666
                                                                  NC_003098.1
                                TCCTGTCATCGTCTTGAGTGCTCTGGGAGATGAAACTACTCAGTCACAGG
Spr_2   H22   opSpV0100000610                       ref|NC_003098.1|:c140428-140042
                                                                  NC_003098.1
                                CTTAACCCATCGGGAAGTACGAGATAAGCTGCTTTCTTACTCTGAGGGAT
Spr_2   H24   opSpV0100000611                       ref|NC_003098.1|:608630-608827
                                                                  NC_003098.1
                                TTGTAGGCCTGATTTTGGGTATCATAGGATTGGTCTTGGCTATTTCATACC
Spr_2   J02   opSpV0100000612                       ref|NC_003098.1|:c1843214-1842900
                                                                  NC_003098.1
                                GGAAGAAGAGATGAATCGTTATCAACCTGACTTTGTCCTTTGTATTGGGCA
Spr_2   J04   opSpV0100000613                       -             -
                                AAATAAATGACAAATAAAAATGCATATGCCTCACGTCTCACTACTGACTAAA
Spr_2   J06   opSpV0100000614                       ref|NC_003098.1|:487231-488565
                                                                  NC_003098.1
                                GAACTCTTTCAAACAGCTCTAACGACAGCCAAGTCACTACCAGAAGTGTCA
Spr_2   J08   opSpV0100000615                       ref|NC_003098.1|:867934-870288
                                                                  NC_003098.1
                                CAGGCTCGTTATTCGGAGCACAATCACGGCCACTATGGACTAGCTGCTGA
Spr_2   J10   opSpV0100000616                       ref|NC_003098.1|:642890-643414
                                                                  NC_003098.1
                                GATGTAGTCCTTACACCTATCTTTCGAATTGAGGGAATGGCACCGATGTC
Spr_2   J12   opSpV0100000617                       ref|NC_003098.1|:73075-73929
                                                                  NC_003098.1
                                CCAGGTTTAGCCTACTATGTCATCGAAGTCGCACATAAAAAAGAACTGTTA
Spr_2   J14   opSpV0100000618                       -             -
                                GTAGTAAATCGCCTCCTTGTAATAACTGTTGAAAATCCTGATTTCGAAGAC
Spr_2   J16   opSpV0100000619                       ref|NC_003098.1|:1878527-1878943
                                                                  NC_003098.1
                                ATCAAGCGTTTTCGACGTCTCTTCCTTCATATTGCCGGAAAATATGTCTCT
Spr_2   J18   opSpV0100000620                       ref|NC_003098.1|:c1458567-1457719
                                                                  NC_003098.1
                                CTTGTTGGATCAACTACCGATTACGGCTAGAGTTTTGGGAAACTGGGAAG
Spr_2   J20   opSpV0100000621                       ref|NC_003098.1|:988523-989419
                                                                  NC_003098.1
                                ACCGCAAAATGCAACGTATCTATTGGACGTTGGAGACTACGTTACCATTG
Spr_2   J22   opSpV0100000622                       ref|NC_003098.1|:813563-814378
                                                                  NC_003098.1
                                ATGTAAAACACGTTCAAAAAATTTATAAAACACGTTTTCAGGGCAACCAAG
Spr_2   J24   opSpV0100000623                       gb|AE007317|:30482-30699
                                                                  AE007317
                                TTTTCCTGTCCATTGTTGGTAATCGCCAATACCTCACCTGTTGTGTCTTCG
Spr_2   L02   opSpV0100000624                       ref|NC_003098.1|:c1426787-1425561
                                                                  NC_003098.1
                                TGTTGTATCTCGCTTATGGCATTTTAGGTGGGCTTGGTTTGGGAGCAGGC
Spr_2   L04   opSpV0100000625                       ref|NC_003098.1|:c2010488-2010201
                                                                  NC_003098.1
                                GATTCAACTAAGTGATTTAGGTCAAGTTCACATTGTTTGTGGCAAGACAGA
Spr_2   L06   opSpV0100000626                       ref|NC_003098.1|:c1213553-1211829
                                                                  NC_003098.1
                                CTCCGTTTCTCATCCTAGATGATGCAACCTCGGCACTGGATACCATTACAG
Spr_2   L08   opSpV0100000627                       ref|NC_003098.1|:884594-886363
                                                                  NC_003098.1
                                TCTCTATGTCTCTGTCAGATTGATGTTTGCCCTTCCGAAGATTGTATATGA
Spr_2   L10   opSpV0100000628                       ref|NC_003098.1|:1430643-1431725
                                                                  NC_003098.1
                                TTATGGTGAGTACTTCAACCACCGTCTCGGGCATGGTATCGGTATGGATG
Spr_2   L12   opSpV0100000629                       ref|NC_003098.1|:490727-491689
                                                                  NC_003098.1
                                AACAACAATGAAAAACGTATTGTCATCTCTGATATTGAACCAACCAAGGAA
Spr_2   L14   opSpV0100000630                       gb|AE007317|:1460018-1460275
                                                                  AE007317
                                AATTTCGTTCAGCTGACAAAAGCTGGTATTCAAGGAAACTTCGCCAATATC
Spr_2   L16   opSpV0100000631                       ref|NC_003098.1|:53954-55522
                                                                  NC_003098.1
                                GAGAAGATGCACGGCGTTTTCCTCGAAATCATCATTGCACCAAGCTATAC
Spr_2   L18   opSpV0100000632                       gb|AE007317|:65540-65844
                                                                  AE007317
                                GGTCCTATATTCCGAATTTAAAGAGCGTTTGAAATGGGTCTAAAAATGTTT
Spr_2   L20   opSpV0100000633                       gb|AE007317|:1944898-1945105
                                                                  AE007317
                                GCGTTTTCTTGAATGTTTATTTAAGAAAGTAGTTGGTTTTTTACACTTTGTT
Spr_2   L22   opSpV0100000634                       ref|NC_003098.1|:296952-298853
                                                                  NC_003098.1
                                TCGGGAGATATATGAACGTTATCTCTTAAAGAGTGCTTGGAGTCATTCGAC
Spr_2   L24   opSpV0100000635                       ref|NC_003098.1|:c1753647-1752316
                                                                  NC_003098.1
                                TCGCTCTTAATCTAAAGGATGCCTTGGCAATTCGTACAGCGCCGATTATCA
Spr_2   N02   opSpV0100000636                       ref|NC_003098.1|:c1766927-1765923
                                                                  NC_003098.1
                                GCGTTTGGCAGACGCTATTAGCGAAGTTTATCCTCAGCTCAATAAGAGCC
Spr_2   N04   opSpV0100000637                       ref|NC_003098.1|:c1043977-1042274
                                                                  NC_003098.1
                                TATCATCGGTGGTGGAGTTGTCGGTATCGAACTCGGTCAGGCCTTCATGA
Spr_2   N06   opSpV0100000638                       ref|NC_003098.1|:950173-951123
                                                                  NC_003098.1
                                TTTTTAGTGACGTATACATTAATTCATGAAAAAGGGGTAATCCCTTTTGCAG
Spr_2   N08   opSpV0100000639                       -             -
                                ACCGCTTTCTTATGTGATAAGAATAACTTTTTTATTATTTGTTGTCAAGGAA
Spr_2   N10   opSpV0100000640                       ref|NC_003098.1|:511419-511685
                                                                  NC_003098.1
                                GTGGCTATCATGAGCGAGTTGATTGAGGCTAGGTATGAACAAGGAATCAG
Spr_2   N12   opSpV0100000641                       gb|AE007317|:1654514-1654812
                                                                  AE007317
                                GTAGTGCAAAATCTAGTAAACATTCCAAAATTAACTCGAATATTTATTTCCA
Spr_2   N14   opSpV0100000642                       ref|NC_003098.1|:c1788083-1787199
                                                                  NC_003098.1
                                TTGGGAAATTGTCCAGGAGTTAAAAGCGCAAGGAGTCACCATTCTCTATTC
Spr_2   N16   opSpV0100000643                       ref|NC_003098.1|:1532170-1533021
                                                                  NC_003098.1
                                ATATATGCAACGAATACCATCCTAGTAAAAGGCGAGATATTATTGTAGAGA
Spr_2   N18   opSpV0100000644                       ref|NC_003098.1|:c1236462-1234801
                                                                  NC_003098.1
                                TGATGATCGGTCTGATTTCCAAAATCCGAGATTCTCAGATAGTTCCAGACA
Spr_2   N20   opSpV0100000645                       ref|NC_003098.1|:c1109538-1108363
                                                                  NC_003098.1
                                TTTTAACTTGCCTGAGCCAGCTGTAGATGGTAATGTCATGCGGGTCTTGG
Spr_2   N22   opSpV0100000646                       ref|NC_003098.1|:89862-91406
                                                                  NC_003098.1
                                TTCGCGTTCTTGATGGCTACAAAGGAAACACTCACATGGGTGGATGGAAC
Spr_2   N24   opSpV0100000647                       ref|NC_003098.1|:1300224-1300439
                                                                  NC_003098.1
                                AGAGCAAATCCCCGTGGGCCATAATTCTGGCAGTTTTTTCCTCTTCCTACT
Spr_2   P02   opSpV0100000648                       ref|NC_003098.1|:1459304-1459474
                                                                  NC_003098.1
                                TATTTTACTTTCATTTGGTGGGAGAATATTTGAAAAAAAGAAAGGTAGTTTA
Spr_2   P04   opSpV0100000649                       ref|NC_003098.1|:302261-304513
                                                                  NC_003098.1
                                CTTGCTGGGAACCTCTGGAATGGAGAGTTCCTTGAACAGTATTCTTGCAG
Spr_2   P06   opSpV0100000650                       ref|NC_003098.1|:c1159317-1158238
                                                                  NC_003098.1
                                TGCTAGTGGACTTTGGTCTCAAGCACTCAATCCTACGTGAACTTTCTAAAC
Spr_2   P08   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_2   P10   opSpV0100000651                       -             -
                                AAGACTTGGTTTTCTAGTGTCAATTACCAGGCTGCACGAACCCAACCTCAG
Spr_2   P12   opSpV0100000652                       ref|NC_003098.1|:c630273-630031
                                                                  NC_003098.1
                                TTGTAGCTCAGGTGGAAACGCTGGTTCATCCTCTGGAAAAACAACTGCCA
Spr_2   P14   opSpV0100000653                        ref|NC_003098.1|:156408-157781
                                                                   NC_003098.1
                                AACTTATGGTCAACGAAACCCAGAGGAAGTTAGTCGGATTTATGGATTGG
Spr_2   P16   opSpV0100000654                        ref|NC_003098.1|:c1294168-1292606
                                                                   NC_003098.1
                                CTGACTGCCCATACGCAGCCATCGAAAACCCAGATAAACACATTTACGGT
Spr_2   P18   opSpV0100000655                        -             -
                                AATGCTGTAATTAGTCTGAAGTCCACACTTACTTGTTGAGATGTTATCTCT
Spr_2   P20   opSpV0100000656                        gb|AE007317|:623679-623951
                                                                   AE007317
                                TTAATGATTATAAACACAAGTGGGAAGGAAAAATGAACTGATCTTTTTGAC
Spr_2   P22   opSpV0100000657                        ref|NC_003098.1|:c1355990-1355373
                                                                   NC_003098.1
                                AAATATAGCCAAAAATTGACCCAGTCTCATTATATCTTGGCGGAAGAAGTT
Spr_2   P24   opSpV0100000658                        ref|NC_003098.1|:c1763386-1762592
                                                                   NC_003098.1
                                TGGTGCATTCGACAGAAAGCTTTGGGTCAGTAGATGGGCCTGGTATTCGC
Spr_2   B01   EMPTY             -                    -             -
Spr_2   B03   opSpV0100000659                        ref|NC_003098.1|:c1138692-1137655
                                                                   NC_003098.1
                                CCTGAACAAGGCCTGATGGCTCTCCGTAAGGAACTCAATCTTTACGCTAA
Spr_2   B05   opSpV0100000660                        ref|NC_003098.1|:c607936-606890
                                                                   NC_003098.1
                                GCTTCTGGAGGAACGCTATAAAAATCCTGTCGCCCACCGCGAACTCTTTA
Spr_2   B07   opSpV0100000661                        ref|NC_003098.1|:730520-731260
                                                                   NC_003098.1
                                AAAGAATACATTTGGGTGGTGGATGAAAGCAAGCTGGTCGAAAAACTAGG
Spr_2   B09   opSpV0100000662                        ref|NC_003098.1|:673606-674421
                                                                   NC_003098.1
                                ATACTGTTCCGCCTGAAATTGATGGCTGGAAAGGGAACACTGAACCCCTT
Spr_2   B11   opSpV0100000663                        ref|NC_003098.1|:c761602-761198
                                                                   NC_003098.1
                                TCGCCCTACTTTTCGCATGCACTTAACAAATAAAGAAATTCTTGACAAGAT
Spr_2   B13   opSpV0100000664                        -             -
                                TACCTCGTTTTAGCTCTTTTCCACTATTATACACGAAAAGAAAGAAATTGTC
Spr_2   B15   opSpV0100000665                        ref|NC_003098.1|:602334-603269
                                                                   NC_003098.1
                                CTAGAAGGTTACCACCTAGGTGGGGAGACTCCTCATGAGGAGATTTTAGC
Spr_2   B17   opSpV0100000666                        -             -
                                CGCATTGTCCGAACCCTTCTCAGTAGTACAGGTAGCTTAATATCAACAAAT
Spr_2   B19   opSpV0100000667                        -             -
                                GCTTGGAATCACATTGTATGCTAGAAATAGTTTTGGGTTTCGGAATCTAAC
Spr_2   B21   opSpV0100000668                        gb|AE007317|:1929575-1929779
                                                                   AE007317
                                TCGGTAGCAACCTTTTTTAATTTGACGGAAATGATCCAAGCTTCTACAGAT
Spr_2   B23   opSpV0100000669                        ref|NC_003098.1|:c1777805-1777140
                                                                   NC_003098.1
                                CAATTACCTAACACAGGTTCAGCATCAAGTGCAGCACTTGCTAGTCTTGG
Spr_2   D01   opSpV0100000670                        -             -
                                ACCGCGTTACCAACGCCCTCACACGGAAGTATATTCTGTGTGTGGGCTTT
Spr_2   D03   opSpV0100000671                        ref|NC_003098.1|:c1641769-1640591
                                                                   NC_003098.1
                                TCATGAACACCAACAAACGCCGTGAATTGGCGGACTCTAAATACAATGAAC
Spr_2   D05   opSpV0100000672                        ref|NC_003098.1|:378108-378332
                                                                   NC_003098.1
                                GGAAAAGACGCATCAGAAGTAACACTTGAATCAACTTTTGATGATTTGGAC
Spr_2   D07   opSpV0100000673                        ref|NC_003098.1|:c1865725-1864031
                                                                   NC_003098.1
                                TCTATTTGGCTGGTCGCGGGAATGGTTCAGTCGGATCCGTCTGTTGTTGG
Spr_2   D09   opSpV0100000674                        ref|NC_003098.1|:739237-739677
                                                                   NC_003098.1
                                AGATGCTTTGTGGAAACCTATTACGGTTTTACTTTTTTGATGGAACATGCT
Spr_2   D11   opSpV0100000675                        ref|NC_003098.1|:c40991-40224
                                                                   NC_003098.1
                                TTAGCTAGACAACTTTTCCCGTGTGCTAAAATCGTGTTGGATCGCTTTCAC
Spr_2   D13   opSpV0100000676                        -             -
                                CAATGTAAGCGTTTTTAAAACATACAATTCTATTCTATAGTGTATTGAATCT
Spr_2   D15   opSpV0100000677                        -             -
                                CAGCTTTATCGTGGACGTGGTCAAGCCGAGAATTTCATCAAGGAGATGAA
Spr_2   D17   opSpV0100000678                        ref|NC_003098.1|:765098-765889
                                                                   NC_003098.1
                                AATACCCATCAGAAATCCCTGGAATTACCAATGCTGAGTTTCTTCGTGCCG
Spr_2   D19   opSpV0100000679                        gb|AE007317|:1894692-1895616
                                                                   AE007317
                                TATTTCCCTACATTCTTAAAATAACTTAGTACATAAATGACAATGCTGCCAC
Spr_2   D21   opSpV0100000680                        ref|NC_003098.1|:153770-154366
                                                                   NC_003098.1
                                TGAGTTTACACGCATCGACTTATTTCCGTCATACCAGTCTTTGGTACAATA
Spr_2   D23   opSpV0100000681                        -             -
                                CCAAACCTTGCTTCGCCAATTCATTCGTGGTGCTTTGGGGTTTGGATTTAT
Spr_2   F01   opSpV0100000682                        ref|NC_003098.1|:c1134185-1132842
                                                                   NC_003098.1
                                AAATCAATCTAAACCTATACGTCATGCATACTTTCACGAGTACAGAAACTTA
Spr_2   F03   opSpV0100000683                        -             -
                                CCTTTATGGATCCTAAGGTTCTGGTTAGTAGAGGGATTAGCTTTAATCCAG
Spr_2   F05   opSpV0100000684                        ref|NC_003098.1|:200562-200822
                                                                   NC_003098.1
                                AGTTCTTGTTGGACGTGTTGTATCTGACAAAATGGACAAGACAATCACAGT
Spr_2   F07   opSpV0100000685                        ref|NC_003098.1|:c1189761-1188910
                                                                   NC_003098.1
                                CTCGAATCCTATATGGTGGTCGAGTTTCAATTCAAGTCGGGATGTATGGA
Spr_2   F09   opSpV0100000686                        ref|NC_003098.1|:225040-225708
                                                                   NC_003098.1
                                AATTGATTGGCTCTACACCCTCTATTCATGTTCAGGTGATTTCTCAAGATT
Spr_2   F11   opSpV0100000687                        ref|NC_003098.1|:c1570616-1570023
                                                                   NC_003098.1
                                TTGAAATTCATACAGTCGGAGCTGGTCAAATGACAGACCTAGATAAGGTC
Spr_2   F13   opSpV0100000688                        ref|NC_003098.1|:c1439452-1438976
                                                                   NC_003098.1
                                CGGCATCGAAACCACGGAGGGGCTGATAGGATGGCTAATCGTATTTTGAC
Spr_2   F15   opSpV0100000689                        gb|AE007317|:327094-327392
                                                                   AE007317
                                ATGCTGAATCCTTTTTTACATTTGTAAAGAAAGATTCTAAATGTACTGACCC
Spr_2   F17   opSpV0100000690                        ref|NC_003098.1|:234677-235480
                                                                   NC_003098.1
                                CTATCTTGTTGGGATGAACTATGGGAAACGAAAGTTAGCACCAAGGGTAT
Spr_2   F19   opSpV0100000691                        ref|NC_003098.1|:805375-806091
                                                                   NC_003098.1
                                AAAAGAATTGCCAGACTATTTTGATACTATTTTTTTAGAAAACTTTGGCCAT
Spr_2   F21   opSpV0100000692                        ref|NC_003098.1|:1578797-1579369
                                                                   NC_003098.1
                                ATTCACTCCGCGCGGTGGCATTTCAATCGACCCCTACTACAACTACGGTA
Spr_2   F23   opSpV0100000693                        ref|NC_003098.1|:c1910621-1909881
                                                                   NC_003098.1
                                CATACAAACCCTCAAACATTTTTCCTTTCTTTCTTACTCTTTGTGGTATTCT
Spr_2   H01   opSpV0100000694                        ref|NC_003098.1|:559541-560401
                                                                   NC_003098.1
                                TGGGGGCTTTTGTGGCCTTTTATCTCTGGAAGGCTGTCTTTGATTCTTCG
Spr_2   H03   opSpV0100000695                        ref|NC_003098.1|:197664-198497
                                                                   NC_003098.1
                                AGATATCAAAGTCGGAAACGCTCTTCCACTTGCTAACATCCCAGTTGGTAC
Spr_2   H05   opSpV0100000696                        ref|NC_003098.1|:434397-435047
                                                                   NC_003098.1
                                TATCACTTGGGTTGTCATTACAGCTTTTGTCTTTTATCGTAAGCGATGGAA
Spr_2   H07   opSpV0100000697                        -             -
                                AAAAGATACCGATTTCATTTACTAAAAAGAAAAAAGAACTGATTTCTCAGTC
Spr_2   H09   opSpV0100000698                        ref|NC_003098.1|:c1215714-1214845
                                                                   NC_003098.1
                                CTTCCATGAGCGCTATCGTCAGGACTTGGTAAGAGAATTTGCGATGATTA
Spr_2   H11   opSpV0100000699                        ref|NC_003098.1|:c1020975-1020607
                                                                   NC_003098.1
                                CCACTATGCGCTCAAAGCTATGGGCTACACTCGAAAAAAAAGAACCACAC
Spr_2   H13   opSpV0100000700                        ref|NC_003098.1|:359527-359640
                                                                   NC_003098.1
                                AAAATAATGCCCATCAATTCTTTAGTGGTCCAAGAGAAGAACGAACCAAGC
Spr_2   H15   opSpV0100000701                        -             -
                                AGTAACCAATACTATACCTTGAATATATCTCATAAGGTGAGTACCTATCTAA
Spr_2   H17   opSpV0100000702                        ref|NC_003098.1|:378451-379425
                                                                   NC_003098.1
                                GATAAAATCAAATCATTGACTGATAAACCCTTTGGGGTCAACATCATGCTC
Spr_2   H19   opSpV0100000703                        gb|AE007317|:123434-123809
                                                                   AE007317
                                GAATAATATTTGCCATTATAGGGGCAAGTTGCATATTAGTCAGTATGTATC
Spr_2   H21   opSpV0100000704                        -             -
                                TTTTCTGATCACTTATTTAAAGAATACCGAAACAGTACGGCAATTCAAACTA
Spr_2   H23   opSpV0100000705                        ref|NC_003098.1|:511802-514195
                                                                   NC_003098.1
                                ATCATACGGTATGCGTGGGGTAAAACCACCAATCATCTGGGGTGATGTCA
Spr_2   J01   opSpV0100000706                        ref|NC_003098.1|:1872170-1872877
                                                                   NC_003098.1
                                TATGAAACATCCCAACATGACACTGACTAGAGAGCGTCTTTTGGAACGTAT
Spr_2   J03   opSpV0100000707                        ref|NC_003098.1|:2722-2916
                                                                   NC_003098.1
                                ACGCTTGTACAATCAAGTCGACTGGTAAAAAGGCTAATCGTTGGGAAATTA
Spr_2   J05   opSpV0100000708                        -             -
                                AGGTGATGATGCTTCTTCAGAGGAATTGGCTGGTAGATATGGTTCTGCTG
Spr_2   J07   opSpV0100000709                        ref|NC_003098.1|:c1225868-1225020
                                                                   NC_003098.1
                                CTCAAATCGAGGTAACAGCTAGTACAGCTTATGCGGCCCGTTTTATTTCCG
Spr_2   J09   opSpV0100000710                        ref|NC_003098.1|:c1715762-1715352
                                                                   NC_003098.1
                                GACCAGACGTTTGGTCAAGAACTTTATGATAGAAGAGCCGGATCTAGCTC
Spr_2   J11   opSpV0100000711                        -             -
                                ATGCTATTGGTAGTAACTGGAAAGATGTAAGAGCTGAATTATTCAGCAAAG
Spr_2   J13   opSpV0100000712                        ref|NC_003098.1|:c469143-468814
                                                                   NC_003098.1
                                AGATACAGACCCCATCAAAAGAGCTCATACTTTGATTACTGACTTAAACAA
Spr_2   J15   opSpV0100000713                        gb|AE007317|:1333305-1333647
                                                                   AE007317
                                AATTTTTCCTAGCCTCAACATCATATAACCCCAAAATTCAATCTGACCTGGT
Spr_2   J17   opSpV0100000714                        ref|NC_003098.1|:20733-21071
                                                                   NC_003098.1
                                ACAAATGGTGAGTTAATCGCTCCAATGACTTACGAAGAGATGGTGACGAG
Spr_2   J19   opSpV0100000715                        ref|NC_003098.1|:1924956-1925138
                                                                   NC_003098.1
                                AACAGCTCCATCTGTAAACTTTGACGAAACTACTGGAGATTACTCACGTTC
Spr_2   J21   opSpV0100000716                        ref|NC_003098.1|:c1751671-1748021
                                                                   NC_003098.1
                                TTGGATGTTTACCACATCCAAAAATTCCGTCGTTCAAACTCAGGTACTGCT
Spr_2   J23   opSpV0100000717                        ref|NC_003098.1|:c1524201-1523839
                                                                   NC_003098.1
                                GGCTTCGATAGAAAGCGCAGTTACACGACATGAAGGATTTGCTAAGCGTG
Spr_2   L01   opSpV0100000718                        -             -
                                CGAAAAGTATCTTTTTATTTTCCAGTTTGCCTTATGTGATTGGCACGCAAG
Spr_2   L03   opSpV0100000719                        ref|NC_003098.1|:2036394-2037587
                                                                   NC_003098.1
                                AAAGTGCTCTTTACAACCATTCTATCGGAGACACCATTAAGATAACCTACT
Spr_2   L05   opSpV0100000720                        ref|NC_003098.1|:c2012619-2011840
                                                                   NC_003098.1
                                AGGTCAATACTTCATCAACCACCGTTGGTTGGGTGGAACTCTTACAAACTG
Spr_2   L07   opSpV0100000721                        ref|NC_003098.1|:395121-395486
                                                                   NC_003098.1
                                GTTGATGTATATACCGTGTTAAGCTACGGAACAAAGATTAGTGAAGTGTCA
Spr_2   L09   opSpV0100000722                        ref|NC_003098.1|:c1020448-1020110
                                                                   NC_003098.1
                                ACAAATGGTGAATTAATCGTTCCAATGACTTACGAAGAGACGATGACGAG
Spr_2   L11   opSpV0100000723                        ref|NC_003098.1|:622319-622972
                                                                   NC_003098.1
                                ACTGGAATGAGGCAACGAATGCTTTTAGCACGAGCTCTTATCAACAAACC
Spr_2   L13   opSpV0100000724                        ref|NC_003098.1|:966371-966733
                                                                   NC_003098.1
                                TGATGCTATGATAGAGGTTCCAGAAGTAACGGATACTGAGGTTAAATTAGT
Spr_2   L15   opSpV0100000725                        ref|NC_003098.1|:895140-898259
                                                                   NC_003098.1
                                AACTCTATGATTCACCTAGCGCCCAACGTTACAGTGAATCAGATGGCCTG
Spr_2   L17   opSpV0100000726                        ref|NC_003098.1|:276788-278767
                                                                   NC_003098.1
                                AAGATACGAGTGATGTTATCAGAGTATAATTTGTCCATTGAGAGTAGGGCG
Spr_2   L19   opSpV0100000727                        gb|AE007317|:433386-433828
                                                                   AE007317
                                AGAGTCTTCAGGGCAGGGTGTGATTCCCGACCGGCGGTGACTTTAACTAG
Spr_2   L21   opSpV0100000728                        ref|NC_003098.1|:c1850989-1850917
                                                                   NC_003098.1
                                GTGTGGTGAAGTGGTTAACACACCAGATTGTGGCTCTGGCATGCGTGGG
Spr_2   L23   opSpV0100000729                        ref|NC_003098.1|:c1888501-1886036
                                                                   NC_003098.1
                                TTCAGCAAGCTTCCCCAAGCATTTGGGGGAACGAGCGCTTTGCTTTAGAT
Spr_2   N01   opSpV0100000730                        ref|NC_003098.1|:1877042-1877794
                                                                   NC_003098.1
                                AAGAAGTCAAAGATGATCTTAAAAAGAGTGCCATGTCCTTATCTGGCGGTC
Spr_2   N03   opSpV0100000731                        -             -
                                AAGAAGTCCATACCCTGAGAATTATCAACTCACGCATCGACTACCTAAACC
Spr_2   N05   opSpV0100000732                        ref|NC_003098.1|:1647556-1648074
                                                                   NC_003098.1
                                TCATTCGCAAGCTCAATGATTTTCACTTTAAGCATAATTTTTCGAGTCTTCC
Spr_2   N07   opSpV0100000733                        ref|NC_003098.1|:c1637675-1637214
                                                                   NC_003098.1
                                TGGGTGGGAAGTAGGAGATAAATTGCCAGAGTGGCTACATAGCTCCTATC
Spr_2   N09   opSpV0100000734                        ref|NC_003098.1|:c1525277-1524246
                                                                   NC_003098.1
                                TTTGGCCCATGTTATCCTCCGTGGAGCAGTCAACGAGTATGGCAATTATA
Spr_2   N11   opSpV0100000735                        ref|NC_003098.1|:c199198-198743
                                                                   NC_003098.1
                                CGTGATTTACGAGGTGAAACACGTACTGTACGAGCCATTGCTTTAGCTGA
Spr_2   N13   opSpV0100000736                        -             -
                                GGCATTTTCATTTGGCTGCACCGTGTGATTGTTCTGAGGAGCTGACCTCT
Spr_2   N15   opSpV0100000737                        ref|NC_003098.1|:c2002067-2000715
                                                                   NC_003098.1
                                GATTGATGTCAGTGAAAATGCAAATCGAAGCGGGTTTAAGAACATTCGAG
Spr_2   N17   opSpV0100000738                        gb|AE007317|:1751672-1752047
                                                                   AE007317
                                CGTCATATGGTTGTAAACCCCTTATCACCGTGTCCTCTTGACGAATTTTCA
Spr_2   N19   opSpV0100000739                        ref|NC_003098.1|:c1457137-1456835
                                                                   NC_003098.1
                                TAGCCTTTATAGTGTCATTTTGGAAGGATAATAGAAGTTTGTGGAATCCAG
Spr_2   N21   opSpV0100000740                        ref|NC_003098.1|:881755-882300
                                                                   NC_003098.1
                                GGATGAACAAAAACTTATCTTGGTCAAGCAGTACCGCAAAGCTATCGAGG
Spr_2   N23   opSpV0100000741                        ref|NC_003098.1|:1439432-1439710
                                                                   NC_003098.1
                                CTGATTTATTTGATTACCACGATAATGGAATCGTGCGTTTTTACGATGACC
Spr_2   P01   opSpV0100000742                        ref|NC_003098.1|:c1588040-1587834
                                                                   NC_003098.1
                                GTTGTCAGGAGGTAAAAGCGCTATGCCTATGACACAAAAAGAGATGGTTA
Spr_2   P03   opSpV0100000743                        ref|NC_003098.1|:499939-500571
                                                                   NC_003098.1
                                TGAGAGAGGACTTAGCAGGGGAAAGACAGGAATGTCTGCTTATTTTACCT
Spr_2   P05   opSpV0100000744                        ref|NC_003098.1|:c1667915-1666290
                                                                   NC_003098.1
                                CTTTATGCTGGACATGGTACTTAATCATTGTTCGACAGAGCATGAATGGTT
Spr_2   P07   opSpV0100000745                        ref|NC_003098.1|:c1580517-1579849
                                                                   NC_003098.1
                                GTTGTTGGAGCTTTCATCGCTTCTGGCGCTGTCTTCTTCCTCTTGGCTAAC
Spr_2   P09   opSpV0100000746                        ref|NC_003098.1|:752241-754721
                                                                   NC_003098.1
                                GAGCGAAAAGAATTCACTCCATGGCGGACCTATAGATCTAAGTCTGTCAA
Spr_2   P11   opSpV0100000747                        ref|NC_003098.1|:16945-19846, ref|NC_003098
                                                                   NC_003098.1
                                TAGCGTAAGCGAAGGTATGAATTGAAGCCCCAGTAAACGGCGGCCGTAAC
Spr_2   P13   opSpV0100000748                        -             -
                                TTTGAAGAGATTTTCGAAGAGTATAAAATTTTGACATTCTAAAACGCATCCT
Spr_2   P15   opSpV0100000749                        ref|NC_003098.1|:c1070343-1068652
                                                                   NC_003098.1
                                CTTGGAATGAACTCATTCACTGCTAATCTACCATGGACAACTCCAGCTCCA
Spr_2   P17   opSpV0100000750                        -             -
                                TGTCAAATTTACAAAACGAGACGACTTGGACAAGATGTTTGAAGAGTTTGC
Spr_2   P19   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_2   P21   opSpV0100000751                        ref|NC_003098.1|:c1771156-1770284
                                                                   NC_003098.1
                                TTGCCTTTATCGTGCCTCGTACGGTCTTTGTGCCAGCGCCAAATGTGGAT
Spr_2   P23   opSpV0100000752                        ref|NC_003098.1|:c1241505-1238887
                                                                   NC_003098.1
                                TCCAAGCAGTAACTGCTGAGGAACTTCGTGCGATTGAACAGCAAGTTAAC
Spr_3   A01   EMPTY             -                    -             -
Spr_3   A03   opSpV0100000753                        ref|NC_003098.1|:c1182138-1181497
                                                                   NC_003098.1
                                AAGTATATAAAAAGTCAGGGCTGTACTCAAATAATTGTAGCTCATAGATTG
Spr_3   A05   opSpV0100000754                        ref|NC_003098.1|:640145-641530
                                                                   NC_003098.1
                                AGTCATCGTTTAGACCCTTTGATTTCTGTGGTTGATTATTGGATTGAGATG
Spr_3   A07   opSpV0100000755                        ref|NC_003098.1|:c1264172-1263789
                                                                   NC_003098.1
                                ACCTCAATGACCATGCGCGTGTCTTGAGCAAGAAAGCTTCATCAGCTGGT
Spr_3   A09   opSpV0100000756                        -             -
                                TATATTTTATTTCTAAATTAAAAGAGAATCCCATAAAAACTACAGATTTATGA
Spr_3   A11   opSpV0100000757                        ref|NC_003098.1|:c300602-300360
                                                                   NC_003098.1
                                CCTGGTCTGAAAGCAGGTTCGATTTATGGAACAGTGATATTTTTTATAATT
Spr_3   A13   opSpV0100000758                        ref|NC_003098.1|:c2035316-2033991
                                                                   NC_003098.1
                                GGATAGAGGACTATTCCTAAGTTTACTACTATCTCTTTTATATGAGAGCAC
Spr_3   A15   opSpV0100000759                        -             -
                                ACAAAAAAGCACCGAATCGGTGCGCACTTTTTCAAGTTGTGTACGGACAA
Spr_3   A17   opSpV0100000760                        -             -
                                GGTGACAAATGAATCCAATCCAAAGATCTTGGGCTTATGTCAGCAGAAAG
Spr_3   A19   opSpV0100000761                        -             -
                                TGGATGTTTTTTTGCTTCCGTCTAAATATGAGGGGTTGCCTGTTTCTCTAG
Spr_3   A21   opSpV0100000762                        ref|NC_003098.1|:347668-348663
                                                                   NC_003098.1
                                GTGGTGGACAATGGGATTGGTTTCCAGTTAGGGAGCTTAGACGACTTGAG
Spr_3   A23   opSpV0100000763                        ref|NC_003098.1|:c1053819-1053664
                                                                   NC_003098.1
                                TGGTCTTGTTATCGTTTCACATTCCAAACACATTGCAGAAGGTGTTGTTGA
Spr_3   C01   opSpV0100000764                        -             -
                                TTGTCATTTGTTTGTATAGAGGTATTTCAGAAACAGAATTCTATCAACAACT
Spr_3   C03   opSpV0100000765                        ref|NC_003098.1|:c1259827-1259426
                                                                   NC_003098.1
                                GAGTATTTCGGTATCGGAATTGCTTCATTTGATTGAGCAGTATCCTAGTCT
Spr_3   C05   opSpV0100000766                        ref|NC_003098.1|:c1754945-1754739
                                                                   NC_003098.1
                                TTTTAGTCATCATAGTACTGATTTTAGGTACTCTGGCTCTAGGAATCGGTT
Spr_3   C07   opSpV0100000767                        ref|NC_003098.1|:c1652002-1651238
                                                                   NC_003098.1
                                GGCGTTGCTTATGCCCAGTACGATATCTTCCGTTTAGAGAACGGGAAAAT
Spr_3   C09   opSpV0100000768                        -             -
                                GGTGAATAATTGGGGACTATATATCTGCAGAATACTCTTTCAGTTTCATTC
Spr_3   C11   opSpV0100000769                        ref|NC_003098.1|:105242-105490
                                                                   NC_003098.1
                                TGGTGGTCAATGGAACTATGGAGTAGGATGGTCAGGAAATTTTGGTTATT
Spr_3   C13   opSpV0100000770                        -             -
                                ATCTAATATCTTTATTTAATGAACTCCTAAACTTTTTCATAATAATCTCCTTC
Spr_3   C15   opSpV0100000771                        ref|NC_003098.1|:319581-320186
                                                                   NC_003098.1
                                TAGAGTATCGCAGTTTACGTTTTAAGCACGAAGTGCTTGATGAGGAAAATC
Spr_3   C17   opSpV0100000772                        ref|NC_003098.1|:c1815488-1815060
                                                                   NC_003098.1
                                ACGAAATCCAAAGTCGAGCAACTTCCTCTTGGGAACATGGCAATCCGATT
Spr_3   C19   opSpV0100000773                        ref|NC_003098.1|:843217-843960
                                                                   NC_003098.1
                                CCCAAGTATAAACGTATTTTAATCAAGTTATCAGGTGAAGCCCTTGCCGGT
Spr_3   C21   opSpV0100000774                        -             -
                                GAGTTTCTATCATTTTCCTTGGGAGCTCTTTGCTGGCTTTGGAATGATGTC
Spr_3   C23   opSpV0100000775                        ref|NC_003098.1|:c619395-619165
                                                                   NC_003098.1
                                AGGATTGCTAAACCAAATCCGATACCTGTTGCAAGTCCAGCTGAAAAATCA
Spr_3   E01   opSpV0100000776                        ref|NC_003098.1|:857937-858929
                                                                   NC_003098.1
                                CTGCCCTAGAAATGTATCTGGCTGGGGCATCTGCTATCGGAGTTGGAACA
Spr_3   E03   opSpV0100000777                        ref|NC_003098.1|:c1705715-1704954
                                                                   NC_003098.1
                                TCGGTGAAGCGATTGCGCGTGCTTATCTGGAGCAGGGTGAGGATGTCGT
Spr_3   E05   opSpV0100000778                        -             -
                                CTAGTCGTGGACGTTTGGACGCACCGGGTGTCTCTAACTTAGCTTTTGAT
Spr_3   E07   opSpV0100000779                        ref|NC_003098.1|:821932-823191
                                                                   NC_003098.1
                                ATCCATTATATCGACATTTTAGACTGTAATGGCGGTGACCACGGTTATCCA
Spr_3   E09   opSpV0100000780                        ref|NC_003098.1|:199908-200321
                                                                   NC_003098.1
                                AGCATTCGGTGAATACGGTCTTCAAGCTACAACTAGCCACTGGATCACTA
Spr_3   E11   opSpV0100000781                        -             -
                                TGATAATATCTATGTTCTGAACGATACTTTTAAGAAGTAGCACTCAAGAAG
Spr_3   E13   opSpV0100000782                        ref|NC_003098.1|:c1691936-1691864, ref|NC_0
                                                                   NC_003098.1
                                GCTTAGCTCAGTTGGTAGAGCATCTGATTTGTAATCAGAGGGTCGCGTGT
Spr_3   E15   opSpV0100000783                        ref|NC_003098.1|:233892-234668
                                                                   NC_003098.1
                                CTATCTCTTTACTCAGCATTTGCCTAAGGACTTACGAGACCCAGACTTGAT
Spr_3   E17   opSpV0100000784                        ref|NC_003098.1|:747720-747932, ref|NC_0030
                                                                   NC_003098.1
                                CAATTCTAATATTAGGTACATGATTAAATTGATTGATCGTTACGGAATAGAG
Spr_3   E19   opSpV0100000785                        -             -
                                TCTTATACTAGAGTCATCAAAAAGAAACGAGGACTCTCATATGACAGTAAC
Spr_3   E21   opSpV0100000786                        ref|NC_003098.1|:c1995916-1995395
                                                                   NC_003098.1
                                GGAGGCTACATTCGTATAGGACGGATTGAGTTTTCTAGTCATCATGAAATG
Spr_3   E23   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_3   G01   opSpV0100000787                        -             -
                                TTTACTATATTTTTGTTTCGCGGGAAGTCTACTAAGATACTTAAAGATGCAG
Spr_3   G03   opSpV0100000788                        ref|NC_003098.1|:732487-732897
                                                                   NC_003098.1
                                TTACTGAGTCTAGAGGACTTTGAGGCGGAACTTGAAAATCTACCAGCTTG
Spr_3   G05   opSpV0100000789                        ref|NC_003098.1|:c1314292-1314035
                                                                   NC_003098.1
                                AAGAAAAAGTGGAACAAGCCAAACTACGTGAGGAGTACATCGAAGGTTAT
Spr_3   G07   opSpV0100000790                        -             -
                                TGTTATTAGCTTCGACCGATCATCTCTCGTATGGCAATCGCATATCACCTC
Spr_3   G09   opSpV0100000791                        ref|NC_003098.1|:435469-435918
                                                                   NC_003098.1
                                TTTTGTTCCTTATTATAAGGTCAATCATTGTGAGGAAGCTTTTGCTTGGTAT
Spr_3   G11   opSpV0100000792                        ref|NC_003098.1|:c1620031-1619051
                                                                   NC_003098.1
                                CATCTTGGTGCTAGACCGTATTGAAGCAATTACAGGAATACGTCCCGTGT
Spr_3   G13   opSpV0100000793                        ref|NC_003098.1|:c1412659-1411427
                                                                   NC_003098.1
                                GGCGGTTTATAACCACTACAAACGCATCAATTTCCACGATACACGCGAAG
Spr_3   G15   opSpV0100000794                        ref|NC_003098.1|:c1747988-1744311
                                                                   NC_003098.1
                                TAAATCGTTTTAAAAGTATGCAAATCACCCTAGCTTCTCCAAGTAAAGTCC
Spr_3   G17   opSpV0100000795                        ref|NC_003098.1|:c1921072-1919726
                                                                   NC_003098.1
                                CAAAATTCTTTAAATCCATTTGGTACCATGTTTGAGCATGCTTTTCATTTAT
Spr_3   G19   opSpV0100000796                        ref|NC_003098.1|:2037645-2038403
                                                                   NC_003098.1
                                TGGCAAACTATCACAAGCCCATGCGCGTTCCCTAGTTGGGTTAAATAAGG
Spr_3   G21   opSpV0100000797                        ref|NC_003098.1|:403586-403801
                                                                   NC_003098.1
                                GCTGGGTTCGTGATAAGAAAATCACAGGCTACCGTATCTCTAAAGAAACG
Spr_3   G23   opSpV0100000798                        -             -
                                GAAACTCGCGTCTTTTTTTGTTTTCAGAATATTGTTCAAAATTTTGTGCCTG
Spr_3   I01   opSpV0100000799                        ref|NC_003098.1|:345885-346895
                                                                   NC_003098.1
                                GTTTAGAAGCTGGCAATCGCATCTAGCAGATTATAGCAAGCAAATTCCCG
Spr_3   I03   opSpV0100000800                        ref|NC_003098.1|:127503-127802
                                                                   NC_003098.1
                                TGCTTGACTGATTTACATCATTTATTTGACTTATACAAAATCACACGAGATT
Spr_3   I05   opSpV0100000801                        ref|NC_003098.1|:c1814369-1811697
                                                                   NC_003098.1
                                TGCTGCCAAAGTAATGTGGCTCTTCTACGAGCAACCAGAAGTGGACTTCC
Spr_3   I07   opSpV0100000802                        gb|AE007317|:561189-561440
                                                                   AE007317
                                CACACAAGCCTATATAGAAGGAACCACGACACTGCAAGTTTGGACCGCCT
Spr_3   I09   opSpV0100000803                        -             -
                                GATTTATTAGCTGTTTATGGCCCTGATACGCCTCGGGAGATGTGGACCTA
Spr_3   I11   opSpV0100000804                        ref|NC_003098.1|:355553-357508
                                                                   NC_003098.1
                                GGAACGACTTCAGTATGTACAGGCACATCGTACAATTGTCGCGCGTGATG
Spr_3   I13   opSpV0100000805                        ref|NC_003098.1|:836898-837788
                                                                   NC_003098.1
                                AGTTTATATTTTCTTCTTGACTAGCGATGAGGAAAAGATGTTACCGACAAT
Spr_3   I15   opSpV0100000806                        ref|NC_003098.1|:757384-758307
                                                                   NC_003098.1
                                AAGATAAAACAAACCCAGTTCGACTTGGGACATCTGCATTTTGGACTCTAT
Spr_3   I17   opSpV0100000807                        ref|NC_003098.1|:943808-944590
                                                                   NC_003098.1
                                AGAATATTGTAGCCAAAAGGGAGTAAGTGTTAATTCTATACATCCTTTTATG
Spr_3   I19   opSpV0100000808                        ref|NC_003098.1|:24776-25219
                                                                   NC_003098.1
                                GTTAAGGCTTATATGCAGCCGACTGAGGTTCTCTACCTCTATGATCGTTCT
Spr_3   I21   opSpV0100000809                        ref|NC_003098.1|:780983-782125
                                                                   NC_003098.1
                                AATTCCGACTGAAAAGTATCTGACAGAACGGGTGGATTGCGCGACTTTCT
Spr_3   I23   opSpV0100000810                        -             -
                                AATTTGCCGTCTAATATCACCCAATCTAAGGGATTTAAAATACACCTGAGC
Spr_3   K01   opSpV0100000811                        ref|NC_003098.1|:c102095-101463
                                                                   NC_003098.1
                                GTTTTGCGACCTGCCTGTCCAAAGACCAAATTTCTGAAGCCGTGCAGATA
Spr_3   K03   opSpV0100000812                        ref|NC_003098.1|:499631-499915
                                                                   NC_003098.1
                                ATATTCTAGCCCAAGTGGCAGAAGGACGGAATATCTTGGTTTTAGTTAATC
Spr_3   K05   opSpV0100000813                        ref|NC_003098.1|:957625-960321
                                                                   NC_003098.1
                                CATGCTTGGCTACTCTGACAGTAATAAAGATGGCGGTTACTTGTCATCATG
Spr_3   K07   opSpV0100000814                        ref|NC_003098.1|:c1724771-1723401
                                                                   NC_003098.1
                                CTCTTTTGAGCATTCTAGTTATGTTGCTGGGCTTTCTTGGCTTGTATCCTC
Spr_3   K09   opSpV0100000815                        ref|NC_003098.1|:c30016-29624
                                                                   NC_003098.1
                                TGGTCGCTGAAACTTCTGATGACGTACAGTCATATTTCTTCTCTTTTTATTA
Spr_3   K11   opSpV0100000816                        ref|NC_003098.1|:853218-853715
                                                                   NC_003098.1
                                AAATGCTGGCTCATGGATGAGATTACAAATGGCTTAGACGAGTATTATCGA
Spr_3   K13   opSpV0100000817                        ref|NC_003098.1|:c473114-472107
                                                                   NC_003098.1
                                GGTCTTGAATCATCTATCGCAAGCCTCAAAATTCAGCAAGCTGGTATCGG
Spr_3   K15   opSpV0100000818                        -             -
                                ATATGTATCAAATTGATCAATCAACTATCTTGTTTATCACTTCTTAAGAGGA
Spr_3   K17   opSpV0100000819                        ref|NC_003098.1|:c1354018-1353554
                                                                   NC_003098.1
                                GTCTGATTTGCCTGAGATAGGGGCACTTCAGACCTCGTCTTTTCCAGCTG
Spr_3   K19   opSpV0100000820                        ref|NC_003098.1|:c1116457-1115894
                                                                   NC_003098.1
                                TGGGAAATGGCTTATTCACAGCTTAATCCAGTTTGGAAACAGTATGATGCT
Spr_3   K21   opSpV0100000821                        ref|NC_003098.1|:469419-469757
                                                                   NC_003098.1
                                AAGTAAACATCGACGATATCTACTATATCCAAACACATCCAACTAAAGCCC
Spr_3   K23   opSpV0100000822                        gb|AE007317|:486549-486779
                                                                   AE007317
                                TTTGCAGTTCAATTGCTGTTTTACAAGATATTGGATTGGTTCTTTAAACTTA
Spr_3   M01   opSpV0100000823                        ref|NC_003098.1|:c1863289-1861478
                                                                   NC_003098.1
                                GAAATGTGACGCTGGCTCTCATCACCATTGCCAGCACCCCATTGGCTTTC
Spr_3   M03   opSpV0100000824                        ref|NC_003098.1|:276329-276670
                                                                   NC_003098.1
                                ATGTACTTTAAGCAATTTGAAGAGGCTGGTTCTAAAGCAGGAAAACCAGTT
Spr_3   M05   opSpV0100000825                        -             -
                                CTAAGTTGTCGCCCGATTTGGTTGGAAGGTATGGTTTTACTGCTAGCTGT
Spr_3   M07   opSpV0100000826                        ref|NC_003098.1|:973796-975055
                                                                   NC_003098.1
                                GACAACAAATGGTCATATTTTGTACACGGGTGGACGTGATTTACGTGGGG
Spr_3   M09   opSpV0100000827                        ref|NC_003098.1|:c1326317-1325979
                                                                   NC_003098.1
                                GGTGGTCGTAACCATGCTTATATGACGGTTGAGCAAGAGAAAGTCTTTCT
Spr_3   M11   opSpV0100000828                        gb|AE007317|:1884831-1885059
                                                                   AE007317
                                GTCGGTAAAAGCAAGCCCCTACCGATACAACCTAAAAACACTCTTCACAAC
Spr_3   M13   opSpV0100000829                        ref|NC_003098.1|:125670-126428
                                                                   NC_003098.1
                                ATCTATCTGTCTAGCCATAAATTCGATTCTGTTAATGAGTTTCCCCATTTTA
Spr_3   M15   opSpV0100000830                        ref|NC_003098.1|:429323-429871
                                                                   NC_003098.1
                                ATCAACATTCCAACCCCTGTTCCAAATACAAGCATCCAGCTTCAGTATGCG
Spr_3   M17   opSpV0100000831                        gb|AE007317|:927736-927957
                                                                   AE007317
                                TTGTACGAGTTGAAGCATCAGCGAAGTAAAAGTAGATGTTCAGCCAATGC
Spr_3   M19   opSpV0100000832                        ref|NC_003098.1|:c1401140-1399941
                                                                   NC_003098.1
                                ATTTGGAGACTGATTTTACTTTTGAATCCTCTGAACAAGCCTGGGCGGCTT
Spr_3   M21   opSpV0100000833                        ref|NC_003098.1|:152331-153560
                                                                   NC_003098.1
                                TTTGCCCCTTTGGCGATTTTACTCATCACGATTTCAGAAACCCTGCCCCAA
Spr_3   M23   opSpV0100000834                        ref|NC_003098.1|:609733-611595
                                                                   NC_003098.1
                                CAAGAAGCGACTATGGCACCAATCTTTGACACGATTATCGACCATATCCCA
Spr_3   O01   opSpV0100000835                        ref|NC_003098.1|:1012186-1013328
                                                                   NC_003098.1
                                TTTACTCAAGAAACTTGATTTCACCACCAAACTTCCTCGGGGCAAATGCTC
Spr_3   O03   opSpV0100000836                        ref|NC_003098.1|:1658788-1659753
                                                                   NC_003098.1
                                AACATCCCTTAAACTTTATTTCACTGCCCTAGTGGCCAGCTTCTTGCTCCT
Spr_3   O05   opSpV0100000837                        ref|NC_003098.1|:c1845667-1844525
                                                                   NC_003098.1
                                GAAACGAAAATAATTTCAACAACTTACGAGGCACCAGCTGCGCCCGATTA
Spr_3   O07   opSpV0100000838                        ref|NC_003098.1|:c535024-534635
                                                                   NC_003098.1
                                CAAGTTGCTGGTGCCAGCCAGAAAGATTTGGTACCTCTTCGCAAGGAAGT
Spr_3   O09   opSpV0100000839                        ref|NC_003098.1|:488925-489320
                                                                   NC_003098.1
                                GGTTGTAGATGAGACAAAAAAAGTCGTGAAGCGTGCAGAACAGTCAGCAA
Spr_3   O11   opSpV0100000840                        ref|NC_003098.1|:590841-591425
                                                                   NC_003098.1
                                TGGATATCGGAGACACTGCAATTGGCATGCATGTCAAGCATGTTCAGGTT
Spr_3   O13   opSpV0100000841                        -             -
                                ACAGCTATTTGTGCTGCGAGTGGTGTTGGAGCACCATTTATGGGAGCATG
Spr_3   O15   opSpV0100000842                        ref|NC_003098.1|:c415151-414804
                                                                   NC_003098.1
                                TATGCGAATCCTTGTACTCATTTGAGAATCTGACCGTTTTAGTAGTCCCTA
Spr_3   O17   opSpV0100000843                        ref|NC_003098.1|:476175-476354
                                                                   NC_003098.1
                                GGAGGATTTCTATGAAAAAGTATCAACTTCTATTCAAAATAAGTGCAGTCT
Spr_3   O19   opSpV0100000844                        ref|NC_003098.1|:688019-688378
                                                                   NC_003098.1
                                GCTGATTGACGAGTGTGGTCCTGAACTTTATTTTAAGAACTTAACTCAAGC
Spr_3   O21   opSpV0100000845                        ref|NC_003098.1|:720316-720720, ref|NC_0030
                                                                   NC_003098.1
                                TATGACAGTTGAGGAAGAGAAAGCCTTTCTTGCTCGCCATTTGAAGGCTA
Spr_3   O23   opSpV0100000846                        gb|AE007317|:463882-464640
                                                                   AE007317
                                TGTATTGGATGAAGAGTATCTAAAAAATACACGAAAAGTTTATAATGATTTT
Spr_3   A02   EMPTY             -                    -             -
Spr_3   A04   opSpV0100000847                        gb|AE007317|:1468797-1469086
                                                                   AE007317
                                TCTCGCTTTCATTTGTATTTGCATTTATCTTAACAAAAATCACTAGGGAATG
Spr_3   A06   opSpV0100000848                        ref|NC_003098.1|:639551-640144
                                                                   NC_003098.1
                                GTTGGCTCTCTCTAACTGCTAATAGTATTGGGATTACGCTTGTTAGCTTTG
Spr_3   A08   opSpV0100000849                        ref|NC_003098.1|:371275-372186
                                                                   NC_003098.1
                                CCCCCTCTTTTGTCAGGAATGGCAACCTTTCCTATGGCTGGGATGATTTTA
Spr_3   A10   opSpV0100000850                        ref|NC_003098.1|:839217-839762
                                                                   NC_003098.1
                                CAATGATTGATTCGTTGAGTGAGGAAGAATTATTTGAACCGCATATGAGAA
Spr_3   A12   opSpV0100000851                        ref|NC_003098.1|:c1674496-1673429
                                                                   NC_003098.1
                                ATAAAGGGGATCTTTACTCAATCCCAGGAACACCTCCGTCACTTTATACTG
Spr_3   A14   opSpV0100000852                        -             -
                                TTCAATGATACAATTTGGCAATCCACAATTCCTCTAGCAAGCCAAAGCATC
Spr_3   A16   opSpV0100000853                        ref|NC_003098.1|:c247144-243374
                                                                   NC_003098.1
                                TTTACACAAATCCATACTATGTCCATGATATCCGTATGACAGGAGCCCAAC
Spr_3   A18   opSpV0100000854                        -             -
                                GTCCTATTCTTATTTCATTTTACTATATTTTTATGAAAATCTTAAAAAATCAG
Spr_3   A20   opSpV0100000855                        -             -
                                AAGCTCTTTCAAATTATGGTAGAATGGAAGCAGTAGAATTAGAAAAGGAAA
Spr_3   A22   opSpV0100000856                        ref|NC_003098.1|:1964196-1964969
                                                                   NC_003098.1
                                TTAAAGATAGCTCCAAAATCTTTATCACATCTGGCGAGGTCAAACATCAAT
Spr_3   A24   opSpV0100000857                        ref|NC_003098.1|:194080-194670
                                                                   NC_003098.1
                                TATCAGGCTGTATGTTTCACTGCGAGGGATGTTATAATGTTGCGACTTGG
Spr_3   C02   opSpV0100000858                        ref|NC_003098.1|:c405585-404650
                                                                   NC_003098.1
                                CACAAACCTATCAATACTTCCAGACATTTACAATCATCGCCGTGATTTACTT
Spr_3   C04   opSpV0100000859                        ref|NC_003098.1|:740471-741748
                                                                   NC_003098.1
                                GAGTTGGCTCAAACTATGGTAGATCTTGGTAAGGTTGTTGGACGGAAGAC
Spr_3   C06   opSpV0100000860                        gb|AE007317|:1805544-1805801
                                                                   AE007317
                                CTCTCTGCTGTAAACCTCATCCTGTAAAAATAATTAGTTCAACTTTAAAAAT
Spr_3   C08   opSpV0100000861                        -             -
                                TAATTAGTGTTGTGGTACCGATATACAATACGGGAAAATATTTAGTGGAGT
Spr_3   C10   opSpV0100000862                        ref|NC_003098.1|:c1298335-1297700
                                                                   NC_003098.1
                                ATTGTCGAGTATTATCCTCTACAGGAGCTATTTGGGACTTCAAAGACGATT
Spr_3   C12   opSpV0100000863                        ref|NC_003098.1|:c1779561-1778347
                                                                   NC_003098.1
                                TGTCTGGCCCTAAGACTCATGTTAAGGGCTATATCGAAGGGCTCAATATG
Spr_3   C14   opSpV0100000864                        ref|NC_003098.1|:c1075161-1074817
                                                                   NC_003098.1
                                ATCATCTGGTCAACTTTGAACAAGGGACCTTTCATTACCTTTGAACCATGG
Spr_3   C16   opSpV0100000865                        ref|NC_003098.1|:c2031426-2031088
                                                                   NC_003098.1
                                AAAACAGACAATGATCAAGTTCCTGTAAATGGAATCGCAATAGCTCCTTAT
Spr_3   C18   opSpV0100000866                        ref|NC_003098.1|:273944-274309
                                                                   NC_003098.1
                                GGAGGATATAAGATGACATTGACTATTCATGTATATTATAAAGGTGATGGA
Spr_3   C20   opSpV0100000867                        ref|NC_003098.1|:142595-143809
                                                                   NC_003098.1
                                ATGGAGACATTAAGGATATAGTGTTTTCGGCTCATATTATAGTTAGGTATA
Spr_3   C22   opSpV0100000868                        ref|NC_003098.1|:548029-549429
                                                                   NC_003098.1
                                TCAAAGAATTGGGTCTTCCAACTTCTAAGAAAGTTCGCTTCATCGTTGGAA
Spr_3   C24   opSpV0100000869                        gb|AE007317|:1575033-1575375
                                                                   AE007317
                                TTGTCAAGCGTATCTTGATTGGTATGCTTTATGGGGAATCCTAGGACTGAC
Spr_3   E02   opSpV0100000870                        ref|NC_003098.1|:581508-582071
                                                                   NC_003098.1
                                GATAAGTCTGTCATCACCCGACCGCAGACAACGATTGAGGCATTAGAAAA
Spr_3   E04   opSpV0100000871                        ref|NC_003098.1|:1717094-1717357, ref|NC_00
                                                                   NC_003098.1
                                GTTTAAAATATTTTCAACAACCTATCGAAATCATCGTAAACGCTTCGGATTA
Spr_3   E06   opSpV0100000872                        ref|NC_003098.1|:c632361-631681
                                                                   NC_003098.1
                                TTGCATATTGCAGTTTGGGGAATTTTGGGATCCTTTCTGCTCGGTTTAATC
Spr_3   E08   opSpV0100000873                        ref|NC_003098.1|:1759587-1759748
                                                                   NC_003098.1
                                TTTCTTCATAGACAACTCCTCAAAAATTTAATAAACGTATTATACACCTATT
Spr_3   E10   opSpV0100000874                        ref|NC_003098.1|:1301386-1302147
                                                                   NC_003098.1
                                AAGGTGCTGTTCATCAAGGTTTTGTTCTACGAGTGTCTGAATTTGCCTATA
Spr_3   E12   opSpV0100000875                        ref|NC_003098.1|:c1964065-1962617
                                                                   NC_003098.1
                                TGATACAGCAAGCGCGATTGTCTCAGTACCTAAGACAGAAGGTAGTTTAT
Spr_3   E14   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_3   E16   opSpV0100000876                        ref|NC_003098.1|:c1757552-1756515
                                                                   NC_003098.1
                                GAACAAAAGGCGCATCCGGACGCGAAAAACAACTACCAAACAGCCCTAGA
Spr_3   E18   opSpV0100000877                        -             -
                                ATAGATACCTTGTTATGACGCGCTTACTTTCTATATAATTACATTTACGATT
Spr_3   E20   opSpV0100000878                        ref|NC_003098.1|:c1535467-1534157
                                                                   NC_003098.1
                                CCTTACGCACCGATTATCTTTGTATCAGCTTTAACCAAGCAACGTCTCCAC
Spr_3   E22   opSpV0100000879                        ref|NC_003098.1|:870728-871594
                                                                   NC_003098.1
                                ACCAATCCTGTTCATTCAGAGGTCCTAGAGGCCATGCAGACAGTGAAACA
Spr_3   E24   opSpV0100000880                        ref|NC_003098.1|:1877809-1878459
                                                                   NC_003098.1
                                GGCAGGCATTGCCAAAGCTGTTTTGCAACTAAAAGAAAATCAACTAGCCC
Spr_3   G02   opSpV0100000881                        -             -
                                ATGCACGCTTTAGTTGATGCTATGTCTGAACGTATTACGCTACTAGCTAAT
Spr_3   G04   opSpV0100000882                        ref|NC_003098.1|:110545-111936
                                                                   NC_003098.1
                                TGCAGGGAAGTTACATACGGCTCGTTCTCGAAATGACCAAGTTGCGACAG
Spr_3   G06   opSpV0100000883                        ref|NC_003098.1|:c1331853-1330741
                                                                   NC_003098.1
                                AACAGTGACCTTAGTTTATAGAGAAAGCGAAGCGCCAACCACTGCTACAG
Spr_3   G08   opSpV0100000884                        ref|NC_003098.1|:1267181-1268221
                                                                   NC_003098.1
                                CGGAACCTTTAGACCTGTTTCTGTGGATAATCTGGACGAACACGAAATGC
Spr_3   G10   opSpV0100000885                        ref|NC_003098.1|:251074-255465
                                                                   NC_003098.1
                                TTTGATGAATCAATTGGGGATGCCTGCTGAAATGAGACAGGCTCCTGCTT
Spr_3   G12   opSpV0100000886                        ref|NC_003098.1|:478078-478872
                                                                   NC_003098.1
                                AGCAAATCGTCAATATTTTAACCCGTCTTCATCGCTCACGTCCGTTGATGA
Spr_3   G14   opSpV0100000887                        ref|NC_003098.1|:775123-776034
                                                                   NC_003098.1
                                TATCTATAAGGATTTGATTTCCTTGACGCGCCAGACTGGTGCGCAAGTGG
Spr_3   G16   opSpV0100000888                        ref|NC_003098.1|:582330-584384
                                                                   NC_003098.1
                                TGGAAGAACAAGGAGCAAAGCCGTCTCCGTGCTCTTGATTATGACCAAAT
Spr_3   G18   opSpV0100000889                        ref|NC_003098.1|:805375-806091
                                                                   NC_003098.1
                                ACGGAGAAAAATACAAGCTTTTAAGAGAGAAGTGGGAGATACCTTGTTTAT
Spr_3   G20   opSpV0100000890                        -             -
                                TCAGCCAGTCTTGTTATAATCAGCCTATAGGAATCAAGGAGGTGACTCTTA
Spr_3   G22   opSpV0100000891                        ref|NC_003098.1|:1426977-1428293
                                                                   NC_003098.1
                                TGTCGTAACTGAAGACGAAACTTACCGTTTCGACGCCCTTCTCTACGCAA
Spr_3   G24   opSpV0100000892                        ref|NC_003098.1|:400691-400957
                                                                   NC_003098.1
                                ATTCTTCAAATTGGCACAAATAGCTAGAGAAGAAGGTCTTGAAATTCATTC
Spr_3   I02   opSpV0100000893                        -             -
                                TGTTAAATTATTTCACTGTCAAAGTATATCTTTTTTAGGAGCAGAAAGCAAG
Spr_3   I04   opSpV0100000894                        -             -
                                GAACTCGAAATAGTTAGTGGAGGAAGAGGCAATTTAGGATCTGCAATCGG
Spr_3   I06   opSpV0100000895                        ref|NC_003098.1|:c1499806-1499342
                                                                   NC_003098.1
                                TCTGGGGTCAAACAGCTCTGCCCTTCCAATTGCTGAAAGCCATTTGTTTAG
Spr_3   I08   opSpV0100000896                        ref|NC_003098.1|:494407-495177
                                                                   NC_003098.1
                                GGTGATGGATATGACTTTCAGGTAGATGTCCAAGAGTATTCTTACCTTGCC
Spr_3   I10   opSpV0100000897                        ref|NC_003098.1|:c1102751-1099497
                                                                   NC_003098.1
                                AAGATTGGGTATACAGAACGTGATGTCACACAACGTATCAAGGAGCAAAC
Spr_3   I12   opSpV0100000898                        -             -
                                TACCGTATTCTTTCAAATCTAACATATCTCTAGTATAACACAGAAGGTTTCA
Spr_3   I14   opSpV0100000899                        ref|NC_003098.1|:c1593905-1592997
                                                                   NC_003098.1
                                TGCTGAATTAGATGGATTCTCAAAATGGGCTCAGTTTCGTTATATCACGAT
Spr_3   I16   opSpV0100000900                        ref|NC_003098.1|:704637-707183
                                                                   NC_003098.1
                                AAACAATTCTTCATCGGTGAGAACGAAGACAAGAACCGTCTCTGGGTGGT
Spr_3   I18   opSpV0100000901                        gb|AE007317|:247145-247560
                                                                   AE007317
                                GCTATTTTTATTCAGAAATTGATCTCTAACATTACCAATAAAAAAGAAAAAT
Spr_3   I20   opSpV0100000902                        ref|NC_003098.1|:c1296007-1295051
                                                                   NC_003098.1
                                AACCAATTCGCCTATCTGTCTGCTATTCAGGAGACCAATGCGGGAACAGC
Spr_3   I22   opSpV0100000903                        -             -
                                ATGCTTGCGAAAGTTGAAGGGGGGTATAGCTCCACTGATTGTCAAAATGC
Spr_3   I24   opSpV0100000904                        ref|NC_003098.1|:c1299521-1299186
                                                                   NC_003098.1
                                ATCGGAACAGCTAAAGCTCATCCTACTTGGGTCAATCGAACACCAAAGGG
Spr_3   K02   opSpV0100000905                        ref|NC_003098.1|:1024754-1028404
                                                                   NC_003098.1
                                GACCCAGTTTGCTAAACTAGGACAATTATCAGACCAGATAGCGATTCTCGA
Spr_3   K04   opSpV0100000906                        ref|NC_003098.1|:c1615965-1614274
                                                                   NC_003098.1
                                TTGATGCTGTACATCGTGTTCTAAAATCTCAGAGGGCACTTCAGAGTATTA
Spr_3   K06   opSpV0100000907                       gb|AE007317|:405586-406349
                                                                  AE007317
                                ACTTAGAGTTCGCAGCTTCAGCAGTCAGTGCTTCTGGACGTTCAGAAACA
Spr_3   K08   opSpV0100000908                       ref|NC_003098.1|:488575-488829
                                                                  NC_003098.1
                                GCCAAAGATGCCATGATTCGCTACGAGAGTCGCTTGGATGCTTATCAGTT
Spr_3   K10   opSpV0100000909                       ref|NC_003098.1|:c739069-738119
                                                                  NC_003098.1
                                AAGTTGGTATCTGGACCGTTTCTTGAAAATGCTGAGTCTAGCCCAAAACG
Spr_3   K12   opSpV0100000910                       gb|AE007317|:1634693-1635319
                                                                  AE007317
                                ATTATTGTCTATGATACCACTACAACGGGAAATATTTGATAAGACTCGCTT
Spr_3   K14   opSpV0100000911                       ref|NC_003098.1|:c1713045-1712329
                                                                  NC_003098.1
                                AACCTTTACAGAAGGACGTTACGAAGGTTTTGGGCCAAATGGCTCTATGC
Spr_3   K16   opSpV0100000912                       ref|NC_003098.1|:1367399-1368844
                                                                  NC_003098.1
                                ATGACCCTAACTATGAAGACCCAATGGCCATTGCAGATGAAATTAGTAGCT
Spr_3   K18   opSpV0100000913                       ref|NC_003098.1|:c1977108-1976116
                                                                  NC_003098.1
                                GGTCAACGTTATAAAACACTAGTTGGTACACCACAGGGAGGAAATTTATCT
Spr_3   K20   opSpV0100000914                       -             -
                                TTTTATTGAGTATACCACTATTTTACTCCCTCTGGCAAGGGACTTTGTCTA
Spr_3   K22   opSpV0100000915                       ref|NC_003098.1|:529452-530333
                                                                  NC_003098.1
                                CTCTTCCAGGATTCCCAATCGTATTGCACGGTGGATCAGGTATTCCTGAT
Spr_3   K24   opSpV0100000916                       -             -
                                GGGTGAAAATCTATTGCAGACTGTAAAAAATCAAAGCCTGACTGCTATCCA
Spr_3   M02   opSpV0100000917                       -             -
                                ATTTCCGACAAAACTTCCCCTCATGCTTTCCATATAAACGTGAGGATAGAG
Spr_3   M04   opSpV0100000918                       ref|NC_003098.1|:479630-480109
                                                                  NC_003098.1
                                CGTAGAATTAGTCAGAGAAGTTGTAGAACCTGTCATAGAAGCTCCTTTTGA
Spr_3   M06   opSpV0100000919                       -             -
                                TATTATATCAGCTTTCCAGAGGAGCGACAAGAAACAGCAAACTATATATAG
Spr_3   M08   opSpV0100000920                       ref|NC_003098.1|:c1958873-1956579
                                                                  NC_003098.1
                                CACAGGAGAGGGAGCAAGCGATTAATAATTGGTTAGTAAGTGGTTTGCAT
Spr_3   M10   opSpV0100000921                       ref|NC_003098.1|:c1996700-1995972
                                                                  NC_003098.1
                                TATCTTGAGATTCACAAGCAGTTGCAGCTAACAACCCTGATCATCACGCAT
Spr_3   M12   opSpV0100000922                       ref|NC_003098.1|:c652448-651795
                                                                  NC_003098.1
                                TGAGTGGATGAACGTCTTTTTAGAAGAGCTTTCACAAGCTTATCCATATGA
Spr_3   M14   opSpV0100000923                       ref|NC_003098.1|:1465568-1465786
                                                                  NC_003098.1
                                GAGATTTTTGAAGAGTATAAAAATCCTCAAGATACTTTCTTCTATCCTTTAG
Spr_3   M16   opSpV0100000924                       gb|AE007317|:136551-137367
                                                                  AE007317
                                ATAAATCGAATGGTAAAGGGATGGTAGTAATGTTCAAATCATTGAGAATGC
Spr_3   M18   opSpV0100000925                       ref|NC_003098.1|:c308935-308453
                                                                  NC_003098.1
                                CAAGGAAATCGCTGAAACTACTACTTGGGAAGATGTCCCAGGGACAACCA
Spr_3   M20   opSpV0100000926                       ref|NC_003098.1|:c1489321-1487948
                                                                  NC_003098.1
                                GCGCATGTGATTAGTTTATCAGAATTTGCGGGTCAATTAACAGAAGTTAAT
Spr_3   M22   opSpV0100000927                       -             -
                                GGAAAAACAAGATTTTTGCCTATTTTTTAGAAAGCAATCTGTTTTTCAATTT
Spr_3   M24   opSpV0100000928                       ref|NC_003098.1|:c1074203-1073688
                                                                  NC_003098.1
                                CAGGTGTTCGTTCTGCCTTGGTTCGTGATATGACAACAGCCCTTTATGCTA
Spr_3   O02   opSpV0100000929                       ref|NC_003098.1|:c1070660-1070343
                                                                  NC_003098.1
                                ATTGTTAGGTTTTGAAATCGTAGCCTATGCTGGCGATGCTCGTTCAAAACT
Spr_3   O04   opSpV0100000930                       ref|NC_003098.1|:558589-559581
                                                                  NC_003098.1
                                CCAACTCAAGGAGACCTTTGGTAAGATGAAGACTCTCTCTTTTGAACTGCT
Spr_3   O06   opSpV0100000931                       ref|NC_003098.1|:995261-995434
                                                                  NC_003098.1
                                TGTTTTGGCTTTTTTCTTTGTCATCAGGGAAAGTGACTTGCTTCAAATCAG
Spr_3   O08   opSpV0100000932                       -             -
                                ATATCATGACCTTGATAACCTGCGATCCGATTCCTACCTTTAATAAACGCT
Spr_3   O10   opSpV0100000933                       -             -
                                TGAAAATCATCAAAAAAATGGTATAATGGTAGGAAAAGATTCGGCTGAAAG
Spr_3   O12   opSpV0100000934                       ref|NC_003098.1|:c1530000-1529350
                                                                  NC_003098.1
                                GGTCTGGTTATCCTGACGTCGCACATATCGGAAGATATTTCAGACCTTTG
Spr_3   O14   opSpV0100000935                       ref|NC_003098.1|:189340-189483
                                                                  NC_003098.1
                                GAATGATATGATTGAGTTCAAACAGACACATTTACACCGCTTTCGGGAAAT
Spr_3   O16   opSpV0100000936                       -             -
                                TAATCCGTGACTTAAATGATATGGATGATTATGCTCTTTCAATTCAAAATAG
Spr_3   O18   opSpV0100000937                       gb|AE007317|:1053820-1054054
                                                                  AE007317
                                CCCAGTTTCTAAAATAGCAGTAAAGAGTAATCCTGATGAGAATGATCCAGG
Spr_3   O20   opSpV0100000938                       ref|NC_003098.1|:c1174653-1174279
                                                                  NC_003098.1
                                ATTTTTCTAGCTGCTATGTTGGGCGGACTTGTCCGATATCTAGTTTCCACC
Spr_3   O22   opSpV0100000939                       ref|NC_003098.1|:653116-653412
                                                                  NC_003098.1
                                TATCTATGTAGATCGAGATAATGTAGGAAACGGAGCTCTCAAACGTAGCAA
Spr_3   O24   opSpV0100000940                       ref|NC_003098.1|:c1647156-1646347
                                                                  NC_003098.1
                                GGGCAAATCCTCATGACAGCTGTTTACCGTGAACAGTGGATATTCTGGGC
Spr_3   B02   EMPTY             -                   -             -
Spr_3   B04   opSpV0100000941                       ref|NC_003098.1|:448118-448474
                                                                  NC_003098.1
                                TTTCGCCGAAATATGGCTGTTTTTCCTATCGGCAGTGTTATGAAGTTGACC
Spr_3   B06   opSpV0100000942                       -             -
                                ACCTAGTCCTACAACTAACGCTTTAAAACTCTTTTTAGTAGCCGTTTATCTT
Spr_3   B08   opSpV0100000943                       ref|NC_003098.1|:24631-24815
                                                                  NC_003098.1
                                AAGCGGGTCAGGGGAGGAATCCAGCAGCCCTAAGCGATTTGAATTGTGT
Spr_3   B10   opSpV0100000944                       ref|NC_003098.1|:220443-220763
                                                                  NC_003098.1
                                TTGGCACAGGAAGCGTCTGGTACAAAGACAGAAATTACAGCTCTCTTTGT
Spr_3   B12   opSpV0100000945                       gb|AE007317|:1590612-1590820
                                                                  AE007317
                                ACCAATTTTACAAATACCATAAACTAAGCTTATATACCCAAAACACAAAAAG
Spr_3   B14   opSpV0100000946                       -             -
                                TGCAAGATAACTTTTTATTTGAGGAAATTGAAGAAATTTCAGTACCAGTTAA
Spr_3   B16   opSpV0100000947                       gb|AE007317|:1111538-1111751
                                                                  AE007317
                                GATTTTTAACATCCTAAAACCCTCTAAACGTTCGTAAATATCTCTGTTTTTA
Spr_3   B18   opSpV0100000948                       ref|NC_003098.1|:c1418540-1417596
                                                                  NC_003098.1
                                TTAGACAGATGCTTGAGTGGTCTAAGACTCATGTCTATTCGACCCTTCATA
Spr_3   B20   opSpV0100000949                       ref|NC_003098.1|:c1448855-1448241
                                                                  NC_003098.1
                                CTTCGTTAGATTGGTCACAGACCCTCGTGGCCTTGCTTGTGTTTGTAATCG
Spr_3   B22   opSpV0100000950                       ref|NC_003098.1|:c1660942-1660220
                                                                  NC_003098.1
                                TTATGAAATTCTCAAAGTGGACCCAGTCAAAAATCGCTCTGTGGTGCAGTT
Spr_3   B24   opSpV0100000951                       ref|NC_003098.1|:381116-382360
                                                                  NC_003098.1
                                GCTCTCTCTACTACAGAGGATCCAACTCGTGCTTCGATCCCATTTGATAAG
Spr_3   D02   opSpV0100000952                       -             -
                                TCTAAGAATTAGGTTATAATCAGTAGAAGCCTTGCTAATAATGAGGAGGTT
Spr_3   D04   opSpV0100000953                       ref|NC_003098.1|:956376-957605
                                                                  NC_003098.1
                                GTGCTTTTAATGATTGGCGATTCGTTCTCCTAGTTCTGATTGGAAGTTTGG
Spr_3   D06   opSpV0100000954                       ref|NC_003098.1|:1152860-1153663
                                                                  NC_003098.1
                                AGCCTTTTAAAAGATTGGATACGAACAGCCTTCTGGTTACTCCTTCGACCG
Spr_3   D08   opSpV0100000955                       ref|NC_003098.1|:69010-69840
                                                                  NC_003098.1
                                TTGGATTGCAGTTGCAGTAGCGTATGACATCTTCCGTTGGAAACAGTTGG
Spr_3   D10   opSpV0100000956                       ref|NC_003098.1|:1388112-1389620
                                                                  NC_003098.1
                                CTTGATGTACACCATCTTAACCCATGCTGAAAACCTCTCTACTCAGTTGTT
Spr_3   D12   opSpV0100000957                       -             -
                                AATTGTTACTTTCAAACCAACTAAACAAATAGACGATGGGTTTTATCTGCC
Spr_3   D14   opSpV0100000958                        ref|NC_003098.1|:9001-10338
                                                                   NC_003098.1
                                ATCAATCAGAGGTAACTCCAACAATAAAAAAAGTATGGTTAGAATCTGACT
Spr_3   D16   opSpV0100000959                        ref|NC_003098.1|:461030-461578
                                                                   NC_003098.1
                                CAAATATCTTCGCGCTCATGCAGAAATGCAAAATATCCAACGCCGTGCCAA
Spr_3   D18   opSpV0100000960                        ref|NC_003098.1|:1928807-1929196, ref|NC_00
                                                                   NC_003098.1
                                CTGACAGTGGTTATCAAGGGCTCATGAAGATATATCCTCAAGCACAAACTT
Spr_3   D20   opSpV0100000961                        ref|NC_003098.1|:c1421711-1420581
                                                                   NC_003098.1
                                TCCCAGACTGTGTTGTAAAAGCGACTATCTCTGTATCAGAACTGCTTGGTT
Spr_3   D22   opSpV0100000962                        -             -
                                AATGCTCATGAAGGGCTTGATCCAGGTCGCAAGATTTCATTTTAGAAAGTC
Spr_3   D24   opSpV0100000963                        -             -
                                GAAGTCTTCAACAGCTTTATGGAGGAGTGATACAGTCTGGGAGACTGTAT
Spr_3   F02   opSpV0100000964                        ref|NC_003098.1|:296637-296930
                                                                   NC_003098.1
                                ATTGTCTTGGCAGTGAGTCCCCTTTTACTGTCAAGCTTTCATTCTATTCGT
Spr_3   F04   opSpV0100000965                        ref|NC_003098.1|:125317-125703
                                                                   NC_003098.1
                                TGGGGGAGCTTATTTAAGCAAGCGTGCTTGTCAAGGAATTTGCGTAGCTT
Spr_3   F06   opSpV0100000966                        ref|NC_003098.1|:c1141601-1141242
                                                                   NC_003098.1
                                CGTCTCTATCTACGTCTTGATGGGAATTTCTATTTATTTTGCACCTCTTTTA
Spr_3   F08   opSpV0100000967                        -             -
                                AAATGAAACAATGCTGAGTGAGGTTTATGGAGGTAATTCCGGAGGAGCAG
Spr_3   F10   opSpV0100000968                        ref|NC_003098.1|:1924604-1924804
                                                                   NC_003098.1
                                CTTCGACTCTCAACAAAGTTATACGCTGCACTCGCATCATGGGCAGAAGA
Spr_3   F12   opSpV0100000969                        ref|NC_003098.1|:c1108359-1107604
                                                                   NC_003098.1
                                GTGAATTTGAGCTTTTGTATCATTTAGCATCGCATACAGGTCAAGTCATCA
Spr_3   F14   opSpV0100000970                        ref|NC_003098.1|:c21604-21455
                                                                   NC_003098.1
                                ACTCAATATCATAACTGTTCTTGAGAGCAGAACACAAGCCATCATCCGAAA
Spr_3   F16   opSpV0100000971                        ref|NC_003098.1|:c1079192-1077369
                                                                   NC_003098.1
                                TTATTTACAAAGTTAATTTGACCGACGGTGAGTCTATGGATGTGTCTAACC
Spr_3   F18   opSpV0100000972                        ref|NC_003098.1|:c1059416-1056930
                                                                   NC_003098.1
                                CTGACGAACGTCCACATTCTAATGATGGATGGGGCAATGCCAGTGAGCAT
Spr_3   F20   opSpV0100000973                        ref|NC_003098.1|:1543913-1544116
                                                                   NC_003098.1
                                CATCACTATAGGATCTAATGAAAATCACAACAGACTCATTCATAGATGGTT
Spr_3   F22   opSpV0100000974                        ref|NC_003098.1|:c1554481-1554092
                                                                   NC_003098.1
                                ATGGAACCTCAAGCGATTGTCACAAGTCAAGGGAGAATTGTTTCTTTGGA
Spr_3   F24   opSpV0100000975                        ref|NC_003098.1|:518668-519552
                                                                   NC_003098.1
                                CCTATCGCGATCCCTATCTCTCTAACATGCTTAATTTTGACCCAAACATGC
Spr_3   H02   opSpV0100000976                        ref|NC_003098.1|:624413-625114
                                                                   NC_003098.1
                                TTTATTACGCAGCGGGGCCTGAGATTGTGTCCTACTTAAAAGGTTTGGGT
Spr_3   H04   opSpV0100000977                        ref|NC_003098.1|:667600-668256
                                                                   NC_003098.1
                                AAAATTTGAATATCTCCCATACAGTCAATATTCCGCGTAAGGATGGTAAGG
Spr_3   H06   opSpV0100000978                        gb|AE007317|:1194649-1195085
                                                                   AE007317
                                TATTTTGTTTCGCTGGAAGTCTATTATACACCATTTGTTAAGCGTTTTCTAC
Spr_3   H08   opSpV0100000979                        -             -
                                AATCAGACAAGGTAAATTTACTTGAAAAGATGGTTGAGAGTTTATCTGTTG
Spr_3   H10   opSpV0100000980                        gb|AE007317|:1788804-1789054
                                                                   AE007317
                                CTACGGTATTTATTGAAAAGACTGGAGACAAAAAGTATACGCTGCCAAAAT
Spr_3   H12   opSpV0100000981                        ref|NC_003098.1|:323782-324228
                                                                   NC_003098.1
                                GTTGGTGCTGGTCTCTTTGGCGCATAGCTTTGGCTCAGTTTCTATTATCGC
Spr_3   H14   opSpV0100000982                        ref|NC_003098.1|:c1911030-1910815
                                                                   NC_003098.1
                                AGCCTACTAGAACGGGATGAGTACACCCCATCCATTATCATTGCCCTGAA
Spr_3   H16   opSpV0100000983                        ref|NC_003098.1|:76547-76705
                                                                   NC_003098.1
                                CTATAGTCACATCTATCAAGTATTGTTCTTGCCTAAGCTATCAATAAAAAGG
Spr_3   H18   opSpV0100000984                        -             -
                                AATGCGCAATCAAATTCATTAATATTAATAGATGAACCTGAAATCTCACTTC
Spr_3   H20   opSpV0100000985                        ref|NC_003098.1|:c1401904-1401137
                                                                   NC_003098.1
                                TACTCATGCAATTTGCGACGCAGGCTGCCAAATATTTCCCAAATGTGGAG
Spr_3   H22   opSpV0100000986                        ref|NC_003098.1|:c1796298-1795747
                                                                   NC_003098.1
                                GATGAAGCTTGGTTTGTTGTTCGAAACACACCAAATGTTACAGGATTTGTC
Spr_3   H24   opSpV0100000987                        ref|NC_003098.1|:c1632900-1632631
                                                                   NC_003098.1
                                ACAATCAAGTTTCTAACAATAAATTTCAAACTTCACTTCATTTCATCGAGGT
Spr_3   J02   opSpV0100000988                        gb|AE007317|:792302-792563
                                                                   AE007317
                                TTATTAGGAAGAATGTCATCGTTTTCCTAGAATACAGTATCAGTTGTTAAG
Spr_3   J04   opSpV0100000989                        ref|NC_003098.1|:201294-201599
                                                                   NC_003098.1
                                TGTTAACATTGTTAAGAAACACCAACGTCCAACTAACGAGCTTCCTCAAGG
Spr_3   J06   opSpV0100000990                        ref|NC_003098.1|:397357-399057
                                                                   NC_003098.1
                                GTGAATTGACGAATGGAGATGCCATTGTGGTAACAGACGTTGGTCAACAC
Spr_3   J08   opSpV0100000991                        ref|NC_003098.1|:c1834685-1833594
                                                                   NC_003098.1
                                GCTGGGGCTACGGAATTACCTGCTCCCACAACTGGATAGTAGCAATATTG
Spr_3   J10   opSpV0100000992                        ref|NC_003098.1|:c1332212-1331958
                                                                   NC_003098.1
                                ATATCTAAGTCTAATAAAAGTGGTTCAGACTGGAAGAAAACTTTCACAGTG
Spr_3   J12   opSpV0100000993                        ref|NC_003098.1|:748235-748603, ref|NC_0030
                                                                   NC_003098.1
                                AAGAGCTTAAAGCTGAAATTCAATCCATCTTTATCGAACACAAGGGAAATT
Spr_3   J14   opSpV0100000994                        ref|NC_003098.1|:c1691578-1691505, ref|NC_0
                                                                   NC_003098.1
                                AAGTAGCTCAGCTTGGTAGAGTACTTGGTTTGGGACCAAGGTGTCGCAGG
Spr_3   J16   opSpV0100000995                        ref|NC_003098.1|:1462112-1462423
                                                                   NC_003098.1
                                CCTTGGTGTCTTTAAGTGATATTCCACTTTTCCTTCAGGGAACTCTCCTCA
Spr_3   J18   opSpV0100000996                        ref|NC_003098.1|:c104785-104537
                                                                   NC_003098.1
                                GTCTATAAAAACTATCAACGTTTATATGACTTGCGAATAGCAATCCTGCTC
Spr_3   J20   opSpV0100000997                        ref|NC_003098.1|:c1131363-1130665
                                                                   NC_003098.1
                                CTGCCTTTACTCATACGAGTTATGCCAATGAGCACCGCCTCTTAAAAATTT
Spr_3   J22   opSpV0100000998                        ref|NC_003098.1|:c1125522-1124245
                                                                   NC_003098.1
                                ATTATCAAACGTGTTGTGCCAGAAGCACCACATGAAACCTTCTTGGCACTT
Spr_3   J24   opSpV0100000999                        ref|NC_003098.1|:659501-660058
                                                                   NC_003098.1
                                TCTTATCTTCATTCCTTCTGGAGCTCAGCCATCGTCTCTGTCCTTCTAAAA
Spr_3   L02   opSpV0100001000                        ref|NC_003098.1|:c1644377-1644024
                                                                   NC_003098.1
                                TTATTAAGTGTTTTCGTTCGGCGGGTGTCTCTGTAGATAGTTTAGTTGACT
Spr_3   L04   opSpV0100001001                        ref|NC_003098.1|:1249324-1250595
                                                                   NC_003098.1
                                TATATCGTAGAGGACGATTATCTGGGTGATTTGGACTCCAAGAAGGGCCA
Spr_3   L06   opSpV0100001002                        ref|NC_003098.1|:c722781-722359
                                                                   NC_003098.1
                                AGAAGTACAAAAGCCACTAGAAAACTTTAATCATATTGCCTGGTTCCCTAT
Spr_3   L08   opSpV0100001003                        ref|NC_003098.1|:768403-768843
                                                                   NC_003098.1
                                ACTTTCTAAACTAGATAGCCTTTATATGGCAGTGGTAGCAGACCATTCGAA
Spr_3   L10   opSpV0100001004                        -             -
                                TATTACTGACAGCGAGTAGCCTGTTTTCAGCTGCAACAGTTTTTGCGGCTG
Spr_3   L12   opSpV0100001005                        ref|NC_003098.1|:179215-182046
                                                                   NC_003098.1
                                AGATGTTTATGTGGCTTGTGAAGTTTGCCACGGAACCCGCTATAACAGTG
Spr_3   L14   opSpV0100001006                        gb|AE007317|:281601-282001
                                                                   AE007317
                                ATGTTGATCCGGATAATTTATATACCGATCCGGGTTCTTCAGTTCTAAGAA
Spr_3   L16   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_3   L18   opSpV0100001007                        ref|NC_003098.1|:c1374809-1374570
                                                                   NC_003098.1
                                ACTGAGCTTCTTAGCCGTTTCGTTTCAGAACGTGGGAAAATCCTTCCTCG
Spr_3   L20   opSpV0100001008                        gb|AE007317|:140971-142040
                                                                   AE007317
                                CTAATAAGTAACCGCGCTATAACGAGGTATCTACCGAGATTGTCAATTCTC
Spr_3   L22   opSpV0100001009                        gb|AE007317|:76076-76337
                                                                   AE007317
                                TCTAGCTCATACTTTTCAAAAATATGTTTAAACGAGGTCACCTTCCTCTTGT
Spr_3   L24   opSpV0100001010                        -             -
                                CCCCAACTCCCAGAAATGGGGAAGAGTTGGAACGTCCAGTGGATGTTTTT
Spr_3   N02   opSpV0100001011                        ref|NC_003098.1|:c1349378-1348371
                                                                   NC_003098.1
                                GTTAAGCAAACAGGATCTGCTTTACCCTAGAAAAGGAAAAGCGCTTAAGAA
Spr_3   N04   opSpV0100001012                        ref|NC_003098.1|:c1610903-1609440
                                                                   NC_003098.1
                                AACATCGAATGTTGGTAGACTTGGGGCGTAACGATATTGGCCGCATCTCT
Spr_3   N06   opSpV0100001013                        ref|NC_003098.1|:c1653436-1653131
                                                                   NC_003098.1
                                AAATGAGCAATTGCAGGCAGTTCGTCTCTCAGGCCTGGTCAATCGTGAAT
Spr_3   N08   opSpV0100001014                        gb|AE007317|:1977394-1978503
                                                                   AE007317
                                AAACTGCGAGGATAATAGCTTCTGTGTCTAAATAACCCATTTCGAGACCTC
Spr_3   N10   opSpV0100001015                        ref|NC_003098.1|:c761214-761074
                                                                   NC_003098.1
                                TCAAAAAAAGGATTTTTATCGCTCTGAACATCAAAAAAGAAAGGACGAATT
Spr_3   N12   opSpV0100001016                        ref|NC_003098.1|:1654914-1655615
                                                                   NC_003098.1
                                AAGATACCCTGCTCGACCCTGTCAACCCTTATGCAGAGACAAAACTGATG
Spr_3   N14   opSpV0100001017                        ref|NC_003098.1|:686774-687013
                                                                   NC_003098.1
                                CGATGTGGGTCGTGTAATCGGTCGTAAGGGTCGCACTATTTCTGCGATAA
Spr_3   N16   opSpV0100001018                        ref|NC_003098.1|:c971728-971225
                                                                   NC_003098.1
                                GTTCAAATTATGAATCAGTTTGAACGAAAATCTCATGAATACAAGGCTATC
Spr_3   N18   opSpV0100001019                        -             -
                                CCAGAAAAATGTTTGCGGGAGAGTTTCACTATCCAAGTGAATTGAATCGTT
Spr_3   N20   opSpV0100001020                        ref|NC_003098.1|:c1328160-1326964
                                                                   NC_003098.1
                                AGAATACGACTTCCCAGGTGACGATCTTCCAGTTATCCAAGGTTCAGCAC
Spr_3   N22   opSpV0100001021                        ref|NC_003098.1|:c1584957-1583980
                                                                   NC_003098.1
                                TTAAAAGTTACAGTGAAGCGTGAGGGAGAGGAGTTGGTTTCCAATCTCTT
Spr_3   N24   opSpV0100001022                        ref|NC_003098.1|:700006-700935
                                                                   NC_003098.1
                                GATATTTATGGTCGTGGTCGTTGTGAAGAACTGTTAGGTCTTGTCCTAAAA
Spr_3   P02   opSpV0100001023                        -             -
                                CATAGTTTCCCGAACTATGGGAGCTAACTCAAGTTATGCTTTCGCTTAGCC
Spr_3   P04   opSpV0100001024                        gb|AE007317|:1788468-1788704
                                                                   AE007317
                                AAATCTAAGGCAACTTCCTCAAAAGAGATATCAAACCCAATTCACACCATA
Spr_3   P06   opSpV0100001025                        ref|NC_003098.1|:555382-556071
                                                                   NC_003098.1
                                CGTCTTGGACGTGTCCTTGGACCACGTAACTTGATGCCAAACCCTAAAAC
Spr_3   P08   opSpV0100001026                        ref|NC_003098.1|:99217-101067
                                                                   NC_003098.1
                                TCTGAAATCTGTCGTCAAGTTAGTCGCTTCAATCCTGAACGCATTGTCTTG
Spr_3   P10   opSpV0100001027                        ref|NC_003098.1|:c1462905-1462462
                                                                   NC_003098.1
                                AGTGAGTATAGAAGGCCAGATTCAGGGAAAAATCAATCAGGGACTTTTATT
Spr_3   P12   opSpV0100001028                        ref|NC_003098.1|:306052-308157
                                                                   NC_003098.1
                                GAAAGCAGCGGTGGATTATTCTGTTCAATACATTCCTCAACGTAGCTTGCC
Spr_3   P14   opSpV0100001029                        gb|AE007317|:1318520-1318773
                                                                   AE007317
                                TATTTTGCCCTACTTGGCTCCCACTATCCCAAGCTCGCTTGAAGAACGCC
Spr_3   P16   opSpV0100001030                        ref|NC_003098.1|:c1918868-1917936
                                                                   NC_003098.1
                                TAATGGTTGCTCCAAGTATTCGAGTTGCAGATGAACTGTCTAAATTAGGTT
Spr_3   P18   opSpV0100001031                        -             -
                                TCTTCTCAGGTAATGTGTTGGGATTTGAACAGACCAACGAGTTCATAGTGG
Spr_3   P20   opSpV0100001032                        gb|AE007317|:1927856-1928211
                                                                   AE007317
                                TGGGTTAAAAAAGAAATTAACTGAGTAAAAACTCTCGAAATTCAATTCGCT
Spr_3   P22   opSpV0100001033                        ref|NC_003098.1|:887626-888030
                                                                   NC_003098.1
                                AGAGTCAGAAATCCAGCAATTAAGCACGGAATTGATCAAGGTTCTAGGAC
Spr_3   P24   opSpV0100001034                        ref|NC_003098.1|:418456-419781
                                                                   NC_003098.1
                                TATCAATGGCTGTAGGATTAGTACCCTATACAACAGGTGTAATCCTTCCGT
Spr_3   B01   EMPTY             -                    -             -
Spr_3   B03   opSpV0100001035                        ref|NC_003098.1|:1312674-1313918
                                                                   NC_003098.1
                                TAAACGTGTACCACCTCAATCAGGTAGCCGTATGTCGACTGTTCATGGTTC
Spr_3   B05   opSpV0100001036                        gb|AE007317|:671089-671373
                                                                   AE007317
                                CTCCTTTTTTGCTACAAGAGTTTTTGAAAAGAGATGCGCAGAAGAAAAGAG
Spr_3   B07   opSpV0100001037                        -             -
                                GCCAGCAAAAAATGTGACGATTTTGGAGGGAAGTAACATTCACGTCTTGC
Spr_3   B09   opSpV0100001038                        ref|NC_003098.1|:c1798924-1796729
                                                                   NC_003098.1
                                AACAAGTGAACTAGAGGACTCTGATTCTACTATCTTACGTCGCTCTCGTAG
Spr_3   B11   opSpV0100001039                        -             -
                                TGTCATTGAACTTTCCTCCTTTTTTCTTGTTCACTTTTATATTCGGAAAAGA
Spr_3   B13   opSpV0100001040                        ref|NC_003098.1|:709610-710680
                                                                   NC_003098.1
                                TACGATGCTTCAACCATGGTAACTAGCAGTCGTCAGATTAACTTCTGGGG
Spr_3   B15   opSpV0100001041                        -             -
                                TAAGAGGGGAACGTCCTCTCTTTTTTATAGTTTTTAACTATACTGGGATAC
Spr_3   B17   opSpV0100001042                        gb|AE007317|:386658-386913
                                                                   AE007317
                                ATTTTACTATCTACCTATTTACCACAAACAATTGGATTGTATGTGACGATCA
Spr_3   B19   opSpV0100001043                        ref|NC_003098.1|:c1047260-1046292
                                                                   NC_003098.1
                                TAGAACATATCCATCAACGTAGCGCCGCTTATGGAATTCCTGGAATGTTCA
Spr_3   B21   opSpV0100001044                        ref|NC_003098.1|:481311-481604
                                                                   NC_003098.1
                                ACAAGGAAGGACAAGTCTTTATTGATCCTACGGGCAAGGCCAATGGCCGC
Spr_3   B23   opSpV0100001045                        ref|NC_003098.1|:1656023-1656997
                                                                   NC_003098.1
                                GTTCTGGCTTGCGATATCCTATCCCGAGTTCTGATTAGGCCCTATGAGTTG
Spr_3   D01   opSpV0100001046                        ref|NC_003098.1|:605131-606060
                                                                   NC_003098.1
                                AGTCATTTGTCTTAACCAGCCTTCGTGTGTCAGGTTCTCGTCTGCCCTACC
Spr_3   D03   opSpV0100001047                        -             -
                                TTATCTCAGAGCTATAAGCCCAAATCATCAGCCAGCGCCTAAAGACGCTG
Spr_3   D05   opSpV0100001048                        ref|NC_003098.1|:57724-58875
                                                                   NC_003098.1
                                GGAAAATATCCACCGCAACAATATCCTGTCTAAGACCATCGTACCAGCCC
Spr_3   D07   opSpV0100001049                        ref|NC_003098.1|:341956-342972
                                                                   NC_003098.1
                                AGCTAGGAAATTTTGGCGATGATTCTTACAATCCACTACCAATTGGTGAAG
Spr_3   D09   opSpV0100001050                        ref|NC_003098.1|:c1720810-1720385
                                                                   NC_003098.1
                                TTTCCTTAGCGAAAAAGCATAATGGGATATTAGGAAGTAATAACCTAAGAG
Spr_3   D11   opSpV0100001051                        -             -
                                TAATCTTGGCACAGTCAGAACGTCAAGTCACCCAAGAGCATGTATCTATTC
Spr_3   D13   opSpV0100001052                        ref|NC_003098.1|:c904132-903701
                                                                   NC_003098.1
                                TGTAACCCAATTTCCTCACATCATAGGGCAATTCGTAACTGAAAACATTGA
Spr_3   D15   opSpV0100001053                        -             -
                                TGCAATTCCCCCAATAACTGGTAATTTTTGAGCATCCCATTGAGAAGTTAG
Spr_3   D17   opSpV0100001054                        ref|NC_003098.1|:c1119485-1118532
                                                                   NC_003098.1
                                TTGCAGACCTTGCATCAGAGCTTGACGGATAAAACAAGTGACTTTCGTTTA
Spr_3   D19   opSpV0100001055                        -             -
                                GCTCCTTTTCTAAAAGACAAGTTGTACTCTCTTCAAACCACTTCAGATTCAC
Spr_3   D21   opSpV0100001056                        gb|AE007317|:841561-841804
                                                                   AE007317
                                ATTCTTAACTGGAATACTCACTATCTCTTTACATCAAGAAAATGACTAAACA
Spr_3   D23   opSpV0100001057                        ref|NC_003098.1|:1598954-1599526
                                                                   NC_003098.1
                                ATTTTCCTTCCTGTTTTGATAGATTATCATCAAGTTAGTGATCTAGGTATTC
Spr_3   F01   opSpV0100001058                        ref|NC_003098.1|:1810176-1810484
                                                                   NC_003098.1
                                ATGCGGGAATGTCGACAAGTATGCTTGTTAAAAAAATGCAACAAAGTGCG
Spr_3   F03   opSpV0100001059                        ref|NC_003098.1|:1633221-1634048
                                                                   NC_003098.1
                                TCATGGCGATGTTCCTGAACGCTACACTTGGTGGGCACAACGCAGCAAAA
Spr_3   F05   opSpV0100001060                        ref|NC_003098.1|:1915450-1915791
                                                                   NC_003098.1
                                TATGAAATCAATCTGGATGAAACGGGGCTCTGCAAGATTGTCATGACCTTC
Spr_3   F07   opSpV0100001061                        ref|NC_003098.1|:c1362378-1361926
                                                                   NC_003098.1
                                ATGCAGTCTTATCTGGCAGTATTCGTGACAATCTTTGTCTCGGTTTGAATC
Spr_3   F09   opSpV0100001062                        ref|NC_003098.1|:c1330783-1330175
                                                                   NC_003098.1
                                AACCTTAAGCCGTACAAAAACTGAGAACAAGGTCACGGGAGTTGTAACCT
Spr_3   F11   opSpV0100001063                        ref|NC_003098.1|:435075-435464
                                                                   NC_003098.1
                                TAGAGATGGTGGTGATGAACTATATCATCTCTATGCGCAAGCTTGCGAGG
Spr_3   F13   opSpV0100001064                        gb|AE007317|:1328528-1329081
                                                                   AE007317
                                TCCAACTTCAACCCACTATAAAGCAGACTTACAAGATAGGGAACCCATCTC
Spr_3   F15   opSpV0100001065                        gb|AE007317|:1182848-1183137
                                                                   AE007317
                                AGATAAAGGCTTCTTTGGGTTACAAGAGATGTAATCTGAGGGGCAAGTGA
Spr_3   F17   opSpV0100001066                        ref|NC_003098.1|:c363641-361275
                                                                   NC_003098.1
                                TCTAACAGTAAGATCCTCATCGTAGGTGACAGTGATCAGCTACCTTCTGTC
Spr_3   F19   opSpV0100001067                        ref|NC_003098.1|:933794-934111
                                                                   NC_003098.1
                                ATTTTTTAGAACTAATTAATCACAAAGGGCTACCTCTTTTTAATCCGCTTGT
Spr_3   F21   opSpV0100001068                        ref|NC_003098.1|:150908-151585
                                                                   NC_003098.1
                                CTTATTGTTCGTGTGGGCAAATCTAACAACCTATATCTTTCCTCGTACCCA
Spr_3   F23   opSpV0100001069                        ref|NC_003098.1|:969696-971006
                                                                   NC_003098.1
                                TTTGGGAACTCAGTTCCTCCGTCACATCGAGCGTACACGTGTTATCCTTC
Spr_3   H01   opSpV0100001070                        gb|AE007317|:1076753-1077127
                                                                   AE007317
                                AGGCTTCACGATAAGTTGGAGTGACAATTTCTCGTTCTTCCAACAAGCTTG
Spr_3   H03   opSpV0100001071                        ref|NC_003098.1|:c1486667-1485996
                                                                   NC_003098.1
                                TTGTTTTTCGAGAAGTTGCAGAGGCTAGTCTGAGTGCTCATCGAGAGAGT
Spr_3   H05   opSpV0100001072                        ref|NC_003098.1|:910286-911365
                                                                   NC_003098.1
                                TGTATACTCTAAGCTTAAGTATGAATCAGGTGCCCACCGTGTGCAACGTG
Spr_3   H07   opSpV0100001073                        ref|NC_003098.1|:c166511-165249
                                                                   NC_003098.1
                                GTATCCTCAACTCAAGCTGGCGGTTCTTACGGTTGGTCTCTACTTCTCTTG
Spr_3   H09   opSpV0100001074                        -             -
                                GTTGGAAAAGGTATAGCTAATACGTTAACAACTAGTGGTCAAATGGGAGTA
Spr_3   H11   opSpV0100001075                        ref|NC_003098.1|:c1806103-1805909
                                                                   NC_003098.1
                                TTCGTATAGGGTGGATCATCGTATATTGTTTGATAATATTTCTTTTGATACT
Spr_3   H13   opSpV0100001076                        ref|NC_003098.1|:912753-913223
                                                                   NC_003098.1
                                TGGGTTATACTTTTAGTCCAGAGGAAACGGCTAGCCAACTAGCTAGACTG
Spr_3   H15   opSpV0100001077                        ref|NC_003098.1|:c1136079-1134145
                                                                   NC_003098.1
                                GGTTTAAGACCAGTATCAAATGGGGATGGAGCTATTGAGTTTAGGCTACA
Spr_3   H17   opSpV0100001078                        ref|NC_003098.1|:c1097931-1095463
                                                                   NC_003098.1
                                GGACGTGCAACTATGGGAGTTAAAGTAATGCGCCTGGATCAAGATGCTCA
Spr_3   H19   opSpV0100001079                        ref|NC_003098.1|:c1351265-1350774
                                                                   NC_003098.1
                                ATTAGAAGAATTGAAATTGGTTCGTCGACCAGAAGTGGTAGAACGCATTAA
Spr_3   H21   opSpV0100001080                        ref|NC_003098.1|:c1377499-1377128
                                                                   NC_003098.1
                                TTCTCTAATTAGTTTTCTATCCCCGAACAGCCCTCATCCTGGTGGTGATTT
Spr_3   H23   opSpV0100001081                        gb|AE007317|:1421712-1421993
                                                                   AE007317
                                GAGAATATCGGAGAATTTGAAGAAGATAATCTTTATTATTCTTCTATGACAA
Spr_3   J01   opSpV0100001082                        gb|AE007317|:1349379-1349822
                                                                   AE007317
                                GAAAGACACAATTTCTAGGTTATAACTGGTATTTATCGATAGTTACTCATAT
Spr_3   J03   opSpV0100001083                        ref|NC_003098.1|:c1042210-1041221
                                                                   NC_003098.1
                                GTCGTCACCAGAACACTATCGAAGAAATCAACCGTGATTATGTTCGCGAA
Spr_3   J05   opSpV0100001084                        ref|NC_003098.1|:1761591-1762517
                                                                   NC_003098.1
                                AAAAGAGCACGGTATCAGCATGTTTGGCGGTGTAGGATGTTTCCCTATCC
Spr_3   J07   opSpV0100001085                        ref|NC_003098.1|:1277743-1277910
                                                                   NC_003098.1
                                GCGTTTTATTGTGGGAAGATTTACTTCATTTTCTCTTGGAATTGAGTTTTCT
Spr_3   J09   opSpV0100001086                        ref|NC_003098.1|:720316-720720, ref|NC_0030
                                                                   NC_003098.1
                                AGTTGAGGAAGAGAAAGCCTTTCTTGCCCGTCATTTGAAGGCTACAGAGG
Spr_3   J11   opSpV0100001087                        ref|NC_003098.1|:c1339622-1338378
                                                                   NC_003098.1
                                AGCGGCTATTCAAGCCTATGCCCAGTTAGATAATCGCTCGATTTATGAGC
Spr_3   J13   opSpV0100001088                        -             -
                                GCCTAAGATGGCAAATAGAGACAGAAGCCCCTTGTCTTCTAGTAAAAGTTC
Spr_3   J15   opSpV0100001089                        -             -
                                TGCTTGCTTTTTTAATTTTTACAATTCAAGAGGTTTTGATGACCATTTATGA
Spr_3   J17   opSpV0100001090                        gb|AE007317|:954595-955252
                                                                   AE007317
                                TTAGAGCGCCTTTGGAATATATTTTTGGAATTTAATCAATCACAGTTGAATG
Spr_3   J19   opSpV0100001091                        ref|NC_003098.1|:c1329951-1329082
                                                                   NC_003098.1
                                TGCCAACGTTGAACTTAAAGGTACGAAAGGTCACCAAAGTGGCTGGATCG
Spr_3   J21   opSpV0100001092                        -             -
                                AGCCTTTTTGCCCAGCCTCGTCAAAAGTAATGTTTTGACACAAAATCTGTG
Spr_3   J23   opSpV0100001093                        ref|NC_003098.1|:2032457-2032999
                                                                   NC_003098.1
                                AATATAGTAGCATCTATCTAACTCATGCACTTTTTGGTGTCTGCCAAACTTG
Spr_3   L01   opSpV0100001094                        ref|NC_003098.1|:c1628356-1627625
                                                                   NC_003098.1
                                AATGTCCTTAAAGGTGAGATGTCCTTTGTCGGTACACGACCTGAAGTGCC
Spr_3   L03   opSpV0100001095                        ref|NC_003098.1|:1172516-1173322
                                                                   NC_003098.1
                                CCATTACCAAGGACGGTATCTATACTGCAAATCGCAATATCGGAAAATACA
Spr_3   L05   opSpV0100001096                        ref|NC_003098.1|:c1377109-1375766
                                                                   NC_003098.1
                                GAACAGACTTTTTGATGGATAACCGTCACTTGTGGCTACGCTCTCGTAAG
Spr_3   L07   opSpV0100001097                        ref|NC_003098.1|:c1095463-1094720
                                                                   NC_003098.1
                                ATGATAGAGATGGGGTCAATGAAATCACATTAGTAACCTGTGAAGACCTTG
Spr_3   L09   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_3   L11   opSpV0100001098                        ref|NC_003098.1|:c1849282-1847798
                                                                   NC_003098.1
                                CATCAGCTAACTCTATGAACATTGGTCGTCTGGTGCCACAAATTGTTTATT
Spr_3   L13   opSpV0100001099                        ref|NC_003098.1|:c1249182-1248451
                                                                   NC_003098.1
                                CATCAACCGGAATATAGTCGTGACAATGTTGCGGGGACTATTGTTGGTTT
Spr_3   L15   opSpV0100001100                        ref|NC_003098.1|:965281-966390
                                                                   NC_003098.1
                                AGAAGGAAATATGGGCTTGATGAAGGCGGTTGACAAGTTTGACTATTCTA
Spr_3   L17   opSpV0100001101                        gb|AE007317|:818212-818662
                                                                   AE007317
                                TACGTAATATTTGCTACTAGAGAGTTAGGAAACATCGGGAACAGACATACT
Spr_3   L19   opSpV0100001102                        ref|NC_003098.1|:c1730321-1729701
                                                                   NC_003098.1
                                CCATTGTCTCACTTCTGATTTATATTGGACTGGGCTTGTTTTTTGCAGCCT
Spr_3   L21   opSpV0100001103                        ref|NC_003098.1|:c215987-214896
                                                                   NC_003098.1
                                CTACCACGATGTCCCTGTTATTGAGAATTTGAACATTACAATTCCAAAAGG
Spr_3   L23   opSpV0100001104                        gb|AE007317|:692934-693197
                                                                   AE007317
                                ATTTGATTGCAAAAATCTGCTACGCACAAAAAATTGCAAAAAAGCTTGCCA
Spr_3   N01   opSpV0100001105                        gb|AE007317|:1274526-1274879
                                                                   AE007317
                                TTTGGAAATGAGCCTAGTATAAGTCAAAAACGTGTTGAATAGTGAAAGCAG
Spr_3   N03   opSpV0100001106                        ref|NC_003098.1|:951138-952337
                                                                   NC_003098.1
                                ACTTTTTGCGAAATTGCTTCTAGAGTAGGAGGAGGGCTGATAAATGATTCC
Spr_3   N05   opSpV0100001107                        ref|NC_003098.1|:c1690870-1690783
                                                                   NC_003098.1
                                TCAAGAGGCTGAAGAGGACGGTTTGCTAAATCGTTAGGTCGGGTAACTGG
Spr_3   N07   opSpV0100001108                        -             -
                                CATCACTAAACACTTTGCCATTCACGGAAAGAGTTACCGCAGAAAGCTTAT
Spr_3   N09   opSpV0100001109                        gb|AE007317|:557877-558588
                                                                   AE007317
                                TGAAAGCCTTAAGTGTTATTTTATAAAGGTTATTTCAAGTCGTTCCAAGGTA
Spr_3   N11   opSpV0100001110                        ref|NC_003098.1|:811867-812316
                                                                   NC_003098.1
                                TTATCCATCATGTCCAGTGGAATAGGCGTCTACGTTCGACAGGTGGGCGA
Spr_3   N13   opSpV0100001111                        ref|NC_003098.1|:865592-866224
                                                                   NC_003098.1
                                AATGAAAAGGGACCAGTTGTCCAAAGATGAAGCTGAGTCTCGTCTGGCAG
Spr_3   N15   opSpV0100001112                        gb|AE007317|:1325488-1325712, gb|AE007317
                                                                   AE007317
                                TCGGAGTTCTCTTAACTTTTTTAGGATGGCATTTTCCGCTCTCAGGTACTC
Spr_3   N17   opSpV0100001113                        ref|NC_003098.1|:462058-463881
                                                                   NC_003098.1
                                CTGCACCTCGTGGAATTCCTCAAATCGAAGTAACATTTGACATCGACAAGA
Spr_3   N19   opSpV0100001114                        ref|NC_003098.1|:c1692114-1692042, ref|NC_0
                                                                   NC_003098.1
                                CGTTAGCTCAGTTGGTAGAGCAATTGACTTTTAATCAATGGGTCACTGGTT
Spr_3   N21   opSpV0100001115                        ref|NC_003098.1|:c780950-780417
                                                                   NC_003098.1
                                GAAGATCAGAAAACAGCAACTCAGGACTCTTCTACTCCTGCTTCAAGTAAA
Spr_3   N23   opSpV0100001116                        ref|NC_003098.1|:c1688031-1685869
                                                                   NC_003098.1
                                CTATTTCCCACAAGTCTGGGCTAGTGATAATACTGATGCCATTGCACGTTT
Spr_3   P01   opSpV0100001117                        ref|NC_003098.1|:c1560151-1558835
                                                                   NC_003098.1
                                ACAGCCCATATAGCCTCTTATCTTACGACAGGTCAGGTTACTGCTCTGGA
Spr_3   P03   opSpV0100001118                        ref|NC_003098.1|:1288223-1289587
                                                                   NC_003098.1
                                TTGATTATGGTGAAGAGCATATATTAGATGATATATCACTATCCATAGCCG
Spr_3   P05   opSpV0100001119                        gb|AE007317|:995435-995721
                                                                   AE007317
                                GACACTTTATGGTTACCGAACAAGTCTAATCACTCCTTGCAAAATTTTGAA
Spr_3   P07   opSpV0100001120                        ref|NC_003098.1|:c1085315-1083969
                                                                   NC_003098.1
                                AAGTTTCCAACTTTCGTAAACGACCTACTCACCAATATTTCTCCCTAAAGG
Spr_3   P09   opSpV0100001121                        ref|NC_003098.1|:c1274525-1274286
                                                                   NC_003098.1
                                AAATTAAAATTAGCTCGGGTAGAGCGTGATTTAACACAAGGTCAACTGGCA
Spr_3   P11   opSpV0100001122                        -             -
                                AGTATTATGCTTGTTATCGGTGTCATGATTCATTAGAACATCACCCTTTTG
Spr_3   P13   opSpV0100001123                        ref|NC_003098.1|:c411727-410657
                                                                   NC_003098.1
                                AATAGACCGTTTTGGTAGACTAGGCTATGATCTGTATCGAAAGGCTCGTG
Spr_3   P15   opSpV0100001124                        ref|NC_003098.1|:257547-257777
                                                                   NC_003098.1
                                ATTTTTAGCAGGTGCTATGACCAATCGTGGAGAGCGAATGGGATGTTTTG
Spr_3   P17   opSpV0100001125                        -             -
                                GCGAACGACAGACTTGTGGCAACACAAACTACTGATGGTAAAAATGAAAA
Spr_3   P19   opSpV0100001126                        ref|NC_003098.1|:142595-143809
                                                                   NC_003098.1
                                CAGAAGGAATACCTATGTGTGTTTTAGAGTCAATGTCACAAGGAACTCCG
Spr_3   P21   opSpV0100001127                        ref|NC_003098.1|:459960-461027
                                                                   NC_003098.1
                                ACAAGATTCGGACGGAGATTCCGCAGATTATCCAGCGTTACTTTACAACAA
Spr_3   P23   opSpV0100001128                        ref|NC_003098.1|:c1018158-1017712
                                                                   NC_003098.1
                                AGCCACCATAGTATCTGAAGAGCATATTACTTCTCCTTTTGGCCTGGTTAT
Spr_4   A01   EMPTY             -                    -             -
Spr_4   A03   opSpV0100001129                        ref|NC_003098.1|:1656987-1657943
                                                                   NC_003098.1
                                CTGCTGATCTGTCTAGCGCTCAGAAGTCTCTTTCGAAATATCAGCACCTTC
Spr_4   A05   opSpV0100001130                        ref|NC_003098.1|:c1193471-1192548
                                                                   NC_003098.1
                                GAATATTTTTCTAAAGGGAGAGATTTCTTTAATTGGAATCGTAGCATGCGA
Spr_4   A07   opSpV0100001131                        ref|NC_003098.1|:447514-448041
                                                                   NC_003098.1
                                TTTTGTACGTGTTTGTGCGTGTATTAGAAACGTTTATGGGAGTTTTTGTCG
Spr_4   A09   opSpV0100001132                        gb|AE007317|:555175-555381
                                                                   AE007317
                                AGTAGAAAATCTCACAGCAGTCTATTAGTTGCTTTTCATACTAGGCAAGTG
Spr_4   A11   opSpV0100001133                        -             -
                                GAACTTGAGTTCTATCTACAGCTCCATGCCTACTACTAAAAGCAAACAAAA
Spr_4   A13   opSpV0100001134                        ref|NC_003098.1|:65845-67632
                                                                   NC_003098.1
                                TTTCTCCAAATAGCGCAGGATTTGGGTCTCTACGCAATTGTGCGTCCGTC
Spr_4   A15   opSpV0100001135                        ref|NC_003098.1|:1208270-1208455
                                                                   NC_003098.1
                                CACCTCCGTAATTATTTTGCTTGGGGAATTTTTCAAAAAGAAAAACGCGCC
Spr_4   A17   opSpV0100001136                        ref|NC_003098.1|:1166177-1166914
                                                                   NC_003098.1
                                CAGGATTTCCTAGTCTACCAATGAAAATTCTCTATCCGGAGTTAGATGTGA
Spr_4   A19   opSpV0100001137                        ref|NC_003098.1|:c1758024-1757536
                                                                   NC_003098.1
                                AGATTGGCTTATTCACAGGCTCATTTGATCCGATGACAAATGGGCATCTGG
Spr_4   A21   opSpV0100001138                        -             -
                                ATAAAAATGTTGTCTGAAACTATTAGCCTTTTTCCAGAAGTTTTAGAGGAAG
Spr_4   A23   opSpV0100001139                        ref|NC_003098.1|:911365-912204
                                                                   NC_003098.1
                                TCCACCCTATATCTCTCGTGAAGATGAGTCAGAGGTAGGCTTGAATGTCT
Spr_4   C01   opSpV0100001140                        ref|NC_003098.1|:1670245-1670955
                                                                   NC_003098.1
                                GCCCTGTCTCTCCTCCAAGAGGAAGGATTGATCAAAAAGATAAGAGGGCA
Spr_4   C03   opSpV0100001141                        ref|NC_003098.1|:665712-666476
                                                                   NC_003098.1
                                TTATGAACCAAGCGAGGGAACAGTAACCCTAGATGGTCACCTTTTGAATG
Spr_4   C05   opSpV0100001142                        -             -
                                TTTTTGATAGTTATCAAATAAGCAAGAAAAGAAGAAGCCTCATTGGTTTGT
Spr_4   C07   opSpV0100001143                        -             -
                                TTGATCACGCGTGAAAAGTCATTTCCAACTGGTTTATATATGGAATTTCTA
Spr_4   C09   opSpV0100001144                        -             -
                                AGTATCAAGTTACACAACCTTGGTAATATGCGTTTTATTATGTAGAGACTTA
Spr_4   C11   opSpV0100001145                        ref|NC_003098.1|:c1768152-1766854
                                                                   NC_003098.1
                                TATGCCATCAAGTTACCCGGACAAGGCGACCAAGAATACGTCTATCTGCC
Spr_4   C13   opSpV0100001146                        ref|NC_003098.1|:358009-359145
                                                                   NC_003098.1
                                GTTAGTCGCGTAGCTCGTACTCCAATCCGAAAATTAGGCTATAATGAACG
Spr_4   C15   opSpV0100001147                        ref|NC_003098.1|:c1807291-1806563
                                                                   NC_003098.1
                                GACAAAAATATCTGAAGATGCTCATTCTACAATTGACTCGAGGATTATTCA
Spr_4   C17   opSpV0100001148                        ref|NC_003098.1|:162537-163823
                                                                   NC_003098.1
                                TTACACCTTTTGAAGCTCCTTATCAAGAACACTTTGAACGCTGGAAGCTGA
Spr_4   C19   opSpV0100001149                        ref|NC_003098.1|:c785035-784604
                                                                   NC_003098.1
                                TTTTGGTAAATAGCATCATCGTTGTAGTAATCACCGACAAAGAAACGTGCG
Spr_4   C21   opSpV0100001150                        ref|NC_003098.1|:119688-120059
                                                                   NC_003098.1
                                TCAACTAGTTCTTGCATCTTATGGATTACGCTCCGCACTGGTAGCTGGGA
Spr_4   C23   opSpV0100001151                        -             -
                                TCTACCATATACAAATAAAAACCGTAGCTATCAAAAGAGATAAACTACAGTT
Spr_4   E01   opSpV0100001152                        ref|NC_003098.1|:560403-561188
                                                                   NC_003098.1
                                TTCTTCGTTGGTTGATTAGCTTTATCGTGCCTTTCGCCTTTACAGCCTACT
Spr_4   E03   opSpV0100001153                        ref|NC_003098.1|:731211-732485
                                                                   NC_003098.1
                                CCCTTATGTAGGTGAACCAGGTAACTTCACTCGTACGGCAAACCGTCGTG
Spr_4   E05   opSpV0100001154                        ref|NC_003098.1|:c1086075-1085437
                                                                   NC_003098.1
                                GATATGGAGGAGCGTGGCCGTAGCCTTGATAGCGTTATTAACCAGTACTT
Spr_4   E07   opSpV0100001155                        ref|NC_003098.1|:c726663-726433
                                                                   NC_003098.1
                                ATCACATTTGGTTAGAATCATCAACCGCCTTGAAGCAATGGCAAACGATGG
Spr_4   E09   opSpV0100001156                        ref|NC_003098.1|:c1831652-1831470
                                                                   NC_003098.1
                                TATCTTCCTCGCAAACTTGGTATGTCAAGCAGCCGAGAAACAGATTGATCT
Spr_4   E11   opSpV0100001157                        gb|AE007317|:969440-969695
                                                                   AE007317
                                TTTATCGTGATTATCATGCTAGTAGCAAGTTTATTGGGAATTTTTGCAACTG
Spr_4   E13   opSpV0100001158                        gb|AE007317|:103670-103910
                                                                   AE007317
                                ATCAAAGAATGAGGGGCTTGGCTTTAATTGTGGATGAAAACCTTTCTAATA
Spr_4   E15   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_4   E17   opSpV0100001159                        -             -
                                AGATTCGCCACTACAAGATGGAACAACGAATGCCTCAAAGTCCATGGGTA
Spr_4   E19   opSpV0100001160                        gb|AE007317|:64467-64780
                                                                   AE007317
                                AACCTCCTGATTGCATTGTTATATTGATAGCGATTATATAAATCAACGCCTT
Spr_4   E21   opSpV0100001161                        ref|NC_003098.1|:c1612989-1611988
                                                                   NC_003098.1
                                TTTAAAGAAGAACCATATGCCTTTTCTTGTTTTCGGTGAATCTCAAACGTC
Spr_4   E23   opSpV0100001162                        ref|NC_003098.1|:c820340-820104
                                                                   NC_003098.1
                                GATAAGCTGATAGAAATTAAGCGATTGACCGCTTCTAATTCAAGGGCTTTT
Spr_4   G01   opSpV0100001163                        ref|NC_003098.1|:c1769393-1768737
                                                                   NC_003098.1
                                ATCAGTTTTGGTGCAGGTGTGGTCGAGAGCCTTCGTCCTCATAGTAAGAT
Spr_4   G03   opSpV0100001164                        ref|NC_003098.1|:1731759-1731929
                                                                   NC_003098.1
                                TTTAGTAATACAATTCCTTACCAACAGTTTATTCAGAAGAATAAACAATTGG
Spr_4   G05   opSpV0100001165                        ref|NC_003098.1|:883965-884591
                                                                   NC_003098.1
                                TAGTTTAGAGGATGCTCGGATGACGGCGCGTGTTTACGAATCCTTCTTAG
Spr_4   G07   opSpV0100001166                        ref|NC_003098.1|:c1728656-1727640
                                                                   NC_003098.1
                                ATTCTGACGCGCATTGAATCAGGGAATGGTCAGGCTCATGAAGCGAAACT
Spr_4   G09   opSpV0100001167                        ref|NC_003098.1|:c813192-813001
                                                                   NC_003098.1
                                AAGAACATATACTCATCGGACTTCTCTATCTGCTCTCTCCATTCATCGGTC
Spr_4   G11   opSpV0100001168                        ref|NC_003098.1|:c726204-723946
                                                                   NC_003098.1
                                CTGCAACTCTTTCCAATCGCTACATCCAAGATCGCTTCTTGCCTGACAAGG
Spr_4   G13   opSpV0100001169                        ref|NC_003098.1|:1928212-1928781, ref|NC_00
                                                                   NC_003098.1
                                TCACGAAAGCAACTTACTCCGTCGGAGCCAATGGGTTGAAGTAACTCTTG
Spr_4   G15   opSpV0100001170                        gb|AE007317|:1059417-1059634
                                                                   AE007317
                                CCAACTTGTCAAGAATTTTATGAACCATTTAAGTATTTTTTGTTCTGACCAC
Spr_4   G17   opSpV0100001171                        gb|AE007317|:469144-469418
                                                                   AE007317
                                TGCCTCCTTTAATCTGGGTGCCAGTCTTACTTCTGGCAACTGTGTTTTGAT
Spr_4   G19   opSpV0100001172                        ref|NC_003098.1|:619725-620573
                                                                   NC_003098.1
                                GCAGGAATTGCTTCAAATTCGATTTTATCACTTACAGGTTTACTTGTTTTAT
Spr_4   G21   opSpV0100001173                        ref|NC_003098.1|:c1721586-1721344
                                                                   NC_003098.1
                                AAAATTTGACGCTGGTATTTTATGGACTCGGAAAGAATATTAGCGGAGTCT
Spr_4   G23   opSpV0100001174                        -             -
                                TCATCTATGCAGGCTATACAATACCAGGGTATATCGGAGTAAACTTTACTG
Spr_4   I01   opSpV0100001175                        ref|NC_003098.1|:853019-853207
                                                                   NC_003098.1
                                CAAGTATGATTGGAATACGGTTTTGGAATATAGTACCAACTATCACGACCA
Spr_4   I03   opSpV0100001176                        ref|NC_003098.1|:c1554063-1553776
                                                                   NC_003098.1
                                CTTGTTGTTTATCCCAGTCATGGTTTCTAGTTCGGGCTCAGAGTTTCAAAG
Spr_4   I05   opSpV0100001177                        ref|NC_003098.1|:923268-924062
                                                                   NC_003098.1
                                CACTCATTAAAACCTTGTCTCGACTTATAAAGCCATTAGAGGGAGAAGTAT
Spr_4   I07   opSpV0100001178                        ref|NC_003098.1|:762595-763092
                                                                   NC_003098.1
                                AATGTTTTGGCTAATCTTTCCAACGCCAGTGCTCTCATAAAATCACGTTTT
Spr_4   I09   opSpV0100001179                        ref|NC_003098.1|:c1177487-1176909
                                                                   NC_003098.1
                                AAAGTCCGAGAAGCTTTTAAGAAAATGAATTCCACTTGGACCATCAATGAA
Spr_4   I11   opSpV0100001180                        -             -
                                GTTCTCAATCTGGAGGACATTTGTACCACCATATTCATGAATTAGATTGCA
Spr_4   I13   opSpV0100001181                        ref|NC_003098.1|:c1995393-1993105
                                                                   NC_003098.1
                                AGGCTTTACGCCAACGCCATCGTACAGTAGCTGACAAGCAAAATTCTATG
Spr_4   I15   opSpV0100001182                        ref|NC_003098.1|:626460-627224
                                                                   NC_003098.1
                                TTCGAGGATTTTCACCGATTAGCCTAGTAGCTGCACTTATCTGTACACTGC
Spr_4   I17   opSpV0100001183                        ref|NC_003098.1|:419729-421669
                                                                   NC_003098.1
                                TAGCTTTGCCTTAGAGGAATTAAGTTACTATATGAATCGGGTCTTTAAGAC
Spr_4   I19   opSpV0100001184                        -             -
                                AGCTTGTTTTGCTACAACGACTTATAGCGCAGATAGCGAGCCGATTATGA
Spr_4   I21   opSpV0100001185                        -             -
                                AGAAGAATACTGACCAGTTTTGGGGCTTAATTCAAGACACGTTACCTCATC
Spr_4   I23   opSpV0100001186                        gb|AE007317|:898260-899088
                                                                   AE007317
                                CTGAATCAAAAATGAAGTTCTCTCAAAAGTTAGAAATAAAACTCTGACTTTG
Spr_4   K01   opSpV0100001187                        ref|NC_003098.1|:c1700915-1700709
                                                                   NC_003098.1
                                TTTGTAGAAGGATATAAAATATACCTGACAGAATCTAAAGAATCTGGAATTA
Spr_4   K03   opSpV0100001188                        ref|NC_003098.1|:c2020623-2019340
                                                                   NC_003098.1
                                AAGCCAACAGATAGTATGAGAATGGAAGTATCTTCTCCCAAACTAGCGATT
Spr_4   K05   opSpV0100001189                        ref|NC_003098.1|:c1403029-1402181
                                                                   NC_003098.1
                                TCGATGACTATGAGGGCTTAACCATTGCTTTCCCAGACACTTTGATTACAA
Spr_4   K07   opSpV0100001190                        -             -
                                AAATCTACTATTCCACGGAGGATATCGATACAGCGATACAAGTCGTTATAA
Spr_4   K09   opSpV0100001191                        -             -
                                CTAAAATCCTAACAAACTCAATACTTTAGTAGTCTGATATGCCAATCTCACG
Spr_4   K11   opSpV0100001192                        ref|NC_003098.1|:1590539-1590611
                                                                   NC_003098.1
                                AGCTGGCAGAGCAGCGGACTCTTAATCCGTGGGTCACAGGTTCGATCCC
Spr_4   K13   opSpV0100001193                        ref|NC_003098.1|:c1506217-1504685
                                                                   NC_003098.1
                                GTCGGAATAGTTGCCGTATATTTGCACAACCGATATAACAATATTCAATTA
Spr_4   K15   opSpV0100001194                        ref|NC_003098.1|:1657940-1658692
                                                                   NC_003098.1
                                GATATCAAGCAAAGCGTCAGCATGATGCAGATTCTTCGACGACTGGTGGA
Spr_4   K17   opSpV0100001195                        ref|NC_003098.1|:c2032278-2031511
                                                                   NC_003098.1
                                ATCAATGTGGGATCCATATGGGCAATTGTCTGACTTACCTGTGGCAGTTG
Spr_4   K19   opSpV0100001196                        ref|NC_003098.1|:c1585496-1585068
                                                                   NC_003098.1
                                GGAGATGAAGGACAGGGCTATCAGCTGATGAATGTTGAGGAATTTCTTAG
Spr_4   K21   opSpV0100001197                        ref|NC_003098.1|:c690337-690017
                                                                   NC_003098.1
                                CAACTCCCTTACAGCCACTATTGAAGAGGCTATCCAGAAACAAACCGCTG
Spr_4   K23   opSpV0100001198                        ref|NC_003098.1|:637592-638395
                                                                   NC_003098.1
                                AATTTCACAGCAAATGGATTAGTAGCACTGGGCGCCTCACCAGCCATGAG
Spr_4   M01   opSpV0100001199                        -             -
                                GATTTACCCACTACAAATATTATAGAACCTAAAATTTTCGCTATAACTCCCA
Spr_4   M03   opSpV0100001200                        ref|NC_003098.1|:c1857533-1857099
                                                                   NC_003098.1
                                CAAACTAAGGTTAAGAAAGTATTAGCCTTTCGAGACAAACCACCTTATGGT
Spr_4   M05   opSpV0100001201                        ref|NC_003098.1|:c1666202-1665900
                                                                   NC_003098.1
                                TCGTACTCTTTTGAGTGCAAATGGTCAAAAACCAAGCGAAGCTAAGGTACA
Spr_4   M07   opSpV0100001202                        -             -
                                CAAGTCATCAAGATACCAAGCCGTCAAGCAACTCAAAGGAAGATAGGAAA
Spr_4   M09   opSpV0100001203                        ref|NC_003098.1|:904864-904936
                                                                   NC_003098.1
                                GGCAGAGCGCATCCATGGTAAGGATGAGGTCGCCGGTTCAATCCCGGCA
Spr_4   M11   opSpV0100001204                        -             -
                                TTGGGTAAAAGCAACTCAGTTAGTTGATGAAATGGAACAAGTAGGTTTAAT
Spr_4   M13   opSpV0100001205                        ref|NC_003098.1|:c1715341-1713926
                                                                   NC_003098.1
                                AAGTAGCGATAGCTTTCTCCAAGTGGAAGACCCCAGCAATTCAAGTGTTC
Spr_4   M15   opSpV0100001206                        ref|NC_003098.1|:230671-231087
                                                                   NC_003098.1
                                CTTATCTCATTCATTAGTAATTTATCTGGCACTTGATGGTGATGCTGTGGT
Spr_4   M17   opSpV0100001207                        -             -
                                AATACAAGGAGTTGGGAAAGTTATTTTTCCAGCTTCTTTTTCTGATGAAATT
Spr_4   M19   opSpV0100001208                        ref|NC_003098.1|:c1587054-1586584
                                                                   NC_003098.1
                                CTTTCCCTTTGACTTTGAGATTAGCTGGGACAAACGCAACCATGCGGTAG
Spr_4   M21   opSpV0100001209                        ref|NC_003098.1|:c774224-774137
                                                                   NC_003098.1
                                CAAGAGGCTTAAGAGGCCGTGTTGGAAACGCGGTAGGCGTGTAATAGCG
Spr_4   M23   opSpV0100001210                        ref|NC_003098.1|:511168-511296
                                                                   NC_003098.1
                                TACTATTGGATTCATCGTGGAAAATTGGGGTTAAGCAAGCAGGATCTGCT
Spr_4   O01   opSpV0100001211                        gb|AE007317|:877014-877382
                                                                   AE007317
                                TTTACCTTTTCCTCCCTACTCATCTTAGTATAGAAAAGTGAATCTGAAATAG
Spr_4   O03   opSpV0100001212                        ref|NC_003098.1|:184622-185041
                                                                   NC_003098.1
                                TAAAAACATGAACAATACAAGTGGACCGCGCGTAGAAGCTAGTCAAGCCT
Spr_4   O05   opSpV0100001213                        gb|AE007317|:1965089-1966097
                                                                   AE007317
                                CGATTACGTTCCTATGGGTTCGTGAGAGGAGGTGAAACTAATGAGCCTTA
Spr_4   O07   opSpV0100001214                        -             -
                                ATAATTGGGGAAAAAGTAGTTCAAATGCCTGGCAGCAAAAAATCTCAACGA
Spr_4   O09   opSpV0100001215                        ref|NC_003098.1|:747720-747932, ref|NC_0030
                                                                   NC_003098.1
                                GATTGATCGTTACGGAATAGAGTTCGTCAAAAAAGGGAAAAATCGTTACTA
Spr_4   O11   opSpV0100001216                        ref|NC_003098.1|:786755-788248
                                                                   NC_003098.1
                                CCGCTATGGGTTCTGCTGGCTTCTTAGTATCTGCTAGCCGTTACTTAAAGC
Spr_4   O13   opSpV0100001217                        -             -
                                AATTCAATTGCTCACGTAGTTTACGCATATAGCTTCACTTGTAGATGGTAC
Spr_4   O15   opSpV0100001218                        -             -
                                TGTTATATTAAAAGTATAATTATTTTTTATTTATCAGAGTTAAGCATTGCACT
Spr_4   O17   opSpV0100001219                        ref|NC_003098.1|:c1107611-1106262
                                                                   NC_003098.1
                                TGCGCATGGTGACGGATCTCCTCCATCTTTCACGTATTGATAATGCTACCA
Spr_4   O19   opSpV0100001220                        ref|NC_003098.1|:c1173837-1173490
                                                                   NC_003098.1
                                CACGTGTTGAAAAAATCGAAGTTGTTCGTTACGGTAAAGTACGTCGTGCG
Spr_4   O21   opSpV0100001221                        ref|NC_003098.1|:c580482-580123
                                                                   NC_003098.1
                                TGATACTGACCTTAGTCGTCTGCATTATCCTAACCAAACTTTTTAGATTAAA
Spr_4   O23   opSpV0100001222                        ref|NC_003098.1|:c1490946-1490335
                                                                   NC_003098.1
                                CGCATTACCAAGGAGCAAATAGAGCTTCTTTGGCAGGTTTATCAAGGTCA
Spr_4   A02   EMPTY             -                    -             -
Spr_4   A04   opSpV0100001223                        ref|NC_003098.1|:c118931-118611
                                                                   NC_003098.1
                                TATGTCCGCATTGGGATTTGTAGGGATAATGCGAAACTTATCCAAAAAGGG
Spr_4   A06   opSpV0100001224                        -             -
                                CAAATTGAGGTCTATAAATATCTACTCTCATCAAAAAACTCTCCAATTGAAC
Spr_4   A08   opSpV0100001225                        gb|AE007317|:856931-857179
                                                                   AE007317
                                AATTTTCTAGAGGAGACTTTTTGAGTGTGCTCTCTTGTGTTGTACGATTTT
Spr_4   A10   opSpV0100001226                        -             -
                                AAGAAAACATTGAAGTTTATGACAGCCAGTTCACCGTTATCTCCTAAAGAC
Spr_4   A12   opSpV0100001227                        ref|NC_003098.1|:274499-275935
                                                                   NC_003098.1
                                ATCCAGTTACTTGCAATCCTAAGGATATCTTAATGGCAATGAAAGCTATGC
Spr_4   A14   opSpV0100001228                        ref|NC_003098.1|:c1618157-1617090
                                                                   NC_003098.1
                                GATAAAGATAATTATTATAATCCTGTGATTGTTCAACCATTAGTTTTAATTG
Spr_4   A16   opSpV0100001229                        ref|NC_003098.1|:625960-626364
                                                                   NC_003098.1
                                TCTAGGATTGTCATGTACTATAATGGAGGTGGTGACAATTATATTGGTTCT
Spr_4   A18   opSpV0100001230                        -             -
                                AACCTGCGGCTAGCTTCCTAGTTTGTGCTCTTTGATTTTCATTGAGTATTA
Spr_4   A20   opSpV0100001231                        ref|NC_003098.1|:c1691499-1691426
                                                                   NC_003098.1
                                TCAGCTGGCTAGAGCGTCCGGTTCATACCCGGGAGGTCGGGGGTTCGAT
Spr_4   A22   opSpV0100001232                        ref|NC_003098.1|:197350-197646
                                                                   NC_003098.1
                                TGAAGTTGACACTCGTGCACACAAACTTTTGATCAAGCAAGCTGTTGAAGC
Spr_4   A24   opSpV0100001233                        ref|NC_003098.1|:921242-922261
                                                                   NC_003098.1
                                GCTTCGTAGGTCTTATAGTTCCTCACTTTTGTGGCTTATTTATAAGCAAAG
Spr_4   C02   opSpV0100001234                        ref|NC_003098.1|:c1616987-1615977
                                                                   NC_003098.1
                                TTACTCATGATCAAGAGGAAGCCTTGACTTTATCTGATAGAATTGCAGTCT
Spr_4   C04   opSpV0100001235                        gb|AE007317|:827276-827546
                                                                   AE007317
                                CAATTCATGATTTGAAGAGGATATTTCGCAAAGATATGCTATACTATGTTTG
Spr_4   C06   opSpV0100001236                        -             -
                                TTGAGTATTAGATTTACTCAAAATCAAGGATTTTGAAGATGAACTTGTATCA
Spr_4   C08   opSpV0100001237                        -             -
                                CCGCCTTTTTTGGGCGTTTTGGCTTGTTGTTCAGCTTTCTGACTGTAGTTG
Spr_4   C10   opSpV0100001238                        ref|NC_003098.1|:c1823403-1822669
                                                                   NC_003098.1
                                TAAAGGCTATCAAGACTGAACGAGGAGAACGAGGCGAAATCCAGATCGAG
Spr_4   C12   opSpV0100001239                        -             -
                                TGACAGGATATTGCCACGGAATAACTAGCTTACTACAAACCACTGTCTACA
Spr_4   C14   opSpV0100001240                        gb|AE007317|:1162699-1162970
                                                                   AE007317
                                GTCTATCAAATAAAGAACCTTTATTTAGTAGATCTTGTTTTTGTCTCTTTTT
Spr_4   C16   opSpV0100001241                        ref|NC_003098.1|:c1052978-1052265
                                                                   NC_003098.1
                                AATAATGCGGGGATTGACACTATCTGGTATAATCCTCATCACCTCGAAAAT
Spr_4   C18   opSpV0100001242                        -             -
                                GAGTTATAGTGGCTTGATGCTGGGAAAGTACACTGTGACTGCTAAAACAT
Spr_4   C20   opSpV0100001243                        ref|NC_003098.1|:c1496273-1494216
                                                                   NC_003098.1
                                CAGACCAGTCCATTGTCTTCCAAGGTTCAGCTCCCATCAATTCTTGGTATA
Spr_4   C22   opSpV0100001244                        ref|NC_003098.1|:c103669-102998
                                                                   NC_003098.1
                                GTTGAATTCCAACTTTTTAACTCATTTGCCAAGACCTATCGTGGTCACGGA
Spr_4   C24   opSpV0100001245                        ref|NC_003098.1|:625148-625780
                                                                   NC_003098.1
                                ATCAAGTCACCGATTTACACTGATAATCGTGTGACACTAGCCTATCCAGAA
Spr_4   E02   opSpV0100001246                        ref|NC_003098.1|:c1498973-1498242
                                                                   NC_003098.1
                                GGAAGACCATATTGTCTTTAACGGTCCAGATGAACAGTTCCTAGGTGGCC
Spr_4   E04   opSpV0100001247                        ref|NC_003098.1|:701264-701962
                                                                   NC_003098.1
                                TAAACGTGTACTCATTACAGGAGTGAGTTCAGGGATCGGATTGGCTCAAG
Spr_4   E06   opSpV0100001248                        ref|NC_003098.1|:c35674-34652
                                                                   NC_003098.1
                                TATCCTTTACTTTATCCTTGCCTCTCTCCTCACTACACTACTCACCTCTCTA
Spr_4   E08   opSpV0100001249                        ref|NC_003098.1|:318314-319552
                                                                   NC_003098.1
                                ATTATTGGCATCTATAGATTGACCATGAAGAGTAATAGCGATAATTTTCGT
Spr_4   E10   opSpV0100001250                        ref|NC_003098.1|:322855-323706
                                                                   NC_003098.1
                                AAGTCAAGCCAGTAGATTCCAGTCAATTTCCAGCCAAAGCTAAACGTCCG
Spr_4   E12   opSpV0100001251                        ref|NC_003098.1|:c1214549-1213611
                                                                   NC_003098.1
                                AGAAGGAAGTGTCACTCAGAGAGATTTTACTTTATTATTTCCGAGTTATCG
Spr_4   E14   opSpV0100001252                        ref|NC_003098.1|:c1318519-1318112
                                                                   NC_003098.1
                                ATGCTGCTACACAGATTATTAGGGAAAGTGCTGTTCCAACCTATACAAATA
Spr_4   E16   opSpV0100001253                        ref|NC_003098.1|:11616-12158
                                                                   NC_003098.1
                                GGTCAAACATATTGATACACATATTGAAATGGACTTCATGATGGTTTCTAG
Spr_4   E18   opSpV0100001254                        ref|NC_003098.1|:435469-435918
                                                                   NC_003098.1
                                AGGAGAAGGGAGAATGGTTTCCAATTGGGGATATTACACTATCTCAGGAT
Spr_4   E20   opSpV0100001255                        gb|AE007317|:557179-557769
                                                                   AE007317
                                AATCAGTTTGTTCACATTTACCTTCGATATATTATATCCCATAGTTAAGGTT
Spr_4   E22   opSpV0100001256                        gb|AE007317|:272097-272398
                                                                   AE007317
                                TAGGCGGTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATAC
Spr_4   E24   opSpV0100001257                        ref|NC_003098.1|:979142-981433
                                                                   NC_003098.1
                                TGATGTTGCTTATGCTGCCCAAGCTGGCGATATGTATACGCAAATTGTGG
Spr_4   G02   opSpV0100001258                        ref|NC_003098.1|:754851-755873
                                                                   NC_003098.1
                                AGGCAGGTGCCTGTGGTACAGCAGCGGTTATTTCTCCAATTGGAGGTATT
Spr_4   G04   opSpV0100001259                        -             -
                                CCGGATGTCTGAGAATCCTCCTATTCCTCCTTCTATAGTGAGTTGAAATAA
Spr_4   G06   opSpV0100001260                        -             -
                                ATTCAGTACAAATCGTTGCGGTAACTGGAGTGCTTTTAGTTGGGAAAATTG
Spr_4   G08   opSpV0100001261                        ref|NC_003098.1|:680041-680646
                                                                   NC_003098.1
                                CGACGCTTTGGAACCATACATCGATGCGGAAACAATGCATTTGCACCATG
Spr_4   G10   opSpV0100001262                        ref|NC_003098.1|:634965-636101
                                                                   NC_003098.1
                                GGTGTGCATGAGTTTGGTTCTCTTTATACAACCAGTTCTTACTCTACTGTT
Spr_4   G12   opSpV0100001263                        ref|NC_003098.1|:c1761219-1760461
                                                                   NC_003098.1
                                ATCTACAGTCTCAAAACCCTACGTTCCATGCAAGGTAGTCATTTCCATCTG
Spr_4   G14   opSpV0100001264                       ref|NC_003098.1|:c1076442-1076140
                                                                  NC_003098.1
                                ATTCTGTATCCCAGCAATGAGCGTTCCAGTATTTGACAATATTAGACTTCC
Spr_4   G16   opSpV0100001265                       -             -
                                AATTTTTCCATAGTGACTCCTTAATTTTCTTCTACACGTCTGATGATAAATC
Spr_4   G18   opSpV0100001266                       -             -
                                CCGGTCTTCCAAGCCCTAAATAAGGAATTAATTCAGGAAAATCTGACTTTA
Spr_4   G20   opSpV0100001267                       gb|AE007317|:924063-924629
                                                                  AE007317
                                TGGAAAAACTCCTAGAATTAGTGCTACAAATATTGACAATGGTATCTTAGG
Spr_4   G22   opSpV0100001268                       ref|NC_003098.1|:1741440-1742207
                                                                  NC_003098.1
                                GTCCATTTTGTTTTGGATAGACGCAGTACAGAACTACGTTCTCTTTAATCA
Spr_4   G24   opSpV0100001269                       ref|NC_003098.1|:208585-208968
                                                                  NC_003098.1
                                ACAAGAACACGGTCTTAAATCAGTTGAAGTTACTGTAAAAGGTCCAGGTTC
Spr_4   I02   opSpV0100001270                       gb|AE007317|:118932-119687
                                                                  AE007317
                                AAAATCAGGGAATCAGTGATTAGCTGTTATTTGAATTAAGTAAACTGTTAAG
Spr_4   I04   opSpV0100001271                       ref|NC_003098.1|:c1802484-1802161
                                                                  NC_003098.1
                                AATGGGTAAGTTAGAACTCTTGTGTGAAGAGTTTGGGCATAAACTTTTACC
Spr_4   I06   opSpV0100001272                       ref|NC_003098.1|:c1719179-1718982
                                                                  NC_003098.1
                                AGATGATGATGACCCACGTATAGAGGAAGAGAGTGAAGCACTAGAAAATA
Spr_4   I08   opSpV0100001273                       ref|NC_003098.1|:c1455515-1454838
                                                                  NC_003098.1
                                AGACTTTATGGAAGTTTTGAGTCTATTTGTTCAGTCGGAACCTCATCTGGT
Spr_4   I10   opSpV0100001274                       ref|NC_003098.1|:1577898-1578200
                                                                  NC_003098.1
                                AAGACTTTGAACGTTCGCAACAAGCTTGCCTTATCGGCGTCGCAGACTAC
Spr_4   I12   opSpV0100001275                       ref|NC_003098.1|:270271-270825
                                                                  NC_003098.1
                                TCATTGAGGCGGAACATATGTGTATGAGTATGCGTGGTGTTAGAAAACCA
Spr_4   I14   opSpV0100001276                       ref|NC_003098.1|:c1232954-1232277
                                                                  NC_003098.1
                                AAATCCAAAACTTGTTAAGGTTGCGGTGATGGCTCACACGGAGCAGGATG
Spr_4   I16   opSpV0100001277                       gb|AE007317|:1329952-1330174
                                                                  AE007317
                                CCAGTTCAACAGACTTGTAAGCGTTTTTATTCTTTACGAAAGACCTCGTTC
Spr_4   I18   opSpV0100001278                       gb|AE007317|:953001-953382
                                                                  AE007317
                                AACTCTTCATTGCCATATAACTTAAGTTTCATCGCATGTCAGTAATCTCATA
Spr_4   I20   opSpV0100001279                       ref|NC_003098.1|:952356-953000
                                                                  NC_003098.1
                                TAGGGGGATTAAAATGGTTTGAAAGTTTACTCTTAACACTTGATAGGAAGC
Spr_4   I22   opSpV0100001280                       -             -
                                ATCAAACGCACATACGGTATTTCTGGTCCCCTTGACGAATACAAACGGCG
Spr_4   I24   opSpV0100001281                       ref|NC_003098.1|:c1894042-1893836
                                                                  NC_003098.1
                                GTTTACTCTCAATCATCAAGAATTCTCTTTTCGTGGTAGCGTTTGGGGTCT
Spr_4   K02   opSpV0100001282                       ref|NC_003098.1|:409666-410511
                                                                  NC_003098.1
                                GCTATCGAGCCAAGTGTAACAGAGTTGGACAAGCTTCCTTATACGACCGC
Spr_4   K04   opSpV0100001283                       -             -
                                TTCAAACTACTATAAAAGTTCTATAATCTCTTTATAAGATTTGCCCATCAGA
Spr_4   K06   opSpV0100001284                       ref|NC_003098.1|:c1226341-1225865
                                                                  NC_003098.1
                                TGTCAACTGGAGGAGGAGTGGTTATTTCTCAGAGAAATCGTGACTTACTC
Spr_4   K08   opSpV0100001285                       gb|AE007317|:1182139-1182409
                                                                  AE007317
                                CGGAAAATAATTTAACCAATAACTATCTTTCATCGTATCCTCCAACCAGTAC
Spr_4   K10   opSpV0100001286                       ref|NC_003098.1|:c1083991-1083779
                                                                  NC_003098.1
                                AAGATGCGATTACTGCCTTTCAAAAGGGCATGGTCTTGTCAAAAGAGCTC
Spr_4   K12   opSpV0100001287                       ref|NC_003098.1|:543591-545435
                                                                  NC_003098.1
                                AAATCTAGGGCGTTTGCTCCAAATCCCGACCCCAGTACGTATCGAGTCCT
Spr_4   K14   opSpV0100001288                       ref|NC_003098.1|:c1435491-1434742
                                                                  NC_003098.1
                                TCTTGTATAAACAGATTCGCAATATGGTGGGGACTCTTCTCAAAATCGGTA
Spr_4   K16   opSpV0100001289                       ref|NC_003098.1|:c1563865-1563551
                                                                  NC_003098.1
                                TCAAAATATTCACTCGTAATCTTGGAAGCAAAACGTGCCCACGAATTGGAA
Spr_4   K18   opSpV0100001290                       ref|NC_003098.1|:1162334-1162522
                                                                  NC_003098.1
                                CTATCCAAGTTAAATAAAAGCTACCAAAACTGTAAACAGGGTACGGCAGAT
Spr_4   K20   opSpV0100001291                       ref|NC_003098.1|:115766-116233
                                                                  NC_003098.1
                                CATCTCTGTTCCATATTGTTTATATGTTCGTTTTGAAGACAGTCCAGAGTA
Spr_4   K22   opSpV0100001292                       ref|NC_003098.1|:248889-250970
                                                                  NC_003098.1
                                AGATCATGACTGACCCATTCGTAGGTCGTTTGACATTCTTCCGTGTTTACT
Spr_4   K24   opSpV0100001293                       ref|NC_003098.1|:c1821800-1821096
                                                                  NC_003098.1
                                GACTTAACCCGGTTGAAGTACCAGGAATTGTTGTACGCAATCACGGTCCA
Spr_4   M02   opSpV0100001294                       ref|NC_003098.1|:c1259233-1258385
                                                                  NC_003098.1
                                CAGTTTGGTCTGATTTATGATGTGGTCAAAGGGGATTGTTACCACGGTGG
Spr_4   M04   opSpV0100001295                       gb|AE007317|:1652450-1653130
                                                                  AE007317
                                CTTATTTCATTCCGCTATAATTTCACCTTACCCTATCTTTTTCGTAGCACCC
Spr_4   M06   opSpV0100001296                       ref|NC_003098.1|:c335615-335019
                                                                  NC_003098.1
                                TGAAGCCTATTTTCGACAAGCTTCAACGACGGACTATTCTGGCGTTTATAA
Spr_4   M08   opSpV0100001297                       ref|NC_003098.1|:585634-586344
                                                                  NC_003098.1
                                TTGTTACCGGTCTATACAGGAGTGTTACTAGATGATAAGGATGGTGCTCA
Spr_4   M10   opSpV0100001298                       -             -
                                TGATTTGGGTAAATACAATGAGCTTGAAAGAAGTAGCAAACTCACCAAGCG
Spr_4   M12   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_4   M14   opSpV0100001299                       -             -
                                AGATGTGACTATAGGTCAAAAAAGCAAGACAGGAGCTTTTAACGCCAGCT
Spr_4   M16   opSpV0100001300                       ref|NC_003098.1|:c1721298-1720939
                                                                  NC_003098.1
                                TAATTTTCCCATCTTCACTGTATAGGATGGTTGAGGAAATCAGAGAAAATG
Spr_4   M18   opSpV0100001301                       ref|NC_003098.1|:917259-918890
                                                                  NC_003098.1
                                GCTGGATGAGATGGATTTGACAAGTGCGGAGAGCAAAGCAACATATGCTC
Spr_4   M20   opSpV0100001302                       -             -
                                GACTCGTCCAGTAGCTGGTATTTGTGCCTTGTTAGCTAACATTGTAGTCAC
Spr_4   M22   opSpV0100001303                       ref|NC_003098.1|:c1136564-1136391
                                                                  NC_003098.1
                                TTGGCTGCCAAGCTTTGGGAAGAAGGTAAAATGGTCTACGCCTCATATGC
Spr_4   M24   opSpV0100001304                       ref|NC_003098.1|:714601-715155
                                                                  NC_003098.1
                                ACCAATTGCCCTCAATCAAGCAGAGATATTGAAAAATAAGCGATACACTTG
Spr_4   O02   opSpV0100001305                       ref|NC_003098.1|:c1076180-1075659
                                                                  NC_003098.1
                                GCGACGGAAGTACAAATCAATCGCCCTAAAAAAGAATTAGCGAATTATTCT
Spr_4   O04   opSpV0100001306                       ref|NC_003098.1|:c1716585-1716376, ref|NC_0
                                                                  NC_003098.1
                                AAAAATTCCTCTATCAATGCCAAACGGAGAAATATGCAGGAAAGACCAAGG
Spr_4   O06   opSpV0100001307                       ref|NC_003098.1|:c685311-684508
                                                                  NC_003098.1
                                AGCCAAGGTGATATTCGCATTAAACTCTTCCCTAAACTCGCTCCTCTAGCG
Spr_4   O08   opSpV0100001308                       gb|AE007317|:645843-646177
                                                                  AE007317
                                AGATTGAGTCAGAGGGATCTAACAGTCGTTAATCTCAGCTTTACGCACCC
Spr_4   O10   opSpV0100001309                       ref|NC_003098.1|:c1510307-1508214
                                                                  NC_003098.1
                                TGGAATCCAACAAACTTCATATGGCACACAAGTATCTGCAATTAAATACTC
Spr_4   O12   opSpV0100001310                       ref|NC_003098.1|:384683-385549
                                                                  NC_003098.1
                                AAGCTAAGCCAGAGGTTCCAGATGAATTATTTTCCCAGTGTCCAGGCTGT
Spr_4   O14   opSpV0100001311                       ref|NC_003098.1|:c1850825-1850742
                                                                  NC_003098.1
                                ATTGGCAGACGCGCTGGACTCAAAATCCAGTGTCCGCAAGGACGTGCCG
Spr_4   O16   opSpV0100001312                       ref|NC_003098.1|:c1593004-1592150
                                                                  NC_003098.1
                                AAATCCCGCTGATTGGTTTAAACCTTATCAGGAAGTATTTGAGCGCTTTAG
Spr_4   O18   opSpV0100001313                       -             -
                                CGCTAGGATTTCGGTCCTAGCGGGAACACTCATCATAAGTTGGGATAGTA
Spr_4   O20   opSpV0100001314                       ref|NC_003098.1|:c1208265-1207765
                                                                  NC_003098.1
                                GTTGAGCAAGATACAGTTCTTCGTCGTGAGCTTCGTGGAAGCGAAGTTGA
Spr_4   O22   opSpV0100001315                        ref|NC_003098.1|:87777-88736
                                                                   NC_003098.1
                                ACGGAGCTAGCAAGTGGCAACGTATTCGCAACGTAACCATTCCTCAGTTG
Spr_4   O24   opSpV0100001316                        ref|NC_003098.1|:399592-400614
                                                                   NC_003098.1
                                TTCACGAAATGAAATTGATCGTTGACTTGATCTACGAAGGTGGATTCAAGA
Spr_4   B02   EMPTY             -                    -             -
Spr_4   B04   opSpV0100001317                        ref|NC_003098.1|:1626138-1626314
                                                                   NC_003098.1
                                ATTGCTCACATCTTATTTCAAACCACGGGACTCCCACAAGAAAGGAAAATC
Spr_4   B06   opSpV0100001318                        ref|NC_003098.1|:c65539-64781
                                                                   NC_003098.1
                                TTTATATCTACCATACATCCTACATCCCAGAACAATATATCAACGCAAATTA
Spr_4   B08   opSpV0100001319                        ref|NC_003098.1|:961807-962673
                                                                   NC_003098.1
                                GATAACCAAAGGCGTGAACCCATTTTTAGCGACACTTGTTGCTGTAGGAG
Spr_4   B10   opSpV0100001320                        -             -
                                TCTTTTAGCCCGTGCTCTAATCTAAGATATTAATGACGAAGAGCTCTGCAC
Spr_4   B12   opSpV0100001321                        ref|NC_003098.1|:547411-548016
                                                                   NC_003098.1
                                TTTTATGAAAAATCTGCCAGCTGAGTTTGCCCGTTACAGTGAGCAACAAGT
Spr_4   B14   opSpV0100001322                        ref|NC_003098.1|:c1932655-1931774
                                                                   NC_003098.1
                                AAGTATTTCAACGCCTGAAAACTTGGAGGATTTACTAGCGTGGCTAGATCA
Spr_4   B16   opSpV0100001323                        ref|NC_003098.1|:c1570022-1569522
                                                                   NC_003098.1
                                TAGTTTTATGTGGTATGCAGACAGAATATTGTGTGGATACCTCTGTCAAGG
Spr_4   B18   opSpV0100001324                        ref|NC_003098.1|:1001242-1002135
                                                                   NC_003098.1
                                CTCTATAGTTTCTACGATGTAGACTATGTCACTCGGATTGGTAGAGAAGTT
Spr_4   B20   opSpV0100001325                        ref|NC_003098.1|:c2035700-2035627
                                                                   NC_003098.1
                                GATAGAGCATTCGCCTTCTAAGCGAACGGTCGCAGGTTCGAATCCTGCTG
Spr_4   B22   opSpV0100001326                        gb|AE007317|:1268222-1268462
                                                                   AE007317
                                TCTAATACCAATAAATCGCTAAGATATTATTTCAAAGAACATCTACAATTGA
Spr_4   B24   opSpV0100001327                        ref|NC_003098.1|:c1061368-1059635
                                                                   NC_003098.1
                                TCTACAGGCATCACAAGACGAGCTTTCTGTTATTCGCGAGAAAGCAGTAG
Spr_4   D02   opSpV0100001328                        ref|NC_003098.1|:539428-540207
                                                                   NC_003098.1
                                GAGGAACTAATCTCATCGTTGTTATGCCCAATACCAGCAATGGTTGGTACA
Spr_4   D04   opSpV0100001329                        ref|NC_003098.1|:c1254721-1253837
                                                                   NC_003098.1
                                GATGACGCGTAATGTAGAGGATAGTTTGAAACACGTTCACCATACCCAAC
Spr_4   D06   opSpV0100001330                        ref|NC_003098.1|:c1638436-1637672
                                                                   NC_003098.1
                                CCAAAAGGCACGTATCTTAACGGAGGATTGGGTTTATCGTCAGTCTTATTG
Spr_4   D08   opSpV0100001331                        ref|NC_003098.1|:c1127138-1126344
                                                                   NC_003098.1
                                CACCTTATGTAGATATCAATAAACTGCTCTTGACGGGTAAGAAGGGTTCAT
Spr_4   D10   opSpV0100001332                        ref|NC_003098.1|:936852-937304
                                                                   NC_003098.1
                                AGTGATTATTCTAAAGACTTCAGACCATTGATTATTGATCAGCCTGAAGAC
Spr_4   D12   opSpV0100001333                        ref|NC_003098.1|:c335022-332863
                                                                   NC_003098.1
                                CTCACCTGCTCCACAACAACCCCCATCAACTGAAAGTTCAAGCTCATCATC
Spr_4   D14   opSpV0100001334                        -             -
                                GATGTTTTTCTCCTCAGTTCATCAGCTTCCTCCTTGACACTCGGTCAGATT
Spr_4   D16   opSpV0100001335                        ref|NC_003098.1|:644210-644842
                                                                   NC_003098.1
                                TTATCAGGTACCCTTGATAATCGATGATCGGTTGGATGTTTGTCTTGCGGT
Spr_4   D18   opSpV0100001336                        ref|NC_003098.1|:739884-740474
                                                                   NC_003098.1
                                ATGTCATTTCCAATCCTCCTATCCGTGCGGGCAAGCAAGTCGTTCATGAA
Spr_4   D20   opSpV0100001337                        ref|NC_003098.1|:550378-550512
                                                                   NC_003098.1
                                CAAAGATCGCTTGCATTATATTATTTGCAAATCTGGAATGAGATCGGCGCG
Spr_4   D22   opSpV0100001338                        ref|NC_003098.1|:c1046276-1045284
                                                                   NC_003098.1
                                GACTTAAGGTTGTGGCACCTGGAACACCTGCGGACATGAAAGGCCTGCTT
Spr_4   D24   opSpV0100001339                        -             -
                                CCTAAAACCTAAAGTTTGTGATATAATTATCAAGAAAAAAGATTTAGGAGTT
Spr_4   F02   opSpV0100001340                        -             -
                                TTGGTGCAATCGTATCCTAAACGAGGATGAAACGGAAATACTATACTTTCC
Spr_4   F04   opSpV0100001341                        gb|AE007317|:1810790-1811304
                                                                   AE007317
                                CATTGTAGGAACCTCCAAAAGTTGGACAAAATGATTGAAAGGATTGGATCC
Spr_4   F06   opSpV0100001342                        ref|NC_003098.1|:c1346837-1346301
                                                                   NC_003098.1
                                ATTTGAAGTGACGATTACGTCTGCTCATCCTCTAACTGATGAACAGAAGAC
Spr_4   F08   opSpV0100001343                        ref|NC_003098.1|:c1148429-1147539
                                                                   NC_003098.1
                                AACGTGAGCTATGTAGTATGGACGGTCTTGTTTGCAGTTGTTTTCTTGGG
Spr_4   F10   opSpV0100001344                        ref|NC_003098.1|:812345-812647
                                                                   NC_003098.1
                                AAGGAAGAAATCGAAGCAGAAATGTACGGAACAGGCCCACGTAAACGCAA
Spr_4   F12   opSpV0100001345                        gb|AE007317|:216708-217197
                                                                   AE007317
                                TAGTTTTCAAAGAGTTCTCCGTGGGTAGCATATTGTGTATAAGAACCACCA
Spr_4   F14   opSpV0100001346                        ref|NC_003098.1|:c849152-848727
                                                                   NC_003098.1
                                GTGAAAGTAAAAGAACCTTTAAGTTCTGAATACGGTTACTTGCGCGACGAT
Spr_4   F16   opSpV0100001347                        ref|NC_003098.1|:975065-975622
                                                                   NC_003098.1
                                TTACTTTATGAAGTCCCCTTTGGGAGTGTGGGCAATTTGTGACCAGAAAAA
Spr_4   F18   opSpV0100001348                        ref|NC_003098.1|:375761-376546
                                                                   NC_003098.1
                                TGGTTTGGGAGAGCCAATTTAAAGACTGGCAGGGTTACGCTACTTTAGAA
Spr_4   F20   opSpV0100001349                        -             -
                                AATCGAAGCGGTCTCTAAAAGCACTACGGGAATGTTTTTCGCCCCTGGTA
Spr_4   F22   opSpV0100001350                        ref|NC_003098.1|:857180-857980
                                                                   NC_003098.1
                                TATTTATCTCTGGAATCTCGTATGGCTTGTGGGATGGGAGCTTGCTATGC
Spr_4   F24   opSpV0100001351                        -             -
                                ACTACTAGGCAAGCAAATAAACAAATAAACAACTAGAATAGAAAAAGATAG
Spr_4   H02   opSpV0100001352                        ref|NC_003098.1|:748579-749067, ref|NC_0030
                                                                   NC_003098.1
                                CTATGAGAAAACATTTAAATCACTTAACCAATTGGAACAAGCCATTATAGAC
Spr_4   H04   opSpV0100001353                        ref|NC_003098.1|:c1692286-1692214, ref|NC_0
                                                                   NC_003098.1
                                GTTTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCAGCGG
Spr_4   H06   opSpV0100001354                        ref|NC_003098.1|:1872878-1874209
                                                                   NC_003098.1
                                CTCAAATGCCTCCCATGAATTGAGGACACCAGTTACTTCGATTAAGGGCT
Spr_4   H08   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_4   H10   opSpV0100001355                        ref|NC_003098.1|:103911-104414
                                                                   NC_003098.1
                                GCTGCCTTGTTTGCAGTATTTGCTCCATCATTTGTATCTGCTCAAGAATCA
Spr_4   H12   opSpV0100001356                        -             -
                                TTATGCAGTTCCTTTTTATTTTAACAGGAGTGAAACTATAGTGTTTCTAAAT
Spr_4   H14   opSpV0100001357                        gb|AE007317|:500572-500871
                                                                   AE007317
                                GTCACCATTAAAAATTGAAATAAAAGGATGTTATCACTAATACAAGTGAGC
Spr_4   H16   opSpV0100001358                        ref|NC_003098.1|:695084-696343
                                                                   NC_003098.1
                                TTCGAGTGAATGATACCAGTTTAACCCCAACTCTGGGTCCAGAACTGGCA
Spr_4   H18   opSpV0100001359                        ref|NC_003098.1|:c1082106-1081675
                                                                   NC_003098.1
                                TCGGCTGAATTGATGGATAAGATGATCAATCTCCAAGTTATTCCAGGAAAT
Spr_4   H20   opSpV0100001360                        ref|NC_003098.1|:1701075-1702304
                                                                   NC_003098.1
                                ACACAAGCTGTCATCCGAGATCACTTTCTTAAATATGATAGAGCCGTCCGA
Spr_4   H22   opSpV0100001361                        ref|NC_003098.1|:256296-257537
                                                                   NC_003098.1
                                ACAGAAGAGGTCTTCACAGCGCCTGACTTCCGTCGTGCAGATGGTTATGT
Spr_4   H24   opSpV0100001362                        -             -
                                ACAGAGTAGCAGACCAGCTCACGTTATTCGAGTCAGTAGATCCGTTTACT
Spr_4   J02   opSpV0100001363                        ref|NC_003098.1|:295053-295832
                                                                   NC_003098.1
                                CTGTTTTAGTGGAATGCTGTTAGGAATTTACACCAATAGATGTATTGTTCT
Spr_4   J04   opSpV0100001364                        gb|AE007317|:1863702-1864030
                                                                   AE007317
                                CCCTGTTTTATATCCTAAAAAAGAGCTGCCATTTGACGAACAAAAAGTGAT
Spr_4   J06   opSpV0100001365                        ref|NC_003098.1|:742415-742804
                                                                   NC_003098.1
                                CTATCCTTTGACCAATTGCGGTGAGAGAACAGCTATTTTTAAGGCTATATC
Spr_4   J08   opSpV0100001366                        ref|NC_003098.1|:931945-933708
                                                                   NC_003098.1
                                AACACCGTGCATTTATTACGTAACCGAGCTAGCCTTGACTGGAGGACCAG
Spr_4   J10   opSpV0100001367                        gb|AE007317|:813193-813562
                                                                   AE007317
                                TTACAAAAATGTAAGATTAAAGTCTCTTTTGTAAGGTTAGGTTATGGCAAG
Spr_4   J12   opSpV0100001368                        -             -
                                TTTACCATTTTTGACAGGGAATGTCATTTGCCATCCTAAACTACCTGATAA
Spr_4   J14   opSpV0100001369                        ref|NC_003098.1|:476922-477155
                                                                   NC_003098.1
                                TTTTTCCTAGATTCCAAAACTTTAGATCGGTTGACACCCTATATTCTAGTCT
Spr_4   J16   opSpV0100001370                        ref|NC_003098.1|:1521-2657
                                                                   NC_003098.1
                                ACTTTAACACTACTATTACTTTTAATGTGGTAAACTTACGCCAGTCAATGGA
Spr_4   J18   opSpV0100001371                        -             -
                                TTTTGAAGAGTATGAAACGAAAAGGAGGTTGGTCATTGTACTAGCCTCCTT
Spr_4   J20   opSpV0100001372                        gb|AE007317|:126429-127281
                                                                   AE007317
                                GAGTTATATTTGTAAGTATGTTAACTATTGCTCGAATTTATCGGACTTTTCT
Spr_4   J22   opSpV0100001373                        ref|NC_003098.1|:c1961434-1960988
                                                                   NC_003098.1
                                ATTCAGTTGATATTGTAACAGGGTTTAATATCCCTCTCCTAGTGGAATTAA
Spr_4   J24   opSpV0100001374                        -             -
                                AAAGAGCCAAATTTTAGGACATAAAGATATCTCCATGTTGATTGACGTTTA
Spr_4   L02   opSpV0100001375                        ref|NC_003098.1|:c1197690-1196371
                                                                   NC_003098.1
                                TGTCGGACTTCCAGATCCTAAACCAATTTTTATGTTTCCGATAGTATTCGG
Spr_4   L04   opSpV0100001376                        -             -
                                AAAGATATGCACGTTCTAGTTATCATGACGGATATGACTAACTATTGTGAA
Spr_4   L06   opSpV0100001377                        -             -
                                AAATTTATTAGACGTAATAGAGCAATTTTTGAGTTTGTCAGATGAAAAGCTG
Spr_4   L08   opSpV0100001378                        ref|NC_003098.1|:c1538791-1538258
                                                                   NC_003098.1
                                CCATTCGTAGAAGACGTGAGTGCGACGAATGCCAACACCGTTTTACAACC
Spr_4   L10   opSpV0100001379                        ref|NC_003098.1|:c1802118-1801138
                                                                   NC_003098.1
                                GTAATCAATGATGAAGATGACATGGAGGACAGCAACAGTTTCATGCTGTC
Spr_4   L12   opSpV0100001380                        ref|NC_003098.1|:c1217890-1217153
                                                                   NC_003098.1
                                CCTGATAGCTTTCTGGATACAGGCATGTTGAGCTTCCGTGTGACTCCAAA
Spr_4   L14   opSpV0100001381                        ref|NC_003098.1|:1742209-1742841
                                                                   NC_003098.1
                                GAGGCAGAAGCAGGCTTTAGAACAGGTCGGCCTGGTTTATCTTGACCTAG
Spr_4   L16   opSpV0100001382                        -             -
                                GCTTTACTGACAAAAAAGAAAACAGTTTACAAAGAAAAATGATGGAGGAGC
Spr_4   L18   opSpV0100001383                        -             -
                                GAACGATATTCACAACAAGAGGTCATAGTAACCTTTGGGGAACGGACTTT
Spr_4   L20   opSpV0100001384                        ref|NC_003098.1|:771852-772961
                                                                   NC_003098.1
                                AAATGCGACGATTGCTCGCTATATTAGTGGAGTTTCGATTGACGCAATCAT
Spr_4   L22   opSpV0100001385                        gb|AE007317|:904937-905278
                                                                   AE007317
                                TGTGTGAACCTGCTCATCACATGAAGATGCCTCTTAGTCCCTAGTCTAGCG
Spr_4   L24   opSpV0100001386                        ref|NC_003098.1|:2028093-2030645
                                                                   NC_003098.1
                                CCAAGGGGAAAGGAACTATTACACTTTCCTTCATTCCCAATGGTTTTATTA
Spr_4   N02   opSpV0100001387                        ref|NC_003098.1|:c1422736-1422161
                                                                   NC_003098.1
                                CGTAGAGTGTCTACCGTTATCTTAACAGGTGTCTTGACGGATATCTGTGTC
Spr_4   N04   opSpV0100001388                        ref|NC_003098.1|:978562-978951, ref|NC_0030
                                                                   NC_003098.1
                                CAAGCCGCTAACAGCTGAAGATAAAGCCTGTAACCATGCGCTATCCAAGG
Spr_4   N06   opSpV0100001389                        ref|NC_003098.1|:c1500986-1500534
                                                                   NC_003098.1
                                TGGGTTATCACAATTTTGCGATTTTCTTCCCAGGTGAGCCACATCAGCCAA
Spr_4   N08   opSpV0100001390                        ref|NC_003098.1|:53441-53950
                                                                   NC_003098.1
                                TGAAACAAATCCTGAATTTATAGCATTTTTCTTAGCTCCAAGGTATATCAAT
Spr_4   N10   opSpV0100001391                        ref|NC_003098.1|:c1490244-1489540
                                                                   NC_003098.1
                                TTTATGGGATATTTTCTTTACGACTCAGGCAACCGAGCCGCCCAAATTTGA
Spr_4   N12   opSpV0100001392                        -             -
                                ACATGAGATGCATTTGAAAGGTTGGAGGTATAGAACGAGTCGTTTTGGTT
Spr_4   N14   opSpV0100001393                        ref|NC_003098.1|:c1820917-1819244
                                                                   NC_003098.1
                                AGAGCAGAGAGATGCTTGTTGTAAACTATTATCGGAAGTAGATTCGTACG
Spr_4   N16   opSpV0100001394                        ref|NC_003098.1|:c1115928-1115440
                                                                   NC_003098.1
                                CTTAATCATTTTTCTGAAATTTTCTTATGGGTATTGAAAGATAACAAGCGCG
Spr_4   N18   opSpV0100001395                        -             -
                                GGATAATGAAATGCTTGCTTGCGTTGAAGGTGGAGATATTGATTGGGGAA
Spr_4   N20   opSpV0100001396                        ref|NC_003098.1|:c1369780-1369466
                                                                   NC_003098.1
                                TGGAAGAGTATATAAAGGCAAGCTTGATTCTACGTGAAAATAAGCGCTATT
Spr_4   N22   opSpV0100001397                        ref|NC_003098.1|:c300406-300143
                                                                   NC_003098.1
                                CTTATTTCAGGAGCTGTTTCTCATACAGTTTTACTACTCCTACTCCTCTTTC
Spr_4   N24   opSpV0100001398                        ref|NC_003098.1|:c658490-657297
                                                                   NC_003098.1
                                GGTATGATGGCTACGATTTCCAGTAGCTTTTATGGACAGAAAACCCTCCTC
Spr_4   P02   opSpV0100001399                        gb|AE007317|:1276347-1276850
                                                                   AE007317
                                ATCTCTTGCGCATCAAGGGATTTCGCCATTCTTTAATCTCGTTTAAGTGTT
Spr_4   P04   opSpV0100001400                        ref|NC_003098.1|:c1253826-1253023
                                                                   NC_003098.1
                                AAGTCCTAGATGAAATCGTAGAAACCTCCCTTCGTCAGGCTGCCCTCTGG
Spr_4   P06   opSpV0100001401                        -             -
                                AATGTCAAGCATTCACACCAAAAATTCATCTCTTAAAAGCAAATCCCGATTT
Spr_4   P08   opSpV0100001402                        ref|NC_003098.1|:928882-929079
                                                                   NC_003098.1
                                ACCGATAAAAATAGAATAATGATTAGCTTGGATGATAAAAATCTAGAGAAA
Spr_4   P10   opSpV0100001403                        gb|AE007317|:111937-112224
                                                                   AE007317
                                TGATGGGTTCAGAATAAGAGGTTGGTCGATTGGCAGCCTCTTTCTTGTCG
Spr_4   P12   opSpV0100001404                        ref|NC_003098.1|:c1130674-1127135
                                                                   NC_003098.1
                                GATGCTATCGCTGTAAGCCCAGGTTTCCTTGGGATGGCAGATGAGTTGGT
Spr_4   P14   opSpV0100001405                        ref|NC_003098.1|:236774-238627
                                                                   NC_003098.1
                                CTCTTTGTTAACAAAACGCCAAAAGGTGAATACCGTTACGCTTGGGGAATC
Spr_4   P16   opSpV0100001406                        ref|NC_003098.1|:674561-675904
                                                                   NC_003098.1
                                ATGATTTTTGTTAACACTAAAACGCGTGCTGATGAATTGCATTCATATCTG
Spr_4   P18   opSpV0100001407                        gb|AE007317|:1450629-1450857
                                                                   AE007317
                                CTTCTTTGTCAACAAATTTACTTTCTTGTTTTAAACATGCTATAATAATCATA
Spr_4   P20   opSpV0100001408                        ref|NC_003098.1|:c1170659-1170327
                                                                   NC_003098.1
                                AATTGCACATGTACTCGGACTATATTGTCCGCAGTCAGATTTTTGATCAGA
Spr_4   P22   opSpV0100001409                        ref|NC_003098.1|:c2017924-2017097
                                                                   NC_003098.1
                                AATCAACTAGTAGTCCAAGGGAGCTTTTCTCTCGAAATGATTTAGATCAAA
Spr_4   P24   opSpV0100001410                        -             -
                                TAACTTTTGGGGGGCAGTTCATTCAACACCTGATACTATGCGTTTTTCTTA
Spr_4   B01   EMPTY             -                    -             -
Spr_4   B03   opSpV0100001411                        -             -
                                GACGGAAATTAATGGAGAAAACTACCTTGGTGGTGAAAGACGTGCGGGG
Spr_4   B05   opSpV0100001412                        ref|NC_003098.1|:c749751-749110
                                                                   NC_003098.1
                                GAACCCTAGCAACGCTGCTTCCGATTATTTTTCATCTACAAGGCGTTTCTC
Spr_4   B07   opSpV0100001413                        gb|AE007317|:1753648-1753875
                                                                   AE007317
                                ACAAAATTTAATCCAATACATATTATTTTTTCTTACCGTAACTTCTCAAAGTA
Spr_4   B09   opSpV0100001414                        ref|NC_003098.1|:433829-434407
                                                                   NC_003098.1
                                CTTTGACTTTCCGCTTTTACCAGCGGCATCTTTCCTCAAGATCGAATTTAG
Spr_4   B11   opSpV0100001415                        ref|NC_003098.1|:c1908628-1906865
                                                                   NC_003098.1
                                GTCATTGCCTTTCCTAAGAACAACAAGGCAACTGACCCAATGACACAAGC
Spr_4   B13   opSpV0100001416                        ref|NC_003098.1|:c1414033-1413497
                                                                   NC_003098.1
                                TTTGTATGTAGCTCACGTTGCTTTGCACCAAGTGCACTGGTATATGCATGG
Spr_4   B15   opSpV0100001417                        ref|NC_003098.1|:c1076442-1076140
                                                                   NC_003098.1
                                ATTCCGTATCCCAGCAATGAGCGTTCCAGTATTTGACAATATTAGACTTCC
Spr_4   B17   opSpV0100001418                        gb|AE007317|:611870-612184
                                                                   AE007317
                                GGAATTTTACAAGATTGCAATTTATTTTTGAGTTATCACCATCTCTTTTGTT
Spr_4   B19   opSpV0100001419                        ref|NC_003098.1|:c1190773-1189778
                                                                   NC_003098.1
                                TCTATCATCCTATCTAGTGTAACAGCAGGTGACTATCCTGTAATTATGATT
Spr_4   B21   opSpV0100001420                        ref|NC_003098.1|:c388228-387839
                                                                   NC_003098.1
                                TATCGCTACTGCAAAGGTAGAGGGTGTTCACTCTTTTTCAAACAGATCAGT
Spr_4   B23   opSpV0100001421                        ref|NC_003098.1|:c1586580-1585462
                                                                   NC_003098.1
                                TATGCTAGTATTCGACAGGTCAAATCGTTTCTGTCTCTCAAACTGTCCAAT
Spr_4   D01   opSpV0100001422                        -             -
                                ACAGTTGGAATTAGAAAGTGATAGGTATGAAAAGTGGCGTTGAAGCTGAA
Spr_4   D03   opSpV0100001423                        ref|NC_003098.1|:144765-146381
                                                                   NC_003098.1
                                TTAAAGATGGTTATACAAAGAAAGACAACTGTAGAAACGTTAGCAGGCGCT
Spr_4   D05   opSpV0100001424                        -             -
                                ACTTTCCAACTGAAAGAACTACCTCCAGTGACAAACTTTGAGAAAAACGGT
Spr_4   D07   opSpV0100001425                        gb|AE007317|:1588734-1589002
                                                                   AE007317
                                GATTCTATCTCACTCCCTGATTATTACAAAACCATTGAAATATCACAACTAA
Spr_4   D09   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_4   D11   opSpV0100001426                        ref|NC_003098.1|:c1178466-1177462
                                                                   NC_003098.1
                                TCAGATGTTTTTAGAGACCTGGGACCGCACTAGTCTCGAAGAACAAGAAA
Spr_4   D13   opSpV0100001427                        ref|NC_003098.1|:349310-349456
                                                                   NC_003098.1
                                GAAGCAGCAAAAGACTCTAAAAAAGCAAGGCCCATGGAAGCCTATATGCG
Spr_4   D15   opSpV0100001428                        ref|NC_003098.1|:c1079999-1079271
                                                                   NC_003098.1
                                CATACACCGGTCTATGGTTTGTTACAGCAAGAACGCGGTACATCTGAGCT
Spr_4   D17   opSpV0100001429                        ref|NC_003098.1|:688917-689636
                                                                   NC_003098.1
                                GTCTAGCCACCAAGATGATAGTTTTTCTTCAGGTCTTTTAGAATATCCTCA
Spr_4   D19   opSpV0100001430                        ref|NC_003098.1|:c1568297-1567200
                                                                   NC_003098.1
                                CAGGACGGAATATCAAGCTGCATCCGATTCAGCGTCAGGGGGCAGGTTA
Spr_4   D21   opSpV0100001431                        ref|NC_003098.1|:c1670210-1668093
                                                                   NC_003098.1
                                TGATATGGATGTCATTAAGGCTGCAGGTCTGGTGACAGAAACTCCTGTTA
Spr_4   D23   opSpV0100001432                        ref|NC_003098.1|:c1704876-1704481
                                                                   NC_003098.1
                                ATCATGATTGGGCGTTTAACGTCTACACCAGAATTGCACAAAACCAACAAT
Spr_4   F01   opSpV0100001433                        -             -
                                ACGAGAACAGGACAAATTGATCAGGACAGTCAAATCGATTTCTAACAATGT
Spr_4   F03   opSpV0100001434                        ref|NC_003098.1|:c1146754-1145894
                                                                   NC_003098.1
                                ATGTGTTTTATCCTAAAGCCAATAAACGCTTGCAAGACTACATCGGCAATG
Spr_4   F05   opSpV0100001435                        ref|NC_003098.1|:758322-758966
                                                                   NC_003098.1
                                ATTAATCCAGCTTTGGAGGCTGTAAAATTATTACCATCTGAGATTAATGGG
Spr_4   F07   opSpV0100001436                        ref|NC_003098.1|:c365373-364501
                                                                   NC_003098.1
                                GGCTATCAAGCTGTAGAGCAAACCAGCGGACAAAATCTTCCTTTAATTGG
Spr_4   F09   opSpV0100001437                        ref|NC_003098.1|:c416416-416246
                                                                   NC_003098.1
                                AAGTCCCTAAATTTACTAAAGACACTGCTCAACTTTACACCTGTAAATGGT
Spr_4   F11   opSpV0100001438                        ref|NC_003098.1|:830091-830978
                                                                   NC_003098.1
                                TGCCCTCATGTATCATATTAAGGACTTGTCGGGTATCAATGGGGTTCTGC
Spr_4   F13   opSpV0100001439                        ref|NC_003098.1|:1875369-1876232
                                                                   NC_003098.1
                                TTAGGCAGTGATTGGTCGCCAACGAACATTCCGGCAAGCTATGGTATTTT
Spr_4   F15   opSpV0100001440                        ref|NC_003098.1|:834084-835346
                                                                   NC_003098.1
                                CCTTGCTAGCCATGGCTGATCACTTAGTGGCTGCTACTGAGGAAATTTTA
Spr_4   F17   opSpV0100001441                        gb|AE007317|:87314-87776
                                                                   AE007317
                                CTTGGCAGATGAAAAAGGCTCTGAGCATACTGCAGCAGAGTTGATTGATA
Spr_4   F19   opSpV0100001442                        ref|NC_003098.1|:c1267057-1266335
                                                                   NC_003098.1
                                GGCCTTGATGGGGACAATCCACAGTCTTATCGTTACTTCATGCAAGAAAA
Spr_4   F21   opSpV0100001443                        -             -
                                GAAATTCAATCACCATTACGATTCCAAGTGAATTTAATATTCCAAGTGGTG
Spr_4   F23   opSpV0100001444                        ref|NC_003098.1|:c1727555-1726299
                                                                   NC_003098.1
                                ATAGCCTAGAAGGACACCCAGTTGGGACAGTCTTCATAGGCTTGGCGCAA
Spr_4   H01   opSpV0100001445                        gb|AE007317|:1039845-1040077
                                                                   AE007317
                                GTGTTTTGTATCTCATAGCTCCTTATATAGCTCTTCAGTTATGTAGTATTAA
Spr_4   H03   opSpV0100001446                        ref|NC_003098.1|:c1665693-1664899
                                                                   NC_003098.1
                                AGCCATCAAGTCCAGTCAAGGTGGGAAAATCGGAGTGATTGGAACGCCCA
Spr_4   H05   opSpV0100001447                        ref|NC_003098.1|:259029-260363
                                                                   NC_003098.1
                                ATGTCGGCCAGCTCAGCAACCGTAAGGCTGGCATCCTTGCGACAGATGTT
Spr_4   H07   opSpV0100001448                        ref|NC_003098.1|:338263-339657
                                                                   NC_003098.1
                                ACTAGTGAGCCAAAACCAAGTAGTTCAAATGAGACTAGAAGTAGTCGCAG
Spr_4   H09   opSpV0100001449                        ref|NC_003098.1|:829640-830101
                                                                   NC_003098.1
                                TTGGGTTTGACTCTAATAATCGCGGGTGGTCTTGGAAACTTTATTGACAGG
Spr_4   H11   opSpV0100001450                        ref|NC_003098.1|:c263183-262185
                                                                   NC_003098.1
                                GAAAATCCTGAGCGTAAGTTTGCCATCATCACAGGACTTAACTTACCGATG
Spr_4   H13   opSpV0100001451                        ref|NC_003098.1|:c1569053-1568307
                                                                   NC_003098.1
                                TGCTGAATTTGTCCAAGGCAGGGAAATACGATTTTGTCACGTGTTATTCGG
Spr_4   H15   opSpV0100001452                        ref|NC_003098.1|:227269-229770
                                                                   NC_003098.1
                                TCACTTGCTTTATGCTCGTTTCTGGCATAAATTCCTCTATGACCTCGGTGT
Spr_4   H17   opSpV0100001453                        ref|NC_003098.1|:1021482-1024757
                                                                   NC_003098.1
                                GAGAGAGAAGAGGATGAATCACAAAGGACTGTCTAAGGAGGATATGGGG
Spr_4   H19   opSpV0100001454                        ref|NC_003098.1|:499462-499665
                                                                   NC_003098.1
                                TCAATCTCTATTTAAGTTGGAAAATAGTCAAAGTCTTTTGGATGAGTATGAG
Spr_4   H21   opSpV0100001455                        ref|NC_003098.1|:c113124-112225
                                                                   NC_003098.1
                                AAAGGGGCTGACCCAAGAAGAGGTCTGTGGGGGTGTTCTCTCAAGAACC
Spr_4   H23   opSpV0100001456                        ref|NC_003098.1|:606081-606836
                                                                   NC_003098.1
                                ATTCACCAGATGTTTGAGGTCAATACCTTTGCCCTGATGAATCTGTCTCGT
Spr_4   J01   opSpV0100001457                        ref|NC_003098.1|:c1147527-1146838
                                                                   NC_003098.1
                                TTAGCAGCGGGATTGGGAACTCGCTTGCGTCCTATGACTGAAAATACCCC
Spr_4   J03   opSpV0100001458                        ref|NC_003098.1|:1599747-1600355
                                                                   NC_003098.1
                                CGACATCAAAACTAAAGAACAGCATGAAGCAGACTCAGTAAGCCTTCAAG
Spr_4   J05   opSpV0100001459                        gb|AE007317|:113125-113541
                                                                   AE007317
                                CAGTCCTTGGGCAAAAATCTGCTGTACTACAATGCTTGGAAAGATATCAAG
Spr_4   J07   opSpV0100001460                        -             -
                                ACATTTTTACAAATCTCTATCGTATCTATTGGGTGGCTTGTTCTTTACAGTG
Spr_4   J09   opSpV0100001461                        ref|NC_003098.1|:c992016-991498
                                                                   NC_003098.1
                                AACATGATTTTTCTTGTCTTCCTGAGATTATGTCTTGGGACGTTGAAACAG
Spr_4   J11   opSpV0100001462                        gb|AE007317|:87314-87776
                                                                   AE007317
                                TCAGTATACCCCGTTGTTGGATGCTTATAACAGAGTGACGCCATCACTGG
Spr_4   J13   opSpV0100001463                        ref|NC_003098.1|:c1718382-1718122
                                                                   NC_003098.1
                                GGAGCGCTCTGCCACAGGTGCTCAAGGTTTAAGTAAGTCCATTAAAAAGC
Spr_4   J15   opSpV0100001464                        ref|NC_003098.1|:867599-867832
                                                                   NC_003098.1
                                AGGTGATTTGTTTGAACGCAGTAAAGCTCGCGGTTTTGAAGCTGTAATGC
Spr_4   J17   opSpV0100001465                        ref|NC_003098.1|:c609592-608867
                                                                   NC_003098.1
                                TTGACCGATAACGGTCCCTTGGGCTTTCAGCTCCTCCATCCCCAATATCA
Spr_4   J19   opSpV0100001466                        gb|AE007317|:308158-308452
                                                                   AE007317
                                ATAAAAAAGAAGGAGCCAGCTGAAAAAAACTGGTTCCTTTTTAGGTACGAC
Spr_4   J21   opSpV0100001467                        -             -
                                GAAACAGAGAAAAGAATTGTACCTCTTTCTTGGTCGGACAGCCTTGTATTT
Spr_4   J23   opSpV0100001468                        ref|NC_003098.1|:22635-23921
                                                                   NC_003098.1
                                AAAGCTTATACGAGTCGTGTAGGAGATGGTCCTTTCCCAACTGAGTTGTT
Spr_4   L01   opSpV0100001469                        ref|NC_003098.1|:c418291-417068
                                                                   NC_003098.1
                                GGCTTATCAATACCTGGACATTATAACAAAGACTCCGGAAGTATCATTACA
Spr_4   L03   opSpV0100001470                        ref|NC_003098.1|:1635320-1635901
                                                                   NC_003098.1
                                TAAGAACATCACCATGAACGAAGGCATCTTAACTGCTCAAGTCTACTCCTT
Spr_4   L05   opSpV0100001471                        ref|NC_003098.1|:c94782-93718
                                                                   NC_003098.1
                                TGCTTACTATGGACATATAGCAAGCATTAACAGTCGCTTCCCTGAGCAGC
Spr_4   L07   opSpV0100001472                        ref|NC_003098.1|:c1546355-1545468
                                                                   NC_003098.1
                                AACTTATGGCTTTATCACGACGACTCCAAAACCAAACTGGGCAAATGTAGA
Spr_4   L09   opSpV0100001473                        ref|NC_003098.1|:469762-470499
                                                                   NC_003098.1
                                CGAGACAGCCCTCCTCTATGCCAATAGTCAAGATAGTAAAAGTCTGGCGG
Spr_4   L11   opSpV0100001474                        ref|NC_003098.1|:c1405634-1404855
                                                                   NC_003098.1
                                ACCAGTGCTAGGCAGGTAAAAACGGAAACCTATACTAATACAGTAACAAAT
Spr_4   L13   opSpV0100001475                        ref|NC_003098.1|:682910-684451
                                                                   NC_003098.1
                                GTGTTATGGACTTTGGCATGGATACGGATGTAACTTCTTTGTCAGGTGGG
Spr_4   L15   opSpV0100001476                        ref|NC_003098.1|:845750-846718
                                                                   NC_003098.1
                                GGAGAGAGTCTTGGATTTCTTCCGGGTGATCTTAAGGAGAAGGTGGATCC
Spr_4   L17   opSpV0100001477                        ref|NC_003098.1|:550668-552008
                                                                   NC_003098.1
                                GCCTATTTGATTTCGCTTAATCCATCAAAAATCTTAGACCGCATTGGACGT
Spr_4   L19   opSpV0100001478                        gb|AE007317|:1365469-1365670
                                                                   AE007317
                                AAAGATAATTTTAGCTATTTTGACGCTAAAAAAGGAATAAGTTTCAAGTTCT
Spr_4   L21   opSpV0100001479                        ref|NC_003098.1|:c1337581-1336952
                                                                   NC_003098.1
                                ACAACTCTTTTACGTATGCTTGCAGGTCTTGAAACCATTGATTCAGGGCAA
Spr_4   L23   opSpV0100001480                        gb|AE007317|:495178-495459
                                                                   AE007317
                                GACAGGTCAACGACTTAATGAACTGGAAATCAACGGTATTCGTTTGACTAA
Spr_4   N01   opSpV0100001481                        ref|NC_003098.1|:295819-296637
                                                                   NC_003098.1
                                ACCGTAATTGCTGGTTTGGCAGCGACATCTGTTAAGATTATGGTGCCGAT
Spr_4   N03   opSpV0100001482                        -             -
                                ACATTGTTAGAAATCGATTTGACTGTCCTGATCGATTTGTCCTGTTCTTATT
Spr_4   N05   opSpV0100001483                        ref|NC_003098.1|:c1683624-1682791
                                                                   NC_003098.1
                                TGATTGGCAAATACATTCTATTGATTCTAGGATCGGTTCTGATTTTAGTGC
Spr_4   N07   opSpV0100001484                        ref|NC_003098.1|:c1247577-1246627
                                                                   NC_003098.1
                                AGGATTTATGATCAATGTCGCAGATGGAACGGCCAAAGACTACGAGGACT
Spr_4   N09   opSpV0100001485                        -             -
                                AAGTAGAACAGAACACAGTGCGCGACTTCCCGATTCCTAAGATTCGTGAT
Spr_4   N11   opSpV0100001486                        ref|NC_003098.1|:892369-894930
                                                                   NC_003098.1
                                CATCAAAATCAAGGGGAAAACATTTCAAGCCTTTTACGTGAATTGTATGCT
Spr_4   N13   opSpV0100001487                        ref|NC_003098.1|:386914-387126
                                                                   NC_003098.1
                                AAATGGACAACCAACCTTTTTATCGACTATCTTATCTTTTGTCCTGCCTGTA
Spr_4   N15   opSpV0100001488                        ref|NC_003098.1|:759134-759364
                                                                   NC_003098.1
                                ATCGGAGAAATTGCCGAATTAGACGGACAATTTGCCATTATAAAGAATGGG
Spr_4   N17   opSpV0100001489                        ref|NC_003098.1|:c1967603-1966098
                                                                   NC_003098.1
                                GTTTGGTTATCACCAGTTCGTGCCATTAAACTAGTAGAGCACATCCGCGA
Spr_4   N19   opSpV0100001490                        ref|NC_003098.1|:c1625225-1623066
                                                                   NC_003098.1
                                GGGAATTAGTAACAGCAATTGGCACACACTATCAAACATTGTCGACACAGA
Spr_4   N21   opSpV0100001491                        -             -
                                CCTGTTTCCAAAGAGGCAGCAAGCACAACTCGAAATCACATGATCTTAGTT
Spr_4   N23   opSpV0100001492                        ref|NC_003098.1|:191172-193385
                                                                   NC_003098.1
                                GTAGCCAATGCCCACCAAAAGGGGGATATCCACTATCACGATTTGGACTA
Spr_4   P01   opSpV0100001493                        ref|NC_003098.1|:c1566704-1566450
                                                                   NC_003098.1
                                ACTCAAATATGATTACCAAGGAGCCTGGTCACGGCGTATTGATGCAGAAA
Spr_4   P03   opSpV0100001494                        ref|NC_003098.1|:948960-950183
                                                                   NC_003098.1
                                AAGAAGTTAGTTCGTTGGCTATAGCTAAAGCTAAGAGGAGGGCCTACATT
Spr_4   P05   opSpV0100001495                        -             -
                                ATAGTTTTCTCATCAGAATGAGACTATTTTAATATTAGATCCCCAATTATTC
Spr_4   P07   opSpV0100001496                        ref|NC_003098.1|:c1393733-1392942
                                                                   NC_003098.1
                                AGCATATCAATTACCGACCGTATGGCAGGATGAAGCTAGTAATCAAGGAG
Spr_4   P09   opSpV0100001497                        -             -
                                GCAAGGCGACACTGACGAAGTTTGAATTGGATTTTCGCAGAGTGTAAATT
Spr_4   P11   opSpV0100001498                        ref|NC_003098.1|:c21851-21645
                                                                   NC_003098.1
                                GATTGCTCAGAAGCTAATTGAAAAGACTTCTATGACCGACATTGATCATCA
Spr_4   P13   opSpV0100001499                        gb|AE007317|:281043-281423
                                                                   AE007317
                                GTATGTTATCGTAGAATACGATACAATAGTAAAAAAGCAAAAAGAATGCGT
Spr_4   P15   opSpV0100001500                        ref|NC_003098.1|:782134-783348
                                                                   NC_003098.1
                                GTGCCCACGCTTACCTCAATGGAGCTGATTACACAGCAGTTGCAGAATCT
Spr_4   P17   opSpV0100001501                        -             -
                                GCTCATGAGGTCAGGGGTTTTGTAAGTTACATCTAGTTGAGAGAGGTATG
Spr_4   P19   opSpV0100001502                        ref|NC_003098.1|:c722194-721895
                                                                   NC_003098.1
                                ATTCTGCAGGGAATACAGATGTTATTTTTACCCAAGCTCCGCTTCACTATG
Spr_4   P21   opSpV0100001503                        ref|NC_003098.1|:160263-160877
                                                                   NC_003098.1
                                GAGGGATTATCCTTGGTCTAGCGCCGGCTAGTGCCACCTTGATGAGCTTA
Spr_4   P23   opSpV0100001504                        ref|NC_003098.1|:247994-248464
                                                                   NC_003098.1
                                TCGTAAAAATAGAGCTCCAAAACGTGACGTATTGCCAGATCCGCTATACAA
Spr_5   A01   EMPTY             -                    -             -
Spr_5   A03   opSpV0100001505                        ref|NC_003098.1|:c1536194-1535481
                                                                   NC_003098.1
                                TACCTCAAGAAGCCATTCGCCAGTCTGCTGTTTTCCTTCTCTTTGTCGGAG
Spr_5   A05   opSpV0100001506                        ref|NC_003098.1|:c1406499-1405621
                                                                   NC_003098.1
                                AGGAAACGGGAGGAATTTCGATAACCTATAATGGAAGGTTTAAGCACAAC
Spr_5   A07   opSpV0100001507                        ref|NC_003098.1|:c1897994-1895736
                                                                   NC_003098.1
                                CTTTGTACGTGATCCACAAATACCTTGACATCAAAGCTGGTAACATCCCTG
Spr_5   A09   opSpV0100001508                        ref|NC_003098.1|:c1775429-1774530
                                                                   NC_003098.1
                                ATTGCTCGCCGGCTAGGAGTTCCAGTTTATAGCCTTATGCCGGATTTTTCA
Spr_5   A11   opSpV0100001509                        ref|NC_003098.1|:920239-921264
                                                                   NC_003098.1
                                TAAAAATGGTGCCGTTGCTGTAATTCCAGATAATACACCGTTAGCAGCCTC
Spr_5   A13   opSpV0100001510                        ref|NC_003098.1|:c1607865-1607098
                                                                   NC_003098.1
                                CAACCGCAACTTGACTACCTTTGAGGTCGACTTGCAGACCAGTGTAGATT
Spr_5   A15   opSpV0100001511                        ref|NC_003098.1|:c2011774-2010734
                                                                   NC_003098.1
                                AACAGACGCACAACACTTTGGAGCATACCAACATAACGGTGGACGTATCG
Spr_5   A17   opSpV0100001512                        -             -
                                GAGCAGCAGGTTATCACGTTAGACACATCAATATACACCAATACATTATGG
Spr_5   A19   opSpV0100001513                        ref|NC_003098.1|:c1403417-1403031
                                                                   NC_003098.1
                                TTTATGATTGTATTTGATAAGTTTGTCATTAGTGGAACAATCTCACAAGTAA
Spr_5   A21   opSpV0100001514                        ref|NC_003098.1|:c1650502-1648982
                                                                   NC_003098.1
                                ATTACAGAAAGCCAGATGAGCCAGCTCAACTACCAAGTCGGTGTTGAAGG
Spr_5   A23   opSpV0100001515                        ref|NC_003098.1|:258893-259057
                                                                   NC_003098.1
                                ATTCGAAAAAGGTGAGGGACAATGTCCTCGCCTTTTATGTTTTTTAGTTGC
Spr_5   C01   opSpV0100001516                        -             -
                                TCAAATTATATCGGACATCATCAGTTCTATTAAAAATAAATTGACCGAACGG
Spr_5   C03   opSpV0100001517                        ref|NC_003098.1|:938857-939474
                                                                   NC_003098.1
                                ATGGTAGAAATGTACAATGTTAACTTTACTAATAACGACAAGTTGTACGAG
Spr_5   C05   opSpV0100001518                        -             -
                                TGGTGCTCTCAATTCCATTTATCTACCTCTCTAACAAATACATCATTGATTA
Spr_5   C07   opSpV0100001519                        -             -
                                TCCCAGGTATGGGAGTCAGTGTTAGCTCATTATCACCCAAATCCATTTCTT
Spr_5   C09   opSpV0100001520                        -             -
                                TTATATAGGTGATTTAGTTAGTTTCACTCGATTGATGGCATTAGGATTATCT
Spr_5   C11   opSpV0100001521                        ref|NC_003098.1|:c313462-313115
                                                                   NC_003098.1
                                CACCAAGTAAAAGGAACAAAACCAAGAAAAGTTGATAGAGATAGACTTAAA
Spr_5   C13   opSpV0100001522                        ref|NC_003098.1|:c1581188-1580628
                                                                   NC_003098.1
                                CTTGGCCAACTATTTAAAAGAATGTCGATTCGCTTTACAGATGATGAGGAT
Spr_5   C15   opSpV0100001523                        ref|NC_003098.1|:247561-247974
                                                                   NC_003098.1
                                GTTTGAGCAACCTTATCGAAGTTACTGCCTACATCCCAGGTATCGGACAC
Spr_5   C17   opSpV0100001524                        ref|NC_003098.1|:183696-184265
                                                                   NC_003098.1
                                TTGAAACAAAACTATTGAGCGCAACGGAACTTCAAACAACGACTAGTTTTG
Spr_5   C19   opSpV0100001525                        ref|NC_003098.1|:c352590-352405
                                                                   NC_003098.1
                                AAGCCATTATAGACTATATTGATTATTACAACAACAAGAGAATTAAGGTAAA
Spr_5   C21   opSpV0100001526                        ref|NC_003098.1|:814380-816368
                                                                   NC_003098.1
                                GATACGACTATGATGTTGATTGTGACCTTGTCTATCTGCGCTATCTTCCTC
Spr_5   C23   opSpV0100001527                        ref|NC_003098.1|:c1206701-1206423
                                                                   NC_003098.1
                                TGGACAAGGCTATCGAGCCGAGGGAAAAGAGGGAATACTTACAACCCAAG
Spr_5   E01   opSpV0100001528                        ref|NC_003098.1|:1739650-1741389
                                                                   NC_003098.1
                                CACACACAATATTATTACTATTGCCCGAGAAGGGTACTCTCAAAATTATTTA
Spr_5   E03   opSpV0100001529                        ref|NC_003098.1|:300978-301928
                                                                   NC_003098.1
                                CGTTGATGCGACTTTGGGCGGAGCAGGACATAGCGAGTATTTATTAAGTA
Spr_5   E05   opSpV0100001530                        ref|NC_003098.1|:1280441-1280632
                                                                   NC_003098.1
                                ATATTATTATGGAGATTCTGCCTGGGAACATTTAAGAGCAGTGACCGGTAT
Spr_5   E07   opSpV0100001531                        ref|NC_003098.1|:c1919722-1918865
                                                                   NC_003098.1
                                TACAAATGGAACCAAATTACCGTCTCATCCTGATAGAAATCTAACGCCAGG
Spr_5   E09   opSpV0100001532                        -             -
                                TTTCATTTAAGAAAACTTTAAGACTGTTTAAGTATAAACCGTTTTCATAAAA
Spr_5   E11   opSpV0100001533                        -             -
                                GAAGTATTCTTATTTGAAGAAATTGAAGAAATCGTAGCCCCTACAGATGGT
Spr_5   E13   opSpV0100001534                        ref|NC_003098.1|:1010268-1012196
                                                                   NC_003098.1
                                ATCAACTGATGAAGATTGACCCTTTTGCTGTCAGGTATGAGGCTCGTCCA
Spr_5   E15   opSpV0100001535                        ref|NC_003098.1|:c95807-94845
                                                                   NC_003098.1
                                CTTTGGTGTGGTGACTACCGTTATCGGCTTTATCCTGCTTTTTGTAGGTAT
Spr_5   E17   opSpV0100001536                        ref|NC_003098.1|:c1317547-1316630
                                                                   NC_003098.1
                                GCCTATGACTATGTTCTCAAATGTTCACATACCTTTAATCTGCTTGACGCG
Spr_5   E19   opSpV0100001537                        ref|NC_003098.1|:1737518-1739626
                                                                   NC_003098.1
                                CTTTTAAAGCTTCGGTAAGAGATTTAAAACCGCTCAGTTTCCCACTCATTT
Spr_5   E21   opSpV0100001538                        ref|NC_003098.1|:c1276346-1275624
                                                                   NC_003098.1
                                CTATGTCTGGGAATATTCAAAATAGTGAGCTTTTTAAATTTTTTAACGAAAA
Spr_5   E23   opSpV0100001539                        ref|NC_003098.1|:c1468796-1466904
                                                                   NC_003098.1
                                AACCAAACTTCCTTCCTTTTGGTGTATCGCCAGACTTTATGGATGCTAGAA
Spr_5   G01   opSpV0100001540                        ref|NC_003098.1|:c1093531-1093409
                                                                   NC_003098.1
                                TCGTGATTTTAAATTTGAAACTCTACAACTACATGCTGGTCAAGTTGTGGC
Spr_5   G03   opSpV0100001541                        ref|NC_003098.1|:663874-664752
                                                                   NC_003098.1
                                ATAGCGACGCGGCGCAATTGATGGGGATCAATGTAAACCGTACGATTAGC
Spr_5   G05   opSpV0100001542                        ref|NC_003098.1|:939505-940062
                                                                   NC_003098.1
                                GCTAAGCAAGAGATTGAAAGTCGTTTAGAATTTTTGTTGAACCGTGTCAAT
Spr_5   G07   opSpV0100001543                        ref|NC_003098.1|:c1253010-1252252
                                                                   NC_003098.1
                                CTGGATCCGTGGTGTACAATGGTCACAACATCTACAGTCCGCGTACAGAT
Spr_5   G09   opSpV0100001544                        ref|NC_003098.1|:1600386-1600589
                                                                   NC_003098.1
                                AGTAGAAGAAAAATTAAATCAAGCTAAAGGTTCTATTAAAGAAGGTGTTGG
Spr_5   G11   opSpV0100001545                        ref|NC_003098.1|:c1131617-1131546
                                                                   NC_003098.1
                                CCTTAGTGTAATGGATATCACGTAAGATTCCGGTTCTTGAGATGGGGGTT
Spr_5   G13   opSpV0100001546                        ref|NC_003098.1|:c173759-172659
                                                                   NC_003098.1
                                TGAACCCTGTTGTCACTTCGGGAAAACACCTCCCTGTATAGATGCTATAAT
Spr_5   G15   opSpV0100001547                        ref|NC_003098.1|:c1475099-1472325
                                                                   NC_003098.1
                                TATCTGGCGTCGTCTCAGTTTTACTCATAAGGTAACAGCCCGCAACATCTT
Spr_5   G17   opSpV0100001548                        ref|NC_003098.1|:401195-401551
                                                                   NC_003098.1
                                ATGGTTATATGATTGGATTTCCACAAATCGTTATGAACTTCCTAAAGAGTTT
Spr_5   G19   opSpV0100001549                        ref|NC_003098.1|:c137707-137522
                                                                   NC_003098.1
                                CTCGCTCCCTTGGTTATCTTTGGAGTAGCAGTATCTTGGAAGGCTATTGC
Spr_5   G21   opSpV0100001550                        ref|NC_003098.1|:870251-870718
                                                                   NC_003098.1
                                TAAAAAGGCACGCCACGACTATACAATCGTAGATACGCTAGAGGCAGGGA
Spr_5   G23   opSpV0100001551                        ref|NC_003098.1|:c1379158-1378670
                                                                   NC_003098.1
                                ACAGCAAGAAGCGCTTGCTGTCCTGATTGGTAAAGATGACCATAAGATTTA
Spr_5   I01   opSpV0100001552                        -             -
                                TTCCCCTAGGGAAATGAGCCCTACTGCTAACAAATTTATAACTCTATATCC
Spr_5   I03   opSpV0100001553                        ref|NC_003098.1|:c1555989-1555231
                                                                   NC_003098.1
                                TCGCAGGGGATTGTGGATTGCAATGTCCTTGCCATGCCTGCCGCTATCTT
Spr_5   I05   opSpV0100001554                        ref|NC_003098.1|:1311068-1311991
                                                                   NC_003098.1
                                AAGGTTGCCCAATTTCTTAGGAAAGAGGGGGTGACTTCTGCCTTGATCAA
Spr_5   I07   opSpV0100001555                        ref|NC_003098.1|:c1465475-1465305
                                                                   NC_003098.1
                                TAATTCCAAAATCCAGTCAAGGTACCAGTGTATGTGATACGAGTTCCACCG
Spr_5   I09   opSpV0100001556                        -             -
                                CAGTTCATCTGATGGTCACAGACCCAACCTTTTGGGTAGATCAAGTTCTCG
Spr_5   I11   opSpV0100001557                        gb|AE007317|:359743-359943
                                                                   AE007317
                                ACCAAAAGATATCCAAAGTAGTCTAAAATTGTCTATACTTTATGAGTGTTTT
Spr_5   I13   opSpV0100001558                        ref|NC_003098.1|:c1990255-1989728
                                                                   NC_003098.1
                                GGACAGTGAAGCTTATGCTTGTCAATAATCACAAATATGTAGATCATATCT
Spr_5   I15   opSpV0100001559                        -             -
                                TAAAATAAGGACAAGAGAAAACATGGATATCTATATCCTTGTGCCAAAAAA
Spr_5   I17   opSpV0100001560                        ref|NC_003098.1|:c1325982-1325713, ref|NC_0
                                                                   NC_003098.1
                                AGTTAGACAGAAAAAATCTAACTTTTGGAGTGTTTTTATTATGAAATTAACT
Spr_5   I19   opSpV0100001561                        ref|NC_003098.1|:c997580-996732
                                                                   NC_003098.1
                                GCTGGAGGTACAACTGGCGGAACTGATATTCTAGCTCGTATTCTCAACAA
Spr_5   I21   opSpV0100001562                        ref|NC_003098.1|:c1071532-1070696
                                                                   NC_003098.1
                                TTGAATTATTTCTTGGATTATTTAGACAGATCTAGAGATGATAACCAATCAC
Spr_5   I23   opSpV0100001563                        ref|NC_003098.1|:c1251430-1250615
                                                                   NC_003098.1
                                GCACCCTTTGAATTTCAATCATTGGTTGATGGAAAGAACCAGGTAGTCGG
Spr_5   K01   opSpV0100001564                        ref|NC_003098.1|:c1583990-1583235
                                                                   NC_003098.1
                                CAGTGCTATCTCTCCTGTCACTATCGAGGACAAGGAAACCAGTAAGCATA
Spr_5   K03   opSpV0100001565                        ref|NC_003098.1|:399026-399526
                                                                   NC_003098.1
                                ATTTTGGTTAAGATGTCAGCGCCAGCTGAGAAGAGAGCTGAGATTTTAGC
Spr_5   K05   opSpV0100001566                        -             -
                                TGGTTTAGTAGTTGGTATATTTGGTCCTTATATGGATGACTTAATTAGAAAA
Spr_5   K07   opSpV0100001567                        gb|AE007317|:579912-580122
                                                                   AE007317
                                ATAAGAGACTATTGTCCCAGACTCTTTTCTTTGTATAAAATTGTATAGTGTT
Spr_5   K09   opSpV0100001568                        ref|NC_003098.1|:310667-312274
                                                                   NC_003098.1
                                GCTAGGAATCACAGCAATTTGGCTTTCTCCCGTTTATGACAGCCCTATGG
Spr_5   K11   opSpV0100001569                        ref|NC_003098.1|:1752048-1752118
                                                                   NC_003098.1
                                TATAGCCAAGTGGTAAGGCACGGCTCTGCAAAAGCTTGATCGTCGGTTCA
Spr_5   K13   opSpV0100001570                        ref|NC_003098.1|:c453278-452481
                                                                   NC_003098.1
                                TAAAATGGCATTTTGTCGTTTGGTTTTTAGGTGCAACTGGGGCTCGTGTAA
Spr_5   K15   opSpV0100001571                        ref|NC_003098.1|:600133-601110
                                                                   NC_003098.1
                                TCTATTCAACATCGTTTGGACTTGCTTGGATTGGCAGCAGCGGACTTCCA
Spr_5   K17   opSpV0100001572                        ref|NC_003098.1|:c1087604-1086726
                                                                   NC_003098.1
                                GATGAAGCGATTGCTAGCTTGACTGGGCCTATTACTCAGATTCCCCCTAT
Spr_5   K19   opSpV0100001573                        ref|NC_003098.1|:c1552473-1551199
                                                                   NC_003098.1
                                TCTGCCAGAGAATTAGCCCAGATTATCGTGTCCATCGGTCTTGCTCAAAAT
Spr_5   K21   opSpV0100001574                        ref|NC_003098.1|:1799011-1799886
                                                                   NC_003098.1
                                ATGTCAGTACCTATGTTGGCCAAACCTGCTATGTCGTTCATCGTCTGGAC
Spr_5   K23   opSpV0100001575                        -             -
                                AGATAAGACTGACGAAGTCAGCTCAAAACAGTGTTTTGAGGCTGCAGATG
Spr_5   M01   opSpV0100001576                        -             -
                                ATATAGTATGGAAGGGGACTACAATATAACTCTGGCATTCTTACAGAGCAT
Spr_5   M03   opSpV0100001577                        gb|AE007317|:1682434-1682638
                                                                   AE007317
                                CTCTCCTTTTTCTAATTGAAGCCAAGTCTCATATGATCTGGCTTCATAAATA
Spr_5   M05   opSpV0100001578                        gb|AE007317|:585424-585633
                                                                   AE007317
                                ATACTATGCGCTTTTGTGCTTTGACAGTTTTTTGTATAGTTTTTGTCCAAGA
Spr_5   M07   opSpV0100001579                        ref|NC_003098.1|:c41500-40982
                                                                   NC_003098.1
                                AACATGATTTTTCGCGTCTTCCTGAGATTATGTCTTGGGAGGTTGAAACAG
Spr_5   M09   opSpV0100001580                        ref|NC_003098.1|:c1220528-1219095
                                                                   NC_003098.1
                                AGTTTTGGTGTTCTGGCTCGAGGTTTTCTATTTAACAGTAGCCTCCCTTAC
Spr_5   M11   opSpV0100001581                        ref|NC_003098.1|:c1194503-1194240
                                                                   NC_003098.1
                                GCTAACAGCTGAAGATAAAGCCTATAACCATGCGCTATCTAAGGAGAGAA
Spr_5   M13   opSpV0100001582                        -             -
                                GTTTGATGTATGGAGCTGTAAAAGAGTTACCCAACGTTTACGAAAGAGGT
Spr_5   M15   opSpV0100001583                        -             -
                                TTTCCAGTTTCAAACCACCACGGCTGACATACTTGAGTTTCTCCCCCTTGA
Spr_5   M17   opSpV0100001584                        -             -
                                GAAAACGGGAGCACCTGTCTTAGTTTACCGTTTCCCGAATCTTTATGGGA
Spr_5   M19   opSpV0100001585                        ref|NC_003098.1|:c1882928-1882383
                                                                   NC_003098.1
                                GATTCATGTTCCTGGTCTGGCTTTTACGACGAAAGGATATCGGATAGGAT
Spr_5   M21   opSpV0100001586                        ref|NC_003098.1|:c2019307-2018477
                                                                   NC_003098.1
                                CAGTTAAATTGCAATTGGCAGTTTCAGATGTTACAAGTTGGGTCAGTGTTT
Spr_5   M23   opSpV0100001587                        ref|NC_003098.1|:432843-433385
                                                                   NC_003098.1
                                ATGATGAACATGTCCGCAGTCTCAATGTGTCTAATACCGTCTGCATGATTG
Spr_5   O01   opSpV0100001588                        -             -
                                AAACTGACCTTTCTCCTGCAAAAGAAAAAGGAAAGACTTCCTTTCGTGCCT
Spr_5   O03   opSpV0100001589                        -             -
                                ATTGAGAAATAACATTTCTCAGTTCCCAACTTCCCTTGTGTGAAGTTAATAC
Spr_5   O05   opSpV0100001590                        ref|NC_003098.1|:1717094-1717357, ref|NC_00
                                                                   NC_003098.1
                                AAGATATATCCTCAAGCACAAACTCCACGTAAATCCAGCAAACTCAAGCCG
Spr_5   O07   opSpV0100001591                        ref|NC_003098.1|:537698-539359
                                                                   NC_003098.1
                                TCAGGCAGGTGGGGTTGTCAAATTGATTACCCAAAGTTTACATGTATCAGG
Spr_5   O09   opSpV0100001592                        ref|NC_003098.1|:c466381-466094
                                                                   NC_003098.1
                                TGCAGCCGGAAGTTATCTGGTTACAAAAAATCGCCAAACCATCACAGATG
Spr_5   O11   opSpV0100001593                        ref|NC_003098.1|:759414-759494
                                                                   NC_003098.1
                                AGATAGCGAAGAGGCTAAACGCGGCGGACTGTAAATCCGCTCCTTCGGG
Spr_5   O13   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_5   O15   opSpV0100001594                        ref|NC_003098.1|:662455-663615
                                                                   NC_003098.1
                                CCTTCCTTGACGCTTACCGTGCTAAGTACAATGAAGAGCCTTCAACATTTG
Spr_5   O17   opSpV0100001595                        ref|NC_003098.1|:c1726244-1725078
                                                                   NC_003098.1
                                ACAACACCGGGCGGACGTGCTTTGAAATTCTATGCTTCAGTCCGCTTGGA
Spr_5   O19   opSpV0100001596                        ref|NC_003098.1|:c1392404-1390809
                                                                   NC_003098.1
                                TGTCTATCGGTAATGACATCTATCTCTACACAGGTGTGACGTCGGCTAATG
Spr_5   O21   opSpV0100001597                        gb|AE007317|:403039-403585
                                                                   AE007317
                                GATGGTTTAGATAATCGGGTGTCTGCTTCTAGGCTAGCACCTCAATATCC
Spr_5   O23   opSpV0100001598                        ref|NC_003098.1|:343873-344907
                                                                   NC_003098.1
                                AAATATGTATACAGAGACGACCTTGTCGCCTTTACCAGCCAATGTAACAGC
Spr_5   A02   EMPTY             -                    -             -
Spr_5   A04   opSpV0100001599                        gb|AE007317|:1700356-1700708
                                                                   AE007317
                                TGTGTAAACACAAAAAGGAATAAATCTATTATAGCAGAGTTACAACACATTA
Spr_5   A06   opSpV0100001600                        ref|NC_003098.1|:c1554715-1554515
                                                                   NC_003098.1
                                ACTCTTGTTCAAAGTGGTGTTACGATTTCAAAAACTCATCTTAGTGCTGAG
Spr_5   A08   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_5   A10   opSpV0100001601                        ref|NC_003098.1|:c1126344-1125526
                                                                   NC_003098.1
                                TCAGCCATCTTGGAATCGACCAAAGTCAAGTGATGGCTTGTGGTGACGAG
Spr_5   A12   opSpV0100001602                        ref|NC_003098.1|:1928212-1928781
                                                                   NC_003098.1
                                AAGCTAAAAACAATCTTCCAGAGTCTTTCTGGGAAACCTACTCAGCATTTG
Spr_5   A14   opSpV0100001603                        ref|NC_003098.1|:662105-662353
                                                                   NC_003098.1
                                CATCGTTACTTACAACTCTATGTTCCAACTCAAGAAGTGGAGCAATTGGTC
Spr_5   A16   opSpV0100001604                        ref|NC_003098.1|:608131-608511
                                                                   NC_003098.1
                                TCCACAGAAAACATATCCTTGGTGCACGCAATATTCCTTCAAGTCAGTTGA
Spr_5   A18   opSpV0100001605                        -             -
                                TTTTTAGCGAAAAAAGACTAGCAAACACAAACTGCTAGTCTCTTTGTTATC
Spr_5   A20   opSpV0100001606                        ref|NC_003098.1|:c136468-134636
                                                                   NC_003098.1
                                CTTTGATCCGTGGGAAACTCGAAGAACACGGCCTCTTGCGCAACGCCAAA
Spr_5   A22   opSpV0100001607                        gb|AE007317|:195285-195550
                                                                   AE007317
                                CAGTTTCATCCCAAAAAAACGAAAAAACAGCAACAAATCCCTTGCAATCGC
Spr_5   A24   opSpV0100001608                        ref|NC_003098.1|:c1258384-1257581
                                                                   NC_003098.1
                                GAAGAGCAACTTTCCTTTTCTGATGCCATTACTCAAACCCCTTGGGGCCAC
Spr_5   C02   opSpV0100001609                        ref|NC_003098.1|:c1780025-1779717
                                                                   NC_003098.1
                                CTCTACCATCTAATCTTATTTCTAGTTGCAAAACGAAGTGGGCGTTGGGAT
Spr_5   C04   opSpV0100001610                        ref|NC_003098.1|:828735-829643
                                                                   NC_003098.1
                                TTTATTATTCAGAGAACTTTGTCGATACCAGCGCTAGCTCACAGATGTTTA
Spr_5   C06   opSpV0100001611                        ref|NC_003098.1|:747720-747932, ref|NC_0030
                                                                   NC_003098.1
                                TAATCTTAGGTACATGATTAAATTGATTGATCATTACGGAATAGAGTTCGTC
Spr_5   C08   opSpV0100001612                        ref|NC_003098.1|:580406-581026
                                                                   NC_003098.1
                                AGGCTATCAATGAGCCAGGTGTGGTAGGAATCAATATTGGAATGCGCCCA
Spr_5   C10   opSpV0100001613                        ref|NC_003098.1|:678831-679868
                                                                   NC_003098.1
                                TGGATCAGGCGCGCGATTTGGTGAGAGACTTGACCTTGCAAGGGGAAGA
Spr_5   C12   opSpV0100001614                        ref|NC_003098.1|:c1788467-1788261
                                                                   NC_003098.1
                                TGAGTTTAGTAGTAGCAGGAGTTATGACCTATCTCATGTTTTCGGGATTGG
Spr_5   C14   opSpV0100001615                        ref|NC_003098.1|:c2015427-2014609
                                                                   NC_003098.1
                                TGGAAGCAGGAGTTGACCTTAGATGCAGGTAGATCAAAAGGTGCTTCTGA
Spr_5   C16   opSpV0100001616                        ref|NC_003098.1|:c1461107-1460808
                                                                   NC_003098.1
                                TAGTCTTTATATAAGCGAGGCTAATAGATTGGAGGGCGATGTAACTCTACT
Spr_5   C18   opSpV0100001617                        ref|NC_003098.1|:c510690-509689
                                                                   NC_003098.1
                                TAAAACCTTAAAATTAGTAACTTGGAACGTCGCTAATCAAATAGAAGCACA
Spr_5   C20   opSpV0100001618                        ref|NC_003098.1|:841805-843139
                                                                   NC_003098.1
                                GCGATTGGAAGCTTAGCTCATTACATTACCCATGCCGACAGCAAACATTTC
Spr_5   C22   opSpV0100001619                        ref|NC_003098.1|:929956-930810
                                                                   NC_003098.1
                                GATTACGGTGCTCGGTTTAATGCATGGCTAAACAGCGATAACCGTGAGCC
Spr_5   C24   opSpV0100001620                        ref|NC_003098.1|:c1209981-1208515
                                                                   NC_003098.1
                                ATTTCAAGGTTATGGTAGCACCTCATTCTCCGTATAGCTGCAGTAGAGACT
Spr_5   E02   opSpV0100001621                        ref|NC_003098.1|:c262157-261354
                                                                   NC_003098.1
                                CTTCGTATCGCGCTTCCTGCAGCTCTTCTCCTTATGGTACCAACTGAAACT
Spr_5   E04   opSpV0100001622                        -             -
                                CCGAGGAAACTTCTATGCTGTCTCATCTCAAAAAAGAAGTAGAGACCCATT
Spr_5   E06   opSpV0100001623                        gb|AE007317|:1166915-1167229
                                                                   AE007317
                                CAAAATCATTTTTTTCTGCTATACTATCCTAAGCAAAGGTTTTTAATGTCAT
Spr_5   E08   opSpV0100001624                        ref|NC_003098.1|:c1297631-1296891
                                                                   NC_003098.1
                                AACCCTTGGAATGAAGGCCTTGTTAGAAGAATCGGCCTTTCTGTCACTAG
Spr_5   E10   opSpV0100001625                        ref|NC_003098.1|:185057-185362
                                                                   NC_003098.1
                                AAAAACTATGTTCTTCTAGTACCAGTTAACGCAGAAGAAGACGAAGACGGA
Spr_5   E12   opSpV0100001626                        -             -
                                GATGATATCTGTCACCAAGTGTATCATCACCAAAAATAAAAAAACACAGGA
Spr_5   E14   opSpV0100001627                        ref|NC_003098.1|:941893-943188
                                                                   NC_003098.1
                                ACTGACTTAATCAAAAGCTATAACTGTCAAAAAGTAGGAGTATTAGGTCTA
Spr_5   E16   opSpV0100001628                        ref|NC_003098.1|:c1484405-1483605
                                                                   NC_003098.1
                                GAACAAGAGCCGTGTCTTCCACCAACGTCTCAAATCTACAATTGAGAGTC
Spr_5   E18   opSpV0100001629                        -             -
                                TTATTCTCTTTCCATATGGTATAATATAAGCAGTAAAATCATTTTATACTCTT
Spr_5   E20   opSpV0100001630                        ref|NC_003098.1|:1406614-1407582
                                                                   NC_003098.1
                                GGTTTCAAATCTTCTGTCGGTAACCTTAAAAACTGGGGGCTCGACCTCAA
Spr_5   E22   opSpV0100001631                        ref|NC_003098.1|:804440-804604
                                                                   NC_003098.1
                                ACATTTATTGGCTATGTCCAAAGATACGATATTGATGGGAATGGCTATCAA
Spr_5   E24   opSpV0100001632                        ref|NC_003098.1|:1153665-1154474
                                                                   NC_003098.1
                                AATTGATCAACTAGTCAAAAATGCTGTAACCAACACTCCTCAATATGAAGG
Spr_5   G02   opSpV0100001633                        ref|NC_003098.1|:c1230337-1229171
                                                                   NC_003098.1
                                CAATAAGGACCACCAGAAATGGCTGGACATCATGTCTGCGGAGGACATTG
Spr_5   G04   opSpV0100001634                        -             -
                                GATGTACAGACGTTTGAGAGATTTGAGGGAGGATCATGATCTGCCCCAAA
Spr_5   G06   opSpV0100001635                        ref|NC_003098.1|:707226-707966
                                                                   NC_003098.1
                                TGGGGATTTGATAGTGATACAACGATTTCGGTTGTCGAAGTCTATGTTTCA
Spr_5   G08   opSpV0100001636                        gb|AE007317|:142308-142594
                                                                   AE007317
                                TAGCAATTCTTTGGAGAAGGTCGAGACAAGATAAAATAGGTATCTTTGAGA
Spr_5   G10   opSpV0100001637                        ref|NC_003098.1|:c1143812-1141707
                                                                   NC_003098.1
                                TCAATTTCCGTACTCGAAAAACCATGATGGTTGCCCAACAGCTCTATGAAG
Spr_5   G12   opSpV0100001638                        ref|NC_003098.1|:541544-542776
                                                                   NC_003098.1
                                CAAAAATATGTTATGTTGGAAAGCATAAAACGTGGAATACCTAAATACAAC
Spr_5   G14   opSpV0100001639                        ref|NC_003098.1|:1614153-1614308
                                                                   NC_003098.1
                                GATTTGCTCCCTCTCTCTAAACCAATTATACTACCAATGACTACTGATAAAA
Spr_5   G16   opSpV0100001640                        ref|NC_003098.1|:c1825743-1824217
                                                                   NC_003098.1
                                GCCCATGACGTTTTTTCAGGGTTTGTTAAAGCAACAGTAGGGTATATGTTG
Spr_5   G18   opSpV0100001641                        -             -
                                ATTTTAGCATACTAGTGGCACTCACTTGGAAACGTCGGGAATTTCCACTTG
Spr_5   G20   opSpV0100001642                        ref|NC_003098.1|:c1950203-1949304
                                                                   NC_003098.1
                                TAGCGACTCAGTACCGTGTCAACGAGCAGAGCGTGACAGATGCTTACTAT
Spr_5   G22   opSpV0100001643                        ref|NC_003098.1|:699119-699994
                                                                   NC_003098.1
                                CGTTATTATGAGTGGATGGGAATTTCAAATGTTTTCCTTACAAAAGTTATTC
Spr_5   G24   opSpV0100001644                        ref|NC_003098.1|:1321864-1322925
                                                                   NC_003098.1
                                CTTCTTTTGATTTAGTCTATATCGCCAGTCCAAACTCCTTACATTTTGCTCA
Spr_5   I02   opSpV0100001645                        ref|NC_003098.1|:281424-281600
                                                                   NC_003098.1
                                TGAAAACCGATCCGTTTTTAAGAGTGTTTGGTATGCTTTAAGTACAAATAT
Spr_5   I04   opSpV0100001646                        ref|NC_003098.1|:c1266219-1266019
                                                                   NC_003098.1
                                TTCGCCGTTTCAAACGTGCGGTTACTAAAGCTGGTACTCTTCAAGAAACAC
Spr_5   I06   opSpV0100001647                        ref|NC_003098.1|:c1185491-1185003
                                                                   NC_003098.1
                                GGGATTGATGAAGTAATCGTCTTATCGATATTGAATTTATATGGTTCTATTG
Spr_5   I08   opSpV0100001648                        gb|AE007317|:634520-634964
                                                                   AE007317
                                GATTCCCCAATTGATTTGTTCAGATTCACTATAAATAAAAAATTAATAAGTG
Spr_5   I10   opSpV0100001649                        gb|AE007317|:28366-28582
                                                                   AE007317
                                GCCTTTAGCGATTCCAGTGGTTACGGCTATTGCTCTCTATGGTTATTATCA
Spr_5   I12   opSpV0100001650                        ref|NC_003098.1|:c1828654-1828283
                                                                   NC_003098.1
                                AACTGGGGAATGCCGTCACTAGAAATCAAATTAAGCGACGGATTCGGCAT
Spr_5   I14   opSpV0100001651                        ref|NC_003098.1|:545425-546258
                                                                   NC_003098.1
                                GCAATTGGGATGATCGTGTCCTTGAGGCTTTAGATGGGCAATATGGCTTA
Spr_5   I16   opSpV0100001652                        ref|NC_003098.1|:776031-777983
                                                                   NC_003098.1
                                TGGTGGTGCCTTGTACAAACACTTGATGAGTGGTGTATCTCAAATGTTACC
Spr_5   I18   opSpV0100001653                        gb|AE007317|:668257-668469
                                                                   AE007317
                                AGTATTTATGGACATTTCAGTAATTCGTCAGAAAATTGACGCAAATCGTGA
Spr_5   I20   opSpV0100001654                        ref|NC_003098.1|:845449-845664
                                                                   NC_003098.1
                                AAAATCATTTTACACTTGGCTCATGACCGAGCGCAATCCTAAAAGTAACAG
Spr_5   I22   opSpV0100001655                        ref|NC_003098.1|:1294301-1295008
                                                                   NC_003098.1
                                AATTTTTCCAACGGACAATATTATCCGAATGGAGCGGGTCCGCTATGCCG
Spr_5   I24   opSpV0100001656                        ref|NC_003098.1|:1635901-1637163
                                                                   NC_003098.1
                                TCAACAAATACTTTGGGATTGGACTCCCAGTCGTTCTTGGAGTTGCATTCC
Spr_5   K02   opSpV0100001657                        ref|NC_003098.1|:475926-476159
                                                                   NC_003098.1
                                TGGGGATGTCTCTGATATTTATAGAGGGTACGCTAATCAGAGAAGTCCAT
Spr_5   K04   opSpV0100001658                        ref|NC_003098.1|:682441-682908
                                                                   NC_003098.1
                                TTCTTTTGACTCCTTTCAATTCTCTCTGGAAACTGGGCGAAGTGAGTGACA
Spr_5   K06   opSpV0100001659                        gb|AE007317|:1893493-1893835
                                                                   AE007317
                                AATATGATATAGGCCGTATAAATCAAGTATTTCGATTTTTCCCGCCTCAAAG
Spr_5   K08   opSpV0100001660                        ref|NC_003098.1|:899089-899229
                                                                   NC_003098.1
                                ATCCCCTTATCAATTTGCTCATATTCTATTTCAATCTACGATAGTACCACAT
Spr_5   K10   opSpV0100001661                        ref|NC_003098.1|:98018-99175
                                                                   NC_003098.1
                                TCTAGCATTGTTACCGATCACATTCGTATTCATAACTTTACTATTAGGTGCC
Spr_5   K12   opSpV0100001662                        ref|NC_003098.1|:c1436955-1435804
                                                                   NC_003098.1
                                GAAAAAGGCGAATTCAGATGTTAGGGCTACGCGCTTCTGCAGAGGTCGTT
Spr_5   K14   opSpV0100001663                        ref|NC_003098.1|:c1592140-1590821
                                                                   NC_003098.1
                                GTGGGAATGCCCAGATTACTTCGAGTTAGATGGGAAAGATTGCCTTATTA
Spr_5   K16   opSpV0100001664                        ref|NC_003098.1|:c1139138-1138704
                                                                   NC_003098.1
                                CATTGAAGCGCTCGTTAGCCTAGCCAATATGGATGGTGAGAAAGTCGAAT
Spr_5   K18   opSpV0100001665                        ref|NC_003098.1|:c1372460-1371711
                                                                   NC_003098.1
                                GTTTTCCTAAGAAGGGGTTGATTGTGGATTTCTGTGCTGGGAATGGAGCA
Spr_5   K20   opSpV0100001666                        ref|NC_003098.1|:203327-203863
                                                                   NC_003098.1
                                GAAGCTCCAGAAGGAATTACTTTTGAACTTCCAAACCCAACAACAATCGTT
Spr_5   K22   opSpV0100001667                        ref|NC_003098.1|:c909085-908903
                                                                   NC_003098.1
                                TTTATTTGAAGGACGCACGCTCGAGCAAAAGAAAGCTCTTGCTAAGGAAG
Spr_5   K24   opSpV0100001668                        ref|NC_003098.1|:c1832686-1832180
                                                                   NC_003098.1
                                TCAAGGCTTTTACCTTGTTAGAATCCCTGCTTGCCCTCATTGTCATCAGTG
Spr_5   M02   opSpV0100001669                        -             -
                                TTGATAATATGCGTTTTATTATGGAAATATTTGCTTCATTTTCTCCTGAAAT
Spr_5   M04   opSpV0100001670                        ref|NC_003098.1|:c1261417-1260644
                                                                   NC_003098.1
                                GTAACCAACAATACAACCCGCACTCCAGAGAGTGTTAAGGAGATGTTGGC
Spr_5   M06   opSpV0100001671                        ref|NC_003098.1|:c1661498-1660929
                                                                   NC_003098.1
                                TACTTTAGCAAAAATAGAAGCGCTCTTGTTTGTAGCGGGTGAAGATGGGA
Spr_5   M08   opSpV0100001672                        ref|NC_003098.1|:c137520-137368
                                                                   NC_003098.1
                                TGGTATCGCTTTATTTATGGCAGGTTATACCATTGGAAAAGACCTTCGTAA
Spr_5   M10   opSpV0100001673                        ref|NC_003098.1|:293346-294536
                                                                   NC_003098.1
                                AACGAGACAAGGGTATAGTGATGATTCATGCTGGGCACGTGGTCAATCAT
Spr_5   M12   opSpV0100001674                        ref|NC_003098.1|:c1211866-1210076
                                                                   NC_003098.1
                                CCATTTATGATTATACACGAGTATCATTGAGACAGCAGTTTGGTATGGTGC
Spr_5   M14   opSpV0100001675                        ref|NC_003098.1|:c1723153-1723091
                                                                   NC_003098.1
                                GTTTTGAAGTTCTATCTACAAGCCTAATCGTGACTAAGATTGTCTTCTTTG
Spr_5   M16   opSpV0100001676                        ref|NC_003098.1|:75311-76075
                                                                   NC_003098.1
                                GGTGTGGAGCAGATTATCTCTACTGGGACCTGTGGTGTCCTAGCTGATAT
Spr_5   M18   opSpV0100001677                        -             -
                                AGGGGTTGCCCCTCTTTTTTGGTGGAGGAAAATAGGTTGAATTTGAAATG
Spr_5   M20   opSpV0100001678                        -             -
                                ATTAGAACTACTTCCAGAGGAAGATATCATTGTCACAGGTCTCCCTAAGTA
Spr_5   M22   opSpV0100001679                        ref|NC_003098.1|:c1538257-1537088
                                                                   NC_003098.1
                                CGTTTTTCTTATCTAAAGAATAATCGGGTGTCGCAAGATACCTCATCTCTG
Spr_5   M24   opSpV0100001680                        ref|NC_003098.1|:c1640572-1639091
                                                                   NC_003098.1
                                CGATTGTGGGGGGCTCTATTCTAACTCATGATCATTATCAGGGAGGCCGT
Spr_5   O02   opSpV0100001681                        -             -
                                GGTTTCTGATTAATTCATTTTTTATATATTAAGAGTGATGTGAAATGTTCAA
Spr_5   O04   opSpV0100001682                        ref|NC_003098.1|:c1184276-1184181, ref|NC_0
                                                                   NC_003098.1
                                AGATTTGAAAAAATACGAAGGTGTCATTCCAGCCTTCTACGCATGTTATGA
Spr_5   O06   opSpV0100001683                        ref|NC_003098.1|:c1770282-1769404
                                                                   NC_003098.1
                                AGATTGCTACTGTTAGCCGAGATTGTAAGTTCCGTACTTGTACCCATACCC
Spr_5   O08   opSpV0100001684                        ref|NC_003098.1|:1688996-1689931
                                                                   NC_003098.1
                                CATTCATTCTAGGAAAAGAAGTCACTTTCACACTAGAGCAAAAAGACTACA
Spr_5   O10   opSpV0100001685                        ref|NC_003098.1|:321134-321727
                                                                   NC_003098.1
                                CAATGATTATTGGGCTCTTGAACTCAAACCCAAGTATGCCTTTGTGAACTA
Spr_5   O12   opSpV0100001686                        gb|AE007317|:687164-687577
                                                                   AE007317
                                ACGTTTAGGCAATTCCAAGACTACTTAATCGAACATTAACAGCAGTCTCGG
Spr_5   O14   opSpV0100001687                        ref|NC_003098.1|:c1879584-1879066
                                                                   NC_003098.1
                                TTCTTGATGAGGACTCCTACATACGAAGATGAAACTATCGCCCAAAAGAAA
Spr_5   O16   opSpV0100001688                        ref|NC_003098.1|:784661-785068
                                                                   NC_003098.1
                                TTTACCAAAACTCGCCAGTAGATTATATTTGGAACCAAAACGACGGCTGGT
Spr_5   O18   opSpV0100001689                        ref|NC_003098.1|:515696-518023
                                                                   NC_003098.1
                                AGAAACGCTTTATGCACCACTATAACTTCCCTCAATATTCTGTAGGGGAAA
Spr_5   O20   opSpV0100001690                        ref|NC_003098.1|:506633-507142
                                                                   NC_003098.1
                                ACTTTGTCAACTGAGTTGGGAAATCCTGACTCTGAAACCTATTTCATTATG
Spr_5   O22   opSpV0100001691                        ref|NC_003098.1|:584548-585423
                                                                   NC_003098.1
                                CAAGGCTTATGGCGTCGAAAAGAGTCGTGGACTTATTTCCCATCAGATGC
Spr_5   O24   opSpV0100001692                        ref|NC_003098.1|:2026409-2028031
                                                                   NC_003098.1
                                TTGCTCGTTTCTCTGCCAATGCTTCTAAGTCAAGGCAGGCAACATCACGTA
Spr_5   B02   EMPTY             -                    -             -
Spr_5   B04   opSpV0100001693                        gb|AE007317|:803264-803554
                                                                   AE007317
                                CGAAATCCACGAAAATGAAAACCTTTGTTGTGTTTTCGTAAAAAATTTGTTG
Spr_5   B06   opSpV0100001694                        -             -
                                ATCAAGAATGGGCGAAGATTGAACCCTATTTCTCCAAACACCGCACCTATA
Spr_5   B08   opSpV0100001695                        ref|NC_003098.1|:c624095-623952
                                                                   NC_003098.1
                                TGCGGATGCCTATTCATCTTGGCAAAGGGGAAGTAATGAGAATGCGAATG
Spr_5   B10   opSpV0100001696                        gb|AE007317|:248465-248888
                                                                   AE007317
                                ACCATCTCGTAAGTTGAAACCAACAATAGCATGAAAACATTGAGAACGGGT
Spr_5   B12   opSpV0100001697                        -             -
                                ATAGATAAAAAAACGAACGTTTTTCTTGGAAATATCTTTCTCAAAGACAAAA
Spr_5   B14   opSpV0100001698                        ref|NC_003098.1|:255567-255830
                                                                   NC_003098.1
                                TCGTCAGGCAATTCAATATCAGGGATTACCTTTTGATGTTAGACTAGACGA
Spr_5   B16   opSpV0100001699                        ref|NC_003098.1|:507219-509621
                                                                   NC_003098.1
                                ATGAAATCATCGAACTTTCCATCACACCAAACCGTGCAGATGCCCTTTCTA
Spr_5   B18   opSpV0100001700                        ref|NC_003098.1|:c1465157-1462935
                                                                   NC_003098.1
                                ATTTCAACGGTCAATGCCCAACCAACCAAGGATATGAAGTTTGCTAATATC
Spr_5   B20   opSpV0100001701                        ref|NC_003098.1|:c1105125-1104862
                                                                   NC_003098.1
                                GCTTTGGTTGGTAATCGCGTTGGTCAATGGCGCTATAGAATTGGTAATTAT
Spr_5   B22   opSpV0100001702                        ref|NC_003098.1|:194667-195284
                                                                   NC_003098.1
                                TTAGTAGACCAACTAGTCTCAGAGATCGAGACGGGGAAAGTCAGGACACT
Spr_5   B24   opSpV0100001703                        -             -
                                GCTAAATATCATAAACGCCTTCAAATCGTTCTATTTCGTCTGATGGGCAAA
Spr_5   D02   opSpV0100001704                        -             -
                                TTATTTAGCAAATTACCAGTCTGAAAAGGATTGTAGTAAGGCAAATTTAGA
Spr_5   D04   opSpV0100001705                        ref|NC_003098.1|:1122712-1124199
                                                                   NC_003098.1
                                GATTGATGGCATGAAATACATCTCTTATCGTAGCGAGCCAAATGTGAATCC
Spr_5   D06   opSpV0100001706                        ref|NC_003098.1|:1167230-1168549
                                                                   NC_003098.1
                                GGCTTGGTTGACTTTACACCAGTTCTTAAAGCCAACTGGTTCGAAATTCCT
Spr_5   D08   opSpV0100001707                        ref|NC_003098.1|:c1308367-1307786
                                                                   NC_003098.1
                                GCCATTCTATCTGGCTTACCAGTGTTTGGGACCTGTGCGGGCTTAATTTT
Spr_5   D10   opSpV0100001708                        ref|NC_003098.1|:212409-213158
                                                                   NC_003098.1
                                GATTGTATTTGGTACGTCATGGCAAGACCATGTTTAACACGATTGGTCGC
Spr_5   D12   opSpV0100001709                        ref|NC_003098.1|:c1437824-1437195
                                                                   NC_003098.1
                                TTTTTTGACAAACAGGGTCAATACAAGATTTGGGATCCAGCAGTGTGGAC
Spr_5   D14   opSpV0100001710                        ref|NC_003098.1|:255823-256101
                                                                   NC_003098.1
                                GATCATTCATTGACGGCATCCAAGCATTTTCAAGGAGTTCGTGAATGCCAT
Spr_5   D16   opSpV0100001711                        ref|NC_003098.1|:c878485-878003
                                                                   NC_003098.1
                                TCATCAGGGGATTCAAATCAATGCCCTAGAAGGAGAGCTTCCTCAAGGTT
Spr_5   D18   opSpV0100001712                        ref|NC_003098.1|:202183-202452
                                                                   NC_003098.1
                                CGGCAGGGGACTACGAAGGTTTATCTAAATTACCTCGCAACGCCTCACCG
Spr_5   D20   opSpV0100001713                        -             -
                                AGTAGCTTTTTTCTTATTCAAGTTTACATATTATACTCAATGAAAATCAAATT
Spr_5   D22   opSpV0100001714                        ref|NC_003098.1|:c2018466-2017921
                                                                   NC_003098.1
                                ATGTGGTCAGTAATTTTGGTAAATTTGCAGATCCTATGGCGGATAAGTTAC
Spr_5   D24   opSpV0100001715                        ref|NC_003098.1|:875223-876164
                                                                   NC_003098.1
                                ACCAACGTGTCTTGTCACAAGCAGGTATGACTCTTGAAACACGTAAAGCTC
Spr_5   F02   opSpV0100001716                        ref|NC_003098.1|:1876225-1877040
                                                                   NC_003098.1
                                AAGCCCTTTTATCTGTTAGTGATAGCATGCGTCAAGCAAGTTATGGACTTG
Spr_5   F04   opSpV0100001717                        ref|NC_003098.1|:671374-673554
                                                                   NC_003098.1
                                GTTAGATACAGTACATCCAGCTCGTTTCAAAGTTGGACAAATGATCGGTTC
Spr_5   F06   opSpV0100001718                        ref|NC_003098.1|:902106-903200
                                                                   NC_003098.1
                                ATTCCATGGATTAAACCAGATGTTTTGGAGTATCTCAGAGAACAGACAGAA
Spr_5   F08   opSpV0100001719                        -             -
                                AAATGTTGAAATAGGGAATGAGCCTTTGACTCACTCCCTGTTTCGATATTT
Spr_5   F10   opSpV0100001720                        ref|NC_003098.1|:349534-349788
                                                                   NC_003098.1
                                CTAAGCTAGAGCAGTTAGTCGTGACAAAATCCTGGTGGGACACGGTAGAT
Spr_5   F12   opSpV0100001721                        ref|NC_003098.1|:369089-370411
                                                                   NC_003098.1
                                ACCATCTTCCTTGTACTTTTTGCCTTTACAACGATTCTAGGTTGGAACTATT
Spr_5   F14   opSpV0100001722                        -             -
                                AAAAATTTTATAAAGAACACCAAGTCAAACCCTTCATATCGCCTGAACGAG
Spr_5   F16   opSpV0100001723                        -             -
                                AAAGAAATTCTCCATAGAAGCTCTATCGCAGCCTTTGTGACCTCACGCGC
Spr_5   F18   opSpV0100001724                        ref|NC_003098.1|:1716958-1717089
                                                                   NC_003098.1
                                CAGCGTACCACTTTTGAAGAGATGTTAGCTGTATTAAAAACAGCTTATCAA
Spr_5   F20   opSpV0100001725                        gb|AE007317|:1533022-1533242
                                                                   AE007317
                                AATAACTCTCATCATTTTATTATAGTAGATTGTAATAGAATGTGAACGAATC
Spr_5   F22   opSpV0100001726                        ref|NC_003098.1|:c2031060-2030746
                                                                   NC_003098.1
                                TTAGCAACGTGGAATAGCCGTATAGGAGCTTTTTTCTCACTTATTTTGCTT
Spr_5   F24   opSpV0100001727                        -             -
                                GAGAAGATTCAAGTAAATTACTATACTTCTTTAATTATTTTGAAAATCTACA
Spr_5   H02   opSpV0100001728                        ref|NC_003098.1|:c1911495-1911031
                                                                   NC_003098.1
                                AGTGTATATTGGGCCAGATAACTGGGAAGTTGTGGATGTTGATGAGGAAT
Spr_5   H04   opSpV0100001729                        ref|NC_003098.1|:147932-149104
                                                                   NC_003098.1
                                CTTTTTTCTAACACATTCTTAGCTCTCCGTGTTGCTTTTTTTAATGAACTAG
Spr_5   H06   opSpV0100001730                        ref|NC_003098.1|:c1575032-1574427
                                                                   NC_003098.1
                                GTCTGATGTCATCAATGGCTTTTTCATCCTCTTTGAACGTCAACTGGATGT
Spr_5   H08   opSpV0100001731                        ref|NC_003098.1|:929141-929956
                                                                   NC_003098.1
                                TATCATGTTGGAAAGATGCGCCAATAGCTTATGGACTAGATATCGGTGTTA
Spr_5   H10   opSpV0100001732                        ref|NC_003098.1|:1742999-1743160
                                                                   NC_003098.1
                                TTGAGAAGCCTTGCGATTCTAATTCAGATAAACTGCAAAAAATCTTAATAAT
Spr_5   H12   opSpV0100001733                        ref|NC_003098.1|:c1503010-1502114
                                                                   NC_003098.1
                                AAATTTGAGTTTGTAGGCTTGGATAACTATATCCGTATGTTTAAAGATCCTG
Spr_5   H14   opSpV0100001734                        -             -
                                GGAAGATAAGCCGGCTAAGAAGGTATTTGAATATCAATTAGAACTTGCTGA
Spr_5   H16   opSpV0100001735                        ref|NC_003098.1|:1237343-1238797
                                                                   NC_003098.1
                                TATGCCCTCATTTTGTTACGCCAAGACGGCCTTCCATGTGTCTTTTACGGA
Spr_5   H18   opSpV0100001736                        ref|NC_003098.1|:270868-271680
                                                                   NC_003098.1
                                ATACAGACGACCTCATATTGCCTCATCCTTACATAGCGGAACGCCTTTTTG
Spr_5   H20   opSpV0100001737                        -             -
                                CTGATTATTTTCGTTCTGTATCTAATCATGTCCATCTTTCTATATCCGCTTA
Spr_5   H22   opSpV0100001738                        ref|NC_003098.1|:476191-476880
                                                                   NC_003098.1
                                ATTTATCCATCCTATGCGGTGCATGTGATCAATAATATTGTAGCGACCTTC
Spr_5   H24   opSpV0100001739                        -             -
                                GTTCAAATCCGTCTACCGCCTTCTATAACTTGATTTATCAGGTTTCAAATG
Spr_5   J02   opSpV0100001740                        gb|AE007317|:990438-990698
                                                                   AE007317
                                GGTGTCAAAAAGGAAAACTTCCAAGCGATGATATCCTGTCTATACACGACC
Spr_5   J04   opSpV0100001741                        ref|NC_003098.1|:365759-366307
                                                                   NC_003098.1
                                TTACCTGATTTCAGCCATGGCATCGGCTTTTATGGCTGGCCAGTTTTATAA
Spr_5   J06   opSpV0100001742                        ref|NC_003098.1|:c1607141-1606512
                                                                   NC_003098.1
                                AAAGGTTAAAATTTGTGGACTATCGACCAAAGAAGCGGTGGAAACAGCCG
Spr_5   J08   opSpV0100001743                        ref|NC_003098.1|:428433-429308
                                                                   NC_003098.1
                                ATCATCTGGTGAAGGGAGCCATTGATATTCTGGATGTGCGTTTCGGTTCG
Spr_5   J10   opSpV0100001744                        ref|NC_003098.1|:c1487931-1486672
                                                                   NC_003098.1
                                TTTATCGCAGCAAACACAGATGTACAAGCATTGAGTAGTACAAAAGCTGAG
Spr_5   J12   opSpV0100001745                        gb|AE007317|:795762-795965
                                                                   AE007317
                                ATACAAATGAATAGAAAATAAATTAGTAAGCTGATGAAATTTTTCTCAAGAG
Spr_5   J14   opSpV0100001746                        ref|NC_003098.1|:c1234123-1232951
                                                                   NC_003098.1
                                CAAACGTTCACGAGAATTGTCTCAAGCGCATTTTCAGGCAAATGGGCTCA
Spr_5   J16   opSpV0100001747                        ref|NC_003098.1|:c1518051-1514944
                                                                   NC_003098.1
                                TAGCGACAAGGGGGATCTATACAAGGGTAACCAATTACTAGGCAATATCT
Spr_5   J18   opSpV0100001748                        -             -
                                AGCAGAAGTATTAAATCTTCAATTAGTATCTGTTCAAGTTGACGAAACAGA
Spr_5   J20   opSpV0100001749                        gb|AE007317|:1540721-1541132
                                                                   AE007317
                                GCGTTTTTTGTGAGCTGACTTATTTCCTTTCACTATATCGCAAAATGAAATA
Spr_5   J22   opSpV0100001750                        gb|AE007317|:937305-938135
                                                                   AE007317
                                GCAGTGGTGTTAGAGATTAGTCCTTACTTGATTTGTGATAACTTCCCCAAA
Spr_5   J24   opSpV0100001751                        gb|AE007317|:136551-137367
                                                                   AE007317
                                TATTGCTTGTCATAATTCCATATAGATTTTAAGTCAAGGAGGTTGCCCTATG
Spr_5   L02   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_5   L04   opSpV0100001752                        ref|NC_003098.1|:c387864-387424
                                                                   NC_003098.1
                                TTTTCAAGCTCTCATGAGCCTTGAGTTCGGTACGGATGTCGAAACTGCTTG
Spr_5   L06   opSpV0100001753                        ref|NC_003098.1|:799177-800184
                                                                   NC_003098.1
                                ATCGAAGTTATGGGACGTAACGCTGGTGATATCGCTCTTTGGGCTGGTAT
Spr_5   L08   opSpV0100001754                        ref|NC_003098.1|:c2021870-2020620
                                                                   NC_003098.1
                                ATATGTCAACCAATTGTTTCAGAAGAGGGCAAAGCCACATTATAGAATTGA
Spr_5   L10   opSpV0100001755                        ref|NC_003098.1|:c972018-971764
                                                                   NC_003098.1
                                TTGAAGGCAGAACACAAGCTGTCATCCGAAATCACTTTCTTCGCTACGATA
Spr_5   L12   opSpV0100001756                        ref|NC_003098.1|:597147-598868
                                                                   NC_003098.1
                                GCCAGTTGGTTGGAACAGGATTCCAAAAATCGCTCTGAAAATATGATGATT
Spr_5   L14   opSpV0100001757                        ref|NC_003098.1|:981461-982156
                                                                   NC_003098.1
                                CGCTTAGTAACCAAGAGTTGCTAGCTATTTTACTCAGGACAGGAACACGTC
Spr_5   L16   opSpV0100001758                        gb|AE007317|:1520397-1520711
                                                                   AE007317
                                CAATGCAAGAAAGAAGGATAAATAGAAAGTGAATTTAGATTCTTTACTTTTA
Spr_5   L18   opSpV0100001759                        ref|NC_003098.1|:855261-855848
                                                                   NC_003098.1
                                ACCCCAAGCCAAACCGCCTGTTGCAAAAATTATGGACTACGGTAAGTTCA
Spr_5   L20   opSpV0100001760                        -             -
                                TCACATTCGGTCTCCTTATATAAAAAAGCGATTCATTTTGAACCGCTTTTTC
Spr_5   L22   opSpV0100001761                        -             -
                                AAAACACAACTTCGATGTTACAGACAAAACTGGCAAAATTAGCTCAAAACA
Spr_5   L24   opSpV0100001762                        ref|NC_003098.1|:c1841673-1840531
                                                                   NC_003098.1
                                AACTCAACTGCTGCCTGAAAATAAACCTCGTTATCTGATGGGTGTGGGAG
Spr_5   N02   opSpV0100001763                        ref|NC_003098.1|:c903619-903242
                                                                   NC_003098.1
                                AGTGCTATTATCAATTTTATCTTTGTGGGTACCGCCCTCTTCTTTATTATCA
Spr_5   N04   opSpV0100001764                        ref|NC_003098.1|:c1050328-1049060
                                                                   NC_003098.1
                                TAAAGTAGTGGAGTTTGCTCAGGGGTTAGGTGCAGAAGTCACAGCAGAAG
Spr_5   N06   opSpV0100001765                        ref|NC_003098.1|:c167797-167276
                                                                   NC_003098.1
                                GAATCGGAAGGTTCTAGCAGAAACCGCGAGTCAGACCTACAGCATTGATT
Spr_5   N08   opSpV0100001766                        ref|NC_003098.1|:113542-113775
                                                                   NC_003098.1
                                GACCAGTCAGATTGTGCTGCGGCAGTTGTTTCAACAGTTCTTTTATCTTAC
Spr_5   N10   opSpV0100001767                        ref|NC_003098.1|:874443-875156
                                                                   NC_003098.1
                                ATTATTCCCCATGAAACGGTTGCTTATTTCCGTTTTCTTATGGAAACCATG
Spr_5   N12   opSpV0100001768                        ref|NC_003098.1|:c1567001-1566708
                                                                   NC_003098.1
                                ACTCAACATTCCGAAATCATTTAAAGGACTACATGAAGAAGGTAAATGATG
Spr_5   N14   opSpV0100001769                        -             -
                                AACTATTATCGGACCAATTGTGGTCGGTGTCGTTCTTCGTATAGTCGATAA
Spr_5   N16   opSpV0100001770                        ref|NC_003098.1|:1874313-1875251
                                                                   NC_003098.1
                                TAGTCGAGACACAGTTTTAGATGGTGAATACCCTCTTCAACGTCCCTTCAA
Spr_5   N18   opSpV0100001771                        gb|AE007317|:1590275-1590538
                                                                   AE007317
                                AAGTGGTATCATATAAATATAGAAACGCTGTGGTGTACGACTTCACACTTA
Spr_5   N20   opSpV0100001772                        -             -
                                TCGCAAATGTATTCGCTGGTTTAGTCGGGGCATATGCAGGACAATCTCTT
Spr_5   N22   opSpV0100001773                       ref|NC_003098.1|:c1886193-1885060
                                                                  NC_003098.1
                                GTCTTCGGGCTGGATTACCTCTATGCGTTTGACACTGGCAGGGAGTCTTG
Spr_5   N24   opSpV0100001774                       ref|NC_003098.1|:36977-37747
                                                                  NC_003098.1
                                TCTTGCGAATCAATGATGACGGACTCAGTTACATCGAAGACTATCATGAGG
Spr_5   P02   opSpV0100001775                       ref|NC_003098.1|:783459-784307
                                                                  NC_003098.1
                                TTTTTTCATCTGCAAACTGGCTCCACCAAGAAGCCTTTAACCGCTATTTCG
Spr_5   P04   opSpV0100001776                       ref|NC_003098.1|:25158-25736
                                                                  NC_003098.1
                                ACGGCTTCGTATGTGGTCTGTGCTACGGGTCTTCCTTTAAGAGTAGAGCC
Spr_5   P06   opSpV0100001777                       ref|NC_003098.1|:693198-694397
                                                                  NC_003098.1
                                CTAGTCCAGCAGCCGGGAATAATACAGGTTCTAAATACCCTTATACTATTG
Spr_5   P08   opSpV0100001778                       ref|NC_003098.1|:c1321121-1319730
                                                                  NC_003098.1
                                ACTGATACTGAGGATGTGCTAACTAAAGTGCTGGGTTCTAGTTCTAAACTC
Spr_5   P10   opSpV0100001779                       ref|NC_003098.1|:c1975660-1974482
                                                                  NC_003098.1
                                TACTGGTAGGAATGTTTACCGTAATGCAATCCGTAGCGCCTTTGGTGACC
Spr_5   P12   opSpV0100001780                       ref|NC_003098.1|:491701-494352
                                                                  NC_003098.1
                                CAAGACACAGAGGACAAGGTCGAATTCTACCCACCTCGTTTCAACGATAC
Spr_5   P14   opSpV0100001781                       ref|NC_003098.1|:1162971-1164497
                                                                  NC_003098.1
                                CTAGTAGAGCATTTAGACTATGATAGCTATAGTGAGCAGAGAAAGGCTAAT
Spr_5   P16   opSpV0100001782                       gb|AE007317|:556072-556332
                                                                  AE007317
                                GTTGAAGACACTATGTCTCAACTTTTTTTGATGTACGACGGGCATGTCGTA
Spr_5   P18   opSpV0100001783                       ref|NC_003098.1|:818663-820138
                                                                  NC_003098.1
                                TATATCCAATTCGCCAAGGAACGTGGTTGCTCCCTCCAAGGGACGGAAGA
Spr_5   P20   opSpV0100001784                       ref|NC_003098.1|:c1141149-1140517
                                                                  NC_003098.1
                                AACTACGATACAACCATCATGACCATGATTCGGCCACGTGGTGGTGACTT
Spr_5   P22   opSpV0100001785                       ref|NC_003098.1|:c1479381-1479193
                                                                  NC_003098.1
                                GGTTAAATAATGAAGATAGAATAGAAACAACCAAAAACAATGTGATTGCCA
Spr_5   P24   opSpV0100001786                       ref|NC_003098.1|:c1663437-1662976
                                                                  NC_003098.1
                                TATGACAAAAACGGACGTAGCGGTTGTTTCGCCTGATTTCACCATTACGG
Spr_5   B01   EMPTY             -                   -             -
Spr_5   B03   opSpV0100001787                       ref|NC_003098.1|:c1050805-1050341
                                                                  NC_003098.1
                                AATTTACACCAGATTTAGACTGGTACACCTATGTTTTTAAGGTGACGGAGT
Spr_5   B05   opSpV0100001788                       ref|NC_003098.1|:c140970-140419
                                                                  NC_003098.1
                                CACCATGGACATGTACAGCCCTTATTATCGGCTCGCTAAGCAACTCTTTCC
Spr_5   B07   opSpV0100001789                       ref|NC_003098.1|:863847-864746
                                                                  NC_003098.1
                                GCCATCATGAGTGACAAGGCGCAGACAACGCGCAATAAAATCATGGGAAT
Spr_5   B09   opSpV0100001790                       ref|NC_003098.1|:c1207704-1207321
                                                                  NC_003098.1
                                TGCAGGCGACAAAAAAGTTGGCGTTATCAAAGTTGTACGTGAAATCACTG
Spr_5   B11   opSpV0100001791                       ref|NC_003098.1|:c995285-995115
                                                                  NC_003098.1
                                TCCAACAACTCCCATCTAGTGTGCTTCAGACTGGGCTATTTTTCTCTCCAT
Spr_5   B13   opSpV0100001792                       ref|NC_003098.1|:366411-368747
                                                                  NC_003098.1
                                TTGTCATTACAGGTCCCAATACAGGTGGGAAGACCATCATGCTCAAAACTC
Spr_5   B15   opSpV0100001793                       ref|NC_003098.1|:765917-767179
                                                                  NC_003098.1
                                AGTTATCTGGAGCGTTTAGAGTCACGCGGTGAAGGAAGTGACAAAGCAAC
Spr_5   B17   opSpV0100001794                       ref|NC_003098.1|:c1923403-1921373
                                                                  NC_003098.1
                                AACCTATCAGGTTAGTTCGCAAAAATTAGGATGGAAGGAGGCGATTCGTT
Spr_5   B19   opSpV0100001795                       ref|NC_003098.1|:121084-122142
                                                                  NC_003098.1
                                TTCGGAATTACAAGATGGTTCTTTCGAGGGCGGTATACAAGATGCTGTTG
Spr_5   B21   opSpV0100001796                       ref|NC_003098.1|:1671890-1672417
                                                                  NC_003098.1
                                GTTTCACTTTCAGAATAAGGAACCGGAGAAATTTTTCGGATTCATTGAGGA
Spr_5   B23   opSpV0100001797                       ref|NC_003098.1|:827547-827768
                                                                  NC_003098.1
                                CTAATGGTAGGTACGATTGGGAAATAGAACCAGTATTAACTCTGCCGGTT
Spr_5   D01   opSpV0100001798                       ref|NC_003098.1|:c1161670-1161041
                                                                  NC_003098.1
                                TGTAGCGACAGAGAGTGAGATTGCTTCACATATTTCTCGCTTGGGATTGT
Spr_5   D03   opSpV0100001799                       ref|NC_003098.1|:c1835946-1835575
                                                                  NC_003098.1
                                AAGTAGAAGCGACTTGATGACCATTTTTTGGGACCCGGAAGACCAACGCT
Spr_5   D05   opSpV0100001800                       ref|NC_003098.1|:c972563-972009
                                                                  NC_003098.1
                                ACCATCATTAGAAAAATTCATATGGAACAATTACATTTTATCACAAAACTGC
Spr_5   D07   opSpV0100001801                       gb|AE007317|:919847-920238
                                                                  AE007317
                                ATGAATGATGTAGCAATAATCCTTGAAACAAAATCAGAAGAAAGAGATATT
Spr_5   D09   opSpV0100001802                       ref|NC_003098.1|:1732032-1732256
                                                                  NC_003098.1
                                ATTGTCTGCTGATGAAATGAGTTTAATTTATGGTGCATCTGATGGTGCAGA
Spr_5   D11   opSpV0100001803                       -             -
                                GCTATTACGAAAATCACAGCTACGATAAAGCAATGTAAGGAGTACAGGAC
Spr_5   D13   opSpV0100001804                       -             -
                                GTGGTTACAATCCGGCTATAAATCTATCAAAACAGACAAGGCTATTCTTTC
Spr_5   D15   opSpV0100001805                       ref|NC_003098.1|:143802-144755
                                                                  NC_003098.1
                                ATCCCTTGTTTGTTCAAATGGTTCACAATATAGCAGGTACGTCATTTTGGT
Spr_5   D17   opSpV0100001806                       ref|NC_003098.1|:c1195307-1195086
                                                                  NC_003098.1
                                GGGAAATAAAGGTGGTTGTACCATCCAATTGATTCATCACTTTCCTTTTGG
Spr_5   D19   opSpV0100001807                       ref|NC_003098.1|:c1205739-1205152
                                                                  NC_003098.1
                                CAACAAGTAAATGTCCTATTGGTATCTCTATACTTATTGAAATTTCTTTGTA
Spr_5   D21   opSpV0100001808                       -             -
                                CAATCGGGAAAGATACTCGTAAGGAACTGGTAACAGTGGTTAAAAATAACA
Spr_5   D23   opSpV0100001809                       gb|AE007317|:619396-619724
                                                                  AE007317
                                GCGGACTGAGGGACTAGAGTATGTTTTACTTAGCCCCTCTTTTATTTATTA
Spr_5   F01   opSpV0100001810                       ref|NC_003098.1|:c1786460-1785363
                                                                  NC_003098.1
                                CAGATGGAGGCTTATCCACAGGTGGAAAAGGAATTAAAAGAAATTCACCA
Spr_5   F03   opSpV0100001811                       ref|NC_003098.1|:723532-723708
                                                                  NC_003098.1
                                ATCCTATTGAGAAAACATGGGCTCATATCAAAAAGCACCTCATAAAAGGTA
Spr_5   F05   opSpV0100001812                       ref|NC_003098.1|:c923156-922743
                                                                  NC_003098.1
                                TAAAATTCCAACCAATCCAGCTAATATTGGGCTTCTTTTCTTGCCAATATTT
Spr_5   F07   opSpV0100001813                       gb|AE007317|:74337-74551
                                                                  AE007317
                                TGTTTTGAGACGATATGTGCAAAGGTCTATTAACTATTAGAATAGTTTAATG
Spr_5   F09   opSpV0100001814                       ref|NC_003098.1|:c1494205-1493609
                                                                  NC_003098.1
                                AGTTGATTGACAGTTATTCTAAGTTACCAGGTATCGGGATTAAGACGGCTA
Spr_5   F11   opSpV0100001815                       ref|NC_003098.1|:c178148-177444
                                                                  NC_003098.1
                                ATGATTATGGACTCAGCTCTTTTCATCACTAGCCTCTTTGCCCTTGTCAGC
Spr_5   F13   opSpV0100001816                       ref|NC_003098.1|:c142307-142041
                                                                  NC_003098.1
                                GCTGAATTCAACTGTCCTCCAACAACTATTCATTACGCTCTAAAGGCTATG
Spr_5   F15   opSpV0100001817                       ref|NC_003098.1|:c177189-176158
                                                                  NC_003098.1
                                AAGAATTTCAGAAATCCGCCCTAGTGACGTTTGGTATGAGGAACGAACTG
Spr_5   F17   opSpV0100001818                       ref|NC_003098.1|:525639-527018
                                                                  NC_003098.1
                                CCCTGCTCTAGTTTCTGCTTACTTCCTAGCTAATTACACTGCCCGTGCAAT
Spr_5   F19   opSpV0100001819                       ref|NC_003098.1|:856499-856930
                                                                  NC_003098.1
                                GTTTTAAAGAATTGCGTCGCAGAGATTTTCCAGACCATGCCTTCACGATTG
Spr_5   F21   opSpV0100001820                       gb|AE007317|:1544117-1544530
                                                                  AE007317
                                TTTAGGGAAAATGACTATTCGAAAGCGCGAATGCCTCAAAATTATCTCAGA
Spr_5   F23   opSpV0100001821                       -             -
                                TACGAAAATGACGAAAAAAGTCAAAAAAAATTAAAAATAGGTCGCAAGTCG
Spr_5   H01   opSpV0100001822                       ref|NC_003098.1|:785081-786247
                                                                  NC_003098.1
                                AATGGAGTGGGAGCAGCCGCAACCTTTAAACTTGAGACAGAAGACGATAT
Spr_5   H03   opSpV0100001823                       -             -
                                ACTCTTCGAAAATCAAATTCAAACCACGTCAACGTCGCCTTGCCGTATATA
Spr_5   H05   opSpV0100001824                        ref|NC_003098.1|:c1184090-1183359, ref|NC_0
                                                                   NC_003098.1
                                ATACTGGAACGATATCAGTTCTGCAGCTCCAAACACAGACTACGTGATTTA
Spr_5   H07   opSpV0100001825                        ref|NC_003098.1|:395489-397156
                                                                   NC_003098.1
                                TAGCGGAAGCGTCACAACAGCCGTGCGTGATACAACGATCGATGGCTTAG
Spr_5   H09   opSpV0100001826                        ref|NC_003098.1|:c1518521-1518294
                                                                   NC_003098.1
                                TCTTCACTTATTTGGGATTGTCCCCTTTAAGCTGGATAAGATTCTGATTGT
Spr_5   H11   opSpV0100001827                        -             -
                                AAAATGGCAGTAACTTCCCCAGTTCGTGCCCAGTCACGTGTACCTTTTAG
Spr_5   H13   opSpV0100001828                        ref|NC_003098.1|:19924-20038, ref|NC_003098
                                                                   NC_003098.1
                                TGACGATAGCCTAGGAGATACACCTGTACCCATGCCGAACACAGAAGTTA
Spr_5   H15   opSpV0100001829                        -             -
                                TGTAATTCAGGTCGAAAAATTGCCAGTTGAGGAGATGGGCTATAAAATAG
Spr_5   H17   opSpV0100001830                        ref|NC_003098.1|:282002-284215
                                                                   NC_003098.1
                                CTACAAACTAGATGGCTACAGTTTGGTGTTTTTAGTCCGATTACTCGATTA
Spr_5   H19   opSpV0100001831                        ref|NC_003098.1|:c1343801-1342395
                                                                   NC_003098.1
                                ACTTGCTACGGAAATGGGTCAATTGCAAGAACGTATCACATCAACCAAGAA
Spr_5   H21   opSpV0100001832                        ref|NC_003098.1|:603262-604500
                                                                   NC_003098.1
                                AGGATTTCACGCCTACCCAAACGCCATATACCCTCATTTCTGCCAAGTCTG
Spr_5   H23   opSpV0100001833                        ref|NC_003098.1|:1804233-1805543
                                                                   NC_003098.1
                                TCTTTTGTGTGATAGCCGGAGTGATGTCACTCTTTAGTTCCACCCTATCCG
Spr_5   J01   opSpV0100001834                        ref|NC_003098.1|:c1973932-1972466
                                                                   NC_003098.1
                                CAACAAGTCTCGCTTTATCGAATCTGCTGTCGCAGTACCGCGCTATAACA
Spr_5   J03   opSpV0100001835                        ref|NC_003098.1|:591447-597077
                                                                   NC_003098.1
                                TATCAGGTGACATCCTCAAAACGCTTGGCTTGGACACTGTTTTAGAAGAAA
Spr_5   J05   opSpV0100001836                        ref|NC_003098.1|:784329-784664
                                                                   NC_003098.1
                                TCTTAACCGTGAAATGTACCTTAACCGTTATGGACATGGTGGGATTCCAGT
Spr_5   J07   opSpV0100001837                        ref|NC_003098.1|:c1782077-1780659
                                                                   NC_003098.1
                                TCGTTCCCTCTGTTTTAACTCGGACGGTGAGTCAGTCTTTTAATCGCATGG
Spr_5   J09   opSpV0100001838                        ref|NC_003098.1|:589055-590746
                                                                   NC_003098.1
                                ATGGTAGCTATTCGTAGCCAGGAAGAAACGACCCGTCAGTACCAACTTCA
Spr_5   J11   opSpV0100001839                        ref|NC_003098.1|:c1972469-1971225
                                                                   NC_003098.1
                                TATCATGTGGGGCTTTTTGTATAAGTTTATCCTAGCTCATGTTTTAGGAGA
Spr_5   J13   opSpV0100001840                        ref|NC_003098.1|:1121823-1122563
                                                                   NC_003098.1
                                ACTTCAACCTCTTCCCTCATATGTCTGTATTGGACAACATCACCTTTGCTC
Spr_5   J15   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_5   J17   opSpV0100001841                        -             -
                                CAGCTATAATATAGAATCATTTTCACCTAAAAAGATAATTAATCACACCCTA
Spr_5   J19   opSpV0100001842                        -             -
                                GAGACGGTAGGAATCATTGAACATAACCTAGCCAACATCAATCACAATCAT
Spr_5   J21   opSpV0100001843                        ref|NC_003098.1|:c1587797-1587345
                                                                   NC_003098.1
                                TCGGAGTGGCTAGGGATAACTGTTGCAGATTTGATAGAGAGTGATGGAGA
Spr_5   J23   opSpV0100001844                        -             -
                                CTCTTGGGTTCACCGATAGATGATCGGCACGTAGGCCTTGCACATCAGAT
Spr_5   L01   opSpV0100001845                        ref|NC_003098.1|:161830-162525
                                                                   NC_003098.1
                                AAAGGCAGTCTATCGGGATTGTCAATGTACACGAGCGTTTTGTGCTCTAT
Spr_5   L03   opSpV0100001846                        ref|NC_003098.1|:c1754700-1753876
                                                                   NC_003098.1
                                TGTCCGTTACCGTGTAACCCTTTACTACGCTTCAAACGAGGATTTAGTTCC
Spr_5   L05   opSpV0100001847                        ref|NC_003098.1|:c1195921-1195742
                                                                   NC_003098.1
                                GTGTTTTTGGGGCTGAGAGAAGTATCTTGATTTTATGTGTGGTTTTTATAC
Spr_5   L07   opSpV0100001848                        ref|NC_003098.1|:20044-20117, ref|NC_003098
                                                                   NC_003098.1
                                CCATAGCTCAGTTGGTAGTAGCGCATGACTGTTAATCATGATGTCGTAGG
Spr_5   L09   opSpV0100001849                        -             -
                                CCTATAAATTGCCTCGAGAAAATAGATATAGCATAAAATTATTGGTGAAGG
Spr_5   L11   opSpV0100001850                        gb|AE007317|:14899-15160
                                                                   AE007317
                                CTTGAGAGAAGCAAGTGACAAAGACCTTTGAAAACTGAACAAGACGAACC
Spr_5   L13   opSpV0100001851                        ref|NC_003098.1|:c1847737-1846457
                                                                   NC_003098.1
                                GTATATATGTCTTGGGTGTACCATTAACTCATCTCTATACGACTGATTCTC
Spr_5   L15   opSpV0100001852                        ref|NC_003098.1|:c1861387-1860650
                                                                   NC_003098.1
                                AAGAAATCGAAGGTCACTGGCAAGGACTACCTTTCGGGACATCTCACTCT
Spr_5   L17   opSpV0100001853                        ref|NC_003098.1|:c579911-579666
                                                                   NC_003098.1
                                CATGCCTTTGATCGCCCGTCTTATCACCTTAAAATGCTTGTATCTACTCTT
Spr_5   L19   opSpV0100001854                        -             -
                                AAAGTGTGATGCGTCCATCTTGGTAACAGCAACAGGTGAGGCGAATAAAC
Spr_5   L21   opSpV0100001855                        ref|NC_003098.1|:242225-243274
                                                                   NC_003098.1
                                AAGTTTATCCTCGTCCAGTTCAGGACAAATTGCCCTTGTGGATAGCTACAG
Spr_5   L23   opSpV0100001856                        -             -
                                CATCAATTCATTTTTGATATTCCGCTCGAACCACTGCCACTAATTTTACACT
Spr_5   N01   opSpV0100001857                        ref|NC_003098.1|:c1723025-1722069
                                                                   NC_003098.1
                                AAAACGCACGAGTATTGCACGAATAACCAACCAAACAACCACTCAGACCA
Spr_5   N03   opSpV0100001858                        ref|NC_003098.1|:481597-481896
                                                                   NC_003098.1
                                GTAGAAATTGTAACCGTGTTTTCAACACTGGAATTAAGCATAGCAGTCGGG
Spr_5   N05   opSpV0100001859                        ref|NC_003098.1|:1455671-1456744
                                                                   NC_003098.1
                                TATTACGACCTTCCCTTGAATGAGTTAGACATTCTAACCTTAATAGAAATCA
Spr_5   N07   opSpV0100001860                        -             -
                                AGAGAGAACTGTTTCTAATCTTCTCAAATGTCTCTTTAAGACGCTAAACAA
Spr_5   N09   opSpV0100001861                        -             -
                                GAAACTTTCAACATCATGTCTTAGTGATTACTAGATTAAAATCACCTATCAG
Spr_5   N11   opSpV0100001862                        ref|NC_003098.1|:c1300034-1299522
                                                                   NC_003098.1
                                TTTATACGCACGAACCACGTGATCAGGCTCCGCTGGTCATTAAGGAAGTG
Spr_5   N13   opSpV0100001863                        ref|NC_003098.1|:c1785361-1784762
                                                                   NC_003098.1
                                CAAGAATGGGCAAGAAGCAATCCAACTATTAGAAAAGGAGTCTGTAGATA
Spr_5   N15   opSpV0100001864                        ref|NC_003098.1|:926056-927735
                                                                   NC_003098.1
                                GACGGCAAGCTGTTTATAAATGAGGAAGAGGCAGTTGCAATAAGAACGAT
Spr_5   N17   opSpV0100001865                        ref|NC_003098.1|:c1306046-1305516
                                                                   NC_003098.1
                                AGTTATTGCTTGCTTAGATGATTACTTTAAAGGCAAGCCTCAGGATTTATC
Spr_5   N19   opSpV0100001866                        ref|NC_003098.1|:971016-971174
                                                                   NC_003098.1
                                ATTTTGTTTCCGCCGCAGACGTTTGGAATGAAAAGAAATTGGAAGAACTAT
Spr_5   N21   opSpV0100001867                        -             -
                                ATTAGTCTGTAAACAAGGACCTAAAACAAATATTGTATGGGTATAAAAATCT
Spr_5   N23   opSpV0100001868                        ref|NC_003098.1|:612185-612532
                                                                   NC_003098.1
                                GAGTATGGACATATGGAGAAGGTTCAGGAGGTGGTTGGGCTTTTTCAAAT
Spr_5   P01   opSpV0100001869                        gb|AE007317|:1310775-1311067
                                                                   AE007317
                                TTTCCTGCCTTCATTCTAAATTTACCTTACTAGTATACCATTTACCGTTAGC
Spr_5   P03   opSpV0100001870                        gb|AE007317|:1655616-1656022
                                                                   AE007317
                                CTACCTATTTCAAGAAGACAGTTCTTCTCAAATCTTTAACTTAGGAACTAAA
Spr_5   P05   opSpV0100001871                        ref|NC_003098.1|:1457631-1457825
                                                                   NC_003098.1
                                TTTAGTTGTAATGTCAATCGTTACCACTTTTCAACCAGTCGTCTAACTCCC
Spr_5   P07   opSpV0100001872                        gb|AE007317|:1998757-1999011
                                                                   AE007317
                                GATAGCGCAAAATAAGAAAAATGTCAAGGAAACTGCTTACAGAAAAGAGCA
Spr_5   P09   opSpV0100001873                        -             -
                                AATTATTTTTAGCAATTTGATTTTGAAAGTGTCATGCAGCAATATGAAAGCG
Spr_5   P11   opSpV0100001874                        ref|NC_003098.1|:778069-780372
                                                                   NC_003098.1
                                TAATTTAATTCGCTTGCTAGTGGGTAGCCTAGCTTATCTGGCGATATTCGG
Spr_5   P13   opSpV0100001875                       ref|NC_003098.1|:313695-314657
                                                                  NC_003098.1
                                ATCCTTGCTTTTAGATATCTTAATCTAGTGGTAACTGCGTTAGTCCTACTAG
Spr_5   P15   opSpV0100001876                       gb|AE007317|:685735-686481
                                                                  AE007317
                                GAAAAAGTGGGAAAACATTGATTCTAAGCGAATTTTGAATCATATTCGAAT
Spr_5   P17   opSpV0100001877                       ref|NC_003098.1|:117728-118108
                                                                  NC_003098.1
                                AATAATTAAACATGTAGGTAGTGCAGCTGGCCATTTAGTCAATACTGCACT
Spr_5   P19   opSpV0100001878                       ref|NC_003098.1|:c1756203-1754920
                                                                  NC_003098.1
                                TCTAAAAGCTGTTCATGTGAAAACCTTGCCCCACCCAGGATTTCCAACAGA
Spr_5   P21   opSpV0100001879                       -             -
                                TATCAGGGAGTTGTTTTTTTCTGTATTATAGTAGGTTGAAGTTGAAATAGC
Spr_5   P23   opSpV0100001880                       ref|NC_003098.1|:1016262-1016591
                                                                  NC_003098.1
                                GAGATTAGCAAAATCCCTTGGTATTGCCTATTTCACTGCCAACCAGCTTGA
Spr_6   A01   EMPTY             -                   -             -
Spr_6   A03   opSpV0100001881                       gb|AE007317|:1328161-1328398
                                                                  AE007317
                                TATAGATAGACAGTAGGCAATACAGTCTAACTTTCCTTACTATTTTATCAAA
Spr_6   A05   opSpV0100001882                       ref|NC_003098.1|:599026-600015
                                                                  NC_003098.1
                                GTGAATATTCTGCTGCTTTAGGAAAGGCAAAAAGTTATAATTCGTTATTCC
Spr_6   A07   opSpV0100001883                       ref|NC_003098.1|:c1306540-1306046
                                                                  NC_003098.1
                                GAAGCTATTTATGAGGGAAACTGGCAAGCTGGAGAGTCAGAGTATCTAGT
Spr_6   A09   opSpV0100001884                       ref|NC_003098.1|:1018322-1019626
                                                                  NC_003098.1
                                TGCTATGATCGCACTTGACGGTACTCCTAACAAAGGTAAATTGGGTGCGA
Spr_6   A11   opSpV0100001885                       ref|NC_003098.1|:1040078-1041148
                                                                  NC_003098.1
                                CAAGAGCACCCACAACAGCTTTCAAATCGAGCTCTCTCATCATTCAACAAA
Spr_6   A13   opSpV0100001886                       -             -
                                GATGGGGAAGGCTGGGCAACTAGTCTTTTTCGATGTTTATAGATTAGTTAG
Spr_6   A15   opSpV0100001887                       -             -
                                TTTCTTGTTTGAGCATATTATCACCTCGTTTCCTACTACTATCTTACCATAA
Spr_6   A17   opSpV0100001888                       gb|AE007317|:411891-412112
                                                                  AE007317
                                TATAGACTGTTTTAGAAAAGAAAGTGTAAAAATAGGGATTTTGCACTTGTT
Spr_6   A19   opSpV0100001889                       ref|NC_003098.1|:279110-279616
                                                                  NC_003098.1
                                TTGAACAACAACGTCGAGAGATGGCTCTAACTAATACTTTTTTCAATCGAT
Spr_6   A21   opSpV0100001890                       ref|NC_003098.1|:157774-158835
                                                                  NC_003098.1
                                GGTGCAACTCAAGTACGCTGGAGCTTCAACAGACGAGCCACTTTTGAATG
Spr_6   A23   opSpV0100001891                       ref|NC_003098.1|:4756-8265
                                                                  NC_003098.1
                                TGAAAGAACTGAAGAAACAAGTGGATGTCCTAACCTTGACCGCTACGCCA
Spr_6   C01   opSpV0100001892                       ref|NC_003098.1|:607862-608131
                                                                  NC_003098.1
                                AACTGATGAAGTTGGAACTATCTCGGATTTACGATGCAGGGTTGATGGAT
Spr_6   C03   opSpV0100001893                       ref|NC_003098.1|:151597-152262
                                                                  NC_003098.1
                                GAAAATCAATAGTAGAAAGTTTAAAGGATCCTATCTTTTCTATTCCTTCCTA
Spr_6   C05   opSpV0100001894                       ref|NC_003098.1|:c217536-217339
                                                                  NC_003098.1
                                ATAGATAAGATGGCTGAATCTCCCAACTCCCCTTTAAGCGCTATCTCTGAC
Spr_6   C07   opSpV0100001895                       ref|NC_003098.1|:c1279469-1278165
                                                                  NC_003098.1
                                AGAATTAGCTGAGATCCGCAAACGTACAGATGTTGAAATTGAAGCCTTTGT
Spr_6   C09   opSpV0100001896                       ref|NC_003098.1|:220809-221117
                                                                  NC_003098.1
                                AGTCTAAATTAGCGGATTATGCGCCAAATATAGATGTTGCACTATTGGGTC
Spr_6   C11   opSpV0100001897                       ref|NC_003098.1|:1634203-1634442
                                                                  NC_003098.1
                                AGAGGAGGGAACAAAGGATCAACTAGCTGAACTGACCTACCCCTTTGGTC
Spr_6   C13   opSpV0100001898                       ref|NC_003098.1|:553218-553721
                                                                  NC_003098.1
                                GCTAGGAAATGGCGATGCTCATCTTCATTGGCATCTGTTTCCACGACGGA
Spr_6   C15   opSpV0100001899                       ref|NC_003098.1|:c1223470-1222625
                                                                  NC_003098.1
                                TTTCTTGCCATTTGAAGGAACAGAGATGCCTATTCCAATCGGCTATGATGT
Spr_6   C17   opSpV0100001900                       gb|AE007317|:1975661-1976115
                                                                  AE007317
                                TATCGTTGTTGGCTAGTACTAAGAAGTTAGTTAGTTAGTAGAATAATTACA
Spr_6   C19   opSpV0100001901                       ref|NC_003098.1|:c1299164-1298337
                                                                  NC_003098.1
                                AATCAATGCTCTCTTTGATGGCCGTGTCCGAGCTGTATCCAGTGGCTATG
Spr_6   C21   opSpV0100001902                       ref|NC_003098.1|:611615-611869
                                                                  NC_003098.1
                                GAAAATTTTTCAATTACCAACAGAAATATTCCTAGCAATAGCCATGTTGATC
Spr_6   C23   opSpV0100001903                       ref|NC_003098.1|:485549-486364
                                                                  NC_003098.1
                                CTTTGGGCTTCACGAGAGGAGTTGAGTGAAGATGCTCAAAATACCCTCTT
Spr_6   E01   opSpV0100001904                       ref|NC_003098.1|:c878003-877383
                                                                  NC_003098.1
                                TATTCTAATTGTCGGACACGGCGCCAATCTTACTGCCAGTCTTCGTACTCT
Spr_6   E03   opSpV0100001905                       ref|NC_003098.1|:900059-900688
                                                                  NC_003098.1
                                TAACACCAGTGCTGAGAACCAACCAAACGCAACTGCAGAATCTAACATTG
Spr_6   E05   opSpV0100001906                       -             -
                                GGGATGGTCATTCTGATAAAGGAGAAGCTCCTGCTGGAAAACCTCCTATG
Spr_6   E07   opSpV0100001907                       ref|NC_003098.1|:c1710891-1709860
                                                                  NC_003098.1
                                TCTTCATCGTTCTTCCCCGAACTATGGTCTCTGCTAAGCGGATTAATCAAG
Spr_6   E09   opSpV0100001908                       ref|NC_003098.1|:c692933-691587
                                                                  NC_003098.1
                                TTGAATTAGCTGGCGTACTCCACACTTTTGGTGTCAAGACAGATCTCTTTG
Spr_6   E11   opSpV0100001909                       ref|NC_003098.1|:c1706707-1706390
                                                                  NC_003098.1
                                CGAGATCAGTATATGGATTTGGCCAAACTCTGGGATGTTTACGGAATTCC
Spr_6   E13   opSpV0100001910                       -             -
                                ACCATAATAAAAAGGGAAGCGAATTTCGTGAGTTGGTCATGATTTCAGATC
Spr_6   E15   opSpV0100001911                       ref|NC_003098.1|:c1318130-1317741
                                                                  NC_003098.1
                                ATAAGAACTATGCAAGTATTTTTTATGAATACTGGCGCAGCTTTTTGACAG
Spr_6   E17   opSpV0100001912                       ref|NC_003098.1|:720316-720720
                                                                  NC_003098.1
                                TAGAACTTTTAGACTGTAATCAAACAATGATTTGGCGAAATGTAAAAAAATA
Spr_6   E19   opSpV0100001913                       -             -
                                ATAGTATTAGCTGACGCGAATTATCCTTCTGCCTCATGTGCAAATAAGCTA
Spr_6   E21   opSpV0100001914                       ref|NC_003098.1|:50314-51756
                                                                  NC_003098.1
                                CATTGGTGCCGAGTGGATTCGTGATTTGAAGCCAGGTGAGATTGTGATCA
Spr_6   E23   opSpV0100001915                       ref|NC_003098.1|:735107-735310
                                                                  NC_003098.1
                                AGATTTGGCTAAAGAAGAAACCATTCGCCAAATCAATATTTACAACCGAAC
Spr_6   G01   opSpV0100001916                       ref|NC_003098.1|:c1186914-1185496
                                                                  NC_003098.1
                                AGTCTGAAAAATACTCTTTAGAGGAGCGTAAGGAACGTCAATATCTACCTC
Spr_6   G03   opSpV0100001917                       -             -
                                CAATATCAACTCCCATGATAGTCATGAGATGACTCTTCACGAATTGACGTG
Spr_6   G05   opSpV0100001918                       -             -
                                GGGAATTTGGGCTTCATATTTTAAAAAGCCTATAGGAGTATTAGGTATTGG
Spr_6   G07   opSpV0100001919                       ref|NC_003098.1|:710880-713330
                                                                  NC_003098.1
                                TGGAAAAATATAGCTTGCCGATTTTGTGTCGAGAATTAGGAATTCCTCTTA
Spr_6   G09   opSpV0100001920                       ref|NC_003098.1|:c1596445-1595432
                                                                  NC_003098.1
                                ATCAATTACCATGAAAGATGTTGCTTTAGAAGCAGGAGTTAGTGTTGGAAC
Spr_6   G11   opSpV0100001921                       ref|NC_003098.1|:174766-175329
                                                                  NC_003098.1
                                AAGATCTCAAAAAACGAGGCTTCAAGTTCACAGGCCCAGTCGCCGTATTG
Spr_6   G13   opSpV0100001922                       -             -
                                GGGATTCCTAATTACCCTGAAGGGAAGATATATGCAGATTATCGTCATAAT
Spr_6   G15   opSpV0100001923                       ref|NC_003098.1|:872639-874441
                                                                  NC_003098.1
                                CTAAAGTTCGTAACTACAAGAGTGCTCGTCATGCAGCCCTCGCAGCGAAT
Spr_6   G17   opSpV0100001924                       ref|NC_003098.1|:1312051-1312656
                                                                  NC_003098.1
                                ATGGTATTTACCCACTTTTGAACAAACCAATCATGATTACAGGTGCTTCTT
Spr_6   G19   opSpV0100001925                       gb|AE007317|:636281-636655
                                                                  AE007317
                                AGCTCTCTGCAAATGCTCTCGATGTGCTTTAAAAGGATCAAGTGGAATTAC
Spr_6   G21   opSpV0100001926                       ref|NC_003098.1|:294547-295038
                                                                  NC_003098.1
                                TGGACAAGGACAACTTTGGGTAAAATACCTAGGTTGTAATACGGTCATTGT
Spr_6   G23   opSpV0100001927                       ref|NC_003098.1|:321740-322789
                                                                  NC_003098.1
                                GTGATGAGTTGGGGTGGAAACCTGAATTTACCAACTTTGAAGCTGGGCTC
Spr_6   I01   opSpV0100001928                       ref|NC_003098.1|:c415633-415349
                                                                  NC_003098.1
                                TATATGATACAGGCATCCAAACAATCACAATTCAACGCAAGCCATTGGTTT
Spr_6   I03   opSpV0100001929                       ref|NC_003098.1|:756677-757387
                                                                  NC_003098.1
                                TTGTAGGTGCTGGGGGAGTCCTCTTGATAGGGGGAACATTAGATCAGTTA
Spr_6   I05   opSpV0100001930                       ref|NC_003098.1|:c1350305-1349823
                                                                  NC_003098.1
                                TTTGTCAATACTTACCAGTTCCAGGCACCGGACTTTTATCAGAAACATGGC
Spr_6   I07   opSpV0100001931                       gb|AE007317|:1518052-1518293
                                                                  AE007317
                                TCTCCAATCAGACTCCTGCCAATCTAGTTTATCTACCAGGACACCGCTGCA
Spr_6   I09   opSpV0100001932                       -             -
                                AGATGAGATGATGGATAAAACAACTCAAATGCTTTATTTAGCATCATCTAAC
Spr_6   I11   opSpV0100001933                       ref|NC_003098.1|:763092-764747
                                                                  NC_003098.1
                                AACAAGTTGCACCAGCTCCTAGTCGACCAGCTACGGGCAAAACAGTCTAT
Spr_6   I13   opSpV0100001934                       ref|NC_003098.1|:540319-541539
                                                                  NC_003098.1
                                GAATTAGCCAATGTATTACAAAGTAGTGCTTGGGAGGAAGTTAAGTCTAAT
Spr_6   I15   opSpV0100001935                       ref|NC_003098.1|:1732263-1732451
                                                                  NC_003098.1
                                GTGGCACAGATGGTGCTGACCCTAGATCAACAATTATATGTTCTGCTACAT
Spr_6   I17   opSpV0100001936                       ref|NC_003098.1|:204321-204815
                                                                  NC_003098.1
                                TCACTTGGTTCTAACACTCCAATCAACATTGTTCGTGCAACTGTTGAAGGT
Spr_6   I19   opSpV0100001937                       ref|NC_003098.1|:825410-826285
                                                                  NC_003098.1
                                GTATCGGTATCTGTTGGGATCAATGGTTCCCTGAAACAGCGCGCTGTCTT
Spr_6   I21   opSpV0100001938                       ref|NC_003098.1|:c428271-426922
                                                                  NC_003098.1
                                AAATCGCCAGCTTCTTTAGCGAGAAATTCCCAAATCTCTACATCGTTCAAG
Spr_6   I23   opSpV0100001939                       -             -
                                ATCTAGTTGAGAGAGGTATGAATGATTTGGGTTAAAAGATTTATGCCTGGA
Spr_6   K01   opSpV0100001940                       ref|NC_003098.1|:1335477-1335824
                                                                  NC_003098.1
                                TTCTTTATCGGTCGCAAAACTTGCCCTTACTGCCGTAAATTTGCAGGTACA
Spr_6   K03   opSpV0100001941                       ref|NC_003098.1|:c1184715-1184308
                                                                  NC_003098.1
                                AAATGTATCGTTTGGTGTAACTAACTGTGCAGAACGTAGTGCTATTTTTTA
Spr_6   K05   opSpV0100001942                       ref|NC_003098.1|:c1493433-1492390
                                                                  NC_003098.1
                                CTGTCCTTTCAGCTGAGAGTGTCATGCGTGCGGTCGATTACGACCGTTTC
Spr_6   K07   opSpV0100001943                       ref|NC_003098.1|:987053-987724
                                                                  NC_003098.1
                                GCAAAATAAGCATTCTCCAATTGAGTTTGTGACCGGTCGAGTCAAGCCAA
Spr_6   K09   opSpV0100001944                       ref|NC_003098.1|:c1511158-1510325
                                                                  NC_003098.1
                                GGTATTGTTCGATTCTTTCCTAAATTGGGAGCAATCATGTCGAGACTACTC
Spr_6   K11   opSpV0100001945                       ref|NC_003098.1|:448511-449857
                                                                  NC_003098.1
                                TTTGTACGTATCAATGAGTCGGATATGTACTTGTACCCGGACTTGGATACA
Spr_6   K13   opSpV0100001946                       ref|NC_003098.1|:c1558083-1556104
                                                                  NC_003098.1
                                TGGAACGGTCCTGAAGCAAAGTCTACCAGAAGGTACGACCTATGACTTGA
Spr_6   K15   opSpV0100001947                       ref|NC_003098.1|:849966-850616
                                                                  NC_003098.1
                                AAGGTGCTGTCAAATCGCCAGGGATTTATGACTTGCCTGTAGGTAGTCGA
Spr_6   K17   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_6   K19   opSpV0100001948                       ref|NC_003098.1|:c1478397-1475986
                                                                  NC_003098.1
                                CCAGCTAACCTACAGGGAGTCTGGAATGCGGTCGACAATCCTCCTTGGAA
Spr_6   K21   opSpV0100001949                       -             -
                                TTGAAGAGATTTTCGAAGAGTATTAACTATTATGCTTTACAAACTAGTGTAG
Spr_6   K23   opSpV0100001950                       ref|NC_003098.1|:c1324229-1324068, ref|NC_0
                                                                  NC_003098.1
                                TACAAGGATTGGAGAAGGAGGTGATAAAGTCCATCGTTAATCGGAGATGG
Spr_6   M01   opSpV0100001951                       ref|NC_003098.1|:4186-4755
                                                                  NC_003098.1
                                AACACAATGTTGGTTTTATGTTGATTGATCAACTAGCGAAGAAACAGAATG
Spr_6   M03   opSpV0100001952                       -             -
                                GATACAGTAGTTCTAGGTACGATATCTACAAGTAATTCAGCGAGTTCAACT
Spr_6   M05   opSpV0100001953                       -             -
                                CTTGTGCTTTTGGATCTTGTGCTACCAATTGATTTCCTGGAATTGTAATAG
Spr_6   M07   opSpV0100001954                       ref|NC_003098.1|:c1361807-1361655
                                                                  NC_003098.1
                                GTCAACGGTAAAAGATGTAGATTGTATTTTCTTCTTAGAGGAGAGGAAAAT
Spr_6   M09   opSpV0100001955                       -             -
                                TGCTATCCTCCGTTATTTTATCCGTCGTCTATTCTATCACATTTTTTACAAA
Spr_6   M11   opSpV0100001956                       ref|NC_003098.1|:998667-998942
                                                                  NC_003098.1
                                TATTTGCAGCAGTAGCTGACTATCTTGCAGCTGGTGAAAAAGTTCAATTGA
Spr_6   M13   opSpV0100001957                       gb|AE007317|:1269160-1270612
                                                                  AE007317
                                ATTACCACCTGTTCGACTGGAGAATCTAGTCGATTAGCTCCCTCTTAGTTA
Spr_6   M15   opSpV0100001958                       ref|NC_003098.1|:c1244627-1243854
                                                                  NC_003098.1
                                GGGACTTTTGGTGCCATTTACATCTACCAGTCTCGTAAGAAATACCAAGAA
Spr_6   M17   opSpV0100001959                       -             -
                                CTCTTATGCAGAATATACAATCATTGGTGTTATAGCTTTATTGATAATCGGG
Spr_6   M19   opSpV0100001960                       ref|NC_003098.1|:715818-717764
                                                                  NC_003098.1
                                AACCACCAATCTATGGTGTCAAGGTTGGAAGCGAGATTAAAGAATATATCC
Spr_6   M21   opSpV0100001961                       ref|NC_003098.1|:207771-208043
                                                                  NC_003098.1
                                GTAGTTGATACAATGCCGAATGCAATGTTTACGGTTGAACTTGAAAATGGA
Spr_6   M23   opSpV0100001962                       ref|NC_003098.1|:c1929574-1929248
                                                                  NC_003098.1
                                GAATGGCGTTTTGAATGCCAAGTGCTGAGAGAAATCGAGACAGAGGACGA
Spr_6   O01   opSpV0100001963                       -             -
                                GATTTTTAACATCCTAAAACTCTCTAAACGTTCGTAAATATCTCTGTTTTTA
Spr_6   O03   opSpV0100001964                       ref|NC_003098.1|:c1321601-1321356
                                                                  NC_003098.1
                                GTGAAGGTGATACCCACCAGAGCTACAAACAAATCGCACTAGTATACGCT
Spr_6   O05   opSpV0100001965                       -             -
                                CCTTACCGTATATATATGTTACTGACTTCGTCAGTTCTATCTGCCACCTCA
Spr_6   O07   opSpV0100001966                       ref|NC_003098.1|:c879327-878485
                                                                  NC_003098.1
                                AAACAACTACCACTCACGCGTCTATCATTTCATCATCGGTATCGTCCTATC
Spr_6   O09   opSpV0100001967                       ref|NC_003098.1|:c1355362-1354028
                                                                  NC_003098.1
                                CAGGAGCACATGGAAAAACTTCAACGACAGGTATGTTGTCTCATGTCTTG
Spr_6   O11   opSpV0100001968                       ref|NC_003098.1|:c1432536-1432048
                                                                  NC_003098.1
                                AACAGCCAAGACAACGGTATGATGGAGTCCTTCTTTGGGATTCTGAAATC
Spr_6   O13   opSpV0100001969                       ref|NC_003098.1|:c364489-363875
                                                                  NC_003098.1
                                GGAAGATGGCAATAAGGACATCGTCAAGCGCGTGATTGGAATGCCTGGC
Spr_6   O15   opSpV0100001970                       ref|NC_003098.1|:225726-226814
                                                                  NC_003098.1
                                GAAGAAATGTGAAGAAACGCTGTTTGCAGATGGTTTACAGGCTATGGCAG
Spr_6   O17   opSpV0100001971                       ref|NC_003098.1|:1869051-1870742
                                                                  NC_003098.1
                                CAAGAAAATGTTGTTATCGACATGTCTAGTCCGAATATCGCTAAACCATTT
Spr_6   O19   opSpV0100001972                       ref|NC_003098.1|:c1868903-1868457
                                                                  NC_003098.1
                                TGTTGCAAGAGCAGAGTTTACCTTGGTGCTTCATACCAAATTGGGAGAAG
Spr_6   O21   opSpV0100001973                       ref|NC_003098.1|:147164-147919
                                                                  NC_003098.1
                                AGAAAGAAGACAGGTTAGCTTGTGAACGTCTACAATGTGATTTTAGACACT
Spr_6   O23   opSpV0100001974                       ref|NC_003098.1|:747720-747932
                                                                  NC_003098.1
                                TTCAGATCTATGAACTAAGAAAGCAAGGATATAGCTTAGAGAAGCTTTCAA
Spr_6   A02   EMPTY             -                   -             -
Spr_6   A04   opHsV04NC000001                       -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_6   A06   opSpV0100001975                        ref|NC_003098.1|:c1884830-1884132
                                                                   NC_003098.1
                                GTAACCTTTGAGGGGCAACTCGCAACTGCTGTGCCTAGCTCTGTTGTCAA
Spr_6   A08   opSpV0100001976                        ref|NC_003098.1|:c1704325-1704041
                                                                   NC_003098.1
                                TAAAACTGGAGATCGTGTCTTAGTTGAAGCCCACGCAGGTCTTGATGTCA
Spr_6   A10   opSpV0100001977                        ref|NC_003098.1|:c1731567-1730704
                                                                   NC_003098.1
                                CAGATTAGTAAAATTGAAAGAGGTCATTTTATTCCCTCCGCAGACTTGTTA
Spr_6   A12   opSpV0100001978                        ref|NC_003098.1|:138992-140002
                                                                   NC_003098.1
                                TATGATTTCCCCCGTGCCATGATTAAGGAAGATAATCTGGAGTTCTCCTTC
Spr_6   A14   opSpV0100001979                        gb|AE007317|:562193-562417
                                                                   AE007317
                                CCTAGATAATACTTAGTAAAACTTTTTATAACAAAGGCTAGCAAAGTTAAAG
Spr_6   A16   opSpV0100001980                        -             -
                                TCTTTGATTTTCATTGAGTAGTAAAACTACATGTAATGGCAATCAAGATATC
Spr_6   A18   opSpV0100001981                        gb|AE007317|:888036-888260
                                                                   AE007317
                                ATGAAATGTCAGACCTAAAAGACATTTTCGTTCACAAAAGCAGCGATGAGT
Spr_6   A20   opSpV0100001982                        ref|NC_003098.1|:c1709794-1709432
                                                                   NC_003098.1
                                AGCACCATATTATGTCCCTGAACGAATTGCAATTACAGGGAAGATTTGCGG
Spr_6   A22   opSpV0100001983                        -             -
                                GGAGGAATAGTAGGATCTACGTGGCAAAACGGTCGAGTAAATAATGTTGT
Spr_6   A24   opSpV0100001984                        ref|NC_003098.1|:1182410-1182847
                                                                   NC_003098.1
                                TACTATTGAAAAAGTGGTGAATACCGATGAAAAGGAGGTAAACCATCTGAT
Spr_6   C02   opSpV0100001985                        ref|NC_003098.1|:882643-883335
                                                                   NC_003098.1
                                TGCTTATGGACAAATGGCGCAACAACCGCTTTATTTCGAATCAGACAAAAC
Spr_6   C04   opSpV0100001986                        ref|NC_003098.1|:864795-865619
                                                                   NC_003098.1
                                GGTGGCACGCTTGTTTATGAGGATGTTCGCAAGTTTGGAACCATGGAACT
Spr_6   C06   opSpV0100001987                        -             -
                                ATTGACTAAACAAACCAAGAGTTGTATAATAAAACAAATATTTAAAGCAGGA
Spr_6   C08   opSpV0100001988                        -             -
                                TGTTGGATTTCGGATGCCTAGTCATCCCATTACCCTTGATTTGATTCGAGA
Spr_6   C10   opSpV0100001989                        gb|AE007317|:1987315-1987543
                                                                   AE007317
                                TGAATGCCGCCATTCTTTCCTCATCAAAAAAACTCCGTAGTCTCTAGCGCT
Spr_6   C12   opSpV0100001990                        ref|NC_003098.1|:195551-195859
                                                                   NC_003098.1
                                TCCAACTGAACGTAGCCTCTACACAATCATTCGTGCGACTCACAAATACAA
Spr_6   C14   opSpV0100001991                        gb|AE007317|:1514170-1514698
                                                                   AE007317
                                TGCAAAAGATACTAGTATGAATCTATTTGGGGACTTGAATTTATAAGCTGC
Spr_6   C16   opSpV0100001992                        ref|NC_003098.1|:850600-852840
                                                                   NC_003098.1
                                GCGACTCAAACAAAGGTGCGTAGTATGATAGTAGGGGAGAACTTGCCCAT
Spr_6   C18   opSpV0100001993                        ref|NC_003098.1|:105545-107653
                                                                   NC_003098.1
                                AAATAGGGACAACTATTTTACTGACGGCCTTACTGATTGGGGTGGGCAGA
Spr_6   C20   opSpV0100001994                        ref|NC_003098.1|:c170813-170346
                                                                   NC_003098.1
                                ATCTGCTTGGGAGCTGTCATTAGAGGGAATACAAGTCATTATGATTATGTA
Spr_6   C22   opSpV0100001995                        ref|NC_003098.1|:39514-39744
                                                                   NC_003098.1
                                TTGAAATTATGGATACTGAGATGCTTGCTTGCGTTGAAGGTGGCGGATGC
Spr_6   C24   opSpV0100001996                        ref|NC_003098.1|:51793-52815
                                                                   NC_003098.1
                                AGGTGCGGAACCCCTCTATTTTCTCGACTACGTAGCGACAGGGAAGAATG
Spr_6   E02   opSpV0100001997                        -             -
                                TCAGTCCTGATCTTTTTAATATTGCTGTTATTCTCTATATCCTATTTTTCATT
Spr_6   E04   opSpV0100001998                        ref|NC_003098.1|:1396746-1397930
                                                                   NC_003098.1
                                TCTGCAGCCAAATTAGCAGCTGGTCATCTCCTTCATTCATCCAGTTTGGTG
Spr_6   E06   opSpV0100001999                        ref|NC_003098.1|:235502-236761
                                                                   NC_003098.1
                                CAGAAACCAAAGATAAGACGGCACCGACTTTGGATGTGACTATTTCTGAA
Spr_6   E08   opSpV0100002000                        ref|NC_003098.1|:c1412861-1412691
                                                                   NC_003098.1
                                CTTTTCGTAAAAAGCGTTACGGGCTTTCTATCCTCCTTTGGTTAAATGCCT
Spr_6   E10   opSpV0100002001                        gb|AE007317|:1039495-1039744
                                                                   AE007317
                                AATGATCAGTTTGATTTATTTAGAAAACCGATTCTCAGAAATGAGATCGGT
Spr_6   E12   opSpV0100002002                        ref|NC_003098.1|:386472-386657
                                                                   NC_003098.1
                                TCAACTGAGGACTTGGAGCAAACTTCAGGTGGTCTTGCTGTTTGGGAAGA
Spr_6   E14   opSpV0100002003                        gb|AE007317|:149105-149498
                                                                   AE007317
                                GATATTTTGAGCTCACACCTCATCGTTCCAGTGGCTGTTCCCCAAGCTCG
Spr_6   E16   opSpV0100002004                        ref|NC_003098.1|:1942262-1942711
                                                                   NC_003098.1
                                CAACCGTAAATTCATGCACTTGGATACTGTCTTCACTATGGTAGACTATGA
Spr_6   E18   opSpV0100002005                        -             -
                                TTAGAAAGAGTGGATGTCTTTTTGATAACACCTACTTATGAATGGCAGTTT
Spr_6   E20   opSpV0100002006                        gb|AE007317|:505280-505505
                                                                   AE007317
                                AATCTGAAAGACTAGTAGCCCAAGGGAAGTATATCAGGGAGGAGAGCCGT
Spr_6   E22   opSpV0100002007                        -             -
                                ATCTCCGCTTTCAAACCTGAAGGTGGAGATTTTGCTCTATACAGTTTCTTT
Spr_6   E24   opSpV0100002008                        ref|NC_003098.1|:31306-33939
                                                                   NC_003098.1
                                ATTCGGAAGGCTTTTGTGCCAGAGTGGGAGGATAGTGTGCTACTCAGCTC
Spr_6   G02   opSpV0100002009                        ref|NC_003098.1|:c1444628-1443951
                                                                   NC_003098.1
                                GTTTGATCCTCCAGCCCAATAATCGTGAAGACGACTTGCGTATCTGGCTA
Spr_6   G04   opSpV0100002010                        ref|NC_003098.1|:c1968449-1967613
                                                                   NC_003098.1
                                AGGTCTGGCTGTTTCTCTGATTGTCATGAGCAAGGGTAAAAGCTCGAGTT
Spr_6   G06   opSpV0100002011                        -             -
                                ATTGAAAGACTTATTGGACTTTCTCTCAAATCGAGTTTTTACTCAATTTTCT
Spr_6   G08   opSpV0100002012                        -             -
                                TAGTCGGAACAGTTCTCTTTGGAGTGGTCTTGATTGCCATCTTGCGTTTGG
Spr_6   G10   opSpV0100002013                        ref|NC_003098.1|:c985274-984159
                                                                   NC_003098.1
                                GAAAAATGACCTCTTACTCCTTCGGCTAGATTTAGCTGGAATTTCAATCTC
Spr_6   G12   opSpV0100002014                        ref|NC_003098.1|:c261330-260419
                                                                   NC_003098.1
                                GATCGTAAAAAAGTTTGGTGGCGTTCAACCTTCTTACAAGGGTCTTGGAAC
Spr_6   G14   opSpV0100002015                        ref|NC_003098.1|:977840-978547
                                                                   NC_003098.1
                                CCAACTCTGTTTGTAAGCGCATCATAACAAAGGGTCTAGGATTCAGGGCT
Spr_6   G16   opSpV0100002016                        gb|AE007317|:1451068-1451431
                                                                   AE007317
                                GGTCGGCATGGATTCTGGTATTAGCATCAAGCATATTCTACAAAAAATGAA
Spr_6   G18   opSpV0100002017                        ref|NC_003098.1|:c1621519-1620044
                                                                   NC_003098.1
                                GTTTACTATGTATGGAAAATGAAGGATATCAGGGGCGAATAAATTATCCAG
Spr_6   G20   opSpV0100002018                        -             -
                                GGCATTAGTACTTCTATAACAGTATCGCAATCTCTGGTGTGCGTTGTCTCG
Spr_6   G22   opSpV0100002019                        ref|NC_003098.1|:889898-891301
                                                                   NC_003098.1
                                CTTGATTACAGTTTGTATTTCGATGACCTATGCCCTATCGCGTATGATTTA
Spr_6   G24   opSpV0100002020                        -             -
                                ATTGTGGGAAGATTTACTTCCTTTTCTACTGAAATTGAGTCTTTTCCCAAG
Spr_6   I02   opSpV0100002021                        gb|AE007317|:934439-934825
                                                                   AE007317
                                CTTGATTTCAAACTATTTTATAAGCATTTTGTCTTTGTAGATAAAGGCAATT
Spr_6   I04   opSpV0100002022                        ref|NC_003098.1|:350465-351121
                                                                   NC_003098.1
                                AGGGACTTTGGGTCTTCCTACTAGTCAAAAAAATTTGACAGGAATAACTGT
Spr_6   I06   opSpV0100002023                        ref|NC_003098.1|:325111-327093
                                                                   NC_003098.1
                                AATCTTGTCTAAGATGGTACCATTTACAATACCATTTGCATTGTCAGGAAA
Spr_6   I08   opSpV0100002024                        ref|NC_003098.1|:c1627609-1626356
                                                                   NC_003098.1
                                GTCTCTTTACACACAGACACCTAAGACTGTTTGTCTCAACTCTGCGACAGC
Spr_6   I10   opSpV0100002025                        ref|NC_003098.1|:68133-69038
                                                                   NC_003098.1
                                GGTTCTTGCGACAGCCTTCTCTGTTTCACAAGGAATTGATGCACCGCTTG
Spr_6   I12   opSpV0100002026                        ref|NC_003098.1|:158837-159529
                                                                   NC_003098.1
                                ACTTGATTGTTAAAACAAGTATCGGGCCAAATGCAGCCCTTGTCCCACTTT
Spr_6   I14   opSpV0100002027                        ref|NC_003098.1|:c1348296-1348096
                                                                   NC_003098.1
                                AAGGTTTATTGATGAATGGACTGTTTAAATCAGTAGCACGCCAACCAGATA
Spr_6   I16   opSpV0100002028                        gb|AE007317|:1587055-1587344
                                                                   AE007317
                                CCTCTTTCTATGCGACTCTTTAATCGCCCCGATTGCTCGGAAATATGCTAA
Spr_6   I18   opSpV0100002029                        ref|NC_003098.1|:22162-22404
                                                                   NC_003098.1
                                TACAAAAAATTTATGAGCAGATGGCTAATTTCTATGATAGTATTGAAGAAG
Spr_6   I20   opSpV0100002030                        ref|NC_003098.1|:c1417587-1416910
                                                                   NC_003098.1
                                GATTGGCAAGGAAATTTCGGATGTCAACCAGTCCATTTCTAATCTGACGG
Spr_6   I22   opSpV0100002031                        ref|NC_003098.1|:c1768795-1768112
                                                                   NC_003098.1
                                GAACCTCGTTCAGACTACGACTATCTAGCCTTTATGCCAGTTCGGGATAG
Spr_6   I24   opSpV0100002032                        ref|NC_003098.1|:c1413367-1412861
                                                                   NC_003098.1
                                AAATTTTTCAGGCTTTTGAACCTTACCTTGATGAAGTGATTGTCACTCACA
Spr_6   K02   opSpV0100002033                        ref|NC_003098.1|:1451432-1451638
                                                                   NC_003098.1
                                GGTGGAACCACGTTGCGACGTCCTTTCGAGGATGTCGCATTTTTTTATTAG
Spr_6   K04   opSpV0100002034                        ref|NC_003098.1|:466869-467600
                                                                   NC_003098.1
                                CATCAATATCAATGGCCTGACTCTGCAAGGAGATGCGACTAGCTACCGCA
Spr_6   K06   opSpV0100002035                        ref|NC_003098.1|:34024-34461
                                                                   NC_003098.1
                                GTGGCGAAATCTTGGGTGAAAAGGCTTATGCTAGCCTCGCTGAAATTCCT
Spr_6   K08   opSpV0100002036                        ref|NC_003098.1|:c1632015-1630231
                                                                   NC_003098.1
                                ACTATTTGCGCTATGTGTGGCGTATGTATATCCTTGGGACCTCTTATTGCT
Spr_6   K10   opSpV0100002037                        ref|NC_003098.1|:c1304208-1303465
                                                                   NC_003098.1
                                TAAGATTTCGAATTTAAGCAAATCCTTTTCAGGACAGACTGTCTTGGATCA
Spr_6   K12   opSpV0100002038                        ref|NC_003098.1|:336620-337023
                                                                   NC_003098.1
                                TTCTGGAAACAGAGAGAGTGGAACGCGGTAAACCCCTCAAGCTAGCAACC
Spr_6   K14   opSpV0100002039                        ref|NC_003098.1|:1736592-1737521
                                                                   NC_003098.1
                                TTACATGAACTAGGTCATTTTTTAGTGGGAAGATGTTTATCTTATAAACTAG
Spr_6   K16   opSpV0100002040                        ref|NC_003098.1|:1589003-1590274
                                                                   NC_003098.1
                                GCCTCTCTTGGAAAGTGGACTGGTCATCATGATTGGAGCAACGACTGAAA
Spr_6   K18   opSpV0100002041                        -             -
                                TGAAGAGATTCTCGAATAGTATAAAGTTCTTATAAGAGGTGGTTGAAGTTG
Spr_6   K20   opSpV0100002042                        ref|NC_003098.1|:c1483562-1483401
                                                                   NC_003098.1
                                ACCGGGATTTGAAGCACCGCAAGAATCTGTTACAATTTTATAAGAAATATT
Spr_6   K22   opSpV0100002043                        ref|NC_003098.1|:969263-969439
                                                                   NC_003098.1
                                AAGCGGTCGTGATAAAAAGATTGCGGGTGTTTGTGCTGGGGTGGCCCAT
Spr_6   K24   opSpV0100002044                        gb|AE007317|:1604241-1604541
                                                                   AE007317
                                TATTTTAGGAACCGTAGTGTAATATTCCAGATTCAATTCACTATAAAACTAG
Spr_6   M02   opSpV0100002045                        -             -
                                TTGTAAATCTATTTTTGTTAGAGTTGATTTGGTTTACATCCGTACTTAAATT
Spr_6   M04   opSpV0100002046                        ref|NC_003098.1|:1008379-1009803
                                                                   NC_003098.1
                                ATTGTTGCGGGAGCCTTTAGCTACTCAGGACAACGTTGCACGGCCATTAA
Spr_6   M06   opSpV0100002047                        ref|NC_003098.1|:c1390399-1389671
                                                                   NC_003098.1
                                CTTGTCATCAGAGTTTGAGACTGTATTTTCTAAGGAAATCAGAGCAAAGAT
Spr_6   M08   opSpV0100002048                        gb|AE007317|:1678974-1679659
                                                                   AE007317
                                AGGAAATTTGACGCAGAAACTTTGGAGTTTAGGAAGACATACAGTAAAATG
Spr_6   M10   opSpV0100002049                        ref|NC_003098.1|:748068-748235
                                                                   NC_003098.1
                                ACGTAATCCAAAAACGAGACCTGAAGAGAGGACAGAATTAGAACGTCTTC
Spr_6   M12   opSpV0100002050                        ref|NC_003098.1|:1902742-1903605
                                                                   NC_003098.1
                                TGGTGGTATCCCGATGAATGCTTGGCTCATGAAAGGCTACTTCGATACAG
Spr_6   M14   opSpV0100002051                        ref|NC_003098.1|:c888035-887403
                                                                   NC_003098.1
                                GTCATCTTATCTGAATCCTTACTATCTTCCGTTCCTTGTTTTGCATCCTTCT
Spr_6   M16   opSpV0100002052                        ref|NC_003098.1|:c1363338-1363036
                                                                   NC_003098.1
                                CTGTCTAGTCTACTTGCTTTGTTGCTTCCCCTTATCTTAAAGGGTTTAATAG
Spr_6   M18   opSpV0100002053                        ref|NC_003098.1|:c1542332-1541133
                                                                   NC_003098.1
                                ATTGGGATCTATGTTGTAGGTGGTCTGGCTGCCGTTTTGCTCTTTAAAGAT
Spr_6   M20   opSpV0100002054                        ref|NC_003098.1|:c1758553-1758014
                                                                   NC_003098.1
                                CAGGTATCTGGGGAATTTGACCTCGTTTTCTTAGACCCTCCCTATGCCAAG
Spr_6   M22   opSpV0100002055                        ref|NC_003098.1|:107650-108291
                                                                   NC_003098.1
                                TTGCATCAAAGGGTCTCCGAGTTGTCTGGGGGCGAACAACAACGAATTGC
Spr_6   M24   opSpV0100002056                        ref|NC_003098.1|:c1206368-1205988
                                                                   NC_003098.1
                                AAATCAACTTCTTTTAGATTTCTTCCAAAACTATGGCATAGAGGTATCTTGT
Spr_6   O02   opSpV0100002057                        ref|NC_003098.1|:651331-651678
                                                                   NC_003098.1
                                ACGAGCTTGGTATAAAGGTTTTACACGGACCAACTGTAACCGATTGGGGA
Spr_6   O04   opSpV0100002058                        gb|AE007317|:1581189-1581427
                                                                   AE007317
                                CTACATTTCTAGCAACTGTTCAAAAAGGCAGTCTTAAATGACTCAATATTG
Spr_6   O06   opSpV0100002059                        ref|NC_003098.1|:1016588-1017715
                                                                   NC_003098.1
                                CTTGCCTGCTTCCGGTCAATCCTTATTAAACTTAGCTTCTGTTTCAACAGA
Spr_6   O08   opSpV0100002060                        ref|NC_003098.1|:c691390-690854
                                                                   NC_003098.1
                                TTTATCTCGTTTACTCTGGACTTACTTCCTCTCTAACCAACAGCAAGAGTG
Spr_6   O10   opSpV0100002061                        ref|NC_003098.1|:962670-963428
                                                                   NC_003098.1
                                GCATACTGCTGCCCTGGATCCAAAGACTAGTGTTGCTTTGATGGAATTGA
Spr_6   O12   opSpV0100002062                        gb|AE007317|:392150-392361
                                                                   AE007317
                                TTCGTGAAATGATGATTTTTAGTCTGTTCTATTTTACCATATTTTCCTATAA
Spr_6   O14   opSpV0100002063                        ref|NC_003098.1|:c1274296-1273808
                                                                   NC_003098.1
                                ATTGCTTTGTCGCTCCTATCTTATATCATTTCAGTATTAGCACCAAGCCTTT
Spr_6   O16   opSpV0100002064                        ref|NC_003098.1|:132343-134256
                                                                   NC_003098.1
                                ATCGGTCGTTTCAAGACAGGAACCCCTCCACGTGTCAAGGCTTCTTCTAT
Spr_6   O18   opSpV0100002065                        -             -
                                TATTGCTATTCCCCATAGCAAGAGTTCTGCTGTGGAGAAGGCGGGGGTAG
Spr_6   O20   opSpV0100002066                        ref|NC_003098.1|:656131-656793
                                                                   NC_003098.1
                                TTAACCAAGTCTTTCAAACTTTGGCACAAAATCTTCAAGTTGGTTTACCTG
Spr_6   O22   opSpV0100002067                        gb|AE007317|:1325488-1325712, gb|AE007317
                                                                   AE007317
                                TTCTCTTTTTCCTCCTTCAATCGGAGTTCTCTTAACTTTTTTAGGATGGCAT
Spr_6   O24   opSpV0100002068                        -             -
                                CCCTTTCTGATTGCAAATGGAAACCTGAGGCCAATACTCAATGAAAATCAA
Spr_6   B02   EMPTY             -                    -             -
Spr_6   B04   opSpV0100002069                        gb|AE007317|:72869-73074
                                                                   AE007317
                                TTATATTATCCTGAAATGGTGTTATTTTTGAGTTATCTGGCTTGACTTTCTT
Spr_6   B06   opSpV0100002070                        -             -
                                GGACCAACACGCTATCAAGAATAAGAAAACGATAAAAGCAACTGCAGGTG
Spr_6   B08   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_6   B10   opSpV0100002071                        gb|AE007317|:108292-108505
                                                                   AE007317
                                TCCAGAGAAAAATAGCATAAATACGCCTAGGAATGACATTTTATGTAGCAT
Spr_6   B12   opSpV0100002072                        ref|NC_003098.1|:c1160830-1160309
                                                                   NC_003098.1
                                GAGTTTAGCAGTTCTAGTCGATCGTGGACATAGAGAATTGCCAATCCGTC
Spr_6   B14   opSpV0100002073                        ref|NC_003098.1|:c1305008-1304208
                                                                   NC_003098.1
                                CTACGGAATCCCTTTGGCTTTGAAAGCCCTCAATCAGCAATGGGGAACTG
Spr_6   B16   opSpV0100002074                        gb|AE007317|:450280-450636
                                                                   AE007317
                                ATCGAGCGGAAGAATATTTCTGCCGAGGTTGCCAAGGGGAAAATACTGAA
Spr_6   B18   opSpV0100002075                        ref|NC_003098.1|:670099-671088
                                                                   NC_003098.1
                                GAAACGAAATGGTTGGATGACAGTAGCTGCTGTCAGTTCAGTCATGATTA
Spr_6   B20   opSpV0100002076                        ref|NC_003098.1|:1782113-1783075
                                                                   NC_003098.1
                                CTATCGTTCTAACAGGAGCCATGCGTAGCTCCAATGAGCTCGGTAGTGAT
Spr_6   B22   opSpV0100002077                        ref|NC_003098.1|:c1692036-1691955, ref|NC_0
                                                                   NC_003098.1
                                GTTTGGCGGAATTGGCAGACGCACCAGATTTAGGATCTGGCGCTTAACGG
Spr_6   B24   opSpV0100002078                        ref|NC_003098.1|:736505-737215
                                                                   NC_003098.1
                                TGCGCGTGAGTTAATCGTAGACTACGGTGTGAAGAAATTGATTCGTGTGG
Spr_6   D02   opSpV0100002079                        ref|NC_003098.1|:858971-861136
                                                                   NC_003098.1
                                TTTCCTATATATCGCAAGGTAGTGTCGTATGGCTAGATAAGGATAGAAAAA
Spr_6   D04   opSpV0100002080                        ref|NC_003098.1|:c1257475-1257080
                                                                   NC_003098.1
                                CTTTTAAGAAGAAACGCTTTGAGCCCAGTTTCGCTCTTGGTTTAGCCTTGA
Spr_6   D06   opSpV0100002081                        ref|NC_003098.1|:1162519-1162698
                                                                   NC_003098.1
                                TTACCAACCCACCAGTCCTCTGATTGGACTGGGTAGCCTAAAACTAAACAA
Spr_6   D08   opSpV0100002082                        ref|NC_003098.1|:c2035462-2035337
                                                                   NC_003098.1
                                AAACACAGTTAAATTGGAACAGTTTGTAGCTTTGAAGGAAAAAGACTTACA
Spr_6   D10   opSpV0100002083                        ref|NC_003098.1|:c1291121-1290909
                                                                   NC_003098.1
                                TGTCTGGGAAAGCTGAGAATCAAGCAATCACGCTGTACCACCATGATCAG
Spr_6   D12   opSpV0100002084                        -             -
                                CAACAACGGTTTGACATTTCTATTGGGACCATTTGCTATAGGAATAGGTGT
Spr_6   D14   opSpV0100002085                        -             -
                                GTACTTATGCTTCCTGGTGTGTTCTCCTTGTTTTATTCAGATAAGCTGTCC
Spr_6   D16   opSpV0100002086                        ref|NC_003098.1|:681354-682439
                                                                   NC_003098.1
                                GATGATAAAGGAATGGCTATCGGTGCTCGTCACATCACGGTTTCAACCTC
Spr_6   D18   opSpV0100002087                        gb|AE007317|:1205740-1205987
                                                                   AE007317
                                CTACCCATGGACTTTGAGGCATTCATTGTTCCATCTTCTAGTGGCGAATCT
Spr_6   D20   opSpV0100002088                        -             -
                                ATGATAAATCCTCTTTCTAAGAAATCTCTCCCTATTATACCAAAAAAAGCAA
Spr_6   D22   opSpV0100002089                        ref|NC_003098.1|:c1838463-1837312
                                                                   NC_003098.1
                                AATTCCCAGTTGTCGTTGCAAATGGAACTGCACGCCTCAAATCGACAGGT
Spr_6   D24   opSpV0100002090                        -             -
                                CCAATCACTTTTAAAGATGAAAATCAAAGGGCAAACTAGAAAACTAGCCGC
Spr_6   F02   opSpV0100002091                        ref|NC_003098.1|:c218387-217611
                                                                   NC_003098.1
                                AGGTATTAAAAGACAAAGAATTTTACGAAGAATCCGGTGGAGGTTTAACTT
Spr_6   F04   opSpV0100002092                        ref|NC_003098.1|:1894119-1894691
                                                                   NC_003098.1
                                TATTTCGGTTTTTTTGACGTCAATTGTGTTAATTGTATCAGCGATTCCAAGT
Spr_6   F06   opSpV0100002093                        -             -
                                TTAAGCCAGAATATACGAGTACCACGCGAATTTACGTAGTGAATCGCAATC
Spr_6   F08   opSpV0100002094                        ref|NC_003098.1|:1941478-1942221
                                                                   NC_003098.1
                                GGAAACGCCGTATCGCTTAACCACATGTTTGCAGACACTCGTAACCGTGA
Spr_6   F10   opSpV0100002095                        gb|AE007317|:761603-761882
                                                                   AE007317
                                GTTTAGCCAAGTCATAGTAAGGACTAAACATATCCATAGTAATAATTTTGAC
Spr_6   F12   opSpV0100002096                        -             -
                                ATAATTTTTTGTCCCAATATGAACTCTACTATGTGGGACAATCACATAGTTC
Spr_6   F14   opSpV0100002097                        ref|NC_003098.1|:c1447066-1444730
                                                                   NC_003098.1
                                GCCTCTCAAGTCATCCGTTGTAAACTCGTCGACAGCTCTTTTGGGAATGT
Spr_6   F16   opSpV0100002098                        ref|NC_003098.1|:c1221530-1220544
                                                                   NC_003098.1
                                TCGAGCTGTGGTGTCATGAATGTCTATGCTAATGATGAAAGCCCACAGTC
Spr_6   F18   opSpV0100002099                        ref|NC_003098.1|:c96342-95749
                                                                   NC_003098.1
                                TTGCAGTTTCCATACTGGGTATCATCGGCGGATTCCTATTTTTAGTTGAAA
Spr_6   F20   opSpV0100002100                        ref|NC_003098.1|:701014-701271
                                                                   NC_003098.1
                                ATATGTACGAACTGGTTGGGGAGGTGCTGAAAACTATGTCCAACTCTTTG
Spr_6   F22   opSpV0100002101                        ref|NC_003098.1|:1037149-1037928
                                                                   NC_003098.1
                                TTTCCAAGCCGTTCAAGACCAAGCCTTGTCGATTGGAATTGGTATCATAGA
Spr_6   F24   opSpV0100002102                        ref|NC_003098.1|:c1531843-1531451
                                                                   NC_003098.1
                                GTATAGTAAATTCTAATGGAGAAGCTCGTAGTGGAGAATCGTTAACAACCT
Spr_6   H02   opSpV0100002103                        ref|NC_003098.1|:768897-770309
                                                                   NC_003098.1
                                ACGTGCTTATTTAGCAGGGGCTTCTGCCCAGTACGAGTCAGAAGTGGTTT
Spr_6   H04   opSpV0100002104                        ref|NC_003098.1|:131851-132333
                                                                   NC_003098.1
                                CGGCGTTTCCTATCACAATATCGAGTTTCATTATCTGGTGGATTTGCTTGA
Spr_6   H06   opSpV0100002105                        ref|NC_003098.1|:c1815058-1814648
                                                                   NC_003098.1
                                ATGGAGACCAATATACAGGTGGCTTCAACAATGGAGCCTTCAACGGAAAA
Spr_6   H08   opSpV0100002106                        ref|NC_003098.1|:193581-194087
                                                                   NC_003098.1
                                ATTTCTTAATCTCCGGTTGCGCCTCAGTAACTTTCTACTAGAAGAAGGTGG
Spr_6   H10   opSpV0100002107                        ref|NC_003098.1|:205609-206919
                                                                   NC_003098.1
                                TGTTATCTTTGCCAGTTCGATTACTGCAGCGCCTGCGGCTATTCTTCAGTT
Spr_6   H12   opSpV0100002108                        ref|NC_003098.1|:c827275-826466
                                                                   NC_003098.1
                                AGATTATGGCCATGGGCGATGCTAATAACGATATCGAAATGCTCCAGTTTG
Spr_6   H14   opSpV0100002109                        ref|NC_003098.1|:803555-804427
                                                                   NC_003098.1
                                AAATTAGCCACATTAGGAATCTGTTCAGCCTTGTTTTTAGGCTTGGCTGCT
Spr_6   H16   opSpV0100002110                        ref|NC_003098.1|:c458712-456379
                                                                   NC_003098.1
                                CTATCTCAACTCCATACTATACAGACGCCTTCTCAATGAAAACGCCACGCT
Spr_6   H18   opSpV0100002111                        ref|NC_003098.1|:843969-844526
                                                                   NC_003098.1
                                TGACCGTGTACATGTAGAATACTATGGAGTCGAAACTCCTCTTAACCAAAT
Spr_6   H20   opSpV0100002112                        ref|NC_003098.1|:c1371721-1371422
                                                                   NC_003098.1
                                TATACGACTGATATGAGAAGACGCCTCGCTATCCACAATAGTGGGAAGGG
Spr_6   H22   opSpV0100002113                        ref|NC_003098.1|:c818001-817081
                                                                   NC_003098.1
                                ATTCTCCACTATCATAACCAAAAATTTTCGCCTGATAAGAAACAGGCTAGC
Spr_6   H24   opSpV0100002114                        -             -
                                ATGCTGAACTAGCAAACCATGAATCAAAAGAAGAGCCTATTACAGCAGATG
Spr_6   J02   opSpV0100002115                        -             -
                                TTTCTGTTATGGATACTGAAATGCTTGCTTGCGTTGAAGGTGGCGGATGC
Spr_6   J04   opSpV0100002116                        gb|AE007317|:1784368-1784589
                                                                   AE007317
                                TACAAGTAGAGGTACTGATTGAAGCTCTATATCTACTTACAAAAGTGAAGA
Spr_6   J06   opSpV0100002117                        -             -
                                GTAATATGAGTATTGTAGGTCCTAGACCAGCGGGTATAAATGAACTAGATT
Spr_6   J08   opSpV0100002118                        ref|NC_003098.1|:1986304-1987314
                                                                   NC_003098.1
                                GAAAACCCTGTCTCTATCCAACTTTTTGGTAGCGATGAAGACAGCCTAGCA
Spr_6   J10   opSpV0100002119                        ref|NC_003098.1|:c300812-300618
                                                                   NC_003098.1
                                AGGAATTGGGTATTTCCCAGCTCGAACTCGCCAAGGATATCGGTGTCTCG
Spr_6   J12   opSpV0100002120                        ref|NC_003098.1|:994115-994459
                                                                   NC_003098.1
                                AGAGTGGCGAATACGGCTTAGATGTCGTGTGTGCATCGGTTTCTACGCTT
Spr_6   J14   opSpV0100002121                        -             -
                                CGGAGCAAATAATGTCTACAGATATAAAGGCACTGGTGCTGACGGCTATC
Spr_6   J16   opSpV0100002122                        ref|NC_003098.1|:1576403-1577356
                                                                   NC_003098.1
                                AGAAACATGGCCCAACAGATTAACACTTGTCACCTTGCCGCCAGTGAAAG
Spr_6   J18   opSpV0100002123                        ref|NC_003098.1|:886559-886924
                                                                   NC_003098.1
                                TGCGTTCAAAGCTATGGGCTACACTCGAAAAAAAGAACCACACCTACTATG
Spr_6   J20   opSpV0100002124                        ref|NC_003098.1|:c1498224-1497340
                                                                   NC_003098.1
                                TATCTTCTGCTGGGATGGTGGATCCGGATAAGGGTGAGATTTTCTATGCT
Spr_6   J22   opSpV0100002125                        ref|NC_003098.1|:c1553669-1552473
                                                                   NC_003098.1
                                AATGACAATGTAGCTCAGACCCGTGACATCATGGATTTCTGGCGACCAAA
Spr_6   J24   opSpV0100002126                        ref|NC_003098.1|:715231-715803
                                                                   NC_003098.1
                                AGTATCAGATTAGCTCTGGTCTTGTCATTGGTGATCGGCCGATTGATATCG
Spr_6   L02   opSpV0100002127                        ref|NC_003098.1|:713340-714590
                                                                   NC_003098.1
                                GAATTTCTTTGGAAGGTGACCCCCTTTCTATATATTTTAGGCTTGGGACTT
Spr_6   L04   opSpV0100002128                        ref|NC_003098.1|:357510-357947
                                                                   NC_003098.1
                                CGTTCAAGTCCCTAGAGGGGTTGATTTTGGGAATGTATCTAACCCTCAAG
Spr_6   L06   opSpV0100002129                        ref|NC_003098.1|:1194544-1194648
                                                                   NC_003098.1
                                TAAATCAAGTGCCTTAAAGATTCCGACTAATATTGGCTTTGCATTTATTCCT
Spr_6   L08   opSpV0100002130                        ref|NC_003098.1|:c1523870-1522746
                                                                   NC_003098.1
                                TTGATTGGCTCCAATGGGGATAAGGAAATCACTGCAACTCAGGTAGCGAC
Spr_6   L10   opSpV0100002131                        -             -
                                ATGCAGTTAACTCCAAAAATAATGTTGGAAAGAATTTCATCGATGTTTACC
Spr_6   L12   opSpV0100002132                        -             -
                                GACGAAGTCAGCTCAAACACCGTTTTGAGGTTGCAGATAGAACTGACGAA
Spr_6   L14   opSpV0100002133                        ref|NC_003098.1|:189502-191058
                                                                   NC_003098.1
                                AGTGAGCGCTTGTCGCCATCGGCGATTTTGTCCCCGTTGCACTATACAGC
Spr_6   L16   opSpV0100002134                        ref|NC_003098.1|:c2004533-2002560
                                                                   NC_003098.1
                                TCAGCTCGAAGTCGTAGTAAACTGAATGTACAACGGATTATGGAAGAGTT
Spr_6   L18   opSpV0100002135                        -             -
                                CTAATGAAGCCACCCAATCAGGTGGCTTTTTTGCGGTACGACGGGCATGT
Spr_6   L20   opSpV0100002136                        ref|NC_003098.1|:490168-490725
                                                                   NC_003098.1
                                TAGTTTGCCAGAGGTCGCCTATCCAGCAGGTTTTCCTCCAGTCAAGACCT
Spr_6   L22   opSpV0100002137                        ref|NC_003098.1|:1286956-1287540
                                                                   NC_003098.1
                                TTAAATACAATATGCTTTCTTATGCAATCTTCAGCACATGGATATGTAGCTC
Spr_6   L24   opSpV0100002138                        ref|NC_003098.1|:855881-856081
                                                                   NC_003098.1
                                ACGTTTCAAACGTACAGGTTCTGGTGGACTTAAACGTTTCCGTGCTTACAC
Spr_6   N02   opSpV0100002139                        ref|NC_003098.1|:265664-267136
                                                                   NC_003098.1
                                AGCTATCTGTTTTGCGATTTCAAGCTTCTTTAGCCCACTTCTAGCGATCGT
Spr_6   N04   opSpV0100002140                        ref|NC_003098.1|:210516-210875
                                                                   NC_003098.1
                                TGGATGAATATTTTACGATGATGGCTGTTGTATCTAGTGATGAAAAGCAAG
Spr_6   N06   opSpV0100002141                        ref|NC_003098.1|:199251-199904
                                                                   NC_003098.1
                                AATCAAAACTCAAGTATCAGGTCGTTTGAACGGTGCAGATATCGCCCGTG
Spr_6   N08   opSpV0100002142                        -             -
                                TGTTTAGGAAAATTGTTGCTTTGTTAGTCATAGGATTAATCCTATTAGGGA
Spr_6   N10   opSpV0100002143                        ref|NC_003098.1|:c1663955-1663434
                                                                   NC_003098.1
                                CCTCTTTCTAAATCCAGGTTCTATCAGTCAACCACGAGGTACCATCAGAGA
Spr_6   N12   opSpV0100002144                        gb|AE007317|:1061638-1061969
                                                                   AE007317
                                AAGCATTTTCTGGATTTTCCTTCAATTTCCTTTCAGATAACTTGCTGAAAAT
Spr_6   N14   opSpV0100002145                        -             -
                                TTCTCTTCGCTTTTCAAACCTATCTTATTTATCTATCCATAAGTATCTCCGA
Spr_6   N16   opSpV0100002146                        ref|NC_003098.1|:524940-525587
                                                                   NC_003098.1
                                TTCAAGGAGAGGATATTCGTAAGAAGGGCTATTCTTACCATCGCATGCAC
Spr_6   N18   opSpV0100002147                        ref|NC_003098.1|:c1375311-1374841
                                                                   NC_003098.1
                                ATGACACGTGACGCTGAGTTGCGTTATACCCCATCAAATGTAGCAGTTGC
Spr_6   N20   opSpV0100002148                        gb|AE007317|:1479898-1480464
                                                                   AE007317
                                ACCAATCTTATCCCTAATATCAAATTCCTATTTTATCTTACTACTGTTAGCT
Spr_6   N22   opSpV0100002149                        gb|AE007317|:721527-721894
                                                                   AE007317
                                ATGACGCGCTTACGTAACTTGTAACTAGCTGCCTAGTTTGATCTTTGCTTC
Spr_6   N24   opSpV0100002150                        ref|NC_003098.1|:301940-302257
                                                                   NC_003098.1
                                ATACTACAGATGCAACTTAAACGGTTTTCGCGTGTGGAAAAAGCTTTTTAC
Spr_6   P02   opSpV0100002151                        ref|NC_003098.1|:218461-219255
                                                                   NC_003098.1
                                TGAAACAATAATGATAGAATCTGGATCGACCTGTGCTTTACTTGCTGAGGA
Spr_6   P04   opSpV0100002152                        gb|AE007317|:1071533-1071765
                                                                   AE007317
                                TGATTTCTAATTCACCTGTGATCATGCCTAATATTACTTAGTAACACTCACC
Spr_6   P06   opSpV0100002153                        gb|AE007317|:726205-726432
                                                                   AE007317
                                AATTTTTGTGAATTTGGACTATAAAAAAATCCTATTTGTGAGACAAAAAGGA
Spr_6   P08   opSpV0100002154                        ref|NC_003098.1|:c1772229-1771588
                                                                   NC_003098.1
                                TCTATCAGGGGAAAGATTTAAAAACCATTCCCACTCGTGAGTATTTTCGAG
Spr_6   P10   opSpV0100002155                        ref|NC_003098.1|:c1340763-1339597
                                                                   NC_003098.1
                                CATCCACCCTATTAATGTTCTCTTTGTTTTGTTAACTTCAGGATCTATGTTT
Spr_6   P12   opSpV0100002156                        ref|NC_003098.1|:745591-746676
                                                                   NC_003098.1
                                CTATCGGATTTAACGGAATGGCGGTTAGTTTGCTTGCGGCCAACTCACCA
Spr_6   P14   opSpV0100002157                        ref|NC_003098.1|:1322922-1324004
                                                                   NC_003098.1
                                CCTGTCAGACCTTGGGAATGCCGAGGAAAAACTACAGTATCGTGATATAT
Spr_6   P16   opSpV0100002158                        ref|NC_003098.1|:c1613465-1613097
                                                                   NC_003098.1
                                TATGATATTTGTGAAATGGTGTTTGCCTTTCATTTACCTCCTGATGAGTTG
Spr_6   P18   opSpV0100002159                        -             -
                                GTACTTCCAGAAATTATAGATCCCCTTTCATCCCCAATTTCTATTTTCAAGT
Spr_6   P20   opSpV0100002160                        ref|NC_003098.1|:955253-955474
                                                                   NC_003098.1
                                ACAAATAGCTAAAATACTTTCGTTTACAAACTCAGCTTATGCTAAAATTGAA
Spr_6   P22   opSpV0100002161                        ref|NC_003098.1|:c1485986-1485447
                                                                   NC_003098.1
                                TTTAAAAGATAGATTCGATAGATTTATAGATTATTTTACGGAGGATGAGGA
Spr_6   P24   opSpV0100002162                        -             -
                                TCATACCCGTCTTTCTAGCAAAGATCTTTGGAGTGCCTTTCCAACTTCTAA
Spr_6   B01   EMPTY             -                    -             -
Spr_6   B03   opSpV0100002163                        ref|NC_003098.1|:837801-838145
                                                                   NC_003098.1
                                AAGGCCAAGCATGTTCGTGAAAGTGTCCGTCGCATTTACCGTGATGGATT
Spr_6   B05   opSpV0100002164                        ref|NC_003098.1|:c1604240-1603509
                                                                   NC_003098.1
                                GGACTCAGAAAACAATATTATATCTGTAGATGTTGTTATGCCTGATGCACG
Spr_6   B07   opSpV0100002165                        -             -
                                CACGGACTACCTGCCTCTTGAAAAAAGATGCCTGTCTTGCCTTTCGTGGA
Spr_6   B09   opSpV0100002166                        ref|NC_003098.1|:c1192466-1190838
                                                                   NC_003098.1
                                GTATCCCTTACGTTTGGCAAAATGGTGATGGTTTAGTTCCATATTTGTTAT
Spr_6   B11   opSpV0100002167                        ref|NC_003098.1|:c1971211-1970972
                                                                   NC_003098.1
                                CTTGGATAGTATGGGAACGGTTGAGTTGATTGTGGAGATTGAGAACCGTT
Spr_6   B13   opSpV0100002168                        gb|AE007317|:173760-174162
                                                                   AE007317
                                ATACTGTCGGCTTTGGAATTTCACCAAATCATGCCTTTCGGCTCGTGGGC
Spr_6   B15   opSpV0100002169                        gb|AE007317|:74748-75310
                                                                   AE007317
                                TTTGTAGCCTTGCTCTAAGGTACTTAATGGAAGATTTTTGGCACCTGGTGC
Spr_6   B17   opSpV0100002170                        ref|NC_003098.1|:c1342384-1341965
                                                                   NC_003098.1
                                TGTATCGGTTCGAACTCTGGATGGTGAGATGGGGATCTTGCCACGACATG
Spr_6   B19   opSpV0100002171                        ref|NC_003098.1|:c1980276-1979572
                                                                   NC_003098.1
                                ATCGGAACCTTTGCAGTGGGAACTTTGATTGTCGGTATCGGTCTATCACT
Spr_6   B21   opSpV0100002172                        ref|NC_003098.1|:c1962517-1961864
                                                                   NC_003098.1
                                GTATTAGCTTGTCTCAGAGAACCACTTCCAGCGAGTCATTATATGATTGCA
Spr_6   B23   opSpV0100002173                        gb|AE007317|:632362-632575
                                                                   AE007317
                                GAACCTCCCATCTAGAAATAATACAGTTATTGTAGCACTTAAAATCTTCTTT
Spr_6   D01   opSpV0100002174                        ref|NC_003098.1|:c1691667-1691594, ref|NC_0
                                                                   NC_003098.1
                                CCTTAGCTCAACTGGATAGAGTACCTGACTACGAATCAGGCGGTTAGAGG
Spr_6   D03   opSpV0100002175                        ref|NC_003098.1|:c1508202-1507099
                                                                   NC_003098.1
                                TTGTATCACCACATCCATGAATTGGATTGCGTTCAATTCCTTATGGGGGGC
Spr_6   D05   opSpV0100002176                        gb|AE007317|:1479382-1479756
                                                                   AE007317
                                TGTTTCTTTTGAACTATTGGATGTTGCTACTGTCTTCTCATCATTACTTGTT
Spr_6   D07   opSpV0100002177                        ref|NC_003098.1|:759737-760939
                                                                   NC_003098.1
                                AGAAGAAGGACGTGTATCACTTTCACTTAAAGCAACAGTACCAGGACCATG
Spr_6   D09   opSpV0100002178                        ref|NC_003098.1|:44068-45417
                                                                   NC_003098.1
                                GTAGCAAGAATCAAGGTCGGTGATTCTGTTCGCTATACTACGACTCATGA
Spr_6   D11   opSpV0100002179                        ref|NC_003098.1|:c1255628-1254711
                                                                   NC_003098.1
                                ATTGGTGCAGCAGTTTTTATGACCGAAGTATCACCAAAAGGGGCGAAGAT
Spr_6   D13   opSpV0100002180                        ref|NC_003098.1|:552212-553249
                                                                   NC_003098.1
                                CTTTGGCGAAAGAGCAAGATATTCCATTTAAGCTGGATATCTATCCATTTT
Spr_6   D15   opSpV0100002181                        ref|NC_003098.1|:79660-80070
                                                                   NC_003098.1
                                CTGCTCAACCGATCTGGAACAGCGGAGCATCTGGCAAAAAAACGCCAATT
Spr_6   D17   opSpV0100002182                        -             -
                                AAGGAAGGTACAATGTAGAGGGGCCGTTAGTTCTTGCTAGATATTTATTG
Spr_6   D19   opSpV0100002183                        gb|AE007317|:876165-876380
                                                                   AE007317
                                AAAACGCATAGTACAAGGTTTGTACTGCCCCCCAAAAAAGTTAGACAATTA
Spr_6   D21   opSpV0100002184                        ref|NC_003098.1|:c547255-546440
                                                                   NC_003098.1
                                CGACTACGAGATTCAATTCCAAAGAACCGCCTGGGAGAGCATCTTCCCAG
Spr_6   D23   opSpV0100002185                        gb|AE007317|:461579-462057
                                                                   AE007317
                                TAGCTTCCTTACTAACTCGTCGTCGAAATAAAATCGATTTCGACTCCTCGT
Spr_6   F01   opSpV0100002186                        ref|NC_003098.1|:467597-468646
                                                                   NC_003098.1
                                GTTTCTTTGCCCTCTTTACGCAGGTCAAGGGAATTTCAAACAGCGTTAAGC
Spr_6   F03   opSpV0100002187                        ref|NC_003098.1|:c629956-629408
                                                                   NC_003098.1
                                AGTTGATTTTGCCCTTCCATATATGAAAGTTTCTCTGGGTGTCGTATCACC
Spr_6   F05   opSpV0100002188                        ref|NC_003098.1|:641532-642182
                                                                   NC_003098.1
                                CTAAAAGAGCTTCTCTTGTACTTGGCTCAAAAGGGGCTATCACGCTCTTGG
Spr_6   F07   opSpV0100002189                        ref|NC_003098.1|:c1048775-1047414
                                                                   NC_003098.1
                                AAACTGTCCATGTACCTCATGCTTTTGTTACTCCCTCTCAATAGCGGATTT
Spr_6   F09   opSpV0100002190                        gb|AE007317|:1500987-1501258
                                                                   AE007317
                                TAGTTAACTAAAACCATTCTTAAGTTTATAAGTGTCTGACAAAACTTCATAA
Spr_6   F11   opSpV0100002191                        ref|NC_003098.1|:748579-749067, ref|NC_0030
                                                                   NC_003098.1
                                TTCAAAGAGAAGCACTACGAGAATACGATTCTCCATAGTGACCAAGGCTG
Spr_6   F13   opSpV0100002192                        ref|NC_003098.1|:849329-849898
                                                                   NC_003098.1
                                GCAATGTTTGACTATGCCTCGGACAAGGGTAATACACGTTACACTTTTCCA
Spr_6   F15   opSpV0100002193                        ref|NC_003098.1|:c475104-473479
                                                                   NC_003098.1
                                ATCCTCCAACAAGTCATGAGCTTCTCCAGAGATTATCTCCTAACCGTTCTG
Spr_6   F17   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_6   F19   opSpV0100002194                        ref|NC_003098.1|:c408400-408239
                                                                   NC_003098.1
                                AACTATTGACTTTTCTTATAGTTTGTCTTTCTTCTATCTTCCATTATATCATA
Spr_6   F21   opSpV0100002195                        ref|NC_003098.1|:c264377-263358
                                                                   NC_003098.1
                                TGAAGGATGTGGCACTTGCGAATACTGTACAACTGGTCGCGAAACCCTTT
Spr_6   F23   opSpV0100002196                        ref|NC_003098.1|:c1548387-1546504
                                                                   NC_003098.1
                                GGTGGGGTTCACCAATTGATCGTCGTGTCAGGTGTGCACCACATCTTCAA
Spr_6   H01   opSpV0100002197                        ref|NC_003098.1|:431859-432689
                                                                   NC_003098.1
                                GCACATGGTATAGTTATCAGGCCTTGAAAAAAGGAGACTATATTACCTTGC
Spr_6   H03   opSpV0100002198                        -             -
                                TAGGATACTTTTCAGCTAAGCATCAAGGAAATGTAGCAGTAGCGGGAATG
Spr_6   H05   opSpV0100002199                        ref|NC_003098.1|:c1183341-1183138
                                                                   NC_003098.1
                                GTGCAGCCTTGAAAGAAGTCTTGGTTCCAAGTTTGGCTGAGAACACAAGA
Spr_6   H07   opSpV0100002200                        ref|NC_003098.1|:336266-336607
                                                                   NC_003098.1
                                ACCGAAACCTTCACCAGTTCAAGCAGAACCCCTTGAAGCGGCAATTACAA
Spr_6   H09   opSpV0100002201                        ref|NC_003098.1|:c1691225-1691152, ref|NC_0
                                                                   NC_003098.1
                                GGATGGAGCAGCTCGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAG
Spr_6   H11   opSpV0100002202                        -             -
                                GCCCAATTATCCATGTGAGTTTGAGGTAACATTTTTAGATGATTACCATAA
Spr_6   H13   opSpV0100002203                        ref|NC_003098.1|:935359-936120
                                                                   NC_003098.1
                                TATGAAGTACAATTGGCCTTAATTGCGACAAAGCCTGAATTGTCGTATCTA
Spr_6   H15   opSpV0100002204                        ref|NC_003098.1|:350229-350423
                                                                   NC_003098.1
                                AAAATTGGGTATTTCAATTATTGCGAGTACTTTATTGGCTAGCCAGTTATC
Spr_6   H17   opSpV0100002205                        ref|NC_003098.1|:1287540-1288235
                                                                   NC_003098.1
                                ATGATAAAGACCTCGGATGTAGGCGCAATAATTTCATCGATGGATAAGCTT
Spr_6   H19   opSpV0100002206                        ref|NC_003098.1|:c1171127-1170750
                                                                   NC_003098.1
                                GATTGACCAGCTTTATGATGTGGAAGTGCATGAAAAAGGAGATTATAGCTA
Spr_6   H21   opSpV0100002207                        ref|NC_003098.1|:c1651223-1650495
                                                                   NC_003098.1
                                GAAGCGCATCAAAGACTATGATGAGCGTGAACTTCGTCTTTCTACTGGTTA
Spr_6   H23   opSpV0100002208                        ref|NC_003098.1|:109269-110516
                                                                   NC_003098.1
                                CAAAAGTCAAACTGTATAAGGGGAGCGCTCAGGTCGTGGCTCGGAAATCA
Spr_6   J01   opSpV0100002209                        ref|NC_003098.1|:c1174285-1173956
                                                                   NC_003098.1
                                TCTCGCTATAATCAAGCTTCTAAATTGCCACTCGGAACGCTCATAGCTAAT
Spr_6   J03   opSpV0100002210                        ref|NC_003098.1|:643414-644217
                                                                   NC_003098.1
                                TAGATGCGGTTGGCGTAACGACTTCATCCATTCGTAAGAGCTTAGTTAAAG
Spr_6   J05   opSpV0100002211                        ref|NC_003098.1|:c1639042-1638617
                                                                   NC_003098.1
                                TGGTGGTTATCTCGCTGGGACTTGATGGGGTGACACTCCAATCCTCTATC
Spr_6   J07   opSpV0100002212                        ref|NC_003098.1|:664756-665712
                                                                   NC_003098.1
                                AATTAAAATCATCGCTTTTGTCTTTGGTGCCATTACTGCAAGTATTGCTGG
Spr_6   J09   opSpV0100002213                        ref|NC_003098.1|:c1443159-1442047
                                                                   NC_003098.1
                                TGGAAGAACTTTATCAACTGGCCCTCCAGCGCAGAGAAGAATCTCCCTTG
Spr_6   J11   opSpV0100002214                        gb|AE007317|:438631-438870
                                                                   AE007317
                                GTACCTGCTACCGTTGAAATCAATAGCGACTCCCTCTTGCCCTGTGCTAG
Spr_6   J13   opSpV0100002215                        ref|NC_003098.1|:c793357-792887
                                                                   NC_003098.1
                                AAATATGAACCTATCAAAAGTCCGCGAAGAAGATAGCGCTTATTATGTTCT
Spr_6   J15   opSpV0100002216                        ref|NC_003098.1|:c1344765-1343887
                                                                   NC_003098.1
                                GCTGATTTCTTTAAGGCTCGCGGTATTCAACCACTTTATGAATTACGTGGC
Spr_6   J17   opSpV0100002217                        -             -
                                TTTTTTCGTCGAGTCGGATGGAAGATATTGTTGAAGAATAAGCCTTCAATA
Spr_6   J19   opSpV0100002218                        ref|NC_003098.1|:1029961-1035852
                                                                   NC_003098.1
                                TCTTGCCTCTCCTGACCTTGCCAGAGAGATCCGTATTTGTCATCTCGACC
Spr_6   J21   opSpV0100002219                        ref|NC_003098.1|:720608-721261, ref|NC_0030
                                                                   NC_003098.1
                                CAGTAAACTGGGATCTTGTTGGTCTCCAATAGGAGTAGGTCCACATGTCC
Spr_6   J23   opSpV0100002220                        ref|NC_003098.1|:c2017112-2016273
                                                                   NC_003098.1
                                GCAGCTTTGTCGGATGTTTCTTTGACGATTGAAGATGGCTCTTATACAGCT
Spr_6   L01   opSpV0100002221                        ref|NC_003098.1|:1808876-1810171
                                                                   NC_003098.1
                                ATTCCACCAGCTGTTAGTAGATCATTTAGCGTATTACTTCCAGTCATGACC
Spr_6   L03   opSpV0100002222                        gb|AE007317|:719811-720198
                                                                   AE007317
                                ATCAACTAAAGAAGAAATCCAAACCATCAAAACACTTTTAAAAGACTCTCGT
Spr_6   L05   opSpV0100002223                        ref|NC_003098.1|:184352-184618
                                                                   NC_003098.1
                                TTAACCAAATCGTAGGTTACGTATTGAGTGGAGACCCTGCCTACGTTCCTC
Spr_6   L07   opSpV0100002224                        gb|AE007317|:1325488-1325712, gb|AE007317
                                                                   AE007317
                                CTTAACTTTTTTAGGATGGCATTCTCCGATCTCAGGTACTCTCTCTCTTGT
Spr_6   L09   opSpV0100002225                        ref|NC_003098.1|:c1325982-1325713, ref|NC_0
                                                                   NC_003098.1
                                TAACTTATGATGATAAAGTTCAGATCTATGAACTTAGAAAACAAGGATATAG
Spr_6   L11   opSpV0100002226                        ref|NC_003098.1|:698792-699115
                                                                   NC_003098.1
                                TCAATGGATAAGAGGCGACATGCGCCCGTCGCCAGATGGTCCAGATCGG
Spr_6   L13   opSpV0100002227                        ref|NC_003098.1|:c496486-496379
                                                                   NC_003098.1
                                CTATTGTAGACTATATTGATTACTACAACAATAAACGAATTAAGGTAAAACT
Spr_6   L15   opSpV0100002228                        gb|AE007317|:1543534-1543798
                                                                   AE007317
                                TAAATCCATTATACAGTAGCAAACTTAATTTATACCTTCCGCTCCTCAACTG
Spr_6   L17   opSpV0100002229                        gb|AE007317|:1019627-1020109
                                                                   AE007317
                                GATTTAACAACGTTTCTAGCCCCTCGGATTTTATCCGAAGGGCTATTTTTG
Spr_6   L19   opSpV0100002230                        gb|AE007317|:489321-489731
                                                                   AE007317
                                TAGAGGTGTTTTGAATCCCACATTTTACAGAAAGTGGCGGCGCTGAGAAG
Spr_6   L21   opSpV0100002231                       ref|NC_003098.1|:341169-341858
                                                                  NC_003098.1
                                TTTCGGCGATCTTCCGAGGTCGGGACTTCATTGATCAACACTGCAGTCTG
Spr_6   L23   opSpV0100002232                       ref|NC_003098.1|:59175-60473
                                                                  NC_003098.1
                                CAACCGTTACTCTCGCCCTGAGATGGCGAATATTTGGAGTGAAGAAAATA
Spr_6   N01   opSpV0100002233                       ref|NC_003098.1|:16748-16820, ref|NC_003098
                                                                  NC_003098.1
                                CCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCAGCGG
Spr_6   N03   opSpV0100002234                       ref|NC_003098.1|:c1513458-1512121
                                                                  NC_003098.1
                                ACTAAATGGACTACAGGTTTAGCAAATGGAAATGTGCCAGATATCAGTACA
Spr_6   N05   opSpV0100002235                       ref|NC_003098.1|:221110-222432
                                                                  NC_003098.1
                                ATTTTGCTAAGATCATCTTATATCCCTAAACAAGGTGAGGCGATTGGGGAC
Spr_6   N07   opSpV0100002236                       ref|NC_003098.1|:909208-909807
                                                                  NC_003098.1
                                ACAGTTGTACTATCGTTATGGGACCATGAACTCTGGTAAAACGATTGAGAT
Spr_6   N09   opSpV0100002237                       ref|NC_003098.1|:c1827465-1826479
                                                                  NC_003098.1
                                GAGGCTACACTTTCAAATGATTATAACCGTCGTAGCATCAATCTACAAATT
Spr_6   N11   opSpV0100002238                       -             -
                                GTTCTAACCAAAAGGAGCCTGAAATTTACTTTCGGGCCCCTCCTCTTATTT
Spr_6   N13   opSpV0100002239                       ref|NC_003098.1|:c534255-533461
                                                                  NC_003098.1
                                TATTCTATCTGGCTACACTAGTAAACGGACAGCACTACTAGATGATAGTTT
Spr_6   N15   opSpV0100002240                       ref|NC_003098.1|:c1217035-1215716
                                                                  NC_003098.1
                                GACAGTTAAAATTGCTTTACTAGGATTTGGTACCGTTGCAAGTGGTGTGCC
Spr_6   N17   opSpV0100002241                       ref|NC_003098.1|:503580-504995
                                                                  NC_003098.1
                                AGCTATTACATGAGTGTGACTCAATCTGCTCTTCCAACACAGTATAATTCA
Spr_6   N19   opSpV0100002242                       ref|NC_003098.1|:c1265904-1264954
                                                                  NC_003098.1
                                GGTTTGGTGGTTCCAGAGGAGATGTTAAAGGCTGCTAGAGAATGTAAGAT
Spr_6   N21   opSpV0100002243                       ref|NC_003098.1|:c1824194-1823913
                                                                  NC_003098.1
                                TGAAAATGCTCTCCGTAAGCTTAATCAAACAGATTTTACAGTCAATTCATG
Spr_6   N23   opSpV0100002244                       ref|NC_003098.1|:c1292136-1291786
                                                                  NC_003098.1
                                ATCTATCTAGCCTAGGGCAGGTCTATCTCGTGTGTGGGAAGACTGATATG
Spr_6   P01   opSpV0100002245                       ref|NC_003098.1|:c1675431-1674505
                                                                  NC_003098.1
                                TTGACTTACTCAATCGGAGCTGGATTCTGGAATCTGATTTTTGCCATGAGC
Spr_6   P03   opSpV0100002246                       gb|AE007317|:1665694-1665899
                                                                  AE007317
                                TATGATTCCTTGTACTGAACGAACTGACCGACAGCTTGATAGAATGTCAAC
Spr_6   P05   opSpV0100002247                       gb|AE007317|:289280-289482
                                                                  AE007317
                                GAGGATCCCTTTAGGGATAGTGGTAAGTAATACCAAAGTCTCTTAAAGAGG
Spr_6   P07   opSpV0100002248                       ref|NC_003098.1|:c532761-532102
                                                                  NC_003098.1
                                CCAAATTCTCATGGGCCGTTATTTCGAACCAGAGCAGGTCTTCAGTCTTTA
Spr_6   P09   opSpV0100002249                       -             -
                                ATGTTAATCAGGAATCATGGTGATGTGGCATGAATCACAATAACGGATATG
Spr_6   P11   opSpV0100002250                       gb|AE007317|:299915-300142
                                                                  AE007317
                                GCTCCTAAATCAACTGTTTTTGATCTACTTCTTTAACTACTTGATAAAAGTT
Spr_6   P13   opSpV0100002251                       ref|NC_003098.1|:c1369469-1369185
                                                                  NC_003098.1
                                TTGACAGAAAAACAGCAGGAGCTCTATGACATTTTAGGAGATGTTAATCCT
Spr_6   P15   opSpV0100002252                       -             -
                                AAAATATCAACTAGACGATAAGGGGCGCGCACAAGTGACCCGTTATCACG
Spr_6   P17   opSpV0100002253                       ref|NC_003098.1|:113839-115773
                                                                  NC_003098.1
                                AAGGAATAGTAAGTTCTACGTAGCAGACCCTGCTAGTGGCATACGCAAGA
Spr_6   P19   opSpV0100002254                       ref|NC_003098.1|:35811-36980
                                                                  NC_003098.1
                                GTGATGAGGTTTACTCAGAATTGACCTACACAGGCGAAGCCCATGTGTCT
Spr_6   P21   opSpV0100002255                       ref|NC_003098.1|:2009766-2009945, ref|NC_00
                                                                  NC_003098.1
                                ACAAGTGTGGAAAGAGATTCGTAAACGTGGATTTAAGAATAAAGCCTTTCG
Spr_6   P23   opSpV0100002256                       ref|NC_003098.1|:c284913-284437
                                                                  NC_003098.1
                                GATTTTTCCGTTTTGAACCAAAACAACCAAGCAACTCCCTTGGATAGCTAT
Spr_7   A01   EMPTY             -                   -             -
Spr_7   A03   opSpV0100002257                       ref|NC_003098.1|:c1776834-1776061
                                                                  NC_003098.1
                                CTTTTGTTGTCCATACCCGTGATGCGCTGGAAGATACCTATGAGATTATCA
Spr_7   A05   opSpV0100002258                       ref|NC_003098.1|:c1410388-1409498
                                                                  NC_003098.1
                                TTGAGCCGATTCTGCCAAGTTACCAAAAGGAAGGTAAGTCCGTTTTGACC
Spr_7   A07   opSpV0100002259                       ref|NC_003098.1|:c1729615-1729172
                                                                  NC_003098.1
                                ATCTTTGGTGGCGGCGTGACTGTTATTGAGTGGGGAAATCTCTTAGGAGA
Spr_7   A09   opSpV0100002260                       -             -
                                CAATAGAACTGACAAACCCTGTAATATACCTGCATATATACATACGACAAG
Spr_7   A11   opSpV0100002261                       -             -
                                TAAAAATATGTCAGACAATCGTCGTACGAAAATTGCACAATTCGTATCTCT
Spr_7   A13   opSpV0100002262                       ref|NC_003098.1|:703224-704099
                                                                  NC_003098.1
                                TTTGACTTCCTTTGTTTTTGCGACTATGAGAAACAGTCAATGGCATGATAT
Spr_7   A15   opSpV0100002263                       ref|NC_003098.1|:14254-14733, ref|NC_003098
                                                                  NC_003098.1
                                CGATTTCGAGGGCGTCAAAGAGTATTAAGAGACTTACGCATTGTGTTTAAG
Spr_7   A17   opSpV0100002264                       ref|NC_003098.1|:967907-969232
                                                                  NC_003098.1
                                CTAGTGAGACGGCTCTTTACTATAAAGCGGCGGATTTCTTCATTTCGGCA
Spr_7   A19   opSpV0100002265                       ref|NC_003098.1|:c1512042-1511158
                                                                  NC_003098.1
                                CAAGTTTTAGTAGGGTTTGTATTGGCTTTAGCTCTTCACAGAGTACGCCAC
Spr_7   A21   opSpV0100002266                       ref|NC_003098.1|:c1660220-1659978
                                                                  NC_003098.1
                                TTTTACCAACGTTTTATCTCACCAGTCTTTCCACCCTCTTGTCGCTTTGAG
Spr_7   A23   opSpV0100002267                       -             -
                                CTCCTAGTTTGCTCTTTGATTTTCATTGAGTATAAATCATTCAATGTAAATG
Spr_7   C01   opSpV0100002268                       ref|NC_003098.1|:1645644-1646180
                                                                  NC_003098.1
                                CTTCTTCTGGACCAGCTCTGCCGCTACCTCTTCCATCATCTTTTTGAAAGA
Spr_7   C03   opSpV0100002269                       ref|NC_003098.1|:198894-199238
                                                                  NC_003098.1
                                TTCTTGATAACATCCGTGGTAAAAGCGTAGCCGATGCAATCGCAATCTTGA
Spr_7   C05   opSpV0100002270                       ref|NC_003098.1|:c1520396-1519416
                                                                  NC_003098.1
                                GCAGCGCTCAATCCTCGAATTCAGAAAACAGTTGCCATTTATCCCTTCTTG
Spr_7   C07   opSpV0100002271                       ref|NC_003098.1|:746679-747635
                                                                  NC_003098.1
                                CTTCTCAGTGACAACTATTGTTGGACCTGGATTTATCGCCCTTGCTGCGAT
Spr_7   C09   opSpV0100002272                       gb|AE007317|:1697169-1697430, gb|AE007317
                                                                  AE007317
                                TCATTTCTGTCACTGACAGATTTATTGTTTTTTTCATTGTTCAGTACTACAA
Spr_7   C11   opSpV0100002273                       ref|NC_003098.1|:666476-667186
                                                                  NC_003098.1
                                GACAACTATTCTTCGCACCTTGTCAGGTTTGGTTCGACCAAGTTCAGGAAA
Spr_7   C13   opSpV0100002274                       ref|NC_003098.1|:1483442-1483642
                                                                  NC_003098.1
                                GGACTCACACCATCTCCTGCTCGCTGGGAATATAAGGATAAGATATTGTTC
Spr_7   C15   opSpV0100002275                       ref|NC_003098.1|:742822-743946
                                                                  NC_003098.1
                                ACTTGCTGCATGTGGTAACCGCTCTTCTCGTAACGCAGCTTCATCTTCTGA
Spr_7   C17   opSpV0100002276                       ref|NC_003098.1|:c1441746-1440727
                                                                  NC_003098.1
                                CATCTTGGAAGATTTCCCACTTTCAGTGACCAACCCATACGGTCGTACTAA
Spr_7   C19   opSpV0100002277                       ref|NC_003098.1|:c1399944-1398073
                                                                  NC_003098.1
                                TTTGTCAACACGGATTTTCGAGTTGGATCGTGCAGGCTTGACCGAGTACC
Spr_7   C21   opSpV0100002278                       ref|NC_003098.1|:688409-688927
                                                                  NC_003098.1
                                TGTCCAAACAGTGACCATCGCTAGCCACCGTAAACAGAAGAACTTTGACA
Spr_7   C23   opSpV0100002279                       gb|AE007317|:1292357-1292605
                                                                  AE007317
                                ATGTTCCCGTTTTAATCCCAGTTACAGTTTTTAATCCTCTGTAACCGTTGAT
Spr_7   E01   opSpV0100002280                       ref|NC_003098.1|:c1243857-1242787
                                                                  NC_003098.1
                                ACACTAAGATAAAGCAGGGTGGAACGACCTACGATATTGCCATTCCAAGT
Spr_7   E03   opSpV0100002281                       -             -
                                TCCTGTTGTAAAAAAGATTAAGGAGGACGTGCGTGGAATTACTGATTTACC
Spr_7   E05   opSpV0100002282                        ref|NC_003098.1|:c1711068-1710898
                                                                   NC_003098.1
                                CTTATGGCTATTTTGAATCCTATCATGATGGGGATTTCAAGTGGTTTGAGT
Spr_7   E07   opSpV0100002283                        ref|NC_003098.1|:1863387-1863701
                                                                   NC_003098.1
                                AATGAGTTTGATAACGCATAGACGTTTTATCTCGTGTAATGAAAACATCAA
Spr_7   E09   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_7   E11   opSpV0100002284                        ref|NC_003098.1|:c1008360-1008187
                                                                   NC_003098.1
                                GAGATTATTTTCACAAGCTTGATTTTTCAAAGTATACTCAATAAAAATAAAA
Spr_7   E13   opSpV0100002285                        ref|NC_003098.1|:c1563485-1561089
                                                                   NC_003098.1
                                GGAATCAGACGACAACTCGGCTATCCACCTTACTATTTCACGATTGGTATT
Spr_7   E15   opSpV0100002286                        ref|NC_003098.1|:421837-422181
                                                                   NC_003098.1
                                TCTGCAAACGACTCAATAGTGTCTGCCCATCGAGAACAGACTAATTTATTA
Spr_7   E17   opSpV0100002287                        ref|NC_003098.1|:320264-321133
                                                                   NC_003098.1
                                GCTCAGGTACCCGTCTGTATCCACTTACTCGAGCTACATCGAAACAGCTG
Spr_7   E19   opSpV0100002288                        ref|NC_003098.1|:1699822-1700355
                                                                   NC_003098.1
                                AAGCATGATGGGAGTCTCCACCGAACTTGGCGGGACACCATGGTACTAAA
Spr_7   E21   opSpV0100002289                        gb|AE007317|:786248-786502
                                                                   AE007317
                                TTAATATTTCAATTGAGTCATAGTATTGTGTTTGCGTATCCTTAAATCAGCT
Spr_7   E23   opSpV0100002290                        ref|NC_003098.1|:c1310774-1309395
                                                                   NC_003098.1
                                ATATTGCAATTAGCATGGGAATCCACATGTTCTCACTTGCTATCCAAGAGC
Spr_7   G01   opSpV0100002291                        gb|AE007317|:999163-999367
                                                                   AE007317
                                AAATAATAGACTTGTGCGATAACTATTTGAAACAAGATTAGCTGGTTAGAA
Spr_7   G03   opSpV0100002292                        -             -
                                TTACAAAGAAAATCTGAAATAACTGTTATGATATAGCAGATTGAAACTAGAA
Spr_7   G05   opSpV0100002293                        -             -
                                GTTGGAAGCTGTATTCCAACCTCTTATTTTGGGAGAAAAGAATGAAATTTT
Spr_7   G07   opSpV0100002294                        ref|NC_003098.1|:c1826428-1825805
                                                                   NC_003098.1
                                AGTCAGTTTCATCGAACGTAAGAAGGATGAGCAAACACTGGGCAAGCAGG
Spr_7   G09   opSpV0100002295                        ref|NC_003098.1|:c352891-352538
                                                                   NC_003098.1
                                AAACAATGTTGGAACAGGCATTCACAGAGAAACACTATGGTGGAGTCCTT
Spr_7   G11   opSpV0100002296                        ref|NC_003098.1|:464641-465759
                                                                   NC_003098.1
                                GGAAGCTAGCGACAAGTTTGAACGTGAAGGAACGACTATCTTCTACAATC
Spr_7   G13   opSpV0100002297                        ref|NC_003098.1|:c1273692-1272232
                                                                   NC_003098.1
                                GGGATTCACAATAAGAAGGCGGTCTTTGAGGTGTATTTCCGCCAACAGCC
Spr_7   G15   opSpV0100002298                        ref|NC_003098.1|:c1369084-1368890
                                                                   NC_003098.1
                                ACTTGAAAACAAATTGGAACAAGCAACAGGCGCTGTCAAAGAAGGTTTTG
Spr_7   G17   opSpV0100002299                        ref|NC_003098.1|:c1960502-1959729
                                                                   NC_003098.1
                                GCCACTATTGACTATAATGGACCGTTATTTATGATTCACCGTCCGTTAGTT
Spr_7   G19   opSpV0100002300                        ref|NC_003098.1|:1061970-1062206
                                                                   NC_003098.1
                                ACAATTGTGTCCAATGTAAAATGACCAAGCGTTTCTTGGACAGTAATAATG
Spr_7   G21   opSpV0100002301                        ref|NC_003098.1|:677862-678797
                                                                   NC_003098.1
                                TTGAGACAACAGACCGGATTTTGGCAGAAGTGTTTGCTTACTTCACCAAAC
Spr_7   G23   opSpV0100002302                        ref|NC_003098.1|:c374069-373698
                                                                   NC_003098.1
                                CACTTAACAAAACAGTACTCCTCAGTACGACAGGCACTTCCTACCTCTCTA
Spr_7   I01   opSpV0100002303                        ref|NC_003098.1|:c1139798-1139166
                                                                   NC_003098.1
                                TGTCCTAAATGAGACCATCAATACGTCAGAAATGGTTTCTCGCTTCTCTGG
Spr_7   I03   opSpV0100002304                        -             -
                                ATCCCTTCGTCTCGGTTTTTGTGTATTTTTCCACCATACCCCAGTAATGCA
Spr_7   I05   opSpV0100002305                        -             -
                                CCTATTTACCAGTCTTTGAGAGCGATAAGCGATTGATAGAAACTGATAAAT
Spr_7   I07   opSpV0100002306                        gb|AE007317|:1843215-1843470
                                                                   AE007317
                                TATAACATATTTCCCTTATTCTGGATTAAAAAGGATTAGCGAGATTAGAATC
Spr_7   I09   opSpV0100002307                        ref|NC_003098.1|:c1390657-1390478
                                                                   NC_003098.1
                                ATGGTTGCTTCAATGCTACTCGGACTGCTCGCTTTGAAGATAGGTTTTTCT
Spr_7   I11   opSpV0100002308                        ref|NC_003098.1|:222574-225021
                                                                   NC_003098.1
                                AGAATTACTTGAGATTGCAGATATTTGCTCTAGAGTCCCATATGAACCGGC
Spr_7   I13   opSpV0100002309                        ref|NC_003098.1|:278777-279091
                                                                   NC_003098.1
                                CTGCAGGTTGCAGCATTTGAAATTATCCTGCATTCGGGAAATGCAAGGTC
Spr_7   I15   opSpV0100002310                        ref|NC_003098.1|:124392-125294
                                                                   NC_003098.1
                                AAAAAAATCGAAGATTCTCATAACACCCTTCTGTGTACAGGTCTTGTCGAG
Spr_7   I17   opSpV0100002311                        gb|AE007317|:1234124-1234800
                                                                   AE007317
                                TTTTTACTCTTCTTTTAAAAAATGGTATACTAGACTTCCTGCAAAACTAGGA
Spr_7   I19   opSpV0100002312                        ref|NC_003098.1|:521360-522244
                                                                   NC_003098.1
                                GGATTTCAGACCAACCAGTAGAGAAAGAGGGCTATCTCACGCTCCCTTTA
Spr_7   I21   opSpV0100002313                        ref|NC_003098.1|:c291123-290122
                                                                   NC_003098.1
                                GAAGTTTTCTACGATCGTAAGCATACGAGTATCAGCCAGATTCGGCCAAA
Spr_7   I23   opSpV0100002314                        ref|NC_003098.1|:80186-83671
                                                                   NC_003098.1
                                GAATCACAATCATGCTACAGGTACTACAGATAGCATGCCTGCTGACACCA
Spr_7   K01   opSpV0100002315                        ref|NC_003098.1|:c1608866-1607862
                                                                   NC_003098.1
                                TATCAGGTGTGGAAATGACGGATGTCATTGAGCGTATCGTAACTGGGCGT
Spr_7   K03   opSpV0100002316                        gb|AE007317|:370412-370628
                                                                   AE007317
                                AAGTGTGATAAACTAATATAACAACGAAAATCTTATGAGAGAATAAAGCTTT
Spr_7   K05   opSpV0100002317                        ref|NC_003098.1|:155454-156308
                                                                   NC_003098.1
                                GAAAATCACTGAATTGGACGCTAGCCAAACAGCTCGTTCATTGTCATCAGT
Spr_7   K07   opSpV0100002318                        -             -
                                ATATAAAGCGCTTTCTTGAAAACAACAAAATCAATCTTTTAGGAGGAGAAA
Spr_7   K09   opSpV0100002319                        ref|NC_003098.1|:622097-622222
                                                                   NC_003098.1
                                GTAGAATATAAAGGAGGTGCAATGAGTATGATTGAAGTTAGCCATTTATCA
Spr_7   K11   opSpV0100002320                        ref|NC_003098.1|:c1622725-1622231
                                                                   NC_003098.1
                                ATTATCTAATCAACCGAGTGGGTACTGGATAGGTTCGTTGGATGAGAGAT
Spr_7   K13   opSpV0100002321                        ref|NC_003098.1|:c602264-602094
                                                                   NC_003098.1
                                AGGTCTTGTAACAGGTGTCGCAGGAACTGTCGCTGCCGTTGCAGGTGCA
Spr_7   K15   opSpV0100002322                        ref|NC_003098.1|:c866308-866108
                                                                   NC_003098.1
                                AAATTACCAAACCAGGCAATACGCAGATTATCCTTCCAGTTAATCTCTGTC
Spr_7   K17   opSpV0100002323                        -             -
                                GTAAATATCCCTGGCGAATGCTTGTATGACAAGGTATTTGTTCTTTCATTT
Spr_7   K19   opSpV0100002324                        ref|NC_003098.1|:c1774273-1772231
                                                                   NC_003098.1
                                TGCAGGGATGTTGTGGGGAACTACGGCTAATAGTGCCTTGAAACTAGATC
Spr_7   K21   opSpV0100002325                        -             -
                                GAGGTACATTTTTCTATACTAGCACATACATATTTTGCGTCTAGTGTCGTT
Spr_7   K23   opSpV0100002326                        ref|NC_003098.1|:c1931780-1929900
                                                                   NC_003098.1
                                AAACTGCCCAGTTCTCTATCCTACCAAGCTTGCAAATCTGGGCAGAACTCA
Spr_7   M01   opSpV0100002327                        -             -
                                CTCACTTTCCAAAACTCTATTACCTCTTATTATACCACATTTCAATCTTCAA
Spr_7   M03   opSpV0100002328                        ref|NC_003098.1|:c96655-96329
                                                                   NC_003098.1
                                ATTCTAGAGAGTTCCAAGGTCGCATGCGCAAATACTACTCCTTGACAAACG
Spr_7   M05   opSpV0100002329                        ref|NC_003098.1|:523125-523298
                                                                   NC_003098.1
                                TGCTTAAGTTAGGGGTTCCTAAATGGATAGCAGATAAGGTATCTGGCTGG
Spr_7   M07   opSpV0100002330                        ref|NC_003098.1|:27115-27681
                                                                   NC_003098.1
                                AGTGTACGCGAGGATATGCAACTGCTTATCGAGTCTCCCCTAATACCAGA
Spr_7   M09   opSpV0100002331                        ref|NC_003098.1|:c1892353-1892042
                                                                   NC_003098.1
                                ACGAGCTAGATGCATCTGTTTCTGTTGTGAAGCAACATGGAGACGATGTC
Spr_7   M11   opSpV0100002332                        gb|AE007317|:568853-569212
                                                                   AE007317
                                TACTGAGATTAGATAGTGAGGTGATGACATAGTTTTGTGAAAACAGCCATT
Spr_7   M13   opSpV0100002333                        ref|NC_003098.1|:c1367293-1365671
                                                                   NC_003098.1
                                TTTTTCTTCCAACCAAGTGGACGTTTGTGGAGCTTCTTTTATGTAGCTCTT
Spr_7   M15   opSpV0100002334                        gb|AE007317|:855012-855260
                                                                   AE007317
                                AGCTAGAAAACTTGGTATCATATAAAAGTTGAGAAAAGCAGAAGTGAGAGC
Spr_7   M17   opSpV0100002335                        ref|NC_003098.1|:946534-947640
                                                                   NC_003098.1
                                AACCAAGAGTTTTCCAAAGCACTCGTTAATAGGAGGAGTACCGGCTAGGT
Spr_7   M19   opSpV0100002336                        gb|AE007317|:1545149-1545467
                                                                   AE007317
                                AAAAAATCCGTTTGGTTTCCCAAGTGGATTTTTAAAGCGTAGATTAACTAT
Spr_7   M21   opSpV0100002337                        ref|NC_003098.1|:841288-841560
                                                                   NC_003098.1
                                ATATCACGAAGATTCACAGTTTAAAGGAGATCACTATGTTGAATGTTATGC
Spr_7   M23   opSpV0100002338                        gb|AE007317|:736095-736504
                                                                   AE007317
                                TGATTTGAACACGAGCGGAAAACTCGGAAAATAGATAATCTGACTGAAAAA
Spr_7   O01   opSpV0100002339                        ref|NC_003098.1|:c1815834-1815535
                                                                   NC_003098.1
                                TCCAAATATTACTTTTTTAATCATGCTTGTAGGTATGATGGCCTTGATGTTC
Spr_7   O03   opSpV0100002340                        ref|NC_003098.1|:c533448-532771
                                                                   NC_003098.1
                                TCGTTCAGGGATTCAGTCTATTCCTAGTGGTCAGATGGAGGCCGCCTTGT
Spr_7   O05   opSpV0100002341                        ref|NC_003098.1|:67629-68105
                                                                   NC_003098.1
                                TTGGGAATATGTCTCAAACACCAGAAACTCGTTCTATTACACGTTCTATCA
Spr_7   O07   opSpV0100002342                        ref|NC_003098.1|:653533-654477
                                                                   NC_003098.1
                                AAGTTGCCAATGGTCGTTACGAGGGAACAGATCTTGCTACTTTGTATGCG
Spr_7   O09   opSpV0100002343                        gb|AE007317|:1814370-1814647
                                                                   AE007317
                                TCACAAAGAATTTTTAAACTCTTGTGAAACTTTTCTCATTTTCTTTTCTTATC
Spr_7   O11   opSpV0100002344                        ref|NC_003098.1|:c982842-982153
                                                                   NC_003098.1
                                TGGAGAAATCTCTCATATCAACTCCTTCCACCACCAGAGCATCAAGGACTT
Spr_7   O13   opSpV0100002345                        ref|NC_003098.1|:581084-581530
                                                                   NC_003098.1
                                TTCAAGGGATTAAACTGCATTTGCTCCATCTTATGACAAATACTCGTATGC
Spr_7   O15   opSpV0100002346                        ref|NC_003098.1|:70549-71715
                                                                   NC_003098.1
                                AGACTTGCTCGAATTGGGTGCAGAAATCACTACGCGTGAAATCTACCAAC
Spr_7   O17   opSpV0100002347                        ref|NC_003098.1|:c984154-983807
                                                                   NC_003098.1
                                TTGGAAAAAGTGCCAAACAGCGGTGAAGGCTTCCAACTCAAAATCATCATT
Spr_7   O19   opSpV0100002348                        gb|AE007317|:1035853-1036310
                                                                   AE007317
                                AGGTTCATCAACTTCTGAGCTTACAGCTTTAGGCCTATTAGCTGTTGGTAG
Spr_7   O21   opSpV0100002349                        ref|NC_003098.1|:660077-660544
                                                                   NC_003098.1
                                AACTGTACAAAACAATTGCTTCAGGTCGGCTGCAAGCGCGTGGTTTATAT
Spr_7   O23   opSpV0100002350                        ref|NC_003098.1|:930871-931806
                                                                   NC_003098.1
                                GAAAGATGCCTCTATATTCTCCAAATTATCCGTCATTCCTGATTTATTAAAA
Spr_7   A02   EMPTY             -                    -             -
Spr_7   A04   opSpV0100002351                        ref|NC_003098.1|:809733-811880
                                                                   NC_003098.1
                                GAACTCTATCTTCCTTATAAGGAAAAGCGTCGTACCAAGGCAACCATTGCC
Spr_7   A06   opSpV0100002352                        ref|NC_003098.1|:c452470-451871
                                                                   NC_003098.1
                                GGTGTTAGAATTATACGTGGTGGTAATATTAAGCCTTTAGAATTTTCTCTG
Spr_7   A08   opSpV0100002353                        gb|AE007317|:416417-417067
                                                                   AE007317
                                GCGAGAAGGCGGTTTCCTATATGGAAGTCGTCTTGTTTTCATATTGTCTAA
Spr_7   A10   opSpV0100002354                        gb|AE007317|:409091-409665, gb|AE007317|:8
                                                                   AE007317
                                CAAACTCATTACCAATTGAAACAAAAAACTGTGGTTAGAGCCTTTCGGAAA
Spr_7   A12   opSpV0100002355                        -             -
                                CTGTATTTTCGACAATGCAAGATATTGAGAATGTTGCAACCGATATTATAA
Spr_7   A14   opSpV0100002356                        -             -
                                TTTTACCTAAACGAATTAGAATGTGGCCTTACTCCTGGGCAACTCATACTC
Spr_7   A16   opSpV0100002357                        ref|NC_003098.1|:c1598327-1596789
                                                                   NC_003098.1
                                CAAGCTGAGAGTATTTGTAAAGAATTTTATATCAGTTCATCTTCGCTCTATC
Spr_7   A18   opSpV0100002358                        gb|AE007317|:1713560-1713925
                                                                   AE007317
                                CTAAAACAAGTAAAGGATAATCAATCCCCTGTATATCAAGGAATTGGCTAC
Spr_7   A20   opSpV0100002359                        ref|NC_003098.1|:437023-438630
                                                                   NC_003098.1
                                TAAAAATAAACTGGCCCAGTTCTGTGATGTGGCACCAGAAGCCGTTATCG
Spr_7   A22   opSpV0100002360                        ref|NC_003098.1|:c1410820-1410440
                                                                   NC_003098.1
                                AAAATCGTTGGCAACCTTTTGTTTGCTAGCGGTCAAGTTCCCCTATCCCCT
Spr_7   A24   opSpV0100002361                        ref|NC_003098.1|:c1443964-1443167
                                                                   NC_003098.1
                                AACAGGTCCAGAACGTGGAATTGGACGTATTGGGAATATTCAGCCTCAGA
Spr_7   C02   opSpV0100002362                        ref|NC_003098.1|:351246-351374
                                                                   NC_003098.1
                                AAATGGAGCAATGGTTACAGGTAGCCAAACTATCGATGGTAAAGTTTATAA
Spr_7   C04   opSpV0100002363                        ref|NC_003098.1|:696425-698464
                                                                   NC_003098.1
                                CTATCCATCTGGGAAACTTCATATCGGTTCTGCCTACACAACTATCGCATG
Spr_7   C06   opSpV0100002364                        ref|NC_003098.1|:1469087-1469809
                                                                   NC_003098.1
                                TGAAAAAAGCTGGGAAGACGGTTCTCATCGTTCACCACGACCTCAGCAAG
Spr_7   C08   opSpV0100002365                        ref|NC_003098.1|:c1644023-1642986
                                                                   NC_003098.1
                                TCTCTGTAGCAGGTGGGGCAGCTTCTGCTACAACATACGATAAGCAATTT
Spr_7   C10   opSpV0100002366                        ref|NC_003098.1|:582330-584384
                                                                   NC_003098.1
                                GGACAACTGGAGCTTTTTCTCTGGGGCAAGCTAGCAGTTCGCTCATCTTT
Spr_7   C12   opSpV0100002367                        ref|NC_003098.1|:c1692211-1692139, ref|NC_0
                                                                   NC_003098.1
                                CGTAGTGTAGCGGTTATCACGTCGCCCTGTCACGGCGAAGATCGCGGGT
Spr_7   C14   opSpV0100002368                        ref|NC_003098.1|:924630-924839
                                                                   NC_003098.1
                                TGAATATAAAGATCAAATATCTAGCACAGTATTGCCAGATATCAAAATTAAA
Spr_7   C16   opSpV0100002369                        ref|NC_003098.1|:c1534077-1533733
                                                                   NC_003098.1
                                TATGGGGCATTTGGTTTCTTTTTATTCTGCTAGCTATTGGTATGAATTGGT
Spr_7   C18   opSpV0100002370                        gb|AE007317|:812648-812862
                                                                   AE007317
                                GTCTAAACTGCTTGATTTAAAGCTTTTTTACTTTTATACTCAATAAAAATCAA
Spr_7   C20   opSpV0100002371                        ref|NC_003098.1|:882279-882626
                                                                   NC_003098.1
                                TTACCAACCTCTTCTTCCCGTTTTGGTTATGCCAATCCTAAGGATCATGGT
Spr_7   C22   opSpV0100002372                        ref|NC_003098.1|:343094-343972
                                                                   NC_003098.1
                                AAAAAAAGTTGGTGTCGGTCAGGCACATAGTAAGATAATTTTAATAGGGGA
Spr_7   C24   opSpV0100002373                        ref|NC_003098.1|:c1479142-1478450
                                                                   NC_003098.1
                                AAAATTGGTTTTTGCTCGCCACGGTGAGTCTGAATGGAACAAAGCTAACC
Spr_7   E02   opSpV0100002374                        ref|NC_003098.1|:c1680853-1679660
                                                                   NC_003098.1
                                TTGCTCCTGTTCGCTTGATGATGGATATGAGTCAGGAGTCGGGGAAACGT
Spr_7   E04   opSpV0100002375                        ref|NC_003098.1|:c1935387-1932727
                                                                   NC_003098.1
                                AGACTCATAACACGCGTCCAAGCAATGATTCTGAAAGTATCTATGAGGTGG
Spr_7   E06   opSpV0100002376                        ref|NC_003098.1|:c685616-685395, ref|NC_003
                                                                   NC_003098.1
                                TTTTTACAATGGCATTGCTATCACACCCAATACCTATCTAAGCGCCTGGTT
Spr_7   E08   opSpV0100002377                        gb|AE007317|:1776835-1777139
                                                                   AE007317
                                GAGGGGCACCTAATTTTTCGGTTTCCCCTCCTCTCTTCAATAGAGAGCTAT
Spr_7   E10   opSpV0100002378                        ref|NC_003098.1|:646178-646603
                                                                   NC_003098.1
                                AGACAAGGTTTGTTCCCGTAGGATTAGGAATTTGTTGGCTGACTTGATTGT
Spr_7   E12   opSpV0100002379                        ref|NC_003098.1|:c1654513-1653449
                                                                   NC_003098.1
                                TTTTGGTATCAAACATTCAGAAGCTGTGGATGCACCGCGCGTCTTGGTCG
Spr_7   E14   opSpV0100002380                        ref|NC_003098.1|:1841803-1842660
                                                                   NC_003098.1
                                TTTCTTAATCCCTTATCTCGGATCCACGGGACTGTTTTAGAACAGCCATTT
Spr_7   E16   opSpV0100002381                        ref|NC_003098.1|:406350-408242
                                                                   NC_003098.1
                                TGTTCTTGTACAGTTTAGACGTTCATGGCTATCTTTACCTCCCTTTGCCAA
Spr_7   E18   opSpV0100002382                        ref|NC_003098.1|:748235-748603, ref|NC_0030
                                                                   NC_003098.1
                                TGAGTTTTCGTTAGATCTTCTTCTAGAAGCCATTAAACTAGCTCGTTGGAC
Spr_7   E20   opSpV0100002383                        ref|NC_003098.1|:c1543222-1542329
                                                                   NC_003098.1
                                CTCATGCCTAAATTGACAGTTCTTGAACAAGTTCGCTACTTGGCGACTCTA
Spr_7   E22   opSpV0100002384                        ref|NC_003098.1|:c1729182-1728664
                                                                   NC_003098.1
                                AATATTCCTCAACAAGCAAGCTAGTTCGGACAATCAGATAACCTTACTTGC
Spr_7   E24   opSpV0100002385                        ref|NC_003098.1|:880306-881745
                                                                   NC_003098.1
                                GGTCCTTATGCTCACATTCGTCCAAATTCAAGTCTGGGTGCCCAAGTTCAT
Spr_7   G02   opSpV0100002386                        ref|NC_003098.1|:c1564516-1563890
                                                                   NC_003098.1
                                GAGTTCTGAAAACCAATTTCAATATTCTGTATCGATGACGACACGCGCACA
Spr_7   G04   opSpV0100002387                        gb|AE007317|:847642-848040
                                                                   AE007317
                                ACTTTATTCAATTTAGAGTTTCTTATGCACAATTGAGTCTGGAACGAAAGTC
Spr_7   G06   opSpV0100002388                        ref|NC_003098.1|:871667-872620
                                                                   NC_003098.1
                                AGCTCTAGAAGTTCAGTGTAGTCCCTTGCCTCAGAAAGTCCTTAAAGAGC
Spr_7   G08   opSpV0100002389                        ref|NC_003098.1|:71831-72868
                                                                   NC_003098.1
                                TGCAGGTGCGACCTTTGAGCTCAATGGTAAGACCTATGACCTTGAGGTTA
Spr_7   G10   opSpV0100002390                        ref|NC_003098.1|:c1348061-1347345
                                                                   NC_003098.1
                                GGACTAACTGGTGGAGTTCGCCAACCGCTAATTTACAGTATGACTTAACC
Spr_7   G12   opSpV0100002391                        ref|NC_003098.1|:337078-338250
                                                                   NC_003098.1
                                TGATACGACCGGGTCTAGCCTCTTTAAACGTGGTTATCGTACCGAAAAAG
Spr_7   G14   opSpV0100002392                        ref|NC_003098.1|:c1137385-1137026
                                                                   NC_003098.1
                                TACAATAATGAACTCAATAATGGCATGTTGCCAATCGTTCAGCCTAGAGAG
Spr_7   G16   opSpV0100002393                        ref|NC_003098.1|:c1771601-1771287
                                                                   NC_003098.1
                                ATATCCTCATCATGGAAAATATGACCAATCATCTCCTTTTGGTTCAAATCCG
Spr_7   G18   opSpV0100002394                        ref|NC_003098.1|:c391847-390381
                                                                   NC_003098.1
                                CGAAGAAGTCAGCCTTCCTCACTCTAAATACGGTGTTGCCGTTTATTACAT
Spr_7   G20   opSpV0100002395                        ref|NC_003098.1|:359316-359474
                                                                   NC_003098.1
                                CAAAAAGTCTTCAAAATCGGGAAAAGGCAGCCTATCGGGTGTTCAAAAATC
Spr_7   G22   opSpV0100002396                        ref|NC_003098.1|:c1271164-1270613
                                                                   NC_003098.1
                                TGATTTTAAGAAGATTTGTGGAGAGTGATGCAGAAGCCATGTTTCAAAATT
Spr_7   G24   opSpV0100002397                        -             -
                                GGTTTATATGGTCGTGGAAAGCATGGCTATTACTTCTCAAAGGGCGATTTC
Spr_7   I02   opSpV0100002398                        ref|NC_003098.1|:1028574-1029752
                                                                   NC_003098.1
                                CCAACGCCTCTTTCCAATTGGTAGCGACTGTGTTCGTCATTTTCATCGATT
Spr_7   I04   opSpV0100002399                        ref|NC_003098.1|:c1151027-1150320
                                                                   NC_003098.1
                                TATTACACTTCGCATGATTCAGGACAATATCCAACTTGCCCAAAATCATGA
Spr_7   I06   opSpV0100002400                        gb|AE007317|:1380028-1380264
                                                                   AE007317
                                GAGCGTTACCACTCAAGGTTTTTAGCAGTCTTTTCCATCATAGGAAAATCA
Spr_7   I08   opSpV0100002401                        ref|NC_003098.1|:1119658-1121823
                                                                   NC_003098.1
                                TGTAGGAAGTTTTGCTTTCGGTGTGAAAAAAGGAAGTAAATACGAGCACC
Spr_7   I10   opSpV0100002402                        ref|NC_003098.1|:c1899537-1898020
                                                                   NC_003098.1
                                CAAAGTGCTTACGACTTCGTTGATTTCTTGGTCCGTACAAAACAACGTTAC
Spr_7   I12   opSpV0100002403                        gb|AE007317|:1256507-1256894
                                                                   AE007317
                                TAGAAAGGTATCTCAAACCTCTCTACTCTCCCAGACTAGTTTACAACTAAA
Spr_7   I14   opSpV0100002404                        -             -
                                AAGCAGGGCATCTAAGCATTTAATTCAAAGTAAAATACAAACCAAACGACA
Spr_7   I16   opSpV0100002405                        ref|NC_003098.1|:c1760429-1759722
                                                                   NC_003098.1
                                ATGGCTTCAAGAAATAGTCCAGCTGCTCTTCCAGTATTTTTACTTTACTCC
Spr_7   I18   opSpV0100002406                        ref|NC_003098.1|:934157-934438
                                                                   NC_003098.1
                                AGTAAATACTACTATAAAGAATGGTAGTAAAGGGAAAACTCTGACTGAGAT
Spr_7   I20   opSpV0100002407                        ref|NC_003098.1|:669477-670169
                                                                   NC_003098.1
                                TCGGGGAAAATCGCCGTAATATCAAAAGACGAGTGATGGAAGTTTTGGAC
Spr_7   I22   opSpV0100002408                        ref|NC_003098.1|:298847-299914
                                                                   NC_003098.1
                                CAAATTACAAACCGAGCATTGTTGCGCGTAGCTTAAACTCCAAACGAACAA
Spr_7   I24   opSpV0100002409                        ref|NC_003098.1|:c1574370-1573474
                                                                   NC_003098.1
                                TTGGCAGTCGTGACAGGCTTTTTCGGAATGAATGTTCCCTTACCTTTAACA
Spr_7   K02   opSpV0100002410                        ref|NC_003098.1|:268968-270290
                                                                   NC_003098.1
                                GATTAGCATCAATGGGGAATCGATCTCAGAAGCGAGGCTAGAAGCTCTCA
Spr_7   K04   opSpV0100002411                        ref|NC_003098.1|:759504-759575, ref|NC_0030
                                                                   NC_003098.1
                                GTATAGCCAAGCGGTAAGGCAAGGGACTTTGACTCCCTCATGCGTTGGTT
Spr_7   K06   opSpV0100002412                        -             -
                                TTTAAAGACTTTTTGACCAGCCTCATTTTTTTAACTTGATACTCAGTGAAAA
Spr_7   K08   opSpV0100002413                        ref|NC_003098.1|:505506-506633
                                                                   NC_003098.1
                                AAGAGCGTCAAATTCGTTTGCGTCCATCTTACTTCCCATTCACAGAGCCAT
Spr_7   K10   opSpV0100002414                        -             -
                                TTGATAGTGCACAAACTCCTCTGATTATTGCGGGTTCTCCTCGTGTTCAGT
Spr_7   K12   opSpV0100002415                        gb|AE007317|:195860-196075
                                                                   AE007317
                                AATATAAAAGAGCAGAGGCTGGTGTTTCAATCTAATTGAACACGGGCTAAA
Spr_7   K14   opSpV0100002416                        gb|AE007317|:1281808-1282333
                                                                   AE007317
                                CAAATAAAAAGCTTTAAGACAGATGACAAATCTAAGTCAAATAAGAAAGAC
Spr_7   K16   opSpV0100002417                        ref|NC_003098.1|:839871-840518
                                                                   NC_003098.1
                                TTTATTCCATACTTCTTAAACAGACAGGAATGTCATTTAAGAATAACTGGAT
Spr_7   K18   opSpV0100002418                        ref|NC_003098.1|:c1804023-1803124
                                                                   NC_003098.1
                                GAACAGGCCATTACCCTAATTGCAGGACGTTCTCGGATTGAATGTTCTGG
Spr_7   K20   opSpV0100002419                        ref|NC_003098.1|:944613-946505
                                                                   NC_003098.1
                                TTCGAGAAAACTCTTGTCCCAATTGTAATAATTCCATTCTGCTACAGAAATT
Spr_7   K22   opSpV0100002420                        ref|NC_003098.1|:c473468-473133
                                                                   NC_003098.1
                                TTGCATCTATTCAGTCGACCAGTGATAATCCTATCCTTGCTAATCATTTAG
Spr_7   K24   opSpV0100002421                        -             -
                                TGATTATTAGCAATTGTCACTGTAAATAATATCCTTGTAGCAAGCAATTTTT
Spr_7   M02   opSpV0100002422                        gb|AE007317|:619396-619724
                                                                   AE007317
                                AATTGTTGATAAGATTAAGATATTACCTACTCCTTATGAGGGACACTATCAT
Spr_7   M04   opSpV0100002423                        ref|NC_003098.1|:c1983724-1982216
                                                                   NC_003098.1
                                AAAGGTTAGCTCGAGTCAAAAAGAGTTTACCCAGATTTTCCCTCAGGCAG
Spr_7   M06   opSpV0100002424                        ref|NC_003098.1|:c901951-900731
                                                                   NC_003098.1
                                GCTATTGGAACCTTGCCAGCCAACGATCCGTCTTTAACACGTAAGATTGG
Spr_7   M08   opSpV0100002425                        ref|NC_003098.1|:12174-14132
                                                                   NC_003098.1
                                TTACCATGAGGCAGGACATACCATTGTTGGTCTAGTCTTGTCGAATGCTC
Spr_7   M10   opSpV0100002426                        ref|NC_003098.1|:c1175475-1175032
                                                                   NC_003098.1
                                ACTTGAATGGCAAAATCTACGGAGTGGTCGGCTCAGGAGATACCTTCTAC
Spr_7   M12   opSpV0100002427                        ref|NC_003098.1|:c986243-985284
                                                                   NC_003098.1
                                GTCAACAACCACCTAATGGAATTGTTAATCATGGTCGATGCTTGTGTGCGT
Spr_7   M14   opSpV0100002428                        ref|NC_003098.1|:174163-174756
                                                                   NC_003098.1
                                CCTGCATGTGGCCAATCCTTATGCCTATTCAGGTCAGGTTAATCAGGAGG
Spr_7   M16   opSpV0100002429                        ref|NC_003098.1|:c1485253-1484402
                                                                   NC_003098.1
                                AAGAAAATTGGTCGTATACCTGTTTCGCTGGAGGAACGTCCTTTCACCGA
Spr_7   M18   opSpV0100002430                        ref|NC_003098.1|:436031-436633
                                                                   NC_003098.1
                                CGTGCTATCTTGGAACTTCGTGGTCGCGATCATGAGATGCATTTTAGCGA
Spr_7   M20   opSpV0100002431                        ref|NC_003098.1|:c1076752-1076480
                                                                   NC_003098.1
                                GTGGTTGTTCGATTAGAGAAACCGGTGACTTTCCATAATATGATTGCGCC
Spr_7   M22   opSpV0100002432                        ref|NC_003098.1|:183232-183630
                                                                   NC_003098.1
                                ACAGTCTCAAGTTGTACTAGCTGTAAAAAAGCAAAAACCTGGCTCAATGCC
Spr_7   M24   opSpV0100002433                        ref|NC_003098.1|:c1632634-1632104
                                                                   NC_003098.1
                                TGTGATTCAAGTAGATGTCTTGGAATCGATTGGTCGTAGCGAAGAGTGGT
Spr_7   O02   opSpV0100002434                        -             -
                                TGGTGAGGGACGGTCGGAACTAATTTTCCAAAGATTTCATCTTTGAAAAAT
Spr_7   O04   opSpV0100002435                        ref|NC_003098.1|:c1374275-1372875
                                                                   NC_003098.1
                                TATTAAGACCAATCACGGAGACTTACGTATCAAGCTTTTCCCTGAACATGC
Spr_7   O06   opSpV0100002436                        ref|NC_003098.1|:c1828314-1827484
                                                                   NC_003098.1
                                GCAGTTTATGCGCCAGGTGGAGTCGCCCTATACTGGACAGTGTCTAATGC
Spr_7   O08   opSpV0100002437                        ref|NC_003098.1|:c1691841-1691770, ref|NC_0
                                                                   NC_003098.1
                                ACGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGGGGTCGCGGGT
Spr_7   O10   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_7   O12   opSpV0100002438                        ref|NC_003098.1|:c1316370-1314334
                                                                   NC_003098.1
                                GTCAGTGGATGAAACAGTTGACCTTGCTCGTGCAGCAGCCATTTACAAGT
Spr_7   O14   opSpV0100002439                        ref|NC_003098.1|:906411-907346
                                                                   NC_003098.1
                                ATGGAGATGCTTTCCATGCCATGAACCTTGGGGCGGATGGGGTTATTTCT
Spr_7   O16   opSpV0100002440                        -             -
                                CCATAGCTACAAGAGGAAAAAGAATACTTTCCCCCCAAATCATTCATACCT
Spr_7   O18   opSpV0100002441                        ref|NC_003098.1|:c1361497-1360403
                                                                   NC_003098.1
                                CATTTGACAGCTACCAGTTGCTTCGTGGTCTCAAGACCTTGTCTCTTCGTA
Spr_7   O20   opSpV0100002442                        ref|NC_003098.1|:c1378673-1377486
                                                                   NC_003098.1
                                TTTACGGCTATTCTGTAGCGTCAAATCAAGTGACAGTCGCTGCGGGAGCC
Spr_7   O22   opSpV0100002443                        ref|NC_003098.1|:c1840433-1838616
                                                                   NC_003098.1
                                AATTGCTGATGGCACTATGTTAATTGGTGACTCAGTGGCTTTAAGGGCAA
Spr_7   O24   opSpV0100002444                        gb|AE007317|:649239-649444
                                                                   AE007317
                                GAAAAGTCAGCATAAATATGATACAGTGGAATAGTAAAAATTTGGAGAACG
Spr_7   B02   EMPTY             -                    -             -
Spr_7   B04   opSpV0100002445                        ref|NC_003098.1|:128356-130215
                                                                   NC_003098.1
                                TGCGTCTCAGCCTACTGTTGTAAGAGCAGAAGAATCTCCCGTAGCCAGTC
Spr_7   B06   opSpV0100002446                        ref|NC_003098.1|:1599538-1599708
                                                                   NC_003098.1
                                ATGGCTTAAACAATATCGATATCCAATTATCGCTGGTCTCATAGGCGTATT
Spr_7   B08   opSpV0100002447                        ref|NC_003098.1|:20207-20554, ref|NC_003098
                                                                   NC_003098.1
                                GTATAATCTTTTTATGGCATATTCAATAGATTTTCGTAAAAAAGTTCTCTCT
Spr_7   B10   opSpV0100002448                        -             -
                                AAAATACCCATACAGTGATCACTGCTCACAGAGGATTGCCAACGGCAGAA
Spr_7   B12   opSpV0100002449                        ref|NC_003098.1|:627980-628684
                                                                   NC_003098.1
                                TTTATGTTATACGCACTAGGAGCGAATGTACAAATGAACTTTGCTTGCGTT
Spr_7   B14   opSpV0100002450                        -             -
                                CTTGACAAGTTTAGTATAACAGTATCTATTAATTTTTTTCATCCAAATCTTG
Spr_7   B16   opSpV0100002451                        ref|NC_003098.1|:1943950-1944897
                                                                   NC_003098.1
                                TGGACCTCAAGTTGGGAATCTCTTGCTCCAACATTTGGCATCAGACTCTG
Spr_7   B18   opSpV0100002452                        ref|NC_003098.1|:866211-867410
                                                                   NC_003098.1
                                TCACTATGGGAGGCTTGGCCTTTGTCCCAAATATCTATTGGTTAATCTTTC
Spr_7   B20   opSpV0100002453                        ref|NC_003098.1|:1151363-1152850
                                                                   NC_003098.1
                                CATTCCACTGAGTTTTGGACTCATGGTTTTAGGACCAAATGCCATCCTACT
Spr_7   B22   opSpV0100002454                        -             -
                                CAGCCTTTTTACTTTTACCTAGAAAATAATCATAAATACTTGCCTTCTACCG
Spr_7   B24   opSpV0100002455                        ref|NC_003098.1|:1928807-1929196, ref|NC_00
                                                                   NC_003098.1
                                GTTTAAAATATTTTCAACAACCTATCGAAATCATCGTAAACGCTTCGGATTA
Spr_7   D02   opSpV0100002456                        ref|NC_003098.1|:c1137658-1137389
                                                                   NC_003098.1
                                GTTAGACGAAAAAATTACTCTAGTCCTTTTGATTTGGAATGTCATCATTTTC
Spr_7   D04   opSpV0100002457                        ref|NC_003098.1|:995722-996639
                                                                   NC_003098.1
                                CTTGATTTTAGTAGTCAATTCGCTAGTCTCACTGCACAAGAATTCTTTGCA
Spr_7   D06   opSpV0100002458                        ref|NC_003098.1|:c709611-709324
                                                                   NC_003098.1
                                CGTAAGAAAATTACAATCCTATGAGGTAGACTATCAAGAAGAATTAAACCA
Spr_7   D08   opSpV0100002459                        ref|NC_003098.1|:c167279-166821
                                                                   NC_003098.1
                                TTCTTCCTTATGCTGGCTGGCTTTGTCCCACTAGCAACTCTTGCTGGTTGG
Spr_7   D10   opSpV0100002460                        ref|NC_003098.1|:339733-341157
                                                                   NC_003098.1
                                CCAATCGTAGACTACATCCTTGATGCTGCAGGTAACAAGGGAACTGGTAA
Spr_7   D12   opSpV0100002461                        ref|NC_003098.1|:1283480-1285240
                                                                   NC_003098.1
                                GTGGTAGCACACATGATTCCCGATAGTTCTCAGGCAATAATCACACCCGT
Spr_7   D14   opSpV0100002462                        gb|AE007317|:1160831-1161040
                                                                   AE007317
                                CCTTAAACAAGGAGACTTGAAATTTATAGCCAAGCGAGCCCTACTGCACAC
Spr_7   D16   opSpV0100002463                        ref|NC_003098.1|:8582-8950
                                                                   NC_003098.1
                                CTTTTAATTTAGCGCAGAGTTATCAGCAATTACTCCAAAGACGTCAGCAAT
Spr_7   D18   opSpV0100002464                        ref|NC_003098.1|:832944-834074
                                                                   NC_003098.1
                                ACAATGGCTTGCCTTCTATGCTCAGAGTCAAGGTTCTATTTGGGTTGATAA
Spr_7   D20   opSpV0100002465                        gb|AE007317|:2038404-2038615
                                                                   AE007317
                                AAGCTTAATAAATCAATAATTTCTTCTTTTATCCCCAACCTGTGGATAAAGT
Spr_7   D22   opSpV0100002466                        ref|NC_003098.1|:c1528904-1526391
                                                                   NC_003098.1
                                AGAAAGACCACAGGCAGAACGTCATATCAGTACAACAGCGACTCGCAATA
Spr_7   D24   opSpV0100002467                        ref|NC_003098.1|:c1303399-1303163
                                                                   NC_003098.1
                                ACCATCCTTGTTCTGATTTTTTTAGGGATTTGGATTGGTCTGAGAGCCATG
Spr_7   F02   opSpV0100002468                        ref|NC_003098.1|:365451-365762
                                                                   NC_003098.1
                                GAACAAATGCCTAGCGCAGATGATGAAACAATCGCTCTTTTGTTGGCAGT
Spr_7   F04   opSpV0100002469                        ref|NC_003098.1|:c1822665-1821802
                                                                   NC_003098.1
                                TCAAGGATACTTATGCAGTGACAGAAAGTTCAAAGGGCCAGTTCCGAGAT
Spr_7   F06   opSpV0100002470                        ref|NC_003098.1|:c1118455-1116467
                                                                   NC_003098.1
                                GTTGAGTATTTCGTATCCTACTATGATTATTACCAGCCAGAGGCCTATGTC
Spr_7   F08   opSpV0100002471                        ref|NC_003098.1|:646986-649238
                                                                   NC_003098.1
                                AGGGATAGTGTGGTTGTGCTTGGAGCTAGCTTTGTGTCCTCTCTTCTCTA
Spr_7   F10   opSpV0100002472                        ref|NC_003098.1|:359944-361227
                                                                   NC_003098.1
                                AAGAAATCTCTTAATGTTCCAGGTTTCCGTAAAGGTCACCTTCCACGCCCT
Spr_7   F12   opSpV0100002473                        ref|NC_003098.1|:20207-20554, ref|NC_003098
                                                                   NC_003098.1
                                TTTTCGTAAAAAAGTTCTCTCTTATTGTGAGCGAATAGGTAGTATAACAGA
Spr_7   F14   opSpV0100002474                        -             -
                                GAAGCACGTTTGCGTGCAGCTCTATAAACATCAAGGCTGGGAGCACTTCC
Spr_7   F16   opSpV0100002475                        ref|NC_003098.1|:514259-515125
                                                                   NC_003098.1
                                AATTATGCCAATTCTGAATCGAAATCAGGCTCTCCGACTCTTGAAGACTTG
Spr_7   F18   opSpV0100002476                        ref|NC_003098.1|:c1409501-1408524
                                                                   NC_003098.1
                                CGAAAAAATATGCAACAGTTGACACCGCCAGGTGATCTTCGTAATGTCCTT
Spr_7   F20   opSpV0100002477                        gb|AE007317|:284216-284436
                                                                   AE007317
                                ATAATTAGAAAGTCATTTGTTTAGTGTATATGAAGATTCTGTATGGTATTCG
Spr_7   F22   opSpV0100002478                        ref|NC_003098.1|:925803-925964
                                                                   NC_003098.1
                                CAATGACTGGAATGGATTGGCTGATTTAATAGCAAATCTGATTGCAAAATA
Spr_7   F24   opSpV0100002479                        ref|NC_003098.1|:207070-207708
                                                                   NC_003098.1
                                ACAATTCCATGTTGCACATATCTCAACAGGTGATATGTTCCGCGCTGCAAT
Spr_7   H02   opSpV0100002480                        gb|AE007317|:515126-515695
                                                                   AE007317
                                CGAGTGCGACGTCACCTTCCTATTTTTCTACAGAAATGTTCGGCAAGCCG
Spr_7   H04   opSpV0100002481                        ref|NC_003098.1|:c1989649-1987544
                                                                   NC_003098.1
                                GGTAAACCAAAGGGGCGGGCAAAACGAGGAGTTCCTGGAGAGCTAGCAA
Spr_7   H06   opSpV0100002482                        ref|NC_003098.1|:c1513929-1513477
                                                                   NC_003098.1
                                AAATTTAACAGAAGGTTCGATTGCTATCGATGGTAATCGATTGTTTGGGAA
Spr_7   H08   opSpV0100002483                        ref|NC_003098.1|:638397-639026
                                                                   NC_003098.1
                                AAAACTATTGCCACAAATGCCTTTAGTTGCAATTGGTGGGATACAGACGAA
Spr_7   H10   opSpV0100002484                        gb|AE007317|:1992587-1992798
                                                                   AE007317
                                AGCTAGAACGGATTTGACATGCAAAAAAGAAACAGGTCTCTTTTGAAAGAA
Spr_7   H12   opSpV0100002485                        ref|NC_003098.1|:867410-867559
                                                                   NC_003098.1
                                CATCCAGACAAGATTGAGGTTTTAAAGTATTGTCCCAAGGAAAGAAAAGTA
Spr_7   H14   opSpV0100002486                        ref|NC_003098.1|:c1823836-1823351
                                                                   NC_003098.1
                                GTATTACGATGCTATCATTGAATCGACTGAAGAGTATGGGCCTTACTATAT
Spr_7   H16   opSpV0100002487                        ref|NC_003098.1|:2007310-2007945
                                                                   NC_003098.1
                                TGATGATGGTGAGCCTAGTGGTACTGCTGGTGTTCCCATGCTTGGGGTAC
Spr_7   H18   opSpV0100002488                        -             -
                                TTCAGCTTCATTTGACCGACTGAATACTCATATTTTTCAGAGAGAAATAGC
Spr_7   H20   opSpV0100002489                        ref|NC_003098.1|:c1980843-1980346
                                                                   NC_003098.1
                                ATTGATCAATTCTAAAACTTACCCTGTTTCAGGTGGAGAATTGAACCCAGC
Spr_7   H22   opSpV0100002490                        gb|AE007317|:1029753-1029960
                                                                   AE007317
                                AAAGTATGAAAGCGCATCTCAATTTTAAGACTTTTTTGTAAATTAAGAGTAT
Spr_7   H24   opSpV0100002491                        gb|AE007317|:484706-484928
                                                                   AE007317
                                GTCTCAAAAATCCCCTGTGATGGGACTGATAAATCAGTTCCATCACTTTCA
Spr_7   J02   opSpV0100002492                        ref|NC_003098.1|:c1915326-1914475
                                                                   NC_003098.1
                                CTCACTGAGACAAGCAACCGGAGGACAATTTTCGCCGTCTATGTTGTCCC
Spr_7   J04   opSpV0100002493                        gb|AE007317|:1713046-1713446
                                                                   AE007317
                                TATTAGCAAATCAAGCTAGGATAGCACTTTACCTGCTAAGATGGTCTTGCC
Spr_7   J06   opSpV0100002494                        ref|NC_003098.1|:c1248441-1247689
                                                                   NC_003098.1
                                ACCATCTCTTTTCCAAGTAGGCTGGTTGACAAATCCAGTCTTGGTTGAAGT
Spr_7   J08   opSpV0100002495                        -             -
                                TTTTCAACATCTTAAACAGTCGCTGGCTGTGCTCCTGAGGTTAAAAGATAC
Spr_7   J10   opSpV0100002496                        gb|AE007317|:41501-41731
                                                                   AE007317
                                AGTTGGGAGGGAGATAGGCTCATTTGGGAAGGAAGTCCAGTTTTTGTTTA
Spr_7   J12   opSpV0100002497                        ref|NC_003098.1|:542892-543551
                                                                   NC_003098.1
                                GAGAGGCGGAAAGTCAAACTAATCTCTTAACAGGGCAATTCTTGTCCGTA
Spr_7   J14   opSpV0100002498                        ref|NC_003098.1|:c1438967-1438296
                                                                   NC_003098.1
                                GACTACAAGGATAGTCATCGTGAGACTTCTCCTCTCAAACAAGCAGAGGA
Spr_7   J16   opSpV0100002499                        ref|NC_003098.1|:c1605318-1604542
                                                                   NC_003098.1
                                CTTGAAAACCATTGAAACAGAGATTCCACTGGTCATCATGACCTACTTCAA
Spr_7   J18   opSpV0100002500                        -             -
                                ATTTCTGAAGCATTAACTCATAGCGATACCGTTACAACTAAGACTTATGTTA
Spr_7   J20   opSpV0100002501                        gb|AE007317|:1598328-1598953
                                                                   AE007317
                                TAAAAAAGGAGGGTAGGCAGTGTTGTGATCAATTATTGCTGGAGGTCTTA
Spr_7   J22   opSpV0100002502                        ref|NC_003098.1|:c1262165-1261428
                                                                   NC_003098.1
                                TTCGACCAGGTGGGGTGATTACATCGGCTGTTGAACGGACTGGACTGGA
Spr_7   J24   opSpV0100002503                        ref|NC_003098.1|:749887-751830
                                                                   NC_003098.1
                                TCAGGTGGACTTCACGGAGTGGGTTCTTCCGTTGTTAACGCCCTTTCTAG
Spr_7   L02   opSpV0100002504                        ref|NC_003098.1|:116230-117582
                                                                   NC_003098.1
                                AATTGATTCAACTTCAACAGCAAGGAGACTCCCCTTCCTTATCAGATACGA
Spr_7   L04   opSpV0100002505                        ref|NC_003098.1|:c1561076-1560141
                                                                   NC_003098.1
                                TAACCAAATTCGTGGAATGAACCCCTGGCCTGTTGCCCATACTTTCCTTAA
Spr_7   L06   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_7   L08   opSpV0100002506                        gb|AE007317|:530334-530653
                                                                   AE007317
                                TGTGAGGGTGGGTTTTTTGATTTCAAGCTACTCGTTTTAGTATAGTAAACT
Spr_7   L10   opSpV0100002507                        ref|NC_003098.1|:c1336939-1336103
                                                                   NC_003098.1
                                GAGATAATTGGTCAAAGTACCAGTCTAACAAGTCTATTACTATTGGATTTG
Spr_7   L12   opSpV0100002508                        ref|NC_003098.1|:c1438165-1437827
                                                                   NC_003098.1
                                CAATTTACCAAATTGTCCAAAATGTAACTCAGAGTATGTCTACGAAGACGG
Spr_7   L14   opSpV0100002509                        ref|NC_003098.1|:1985475-1986347
                                                                   NC_003098.1
                                TATCACAGACTACGGTACTGGAAATCCTTACAACTCTATAACTCCCCTCAT
Spr_7   L16   opSpV0100002510                        ref|NC_003098.1|:720316-720720, ref|NC_0030
                                                                   NC_003098.1
                                CTAAGAAAGCAGACGCTCAAACCATTGTCGCGTCTAAAAATAAAATCTCAA
Spr_7   L18   opSpV0100002511                        ref|NC_003098.1|:c1691328-1691239, ref|NC_0
                                                                   NC_003098.1
                                GATTACCCAAGTCCGGCTGAAGGGAACGGTCTTGAAAACCGTCAGGCGT
Spr_7   L20   opSpV0100002512                        ref|NC_003098.1|:150653-150886
                                                                   NC_003098.1
                                ATGTTAGAGGAGGCAACCTCGTAAATTCTATGGGAGGTGGTGGAAGAAGT
Spr_7   L22   opSpV0100002513                        ref|NC_003098.1|:717819-719573
                                                                   NC_003098.1
                                TGCAGTCATTTTAGTTCTGGCTTATGTAGTGGCAATCTTTCTACGTAAGCG
Spr_7   L24   opSpV0100002514                        -             -
                                GAAGCAAAAATCTTGCAAAAGGAAGAAGTCTTGAGGGTAGCTAAGATGGC
Spr_7   N02   opSpV0100002515                        ref|NC_003098.1|:1810463-1810789
                                                                   NC_003098.1
                                AGTTGAAGAAGCGGAAGACTCCTTAGTAGAAGCGCACAAGATTCACTCTA
Spr_7   N04   opSpV0100002516                        ref|NC_003098.1|:759414-759494, ref|NC_0030
                                                                   NC_003098.1
                                AAGAGGCTAAACGCGGCGGACTGTAAATCCGCTCCTTCGGGTTCGGGGG
Spr_7   N06   opSpV0100002517                        ref|NC_003098.1|:c1305522-1305166
                                                                   NC_003098.1
                                GAAGTTTGTCAAACCAAGAAGCGGCTGAGTTGCTAGCAAGTGACGGTATG
Spr_7   N08   opSpV0100002518                        ref|NC_003098.1|:20207-20554, ref|NC_003098
                                                                   NC_003098.1
                                ATGTGGTATAATCCTTTTATGGCATATTCAATAGATTTTCGTAAAAAAGTTC
Spr_7   N10   opSpV0100002519                        gb|AE007317|:972850-973507
                                                                   AE007317
                                ACTTATCCCGTGAGGTCTATCACTATAAAGAGAAAACGACAGATAGAAGTG
Spr_7   N12   opSpV0100002520                        gb|AE007317|:458713-459084
                                                                   AE007317
                                ACTCTGCTAAATTGTTGAAAATAAGTATGCAATATACTTTCGCATCGCGTC
Spr_7   N14   opSpV0100002521                        -             -
                                ATGAAAATCATCAGAAAAGTTTGCCAGTCTTTAAAAGTCAGGTGAAAGCCC
Spr_7   N16   opSpV0100002522                        ref|NC_003098.1|:200848-201216
                                                                   NC_003098.1
                                GTTCATACATCAAATTTGACGAAAACGCAGCAGTTATCATCCGTGAAGACA
Spr_7   N18   opSpV0100002523                        ref|NC_003098.1|:c1074659-1074234
                                                                   NC_003098.1
                                AATGGTTGCTGCAGAAGTATCTGACGAACGTTCAGCTTATATGACTCGTG
Spr_7   N20   opSpV0100002524                        gb|AE007317|:21852-22161
                                                                   AE007317
                                TGTCAACTTTTCCTATTTTTATCTTGTTGAGGCTGGTATTTTAACAATTCAG
Spr_7   N22   opSpV0100002525                        ref|NC_003098.1|:344894-345901
                                                                   NC_003098.1
                                CCAACTTTAGAATGTGATTTCTTAGTGGGATGGACCAAGGAAGTGGCTGT
Spr_7   N24   opSpV0100002526                        -             -
                                TGGAATGAAGGCTGACTTCTTGACAAATCCAGACTTCTTTAGACCTTTATA
Spr_7   P02   opSpV0100002527                        ref|NC_003098.1|:c1290836-1290375
                                                                   NC_003098.1
                                GAAGGGCAATTGAATACAGCCTCAAGTATAGCCTCAAGTATAAAGAAACCT
Spr_7   P04   opSpV0100002528                        -             -
                                TTTCAAAGAGTATAACATAATAAAAGCGAACAAGACTACTTTTCTGACACTC
Spr_7   P06   opSpV0100002529                        ref|NC_003098.1|:122441-123433
                                                                   NC_003098.1
                                TCTTTCACCAACTAATGGGATTTAGTCCAGGAATAGCAGTGTTTTATAAGG
Spr_7   P08   opSpV0100002530                        -             -
                                CAAGAAATTTCGAGAACCCTCTACAATTTCCAGTCAAATAAATTGCATTCG
Spr_7   P10   opSpV0100002531                        ref|NC_003098.1|:c466801-466391
                                                                   NC_003098.1
                                AAGTCGCTGGTCAAACAGTTTTTCATACTCACGTTCACCTTGTGCCTCGCT
Spr_7   P12   opSpV0100002532                        ref|NC_003098.1|:838148-839017
                                                                   NC_003098.1
                                GGGCAAAGTATTGCTCAGGTCTCTGATGCCGGTTTGCCTAGCATTTCAGA
Spr_7   P14   opSpV0100002533                        ref|NC_003098.1|:c1166107-1165547
                                                                   NC_003098.1
                                TTGTCAGCAACTACAATGTAAAATTAGAAACTTTCCCGAGCAATATTATCG
Spr_7   P16   opSpV0100002534                        ref|NC_003098.1|:c1145004-1143961
                                                                   NC_003098.1
                                CAAGTAAGAGAGGTGACTATGGTTTAAGTGATGTTTCTGTTCAAGTTTCAC
Spr_7   P18   opSpV0100002535                        -             -
                                CCATATTTTTACCTCTATTTTCCTTCTTCCATAGAAAATTTTACCATAAAAGC
Spr_7   P20   opSpV0100002536                        gb|AE007317|:1015888-1016261
                                                                   AE007317
                                GATTGATCTTTTAGGGAGAGAGGCAGGTCATGAGGCGGAAATTTCGCAGA
Spr_7   P22   opSpV0100002537                        gb|AE007317|:499247-499461
                                                                   AE007317
                                TTGACTTTCGAAGAGGCAGAAGCTACCCGTTATACGGCATCAGGTCGTGA
Spr_7   P24   opSpV0100002538                        ref|NC_003098.1|:938505-938834
                                                                   NC_003098.1
                                GTCATTTGTCACGATTAACACTGATACTTATGACCAGTTAGTTTTTGAATTG
Spr_7   B01   EMPTY             -                    -             -
Spr_7   B03   opSpV0100002539                        ref|NC_003098.1|:55644-56906
                                                                   NC_003098.1
                                GCCGCTCATGAGATGCTTTTGGACAATAAATTTGGTGACTCAGGTGCGCG
Spr_7   B05   opSpV0100002540                        ref|NC_003098.1|:c310514-309030
                                                                   NC_003098.1
                                CTGAAGTTGTTAAGCCAATCCAAGGTCTTAAAATCGATCATCTCGGTAGCC
Spr_7   B07   opSpV0100002541                        ref|NC_003098.1|:1539214-1539936
                                                                   NC_003098.1
                                TTCAAGACCTTCTATAAAGATTTCAATCTTGAACGCGCCCATCATCTACTTG
Spr_7   B09   opSpV0100002542                        ref|NC_003098.1|:c272096-271725
                                                                   NC_003098.1
                                TGATTTTGACTTTAACCATCCTTTCGACCCTCGTTATCCCCCAAGAGTACT
Spr_7   B11   opSpV0100002543                        ref|NC_003098.1|:827822-828493
                                                                   NC_003098.1
                                GATTCTGCTTTTGATGGAGAGCGGAGTTCTTTTCTTAGCGGTCATCTATCT
Spr_7   B13   opSpV0100002544                        ref|NC_003098.1|:c1160290-1159367
                                                                   NC_003098.1
                                TTTGACTCTGTCTGCTTTAGGAGTGGATGTCTGTGTGATTCGCCATCCAG
Spr_7   B15   opSpV0100002545                        -             -
                                AATGAAAAACGCGTTCGAGAACTGATCGATATGGGCTGTTACACGCAAGT
Spr_7   B17   opSpV0100002546                        ref|NC_003098.1|:1671111-1671893
                                                                   NC_003098.1
                                TTCGCGTCTTCCTGAGATTATGTCTTGGGATGAGTATGCTTTTACAAAGGG
Spr_7   B19   opSpV0100002547                        ref|NC_003098.1|:1379194-1379388
                                                                   NC_003098.1
                                TCTGCAACCTCAAAGCTGTGCTTTGAGCAACCAATTCTATTTCTCCCTTCA
Spr_7   B21   opSpV0100002548                        ref|NC_003098.1|:c645842-645051
                                                                   NC_003098.1
                                GATATTCCACCTCAGGCTGTAAAAACTGGAATGTTGGCTACTACTGAAATC
Spr_7   B23   opSpV0100002549                        ref|NC_003098.1|:588303-589058
                                                                   NC_003098.1
                                TTAGTTTAAAGTCTTTAGCCAGTGACTTAGGTTTTAGTCCGACCTATCTGA
Spr_7   D01   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_7   D03   opSpV0100002550                        ref|NC_003098.1|:163827-164408
                                                                   NC_003098.1
                                GTGCTATCTACTATTTTAGTGGTCGTAGCGATTGTCTTCCTTGTTCGTAAA
Spr_7   D05   opSpV0100002551                        ref|NC_003098.1|:349807-350079
                                                                   NC_003098.1
                                TTTTTTATCAATAAAGCCATTGGCTGGATTCTGCGAGACTACTCCAAAACG
Spr_7   D07   opSpV0100002552                        ref|NC_003098.1|:41902-44055
                                                                   NC_003098.1
                                ATACCTATGTGCCAGATCAGATGCGTTCGACACTAGGGATTATTTCTATTG
Spr_7   D09   opSpV0100002553                        ref|NC_003098.1|:c1572929-1571823
                                                                   NC_003098.1
                                AGCAAGCTTGAAGGAGCTAGTGCTTTCTACGATAAGCACCTGGGAACTCT
Spr_7   D11   opSpV0100002554                        -             -
                                GTCTTAGAAATCAAAGTGTACTATTTTAACTTCAATGCACTATACATCTAAT
Spr_7   D13   opSpV0100002555                        ref|NC_003098.1|:c685616-685395
                                                                   NC_003098.1
                                TCCTAATTGTTGAACCAATTGCCCGTTTTATACTAAGTTCTTTTCAGAAACC
Spr_7   D15   opSpV0100002556                        ref|NC_003098.1|:154470-155300
                                                                   NC_003098.1
                                CAAGTCTCTCGATGATATCGGTGGAAAATCGACGGAAGTCGTTCAAGCCA
Spr_7   D17   opSpV0100002557                        ref|NC_003098.1|:380372-381103
                                                                   NC_003098.1
                                GGCACGCGAGGTCGCTAGTCGGAATATACGAGTCAATGTGATTGCTCCAG
Spr_7   D19   opSpV0100002558                        gb|AE007317|:1068444-1068651
                                                                   AE007317
                                ATAAAGTAAAAGTGAGAGGAGAGGAGTCAGTGAGCCATCCTTCTCCATCT
Spr_7   D21   opSpV0100002559                        ref|NC_003098.1|:c375436-374072
                                                                   NC_003098.1
                                ATCGGTTGGGAACATATGCCAACAGGTATCGACGATCTTTCTATCATTCTC
Spr_7   D23   opSpV0100002560                        ref|NC_003098.1|:c1801033-1799954
                                                                   NC_003098.1
                                CACGCATCAACGACCTTACAGATCCAGTTATGCTTGCACACTTGTTGAAAT
Spr_7   F01   opSpV0100002561                        ref|NC_003098.1|:208202-208567
                                                                   NC_003098.1
                                GCGTAGTAATCTCATTGACTTATGTTTATGGTATCGGACTTGCAACATCTA
Spr_7   F03   opSpV0100002562                        ref|NC_003098.1|:1428392-1429735
                                                                   NC_003098.1
                                GCTCACTACAATACCGAAGGGATTCTCTGTCCTGACTGCCAAGGCATCCT
Spr_7   F05   opSpV0100002563                        gb|AE007317|:146382-147163
                                                                   AE007317
                                AGAACTGTGAGTTGAGGTTTCAAGATAGTGTTCTTGATAACATAAATAGTG
Spr_7   F07   opSpV0100002564                        -             -
                                ATCCTGAACTAACCATCGGACTTCCTTTTGTGGTTTCAAATAAGCGGGTTT
Spr_7   F09   opSpV0100002565                        ref|NC_003098.1|:27706-28365
                                                                   NC_003098.1
                                ACTATACGGACGGTTCGAGGTCAGGTGCGGAATATGGACTAATGGGAGT
Spr_7   F11   opSpV0100002566                        ref|NC_003098.1|:c1256506-1255628
                                                                   NC_003098.1
                                TAATTGGCCCTTGTGGTCTTATGAGCATATGTATACATTGGGGCAGCCCA
Spr_7   F13   opSpV0100002567                        ref|NC_003098.1|:346973-347671
                                                                   NC_003098.1
                                CCAATTCGATGATATCAATCTCTTTCGCTTCATGGGCAAGGACACTATTCA
Spr_7   F15   opSpV0100002568                        ref|NC_003098.1|:c2009616-2009347
                                                                   NC_003098.1
                                AAGACGAGTCAATACTATTTGGAGCCCCTTTATAACCTCTTGCGAGAGAG
Spr_7   F17   opSpV0100002569                        ref|NC_003098.1|:57276-57797
                                                                   NC_003098.1
                                TCATTGGTGTGCCAGTCAAGTCTCGTGCTCTTAGTGGAGTGGATTCACTC
Spr_7   F19   opSpV0100002570                        -             -
                                TGCTCTTTGATTTTCATTGAGTATAATTCTCCACCACTCTTAACCATCAAAA
Spr_7   F21   opSpV0100002571                        ref|NC_003098.1|:c1522727-1520712
                                                                   NC_003098.1
                                TCCCAATGCGACTGTCATGATTATCATGGATGCCGATCGCTTCGGTCTCA
Spr_7   F23   opSpV0100002572                        ref|NC_003098.1|:c172674-172039
                                                                   NC_003098.1
                                GTGAATCTAGAAAGAGCCTTATCTGTCAACGGTCGACTTGGGGGTCACGT
Spr_7   H01   opSpV0100002573                        ref|NC_003098.1|:c2014021-2012843
                                                                   NC_003098.1
                                GTTCGTCCAACATACAGTACAAACGCTTCAAGTTATCCAATTGGAGAATGT
Spr_7   H03   opSpV0100002574                        ref|NC_003098.1|:370629-371177
                                                                   NC_003098.1
                                ATTCCCAACCTAATCGGTCTCTTGGCCAATGCCCCGACTGTTTTAGAAGC
Spr_7   H05   opSpV0100002575                        ref|NC_003098.1|:2022400-2023497
                                                                   NC_003098.1
                                AATCGAATTAATGGAAAGCATTACCACAGAATCTCCTATATTACTGCTTGA
Spr_7   H07   opSpV0100002576                        ref|NC_003098.1|:c1245451-1244624
                                                                   NC_003098.1
                                CTCTATCTATGAACGGTGTGCGAAGTGGGGTTCAGTCGGTCTTTATCCCA
Spr_7   H09   opSpV0100002577                        ref|NC_003098.1|:498905-499246
                                                                   NC_003098.1
                                AAAGCAGGCTATGCGACAGCCAACCTATCAAATTCCTGAGCGAATGTATT
Spr_7   H11   opSpV0100002578                        ref|NC_003098.1|:636656-637324
                                                                   NC_003098.1
                                ATCTAATGTATTCGGCGGTGGCTTCATCAGACTATGCCCATCTTTTGGTCA
Spr_7   H13   opSpV0100002579                        ref|NC_003098.1|:554749-555174
                                                                   NC_003098.1
                                TGACCAAGCTGGTATGATCATTCCAGTTGTTATCTCAGTTTACGAAGATAA
Spr_7   H15   opSpV0100002580                        ref|NC_003098.1|:c1291498-1291130
                                                                   NC_003098.1
                                AGAAGAGAGCATTTGCCCTGATTGTCAGGACGATTTAAAAGAGATTGGAG
Spr_7   H17   opSpV0100002581                        -             -
                                GCAAGTCACTTTCCCTAATGACAAAGAAAAAAGCCAAAACAGCAAAGAAAA
Spr_7   H19   opSpV0100002582                        ref|NC_003098.1|:28583-29602
                                                                   NC_003098.1
                                CACGTCAGGATAGAAAGGCGAGAGCGCGTGAGCCAATCACTTCAAAACTT
Spr_7   H21   opSpV0100002583                        ref|NC_003098.1|:c1684528-1683638
                                                                   NC_003098.1
                                ATTACAAAAATATTGGGCATGGGCTTTTGTGGTCATCCCCCTCTTGTTACA
Spr_7   H23   opSpV0100002584                        gb|AE007317|:264378-264593
                                                                   AE007317
                                GATTGATTTTTTGTCAACAGAGTCGAGTGTGACGAGCTCTCTTGTATTTAT
Spr_7   J01   opSpV0100002585                        ref|NC_003098.1|:348677-349309
                                                                   NC_003098.1
                                GATGTTCTCCAACTCATCGCCAAGGGCTACGAAAATCAGCGCATCGCAGA
Spr_7   J03   opSpV0100002586                        ref|NC_003098.1|:727536-728270
                                                                   NC_003098.1
                                GAAGCAACCAAGGGGAAGGTTATCTTTGAGGGAGTCGATATTACGGACAA
Spr_7   J05   opSpV0100002587                        ref|NC_003098.1|:c1292136-1291786, ref|NC_0
                                                                   NC_003098.1
                                TTAAAGCCCTTTACTGGGATGGTCAAGGATTTTGGCTACTATATAAACGCT
Spr_7   J07   opSpV0100002588                        ref|NC_003098.1|:c1997707-1996700
                                                                   NC_003098.1
                                ATTGTTGAACACAATACATCAGGAATCATCTCTCGTAAATCTGATAATGTAA
Spr_7   J09   opSpV0100002589                        -             -
                                TGTTCTTTGTTTATTAGACTTAATGAATTTTAAAAATGTAGCTACTTTTTTAT
Spr_7   J11   opSpV0100002590                        gb|AE007317|:400958-401194
                                                                   AE007317
                                ATTGAAGGTCCTCTTCGCAGAATAAATGAGACGATAGATGGCGGTTTATAT
Spr_7   J13   opSpV0100002591                        gb|AE007317|:1571609-1571822
                                                                   AE007317
                                TTTCTGAAGTGGTGACGGACGTCAGCAAAGTCCTTCGGACTTTCATGACT
Spr_7   J15   opSpV0100002592                        gb|AE007317|:1690577-1690782
                                                                   AE007317
                                AATTTGTCCTTTCTCGAGCTTAGCTTTTCTTCAACCCACTACAGTTGACAA
Spr_7   J17   opSpV0100002593                        ref|NC_003098.1|:486366-486548
                                                                   NC_003098.1
                                GGGGAAACTTTTTATTGCCGACAAGTTAATGGATACGGCTCGGTGGCTCA
Spr_7   J19   opSpV0100002594                        gb|AE007317|:465862-466093
                                                                   AE007317
                                TTGAAATAGAATATGAACAAATTGATAAGAGGATTTTAAAGTAATCTCTAAC
Spr_7   J21   opSpV0100002595                        ref|NC_003098.1|:484929-485306
                                                                   NC_003098.1
                                GTTGCCAAGGTTTATTACACCATTTTGAGTAACCTTGCTTCGGATAACCAA
Spr_7   J23   opSpV0100002596                        ref|NC_003098.1|:c848316-848041
                                                                   NC_003098.1
                                CAAAGGATTCGCACAAGCAATCTCTGAAGATGAAGGCTTGCGTCAAGGTG
Spr_7   L01   opSpV0100002597                        -             -
                                CGTTTTTTGAATTTTATAGACTGCTCGTTTAAACTCTATTTACTTCGTACCT
Spr_7   L03   opSpV0100002598                        ref|NC_003098.1|:c1173448-1173377
                                                                   NC_003098.1
                                CCTTAGTTCAATGGATATAACAACTCCCTCCTAAGGAGTAGTTGCAGGTTC
Spr_7   L05   opSpV0100002599                        ref|NC_003098.1|:c1759616-1758618
                                                                   NC_003098.1
                                CGAAGTTCAAGGTCCTATCTTGAGTAAGGTCGGTGACGGAATGCAGGACA
Spr_7   L07   opSpV0100002600                        ref|NC_003098.1|:994500-994769
                                                                   NC_003098.1
                                GCTAAAGCAGCTGACGGACAAACTGTAACAGGTGGATCAATCCTTTACCG
Spr_7   L09   opSpV0100002601                        ref|NC_003098.1|:c31053-30700
                                                                   NC_003098.1
                                TTATTCGCGATATGCTGGACTTGCCAGCAAAAAATGTGACCATTTTGGAGG
Spr_7   L11   opSpV0100002602                        ref|NC_003098.1|:c172019-170814
                                                                   NC_003098.1
                                ACCGCACGTATGTGTGTAGCTGAAGATATAACACCCTCTGATTTTCGCAG
Spr_7   L13   opSpV0100002603                        ref|NC_003098.1|:632850-634340
                                                                   NC_003098.1
                                CACAATGCCCAAAACATTGACATGGTGCTTCGTATCGCGACTGAGCTTCA
Spr_7   L15   opSpV0100002604                        ref|NC_003098.1|:c1082914-1082099
                                                                   NC_003098.1
                                AAGACTGATTTCGAGCAGGAGCCGAGCTTTGCCAGTATTGATGTGAGTTT
Spr_7   L17   opSpV0100002605                        ref|NC_003098.1|:c1115366-1114899
                                                                   NC_003098.1
                                GATACAGGTGGGCGCTATATTGTCATTTGTTATAAGGCGACTGAGTTCTC
Spr_7   L19   opSpV0100002606                        ref|NC_003098.1|:729423-730295
                                                                   NC_003098.1
                                CATGGCTGCTTTAGCAGCTGTAAAAAACGGTGCAGGATTGGTGACCGTTG
Spr_7   L21   opSpV0100002607                        ref|NC_003098.1|:c1998506-1997745
                                                                   NC_003098.1
                                TTACTTTTATGCAGGTCTGAGGGTCAGTGTCTCCTACGCCTTTATCACAAC
Spr_7   L23   opSpV0100002608                        ref|NC_003098.1|:209958-210344
                                                                   NC_003098.1
                                TTACCGTAAACTAGGACGCACTAGCTCACAACGTAAAGCAATGCTTCGCG
Spr_7   N01   opSpV0100002609                        ref|NC_003098.1|:497816-498883
                                                                   NC_003098.1
                                CGGAGTTTCCAGACATTGACGAACTCCGTTTTGAAATCTCATTTTCGTGGG
Spr_7   N03   opSpV0100002610                        ref|NC_003098.1|:c1232287-1231433
                                                                   NC_003098.1
                                ATGGCGTCAGTCAGATTTCGGTCTTTGTTCGTTCCGTTTCTATGGAAAAAA
Spr_7   N05   opSpV0100002611                        ref|NC_003098.1|:c97960-96794
                                                                   NC_003098.1
                                GCTCAGAAAATCGGCTTGGAGCATCTCTTCACCTACAGCCTCTTCTTCTTG
Spr_7   N07   opSpV0100002612                        ref|NC_003098.1|:c1090890-1087705
                                                                   NC_003098.1
                                AAACTCTTTTGGGTTACTGGCTAGTAAGTGCTTTTGAACAGCAAAATCGTG
Spr_7   N09   opSpV0100002613                        ref|NC_003098.1|:c1912960-1911671
                                                                   NC_003098.1
                                TGGAGTAGATTACATCATCGATACCAATATGGTGCGTGGTCTGGACTACT
Spr_7   N11   opSpV0100002614                        ref|NC_003098.1|:c1830997-1830044
                                                                   NC_003098.1
                                TATTTTTCTAGCTCCGAGTGATTTGTTGACCAGTCCTCAAAGTGATTTGTT
Spr_7   N13   opSpV0100002615                        ref|NC_003098.1|:c1492306-1490933
                                                                   NC_003098.1
                                TGAATTGACGCGTAACCGTACCGAGTGGAAGAAAGCAGCCAATGGAGCAG
Spr_7   N15   opSpV0100002616                        ref|NC_003098.1|:88750-89673
                                                                   NC_003098.1
                                TCGTTATCATTATTTCAGTGACAGACGAGAAAAGCCTCCTCCAATACGGCT
Spr_7   N17   opSpV0100002617                        ref|NC_003098.1|:46493-50221
                                                                   NC_003098.1
                                CTCAAGGTTTTGGACACTTACTGGTCTGACCACTGCCGTCATACGACTTTT
Spr_7   N19   opSpV0100002618                        ref|NC_003098.1|:45545-46294
                                                                   NC_003098.1
                                GTCAAGAAGGAGCAGATTGCAGGTAAGGGAGTCTTGAATAATCAGATCTC
Spr_7   N21   opSpV0100002619                        gb|AE007317|:160878-161829
                                                                   AE007317
                                CCATTGATAATACTAGAGGTCATACTCCGATGGCAGTAACAGTGACCTCAC
Spr_7   N23   opSpV0100002620                        -             -
                                TCCTATCTACAACCTCAAAACAGTGTTTTGAGCAGCCTGCGGCTAGTTTCC
Spr_7   P01   opSpV0100002621                        ref|NC_003098.1|:c1309261-1308368
                                                                   NC_003098.1
                                AGGAAATTCGCCGCATTCAAAACTTACGTGAGGACGAGCTTTATGTTGCT
Spr_7   P03   opSpV0100002622                        -             -
                                TTCAGATAAATATTTAGAGTCCATTACAGGTTCTGATGGGAACTTAGGCCC
Spr_7   P05   opSpV0100002623                        ref|NC_003098.1|:c1529250-1529050
                                                                   NC_003098.1
                                GCCTTGCTGTCCAAGAAAGTCAGTCTCTTTGTTTTTGGATTGATCTGCTGT
Spr_7   P07   opSpV0100002624                        gb|AE007317|:2026204-2026408
                                                                   AE007317
                                ATGAAATAACCGTAATTTATCAAAATAAATCAGCCTTGCTTTTTACAGATTT
Spr_7   P09   opSpV0100002625                        gb|AE007317|:1717358-1717791
                                                                   AE007317
                                TCCCTTCCTATCAACTAGATCAACCAGTTGAGTGTTGAATGTTGAAACACC
Spr_7   P11   opSpV0100002626                        ref|NC_003098.1|:1007886-1008047
                                                                   NC_003098.1
                                ATCCATTCATTGAAATTGAAAGAATAGAAAGAACCTGGCTAACAGCTCACT
Spr_7   P13   opSpV0100002627                        -             -
                                TACTATACTATATTGTATACAAGTGTGTCATTGCCAGGTTGAGAAGATAGC
Spr_7   P15   opSpV0100002628                        ref|NC_003098.1|:c1985310-1983883
                                                                   NC_003098.1
                                CTGTCTTTTCCGAAAGGTCTGGTCGAGTCAGGAATGGGAAGGTCACATGC
Spr_7   P17   opSpV0100002629                        ref|NC_003098.1|:1690139-1690576
                                                                   NC_003098.1
                                CCATCTTGCCCTGATTGTGGAAGTCTAATGAAGAATAAGGAACCAGAGAA
Spr_7   P19   opSpV0100002630                        ref|NC_003098.1|:c1927855-1925783
                                                                   NC_003098.1
                                TAGAGAAACTAACATTACCAAAATCGGTTAAAACATTAGGAAGTAATCTATT
Spr_7   P21   opSpV0100002631                        ref|NC_003098.1|:285103-288339
                                                                   NC_003098.1
                                TTGAGGAAAGTGGTAAGGACAAGCGATTGTGGAATTCTGCAACGACGTCA
Spr_7   P23   opSpV0100002632                        ref|NC_003098.1|:1648355-1648873, ref|NC_00
                                                                   NC_003098.1
                                TTGAGGACAATCTAAAGCAGGTTCATCCTCTTTTTCAGACTGTCTTTAAAA
Spr_8   A01   EMPTY             -                    -             -
Spr_8   A03   opSpV0100002633                        ref|NC_003098.1|:c1263773-1263384
                                                                   NC_003098.1
                                GCTCTTGCCTTGTTTTTAACAAGTGATAAGGGCAAACAAGTTTGCAGTCAG
Spr_8   A05   opSpV0100002634                        ref|NC_003098.1|:c1292356-1292117
                                                                   NC_003098.1
                                TCTGCTTAAAATTCGTATTGGCAAGCTTGAAGTAAGTTTTTTTCAATCTCTC
Spr_8   A07   opSpV0100002635                        ref|NC_003098.1|:c1363026-1362403
                                                                   NC_003098.1
                                ATCTTTGCGGCTATAGCTGTGATGCTAACCTATGGGGGTTATCGGGTCAG
Spr_8   A09   opSpV0100002636                        ref|NC_003098.1|:1435671-1435832
                                                                   NC_003098.1
                                AATTAATTTCTAGAAATATTTTAGCAACTACAGCGTACTATTCCAAACTCAA
Spr_8   A11   opSpV0100002637                        ref|NC_003098.1|:c1045150-1044023
                                                                   NC_003098.1
                                TGCGTAAGGTTATTGCCCAACGCATGGTTGAATCTTACTTGACTGCGCCA
Spr_8   A13   opSpV0100002638                        -             -
                                GGGGGATAGCAATGCAACTGCTTTCAGCAGCAAAATCATTGTATAATCCTA
Spr_8   A15   opSpV0100002639                        ref|NC_003098.1|:836263-836901
                                                                   NC_003098.1
                                GGCTCAATCAGTTTGCGACAGATGGCCTCAAACCCGATTTGACACTCTAT
Spr_8   A17   opSpV0100002640                        gb|AE007317|:1195308-1195741
                                                                   AE007317
                                TAAAATTGTCTAAATTCGACAGAAGGAAGTAGCAAGCATTGTCGCTAAAAA
Spr_8   A19   opSpV0100002641                        ref|NC_003098.1|:748579-749067
                                                                   NC_003098.1
                                GCCATTATAGACTATATTGATTACTACAACAACAAACGAATTAAGGTAAAAC
Spr_8   A21   opSpV0100002642                        ref|NC_003098.1|:189502-191058
                                                                   NC_003098.1
                                CTATGGAGTACGCTTGTAACGGGGATAACTCTAGGAGTACCGCTATTACT
Spr_8   A23   opSpV0100002643                        ref|NC_003098.1|:c1832202-1831789
                                                                   NC_003098.1
                                CATAGCAGCCATCTTTAGTCTTTTGTTGCAATTTTATTTGAACCGACAAGTC
Spr_8   C01   opSpV0100002644                        gb|AE007317|:1844120-1844325
                                                                   AE007317
                                TCCTCCTATCCATTGACTTATCAATAGTTGACCAATCAATTGTGATATAAAG
Spr_8   C03   opSpV0100002645                        -             -
                                GCAAATGACAGTCGATTTCAGTTGAATTTTATAGGTACTAATGCAGGAGAA
Spr_8   C05   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_8   C07   opSpV0100002646                        ref|NC_003098.1|:c771749-770508
                                                                   NC_003098.1
                                AATTGACGACAAATTCTGAAGCCAGTAATATTCCTATGGAGGCCCGTAATT
Spr_8   C09   opSpV0100002647                        ref|NC_003098.1|:69847-70251
                                                                   NC_003098.1
                                GTGAGGAGCTTAGAGGTAGCACAGAAATGATTATGGGCCCACAAGACAAC
Spr_8   C11   opSpV0100002648                        ref|NC_003098.1|:938136-938495
                                                                   NC_003098.1
                                TCAGGATAGAATTTTTGAAAGTTGGTTCTCCCTTTGGCAGTCTCAAAAGTT
Spr_8   C13   opSpV0100002649                        ref|NC_003098.1|:c631043-630285
                                                                   NC_003098.1
                                CTTTCCCCATCTGGATGTCTTACAAAACCTCATCCTAGGCCCTATCAAAGC
Spr_8   C15   opSpV0100002650                        ref|NC_003098.1|:520970-521356
                                                                   NC_003098.1
                                TCAATCTCATTAACGGGATTGCGCTAGCCTTTGAGGGGGATGCGGTGTAT
Spr_8   C17   opSpV0100002651                        ref|NC_003098.1|:1379398-1380027
                                                                   NC_003098.1
                                CAAGTTTGTCACAGTATCATCTGTAGCCAATGCAGGGCACGATCAACTTTT
Spr_8   C19   opSpV0100002652                        ref|NC_003098.1|:c1662985-1662245
                                                                   NC_003098.1
                                TTACCAAGCCCAGCTAGCCAATCTAAAAATCAGCGCCCAGAAGCGAAAGA
Spr_8   C21   opSpV0100002653                        -             -
                                GAACATAAAGAAGCGTGTCCTTAGTGCAGGCCTGACTTTTGCATCTGCTT
Spr_8   C23   opSpV0100002654                        gb|AE007317|:1335825-1336102
                                                                   AE007317
                                ATCACAGTGGGCTATTCCATATTCAATTATCCATATTCAATCGCTATTATCG
Spr_8   E01   opSpV0100002655                        ref|NC_003098.1|:615371-616723
                                                                   NC_003098.1
                                AATCCAGCTGCCCAAAGTTTGCTGGAAGAAGGGATCAAGGTCATTACAGG
Spr_8   E03   opSpV0100002656                        ref|NC_003098.1|:c1833592-1833266
                                                                   NC_003098.1
                                GGTTAAAGCTTTTACATTGGTGGAGATGTTGGTGGTCTTGCTGATTATCAG
Spr_8   E05   opSpV0100002657                        gb|AE007317|:889537-889897
                                                                   AE007317
                                GAAAAAGTGCACGACAAATAGCCCTAAAACAGAGTCGTCTTAGAGTAACTT
Spr_8   E07   opSpV0100002658                        ref|NC_003098.1|:535289-537523
                                                                   NC_003098.1
                                GTCATTGTTCTTAATATAGAAGACGGTCGTGCCAAGGGCAGTGCTCGTAG
Spr_8   E09   opSpV0100002659                        ref|NC_003098.1|:c1571245-1570616
                                                                   NC_003098.1
                                GTTGGGATTTTAGGGGGGAATTTTAACCCTGTTCACAATGCCCATCTCATT
Spr_8   E11   opSpV0100002660                        -             -
                                GAATATGCGAGACGAACTCTACTCGATCCTGGTATGAATTTTATCACGATT
Spr_8   E13   opSpV0100002661                        ref|NC_003098.1|:279696-281042
                                                                   NC_003098.1
                                TTAAGCCAATTATCGCACAGGTTCCATGGCCAACTCCAGTAGGGATTGGA
Spr_8   E15   opSpV0100002662                        ref|NC_003098.1|:c1765656-1764829
                                                                   NC_003098.1
                                CCAATGTCCTCAATGTCTCTTTTGTCATTGTGCGCCGTGACCTGAAAATTA
Spr_8   E17   opSpV0100002663                        ref|NC_003098.1|:c1259426-1259148
                                                                   NC_003098.1
                                AAGGGATTCAAAGCGGTCGTGCCAAGCAAGAGCGAAGAGAAACGTTTGG
Spr_8   E19   opSpV0100002664                        ref|NC_003098.1|:209011-209946
                                                                   NC_003098.1
                                TTGGTAACTCTCTTCGTCGTGTACTTCTAGCTTCTCTACCAGGAGCAGCTG
Spr_8   E21   opSpV0100002665                        ref|NC_003098.1|:1904668-1905654
                                                                   NC_003098.1
                                GGAACTCAACTACCACCCAAACCTCAACGCTCGTAGCTTGGTAAGCAGCT
Spr_8   E23   opSpV0100002666                        -             -
                                ACTTAAAATCTTACTCTTAATTGTACCACAATTTGAGTAGAAAATTATGGAA
Spr_8   G01   opSpV0100002667                        ref|NC_003098.1|:c265528-264716
                                                                   NC_003098.1
                                TTTTTACCGTGAACTGGGCTTAGACACTCCTATGATTAACTTCAACGGATC
Spr_8   G03   opSpV0100002668                        ref|NC_003098.1|:1111752-1112456
                                                                   NC_003098.1
                                ATCAAGCAGATTTAATCATCGCGAATGACCTGACTCAAATTTCAGCAGATC
Spr_8   G05   opSpV0100002669                        ref|NC_003098.1|:1429735-1430517
                                                                   NC_003098.1
                                TCAGGAAAACGTATCGAAGGGCTAGGGGTCATGGGACACTACACGCTCAA
Spr_8   G07   opSpV0100002670                        ref|NC_003098.1|:993785-994099
                                                                   NC_003098.1
                                TTGTCGGAACTCCACTTGTTGCTGGAGCTACTGTAGTTGGAACTGTTGAA
Spr_8   G09   opSpV0100002671                        ref|NC_003098.1|:694381-695082
                                                                   NC_003098.1
                                CGAAGCTCAATGCTCTGCAAAATGTAGAATTGCCCTTGATTTACGCAGGA
Spr_8   G11   opSpV0100002672                        ref|NC_003098.1|:689648-689986
                                                                   NC_003098.1
                                TATGATTCAATCTATGGTTGAACATCGTTTATTGGGCGCAGGTTACATTAC
Spr_8   G13   opSpV0100002673                        ref|NC_003098.1|:394776-394964
                                                                   NC_003098.1
                                TAAAGTATGTTACTTTACAGGTCGTAAGACTGTATCAGGAAACAACCGTTC
Spr_8   G15   opSpV0100002674                        -             -
                                TCTTTTTCCTCTATTTCTTTTAATTTCTTTGCGATTGCGGCAATCACAGGAA
Spr_8   G17   opSpV0100002675                        gb|AE007317|:1489322-1489539
                                                                   AE007317
                                TAACACAAAAAATTTAATCGTGCTTGCTTTTTTCCTAAATTTCCCAGCCATT
Spr_8   G19   opSpV0100002676                        ref|NC_003098.1|:c291795-291154
                                                                   NC_003098.1
                                GCTGCCATCCTTTTAAATACAAAGGCAGTTGACTTTGTTGTTACCGGCTGT
Spr_8   G21   opSpV0100002677                        ref|NC_003098.1|:1698873-1699733
                                                                   NC_003098.1
                                GAAGAGGAATTGAAAGAGATTCAAGACTTTGCTCAATTTTCTTATGGTAAG
Spr_8   G23   opSpV0100002678                        ref|NC_003098.1|:25849-27111
                                                                   NC_003098.1
                                GTGGGGAGGAGTCTGCCCAGCAGATTAAACTACGTGCAGAGCGCTTAGG
Spr_8   I01   opSpV0100002679                        ref|NC_003098.1|:527983-529311
                                                                   NC_003098.1
                                GCCAAGGAAAGAGAGCTCCAGATAGACAATAGTTTGACCCATCAGCAGGC
Spr_8   I03   opSpV0100002680                        ref|NC_003098.1|:774386-775126
                                                                   NC_003098.1
                                TAAATCAACATCATGTAGTTTCTCTAGAAAAATTAGTTAGTTTGCTAGAAAC
Spr_8   I05   opSpV0100002681                        ref|NC_003098.1|:441113-446092
                                                                   NC_003098.1
                                CTATCTCGGACAATCACCAAGAGCCACAATCGCCGACAAGCTTTTCTGTA
Spr_8   I07   opSpV0100002682                        -             -
                                CATTTTTATCAGCATCCCTTTATCTTCAAACTCATCATTTTATCGCTTTTCC
Spr_8   I09   opSpV0100002683                        ref|NC_003098.1|:c2007254-2005956
                                                                   NC_003098.1
                                TGGCTAAAGTGATCAATGCGGGTGGTGCAGTGTGTTTGGCTAGTCCTCGC
Spr_8   I11   opSpV0100002684                        -             -
                                AGAAAGAGGTTGATGGCGAACATTGGCCTCTTTTGATTTATAAAGATTGGA
Spr_8   I13   opSpV0100002685                        -             -
                                TGCCTCTTTTATGGTGGCTGAAATGAGAAGACACAAAAAGATTGTCACAAA
Spr_8   I15   opSpV0100002686                        ref|NC_003098.1|:c1204661-1202025
                                                                   NC_003098.1
                                CACGGTAAGATCTGGGAGCACACCTTCTTAGGAATTGAACATATGAAGGG
Spr_8   I17   opSpV0100002687                        ref|NC_003098.1|:c1691412-1691339
                                                                   NC_003098.1
                                GTTAGAGCTCTCGGCTCATAACCGAGTGGTCGTAGGTTCAAGTCCTACAA
Spr_8   I19   opSpV0100002688                        ref|NC_003098.1|:616727-617785
                                                                   NC_003098.1
                                AAAAATTGTCTTTACAGGTGGGGGGACGGTTGGACACGTTACCCTCAATC
Spr_8   I21   opSpV0100002689                       ref|NC_003098.1|:c908832-907393
                                                                  NC_003098.1
                                ACTAGGTGAAGGGGCTATTGGTATTGTCCGCCTGAGCGGAACAGACAGT
Spr_8   I23   opSpV0100002690                       gb|AE007317|:324910-325110
                                                                  AE007317
                                TGGAGATTTTTCAATATACTTCGTTATTGGGCGCTTACAATGATATTCATAT
Spr_8   K01   opSpV0100002691                       ref|NC_003098.1|:c1264973-1264173
                                                                  NC_003098.1
                                TCCAATTGCTATTCAACTAGGACCCCTAGCCATTCGTTGGTATGCCTTATG
Spr_8   K03   opSpV0100002692                       ref|NC_003098.1|:887083-887223
                                                                  NC_003098.1
                                TTTTTGAAGTATGGTTTCAGAAGTTTTTCTTACCAACATTAACCACACCATC
Spr_8   K05   opSpV0100002693                       -             -
                                TCAAGATATCATGCCAGATTGGTTTCGCAAACCACGAAAAATAGCTCGCAT
Spr_8   K07   opSpV0100002694                       ref|NC_003098.1|:c1263300-1262170
                                                                  NC_003098.1
                                AATCATGGTCCCATTCGTCATTATCTCAGTGCGGTTGAGGAAGGCAATGC
Spr_8   K09   opSpV0100002695                       -             -
                                TATAAATGAGGGGTATAAGACAAAAGGAGAACCTAAGAGTGTGCTTTTTGT
Spr_8   K11   opSpV0100002696                       gb|AE007317|:523398-523649
                                                                  AE007317
                                CCGCCGTATGCCGAACGGCACGTACGGTGGTGTGAGAGGGGCTAGAGAT
Spr_8   K13   opSpV0100002697                       -             -
                                TCCTTTGCATGAATAGGTGAGAGTTGGGATTGTTTTTATTTTATACTCTTCG
Spr_8   K15   opSpV0100002698                       ref|NC_003098.1|:1780109-1780624
                                                                  NC_003098.1
                                TCTAAGGAAGCGGACTTGGCTTTTGTCAAGGGAGTTCATTCTGCTCTACG
Spr_8   K17   opSpV0100002699                       ref|NC_003098.1|:c1977393-1977112
                                                                  NC_003098.1
                                GATATTATCACGCGAAAATATGCTGGAAGCCTACAATCAAGTAAAATCCAA
Spr_8   K19   opSpV0100002700                       ref|NC_003098.1|:205156-205596
                                                                  NC_003098.1
                                CGTAACCGCGTTGGTCGTGGTACTTCATCAGGTAACGGTAAAACATCTGG
Spr_8   K21   opSpV0100002701                       gb|AE007317|:1332870-1333088
                                                                  AE007317
                                TTTTCATAGACTTTCTCCCCTCTAGGAGCCCCTGCATAAGGACGATAGAG
Spr_8   K23   opSpV0100002702                       ref|NC_003098.1|:680803-681333
                                                                  NC_003098.1
                                GCACCTGAATTATACAACTATAACAAGTTTCCTGGTCCGGAGTTCCATTTA
Spr_8   M01   opSpV0100002703                       ref|NC_003098.1|:459320-459829
                                                                  NC_003098.1
                                ATTTTAGAGATAGAGGTTGGGAATTGATAGGAGCAGGTTCTTGTTCGATTC
Spr_8   M03   opSpV0100002704                       ref|NC_003098.1|:c1991669-1990338
                                                                  NC_003098.1
                                TTTCCTTTGTCCGCGGAGCATCACATGAGTTGAAAACCCCTTTAGCCAGTC
Spr_8   M05   opSpV0100002705                       ref|NC_003098.1|:c1502098-1501259
                                                                  NC_003098.1
                                CAGAGTTGCTTGAATCAGCTAAAATCGACGGTTGTGGTGAGATTCGTACC
Spr_8   M07   opSpV0100002706                       ref|NC_003098.1|:c1052251-1051604
                                                                  NC_003098.1
                                ATAGCCTCAATATGAATCGTAATGGCTGTATGGGAGATTTTCCTCATGACT
Spr_8   M09   opSpV0100002707                       ref|NC_003098.1|:c1914285-1913038
                                                                  NC_003098.1
                                ACCTTATCCATACCTGTGGGAACAGCTTGTTTTTCACTAGTAGCCGTATGG
Spr_8   M11   opSpV0100002708                       ref|NC_003098.1|:c1850635-1849358
                                                                  NC_003098.1
                                CCAGTGGCTTATCCACGCTATCAGATGTTGATGGATTATTTGAATTTGAGT
Spr_8   M13   opSpV0100002709                       ref|NC_003098.1|:c1092176-1090902
                                                                  NC_003098.1
                                GCGATTGGGGAAAGCCTAGAACAGTATGCAGAGAGTGAGTTTAACAAGGT
Spr_8   M15   opSpV0100002710                       ref|NC_003098.1|:185813-187069
                                                                  NC_003098.1
                                GAATGCAGCAAGCGGTGGATTTGTTAGGAAATCCTGAGCAGTCTTACCCT
Spr_8   M17   opSpV0100002711                       ref|NC_003098.1|:c1892049-1889977
                                                                  NC_003098.1
                                AGTGCTACATAGAGGATACCAACATATCCGACTATCATCTTCTTTTTCACT
Spr_8   M19   opSpV0100002712                       ref|NC_003098.1|:87044-87313
                                                                  NC_003098.1
                                AGTCAAAGATGCCATTGCTTCCCTAGAGTCCATTAAGGAAAGCCAGTCAG
Spr_8   M21   opSpV0100002713                       ref|NC_003098.1|:c1228047-1227709
                                                                  NC_003098.1
                                CAGACAGGTCAAATGCCAGATGCGTCCTTCCAAGCTAAGATGGAAGGCTT
Spr_8   M23   opSpV0100002714                       ref|NC_003098.1|:c1583224-1581428
                                                                  NC_003098.1
                                CACCTACTTCCATAACTTTATCACCCACCTCTTGGAAGCCGCCTTCCAGCG
Spr_8   O01   opSpV0100002715                       ref|NC_003098.1|:1466101-1466781
                                                                  NC_003098.1
                                AATACCTATTATCTAGAAGGCGAAAAGCACCTCATCGTCGTCGATCCTGG
Spr_8   O03   opSpV0100002716                       ref|NC_003098.1|:1469806-1470654
                                                                  NC_003098.1
                                TCAAAGGAAACTCGATTATCAAAAGCGATACCGCCATCGGCATTACCTTTT
Spr_8   O05   opSpV0100002717                       ref|NC_003098.1|:808280-808648
                                                                  NC_003098.1
                                GAAGTTATTATTGTAAATCAATCTACAGAGGAGATAGCTTCCATTAGCCAA
Spr_8   O07   opSpV0100002718                       ref|NC_003098.1|:58885-59112
                                                                  NC_003098.1
                                AGACTGGAGCAGTTGTTGAAGTGTTGTATGCCAGTGCTGACCAAGATAAG
Spr_8   O09   opSpV0100002719                       gb|AE007317|:773270-773606
                                                                  AE007317
                                CATCTGAAAGTATTTTAGAATAATTCTCTTCGTGAATTTCTTCAAAACAGAT
Spr_8   O11   opSpV0100002720                       ref|NC_003098.1|:c1162212-1161670
                                                                  NC_003098.1
                                TTAGTTGAATCTTATCCAGTCACGGAAGTTTTCATGGAAGGCGCAACTAAC
Spr_8   O13   opSpV0100002721                       ref|NC_003098.1|:c1370329-1369817
                                                                  NC_003098.1
                                GATTTTTGTGAGAGATGGGTCAGACATGGGACAGGCCATCCAGACTTCCA
Spr_8   O15   opSpV0100002722                       gb|AE007317|:1719978-1720384
                                                                  AE007317
                                GGAGAACTTTTCTCTCATCCACTATGCAGGACTTACTATTTCACTTCTACT
Spr_8   O17   opSpV0100002723                       ref|NC_003098.1|:c1909869-1909228
                                                                  NC_003098.1
                                TTCAGTAAATCAGCAAATAGCGACAGACTTGACCTTGTCTCAACCACTTTT
Spr_8   O19   opSpV0100002724                       ref|NC_003098.1|:486986-487231
                                                                  NC_003098.1
                                TGCCAATCCCTTAATGCGCAATACAGTTGGTCGTAAAGTATCACTTAAACA
Spr_8   O21   opSpV0100002725                       gb|AE007317|:22405-22634
                                                                  AE007317
                                GTTTCTTCTTGATAAAAAGGCGATTTTTTATTATAATAAATTGTAAGATATA
Spr_8   O23   opSpV0100002726                       ref|NC_003098.1|:687578-688018
                                                                  NC_003098.1
                                AGCTTGCAAATTACTCGAGAAACCAATTAAGCGTCAGACTTTAGTAGCAAT
Spr_8   A02   EMPTY             -                   -             -
Spr_8   A04   opSpV0100002727                       ref|NC_003098.1|:755929-756633
                                                                  NC_003098.1
                                TGTCTATGCAGTAGATCCAGCATCATTGGGCTACAGTATAACGACTCGAA
Spr_8   A06   opSpV0100002728                       ref|NC_003098.1|:c292629-291814
                                                                  NC_003098.1
                                GGTATTATCCGCCGAGTTCCAATGTGCGAAATGAGCGCCGCTGATTTCCG
Spr_8   A08   opSpV0100002729                       ref|NC_003098.1|:c1479897-1479757
                                                                  NC_003098.1
                                CTTGGTATCATTGCTATTGTTTACTATAAAGGAGATAAGCGTGTAGGTGCA
Spr_8   A10   opSpV0100002730                       ref|NC_003098.1|:c1833351-1832869
                                                                  NC_003098.1
                                GGGGCAATTCGTCCCTGGCTAAGGTTGAATTTCAGACCAGTAAAGGAGCG
Spr_8   A12   opSpV0100002731                       ref|NC_003098.1|:c1136410-1136240
                                                                  NC_003098.1
                                TGACATTGATAAAATCATGATGCACCTGTCAGATACTTTTAACTCATGGGA
Spr_8   A14   opSpV0100002732                       ref|NC_003098.1|:c390381-388939
                                                                  NC_003098.1
                                ATTTCTGACGTTAAGATGGAGGAAGGTTCGATGCGTGTGGATGCCAACAT
Spr_8   A16   opSpV0100002733                       -             -
                                GTGGATAGAGAGGATAGTTTACGATTGTTGCAGGAGTTGTATCCTGAACG
Spr_8   A18   opSpV0100002734                       gb|AE007317|:1431726-1432047
                                                                  AE007317
                                AGAAATTGGCTGCAATAATCTAACCCTAAGTGTCTGGAATGATAACGAGGG
Spr_8   A20   opSpV0100002735                       gb|AE007317|:1271165-1271410
                                                                  AE007317
                                AAACCTAGTCATCGTTGCAGGGGTAAGACGATGAAATCGAACTCTTCGAG
Spr_8   A22   opSpV0100002736                       ref|NC_003098.1|:808645-809649
                                                                  NC_003098.1
                                CTTGTTTTCGAAGAGGAACTTATTTCACCGAGCTGGACTCATGAAGTTTAT
Spr_8   A24   opSpV0100002737                       ref|NC_003098.1|:489732-490181
                                                                  NC_003098.1
                                TATTTGCCACATCTTTGCCAAGATTCTTGAGCGACTTGTTGCCCCAGAACT
Spr_8   C02   opSpV0100002738                       ref|NC_003098.1|:c1606534-1605311
                                                                  NC_003098.1
                                TTGGGGCCTCATCCATTTCCAGAAATCGTTCGTGACTTCCAAAGTGTCATC
Spr_8   C04   opSpV0100002739                       ref|NC_003098.1|:c1778202-1778068
                                                                  NC_003098.1
                                AAGTAAACTTCGTCGTGCGCGCAAACACGGATTCCGTAACCGTATGTCAA
Spr_8   C06   opSpV0100002740                        ref|NC_003098.1|:c1921369-1921085
                                                                   NC_003098.1
                                TTAGGTGGAGCAGATCCAAATGCAGCTGATATTTGGATTGTTGGTCGTGA
Spr_8   C08   opSpV0100002741                        ref|NC_003098.1|:966767-967891
                                                                   NC_003098.1
                                CCTTCCAAAAGAAACGCTCAGGGAGAAAGATTGGCTATGTGCATTTCTTG
Spr_8   C10   opSpV0100002742                        ref|NC_003098.1|:922261-923268
                                                                   NC_003098.1
                                TGAAGAAATAGCAATCGGACTTGGAGCAAATCCCGAGCTTTCAAGGCTTG
Spr_8   C12   opSpV0100002743                        gb|AE007317|:122143-122440
                                                                   AE007317
                                AAATATCATTAGGCTACCCATATGATTGCCAGAAAAGATGGCTGATGAATC
Spr_8   C14   opSpV0100002744                        ref|NC_003098.1|:1538871-1539236
                                                                   NC_003098.1
                                CAACTGGACGATTTGTGACTAAGGATAAGGAGCTAATCGCCCAGTCACGC
Spr_8   C16   opSpV0100002745                        ref|NC_003098.1|:c2005217-2004669
                                                                   NC_003098.1
                                CTCTCCGCGCAGAAGATGTATCTCAAGATATGTATGGTTCAATTGACCTTG
Spr_8   C18   opSpV0100002746                        ref|NC_003098.1|:c404650-403910
                                                                   NC_003098.1
                                CTCAAAAAATCCTATGGACAAAACGAAGTGCTAAAAGACATTTCACTCACT
Spr_8   C20   opSpV0100002747                        ref|NC_003098.1|:c1174916-1174650
                                                                   NC_003098.1
                                CAAATTGTCAAACTGTTAGAAGAACGAATGCATTTAGTTGAGGGGGTGGT
Spr_8   C22   opSpV0100002748                        ref|NC_003098.1|:510846-511148
                                                                   NC_003098.1
                                CAATCGCAAGCGCTCGGTCAAGAAATCAAGCTTGACCAAGGAACTAAAGG
Spr_8   C24   opSpV0100002749                        ref|NC_003098.1|:1285200-1286945
                                                                   NC_003098.1
                                GATGGAGGAGCAAGAAATTTAAGTAAAGCAACACTGGCTTCATTTTTCGTT
Spr_8   E02   opSpV0100002750                        -             -
                                ATCTCGATCTAAGACAGATTGAGGCGGAGTTGAATGAATCATAGGAACAC
Spr_8   E04   opSpV0100002751                        ref|NC_003098.1|:202737-203135
                                                                   NC_003098.1
                                CGTGTATTTCTTAAATACGGACCAAATGGTGAGAAAGTTATCACTAACTTG
Spr_8   E06   opSpV0100002752                        gb|AE007317|:960322-960703
                                                                   AE007317
                                AGCGATAGGGAAATTCCCTATAATTGAGGTGGTACCGCGCATCGACGTCC
Spr_8   E08   opSpV0100002753                        ref|NC_003098.1|:382845-383267
                                                                   NC_003098.1
                                AGCAAGTTGTACCAGGCGACCAATTGGTTATGACAGCGACTTTTGTAAAA
Spr_8   E10   opSpV0100002754                        ref|NC_003098.1|:c1359136-1356038
                                                                   NC_003098.1
                                GAAGACCAGCAAAAGGCTATTTACCTTGCCCAGTTACAACAGATGCGAGA
Spr_8   E12   opSpV0100002755                        gb|AE007317|:941642-941892
                                                                   AE007317
                                CGATTTTGTTTTTGGTAATGGATATTATCATTATTGTTGGTGGATAAAATGC
Spr_8   E14   opSpV0100002756                        ref|NC_003098.1|:c1425362-1423788
                                                                   NC_003098.1
                                AGACATCGAAGCCATTATTTCCCGTGTACCTGAGAACCGTCAAACTTTGCT
Spr_8   E16   opSpV0100002757                        ref|NC_003098.1|:1458673-1459323
                                                                   NC_003098.1
                                AGCTGAGGTCTTGGAACACACTGTCTCTGACCTGTTCGTGGAAAGACTAG
Spr_8   E18   opSpV0100002758                        ref|NC_003098.1|:c1622173-1621532
                                                                   NC_003098.1
                                AATAAAAATACTTCATGAAGTTATCGGACTGCATATGAATAGGGCTATATC
Spr_8   E20   opSpV0100002759                        -             -
                                TCTAAAATCCTTTGCAGTTGCTAAATCATTAAAGAATTCTCAAATGGTGGAG
Spr_8   E22   opSpV0100002760                        gb|AE007317|:675905-676118
                                                                   AE007317
                                GGTATAATGATAAAGTTATATAGTCCCGATAAGATGGTAGGTATTTATTAC
Spr_8   E24   opSpV0100002761                        -             -
                                AGAGATTTTCGAAGAGTATCATACGAAAAAGCCCTGTTCCTCAAGATGAGG
Spr_8   G02   opSpV0100002762                        ref|NC_003098.1|:c392149-391847
                                                                   NC_003098.1
                                CAATCTTTCAAAATTAAGATTCTCTGAAGAAGAAACTGCTGCCTTTGCGAC
Spr_8   G04   opSpV0100002763                        ref|NC_003098.1|:c1948665-1948375
                                                                   NC_003098.1
                                ATTAATGAGCGTGTCGAGAAATTAGGTAAGTTAAAACCTATTACAATAAATT
Spr_8   G06   opSpV0100002764                        gb|AE007317|:120280-121083
                                                                   AE007317
                                ACTAATGCTCTTAATATTGCGGCTACTGTTGCTGAAGTTTTCTCATTAGGA
Spr_8   G08   opSpV0100002765                        ref|NC_003098.1|:c1219066-1218032
                                                                   NC_003098.1
                                TATTGGTGGAAAAAATTGACCGTCTACTATATGATTGACGATGCAGGGGTT
Spr_8   G10   opSpV0100002766                        ref|NC_003098.1|:164354-164956
                                                                   NC_003098.1
                                TCTATGAAATGGACCATCCCTATGTCGCTTTTTTGCCGACCTATCTCGAAG
Spr_8   G12   opSpV0100002767                        gb|AE007317|:1743161-1743786
                                                                   AE007317
                                TCAATTGAAACAAGAACAGGATAAAAGAACCTTTTGTGCCATATTTTTCTCC
Spr_8   G14   opSpV0100002768                        gb|AE007317|:1461108-1462111
                                                                   AE007317
                                ATCATCTTCATCAAAACCATTCAACTCCTTGTCATTGATGGAATCATGCTG
Spr_8   G16   opSpV0100002769                        -             -
                                TTTACAAACTACAATTCAAGAGGACTATACGCATCCTGAGTTAGAATGGAT
Spr_8   G18   opSpV0100002770                        ref|NC_003098.1|:604493-605116
                                                                   NC_003098.1
                                GGCTCTAAAGTATGGAGGTTATACAAGTCTGGACAAGGTCTATCTGGATC
Spr_8   G20   opSpV0100002771                        ref|NC_003098.1|:c136550-136317
                                                                   NC_003098.1
                                AAAGAACGTAGCCCACGCCGTGAAACAACACGCACGCTTTACCTAGACAT
Spr_8   G22   opSpV0100002772                        ref|NC_003098.1|:847414-847641
                                                                   NC_003098.1
                                GGCAAGATTATTGGCGGCATTTATGACGATCGCTTTTTAGTTAAACCCGTG
Spr_8   G24   opSpV0100002773                        ref|NC_003098.1|:c657277-656822
                                                                   NC_003098.1
                                CTGATCATTTCCAAACCCCAACTCTGTGGTATCAAAAACTGGTATGACGAC
Spr_8   I02   opSpV0100002774                        ref|NC_003098.1|:c1360395-1359229
                                                                   NC_003098.1
                                TTTAGGGCACCATACCTATAAATGGAAAGAAACAGAAACGGATAGTGAAG
Spr_8   I04   opSpV0100002775                        ref|NC_003098.1|:c1960997-1960527
                                                                   NC_003098.1
                                AGTACCTCAATGTAGGACAGATGAGTAAAACGGAGGAAAATGAAAAGGTA
Spr_8   I06   opSpV0100002776                        ref|NC_003098.1|:c1603494-1602343
                                                                   NC_003098.1
                                CAAAGTAAAGAGTATTCTGGACGTCGTTTTGAGTAATCATCTAGTCAGTCT
Spr_8   I08   opSpV0100002777                        gb|AE007317|:1925304-1925782
                                                                   AE007317
                                GTTAGAATATGTAAGTGAGTACCAGATATACCAAGACATCGTCACCATCTA
Spr_8   I10   opSpV0100002778                        gb|AE007317|:312761-313114
                                                                   AE007317
                                AAAAGTTCTAGCTTCCCCATTCTATGGAATCTTGCATTATCCATAATAATAA
Spr_8   I12   opSpV0100002779                        ref|NC_003098.1|:83838-84536
                                                                   NC_003098.1
                                AATACTTATCACCAGAGCAGCCTTTCCTATTTATTACTGCTAAGACCAGTG
Spr_8   I14   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_8   I16   opSpV0100002780                        ref|NC_003098.1|:992899-993603
                                                                   NC_003098.1
                                CCTATAATAACGCTTTTATGACAGGGAATATCAAACGGACCATGCTGGCTT
Spr_8   I18   opSpV0100002781                        ref|NC_003098.1|:128356-130215
                                                                   NC_003098.1
                                TTTAACAAGTCTAGCCAGCGTCGCTATCTTAGGGGCTGGTTTTGTTACGTC
Spr_8   I20   opSpV0100002782                        ref|NC_003098.1|:351393-352277
                                                                   NC_003098.1
                                ATGGTTGTCGGCTGGCAATATATACCTGCTCCACACAAGGGGGTTACGAT
Spr_8   I22   opSpV0100002783                        ref|NC_003098.1|:c1555229-1554780
                                                                   NC_003098.1
                                TATAAGACACCTGCTGTGGTCTTTATCTTGGCCATTTTGGCACCGCTGGTT
Spr_8   I24   opSpV0100002784                        ref|NC_003098.1|:c21312-21106
                                                                   NC_003098.1
                                CTCATCAAACTTATCAAGCACAATGCCTTTGGTTTTAGGAACTTTGAAAAC
Spr_8   K02   opSpV0100002785                        -             -
                                AATTGTCAGATAATATCATTTTGTGTTATAATGAAGAAAAAACAGAGGTGTT
Spr_8   K04   opSpV0100002786                        ref|NC_003098.1|:909797-910276
                                                                   NC_003098.1
                                TTATGGATAAAGTACTAGACTATGTTCGAACAGCGCCAGCAGGTTTAAGCA
Spr_8   K06   opSpV0100002787                        ref|NC_003098.1|:c1132667-1131681
                                                                   NC_003098.1
                                GCCGTGCAGAAGCGGATACAAGTGTCACTTTAGGAAATCACACCTTTAAA
Spr_8   K08   opSpV0100002788                        ref|NC_003098.1|:805060-805371
                                                                   NC_003098.1
                                TACAACACGTACGATTAAACGCATTTCAATTGAATACCCTGAACTCTACGC
Spr_8   K10   opSpV0100002789                        ref|NC_003098.1|:c803119-802865
                                                                   NC_003098.1
                                CAAAAGGATTCTCCTAGCGATATCCAATCTATCTACGACCAACGGGCACC
Spr_8   K12   opSpV0100002790                        ref|NC_003098.1|:660612-661262
                                                                   NC_003098.1
                                TTGACCAACGTCAAATTTTTGTAGTAGACCCAATGTTGGCAACAGGTGGC
Spr_8   K14   opSpV0100002791                        ref|NC_003098.1|:335681-336208
                                                                   NC_003098.1
                                TTGAAACCCATGGGGAAAATTGGAATGAAGGCAATCAGATGAAACTGAGT
Spr_8   K16   opSpV0100002792                        ref|NC_003098.1|:c1910818-1910618
                                                                   NC_003098.1
                                GAACAAGTATAAAGTGATTTATTATGTAGTGGTCATAGCTTTATTAGTCAG
Spr_8   K18   opSpV0100002793                        ref|NC_003098.1|:85780-86391
                                                                   NC_003098.1
                                ACGTCGTAACTACGTACCAGGACAACACGGACCAAACAACCGTTCTAAAT
Spr_8   K20   opSpV0100002794                        ref|NC_003098.1|:c1375613-1375323
                                                                   NC_003098.1
                                CTCTATTTTGACTGACAACGGTGCAACTGTTGTTGAATCAAAAACTTGGGA
Spr_8   K22   opSpV0100002795                        -             -
                                TTTCAAATTGCCAGAGTATTCAATCGCAGCATATTGGAATGCAATGAGTGA
Spr_8   K24   opSpV0100002796                        gb|AE007317|:1632901-1633220
                                                                   AE007317
                                ACAATCCCAAAGCCAACCATGATACCATTTTGCTGACCGATTTGGCTGAGT
Spr_8   M02   opSpV0100002797                        gb|AE007317|:761603-761882, gb|AE007317|:9
                                                                   AE007317
                                TTCGAATGATAGCTTGTGTTCTTCCCTCAAGAACAGTGATGATATTGAGCT
Spr_8   M04   opSpV0100002798                        ref|NC_003098.1|:1577455-1577880
                                                                   NC_003098.1
                                TAAAAATTGCGGTCTACTCAGTCGCATGTGTTGCCATCAAGATAGACGCTC
Spr_8   M06   opSpV0100002799                        ref|NC_003098.1|:c1588329-1588150
                                                                   NC_003098.1
                                AAAAAATATAGAGTACGCAGTGGTCCTATGATTCATTCAACTCCGCCTCAA
Spr_8   M08   opSpV0100002800                        gb|AE007317|:1086486-1086725
                                                                   AE007317
                                AGATTATTTGAGTACCTACAACTCGCAACAATTGGAATATTATAATTCCCAA
Spr_8   M10   opSpV0100002801                        ref|NC_003098.1|:887384-887584
                                                                   NC_003098.1
                                GAGCAAGTTGACAAGTCTGAACTTCGTGCCTTGAGTCAAGAGTTAGACCA
Spr_8   M12   opSpV0100002802                        ref|NC_003098.1|:130562-131737
                                                                   NC_003098.1
                                CTTCGTGGCGTGGACAATGGCAAGGATCAGACCTATTTCCTCAGCCAACT
Spr_8   M14   opSpV0100002803                        ref|NC_003098.1|:518039-518656
                                                                   NC_003098.1
                                GCCCACCGTCTCTCGCATTTTCTCTGGAAGCACGGCTTCAAACTATTAGC
Spr_8   M16   opSpV0100002804                        gb|AE007317|:1723154-1723400
                                                                   AE007317
                                CATTCTATCTACAATAACACCCCAGACTAAAAAGCTTTTCAAAAGTATATTT
Spr_8   M18   opSpV0100002805                        -             -
                                TTAGGATTGAGGGAAGTTAGAAGGCTTTATTTAGGCAGTTCAGATATCCCA
Spr_8   M20   opSpV0100002806                        ref|NC_003098.1|:1550199-1551164
                                                                   NC_003098.1
                                TCGAAGACTACAATCGTGTGACAGCGCCGATTATTTCCTTTGACCGAAAC
Spr_8   M22   opSpV0100002807                        ref|NC_003098.1|:c762401-761883, ref|NC_003
                                                                   NC_003098.1
                                GTTTCAAGTGCTATCACTGTTCAAAAATGATGGTTGCTGAGACTCCCCTGG
Spr_8   M24   opSpV0100002808                        ref|NC_003098.1|:1013318-1014457
                                                                   NC_003098.1
                                GGAAATACAGTTGGTTTTCACAATATGTCGACATTGACGGACCACCGTCC
Spr_8   O02   opSpV0100002809                        -             -
                                CTATGTGGTGGAGCTTTTCTGTTCTTTCTGAAATATGGTATAATAGCACTA
Spr_8   O04   opSpV0100002810                        ref|NC_003098.1|:661436-662026
                                                                   NC_003098.1
                                ATCGCATCAAGTGGAGCAAAAGGCAAACGTTTCATGCTTCCAAATGCTGA
Spr_8   O06   opSpV0100002811                        ref|NC_003098.1|:c1982174-1980789
                                                                   NC_003098.1
                                GTCTGCTGTCAGCAAGCTTGAAAGTAGCACATCTGAGAAACATTTGGATC
Spr_8   O08   opSpV0100002812                        ref|NC_003098.1|:1888643-1889899
                                                                   NC_003098.1
                                AAACAGGAATTTCTTACACTGAGTTCGCTTACCAAATCATGCAAGGGTATG
Spr_8   O10   opSpV0100002813                        -             -
                                CTTGATGGCTATGCTACTAATAACAATTAGGAGAGAAAATCAGGCACTTGT
Spr_8   O12   opSpV0100002814                        ref|NC_003098.1|:1601632-1602291
                                                                   NC_003098.1
                                GTCATGGTCTCCTTCCTCATACTTGGAATTTTGGCTCATTTTATCGATATC
Spr_8   O14   opSpV0100002815                        ref|NC_003098.1|:201623-202165
                                                                   NC_003098.1
                                AGGTGTTGCGATCGGTGCAAAAGTTACCCTTCGTGGTGAACGTATGTACG
Spr_8   O16   opSpV0100002816                        ref|NC_003098.1|:c1416016-1414511
                                                                   NC_003098.1
                                ATGAAACTGAAGTAGCAAAAACTTCGCAGGATACAACGACAGCTTCAAGTA
Spr_8   O18   opSpV0100002817                        ref|NC_003098.1|:888961-889536
                                                                   NC_003098.1
                                TGGTGTGGTCCATGCAAGAAAAGTATGCCAGAGTTGATGGAACTAGCGGC
Spr_8   O20   opSpV0100002818                        ref|NC_003098.1|:c1690950-1690877, ref|NC_0
                                                                   NC_003098.1
                                GTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGT
Spr_8   O22   opSpV0100002819                        ref|NC_003098.1|:c1558820-1558080
                                                                   NC_003098.1
                                GACAGTTATCCTTGAGTCAGGTGACTATCTCTTGCTCAATAGTGACGGCT
Spr_8   O24   opSpV0100002820                        ref|NC_003098.1|:978562-978951, ref|NC_0030
                                                                   NC_003098.1
                                AACTATTGTCATGATATGAAGTTGTTCAAAATGAGTTGCAGAAATATCGGA
Spr_8   B02   EMPTY             -                    -             -
Spr_8   B04   opSpV0100002821                        -             -
                                TAGATAGAATGACACCGCTGTCATTATCTTTATCATATATTTTCCAAATTGA
Spr_8   B06   opSpV0100002822                        ref|NC_003098.1|:572123-578809
                                                                   NC_003098.1
                                GAATGGTGAACGTATTAAATTCCATGGAGTATCCTTGCACCACGACCATG
Spr_8   B08   opSpV0100002823                        -             -
                                GAGAAGATTTTGCTTCATCTGTTCCTTGAAAAAAGTCACAGCAGTCATCAC
Spr_8   B10   opHsV04NC000001                        -
                                TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_8   B12   opSpV0100002824                        ref|NC_003098.1|:495460-496263
                                                                   NC_003098.1
                                ATCCAAACTTGTCTTATGAAGCGAAGCGTGATTTATGGCGGATAGGTTTTG
Spr_8   B14   opSpV0100002825                        ref|NC_003098.1|:668470-669459
                                                                   NC_003098.1
                                ATTACCAAGCAGGTGATGAGGCTGGTATTAAGTCGGTAACTTTATCATTTG
Spr_8   B16   opSpV0100002826                        ref|NC_003098.1|:258090-258812
                                                                   NC_003098.1
                                GTTTCATCAGATCAAGCGTATGGTGGGCTACTGTGGCAAGGAAGTGGTGG
Spr_8   B18   opSpV0100002827                        ref|NC_003098.1|:1900087-1901358
                                                                   NC_003098.1
                                ACAGTTCAAGAACACTCAACCACTGCCAAACATCTCTCAAATGTCTGCAGT
Spr_8   B20   opSpV0100002828                        ref|NC_003098.1|:1732567-1735557
                                                                   NC_003098.1
                                AGGAACGTGTTCTAAGGCTAGTATTAAGTTTAGGTGATACGCTATATAATG
Spr_8   B22   opSpV0100002829                        gb|AE007317|:1644378-1644620
                                                                   AE007317
                                AACCTCCTCTCATTTCATTCACTGAATTCACGCTATTCTAACTCACTTATCT
Spr_8   B24   opSpV0100002830                        ref|NC_003098.1|:208068-208184
                                                                   NC_003098.1
                                AGTAAGACCATCGGTCAAACCAATTTGCGAATACTGTAAAGTTATTCGTCG
Spr_8   D02   opSpV0100002831                        ref|NC_003098.1|:422191-423603
                                                                   NC_003098.1
                                CAATTCAAGCGAATCATAATATGTTGTTGGCGCATGCTCTTGCAGTCCTCG
Spr_8   D04   opSpV0100002832                        gb|AE007317|:39745-40223
                                                                   AE007317
                                GGTGTTATCTATTCTGACTAGGAATAGATCATACCAGAGGTAGCTTAGAAA
Spr_8   D06   opSpV0100002833                        -             -
                                AAAACAGTGTGTTGCGCAGCCTTTAATCAGCCGCCTAGTCCGCTCTATGG
Spr_8   D08   opSpV0100002834                        ref|NC_003098.1|:c900088-899873
                                                                   NC_003098.1
                                ATTTGCCTTGCTCAAAAGACTTTCTACTTCTTCCTTGCTATCTGTCGCAGA
Spr_8   D10   opSpV0100002835                        ref|NC_003098.1|:c941641-940787
                                                                   NC_003098.1
                                TATTTACTCATCTCTGAATAAAACTAATAAGCAGATTGTCTCTCAGCTTGCT
Spr_8   D12   opSpV0100002836                        ref|NC_003098.1|:383279-384646
                                                                   NC_003098.1
                                AGGCCAATTATGGCAATGGTGCCATGTACATAGAACGGGTTATCTATCCA
Spr_8   D14   opSpV0100002837                        ref|NC_003098.1|:844547-845440
                                                                   NC_003098.1
                                CTGGCCAGCCATTGTTTACCGTCTCAAGCTGTCAGGAACTTTTGTTTACCT
Spr_8   D16   opSpV0100002838                        ref|NC_003098.1|:c1764762-1763512
                                                                   NC_003098.1
                                GATTTTCACCGAATTGGGTCGTTTTATGCTGGCACCTCACGGTGCTCTAG
Spr_8   D18   opSpV0100002839                        ref|NC_003098.1|:728361-729281
                                                                   NC_003098.1
                                ATTGATGGGAAAGCTTTAGCGGCCAAATTGCAGGGGCAGTTGGCTGAAAA
Spr_8   D20   opSpV0100002840                        ref|NC_003098.1|:c1652449-1652006
                                                                   NC_003098.1
                                GTTAGTCCGTGTGGAAAAGACAAGCGTAAGAAGTATTTAGTTTTAACGGAG
Spr_8   D22   opSpV0100002841                       -             -
                                CGCTACTCCTAAGAATAGCGATTTAATCATGTTTTTAAGCTACTACTGTAG
Spr_8   D24   opSpV0100002842                       gb|AE007317|:751831-752240
                                                                  AE007317
                                TGCTTATCTCAAAGAGGCGCTTAAGGGAGCGGCTAAGACACAAACTAAGA
Spr_8   F02   opSpV0100002843                       ref|NC_003098.1|:273803-273895
                                                                  NC_003098.1
                                TCAATTGACTATAAATCGCTATAAGAAAAAATCATTTTATTGGTATAAAGAA
Spr_8   F04   opSpV0100002844                       ref|NC_003098.1|:52812-53357
                                                                  NC_003098.1
                                TAGCAGGCTACATGAAAATCGTTGGACCAACCTTATTGTCGGCTTATGAAG
Spr_8   F06   opSpV0100002845                       -             -
                                GAAAATCTCTTCAAACCACGTCAGCGTCACCTTACCGTAGTATGGTTACTG
Spr_8   F08   opSpV0100002846                       ref|NC_003098.1|:477306-477917
                                                                  NC_003098.1
                                GTACTTGAGACGCTGGTTTATATTCATTTCTTCGCTGTTTCTTCTGGCTCA
Spr_8   F10   opSpV0100002847                       ref|NC_003098.1|:1300763-1301374
                                                                  NC_003098.1
                                AAGGCTACAACTCCATTGTTGTTCAGCATGAAATTGACCACATTAACGGTA
Spr_8   F12   opSpV0100002848                       ref|NC_003098.1|:137885-138568
                                                                  NC_003098.1
                                TAGCTATACAGGCTTGCGAATTGCGGTAGCAACTGCTAAGACCTTAGCTC
Spr_8   F14   opSpV0100002849                       ref|NC_003098.1|:c1206963-1206709
                                                                  NC_003098.1
                                TTGGAGTTGTCTTTGAGCAAAGGTTGGATTGATGAGGATGGGGCTATTTA
Spr_8   F16   opSpV0100002850                       -             -
                                GGAATACCAAAGATAAAAATAAAAAACGTTGATTTAACAACGTTTTACCAAG
Spr_8   F18   opSpV0100002851                       ref|NC_003098.1|:c1198451-1197693
                                                                  NC_003098.1
                                TGGAATCAACCCCTATAAAATCAGAAATGCAAAATTGTCAAGTATAAGACG
Spr_8   F20   opSpV0100002852                       ref|NC_003098.1|:76686-78065
                                                                  NC_003098.1
                                TTAGTTAGCTTTTTTCAAACAGTGACGATGCGAACAGCTGGCTTTTCTACG
Spr_8   F22   opSpV0100002853                       -             -
                                AAGAAGCAATGGTCGTTGTTGCTGTTGATAAGGACTGTTAATTTAAACTTA
Spr_8   F24   opSpV0100002854                       -             -
                                AGAAAATTGAGCGTATTTCTGTAATACACCGAGAAAAGATTTTATGGCTCA
Spr_8   H02   opSpV0100002855                       gb|AE007317|:118109-118610
                                                                  AE007317
                                GAATTGGTGAAATAAACTTTGTAAGTTATTTATTGTATATATGTGTAGGAAT
Spr_8   H04   opSpV0100002856                       -             -
                                ATTGAGTACAAAAAGTAAACTTTTCTCTTGCAATTCCAGATAAATAGTGTAT
Spr_8   H06   opSpV0100002857                       -             -
                                AGAGTGCATACGTCGAAATCGAACGGAGAATCGATTAAAGCACAAACCCT
Spr_8   H08   opSpV0100002858                       -             -
                                ATACTCAAGATTATTGAAATCTTAGACTAAAAAATAGGTACTGCTACCTTTA
Spr_8   H10   opSpV0100002859                       ref|NC_003098.1|:c1454845-1453871
                                                                  NC_003098.1
                                ACGCAGGTCTATCGCCAGGAACTTCTCTATGGAGAGAGGGAAGCCAAGTC
Spr_8   H12   opSpV0100002860                       ref|NC_003098.1|:1036311-1037162
                                                                  NC_003098.1
                                AAGGAATCCAGACGCTAGCTATCAACTCCAAAGAGCAAGTGACTGTAAAA
Spr_8   H14   opSpV0100002861                       gb|AE007317|:802063-802864
                                                                  AE007317
                                TCGGTTTCTCTAGTTTAGTATTTGCCTTTTGCAAAGTGATCTTAAATGCCTT
Spr_8   H16   opSpV0100002862                       ref|NC_003098.1|:c983835-983584
                                                                  NC_003098.1
                                CTATAAGGACTGCTATCATGTAGAGCGTACTCTCAAGTATGAGGATCATGA
Spr_8   H18   opSpV0100002863                       ref|NC_003098.1|:74079-74336
                                                                  NC_003098.1
                                CAGTGAGATCTAGTGTAGAGCGCGTGATTGAGATGATAATTACCGAAAAT
Spr_8   H20   opSpV0100002864                       ref|NC_003098.1|:c2016280-2015486
                                                                  NC_003098.1
                                CAACCATGCCTTTAAGTTTGGCATCAGCTGTCGAAGCTTTATTAGCACCTT
Spr_8   H22   opSpV0100002865                       ref|NC_003098.1|:198601-198882
                                                                  NC_003098.1
                                CACTATTGCAGTTTATGACGGACGTAAACACGTACCTGTTTACATCCAAGA
Spr_8   H24   opSpV0100002866                       ref|NC_003098.1|:c1157925-1154749
                                                                  NC_003098.1
                                TAACATCGAGGAATCTCTTCTCAAGGCCTGCCGCTCCCTTGAAATTGGGG
Spr_8   J02   opSpV0100002867                       ref|NC_003098.1|:586337-586930
                                                                  NC_003098.1
                                TAGTGTCACCAGGACATAAGGGAGAGCAATCTGAAGCGGACTTTAAGAAT
Spr_8   J04   opSpV0100002868                       gb|AE007317|:1414287-1414510
                                                                  AE007317
                                GAAATAAGATGAAACCAAGTCGATTAGGAAAGGTAAATGAATTTCTAAAAT
Spr_8   J06   opSpV0100002869                       ref|NC_003098.1|:853830-855011
                                                                  NC_003098.1
                                TTATCGTCATTGTGGAAGTTGTGTACTTGATTGCTTACTTTTTCAAGCAAAA
Spr_8   J08   opSpV0100002870                       -             -
                                GAGGGAAACATGAGATTCTATTGTGAAGCTTATGAGGTAATTACTGAAGAG
Spr_8   J10   opSpV0100002871                       -             -
                                AGAGGAAGATTTATTTTACAAAGACGTTGAAGGCCGCATGGAAGAGTTGA
Spr_8   J12   opSpV0100002872                       -             -
                                AGAAGACAAAATCGAAATCAGGGTGGTTTAGCTTTTCGTTTTATGAAGGGC
Spr_8   J14   opSpV0100002873                       ref|NC_003098.1|:c1530681-1530004
                                                                  NC_003098.1
                                AGTTAATGATGTTGTACTTACTACTGTCTTATCTGATAGCACTGATTAGTG
Spr_8   J16   opSpV0100002874                       ref|NC_003098.1|:138565-139002
                                                                  NC_003098.1
                                GCCGACAGACAAGGAAATTTTCCTCGAAGTCAGACAGTCAAATCAACGAG
Spr_8   J18   opSpV0100002875                       ref|NC_003098.1|:c1940789-1939038
                                                                  NC_003098.1
                                AAATCTACTTTCACTCAGTAGGGCGAGGAACTCCACTCTTGCTTAATATTC
Spr_8   J20   opSpV0100002876                       ref|NC_003098.1|:734318-735061
                                                                  NC_003098.1
                                TGATGCTCCAAAACTAGAAACTCCTCTTAGAGAGGAGCCAAGACTAGCTC
Spr_8   J22   opSpV0100002877                       ref|NC_003098.1|:1-1362
                                                                  NC_003098.1
                                GTAGTCCAAAACATCTAGAAGGGCTCGAGGAGAGGCTTGTCACGCGTTTT
Spr_8   J24   opSpV0100002878                       ref|NC_003098.1|:c1645520-1644621
                                                                  NC_003098.1
                                CCTGATGGCGATTGTTCTTCGATTTACGGACTGGTATATCCTAGATCCTCT
Spr_8   L02   opSpV0100002879                       ref|NC_003098.1|:1179472-1180818
                                                                  NC_003098.1
                                GCAACTGGTTACGGTTTGGTTTACTATACTGAAGAAATGCTCAAAGCTAAC
Spr_8   L04   EMPTY             -                   -             -
Spr_8   L06   EMPTY             -                   -             -
Spr_8   L08   EMPTY             -                   -             -
Spr_8   L10   EMPTY             -                   -             -
Spr_8   L12   EMPTY             -                   -             -
Spr_8   L14   EMPTY             -                   -             -
Spr_8   L16   EMPTY             -                   -             -
Spr_8   L18   EMPTY             -                   -             -
Spr_8   L20   EMPTY             -                   -             -
Spr_8   L22   EMPTY             -                   -             -
Spr_8   L24   EMPTY             -                   -             -
Spr_8   N02   EMPTY             -                   -             -
Spr_8   N04   EMPTY             -                   -             -
Spr_8   N06   EMPTY   -   -   -
Spr_8   N08   EMPTY   -   -   -
Spr_8   N10   EMPTY   -   -   -
Spr_8   N12   EMPTY   -   -   -
Spr_8   N14   EMPTY   -   -   -
Spr_8   N16   EMPTY   -   -   -
Spr_8   N18   EMPTY   -   -   -
Spr_8   N20   EMPTY   -   -   -
Spr_8   N22   EMPTY   -   -   -
Spr_8   N24   EMPTY   -   -   -
Spr_8   P02   EMPTY   -   -   -
Spr_8   P04   EMPTY   -   -   -
Spr_8   P06   EMPTY   -   -   -
Spr_8   P08   EMPTY   -   -   -
Spr_8   P10   EMPTY   -   -   -
Spr_8   P12   EMPTY   -   -   -
Spr_8   P14   EMPTY   -   -   -
Spr_8   P16   EMPTY   -   -   -
Spr_8   P18   EMPTY   -   -   -
Spr_8   P20   EMPTY   -   -   -
Spr_8   P22   EMPTY   -   -   -
Spr_8   P24   EMPTY   -   -   -
Spr_8   B01   EMPTY   -   -   -
Spr_8   B03   EMPTY   -   -   -
Spr_8   B05   EMPTY   -   -   -
Spr_8   B07   EMPTY   -   -   -
Spr_8   B09   EMPTY   -   -   -
Spr_8   B11   EMPTY   -   -   -
Spr_8   B13   EMPTY   -   -   -
Spr_8   B15   EMPTY   -   -   -
Spr_8   B17   EMPTY   -   -   -
Spr_8   B19   EMPTY   -   -   -
Spr_8   B21   EMPTY   -   -   -
Spr_8   B23   EMPTY   -   -   -
Spr_8   D01   EMPTY   -   -   -
Spr_8   D03   EMPTY   -   -   -
Spr_8   D05   EMPTY   -   -   -
Spr_8   D07   EMPTY   -   -   -
Spr_8   D09   EMPTY   -   -   -
Spr_8   D11   EMPTY   -   -   -
Spr_8   D13   EMPTY   -   -   -
Spr_8   D15   EMPTY   -   -   -
Spr_8   D17   EMPTY   -   -   -
Spr_8   D19   EMPTY   -   -   -
Spr_8   D21   EMPTY   -   -   -
Spr_8   D23   EMPTY   -   -   -
Spr_8   F01   EMPTY   -   -   -
Spr_8   F03   EMPTY   -   -   -
Spr_8   F05   EMPTY   -   -   -
Spr_8   F07   EMPTY   -   -   -
Spr_8   F09   EMPTY   -   -   -
Spr_8   F11   EMPTY   -   -   -
Spr_8   F13   EMPTY   -   -   -
Spr_8   F15   EMPTY   -   -   -
Spr_8   F17   EMPTY   -   -   -
Spr_8   F19   EMPTY   -   -   -
Spr_8   F21   EMPTY   -   -   -
Spr_8   F23   EMPTY   -   -   -
Spr_8   H01   EMPTY   -   -   -
Spr_8   H03   EMPTY   -   -   -
Spr_8   H05   EMPTY   -   -   -
Spr_8   H07   EMPTY   -   -   -
Spr_8   H09   EMPTY   -   -   -
Spr_8   H11   EMPTY   -   -   -
Spr_8   H13   EMPTY   -   -   -
Spr_8   H15   EMPTY   -   -   -
Spr_8   H17   EMPTY   -   -   -
Spr_8   H19   EMPTY   -   -   -
Spr_8   H21   EMPTY   -   -   -
Spr_8   H23   EMPTY   -   -   -
Spr_8   J01   EMPTY   -   -   -
Spr_8   J03   EMPTY   -   -   -
Spr_8   J05   EMPTY   -   -   -
Spr_8   J07   EMPTY   -   -   -
Spr_8   J09   EMPTY   -   -   -
Spr_8   J11   EMPTY   -   -   -
Spr_8   J13   EMPTY   -   -   -
Spr_8   J15   EMPTY   -   -   -
Spr_8   J17   EMPTY   -   -   -
Spr_8   J19   EMPTY   -   -   -
Spr_8   J21   EMPTY   -   -   -
Spr_8   J23   EMPTY   -   -   -
Spr_8   L01   EMPTY   -   -   -
Spr_8   L03   EMPTY   -   -   -
Spr_8   L05   EMPTY   -   -   -
Spr_8   L07   EMPTY   -   -   -
Spr_8   L09   EMPTY   -   -   -
Spr_8   L11   EMPTY   -   -   -
Spr_8   L13   EMPTY   -   -   -
Spr_8   L15   EMPTY   -   -   -
Spr_8   L17   EMPTY   -   -   -
Spr_8   L19   EMPTY   -   -   -
Spr_8   L21   EMPTY   -   -   -
Spr_8   L23   EMPTY   -   -   -
Spr_8   N01   EMPTY   -   -   -
Spr_8   N03   EMPTY   -   -   -
Spr_8   N05   EMPTY   -   -   -
Spr_8   N07   EMPTY   -   -   -
Spr_8   N09   EMPTY   -   -   -
Spr_8   N11   EMPTY   -   -   -
Spr_8   N13   EMPTY   -   -   -
Spr_8   N15   EMPTY   -   -   -
Spr_8   N17   EMPTY   -   -   -
Spr_8   N19   EMPTY   -   -   -
Spr_8       N21   EMPTY            -                       -             -
Spr_8       N23   EMPTY            -                       -             -
Spr_8       P01   EMPTY            -                       -             -
Spr_8       P03   EMPTY            -                       -             -
Spr_8       P05   EMPTY            -                       -             -
Spr_8       P07   EMPTY            -                       -             -
Spr_8       P09   EMPTY            -                       -             -
Spr_8       P11   EMPTY            -                       -             -
Spr_8       P13   EMPTY            -                       -             -
Spr_8       P15   EMPTY            -                       -             -
Spr_8       P17   EMPTY            -                       -             -
Spr_8       P19   EMPTY            -                       -             -
Spr_8       P21   EMPTY            -                       -             -
Spr_8       P23   EMPTY            -                       -             -
Spr_CTRL1   A01   EMPTY            -                       -             -
Spr_CTRL1   A03   H2NC000001                               -             -
                                   GTCACATGCGATGGATCGAGCTCCTTTATCATCGTTCCCACCTTAATGCAC
Spr_CTRL1   A05   H2NC000002                               -             -
                                   TCATTCGATCGGGACGAACGCTAGAACCTTGACTTAGCTACTAATAAGTTC
Spr_CTRL1   A07   H2NC000003                               -             -
                                   TTTCTTGACTCGGACATCCGCGCTATGCGCTAGGGTACCGTTACTGGTCA
Spr_CTRL1   A09   H2NC000004                               -             -
                                   ACACGAACGACGTTATGGGCCCCATACGAATCAGAATCGAGTAACCTTTT
Spr_CTRL1   A11   H2NC000005                               -             -
                                   AACTAAGTGCTATATGAGGTATCGTCGTTTATGTCGCGACGAGCAACATG
Spr_CTRL1   A13   H2NC000006                               -             -
                                   CACAAACGCGTCTGAGTAACGGGCGCCCTATGGTCGGAGCGGACACACG
Spr_CTRL1   A15   H2NC000007                               -             -
                                   ATGGTTGGAAACATTGTGAGTTCGTCCAGCAAGCGAGGCCTTGGGCGTAA
Spr_CTRL1   A17   H2NC000008                               -             -
                                   CGCTCCCGTATTTTTGACGTGAAAGGTGTCGCCTCTTGAACACGATTCTC
Spr_CTRL1   A19   H2NC000009                               -             -
                                   TAACCAAGTTATTGCGCACCGAGTCAAAGTCGGACGTGATCCCGGTTCGA
Spr_CTRL1   A21   H2NC000010                               -             -
                                   GGGCCGTGAGCTAACTGTAAATAACTATCCAGATACTGACACGTCAACGC
Spr_CTRL1   A23   H2NC000011                               -             -
                                   CGAGCTGTATGCCGCGTGTCGAAAATACCGGGATATCGATACTAGGACAA
Spr_CTRL1   C01   M2NC000001                               -             -
                                   GGATATCAGCGTGCTAGACGCACTTAATTAACTACGATTAGCGCGCGTCG
Spr_CTRL1   C03                                            -
                  opHsV04NC000001 TCAGTCGATCGCGACGTACGCTAGAACCTC-
Spr_CTRL1   C05                                            ref|NC_003098.1|:199251-199904
                                                                         NC_003098.1
                  opSpV0100002141 AATCAAAACTCAAGTATCAGGTCGTTTGAACGGTGCAGATATCGCCCGTG
Spr_CTRL1   C07                                            ref|NC_003098.1|:c364489-363875
                                                                         NC_003098.1
                  opSpV0100001969 GGAAGATGGCAATAAGGACATCGTCAAGCGCGTGATTGGAATGCCTGGC
Spr_CTRL1   C09                                            ref|NC_003098.1|:436031-436633
                                                                         NC_003098.1
                  opSpV0100002430 CGTGCTATCTTGGAACTTCGTGGTCGCGATCATGAGATGCATTTTAGCGA
Spr_CTRL1   C11                                            ref|NC_003098.1|:1122712-1124199
                                                                         NC_003098.1
                  opSpV0100001705 GATTGATGGCATGAAATACATCTCTTATCGTAGCGAGCCAAATGTGAATCC
Spr_CTRL1   C13                                            ref|NC_003098.1|:1179472-1180818
                                                                         NC_003098.1
                  opSpV0100002879 GCAACTGGTTACGGTTTGGTTTACTATACTGAAGAAATGCTCAAAGCTAAC
Spr_CTRL1   C15                                            ref|NC_003098.1|:c1232287-1231433
                                                                         NC_003098.1
                  opSpV0100002610 ATGGCGTCAGTCAGATTTCGGTCTTTGTTCGTTCCGTTTCTATGGAAAAAA
Spr_CTRL1   C17                                            ref|NC_003098.1|:c1487931-1486672
                                                                         NC_003098.1
                  opSpV0100001744 TTTATCGCAGCAAACACAGATGTACAAGCATTGAGTAGTACAAAAGCTGAG
Spr_CTRL1   C19                                            ref|NC_003098.1|:c1493433-1492390
                                                                         NC_003098.1
                  opSpV0100001942 CTGTCCTTTCAGCTGAGAGTGTCATGCGTGCGGTCGATTACGACCGTTTC
Spr_CTRL1   C21                                            ref|NC_003098.1|:c1498224-1497340
                                                                         NC_003098.1
                  opSpV0100002124 TATCTTCTGCTGGGATGGTGGATCCGGATAAGGGTGAGATTTTCTATGCT
Spr_CTRL1   C23                                            ref|NC_003098.1|:1635320-1635901
                                                                         NC_003098.1
                  opSpV0100001470 TAAGAACATCACCATGAACGAAGGCATCTTAACTGCTCAAGTCTACTCCTT
Spr_CTRL1   E01                                            ref|NC_003098.1|:384683-385549
                                                                         NC_003098.1
                  opSpV0100001310 AAGCTAAGCCAGAGGTTCCAGATGAATTATTTTCCCAGTGTCCAGGCTGT
Spr_CTRL1   E03                    A                       -             -
                  opSpV0100001310_90 tGCTAAaCCAGAGGTTCCAGATGAATTAgTTTCCCAGaGTgCAGGaTGTAA
Spr_CTRL1   E05                    A                       -             -
                  opSpV0100001310_80 tGgTAtaCCAcAGGTaCCAGATGAgTTAgTcTCCtAGaGTgCAGGaTcTAAGgA
Spr_CTRL1   E07                    A                       -             -
                  opSpV0100001310_70 tGgTAtaCgAcAGcTaCCAcATGAgTgAgTcTCatAGaGTgCAcGaTcTAtGgAgA
Spr_CTRL1   E09                                            ref|NC_003098.1|:752241-754721
                                                                         NC_003098.1
                  opSpV0100000746 GAGCGAAAAGAATTCACTCCATGGCGGACCTATAGATCTAAGTCTGTCAA
Spr_CTRL1   E11                    c                       -             -
                  opSpV0100000746_90AGaGAAAcGAATTCACTCCATGGCcGACCTAgAGATCTAtGTCTGTCAAGT
Spr_CTRL1   E13                    c                       -             -
                  opSpV0100000746_80AGaGAtAcGAgTTCACTCCATGaCcGACaTAgAGAgCTAtGTCTGaCAAGTcT
Spr_CTRL1   E15                    c                       -             -
                  opSpV0100000746_70AGaGttAcGAgTaCACTCgATGaCcGtCaTAgAGAggTAtGTgTGaCAtGTcTaCT
Spr_CTRL1   E17                                            ref|NC_003098.1|:856133-856492
                                                                         NC_003098.1
                  opSpV0100000515 TTAAAGGTGGCGTTGTATCACGCAAACGTCGTAAACGTATTCTTAAATTAG
Spr_CTRL1   E19                    T                       -             -
                  opSpV0100000515_90 TAgAGcTGcCGTaGTATCtCGCAtACGTCcTAtACGTATgCTTAgATTAGCAA
Spr_CTRL1   E21                    a                       -             -
                  opSpV0100000515_80TAgAGcTGcCGTaGTATCtCGCAtACaTCcTAtACcTATgCTTAgAgTAcCAAtA
Spr_CTRL1   E23                    a                       -             -
                  opSpV0100000515_70TAgAtcTGcCaTaGTgTCtCGCAtACaTCcaAtACcTgTgCTaAgAgTAcCActAcaT
Spr_CTRL1   G01                                            ref|NC_003098.1|:c1620031-1619051
                                                                         NC_003098.1
                  opSpV0100000792 CATCTTGGTGCTAGACCGTATTGAAGCAATTACAGGAATACGTCCCGTGT
Spr_CTRL1   G03                    C                       -             -
                  opSpV0100000792_90 gTCTaGcTGCTAGtCCcTATTGAtGCAATgACAGGtATACGTCaCGTGTcTTA
Spr_CTRL1   G05                    C                       -          -
                  opSpV0100000792_80 gTaTaGcTtCTAGtCacTATcGAtGCAATgACAGctATACGTCaCaTGTcTaACG
Spr_CTRL1   G07                    a                       -          -
                  opSpV0100000792_70gTaTaGcTtCaAGtCacTATcGAtGCtATgcCAGctATAgGTCaCaTaTcTaAgGAg
Spr_CTRL1   G09   Alien1           -                       -          -
Spr_CTRL1   G11   Alien2           -                       -          -
Spr_CTRL1   G13   Alien3           -                       -          -
Spr_CTRL1   G15   Alien4           -                       -          -
Spr_CTRL1   G17   Alien5           -                       -          -
Spr_CTRL1   G19   Alien6           -                       -          -
Spr_CTRL1   G21   Alien7           -                       -          -
Spr_CTRL1   G23   Alien8           -                       -          -
Spr_CTRL1   I01   Alien9           -                       -          -
Spr_CTRL1   I03   Alien10          -                       -          -
Spr_CTRL1   I05   H300006234                               -          -
                                   GCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCG
Spr_CTRL1   I07   H300013722                               -          -
                                   CTACTCTGTTCCTTCACATCCTGTGTTTCTAGGGAAATGAAAGAAAGGCCA
Spr_CTRL1   I09   H300022861                               -          -
                                   CAGACTCCAGAGCAGCAGGCAGCCATTCTGTCCCTGGTGTAGAGCCTGG
Spr_CTRL1   I11                                            -          -
                  opHsV04TC000032 GTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGGGAGCCGCACC
                R                R                         R6.feature_end_coord
R6.entrez_gene_id 6.gene_symbol 6.locus_tag R6.feature_start_coord       R6.feature_strand
-               -                -          -              -             -
-               -                -          -              -             -
         933172 -                spr1058          1053436        1053594 -
-               -                -          -              -             -
         933146 fucI             spr1964          1951630        1953396 -
         933408 -                spr0022             24122         24589 +
-               -                -          -              -             -
-               -                -                1151028        1151362 +
         934690 -                spr0277            275987        276226 +
         934192 -                spr0652            658531        659376 -
         933935 -                spr1518          1496473        1497324 +
-               -                -          -              -             -
-               -                -                1281808        1282333 +
-               -                -                1947971        1948267 +
         934570 glnP             spr1355          1337591        1338289 -
         934799 hsdM             spr0449            454903        456366 -
         934683 accA             spr0387            385546        386313 +
-               -                -                  719811        720198 +
         933825 rpmE             spr1177          1176610        1176852 +
         933883 -                spr1420          1406396        1406569 -
         934349 -                spr0804            806221        807036 -
-               -                -          -              -             -
         934245 tenA             spr0634            642193        642885 +
         934092 -                spr2005          1998466        1998756 -
         933407 -                spr1923          1905946        1906887 -
         934190 -                spr0640            646614        646985 +
         933425 adcC             spr1977          1968412        1969116 -
         933101 -                spr1952          1935463        1936767 -
-               -                -                1774274        1774529 +
         934048 galR             spr1669          1641933        1642940 +
         934455 ABC-NBD          spr1238          1236416        1237222 -
         932980 malA             spr1921          1903858        1904658 +
         934550 -                spr1332          1318774        1319616 -
         934495 spnIR-truncation spr1285          1280075        1280257 +
         934714 transposase_F spr0412               408542        409090 -
-               -                -          -              -             -
         933404 metY-truncation spr1095           1092272        1093387 -
         933555 infB             spr0481            481913        484705 +
         933181 ABC-SBP          spr0975            960704        961738 +
                                 spr0224
         933052 ABC-SBP-truncation                  216513        216707 -
-               -                -          -              -             -
         932841 map              spr0992            976908        977768 +
    934563   transposase_B     spr1349       1332570       1332869   -
    934782   cps2I             spr0316        315715        316872   +
    933031   dgkA              spr0870        863435        863830   +
    934237   -                 spr0702        701973        702452   +
    933419   dnaG              spr0978        963503        965278   +
-            -                 -              127803        128355   +
    933680   ung               spr1055       1050815       1051483   -
    932820   -                 spr0084         91678         92664   +
    933990   pcp-truncation    spr1871       1842688       1842903   -
    933903   -                 spr1965       1953453       1956569   -
    933225   -                 spr0587        602140        602328   +
    934891   lctO-truncation   spr0625        632576        632722   +
-            -                 -         -             -             -
    932997   groEL             spr1722       1702403       1704025   -
    934044   -                 spr1422       1407616       1408527   -
    933161   -                 spr1465       1447154       1447948   +
    934785   -                 spr0326        324751        324909   +
-            -                 -              955475        956375   +
-            -                 -              475643        475925   +
    933325   PTS-EII           spr0564        570343        571818   +
-            -                 -         -             -             -
    933762   dfp-N-terminus    spr1111       1112468       1113019   +
    934771   ABC-NBD           spr0430        430192        431874   +
-            -                 -         -             -             -
    933502   vncR              spr0528       527330        527986    +
    933987   pepP              spr0172       182039        183100    +
-            -                 -         -             -             -
-            -                 -              130216        130561   +
    933113   -                 spr1471       1451642       1451821   +
-            -                 -             1374276       1374569   +
    933497   -                 spr0933        919628        919846   +
-            -                 -         -             -             -
-            -                 -         -             -             -
-            -                 -             1735558       1735906   +
    933245   ldh               spr1100       1098125       1099111   +
    934526   trxB              spr1312       1302186       1303097   -
    934566   transposase_A     spr1350       1333089       1333304   -
    934078   -                 spr0998        982860        983501   -
    933584   -                 spr0962        943148        943798   +
-            -                 -         -             -             -
    933151   -                 spr1482       1459595       1460017   +
    933169   rplD              spr0189        196727        197350   +
    933218   -                 spr1113       1113794       1114375   +
    934285   pnp               spr0734        733045        733854   +
    932859   sdaA              spr0094        102117        102989   -
-            -                 -             1756204       1756514   +
-            -                 -         -             -             -
    934271   -                 spr0737        735335        735847   +
    934500   ABC-NBD           spr1281       1275624       1276346   -
    934643   serS              spr0372        372211        373548   -
    934483   phoU              spr1252       1251587       1252240   -
    933697   -                 spr1731       1708372       1708821   -
    934039 thrS              spr1472       1451840       1453822 +
    933409 -                 spr1436       1419322       1420080 -
-          -                 -         -             -           -
    934576 atpF              spr1364       1346837       1347331 -
    934060 gpi               spr1882       1859131       1860480 -
    933776 pdxK              spr1450       1433979       1434752 -
-          -                 -              522837        523124 +
    934100 ABC-NBD           spr1021        999368       1001269 +
    932931 lacR              spr1067       1065778       1066539 +
    934059 -                 spr0943        927958        928569 +
-          -                 -              273258        273502 +
-          -                 -             2010489       2010733 +
-          -                 -         -             -           -
-          -                 -              305821        306051 +
    933187 cls               spr0180        187730        189262 +
    933319 -                 spr0566        579191        579598 -
    933873 ABC-MSP           spr0220        213261        214295 -
    933016 amiC              spr1706       1675431       1676927 -
-          -                 -              733855        734317 +
-          -                 -         -             -           -
    934873 ABC-NBD           spr0619        628681        629328 +
    933684 -                 spr1742       1716369       1716851 -
    933226 phpA              spr1060       1054238       1056805 -
    934283 ABC-NBD           spr0748        744090        745625 +
    933476 glnQ-truncation   spr0535        534266        534610 -
-          -                 -         -             -           -
    933806 -                 spr1176       1175567       1176514 +
    934341 dnaE              spr0795        795966        799094 +
    933768 -                 spr0469        475049        475642 -
    934136 hipO              spr1906       1882934       1884064 -
-          -                 -              620574        620915 +
    934206 metK              spr0671        676119        677309 +
-          -                 -              667187        667599 +
    934139 galU              spr1903       1880756       1881655 +
-          -                 -         -             -           -
    932882 msmR              spr1714       1688139       1688999 +
-          -                 -             1518522       1518803 +
    934440 tyrA              spr1231       1228058       1229161 -
    933050 adh2              spr1963       1950333       1951484 -
    933929 -                 spr1856       1831058       1831438 -
-          -                 -              928570        928881 +
    933558 -                 spr0218        210885        212222 +
-          -                 -             1948666       1949094 +
-          -                 -              150363        150652 +
-          -                 -         -             -           -
-          -                 -         -             -           -
    933582 -                 spr1925       1908980       1909210 -
    934737 mraY              spr0305        304515        305495 +
    934147 ruvB              spr0238        232128        233126 +
-          -                 -             2012620       2012842 +
-          -                 -             1899538       1900086 +
    933905 -                 spr0991        975615        976892 +
-            -                 -         -             -           -
-            -                 -             226980         227268 +
    934655   fabH              spr0377       377074         378048 +
-            -                 -         -             -           -
    934880   mutR              spr0140        149499        150362 +
-            -                 -              440821        441112 +
    933932   tpx               spr1495       1471711       1472229 +
    934595   aliB              spr1382       1363510       1365468 -
    934664   transposase_B     spr0273        273609        273815 +
    933155   aroG              spr1543       1525279       1526310 -
    933240   -                 spr1449       1433540       1434001 -
    934409   nanE              spr1196       1193495       1194193 -
    934439   aroA              spr1229       1226334       1227629 -
    933343   -                 spr0560        561441        561686 +
    933658   -                 spr1768       1735907       1736611 +
    933284   -                 spr1426       1410831       1411424 -
    934792   -                 spr0439        439189        440820 -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
    933093   -                 spr0966        947648        948958 +
    933337   vicX              spr1105       1105451       1106260 -
    933736   -                 spr2044       2035744       2036223 -
-            -                 -              925120        925802 +
    932935   -                 spr1148       1149293       1150333 -
-            -                 -         -             -           -
    933492   trpS              spr2034       2025178       2026203 -
    933104   tpiA              spr1432       1416054       1416833 -
-            -                 -         -             -           -
    934354   -                 spr0814        816411        817001 -
    932895   -                 spr0112        120067        120279 +
    932875   -                 spr0167        175326        176003 +
    934260   transposase_B     spr0723        723400        723483 +
    933964   -                 spr0953        936148        936924 +
-            -                 -             1647157       1647555 +
    933020   -                 spr1551       1533243       1533596 -
    934662   sulA              spr0266        268022        268966 +
    934584   -                 spr1371       1353063       1353557 -
    934513   -                 spr1297       1291422       1291616 -
    933943   dltD              spr1979       1969711       1970994 -
    934144   -                 spr1182       1181314       1181484 -
-            -                 -              231088        232127 +
    934865   rplI              spr2009       2002111       2002563 -
    933496   -                 spr0531        530654        531856 -
-            -                 -               56907         57275 +
    933832   ABC-SBP           spr1527       1503232       1504560 -
-            -                 -         -             -           -
    934069   phtE-truncation   spr0910        899263        899811 +
-            -                 -              409091        409665 +
    934131   gpsA              spr1902       1879718       1880734 +
    932849   glnP              spr0623        631044        631721 -
-            -                 -         -             -           -
    932863   -             spr1728       1706704       1707003   -
    933823   ABC-MSP       spr0221        214280        214906   -
    933149   -             spr1560       1539872       1540720   +
    934804   -             spr0328        327393        332696   +
-            -             -             1157926       1158237   +
-            -             -         -             -             -
    934372   lytD          spr0831        830981        832864   +
    932969   amiF          spr1703       1672492       1673463   -
    934541   -             spr1320       1307118       1307765   +
    933692   -             spr1741       1715755       1716363   -
    934220   rpsP          spr0682        686482        686754   +
    934197   -             spr0658        662219        662449   -
-            -             -              312761        313114   +
-            -             -         -             -             -
    933174   -             spr0931        916211        917185   +
    933989   cglA          spr1864       1834558       1835499   -
-            -             -         -             -             -
    934358   pepXP         spr0794        793374        795761   -
    933771   -             spr1010        992198        992497   -
    934656   rplM          spr0271        272399        272845   +
-            -             -              415634        416024   +
    934496   spnIM         spr1287       1280629       1281807   +
-            -             -             1548388       1548763   +
-            -             -         -             -             -
-            -             -             1448856       1449588   +
    933758   ABC-NBD       spr1497       1475035       1475745   -
    934896   hexB          spr0160        168072        170021   +
-            -             -         -             -             -
    933723   cycK          spr2015       2008230       2009150   +
    933830   gtrB          spr1459       1439772       1440863   -
    934720   PTS-EII       spr0291        292900        293334   +
-            -             -         -             -             -
-            -             -         -             -             -
-            -             -             1242025       1242286   +
    933588   glyA          spr0928        913285        914541   +
    933183   corA          spr0170        178139        179083   -
    933282   -             spr1953       1936914       1938998   +
    933868   adcR          spr1978       1969116       1969616   -
    932846   -             spr1638       1610936       1611091   -
    934800   -             spr0451        459085        459285   +
-            -             -             1289588       1290168   +
-            -             -         -             -             -
    933919   msmE          spr1712       1684518       1685777   -
    933048   -             spr0476        478869        479504   +
-            -             -         -             -             -
    934708   ilvA          spr0406        401601        402851   +
    932970   bglA          spr0244        238727        240106   +
    933363   -             spr1959       1945106       1946617   +
    933700                 spr1736
             ABC-NBD-truncation          1711072       1711719   -
    934364   nspC          spr0821        823191        824318   +
-            -             -         -             -             -
-            -             -         -             -             -
    933530   PTS-EII          spr0505        501729        503567   +
    933995   -                spr1876       1845833       1846453   -
    934456   -                spr1241       1241527       1242024   -
    934239   -                spr0705        704074        704514   +
    932987   -                spr0895        883412        883903   +
    932903   pulI             spr1025       1005556       1007835   +
    934585   -                spr1370       1351327       1352982   -
    933890   rpmD             spr0207        204829        205011   +
    934149   npl-truncation   spr1186       1183359       1184090   -
-            -                -         -             -             -
    933447   rRNA_16S-1       sprr01          15161         16674   +
    934766   cps2H            spr0315        314551        315585   +
    933045   fhs              spr1109       1109867       1111537   -
    932991   arcB             spr1957       1942769       1943785   +
    934074   -                spr1003        986356        986925   -
    934378   proC             spr0834        835350        836147   +
    934845   rpmG             spr1944       1925154       1925303   +
-            -                -         -             -             -
    933262   -                spr1627       1601116       1601562   -
    933805   -                spr0940        924964        925119   +
    934328   hsdS             spr0791        788261        788872   +
    934256   transposase_D    spr0718        720608        721261   +
    934624   def              spr1408       1392416       1392826   -
    932914   htpX             spr1162       1164646       1165554   -
    934267   glnP             spr0727        726847        727536   +
    934691   -                spr0397        394175        394660   +
    933003   psaA             spr1494       1470686       1471615   +
    934079   pacL             spr1410       1393746       1396442   -
-            -                -         -             -             -
    934351   -                spr0805        807033        807938   -
-            -                -              751831        752240   +
-            -                -             1465787       1466007   +
    932827   lacG             spr1069       1067037       1068443   -
    932957   -                spr1112       1113003       1113566   +
-            -                -         -             -             -
    934420   -                spr1210       1206960       1207172   -
-            -                -         -             -             -
    933121   -                spr1104       1105118       1105420   -
-            -                -         -             -             -
    932990   ABC-MSP          spr1023       1002215       1003393   +
    933454   scrB             spr1568       1548764       1550218   +
-            -                -         -             -             -
    934658   -                spr0376        376640        377074   +
    933242   -                spr0959        940146        940742   +
    932944   -                spr0617        627173        627976   +
-            -                -              918891        919627   +
    934282   deoC             spr0745        741766        742428   +
    934904   -                spr0151        159559        160128   -
    934478   -                spr1263       1260037       1260687   -
-            -                -         -             -             -
-            -                -              561687        561997   +
    934454   -                spr1242       1242287       1242526   -
    932930 -         spr0951        934826        935359   +
-          -         -             1277911       1278164   +
-          -         -             1596446       1596788   +
    933766 rplR      spr0205        203947        204303   +
    933269 -         spr1584       1564646       1566259   -
    932932 ccl       spr0917        904183        904764   +
-          -         -             1423525       1423787   +
    933475 ileS      spr1502       1480465       1483257   -
    933889 -         spr1659       1632631       1632900   -
    934657 fabD      spr0380        379418        380338   +
    934318 -         spr0773        767190        768416   +
-          -         -             1689932       1690138   +
-          -         -         -             -             -
    933560 bgl2      spr1833       1807407       1808858   +
    932799 trkA      spr0071         78058         78744   +
    934572 -         spr1358       1340907       1341920   +
    934501 -         spr1280       1274880       1275608   -
    933975 ackA      spr1854       1828803       1829993   -
    932800 -         spr0072         79054         79593   +
    933417 -         spr1729       1707340       1707555   -
    934155 appD      spr1191       1186915       1188897   -
    934274 flaR      spr0739        737238        737762   -
    934784 hsdS      spr0445        450637        451917   +
-          -         -              677512        677861   +
    933704 -         spr1732       1708932       1709435   -
-          -         -         -             -             -
-          -         -         -             -             -
    933512 -         spr0522        522381        522836   +
-          -         -              292630        292899   +
    934531 -         spr1319       1306669       1307121   +
    932977 -         spr0608        620916        621929   +
    933291 msrA      spr0577        586941        588053   +
-          -         -         -             -             -
    932804 hk08      spr0077        84533         85585    +
-          -         -         -             -             -
    934067 ccdA      spr0903        888261        888968   +
    933317 -         spr0563        569990        570295   +
-          -         -              556440        556663   +
    933012 ABC-NBD   spr0602        614626        615267   +
-          -         -             1259828       1260036   +
    934860 comFC     spr2012       2005297       2005959   -
-          -         -         -             -             -
    932803 -         spr0073        79471         80040    -
-          -         -         -             -             -
    933705 -         spr1726       1705748       1706374   -
    934581 atpA      spr1362       1344781       1346286   -
    933071 dctA      spr1598       1575376       1576335   +
-          -         -         -             -             -
    933597 -         spr1816       1786460       1787227   -
    934276 rpsT      spr0740        737815        738066   -
    933570 rpmG      spr1822       1796524       1796676   -
    934035 -         spr1477       1457206       1457643   -
    933411 strH             spr0057        60528          64466 -
    933346 -                spr0926       912179         912790 +
    933854 pta              spr1007       989463         990437 +
-          -                -         -             -           -
-          -                -             1531844       1532169 +
-          -                -              624096        624412 +
    934292 IS861-truncation spr0753        748235        748603 +
    934182 NS_transporter spr0648          654580        655971 -
    934396 -                spr0850        846911        847411 +
-          -                -         -             -           -
    933139 -                spr1589       1569156       1569509 -
    934050 ilvD             spr1935       1916000       1917703 -
    933749 -                spr1548       1530638       1531429 -
-          -                -         -             -           -
    934336 pykF             spr0797        800243        801748 +
    934244 ciaH             spr0708        707956        709290 +
    934047 recN             spr1084       1080001       1081668 -
    933430 apt              spr1435       1418722       1419252 -
    933258 pck              spr1147       1148407       1149276 -
-          -                -         -             -           -
    934701 mtlA             spr0356        353760        355529 +
    933466 tRNA-Glu1        sprt01          14827         14898 +
    933865 dnaI             spr1555       1536191       1537087 -
    934045 -                spr1507       1485184       1485447 -
                            spr0223
    933084 ABC-SBP-truncation              216000        216368 -
    933235 thyA             spr0585        601207        602046 +
-          -                -             1806104       1806562 +
    933916 codY             spr1439       1422736       1423524 -
-          -                -         -             -           -
    933611 -                spr1804       1775501       1776061 -
-          -                -         -             -           -
    933744 -                spr1615       1588494       1588733 -
    932891 -                spr0115        123810        124184 +
    934763 -                spr0311        312433        312606 +
    934225 -                spr0690        690411        690650 +
    933509 vex1             spr0524        523650        524927 +
    933332 PTS-EII          spr0562        569431        569952 +
    933719 -                spr2007       2000447       2000713 -
    932986 -                spr1651       1622786       1623082 -
    933557 nusA             spr0478        480153        481289 +
    933275 tRNA-Phe1        sprt15        1691076       1691148 -
    933706 -                spr1730       1707692       1708366 -
    933899 -                spr1469       1450858       1451067 +
    932937 plsX             spr0037         37744         38736 +
-          -                -               56907         57275 +
    933878 -                spr1842       1818041       1819132 -
-          -                -              739678        739883 +
-          -                -             1804024       1804232 +
-          -                -             1179038       1179471 +
    934627 -                spr1045       1037929       1039494 +
    934838 malC             spr1919       1901454       1902761 +
    933109 -                spr1595       1572932       1573522 -
    932978 -                 spr1468       1449999       1450628 -
-          -                 -         -             -           -
    933862 IS1381-truncation spr0993       977840         978547 +
-          -                 -         -             -           -
-          -                 -              393907        394174 +
    933694 ligA              spr1024       1003486       1005444 +
    933353 -                 spr0554        553724        554440 +
    934745 trkH              spr0426        425479        426918 -
    934438 -                 spr1226       1223749       1225023 -
    934314 -                 spr0770        764775        764969 +
    934363 -                 spr0822        824315        825400 +
    932868 -                 spr0228        219268        220248 +
    933735 -                 spr0239        233107        233679 +
    934602 ppaC              spr1389       1370416       1371351 -
    934178 ctpA              spr0641        646986        649238 +
    932810 glmS              spr0245        240298        242106 +
    934101 -                 spr2031       2022029       2022397 +
-          -                 -             1870743       1871056 +
    933813 trpG              spr1636       1608877       1609443 -
    934798 hsdS              spr0448        453335        454903 -
-          -                 -         -             -           -
    934730 -                 spr0418        416025        416195 +
    932892 -                 spr0116        124191        124373 +
    933263 hk13              spr0464        470513        471853 +
    933028 -                 spr1695       1663931       1664941 -
    934367 -                 spr0827        828545        828742 -
    932954 -                 spr1114       1114387       1114902 +
    932861 ABC-SBP           spr0101        108506        109303 +
    933534 IS861-truncation spr0496         496468        496857 -
-          -                 -             1717899       1718121 +
    934490 spsA-truncation spr1274         1268770       1269159 -
    933631 acyP              spr1789       1761235       1761513 +
    934113 hexA              spr1888       1865872       1868445 -
-          -                 -             1940790       1941477 +
    933148 -                 spr1091       1086183       1086485 -
    934883 epsG              spr0135        142595        143809 +
    933716 transposase_A spr0014             20207         20554 +
    932977 -                 spr0608        620916        621929 +
    933455 nrdE              spr1065       1062287       1064446 +
-          -                 -         -             -           -
-          -                 -         -             -           -
                             spr1102
    933783 spnII-interrupted-N             1102916       1104793 -
-          -                 -         -             -           -
    933971 gtfA              spr1709       1680991       1682433 -
-          -                 -         -             -           -
    934703 kdgA              spr0287        289483        290112 -
    933042 tRNA-Leu2         sprt22        1691677       1691762 -
-          -                 -         -             -           -
    933021 -                 spr0601       612603         614624 +
-          -                 -         -             -           -
-          -                 -         -             -           -
-          -                 -             1316371       1316629 +
    933730 imdH             spr2033       2023548       2025026   -
-          -                -              387127        387423   +
    933797 asd              spr0918        905279        906355   +
    933098 flpA             spr0868        861197        862879   -
    934444 -                spr1224       1221532       1222689   -
    934107 -                spr1019        997722        998561   +
    933733 comE             spr2041       2033242       2033994   -
    933770 scpA             spr1691       1661517       1662245   -
    933046 -                spr0890        879422        880222   -
    934084 glmM             spr1417       1403479       1404831   -
-          -                -         -             -             -
    934019 gltX             spr1881       1857547       1859007   -
    934292 IS861-truncation spr0753        748235        748603   +
-          -                -             1618842       1619050   +
-          -                -             1048776       1049059   +
    933525 licT             spr0504        500872        501711   +
    934022 -                spr1883       1860467       1860646   -
    934491 -                spr1282       1276851       1277576   -
-          -                -         -             -             -
    933699 -                spr0930       915523        916137    +
-          -                -         -             -             -
    933271 -                spr1138       1139817       1140473   -
-          -                -         -             -             -
    933861 amiA             spr1707       1676994       1678973   -
-          -                -         -             -             -
-          -                -         -             -             -
    934704 prfC             spr0396       392362        393906    +
-          -                -         -             -             -
    933064 -                spr1941       1923594       1924601   +
    933566 secE             spr1821       1796338       1796514   -
    934173 -                spr0869        862957        863454   +
    933946 acpP             spr0038         38742         38975   +
-          -                -              104786        105241   +
    933448 -                spr0010         10335         11612   +
-          -                -         -             -             -
    933800 lacD             spr1073       1071766       1072746   -
    932802 nrdF             spr1066       1064634       1065596   +
    933506 pep27            spr0527        527198        527281   +
    933683 -                spr1747       1718441       1718995   -
    933428 -                spr0004          3000          4115   +
    933681 IS1381-truncationspr1745       1717094       1717357   +
    933745 ABC-SBP          spr1620       1593995       1595308   -
-          -                -         -             -             -
-          -                -         -             -             -
    933643 ndk              spr1775       1743787       1744200   -
    934335 hsdR             spr0792        788951        792301   +
    933414 -                spr1717       1697564       1698919   -
    934684 rpsI             spr0272        272865        273257   +
    933993 marR             spr1874       1843781       1844119   -
-          -                -         -             -             -
    934499 -                spr1288       1282334       1283326   -
    933203 -                spr0929        914516        915523   +
    934362 speE             spr0819        821075        821935   +
-          -                -             2007946       2008229   +
    933676 -                spr1753       1721537       1721710   -
    933073 -                spr1564       1544531       1545148   +
-          -                -         -             -             -
    933779 nanE             spr1529       1506221       1506919   -
    933839 tRNA-Leu1        sprt10        1421994       1422079   -
    933324 -                spr0007          8323          8589   +
    933481 -                spr0236        229964        230659   +
-          -                -              185363        185812   +
    933436 trxA             spr1602       1578217       1578531   +
-          -                -             1279470       1280074   +
-          -                -              772962        773162   +
    933488 clpC-truncation spr1999        1992961       1993104   -
    934871 -                spr1987       1979178       1979381   -
    934116 -                spr1904       1881722       1882402   -
    934411 rplT             spr0863        856133        856492   +
    933491 mreD             spr2022       2014115       2014609   -
    934802 -                spr0325        324231        324680   +
-          -                -             1499807       1500092   +
    933102 -                spr0186        194667        195284   +
    934118 glgA             spr1032       1014454       1015887   +
    934427 ABC-NP           spr1203       1198448       1200055   -
-          -                -         -             -             -
-          -                -              288340        289172   +
    934361 transposase_F spr0818           820292        820819   -
    933385 -                spr1143       1145198       1145383   -
    932963 -                spr0611        622965        623678   +
-          -                -              557877        558588   +
    934616 -                spr1403       1380265       1387920   -
    933600 ccpA             spr1813       1783327       1784367   -
    934442 aroB             spr1233       1230347       1231414   -
    932845 -                spr0085         92633         93646   +
    934747 -                spr0306        305635        305820   +
-          -                -              894931        895139   +
    933434 tRNA-Gly1        sprt14        1690986       1691056   -
-          -                -         -             -             -
    934608 -                spr1392       1372514       1372900   -
    934562 -                spr1348       1332206       1332448   -
    934419 ptrB             spr1204       1200052       1201992   -
    933220 -                spr1169       1171103       1172503   +
-          -                -         -             -             -
    932979 rplC             spr0188        196076        196702   +
    933743 ip               spr0465        471895        472050   -
-          -                -             1503011       1503231   +
    933023 mgtC             spr1641       1613561       1614271   -
    933863 IS1381-truncationspr1078       1075330       1075728   -
-          -                -         -             -             -
    933051 -                spr1483       1460276       1460713   +
    934320 ssrA             sprs03         773607        773951   +
    933378 -                spr0548        549483        550061   +
    933515 cysS             spr0519        519634        520977   +
-            -                -              639027        639418   +
-            -                -              730296        730519   +
    933543   -                spr1646       1618182       1618841   -
    933912   ffh              spr1166       1168744       1170315   -
    934005   tRNA-Trp         sprt46        1851004       1851074   -
    933478   rpmC             spr0197        200331        200537   +
    934032   nirC             spr1097       1093679       1094476   -
    933984   adh              spr1866       1836091       1837149   -
    933486   -                spr1986       1978504       1979091   +
-            -                -         -             -             -
    934665   accB             spr0383        382363        382848   +
    934250   -                spr0703        702460        703188   +
    932807   ptsH             spr1063       1061374       1061637   -
    933421   -                spr0030         30143         30481   -
-            -                -         -             -             -
    932873   -                spr0179        187066        187584   +
    933997   -                spr1873       1843471       1843770   -
-            -                -         -             -             -
-            -                -             1648075       1648354   +
    933371   ispA             spr1087       1082907       1083782   -
    934633   ppnK             spr1005        987696        988526   +
    934770   cps2J            spr0317        316869        318278   +
    932989   divIB            spr0605        617795        618985   +
    933322   prtA             spr0561        562418        568852   +
    933674   -                spr1749       1719183       1719977   -
    934753   transposase_B    spr0312        312599        312760   -
    934773   pgk              spr0441        446182        447378   +
    934754   PTS-EII          spr0425        423672        425351   +
    934132   rrmA             spr1913       1892472       1893320   +
    934575   pgm              spr1351       1333648       1335366   +
    933137   -                spr1593       1571297       1571608   -
-            -                -         -             -             -
    933062   -                spr1523       1500093       1500437   -
-            -                -              233680        233891   +
    934727   pfl              spr0415        412113        414437   +
-            -                -             1917704       1917935   +
    934680   efp              spr0392        388250        388810   -
-            -                -         -             -             -
    934027   ABC-N/P          spr1656       1628490       1630241   -
    933119   PTS-EII          spr1967       1958932       1959732   -
    933364   -                spr0549        550225        550377   +
    933421   -                spr0030         30143         30481   -
    933301   -                spr0572        582064        582318   +
    934402   ald-truncation   spr0853        848313        848576   -
    934460   potA             spr1246       1245411       1246568   -
-            -                -             1396443       1396745   +
    934181   spxB             spr0642        649445        651220   +
    934037   rpsO             spr1467       1449589       1449858   -
    933289   -                spr1960       1946639       1947970   +
    934133   -                spr1892       1871577       1872086   +
    932947   lmb              spr0906        891426        892361   +
    933922   mefE             spr0971        953383        954594   +
    934648   -                spr0265        267187        267897   +
    933209   lacC             spr1074       1072748       1073677   -
    934859   cbpD             spr2006       1999012       2000358   -
    934488   nadE             spr1276       1271411       1272235   -
    933829   tktA             spr1841       1815951       1817927   -
    933691   -                spr1737       1711861       1712205   -
    934520   -                spr1303       1295956       1296894   -
    934089   rr06             spr1998       1991666       1992319   -
    934630   IS1167-truncationspr0132        140042        140428   -
    933177   -                spr0596        608630        608827   +
    933991   pcp-truncation spr1872         1842900       1843214   -
-            -                -         -             -             -
    933548   -                spr0486       487231        488565    +
    932871   rnr              spr0878       867934        870288    +
    934493   -                spr0635       642890        643414    +
    932795   -                spr0066        73075         73929    +
-            -                -         -             -             -
    934114                    spr1900
             transposase-truncation         1878527       1878943   +
    933056   -                spr1479       1457719       1458567   -
    933234   rluD             spr1006        988523        989419   +
    934359   ABC-NBD          spr0812        813563        814378   +
-            -                -               30482         30699   +
    933237   oxlT             spr1441       1425561       1426787   -
    934862   transposase_E spr2018          2010201       2010488   -
    934430   ABC-N/P          spr1216       1211829       1213553   -
    933351   -                spr0897        884594        886363   +
    933393   pepQ             spr1445       1430643       1431725   +
    933545   -                spr0491        490727        491689   +
-            -                -             1460018       1460275   +
    933467   purH             spr0051         53954         55522   +
-            -                -               65540         65844   +
-            -                -             1944898       1945105   +
    934735   -                spr0297        296952        298853   +
    933644   hlyX             spr1778       1752316       1753647   -
    933622   cbf1             spr1794       1765923       1766927   -
    934625   acoL             spr1048       1042274       1043977   -
    933230   -                spr0968        950173        951123   +
-            -                -         -             -             -
    933521   -                spr0513        511419        511685   +
-            -                -             1654514       1654812   +
    933591   ABC-NBD          spr1817       1787199       1788083   -
    933229   -                spr1550       1532170       1533021   +
    934446   -                spr1237       1234801       1236462   -
    933900   mutY             spr1108       1108363       1109538   -
    932838   ABC-SBP          spr0083         89862         91406   +
    934522   -                spr1309       1300224       1300439   +
    933112   -                spr1481       1459304       1459474   +
    934744   pbpX             spr0304        302261        304513   +
    933238   carA             spr1154       1158238       1159317   -
-            -                -         -             -             -
-            -                -         -             -             -
    932919                    spr0621
             ABC-SBP-truncation             630031        630273    -
    934884 dapE             spr0148        156408        157781 +
    934514 guaA             spr1300       1292606       1294168 -
-          -                -         -             -           -
-          -                -              623679        623951 +
    934590 -                spr1374       1355373       1355990 -
    933619 pflC             spr1791       1762592       1763386 -
-          -                -         -             -           -
    933207 leuB             spr1135       1137655       1138692 -
    933196 cpsY             spr0593        606890        607936 -
    934268 rpiA             spr0731        730520        731260 +
    934209 -                spr0669        673606        674421 +
    934306 IS1167-truncationspr0766        761198        761602 -
-          -                -         -             -           -
    933224 miaA             spr0588       602334         603269 +
-          -                -         -             -           -
-          -                -         -             -           -
-          -                -             1929575       1929779 +
    933609 -                spr1806       1777140       1777805 -
-          -                -         -             -           -
    933086 galK             spr1668       1640591       1641769 -
    934673 acp              spr0378        378108        378332 +
    934054 ABC-NP           spr1887       1864031       1865725 -
    934278 -                spr0742        739237        739677 +
    933120 IS1167           spr0041         40224         40991 -
-          -                -         -             -           -
-          -                -         -             -           -
    934309 ABC-NBD          spr0771        765098        765889 +
-          -                -             1894692       1895616 +
    934882 -                spr0145        153770        154366 +
-          -                -         -             -           -
    932798 -                spr1129       1132842       1134185 -
-          -                -         -             -           -
    932999 rpsQ             spr0198        200562        200822 +
    934156 appC             spr1192       1188910       1189761 -
    933429 talC             spr0233        225040        225708 +
    933060 -                spr1591       1570023       1570616 -
    933097 -                spr1457       1438976       1439452 -
-          -                -              327094        327392 +
    934160 cdsA             spr0241        234677        235480 +
    934347 -                spr0803        805375        806091 +
    933864 -                spr1603       1578797       1579369 +
    933014 -                spr1927       1909881       1910621 -
    933348 -                spr0558        559541        560401 +
    933760 rplB             spr0191        197664        198497 +
    934762 -                spr0434        434397        435047 +
-          -                -         -             -           -
    934431 thrB             spr1218       1214845       1215714 -
    934125 transposase_A spr1038          1020607       1020975 -
    933947 -                spr0361        359527        359640 +
-          -                -         -             -           -
    934670 fabK             spr0379       378451         379425 +
-          -                -             123434         123809 +
-          -             -         -             -           -
    933520 metE          spr0514        511802        514195 +
    934134 phoP_pnpR     spr1893       1872170       1872877 +
    932878 -             spr0003          2722          2916 +
-          -             -         -             -           -
    934451 pheA          spr1227       1225020       1225868 -
    933693 -             spr1740       1715352       1715762 -
-          -             -         -             -           -
    934827 blpT          spr0461        468814        469143 -
-          -             -             1333305       1333647 +
    932809 transposase_B spr0016         20733         21071 +
    933000 rpmF          spr1943       1924956       1925138 +
    933647 rpoB          spr1777       1748021       1751671 -
    933057 acpS          spr1541       1523839       1524201 -
-          -             -         -             -           -
    934102 sphtra        spr2045       2036394       2037587 +
    934093 rpsB          spr2020       2011840       2012619 -
    934702 asp23         spr0399        395121        395486 +
    934108 transposase_B spr1037       1020110       1020448 -
                         spr0610
    932972 ABC-NBD-truncation           622319        622972 +
    933232 -             spr0980        966371        966733 +
    933256 phtE          spr0908        895140        898259 +
    934694 bglG          spr0279        276788        278767 +
-          -             -              433386        433828 +
    934007 tRNA-His      sprt45        1850917       1850989 -
    934893 pbp1b         spr1909       1886036       1888501 -
    934112 pstB          spr1898       1877042       1877794 +
-          -             -         -             -           -
    933126 IS1167        spr1675       1647556       1648074 +
    933798 dpnD          spr1664       1637214       1637675 -
    932815 aroF          spr1542       1524246       1525277 -
    932948 -             spr0193        198743        199198 -
-          -             -         -             -           -
    933489 dnaC          spr2008       2000715       2002067 -
-          -             -             1751672       1752047 +
    933100 -             spr1476       1456835       1457137 -
    932911 -             spr0892        881755        882300 +
    933123 fer           spr1458       1439432       1439710 +
    933465 -             spr1613       1587834       1588040 -
    933532 -             spr0503        499939        500571 +
    933881 dexS          spr1698       1666290       1667915 -
    933893 aqpZ          spr1604       1579849       1580517 -
    934295 parC          spr0757        752241        754721 +
    934056 rRNA_23S-1    sprr02          16945         19846 +
-          -             -         -             -           -
    933773 lacE          spr1070       1068652       1070343 -
-          -             -         -             -           -
-          -             -         -             -           -
    933610 ksgA          spr1799       1770284       1771156 -
    934453 alaS          spr1240       1238887       1241505 -
-          -             -         -             -           -
                         spr1183
    934145 ABC-NBD-truncation          1181497       1182138 -
    934174 ABC-NBD          spr0632        640145        641530 +
    934479 -                spr1268       1263789       1264172 -
-          -                -         -             -           -
    934742 -                spr0300        300360        300602 -
    934103 comD             spr2042       2033991       2035316 -
-          -                -         -             -           -
-          -                -         -             -           -
-          -                -         -             -           -
    934820 hk03             spr0343        347668        348663 +
    933747 -                spr1059       1053664       1053819 -
-          -                -         -             -           -
    934475 spxA             spr1262       1259426       1259827 -
    933642 epuA             spr1780       1754739       1754945 -
    933998 -                spr1679       1651238       1652002 -
-          -                -         -             -           -
    932864 -                spr0098       105242         105490 +
-          -                -         -             -           -
    934780 cps2P            spr0319        319581        320186 +
    933856 -                spr1839       1815060       1815488 -
    934386 pyrH             spr0845        843217        843960 +
-          -                -         -             -           -
    932984 -                spr0606        619165        619395 -
    934407 pyrD             spr0866        857937        858929 +
    933630 ydfG             spr1725       1704954       1705715 -
-          -                -         -             -           -
    934369 -                spr0820       821932         823191 +
    933103 rplP             spr0196       199908         200321 +
-          -                -         -             -           -
    933850 tRNA-Thr2        sprt24        1691864       1691936 -
    934063 uppS             spr0240        233892        234668 +
    934294 IS861-truncation spr0751        747720        747932 +
-          -                -         -             -           -
    933717 ctsR             spr2001       1995395       1995916 -
-          -                -         -             -           -
-          -                -         -             -           -
    934272 -                spr0733        732487        732897 +
    934539 -                spr1327       1314035       1314292 -
-          -                -         -             -           -
    934769 -                spr0436        435469        435918 +
    933268 galE             spr1647       1619051       1620031 -
    933131 clpX             spr1427       1411427       1412659 -
    933649 rpoC             spr1776       1744311       1747988 -
    933025 ulaA             spr1938       1919726       1921072 -
    933738 spo0J            spr2046       2037645       2038403 +
    934719 -                spr0407        403586        403801 +
-          -                -         -             -           -
    934831 fni              spr0341        345885        346895 +
    932897 -                spr0120        127503        127802 +
    933809 adhE             spr1837       1811697       1814369 -
-          -                -              561189        561440 +
-          -                -         -             -           -
    934715 -                spr0357       355553         357508 +
    934380   holB             spr0836       836898        837788    +
    934296   -                spr0761       757384        758307    +
    933374   -                spr0963       943808        944590    +
    933917   dut              spr0023        24776         25219    +
    934333   -                spr0783       780983        782125    +
-            -                -         -             -             -
    932857   gph              spr0093        101463        102095   -
    933533   -                spr0502        499631        499915   +
    932953   ppc              spr0974        957625        960321   +
    933672   dinF             spr1756       1723401       1724771   -
    933038   IS1167-truncationspr0029         29624         30016   -
    934405   -                spr0859        853218        853715   +
    933130   -                spr0466        472107        473114   -
-            -                -         -             -             -
    934592   -                spr1372       1353554       1354018   -
    933313   -                spr1117       1115894       1116457   -
    934833   blpS             spr0462        469419        469757   +
-            -                -              486549        486779   +
    934071   ABC-NP           spr1885       1861478       1863289   -
    934677   PTS-EII          spr0278        276329        276670   +
-            -                -         -             -             -
    933272   murZ             spr0989        973796        975055   +
    934557   transposase_C spr1342          1325979       1326317   -
-            -                -             1884831       1885059   +
    932890   -                spr0119        125670        126428   +
    934767   -                spr0429        429323        429871   +
-            -                -              927736        927957   +
    934161   cca              spr1413       1399941       1401140   -
    934888   -                spr0144        152331        153560   +
    933159   typA             spr0598        609733        611595   +
    934106   glgC             spr1030       1012186       1013328   +
    933306   fatB             spr1687       1658788       1659753   +
    934001   -                spr1875       1844525       1845667   -
    933450   glnQ-truncation spr0536         534635        535024   -
    933547   -                spr0488        488925        489320   +
    933233   -                spr0580        590841        591425   +
-            -                -         -             -             -
    934736   -                spr0416       414804        415151    -
    932909   -                spr0471       476175        476354    +
    934223   -                spr0685       688019        688378    +
    934257   transposase_C spr0717          720316        720720    +
-            -                -             463882        464640    +
-            -                -         -             -             -
-            -                -             1468797       1469086   +
    934636   -                spr0631        639551        640144   +
    934642   shetA            spr0371        371275        372186   +
    934379   -                spr0839        839217        839762   +
    934004   amiE             spr1704       1673429       1674496   -
-            -                -         -             -             -
    933840   pulA             spr0247       243374        247144    -
-            -                -         -             -             -
-            -                -         -             -             -
    934850   fcsR              spr1974       1964196       1964969   +
    932981   nrdG              spr0185        194080        194670   +
    934710   glnH              spr0409        404650        405585   -
    934286   pdp               spr0744        740471        741748   +
-            -                 -             1805544       1805801   +
-            -                 -         -             -             -
    934524   -                 spr1305       1297700       1298335   -
    933607   aspC              spr1808       1778347       1779561   -
    933379   lacX-truncation spr1077         1074817       1075161   -
    934868   -                 spr2038       2031088       2031426   -
    934666   -                 spr0275        273944        274309   +
    934883   epsG              spr0135        142595        143809   +
    933367   pepV              spr0547        548029        549429   +
-            -                 -             1575033       1575375   +
    933303   -                 spr0571        581508        582071   +
    933681   IS1381-truncation spr1745       1717094       1717357   +
    932908   glnP              spr0624        631681        632361   -
    933635   -                 spr1786       1759587       1759748   +
    934536   trmH              spr1311       1301386       1302147   +
    932925   fcsK              spr1973       1962617       1964065   -
-            -                 -         -             -             -
    933633   -                 spr1782       1756515       1757552   -
-            -                 -         -             -             -
    933135   serA              spr1553       1534157       1535467   -
    932916   tehB              spr0880        870728        871594   +
    934135   phoU              spr1899       1877809       1878459   +
-            -                 -         -             -             -
    932888   argH              spr0103        110545        111936   +
    934559   -                 spr1346       1330741       1331853   -
    934484   queA              spr1273       1267181       1268221   +
    934637   polC              spr0251        251074        255465   +
    933194   -                 spr0475        478078        478872   +
    934324   fruB              spr0779        775123        776034   +
    933286   nha2              spr0573        582330        584384   +
    934347   -                 spr0803        805375        806091   +
-            -                 -         -             -             -
    933259   merA              spr1442       1426977       1428293   +
    934699   -                 spr0404        400691        400957   +
-            -                 -         -             -             -
-            -                 -         -             -             -
    933394   -                 spr1522       1499342       1499806   -
    933536   -                 spr0493        494407        495177   +
    933928                     spr1101
             spnII-interrupted-C             1099497       1102751   -
-            -                 -         -             -             -
    932933   ABC-MSP           spr1619       1592997       1593905   -
    934241   pepN              spr0706        704637        707183   +
-            -                 -              247145        247560   +
    934519   -                 spr1302       1295051       1296007   -
-            -                 -         -             -             -
    934521   -                 spr1307       1299186       1299521   -
    933887   rexA              spr1040       1024754       1028404   +
    933624   ABC-MSP           spr1643       1614274       1615965   -
-          -                -              405586        406349   +
    933542 -                spr0487        488575        488829   +
    934284 coaA             spr0741        738119        739069   -
-          -                -             1634693       1635319   +
    933696 -                spr1738       1712329       1713045   -
    934603 murE             spr1384       1367399       1368844   +
    934086 transposase_H    spr1984       1976116       1977108   -
-          -                -         -             -             -
    933499 fba              spr0530       529452        530333    +
-          -                -         -             -             -
-          -                -         -             -             -
    933553 -                spr0477       479630        480109    +
-          -                -         -             -             -
    934848 -                spr1966       1956579       1958873   -
    934094 ABC-NBD          spr2002       1995972       1996700   -
    934179 transposase_C    spr0644        651795        652448   -
    933769 -                spr1489       1465568       1465786   +
-          -                -              136551        137367   +
    934756 luxS             spr0308        308453        308935   -
    933392 ftsA             spr1511       1487948       1489321   -
-          -                -         -             -             -
    933958 lacB             spr1075       1073688       1074203   -
    933794 lacF             spr1071       1070343       1070660   -
    933350 ABC-NBD          spr0557        558589        559581   +
    933223 -                spr1016        995261        995434   +
-          -                -         -             -             -
-          -                -         -             -             -
    933956 ABC-NBD          spr1546       1529350       1530000   -
    933180 orf47            spr0181        189340        189483   +
-          -                -         -             -             -
-          -                -             1053820       1054054   +
    934163 crcB             spr1173       1174279       1174653   -
    934186 bgl-truncation   spr0646        653116        653412   +
    933875 -                spr1674       1646347       1647156   -
-          -                -         -             -             -
    934781 glnR             spr0443       448118        448474    +
-          -                -         -             -             -
    933335 scRNA            sprs01          24631         24815   +
    933017 PTS-EIIA         spr0229        220443        220763   +
-          -                -             1590612       1590820   +
-          -                -         -             -             -
-          -                -             1111538       1111751   +
    933387 metA             spr1434       1417596       1418540   -
    933449 cadD             spr1466       1448241       1448855   -
    933891 rluB             spr1689       1660220       1660942   -
    934660 fabF             spr0382        381116        382360   +
-          -                -         -             -             -
    933970 ftsW             spr0973        956376        957605   +
    933252 licD1            spr1151       1152860       1153663   +
    933330 PTS-EIID         spr0062         69010         69840   +
    934617 -                spr1404       1388112       1389620   +
-          -                -         -             -             -
    933406   -                spr0009          9001         10338   +
    934809   grpE             spr0454        461030        461578   +
    934847   IS1381           spr1947       1928807       1929196   +
    933410   msmK             spr1437       1420581       1421711   -
-            -                -         -             -             -
-            -                -         -             -             -
    934717   -                spr0296        296637        296930   +
    932899   -                spr0118        125317        125703   +
    933904   -                spr1140       1141242       1141601   -
-            -                -         -             -             -
    933036   -                spr1942       1924604       1924804   +
    932912   rr02             spr1107       1107604       1108359   -
    933147   IS1167-truncationspr0018         21455         21604   -
    933087   lepA             spr1082       1077369       1079192   -
    933846   phtA             spr1061       1056930       1059416   -
    933456   IS1239-truncationspr1563       1543913       1544116   +
    933925   IS1381           spr1573       1554092       1554481   -
    933510   -                spr0518        518668        519552   +
    932958   pyrF             spr0613        624413        625114   +
    934199   -                spr0664        667600        668256   +
-            -                -             1194649       1195085   +
-            -                -         -             -             -
-            -                -             1788804       1789054   +
    934777                    spr0324
             transposase_G-truncation        323782        324228   +
    934842   -                spr1929       1910815       1911030   -
    934052   -                spr0069         76547         76705   +
-            -                -         -             -             -
    934164   dapB             spr1414       1401137       1401904   -
    933572   nusG             spr1820       1795747       1796298   -
    933889   -                spr1659       1632631       1632900   -
-            -                -              792302        792563   +
    933260   rplX             spr0200        201294        201599   +
    934698   ilvB             spr0401        397357        399057   +
    933980   cglB             spr1863       1833594       1834685   -
    934567   -                spr1347       1331958       1332212   -
    934292   IS861-truncation spr0753        748235        748603   +
    933818   tRNA-Pro1        sprt20        1691505       1691578   -
    933111   -                spr1485       1462112       1462423   +
    932877   -                spr0097        104537        104785   -
    932926   rncS             spr1127       1130665       1131363   -
    933257   ftsY             spr1123       1124245       1125522   -
    934188   -                spr0653        659501        660058   +
    932950   -                spr1671       1644024       1644377   -
    934462   -                spr1250       1249324       1250595   +
    934254   -                spr0721        722359        722781   -
    934312   nifU             spr0774        768403        768843   +
-            -                -         -             -             -
    933838   uvrA             spr0171       179215        182046    +
-            -                -             281601        282001    +
-            -                -         -             -             -
    934606   rpsR             spr1394       1374570       1374809   -
-            -                -              140971        142040   +
-            -                -              76076          76337 +
-            -                -         -             -           -
    934582   IS1239           spr1367       1348371       1349378 -
    933781   trpE             spr1637       1609440       1610903 -
    932956   -                spr1681       1653131       1653436 -
-            -                -             1977394       1978503 +
    934305   IS1167-truncationspr0765        761074        761214 -
    933099   galE-truncation spr1683        1654914       1655615 +
    934222   -                spr0683        686774        687013 +
    933524   IS1167-truncationspr0986        971225        971728 -
-            -                -         -             -           -
    934560   tuf              spr1343       1326964       1328160 -
    934029   prmA             spr1608       1583980       1584957 -
    934236   -                spr0699        700006        700935 +
-            -                -         -             -           -
-            -                -             1788468       1788704 +
    933347   rplA             spr0556        555382        556071 +
    932856   capD             spr0092         99217        101067 +
    933118   -                spr1486       1462462       1462905 -
    934751   clpL             spr0307        306052        308157 +
-            -                -             1318520       1318773 +
    934843   tktC             spr1936       1917936       1918868 -
-            -                -         -             -           -
-            -                -             1927856       1928211 +
    933860   -                spr0902        887626        888030 +
    934738   PTS-EII          spr0421        418456        419781 +
-            -                -         -             -           -
    934543   -                spr1326       1312674       1313918 +
-            -                -              671089        671373 +
-            -                -         -             -           -
    933569   pbp2a            spr1823       1796729       1798924 -
-            -                -         -             -           -
    934270   -                spr0710       709610         710680 +
-            -                -         -             -           -
-            -                -              386658        386913 +
    934170   acoA             spr1051       1046292       1047260 -
    933559   -                spr0479        481311        481604 +
    933870   fatD             spr1684       1656023       1656997 +
    933204   -                spr0591        605131        606060 +
-            -                -         -             -           -
    933386   purK             spr0054         57724         58875 +
    934810   cbpF             spr0337        341956        342972 +
    933679   -                spr1750       1720385       1720810 -
-            -                -         -             -           -
    934062   mesH             spr0916       903701         904132 -
-            -                -         -             -           -
    933140   -                spr1119       1118532       1119485 -
-            -                -         -             -           -
-            -                -              841561        841804 +
    932829   -                spr1623       1598954       1599526 +
    933815   ptcB             spr1835       1810176       1810484 +
    933227   exoA             spr1660       1633221       1634048 +
    933034   -             spr1934       1915450       1915791   +
    934593                 spr1379
             ABC-MSP-truncation          1361926       1362378   -
    934589   -             spr1345       1330175       1330783   -
    934768   -             spr0435        435075        435464   +
-            -             -             1328528       1329081   +
-            -             -             1182848       1183137   +
    934058   recD          spr0363        361275        363641   -
    933296   -             spr0949        933794        934111   +
    934881   -             spr0142        150908        151585   +
    933276   obg           spr0984        969696        971006   +
-            -             -             1076753       1077127   +
    933484   -             spr1509       1485996       1486667   -
    933019   prfA          spr0924        910286        911365   +
    934021   -             spr0157        165249        166511   -
-            -             -         -             -             -
    933562   -             spr1831       1805909       1806103   -
    933156   -             spr0927        912753        913223   +
    933897   -             spr1130       1134145       1136079   -
    933198   gyrA          spr1099       1095463       1097931   -
    934588   greA          spr1369       1350774       1351265   -
    934615   -             spr1398       1377128       1377499   -
-            -             -             1421712       1421993   +
-            -             -             1349379       1349822   +
    934072   lplA          spr1047       1041221       1042210   -
    933632   -             spr1790       1761591       1762517   +
    934503   -             spr1283       1277743       1277910   +
    934257   transposase_C spr0717        720316        720720   +
    934578   -             spr1356       1338378       1339622   -
-            -             -         -             -             -
-            -             -         -             -             -
-            -             -              954595        955252   +
    934564   glpF          spr1344       1329082       1329951   -
-            -             -         -             -             -
    934096   -             spr2040       2032457       2032999   +
    932855   -             spr1655       1627625       1628356   -
    933184   -             spr1170       1172516       1173322   +
    934611   asnS          spr1397       1375766       1377109   -
    933969   srtA          spr1098       1094720       1095463   -
-            -             -         -             -             -
    934003   thrC          spr1878       1847798       1849282   -
    934465   aldB          spr1249       1248451       1249182   -
    933267   rpoD          spr0979        965281        966390   +
-            -             -              818212        818662   +
    933664   -             spr1762       1729701       1730321   -
    933981   ABC-NBD       spr0222        214896        215987   -
-            -             -              692934        693197   +
-            -             -             1274526       1274879   +
    933819   nikS          spr0969        951138        952337   +
    932939   tRNA-Ser2     sprt12        1690783       1690870   -
-            -             -         -             -             -
-            -             -             557877        558588    +
    934348   -             spr0809       811867        812316    +
    932960 coaE        spr0873        865592        866224   +
-          -           -             1325488       1325712   +
    934811 dnaK        spr0455        462058        463881   +
    933625 tRNA-Lys2   sprt26        1692042       1692114   -
    934327 -           spr0782        780417        780950   -
    933461 aga         spr1713       1685869       1688031   -
    933344 sunL        spr1579       1558835       1560151   -
    934510 ABC-NBD     spr1293       1288223       1289587   +
-          -           -              995435        995721   +
    933134 xseA        spr1089       1083969       1085315   -
    934498 -           spr1279       1274286       1274525   -
-          -           -         -             -             -
    934718 dinP        spr0414       410657        411727    -
    934172 -           spr0255       257547        257777    +
-          -           -         -             -             -
    934883 epsG        spr0135        142595        143809   +
    934815 hrcA        spr0453        459960        461027   +
    934154 -           spr1035       1017712       1018158   -
-          -           -         -             -             -
    932929 fatC        spr1685       1656987       1657943   +
    932793 -           spr1195       1192548       1193471   -
    934790 -           spr0442        447514        448041   +
-          -           -              555175        555381   +
-          -           -         -             -             -
    934033 bgaC        spr0059         65845         67632   +
    934424 -           spr1213       1208270       1208455   +
    933340 gidB        spr1164       1166177       1166914   +
    933639 kdtB        spr1783       1757536       1758024   -
-          -           -         -             -             -
    933764 hemK        spr0925        911365        912204   +
    933116 treR        spr1700       1670245       1670955   +
    934198 livG        spr0662        665712        666476   +
-          -           -         -             -             -
-          -           -         -             -             -
-          -           -         -             -             -
    933621 -           spr1795       1766854       1768152   -
    933124 mtlD        spr0359        358009        359145   +
    933801 -           spr1832       1806563       1807291   -
    934903 rr07        spr0154        162537        163823   +
    934331 -           spr0787        784604        785035   -
    932883 -           spr0111        119688        120059   +
-          -           -         -             -             -
    933329 -           spr0559        560403        561188   +
    934269 deoB        spr0732        731211        732485   +
    933122 udK         spr1090       1085437       1086075   -
    934264 -           spr0726        726433        726663   -
    933982 -           spr1857       1831470       1831652   -
-          -           -              969440        969695   +
-          -           -              103670        103910   +
-          -           -         -             -             -
-          -           -         -             -             -
-          -           -              64467         64780    +
    933352   ccpA             spr1639       1611988       1612989   -
    934368   transposase_F spr0817           820104        820340   -
    933617   rpe              spr1797       1768737       1769393   -
    933662   -                spr1764       1731759       1731929   +
    934055   dnaQ             spr0896        883965        884591   +
    933667   lytR             spr1759       1727640       1728656   -
    934355   -                spr0811        813001        813192   -
    934262   clpE             spr0725        723946        726204   -
    933077   IS1381-truncationspr1946       1928212       1928781   +
-            -                -             1059417       1059634   +
-            -                -              469144        469418   +
    932983   -                spr0607        619725        620573   +
    933671   -                spr1752       1721344       1721586   -
-            -                -         -             -             -
    934398   -                spr0858        853019        853207   +
    933874   -                spr1572       1553776       1554063   -
    933605   ABC-NBD          spr0938        923268        924062   +
    934307   -                spr0768        762595        763092   +
    933834   -                spr1178       1176909       1177487   -
-            -                -         -             -             -
    934858   clpC-truncation spr2000        1993105       1995393   -
    932946   -                spr0616        626460        627224   +
    934749   -                spr0422        419729        421669   +
-            -                -         -             -             -
-            -                -         -             -             -
-            -                -              898260        899088   +
    933040   -                spr1720       1700709       1700915   -
    934872   -                spr2029       2019340       2020623   -
    934169   -                spr1415       1402181       1403029   -
-            -                -         -             -             -
-            -                -         -             -             -
    933808   tRNA-Lys1        sprt11        1590539       1590611   +
    933910   PTS-EII          spr1528       1504685       1506217   -
    933979   fecE             spr1686       1657940       1658692   +
    933732   -                spr2039       2031511       2032278   -
    933359   mutT             spr1609       1585068       1585496   -
    934226   -                spr0689        690017        690337   -
    934546   thiM             spr0629        637592        638395   +
-            -                -         -             -             -
    934018   -                spr1880       1857099       1857533   -
    933041   -                spr1697       1665900       1666202   -
-            -                -         -             -             -
    933842   tRNA-Thr1        sprt07        904864        904936    +
-            -                -         -             -             -
    933687   ply              spr1739       1713926       1715341   -
    934635   -                spr0237        230671        231087   +
-            -                -         -             -             -
    933786   -                spr1611       1586584       1587054   -
    934322   tRNA-Ser1        sprt06         774137        774224   -
    933516   IS1239-truncationspr0512        511168        511296   +
-            -                -              877014        877382   +
    933212   -                spr0176        184622        185041   +
-            -                -             1965089       1966097 +
-            -                -         -             -           -
    934294   IS861-truncation spr0751       747720         747932 +
    934337   hsdM             spr0790       786755         788248 +
-            -                -         -             -           -
-            -                -         -             -           -
    933765   hk02             spr1106       1106262       1107611 -
    932995   rplS             spr1171       1173490       1173837 -
    933310   -                spr0568        580123        580482 -
    933010   mutT             spr1513       1490335       1490946 -
-            -                -         -             -           -
    932885   -                spr0110       118611         118931 -
-            -                -         -             -           -
-            -                -             856931         857179 +
-            -                -         -             -           -
    934676   bglA             spr0276        274499        275935 +
    933166   ABC-SBP          spr1645       1617090       1618157 -
    934889   -                spr0615        625960        626364 +
-            -                -         -             -           -
    933594   tRNA-Met3        sprt19        1691426       1691499 -
    932965   rplW             spr0190        197350        197646 +
    932842   ABC-MSP          spr0935        921242        922261 +
    933848   ABC-NBD          spr1644       1615977       1616987 -
-            -                -              827276        827546 +
-            -                -         -             -           -
-            -                -         -             -           -
    933867   sgh              spr1846       1822669       1823403 -
-            -                -         -             -           -
-            -                -             1162699       1162970 +
    932848   -                spr1057       1052265       1052978 -
-            -                -         -             -           -
    933948   pbp2b            spr1517       1494216       1496273 -
    932851   sdaB             spr0095        102998        103669 -
    932949   pyrE             spr0614        625148        625780 +
    933933   npl-truncation   spr1520       1498242       1498973 -
    934242   fabG             spr0701        701264        701962 +
    933827   -                spr0034         34652         35674 -
    934772   cps2K            spr0318        318314        319552 +
    934778   cpsO             spr0323        322855        323706 +
    934434   msrA             spr1217       1213611       1214549 -
    934549   -                spr1331       1318112       1318519 -
    933767   hgt              spr0011         11616         12158 +
    934769   -                spr0436        435469        435918 +
-            -                -              557179        557769 +
-            -                -              272097        272398 +
    932805   pcrA             spr0995        979142        981433 +
    934293   ilvE             spr0758        754851        755873 +
-            -                -         -             -           -
-            -                -         -             -           -
    934215   sodA             spr0674        680041        680646 +
    932862   lctO             spr0627        634965        636101 +
    933626   yjfA             spr1788       1760461       1761219 -
    933906 -                spr1080       1076140       1076442 -
-          -                -         -             -           -
-          -                -         -             -           -
-          -                -              924063        924629 +
    933646 -                spr1772       1741440       1742207 +
    933403 rpsK             spr0214        208585        208968 +
-          -                -              118932        119687 +
    933561 transposase_B spr1827          1802161       1802484 -
    933682 -                spr1748       1718982       1719179 -
    933349 rr01             spr1474       1454838       1455515 -
    933432 -                spr1601       1577898       1578200 +
    934652 folE             spr0268        270271        270825 +
    934452 aroD             spr1235       1232277       1232954 -
-          -                -             1329952       1330174 +
-          -                -              953001        953382 +
    933493 -                spr0970        952356        953000 +
-          -                -         -             -           -
    934111 -                spr1914       1893836       1894042 -
    934740 uppP             spr0413        409666        410511 +
-          -                -         -             -           -
    934443 aroK             spr1228       1225865       1226341 -
-          -                -             1182139       1182409 +
    933250 xseB             spr1088       1083779       1083991 -
    933390 uvrC             spr0543        543591        545435 +
    933799 truA             spr1451       1434742       1435491 -
    933835 -                spr1582       1563551       1563865 -
    934031 -                spr1159       1162334       1162522 +
    932869 -                spr0107        115766        116233 +
    933055 fusA             spr0250        248889        250970 +
    933851 araD             spr1844       1821096       1821800 -
    934476 -                spr1260       1258385       1259233 -
-          -                -             1652450       1653130 +
    934793 recU             spr0330        335019        335615 -
    933280 ccdA             spr0575        585634        586344 +
-          -                -         -             -           -
-          -                -         -             -           -
-          -                -         -             -           -
    933677 -                spr1751       1720939       1721298 -
    933763 -                spr0932        917259        918890 +
-          -                -         -             -           -
    932830 -                spr1132       1136391       1136564 -
    934252 thiJ             spr0713        714601        715155 +
    934030 IS1381-truncationspr1079       1075659       1076180 -
    933689 -                spr1743       1716376       1716585 -
    934212 ppiA             spr0679        684508        685311 -
-          -                -              645843        646177 +
    933504 nanB             spr1531       1508214       1510307 -
    934669 accD             spr0386        384683        385549 +
    934000 tRNA-Leu6        sprt43        1850742       1850825 -
    933483 ABC-MSP          spr1618       1592150       1593004 -
-          -                -         -             -           -
    934429 rplJ             spr1212       1207765       1208265 -
    932828 ABC-MSP          spr0081        87777          88736 +
    934707 ilvC             spr0403       399592         400614 +
-          -                -         -             -           -
    933623 -                spr1653       1626138       1626314 +
    933173 -                spr0058         64781         65539 -
    933290 ABC-MSP          spr0976        961807        962673 +
-          -                -         -             -           -
    933381 nrd              spr0546        547411        548016 +
    933076 -                spr1950       1931774       1932655 -
    933302 -                spr1590       1569522       1570022 -
    934159 rggD             spr1022       1001242       1002135 +
    933734 tRNA-Arg5        sprt58        2035627       2035700 -
-          -                -             1268222       1268462 +
    933754 ptsI             spr1062       1059635       1061368 -
    933384 estA             spr0539        539428        540207 +
    934472 pstA             spr1255       1253837       1254721 -
    933882 dpnC             spr1665       1637672       1638436 -
    933655 -                spr1125       1126344       1127138 -
    932831 -                spr0954        936852        937304 +
    934791 pbpA             spr0329        332863        335022 -
-          -                -         -             -           -
    934175 thiE             spr0637        644210        644842 +
    934279 -                spr0743        739884        740474 +
    933373 -                spr0550        550378        550512 +
    934165 acoB             spr1050       1045284       1046276 -
-          -                -         -             -           -
-          -                -         -             -           -
-          -                -             1810790       1811304 +
    934579 atpH             spr1363       1346301       1346837 -
    933852 licB             spr1146       1147539       1148429 -
    934356 -                spr0810        812345        812647 +
-          -                -              216708        217197 +
    934404 ald-truncation   spr0854        848727        849152 -
    932825 -                spr0990        975065        975622 +
    934663 phaB             spr0375        375761        376546 +
-          -                -         -             -           -
    933866 pyrDII           spr0865       857180         857980 +
-          -                -         -             -           -
    934287 IS861-truncation spr0754        748579        749067 +
    933740 tRNA-Val1        sprt28        1692214       1692286 -
    934137 phoR-pnpS        spr1894       1872878       1874209 +
-          -                -         -             -           -
    932867 -                spr0096       103911         104414 +
-          -                -         -             -           -
-          -                -              500572        500871 +
    934232 -                spr0695        695084        696343 +
    933785 ahrC             spr1085       1081675       1082106 -
    933774 IS1167-truncationspr1721       1701075       1702304 +
    934836 pepS             spr0254        256296        257537 +
-          -                -         -             -           -
    934729 PTS-EII          spr0294        295053        295832 +
-          -                -             1863702       1864030 +
    934281 cdd       spr0746       742415         742804 +
    933869 nplT      spr0948       931945         933708 +
-          -         -             813193         813562 +
-          -         -         -             -           -
    933043 blpZ      spr0473       476922         477155 +
    933376 dnaN      spr0002         1521           2657 +
-          -         -         -             -           -
-          -         -              126429        127281 +
    933110 PTS-EII   spr1970       1960988       1961434 -
-          -         -         -             -           -
    934413 -         spr1201       1196371       1197690 -
-          -         -         -             -           -
-          -         -         -             -           -
    933896 -         spr1557       1538258       1538791 -
    933567 -         spr1826       1801138       1802118 -
    934432 mecA      spr1220       1217153       1217890 -
    933652 ABC-NBD   spr1773       1742209       1742841 +
-          -         -         -             -           -
-          -         -         -             -           -
    934316 -         spr0777        771852        772961 +
-          -         -              904937        905278 +
    933731 -         spr2036       2028093       2030645 +
    933750 entB      spr1438       1422161       1422736 -
    933283 IS1381    spr0994        978562        978951 +
    933054 -         spr1524       1500534       1500986 -
    933039 vanZ      spr0050         53441         53950 +
    933008 -         spr1512       1489540       1490244 -
-          -         -         -             -           -
    933847 -         spr1843       1819244       1820917 -
    933162 -         spr1116       1115440       1115928 -
-          -         -         -             -           -
    934605 -         spr1387       1369466       1369780 -
    934728 -         spr0299        300143        300406 -
    934187 -         spr0651        657297        658490 -
-          -         -             1276347       1276850 +
    934466 pstB      spr1254       1253023       1253826 -
-          -         -         -             -           -
    933201 -         spr0944        928882        929079 +
-          -         -              111937        112224 +
    933157 smc       spr1126       1127135       1130674 -
    933853 proS      spr0243        236774        238627 +
    934208 rheB      spr0670        674561        675904 +
-          -         -             1450629       1450857 +
    932921 -         spr1167       1170327       1170659 -
    934864 stpA      spr2026       2017097       2017924 -
-          -         -         -             -           -
-          -         -         -             -           -
-          -         -         -             -           -
    934290 -         spr0755        749110        749751 -
-          -         -             1753648       1753875 +
    934779 -         spr0433        433829        434407 +
    934841 aspS      spr1924       1906865       1908628 -
    933945 dpr               spr1430       1413497       1414033   -
    933906 -                 spr1080       1076140       1076442   -
-          -                 -              611870        612184   +
    934157 appB              spr1193       1189778       1190773   -
    934678 -                 spr0391        387839        388228   -
    933498 -                 spr1610       1585462       1586580   -
-          -                 -         -             -             -
    934878 ABC-NP            spr0137       144765        146381    +
-          -                 -         -             -             -
-          -                 -             1588734       1589002   +
-          -                 -         -             -             -
    933059 -                 spr1179       1177462       1178466   -
    934825 alkD-truncation   spr0345        349310        349456   +
    933792 pphA              spr1083       1079271       1079999   -
    934221 trmD              spr0687        688917        689636   +
    933243 -                 spr1587       1567200       1568297   -
    933714 treP              spr1699       1668093       1670210   -
    933820 ssbB              spr1724       1704481       1704876   -
-          -                 -         -             -             -
    933320 smf               spr1144       1145894       1146754   -
    934303 pcp               spr0762        758322        758966   +
    933085 rnhB              spr0365        364501        365373   -
    934743 -                 spr0419        416246        416416   -
    934371 rluD              spr0830        830091        830978   +
    934126 pstC              spr1896       1875369       1876232   +
    934375 proA              spr0833        834084        835346   +
-          -                 -               87314         87776   +
    934489 nagB              spr1272       1266335       1267057   -
-          -                 -         -             -             -
    933663 cinA              spr1758       1726299       1727555   -
-          -                 -             1039845       1040077   +
    933741 murI              spr1696       1664899       1665693   -
    934645 pepC              spr0258        259029        260363   +
    934807 -                 spr0334        338263        339657   +
    934374 lspA              spr0829        829640        830101   +
    934647 manL              spr0261        262185        263183   -
    933287 -                 spr1588       1568307       1569053   -
    934057 leuS              spr0235        227269        229770   +
    933876 rexB              spr1039       1021482       1024757   +
    933528 -                 spr0501        499462        499665   +
    932874 -                 spr0104        112225        113124   -
    933170 -                 spr0592        606081        606836   +
    933831 licC              spr1145       1146838       1147527   -
    933793 -                 spr1625       1599747       1600355   +
-          -                 -              113125        113541   +
-          -                 -         -             -             -
    933833 IS1167            spr1009        991498        992016   -
-          -                 -               87314         87776   +
    933685 -                 spr1746       1718122       1718382   -
    933638 secG              spr0877        867599        867832   +
    933171 rsuA              spr0597        608867        609592   -
-          -                 -              308158        308452   +
-            -                -         -             -             -
    933413   purA             spr0021         22635         23921   +
    934739   xylR             spr0420        417068        418291   -
    934026   xpt              spr1662       1635320       1635901   +
    932843   -                spr0086         93718         94782   -
    933152   scrK             spr1565       1545468       1546355   -
    933176   rr13             spr0463        469762        470499   +
    933941   -                spr1418       1404855       1405634   -
    934213   ABC-NBD          spr0678        682910        684451   +
    934390   phoL             spr0849        845750        846718   +
    933369   brnQ             spr0551        550668        552008   +
-            -                -             1365469       1365670   +
    934568   glnQ             spr1354       1336952       1337581   -
-            -                -              495178        495459   +
    934723   PTS-EII          spr0295        295819        296637   +
-            -                -         -             -             -
    933978   msmG             spr1710       1682791       1683624   -
    934461   murB             spr1247       1246627       1247577   -
-            -                -         -             -             -
    933304   phtD             spr0907        892369        894930   +
    934675   -                spr0389        386914        387126   +
    934299   -                spr0763        759134        759364   +
    933277   adcA             spr1975       1966098       1967603   -
    933108   -                spr1652       1623066       1625225   -
-            -                -         -             -             -
    932922   nrdD             spr0183        191172        193385   +
    933264   -                spr1585       1566450       1566704   -
    933966   -                spr0967        948960        950183   +
-            -                -         -             -             -
    934623   -                spr1409       1392942       1393733   -
-            -                -         -             -             -
    933399   IS1167-truncationspr0019        21645         21851    -
-            -                -             281043        281423    +
    934323   thiI             spr0784       782134        783348    +
-            -                -         -             -             -
    934259   -                spr0720       721895        722194    -
    934895   -                spr0152       160263        160877    +
    933759   rpsG             spr0249       247994        248464    +
-            -                -         -             -             -
    933420   frp              spr1554       1535481       1536194   -
    934085   -                spr1419       1405621       1406499   -
    932789   malP             spr1916       1895736       1897994   -
    933612   plcR             spr1803       1774530       1775429   -
    933737   ABC-SBP          spr0934        920239        921264   +
    933756   trpC             spr1634       1607098       1607865   -
    933725   tsf              spr2019       2010734       2011774   -
-            -                -         -             -             -
    933090   -                spr1416       1403031       1403417   -
    933005   proWX            spr1677       1648982       1650502   -
    934764   -                spr0257        258893        259057   +
-            -                -         -             -             -
    932923                    spr0957
             relaxase-truncation            938857        939474    +
-            -                -         -             -             -
-            -                -         -             -             -
-            -                -         -             -             -
    934752   transposase_A spr0313           313115        313462   -
    934041   -                spr1605       1580628       1581188   -
    934814   rpsL             spr0248        247561        247974   +
    933777   -                spr0174        183696        184265   +
    933907   IS861-truncation spr0352        352405        352590   -
    934353   ABC-MSD          spr0813        814380        816368   +
    934418   -                spr1208       1206423       1206701   -
    933654   nisP             spr1771       1739650       1741389   +
    934733   mraW             spr0302        300978        301928   +
    934505   spnIR-truncation spr1286       1280441       1280632   +
    933053   tktN             spr1937       1918865       1919722   -
-            -                -         -             -             -
-            -                -         -             -             -
    933336   glgB             spr1029       1010268       1012196   +
    932839   -                spr0087         94845         95807   -
    934548   glyQ             spr1329       1316630       1317547   -
    933656   clyB             spr1770       1737518       1739626   +
    934500   ABC-NBD          spr1281       1275624       1276346   -
    933477   pepO             spr1491       1466904       1468796   -
    933327   metY-truncation spr1096        1093409       1093531   -
    934200   livH             spr0660        663874        664752   +
    933357                    spr0958
             relaxase-truncation             939505        940062   +
    934467   pstB             spr1253       1252252       1253010   -
    933216   -                spr1626       1600386       1600589   +
    932814   tRNA-Arg1        sprt08        1131546       1131617   -
    933106   ribD             spr0164        172659        173759   -
    933117   -                spr1496       1472325       1475099   -
    934721   -                spr0405        401195        401551   +
    934875   -                spr0128        137522        137707   -
    933888   smpB             spr0879        870251        870718   +
    934614   -                spr1400       1378670       1379158   -
-            -                -         -             -             -
    933309   -                spr1576       1555231       1555989   -
    934537   apbE             spr1324       1311068       1311991   +
    933914   -                spr1488       1465305       1465475   -
-            -                -         -             -             -
-            -                -              359743        359943   +
    934857   -                spr1996       1989728       1990255   -
-            -                -         -             -             -
    934561   IS861-truncation spr1341       1325713       1325982   -
    934083   -                spr1018        996732        997580   -
    932881   lacT             spr1072       1070696       1071532   -
    934463   glnH             spr1251       1250615       1251430   -
    933160   -                spr1607       1583235       1583990   -
    934725   ilvN             spr0402        399026        399526   +
-            -                -         -             -             -
-            -                -              579912        580122   +
    934759   dexB             spr0310        310667        312274   +
    933640   tRNA-Cys         sprt31        1752048       1752118   +
    934813   xerD             spr0447        452481        453278   -
    933239   glcK             spr0584        600133        601110   +
    933266   truB             spr1092       1086726       1087604   -
    932918   mvaA             spr1570       1551199       1552473   -
    933563   rluD             spr1824       1799011       1799886   +
-            -                -         -             -             -
-            -                -         -             -             -
-            -                -             1682434       1682638   +
-            -                -              585424        585633   +
    933460   IS1167           spr0042         40982         41500   -
    934447   -                spr1222       1219095       1220528   -
    934410   IS1381-truncationspr1197       1194240       1194503   -
-            -                -         -             -             -
-            -                -         -             -             -
-            -                -         -             -             -
    934123   -                spr1905       1882383       1882928   -
    934098   -                spr2028       2018477       2019307   -
    934758   cspR             spr0432        432843        433385   +
-            -                -         -             -             -
-            -                -         -             -             -
    933681   IS1381-truncationspr1745       1717094       1717357   +
    933405   -                spr0538        537698        539359   +
    934812   -                spr0457        466094        466381   -
    934302   tRNA-Tyr1        sprt04         759414        759494   +
-            -                -         -             -             -
    934202   livJ             spr0659        662455        663615   +
    933670   recA             spr1757       1725078       1726244   -
    934168   -                spr1407       1390809       1392404   -
-            -                -              403039        403585   +
    934816   mvd1             spr0339        343873        344907   +
-            -                -         -             -             -
-            -                -             1700356       1700708   +
    933356   IS1381-truncationspr1574       1554515       1554715   -
-            -                -         -             -             -
    933814   -                spr1124       1125526       1126344   -
    933077   IS1381-truncationspr1946       1928212       1928781   +
    934193   -                spr0657        662105        662353   +
    933145   -                spr0595        608131        608511   +
-            -                -         -             -             -
    934629   -                spr0125        134636        136468   -
-            -                -              195285        195550   +
    934471   -                spr1259       1257581       1258384   -
    933606   -                spr1809       1779717       1780025   -
    934370   cpsY             spr0828        828735        829643   +
    934294   IS861-truncation spr0751        747720        747932   +
    933312   -                spr0569        580406        581026   +
    934219   holA             spr0673        678831        679868   +
    933596   -                spr1818       1788261       1788467   -
    934863   mreC             spr2023       2014609       2015427   -
    933074   -                spr1484       1460808       1461107   -
    933523   -                spr0510        509689        510690   -
    934391   gidA             spr0844        841805        843139   +
    933884 -               spr0946        929956        930810 +
    934426 trzA            spr1214       1208515       1209981 -
    934638 manM            spr0260        261354        262157 -
-          -               -         -             -           -
-          -               -             1166915       1167229 +
    934516 cppA            spr1304       1296891       1297631 -
    933178 -               spr0177        185057        185362 +
-          -               -         -             -           -
    933215 rffD            spr0961        941893        943188 +
    933446 divIVA          spr1505       1483605       1484405 -
-          -               -         -             -           -
    934042 trxB            spr1421       1406614       1407582 +
    934342 -               spr0800        804440        804604 +
    933341 licD2           spr1152       1153665       1154474 +
    934448 aroC            spr1232       1229171       1230337 -
-          -               -         -             -           -
    934251 ciaR            spr0707        707226        707966 +
-          -               -              142308        142594 +
    933880 topA            spr1141       1141707       1143812 -
    933396 murN            spr0541        541544        542776 +
    933080 -               spr1642       1614153       1614308 +
    933892 ulaA            spr1849       1824217       1825743 -
-          -               -         -             -           -
    933066 -               spr1962       1949304       1950203 -
    934238 -               spr0698        699119        699994 +
    934555 mocA            spr1335       1321864       1322925 +
    934700 -               spr0283        281424        281600 +
    934480 rpsU            spr1271       1266019       1266219 -
    934152 -               spr1189       1185003       1185491 -
-          -               -              634520        634964 +
-          -               -               28366         28582 +
    933911 rnpA            spr1853       1828283       1828654 -
    933388 -               spr0544        545425        546258 +
    934325 fruA            spr0780        776031        777983 +
-          -               -              668257        668469 +
    934388 -               spr0848        845449        845664 +
    934515 -               spr1301       1294301       1295008 +
    933092 pbuX            spr1663       1635901       1637163 +
    933339 -               spr0470        475926        476159 +
    934218 -               spr0677        682441        682908 +
-          -               -             1893493       1893835 +
    934049 -               spr0909        899089        899229 +
    932836 -               spr0091         98018         99175 +
    933474 MFS_transporter spr1453       1435804       1436955 -
    933211 sacA            spr1617       1590821       1592140 -
    934061 leuA-truncation spr1136       1138704       1139138 -
    934604 -               spr1391       1371711       1372460 -
    933505 rplF            spr0204        203327        203863 +
    933810 xylH            spr0921        908903        909085 -
    933974 -               spr1859       1832180       1832686 -
-          -               -         -             -           -
    934502 nagD            spr1264       1260644       1261417 -
    933665   scpB             spr1690       1660929       1661498   -
    934632   orf51            spr0127        137368        137520   -
    934711   ugl              spr0292        293346        294536   +
    934428   ABC-N/P          spr1215       1210076       1211866   -
    933673   -                spr1755       1723091       1723153   -
    932794   -                spr0068         75311         76075   +
-            -                -         -             -             -
-            -                -         -             -             -
    933424   dnaB             spr1556       1537088       1538257   -
    933029   galT             spr1667       1639091       1640572   -
-            -                -         -             -             -
    934150   npl-truncation   spr1187       1184181       1184276   -
    933616   -                spr1798       1769404       1770282   -
    933753   birA             spr1715       1688996       1689931   +
    934787   cps2M            spr0321        321134        321727   +
-            -                -              687164        687577   +
    934138   -                spr1901       1879066       1879584   -
    934332   -                spr0788        784661        785068   +
    933518   pnpA             spr0516        515696        518023   +
    933526   -                spr0508        506633        507142   +
    933297   -                spr0574        584548        585423   +
    934867   ABC-NBD          spr2035       2026409       2028031   +
-            -                -         -             -             -
-            -                -             803264        803554    +
-            -                -         -             -             -
    932961   IS1239-truncationspr0612       623952        624095    -
-            -                -             248465        248888    +
-            -                -         -             -             -
    933022   -                spr0252        255567        255830   +
    933519   pheT             spr0509        507219        509621   +
    933127   relA             spr1487       1462935       1465157   -
    933412   -                spr1103       1104862       1105125   -
    933102   -                spr0186        194667        195284   +
-            -                -         -             -             -
-            -                -         -             -             -
    933288   zwf              spr1122       1122712       1124199   +
    933249   pyrP             spr1165       1167230       1168549   +
    934544   -                spr1321       1307786       1308367   -
    933096   gpmB             spr0219        212409        213158   +
    934038   -                spr1454       1437195       1437824   -
    932971   -                spr0253        255823        256101   +
    932797   ebsC             spr0888        878003        878485   -
    933061   rpsN             spr0202        202183        202452   +
-            -                -         -             -             -
    933728   pgsA             spr2027       2017921       2018466   -
    932962   prsA             spr0884        875223        876164   +
    934117   pstA             spr1897       1876225       1877040   +
    934203   ptsG             spr0668        671374        673554   +
    933500   hemH             spr0914        902106        903200   +
-            -                -         -             -             -
    934828   alkD-truncation spr0346        349534        349788    +
    934641   dagA             spr0369       369089        370411    +
-            -                -         -             -             -
-            -                -         -             -             -
    933688   IS1381-truncationspr1744       1716958       1717089   +
-            -                -             1533022       1533242   +
    934099   -                spr2037       2030746       2031060   -
-            -                -         -             -             -
    933027   -                spr1930       1911031       1911495   -
    934890   ugd              spr0139        147932        149104   +
    933438   -                spr1597       1574427       1575032   -
    933843   -                spr0945        929141        929956   +
    933651   -                spr1774       1742999       1743160   +
    933757   ABC-MSP          spr1526       1502114       1503010   -
-            -                -         -             -             -
    934449   amy              spr1239       1237343       1238797   +
    934668   sulD             spr0269        270868        271680   +
-            -                -         -             -             -
    933857   blpY             spr0472       476191        476880    +
-            -                -         -             -             -
-            -                -              990438        990698   +
    934646   -                spr0367        365759        366307   +
    933859   trpF             spr1633       1606512       1607141   -
    934755   -                spr0428        428433        429308   +
    933826   ftsZ             spr1510       1486672       1487931   -
-            -                -              795762        795965   +
    934468   -                spr1236       1232951       1234123   -
    933902   nanA             spr1536       1514944       1518051   -
-            -                -         -             -             -
-            -                -             1540721       1541132   +
-            -                -              937305        938135   +
-            -                -              136551        137367   +
-            -                -         -             -             -
    934688   nusB             spr0390        387424        387864   -
    934334   pfkA             spr0796        799177        800184   +
    933729   -                spr2030       2020620       2021870   -
    932806   IS1167-truncationspr0987        971764        972018   -
    933270   pabB             spr0582        597147        598868   +
    934080   radC             spr0996        981461        982156   +
-            -                -             1520397       1520711   +
    934403   infC             spr0861        855261        855848   +
-            -                -         -             -             -
-            -                -         -             -             -
    933988   tgt              spr1869       1840531       1841673   -
    932884   mscL             spr0915        903242        903619   -
    934081   pyrC             spr1053       1049060       1050328   -
    934023   -                spr0159        167276        167797   -
    932872                    spr0105
             Transporter-truncation          113542        113775   +
    933962   -                spr0883        874443        875156   +
    933314   -                spr1586       1566708       1567001   -
-            -                -         -             -             -
    934120   pstS             spr1895       1874313       1875251   +
-            -                -             1590275       1590538   +
-            -                -         -             -             -
    934127   -                spr1908       1885060       1886193   -
    933442   recO             spr0036         36977         37747   +
    934329   -                spr0785        783459        784307   +
    933009   -                spr0024         25158         25736   +
    934233   -                spr0693        693198        694397   +
    934547   pgdA             spr1333       1319730       1321121   -
    933708   -                spr1983       1974482       1975660   -
    933544   valS             spr0492        491701        494352   +
    933416   ABC-NBD          spr1161       1162971       1164497   +
-            -                -              556072        556332   +
    934357   cad              spr0816        818663        820138   +
    932966   cutC             spr1139       1140517       1141149   -
    933817   -                spr1500       1479193       1479381   -
    933937   -                spr1693       1662976       1663437   -
-            -                -         -             -             -
    933037   mutX             spr1054       1050341       1050805   -
    934874   IS1167-truncationspr0133        140419        140970   -
    933913   era              spr0871        863847        864746   +
    934421   rplL             spr1211       1207321       1207704   -
    933849   -                spr1015        995115        995285   -
    934644   mutS2            spr0368        366411        368747   +
    934310   -                spr0772        765917        767179   +
    933065   -                spr1940       1921373       1923403   -
    932879   -                spr0113        121084        122142   +
    933154   IS1167-truncationspr1702       1671890       1672417   +
    934366   -                spr0825        827547        827768   +
    933279   nth              spr1157       1161041       1161670   -
    933983   -                spr1865       1835575       1835946   -
    932860   IS1167           spr0988        972009        972563   -
-            -                -              919847        920238   +
    933661   -                spr1765       1732032       1732256   +
-            -                -         -             -             -
-            -                -         -             -             -
    934876                    spr0136
             glycosyltransferase             143802        144755   +
    934412   -                spr1199       1195086       1195307   -
    934423   -                spr1206       1205152       1205739   -
-            -                -         -             -             -
-            -                -              619396        619724   +
    933598   hk11             spr1815       1785363       1786460   -
    934261   transposase_B spr0724           723532        723708   +
    933058   -                spr0937        922743        923156   -
-            -                -               74337         74551   +
    933153   recR             spr1516       1493609       1494205   -
    933844   -                spr0169        177444        178148   -
    934892   transposase_A spr0134           142041        142307   -
    933807   -                spr0168        176158        177189   -
    933495   vex3             spr0526        525639        527018   +
    934408   lguL             spr0864        856499        856930   +
-            -                -             1544117       1544530   +
-            -                -         -             -             -
    934330   -                spr0789       785081        786247    +
-            -                -         -             -             -
    934149 npl-truncation spr1186       1183359       1184090 -
    934693 -              spr0400        395489        397156 +
    933895 -              spr1537       1518294       1518521 -
-          -              -         -             -           -
    933458 rRNA_5S-1      sprr03         19924          20038 +
-          -              -         -             -           -
    934686 xylS           spr0284        282002        284215 +
    934571 atpD           spr1360       1342395       1343801 -
    933192 -              spr0589        603262        604500 +
    933778 -              spr1830       1804233       1805543 +
    934087 dltA           spr1982       1972466       1973932 -
    933274 zmpB           spr0581        591447        597077 +
    934326 -              spr0786        784329        784664 +
    933603 -              spr1811       1780659       1782077 -
    933281 hk09           spr0579        589055        590746 +
    933707 dltB           spr1981       1971225       1972469 -
    933796 glnQ           spr1121       1121823       1122563 +
-          -              -         -             -           -
-          -              -         -             -           -
-          -              -         -             -           -
    933845 -              spr1612       1587345       1587797 -
-          -              -         -             -           -
    934900 hk07           spr0153        161830        162525 +
    933636 endA           spr1779       1753876       1754700 -
    934414 -              spr1200       1195742       1195921 -
    932819 tRNA-Asn1      sprt03          20044         20117 +
-          -              -         -             -           -
-          -              -               14899         15160 +
                          spr1877
    933996 MATE_transporter             1846457       1847737 -
    934043 guaA           spr1884       1860650       1861387 -
    933300 -              spr0567        579666        579911 -
-          -              -         -             -           -
    933939 -              spr0246       242225         243274 +
-          -              -         -             -           -
    933669 lytA           spr1754       1722069       1723025 -
    933550 -              spr0480        481597        481896 +
    933114 -              spr1475       1455671       1456744 +
-          -              -         -             -           -
-          -              -         -             -           -
    934528 -              spr1308       1299522       1300034 -
    933595 rr11           spr1814       1784762       1785361 -
    933208 ccrB           spr0942        926056        927735 +
    934535 ogt            spr1317       1305516       1306046 -
    933219 -              spr0985        971016        971174 +
-          -              -         -             -           -
    933142 -              spr0600        612185        612532 +
-          -              -             1310775       1311067 +
-          -              -             1655616       1656022 +
    933115 -              spr1478       1457631       1457825 +
-          -              -             1998757       1999011 +
-          -              -         -             -           -
    934321 ftsK           spr0781       778069         780372 +
    934761 cps2A           spr0314        313695        314657   +
-          -               -              685735        686481   +
    932896 -               spr0109        117728        118108   +
    933641 murA            spr1781       1754920       1756203   -
-          -               -         -             -             -
    934110 serB-truncation spr1033       1016262       1016591   +
-          -               -         -             -             -
-          -               -             1328161       1328398   +
    933221 -               spr0583        599026        600015   +
    934530 -               spr1318       1306046       1306540   -
    934109 eno             spr1036       1018322       1019626   +
    934075 xerC            spr1046       1040078       1041148   +
-          -               -         -             -             -
-          -               -         -             -             -
-          -               -              411891        412112   +
    934682 -               spr0281        279110        279616   +
    934901 ABC-NBD         spr0149        157774        158835   +
    933199 mfd             spr0006          4756          8265   +
    933197 -               spr0594        607862        608131   +
    934885 -               spr0143        151597        152262   +
    932975 -               spr0225        217339        217536   -
    934494 -               spr1284       1278165       1279469   -
    933950 PTS-EIIB        spr0230        220809        221117   +
    933082 -               spr1661       1634203       1634442   +
    933365 -               spr0553        553218        553721   +
    934441 licD1           spr1225       1222625       1223470   -
-          -               -             1975661       1976115   +
    934518 -               spr1306       1298337       1299164   -
    933150 -               spr0599        611615        611869   +
    933552 -               spr0483        485549        486364   +
    933141 gpmB            spr0887        877383        878003   -
    933755 -               spr0912        900059        900688   +
-          -               -         -             -             -
                           spr1734
    933695 ABC-NBD-truncation            1709860       1710891   -
    934234 gor             spr0692        691587        692933   -
    933577 -               spr1727       1706390       1706707   -
-          -               -         -             -             -
    934545 -               spr1330       1317741       1318130   -
    934257 transposase_C spr0717          720316        720720   +
-          -               -         -             -             -
    933435 purF            spr0047         50314         51756   +
    934277 -               spr0736        735107        735310   +
    934153 -               spr1190       1185496       1186914   -
-          -               -         -             -             -
-          -               -         -             -             -
    934246 dinG            spr0711        710880        713330   +
    933960 scrR            spr1621       1595432       1596445   -
    933894 tag             spr0166        174766        175329   +
-          -               -         -             -             -
    933006 pepB            spr0882        872639        874441   +
    934542 -               spr1325       1312051       1312656   +
-          -               -              636281        636655   +
    934726   PTS-EII          spr0293        294547        295038   +
    934796   cpsN             spr0322        321740        322789   +
    934731   -                spr0417        415349        415633   -
    934297   -                spr0760        756677        757387   +
    934587   -                spr1368       1349823       1350305   -
-            -                -             1518052       1518293   +
-            -                -         -             -             -
    934308   dnaX             spr0769        763092        764747   +
    933395   murM             spr0540        540319        541539   +
    933653   -                spr1766       1732263       1732451   +
    933812   rpsE             spr0206        204321        204815   +
    934377   but              spr0823        825410        826285   +
    934746   trkA             spr0427        426922        428271   -
-            -                -         -             -             -
    934565   bta              spr1352       1335477       1335824   +
    934151   cdd              spr1188       1184308       1184715   -
    933362   ddl              spr1515       1492390       1493433   -
    934631   -                spr1004        987053        987724   +
    933445   ABC-MSP          spr1532       1510325       1511158   -
    934783   glnA             spr0444        448511        449857   +
    933070   pkn2             spr1577       1556104       1558083   -
    934400   celA             spr0856        849966        850616   +
-            -                -         -             -             -
    933748   -                spr1498       1475986       1478397   -
-            -                -         -             -             -
    934556   transposase_D spr1337          1324068       1324229   -
    933315   pth              spr0005          4186          4755   +
-            -                -         -             -             -
-            -                -         -             -             -
    934600                    spr1378
             ABC-MSP-truncation             1361655       1361807   -
-            -                -         -             -             -
    934105   hlpA             spr1020        998667        998942   +
-            -                -             1269160       1270612   +
    934457   potC             spr1244       1243854       1244627   -
-            -                -         -             -             -
    934253   gyrB             spr0715        715818        717764   +
    932927   infA             spr0211        207771        208043   +
    933095   -                spr1948       1929248       1929574   -
-            -                -         -             -             -
    934553   -                spr1334       1321356       1321601   -
-            -                -         -             -             -
    932840   -                spr0889        878485        879327   -
    934586   murC             spr1373       1354028       1355362   -
    933278   IS861-truncation spr1446       1432048       1432536   -
    934640   spi              spr0364        363875        364489   -
    934143   gldA             spr0234        225726        226814   +
    934066   argS             spr1890       1869051       1870742   +
    934064   argR             spr1889       1868457       1868903   -
    934887   -                spr0138        147164        147919   +
    934294   IS861-truncation spr0751        747720        747932   +
-            -                -         -             -             -
-            -                -         -             -             -
    934124   dapD             spr1907       1884132       1884830   -
    933334   groES            spr1723       1704041       1704325   -
    933657   plcR             spr1763       1730704       1731567   -
    934879   gcp              spr0131        138992        140002   +
-            -                -              562193        562417   +
-            -                -         -             -             -
-            -                -              888036        888260   +
    933703   -                spr1733       1709432       1709794   -
-            -                -         -             -             -
    934146   -                spr1184       1182410       1182847   +
    933030   pfs              spr0894        882643        883335   +
    933206   mutM             spr0872        864795        865619   +
-            -                -         -             -             -
-            -                -         -             -             -
-            -                -             1987315       1987543   +
    932811   rpsJ             spr0187        195551        195859   +
-            -                -             1514170       1514698   +
    934397   celB             spr0857        850600        852840   +
    932866   ABC-MSP          spr0099        105545        107653   +
    933803   ribE             spr0161        170346        170813   -
    932910   thmA             spr0040         39514         39744   +
    933451   purM             spr0048         51793         52815   +
-            -                -         -             -             -
    934626   -                spr1411       1396746       1397930   +
    933841   eep              spr0242        235502        236761   +
    933094   -                spr1428       1412691       1412861   -
-            -                -             1039495       1039744   +
    934671   -                spr0388        386472        386657   +
-            -                -              149105        149498   +
    933231   arcA-truncation spr1956        1942262       1942711   +
-            -                -         -             -             -
-            -                -             505280        505505    +
-            -                -         -             -             -
    933214   polA             spr0032         31306         33939   +
    933452   -                spr1463       1443951       1444628   -
    934852   adcB             spr1976       1967613       1968449   -
-            -                -         -             -             -
-            -                -         -             -             -
    934171   nifS             spr1001        984159        985274   -
    934837   manN             spr0259        260419        261330   -
    933862   IS1381-truncationspr0993        977840        978547   +
-            -                -             1451068       1451431   +
    932967   galT             spr1648       1620044       1621519   -
-            -                -         -             -             -
    933721   yfnA             spr0905       889898        891301    +
-            -                -         -             -             -
-            -                -              934439        934825   +
    934734   cbpG-truncation spr0349         350465        351121   +
    934786   aliA             spr0327        325111        327093   +
    933440   -                spr1654       1626356       1627609   -
    933468   PTS-EIIC         spr0061         68133         69038   +
    934898   ABC-MSD          spr0150        158837        159529   +
    934580 atpE             spr1366       1348096       1348296   -
-          -                -             1587055       1587344   +
    932833 -                spr0020         22162         22404   +
    933431 -                spr1433       1416910       1417587   -
    933613 -                spr1796       1768112       1768795   -
    933011 dfr              spr1429       1412861       1413367   -
    933001 -                spr1470       1451432       1451638   +
    934822 ABC-NBD          spr0459        466869        467600   +
    933816 -                spr0033         34024         34461   +
    934046 ABC-N/P          spr1657       1630231       1632015   -
    934534 ABC-NDB          spr1314       1303465       1304208   -
    934795 rnpB             sprs02         336620        337023   +
    933650 -                spr1769       1736592       1737521   +
    933195 cshA             spr1616       1589003       1590274   +
-          -                -         -             -             -
    933024 -                spr1503       1483401       1483562   -
    933885 -                spr0983        969263        969439   +
-          -                -             1604241       1604541   +
-          -                -         -             -             -
    933338 gapN             spr1028       1008379       1009803   +
    934628 -                spr1405       1389671       1390399   -
-          -                -             1678974       1679659   +
    934300 IS861-truncation spr0752        748068        748235   +
    932952 malD             spr1920       1902742       1903605   +
    932852 -                spr0901        887403        888035   -
                            spr1381
    934597 ABC-MSP-truncation             1363036       1363338   -
    933936 natB             spr1561       1541133       1542332   -
    933637 -                spr1784       1758014       1758553   -
    932876 ABC-NBD          spr0100        107650        108291   +
    934417 -                spr1207       1205988       1206368   -
    934177 -                spr0643        651331        651678   +
-          -                -             1581189       1581427   +
    934122 glxK             spr1034       1016588       1017715   +
    934230 bioY             spr0691        690854        691390   -
    933967 ABC-NBD          spr0977        962670        963428   +
-          -                -              392150        392361   +
    934492 -                spr1278       1273808       1274296   -
    932898 gidA             spr0124        132343        134256   +
-          -                -         -             -             -
    934189 mta              spr0649        656131        656793   +
-          -                -             1325488       1325712   +
-          -                -         -             -             -
-          -                -         -             -             -
-          -                -              72869         73074    +
-          -                -         -             -             -
-          -                -         -             -             -
-          -                -              108292        108505   +
    933441 pyrR             spr1156       1160309       1160830   -
    934533 ABC-MSP          spr1315       1304208       1305008   -
-          -                -              450280        450636   +
    934201 ftsX             spr0667        670099        671088   +
    933602 ansB             spr1812       1782113       1783075   +
    932907   tRNA-Leu3        sprt25        1691955       1692036   -
    934280   deoD             spr0738        736505        737215   +
    934406   lytB             spr0867        858971        861136   +
    934473   -                spr1258       1257080       1257475   -
    933331   -                spr1160       1162519       1162698   +
    934870   comC             spr2043       2035337       2035462   -
    934508   transposase_G spr1295          1290909       1291121   -
-            -                -         -             -             -
-            -                -         -             -             -
    934211   -                spr0676        681354        682439   +
-            -                -             1205740       1205987   +
-            -                -         -             -             -
    933992   nagA             spr1867       1837312       1838463   -
-            -                -         -             -             -
    933787   pflE             spr0226        217611        218387   -
    934130   -                spr1915       1894119       1894691   +
-            -                -         -             -             -
    933088   arcA-truncation spr1955        1941478       1942221   +
-            -                -              761603        761882   +
-            -                -         -             -             -
    934036   ctpE             spr1464       1444730       1447066   -
    934436   cps23FU          spr1223       1220544       1221530   -
    932844   -                spr0088         95749         96342   -
    934235   -                spr0700        701014        701271   +
    933032   rnhB             spr1044       1037149       1037928   +
    933033   -                spr1549       1531451       1531843   -
    934317   -                spr0775        768897        770309   +
    932906   -                spr0123        131851        132333   +
    933811   -                spr1838       1814648       1815058   -
    932982   -                spr0184        193581        194087   +
    933437   secY             spr0209        205609        206919   +
    934365   -                spr0824        826466        827275   -
    934343   -                spr0799        803555        804427   +
    934824   hsdR             spr0450        456379        458712   -
    934401   frr              spr0846        843969        844526   +
    934610   -                spr1390       1371422       1371721   -
    934360   IS1239-truncationspr0815        817081        818001   -
-            -                -         -             -             -
-            -                -         -             -             -
-            -                -             1784368       1784589   +
-            -                -         -             -             -
    933713   -                spr1994       1986304       1987314   +
    934732   yorfE            spr0301        300618        300812   -
    933790   -                spr1013        994115        994459   +
-            -                -         -             -             -
    933402   -                spr1599       1576403       1577356   +
    933144   transposase_A spr0898           886559        886924   +
    933382   glk              spr1519       1497340       1498224   -
    933931   mvaS             spr1571       1552473       1553669   -
    934249   gph              spr0714        715231        715803   +
    934247   rodA             spr0712        713340        714590   +
    932976   mtlF             spr0358        357510        357947   +
    934422 transposase_D spr1198       1194544       1194648 +
    933368 alr           spr1540       1522746       1523870 -
-          -             -         -             -           -
-          -             -         -             -           -
    932988 -             spr0182        189502        191058 +
    933720 -             spr2010       2002560       2004533 -
-          -             -         -             -           -
    933539 -             spr0490        490168        490725 +
    934511 -             spr1291       1286956       1287540 +
    933877 rpmI          spr0862        855881        856081 +
    934650 -             spr0264        265664        267136 +
    933047 -             spr0217        210516        210875 +
    933129 rpsC          spr0195        199251        199904 +
-          -             -         -             -           -
    932835 -             spr1694       1663434       1663955 -
-          -             -             1061638       1061969 +
-          -             -         -             -           -
    933508 vex2          spr0525        524940        525587 +
    934609 ssbA          spr1395       1374841       1375311 -
-          -             -             1479898       1480464 +
-          -             -              721527        721894 +
    934757 ftsL          spr0303        301940        302257 +
    933802 deoR          spr0227        218461        219255 +
-          -             -             1071533       1071765 +
-          -             -              726205        726432 +
    933614 ABC-NBD       spr1801       1771588       1772229 -
    934574 -             spr1357       1339597       1340763 -
    934289 ABC-MSP       spr0749        745591        746676 +
    934554 DEAD/H        spr1336       1322922       1324004 +
    933345 -             spr1640       1613097       1613465 -
-          -             -         -             -           -
    933427 -             spr0972        955253        955474 +
    933746 -             spr1508       1485447       1485986 -
-          -             -         -             -           -
-          -             -         -             -           -
    934376 -             spr0837        837801        838145 +
    933473 -             spr1630       1603509       1604240 -
-          -             -         -             -           -
    934158 appA          spr1194       1190838       1192466 -
    934854 dltC          spr1980       1970972       1971211 -
-          -             -              173760        174162 +
-          -             -               74748         75310 +
    934577 atpC          spr1359       1341965       1342384 -
    933711 glpF          spr1988       1979572       1980276 -
    932993 fucA          spr1972       1961864       1962517 -
-          -             -              632362        632575 +
    932920 tRNA-Arg3     sprt21        1691594       1691667 -
    933464 -             spr1530       1507099       1508202 -
-          -             -             1479382       1479756 +
    934311 rpsA          spr0764        759737        760939 +
    933217 comB          spr0044         44068         45417 +
    934470 pstC          spr1256       1254711       1255628 -
    933366 -                spr0552       552212         553249 +
    932796 -                spr0074        79660          80070 +
-          -                -         -             -           -
-          -                -              876165        876380 +
    933383 ABC-SBP          spr0545        546440        547255 -
-          -                -              461579        462057 +
    934832 ABC-MSP          spr0460        467597        468646 +
                            spr0620
    932886 ABC-SBP-truncation              629408        629956 -
    934339 -                spr0633        641532        642182 +
    934077 -                spr1052       1047414       1048775 -
-          -                -             1500987       1501258 +
    934287 IS861-truncation spr0754        748579        749067 +
    934395 -                spr0855        849329        849898 +
    933924 -                spr0468        473479        475104 -
-          -                -         -             -           -
    934716 transposase_F spr0411           408239        408400 -
    934639 adhP             spr0262        263358        264377 -
    933361 scrA             spr1566       1546504       1548387 -
    934760 ABC-MSD          spr0431        431859        432689 +
-          -                -         -             -           -
    934148 -                spr1185       1183138       1183341 -
    934797 -                spr0332        336266        336607 +
    933222 tRNA-Met1        sprt16        1691152       1691225 -
-          -                -         -             -           -
    932821 -                spr0952        935359        936120 +
    934818 -                spr0348        350229        350423 +
    934527 -                spr1292       1287540       1288235 +
    933175 -                spr1168       1170750       1171127 -
    933246 proV             spr1678       1650495       1651223 -
    932865 argG             spr0102        109269        110516 +
    933959 crcB             spr1172       1173956       1174285 -
    934435 thiM             spr0636        643414        644217 +
    933648 -                spr1666       1638617       1639042 -
    934195 livM             spr0661        664756        665712 +
    934040 -                spr1461       1442047       1443159 -
-          -                -              438631        438870 +
    934338 argR             spr0793        792887        793357 -
    934573 atpG             spr1361       1343887       1344765 -
-          -                -         -             -           -
    933909 iga              spr1042       1029961       1035852 +
    934256 transposase_D spr0718           720608        721261 +
    934095 ABC-NBP          spr2025       2016273       2017112 -
    933775 ptcC             spr1834       1808876       1810171 +
-          -                -              719811        720198 +
    933164 -                spr0175        184352        184618 +
-          -                -             1325488       1325712 +
    934561 IS861-truncation spr1341       1325713       1325982 -
    934231 -                spr0697        698792        699115 +
    933540 IS861-truncation spr0495        496379        496486 -
-          -                -             1543534       1543798 +
-          -                -             1019627       1020109 +
-          -                -              489321        489731 +
    934805   csrR             spr0336        341169        341858   +
    933426   purB             spr0056         59175         60473   +
    933675   tRNA-Ala1        sprt02          16748         16820   +
    933015   ABC-SBP          spr1534       1512121       1513458   -
    934634   PTS-EIIC         spr0231        221110        222432   +
    933593   tdk              spr0922        909208        909807   +
    933938   -                spr1851       1826479       1827465   -
-            -                -         -             -             -
    933401   glnH             spr0534        533461        534255   -
    934437   hom              spr1219       1215716       1217035   -
    933529   bglH             spr0506        503580        504995   +
    934482   hprK             spr1270       1264954       1265904   -
    933915   PTS-EII          spr1848       1823913       1824194   -
    934509   transposase_E spr1298          1291786       1292136   -
    932913   amiD             spr1705       1674505       1675431   -
-            -                -             1665694       1665899   +
-            -                -              289280        289482   +
    933482   glnP             spr0532        532102        532761   -
-            -                -         -             -             -
-            -                -              299915        300142   +
    934599   -                spr1386       1369185       1369469   -
-            -                -         -             -             -
    932887                    spr0106
             Transporter-truncation          113839        115773   +
    932812   aspC             spr0035         35811         36980   +
    933724   transposase_D spr2017          2009766       2009945   +
    934692   basA             spr0285        284437        284913   -
-            -                -         -             -             -
    933604   -                spr1805       1776061       1776834   -
    934082   -                spr1424       1409498       1410388   -
    933660   -                spr1761       1729172       1729615   -
-            -                -         -             -             -
-            -                -         -             -             -
    934243   -                spr0704        703224        704099   +
    933686   comX1            spr0013         14254         14733   +
    932928   -                spr0982        967907        969232   +
    932934   ABC-MSP          spr1533       1511158       1512042   -
    933934   -                spr1688       1659978       1660220   -
-            -                -         -             -             -
    933091   -                spr1673       1645644       1646180   +
    932936   rplV             spr0194        198894        199238   +
    933372   axe1             spr1538       1519416       1520396   -
    934291   ABC-MSP          spr0750        746679        747635   +
-            -                -             1697169       1697430   +
    934205   livF             spr0663        666476        667186   +
    932915   -                spr1504       1483442       1483642   +
    934288   -                spr0747        742822        743946   +
    933804   galE             spr1460       1440727       1441746   -
    934166   ABC-NBD          spr1412       1398073       1399944   -
    934224   rimM             spr0686        688409        688927   +
-            -                -             1292357       1292605   +
    934459   potD             spr1243       1242787       1243857   -
-            -                -         -             -             -
                            spr1735
    933701 ABC-NBD-truncation             1710898       1711068 -
    934053 transposase_F spr1886          1863387       1863701 +
-          -                -         -             -           -
    933254 -                spr1027       1008187       1008360 -
    933323 priA             spr1581       1561089       1563485 -
    934748 PTS-EII          spr0423        421837        422181 +
    934775 cps2L            spr0320        320264        321133 +
    933375 -                spr1719       1699822       1700355 +
-          -                -              786248        786502 +
    934540 nox              spr1323       1309395       1310774 -
-          -                -              999163        999367 +
-          -                -         -             -           -
-          -                -         -             -           -
    933898 -                spr1850       1825805       1826428 -
    934774 IS861-truncation spr0353        352538        352891 -
    934826 dnaJ             spr0456        464641        465759 +
    934497 -                spr1277       1272232       1273692 -
    934607 -                spr1385       1368890       1369084 -
    933265 PTS-EII          spr1968       1959729       1960502 -
    933182 nrdH             spr1064       1061970       1062206 +
    934210 pyrDA            spr0672        677862        678797 +
    934651 -                spr0373        373698        374069 -
    933963 leuA-truncation spr1137        1139166       1139798 -
-          -                -         -             -           -
-          -                -         -             -           -
-          -                -             1843215       1843470 +
    934620 -                spr1406       1390478       1390657 -
    932996 pflF             spr0232        222574        225021 +
    934696 PTS-EII          spr0280        278777        279091 +
    932893 -                spr0117        124392        125294 +
-          -                -             1234124       1234800 +
    933507 -                spr0521        521360        522244 +
    934712 kdgK             spr0288        290122        291123 -
    932818 -                spr0075         80186         83671 +
    933836 trpD             spr1635       1607862       1608866 -
-          -                -              370412        370628 +
    934877 ABC-SBP          spr0147        155454        156308 +
-          -                -         -             -           -
                            spr0609
    932964 ABC-NBD-truncation              622097        622222 +
    933186 -                spr1650       1622231       1622725 -
    933200 -                spr0586        602094        602264 -
    933858 -                spr0874        866108        866308 -
-          -                -         -             -           -
    933608 -                spr1802       1772231       1774273 -
-          -                -         -             -           -
    934846 -                spr1949       1929900       1931780 -
-          -                -         -             -           -
    932854 -                spr0089         96329         96655 -
                            spr0523
    933511 transposase_H-truncation        523125        523298 +
    933190 -                spr0026         27115         27681 +
    934129 -                spr1912       1892042       1892353 -
-          -                -              568853        569212 +
    934598 PST_transporter spr1383        1365671       1367293   -
-          -                -              855012        855260   +
    934070 -                spr0965        946534        947640   +
-          -                -             1545149       1545467   +
    934384 -                spr0843        841288        841560   +
-          -                -              736095        736504   +
    933824 yajC             spr1840       1815535       1815834   -
    933485 glnP             spr0533        532771        533448   -
    933462 PTS-EIIB         spr0060         67629         68105   +
    934184 pmi              spr0647        653533        654477   +
-          -                -             1814370       1814647   +
    934076 -                spr0997        982153        982842   -
    933299 -                spr0570        581084        581530   +
    932790 agaS             spr0064         70549         71715   +
    934034 -                spr1000        983807        984154   -
-          -                -             1035853       1036310   +
    934191 comEB            spr0654        660077        660544   +
    933202 -                spr0947        930871        931806   +
-          -                -         -             -             -
    934350 tex              spr0808       809733        811880    +
    934789 hsdS             spr0446       451871        452470    -
-          -                -             416417        417067    +
-          -                -             409091        409665    +
-          -                -         -             -             -
-          -                -         -             -             -
    933678 -                spr1622       1596789       1598327   -
-          -                -             1713560       1713925   +
    934794 pyrG             spr0438        437023        438630   +
    933389 aldR             spr1425       1410440       1410820   -
    933251 -                spr1462       1443167       1443964   -
    934834 cbpG             spr0350        351246        351374   +
    934240 metG             spr0696        696425        698464   +
    933772 psaB             spr1492       1469087       1469809   +
    933078 adhB             spr1670       1642986       1644023   -
    933286 nha2             spr0573        582330        584384   +
    933439 tRNA-Asp1        sprt27        1692139       1692211   -
    933248 -                spr0939        924630        924839   +
    932941 -                spr1552       1533733       1534077   -
-          -                -              812648        812862   +
    933247 -                spr0893        882279        882626   +
    934821 mvk              spr0338        343094        343972   +
    933138 gpmA             spr1499       1478450       1479142   -
    932951 -                spr1708       1679660       1680853   -
    933083 -                spr1951       1932727       1935387   -
    934228 -                spr0680        685395        685616   -
-          -                -             1776835       1777139   +
    934180 copY             spr0639        646178        646603   +
    932959 pepA             spr1682       1653449       1654513   -
    933994 -                spr1870       1841803       1842660   +
    934724 -                spr0410        406350        408242   +
    934292 IS861-truncation spr0753        748235        748603   +
    933125 natA             spr1562       1542329       1543222   -
    933666 -                 spr1760       1728664       1729182   -
    933167 gcaD              spr0891        880306        881745   +
    933273 gmk               spr1583       1563890       1564516   -
-          -                 -              847642        848040   +
    933951 coiA              spr0881        871667        872620   +
    932955 galM              spr0065         71831         72868   +
    934583 atpB              spr1365       1347345       1348061   -
    934806 -                 spr0333        337078        338250   +
    933965 leuD-truncation   spr1133       1137026       1137385   -
    933615 -                 spr1800       1771287       1771601   -
    934695 gatA              spr0394        390381        391847   -
    933953 -                 spr0360        359316        359474   +
    934485 -                 spr1275       1270613       1271164   -
-          -                 -         -             -             -
    933976 -                 spr1041       1028574       1029752   +
    933316 ispD              spr1149       1150320       1151027   -
-          -                 -             1380028       1380264   +
    934028 glnP              spr1120       1119658       1121823   +
    934839 malM              spr1917       1898020       1899537   -
-          -                 -             1256507       1256894   +
-          -                 -         -             -             -
    933634 -                 spr1787       1759722       1760429   -
    933645 -                 spr0950        934157        934438   +
    934207 ftsE              spr0666        669477        670169   +
    934722 regR              spr0298        298847        299914   +
    933228 corA              spr1596       1573474       1574370   -
    934661 sulB              spr0267        268968        270290   +
    934301 tRNA-Gln1         sprt05         759504        759575   +
-          -                 -         -             -             -
    933527 pheS              spr0507       505506        506633    +
-          -                 -         -             -             -
-          -                 -              195860        196075   +
-          -                 -             1281808       1282333   +
    934381 -                 spr0840        839871        840518   +
    933564 nadC              spr1829       1803124       1804023   -
    933298 -                 spr0964        944613        946505   +
    933788 -                 spr0467        473133        473468   -
-          -                 -         -             -             -
-          -                 -              619396        619724   +
    933712 glpK              spr1991       1982216       1983724   -
    933013 pepT              spr0913        900731        901951   -
    933698 ftsH              spr0012         12174         14132   +
    933952 flaV              spr1175       1175032       1175475   -
    932850 prs               spr1002        985284        986243   -
    933035 ruvA              spr0165        174163        174756   +
    933236 -                 spr1506       1484402       1485253   -
    934765 rpoE              spr0437        436031        436633   +
    932942 -                 spr1081       1076480       1076752   -
    933168 spxA              spr0173        183232        183630   +
    932968 -                 spr1658       1632104       1632634   -
-          -                 -         -             -             -
    934612 -                 spr1393       1372875       1374275   -
    933908 -               spr1852       1827484       1828314 -
    933423 tRNA-Gly2       sprt23        1691770       1691841 -
-          -               -         -             -           -
    934538 glyS            spr1328       1314334       1316370 -
    932822 dapA            spr0919        906411        907346 +
-          -               -         -             -           -
    934621 metB            spr1377       1360403       1361497 -
    934622 aspB            spr1399       1377486       1378673 -
    933986 -               spr1868       1838616       1840433 -
-          -               -              649239        649444 +
-          -               -         -             -           -
    932894 pspA            spr0121        128356        130215 +
    933828 -               spr1624       1599538       1599708 +
    933716 transposase_A   spr0014         20207         20554 +
-          -               -         -             -           -
    932924 -               spr0618       627980         628684 +
-          -               -         -             -           -
    934851 arcC            spr1958       1943950       1944897 +
    933710 pmrA            spr0875        866211        867410 +
    933321 -               spr1150       1151363       1152850 +
-          -               -         -             -           -
    934847 IS1381          spr1947       1928807       1929196 +
    932826 -               spr1134       1137389       1137658 -
    934162 mreA            spr1017        995722        996639 +
    934248 -               spr0709        709324        709611 -
    932902 -               spr0158        166821        167279 -
    934817 gnd             spr0335        339733        341157 +
    934506 ABC-N/P         spr1289       1283480       1285240 +
-          -               -             1160831       1161040 +
    933400 -               spr0008          8582          8950 +
    934389 proB            spr0832        832944        834074 +
-          -               -             2038404       2038615 +
    933782 secA            spr1544       1526391       1528904 -
    934525 -               spr1313       1303163       1303399 -
    934835 -               spr0366        365451        365762 +
    933901 sga             spr1845       1821802       1822665 -
    933244 uvrB            spr1118       1116467       1118455 -
    934178 ctpA            spr0641        646986        649238 +
    933930 tig             spr0362        359944        361227 +
    933716 transposase_A   spr0014         20207         20554 +
-          -               -         -             -           -
    933513 metF            spr0515        514259        515125 +
    934065 -               spr1423       1408524       1409501 -
-          -               -              284216        284436 +
    933415 -               spr0941        925803        925964 +
    933789 adk             spr0210        207070        207708 +
-          -               -              515126        515695 +
    933487 pspC            spr1995       1987544       1989649 -
    933295 -               spr1535       1513477       1513929 -
    932808 thiE            spr0630        638397        639026 +
-          -               -             1992587       1992798 +
    933739 rpmG            spr0876        867410        867559 +
    933871 PTS-EII           spr1847       1823351       1823836 -
    934091 -                 spr2014       2007310       2007945 +
-          -                 -         -             -           -
    934090 glpD-truncation   spr1989       1980346       1980843 -
-          -                 -             1029753       1029960 +
-          -                 -              484706        484928 +
    932938 rgg               spr1933       1914475       1915326 -
-          -                 -             1713046       1713446 +
    934464 -                 spr1248       1247689       1248441 -
-          -                 -         -             -           -
-          -                 -               41501         41731 +
    933380 -                 spr0542        542892        543551 +
    933855 cmk               spr1456       1438296       1438967 -
    933255 trpA              spr1631       1604542       1605318 -
-          -                 -         -             -           -
-          -                 -             1598328       1598953 +
    934474 -                 spr1265       1261428       1262165 -
    934298 parE              spr0756        749887        751830 +
    932889 -                 spr0108        116230        117582 +
    933459 fmt               spr1580       1560141       1561076 -
-          -                 -         -             -           -
-          -                 -              530334        530653 +
    934569 glnH              spr1353       1336103       1336939 -
    933081 phnA              spr1455       1437827       1438165 -
    934856 hslO              spr1993       1985475       1986347 +
    934257 transposase_C     spr0717        720316        720720 +
    933479 tRNA-Ser3         sprt17        1691239       1691328 -
    934894 -                 spr0141        150653        150886 +
    934258 ezrA              spr0716        717819        719573 +
-          -                 -         -             -           -
    933795 ptcA              spr1836       1810463       1810789 +
    934302 tRNA-Tyr1         sprt04         759414        759494 +
    934529 -                 spr1316       1305166       1305522 -
    933716 transposase_A     spr0014         20207         20554 +
-          -                 -              972850        973507 +
-          -                 -              458713        459084 +
-          -                 -         -             -           -
    933923 rplN              spr0199        200848        201216 +
    933185 lacA              spr1076       1074234       1074659 -
-          -                 -               21852         22161 +
    934823 mvaK2             spr0340        344894        345901 +
-          -                 -         -             -           -
    934512 -                 spr1294       1290375       1290836 -
-          -                 -         -             -           -
    932880 -                 spr0114       122441         123433 +
-          -                 -         -             -           -
    934830 -                 spr0458        466391        466801 -
    934385 -                 spr0838        838148        839017 +
    934068 lemA              spr1163       1165547       1166107 -
    933253 -                 spr1142       1143961       1145004 -
-          -                 -         -             -           -
-          -                 -             1015888       1016261 +
-          -                -             499247         499461 +
    933068 -                spr0956       938505         938834 +
-          -                -         -             -           -
    933188 purD             spr0052         55644         56906 +
    934750 -                spr0309        309030        310514 -
    933133 ABC-NBD          spr1559       1539214       1539936 +
    934659 -                spr0270        271725        272096 -
    934373 -                spr0826        827822        828493 +
    933189 pyrB             spr1155       1159367       1160290 -
-          -                -         -             -           -
    933954 IS1167-truncationspr1701       1671111       1671893 +
    934618 -                spr1401       1379194       1379388 +
    934176 thiD             spr0638        645051        645842 -
    933285 rr09             spr0578        588303        589058 +
-          -                -         -             -           -
    934897 -                spr0155        163827        164408 +
    934788 alkD-truncation spr0347         349807        350079 +
    933354 comA             spr0043         41902         44055 +
    933397 -                spr1594       1571823       1572929 -
-          -                -         -             -           -
    934228 -                spr0680        685395        685616 -
    934902 ABC-SBP          spr0146        154470        155300 +
    934672 fabG             spr0381        380372        381103 +
-          -                -             1068444       1068651 +
    934653 lysC             spr0374        374072        375436 -
    933568 gapA             spr1825       1799954       1801033 -
    933973 rpsM             spr0213        208202        208567 +
    933333 -                spr1443       1428392       1429735 +
-          -                -              146382        147163 +
-          -                -         -             -           -
    933470 -                spr0027         27706         28365 +
    934469 pstS             spr1257       1255628       1256506 -
    934819 -                spr0342        346973        347671 +
    933490 transposase_G spr2016          2009347       2009616 -
    933469 purE             spr0053         57276         57797 +
-          -                -         -             -           -
    933472 recG             spr1539       1520712       1522727 -
    933132 ribC             spr0163        172039        172674 -
    933726 gsp-781          spr2021       2012843       2014021 -
    934649 mip              spr0370        370629        371177 +
    934866 recF             spr2032       2022400       2023497 +
    934458 potB             spr1245       1244624       1245451 -
    933535 -                spr0500        498905        499246 +
    932837 -                spr0628        636656        637324 +
    933360 rplK             spr0555        554749        555174 +
    934507 -                spr1296       1291130       1291498 -
-          -                -         -             -           -
    932853 prsA             spr0028         28583         29602 +
    933920 msmF             spr1711       1683638       1684528 -
-          -                -              264378        264593 +
    934829 rr03             spr0344        348677        349309 +
    934265 glnQ             spr0728        727536        728270 +
    934509 transposase_E spr1298          1291786       1292136 -
    934861 -                spr2003       1996700       1997707 -
-          -                -         -             -           -
-          -                -              400958        401194 +
-          -                -             1571609       1571822 +
-          -                -             1690577       1690782 +
    933551 -                spr0484        486366        486548 +
-          -                -              465862        466093 +
    933554 rbfA             spr0482        484929        485306 +
    934393 ald-truncation   spr0852        848041        848316 -
-          -                -         -             -           -
    933501 tRNA-Arg2        sprt09        1173377       1173448 -
    933629 asnA             spr1785       1758618       1759616 -
    934115 rpmA             spr1014        994500        994769 +
    933179 -                spr0031         30700         31053 -
    934025 ribA             spr0162        170814        172019 -
    932817 lysS             spr0626        632850        634340 +
    933503 -                spr1086       1082099       1082914 -
    932945 -                spr1115       1114899       1115366 -
    934273 -                spr0730        729423        730295 +
    933718 ABC-MSP          spr2004       1997745       1998506 -
    933143 rplQ             spr0216        209958        210344 +
    933531 -                spr0499        497816        498883 +
    934445 aroE             spr1234       1231433       1232287 -
    932858 -                spr0090         96794         97960 -
    933791 -                spr1093       1087705       1090890 -
    934840 hisS             spr1931       1911671       1912960 -
    933926 -                spr1855       1830044       1830997 -
    933049 murF             spr1514       1490933       1492306 -
    932824 ABC-MSP          spr0082         88750         89673 +
    933136 purL             spr0046         46493         50221 +
    933370 purC             spr0045         45545         46294 +
-          -                -              160878        161829 +
-          -                -         -             -           -
    934532 pdx1             spr1322       1308368       1309261 -
-          -                -         -             -           -
    933079 -                spr1545       1529050       1529250 -
-          -                -             2026204       2026408 +
-          -                -             1717358       1717791 +
    932994 -                spr1026       1007886       1008047 +
-          -                -         -             -           -
    934088 -                spr1992       1983883       1985310 -
    933944 IS1167-truncationspr1716       1690139       1690576 +
    933069 pcpA             spr1945       1925783       1927855 -
    934705 hysA             spr0286        285103        288339 +
    933580 IS1167-truncationspr1676       1648355       1648873 +
-          -                -         -             -           -
    934477 -                spr1267       1263384       1263773 -
    934517 IS1381-truncationspr1299       1292117       1292356 -
                            spr1380
    934594 ABC-MSP-truncation             1362403       1363026 -
    933918 -                spr1452       1435671       1435832 +
    934073 acoC             spr1049       1044023       1045150 -
-          -                -         -             -             -
    934382 tmk              spr0835        836263        836901   +
-          -                -             1195308       1195741   +
    934287 IS861-truncation spr0754        748579        749067   +
    932988 -                spr0182        189502        191058   +
    933961 -                spr1858       1831789       1832202   -
-          -                -             1844120       1844325   +
-          -                -         -             -             -
-          -                -         -             -             -
    934315 dacA             spr0776        770508        771749   -
    932847 PTS-EII          spr0063         69847         70251   +
    932940 -                spr0955        938136        938495   +
    934886 glnQ             spr0622        630285        631043   -
    933514 -                spr0520        520970        521356   +
    934619 -                spr1402       1379398       1380027   +
    932943 xerD             spr1692       1662245       1662985   -
-          -                -         -             -             -
-          -                -             1335825       1336102   +
    932998 murD             spr0603        615371        616723   +
    933977 cglC             spr1862       1833266       1833592   -
-          -                -              889537        889897   +
    933422 recJ             spr0537        535289        537523   +
    933444 nadD             spr1592       1570616       1571245   -
-          -                -         -             -             -
    934687 PTS-EII          spr0282        279696        281042   +
    933627 purR             spr1793       1764829       1765656   -
    934481 -                spr1261       1259148       1259426   -
    933822 rpoA             spr0215        209011        209946   +
    934853 malR             spr1922       1904668       1905654   +
-          -                -         -             -             -
    934654 -                spr0263        264716        265528   -
    933205 dfp-C-terminus spr1110         1111752       1112456   +
    933453 cobQ             spr1444       1429735       1430517   +
    933955 rplU             spr1012        993785        994099   +
    934229 ABC-NBD          spr0694        694381        695082   +
    934227 -                spr0688        689648        689986   +
    934689 rpmB             spr0398        394776        394964   +
-          -                -         -             -             -
-          -                -             1489322       1489539   +
    934706 -                spr0289        291154        291795   -
    933158 recX             spr1718       1698873       1699733   +
    933443 radA             spr0025         25849         27111   +
    933480 vncS             spr0529        527983        529311   +
    934319 fruR             spr0778        774386        775126   +
    934776 -                spr0440        441113        446092   +
-          -                -         -             -             -
    933722 comFA            spr2013       2005956       2007254   -
-          -                -         -             -             -
-          -                -         -             -             -
    934416 -                spr1205       1202025       1204661   -
    933742 tRNA-Met2        sprt18        1691339       1691412   -
    933002 murG             spr0604        616727        617785   +
    933044 thdF           spr0920           907393        908832   -
-          -              -                 324910        325110   +
    934486 lgt            spr1269          1264173       1264973   -
    933968 transposase_B spr0899            887083        887223   +
-          -              -            -             -             -
    934487 hemN           spr1266          1262170       1263300   -
-          -              -            -             -             -
-          -              -                523398        523649    +
-          -              -            -             -             -
    933599 -              spr1810          1780109       1780624   +
    933709 transposase_H spr1985           1977112       1977393   -
    933940 rplO           spr0208           205156        205596   +
-          -              -                1332870       1333088   +
    934214 -              spr0675           680803        681333   +
    934803 -              spr0452           459320        459829   +
    933715 hk06           spr1997          1990338       1991669   -
    933433 ABC-MSP        spr1525          1501259       1502098   -
    933471 -              spr1056          1051604       1052251   -
    933004 -              spr1932          1913038       1914285   -
    933999 -              spr1879          1849358       1850635   -
    933072 -              spr1094          1090902       1092176   -
    933972 folC           spr0178           185813        187069   +
    934119 ctpC           spr1911          1889977       1892049   -
    932834 -              spr0080            87044         87313   +
    934450 -              spr1230          1227709       1228047   -
    933318 pepF           spr1606          1581428       1583224   -
    933105 -              spr1490          1466101       1466781   +
    933751 psaC           spr1493          1469806       1470654   +
    934345 -              spr0806           808280        808648   +
    933457 -              spr0055            58885         59112   +
-          -              -                 773270        773606   +
    933191 -              spr1158          1161670       1162212   -
    934601 -              spr1388          1369817       1370329   -
-          -              -                1719978       1720384   +
    933018 -              spr1926          1909228       1909869   -
    933549 -              spr0485           486986        487231   +
-          -              -                  22405         22634   +
    934217 -              spr0684           687578        688018   +
-          -              -            -             -             -
                          spr0759
    934304 ABC-SBP-internal-deletion        755929        756633   +
    934713 gno            spr0290           291814        292629   -
    933837 -              spr1501          1479757       1479897   -
    933985 cglD           spr1861          1832869       1833351   -
    933326 -              spr1131          1136240       1136410   -
    934697 gatB           spr0393           388939        390381   -
-          -              -            -             -             -
-          -              -                1431726       1432047   +
-          -              -                1271165       1271410   +
    934352 -              spr0807           808645        809649   +
    933546 -              spr0489           489732        490181   +
    933618 trpB           spr1632          1605311       1606534   -
    933601 rpmH           spr1807          1778068       1778202   -
    934844 -                spr1939       1921085       1921369   -
    933377 cpoA             spr0981        966767        967891   +
    933342 ABC-MSP          spr0936        922261        923268   +
-          -                -              122143        122440   +
    933463 -                spr1558       1538871       1539236   +
    934097 -                spr2011       2004669       2005217   -
    934709 glnQ             spr0408        403910        404650   -
    933949 -                spr1174       1174650       1174916   -
    933522 IS1239-truncationspr0511        510846        511148   +
    934504 ABC-N/P          spr1290       1285200       1286945   +
-          -                -         -             -             -
    933398 rpsH             spr0203        202737        203135   +
-          -                -              960322        960703   +
    934674 fabZ             spr0384        382845        383267   +
    934596 snf              spr1375       1356038       1359136   -
-          -                -              941642        941892   +
    933241 -                spr1440       1423788       1425362   -
    933026 marR             spr1480       1458673       1459323   +
    933690 -                spr1649       1621532       1622173   -
-          -                -         -             -             -
-          -                -             675905        676118    +
-          -                -         -             -             -
    934685 gatC             spr0395        391847        392149   -
    933261 -                spr1961       1948375       1948665   -
-          -                -              120280        121083   +
    934433 -                spr1221       1218032       1219066   -
    934899 -                spr0156        164354        164956   +
-          -                -             1743161       1743786   +
-          -                -             1461108       1462111   +
-          -                -         -             -             -
    933210 -                spr0590        604493        605116   +
    932901 -                spr0126        136317        136550   -
    934392 -                spr0851        847414        847641   +
    934185 -                spr0650        656822        657277   -
    934591 patB             spr1376       1359229       1360395   -
    934849 PTS-EII          spr1969       1960527       1960997   -
    933063 -                spr1629       1602343       1603494   -
-          -                -             1925304       1925782   +
-          -                -              312761        313114   +
    932813 rr08             spr0076         83838         84536   +
-          -                -         -             -             -
    933761 -                spr1011        992899        993603   +
    932894 pspA             spr0121        128356        130215   +
    934801 pcpC             spr0351        351393        352277   +
    933128 -                spr1575       1554780       1555229   -
    933668 IS1167-truncationspr0017         21106         21312   -
-          -                -         -             -             -
    933780 bltD             spr0923        909797        910276   +
    933293 guaC             spr1128       1131681       1132667   -
    934344 -                spr0802        805060        805371   +
    934340 -                spr0798        802865        803119   -
    934196 upp              spr0655        660612        661262   +
    934808   -                 spr0331        335681        336208   +
    934121   -                 spr1928       1910618       1910818   -
    932816   rpsD              spr0078         85780         86391   +
    934613   rpsF              spr1396       1375323       1375613   -
-            -                 -         -             -             -
-            -                 -             1632901       1633220   +
-            -                 -              761603        761882   +
    933307   -                 spr1600       1577455       1577880   +
    933308   -                 spr1614       1588150       1588329   -
-            -                 -             1086486       1086725   +
    933391   -                 spr0900        887384        887584   +
    932900   trmU              spr0122        130562        131737   +
    933517   cysE              spr0517        518039        518656   +
-            -                 -             1723154       1723400   +
-            -                 -         -             -             -
    933292   scrR              spr1569       1550199       1551164   +
    934313   IS1167            spr0767        761883        762401   -
    934104   glgD              spr1031       1013318       1014457   +
-            -                 -         -             -             -
    934194   clpP              spr0656        661436        662026   +
    934855   glpD-truncation   spr1990       1980789       1982174   -
    934128   tyrS              spr1910       1888643       1889899   +
-            -                 -         -             -             -
    933620   pilD              spr1628       1601632       1602291   +
    932791   rplE              spr0201        201623        202165   +
    933163   lytC              spr1431       1414511       1416016   -
    933921   -                 spr0904        888961        889536   +
    933872   tRNA-Ile1         sprt13        1690877       1690950   -
    933328   pppL              spr1578       1558080       1558820   -
    933283   IS1381            spr0994        978562        978951   +
-            -                 -         -             -             -
-            -                 -         -             -             -
    933305   bgaA              spr0565       572123        578809    +
-            -                 -         -             -             -
-            -                 -         -             -             -
    933541   -                 spr0494        495460        496263   +
    934204   prfB              spr0665        668470        669459   +
    933942   rsuA              spr0256        258090        258812   +
    932974   malX              spr1918       1900087       1901358   +
    933659   cylM              spr1767       1732567       1735557   +
-            -                 -             1644378       1644620   +
    933957   rpmJ              spr0212        208068        208184   +
    934741   lacG              spr0424        422191        423603   +
-            -                 -               39745         40223   +
-            -                 -         -             -             -
    933213   -                 spr0911        899873        900088   -
    933784   mutR              spr0960        940787        941641   -
    934681   accC              spr0385        383279        384646   +
    934394   -                 spr0847        844547        845440   +
    933628   lysA              spr1792       1763512       1764762   -
    934266   folD              spr0729        728361        729281   +
    934024   -                 spr1680       1652006       1652449   -
-            -                 -         -             -           -
-            -                 -             751831         752240 +
    934679   bglB-truncation   spr0274       273803         273895 +
    933927   purN              spr0049        52812          53357 +
-            -                 -         -             -           -
    933556   pncP              spr0474        477306        477917 +
    934523   def               spr1310       1300763       1301374 +
    932905   -                 spr0129        137885        138568 +
    934425   -                 spr1209       1206709       1206963 -
-            -                 -         -             -           -
    934415   ABC-NDB           spr1202       1197693       1198451 -
    932801   trkH              spr0070         76686         78065 +
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -             118109         118610 +
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
    933107   hk01              spr1473       1453871       1454845 -
    933067   -                 spr1043       1036311       1037162 +
-            -                 -              802063        802864 +
    934167   -                 spr0999        983584        983835 -
    932792   -                 spr0067         74079         74336 +
    933727   ABC-MSP           spr2024       2015486       2016280 -
    932870   rpsS              spr0192        198601        198882 +
    933355   carB              spr1153       1154749       1157925 -
    933294   -                 spr0576        586337        586930 +
-            -                 -             1414287       1414510 +
    934399   -                 spr0860        853830        855011 +
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
    933752   -                 spr1547       1530004       1530681 -
    932904   rimI              spr0130        138565        139002 +
    933075   -                 spr1954       1939038       1940789 -
    934275   -                 spr0735        734318        735061 +
    932985   dnaA              spr0001             1          1362 +
    933821   czcD              spr1672       1644621       1645520 -
    934142   gdhA              spr1181       1179472       1180818 +
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-            -                 -         -             -           -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
    933129   rpsC   spr0195        199251        199904   +
    934640   spi    spr0364        363875        364489   -
    934765   rpoE   spr0437        436031        436633   +
    933288   zwf    spr1122       1122712       1124199   +
    934142   gdhA   spr1181       1179472       1180818   +
    934445   aroE   spr1234       1231433       1232287   -
    933826   ftsZ   spr1510       1486672       1487931   -
    933362   ddl    spr1515       1492390       1493433   -
    933382   glk    spr1519       1497340       1498224   -
    934026   xpt    spr1662       1635320       1635901   +
    934669   accD   spr0386        384683        385549   +
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
    934295   parC   spr0757       752241        754721    +
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
    934411   rplT   spr0863       856133        856492    +
-            -      -         -             -             -
-            -      -         -             -             -
-            -      -         -             -             -
    933268   galE   spr1647       1619051       1620031   -
-            -      -         -             -             -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
-   -   -   -   -   -
                                                                            T
R6.entrez_pidR6.description TIGR4.sequence_id TIGR4.genome_idIGR4.entrez_gene_id          TIGR4.gene_symbol
-            -                    -                       -                 -             -
-            -                                            NC_003028.1
                                  ref|NC_003028.1|:444857-445696                  930404 -
15903102     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c1107833-1107459               931687 -
-            -                                            NC_003028.1
                                  ref|NC_003028.1|:642282-642899                  930615 -
15904005                          r                       NC_003028.1
             L-fucose isomeraseef|NC_003028.1|:c2074053-2072287                   930204 -
15902066     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:24319-24786                    929767 -
-            -                                            NC_003028.1
                                  ref|NC_003028.1|:110794-111081                  929886 -
-                                 gb|AE005672|:1204413-1204747
             Intergenic Region (Length: 335)              AE005672          -             -
15902321     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:278325-278564                  930117 -
15902696     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c704820-703975                 930692 -
15903561     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:1575248-1576099                931163 -
-            -                                            NC_003028.1
                                  ref|NC_003028.1|:1071948-1073138                931659 -
-                                 gb|AE005672|:1350937-1351177
             Intergenic Region (Length: 526)              AE005672          -             -
-                                 -
             Intergenic Region (Length: 297)              -                 -             -
15903398                          ref|NC_003028.1|:c1410599-1409958
                                                          NC_003028.1
             ABC transporter membrane-spanning permease - glutamine transport     931331 -
15902493                          ref|NC_003028.1|:c491782-490319
                                                          NC_003028.1
             EcoE type I restriction modification enzyme M subunit                930447 -
15902431                          ref|NC_003028.1|:404129-404896
             acetyl-CoA carboxylase alpha subunit         NC_003028.1             930363 -
-                                 ref|NC_003028.1|:764777-764872, ref|NC_003028.1|:c1232260-1232165, ref|NC_003028.1|:c
             Intergenic Region (Length: 388)              NC_003028.1             930759 -
15903220                          ref|NC_003028.1|:1230995-1231237
             50S ribosomal protein L31                    NC_003028.1             931814 -
15903463     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c1471123-1470950               931279 -
15902848     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c858123-857308                 930857 -
-            -                                            NC_003028.1
                                  ref|NC_003028.1|:1101327-1101437                931679 -
15902678                          ref|NC_003028.1|:687607-688299
                                                          NC_003028.1
             Transcriptional regulator of extracellular enzyme genes              930672 -
15904046     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c2121199-2120909               930493 -
15903964     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c2027545-2026604               930234 -
15902684     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:692029-692400                  930678 -
15904018                          ref|NC_003028.1|:c2089830-2089126
                                                          NC_003028.1
             ABC transporter ATP-binding domain - Zinc (Zn2+) permease            930195 -
15903993     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c2057409-2056129               931941 -
-                                 gb|AE005672|:1892594-1892858
             Intergenic Region (Length: 256)              AE005672          -             -
15903711                          ref|NC_003028.1|:1761886-1762893
                                                          NC_003028.1              DNA; regulator of gal operon
             GalR, member of GalR-LacI family of transcriptional regulators, binds930980 -
15903281                          ref|NC_003028.1|:c1304599-1303850
                                                          NC_003028.1
             ABC transporter ATP-binding protein - unknown substrate              931454 -
15903962     MalA protein                                 NC_003028.1
                                  ref|NC_003028.1|:2024516-2025316                931971 -
15903375     hypothetical protein                         NC_003028.1
                                  ref|NC_003028.1|:c1391982-1391140               931354 -
15903328                          ref|NC_003028.1|:1349192-1349749
                                                          NC_003028.1
             Type II restriction endonuclease, uncharacterized, truncation        931403 -
15902456                          ref|NC_003028.1|:c429651-428527
             Degenerate transposase                       NC_003028.1             930394 -
-            -                                            NC_003028.1
                                  ref|NC_003028.1|:c1519731-1519405               931223 -
15903138                          ref|NC_003028.1|:c1145455-1144271
             O-acetylhomoserine sulfhydrylase, truncation NC_003028.1             931728 -
15902525                          ref|NC_003028.1|:523123-525999
             translation initiation factor IF-2           NC_003028.1             930499 infB
15903019                          ref|NC_003028.1|:1005603-1006637
                                                          - unknown substrate
             ABC transporter substrate-binding protein NC_003028.1                931583 -
15902268                          ref|NC_003028.1|:c214506-213490
                                                          - iron transport,
             ABC transporter substrate-binding protein NC_003028.1 truncation 930044 -
-            tracking oligo       -                       -                 -             -
15903036                          ref|NC_003028.1|:1020328-1021188
             methionine aminopeptidase                    NC_003028.1             931598 -
15903392                       ref|NC_003028.1|:c1405236-1404937
           Degenerate transposase                     NC_003028.1           931344 -
15902360   The type 2 capsule- locus of Streptococcus- pneumoniae       -          -
15902914                       ref|NC_003028.1|:915324-915719
           Diacylglycerol kinase                      NC_003028.1           931321 -
15902746   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:747420-747920               930744 -
15903022   DNA primase                                NC_003028.1
                               ref|NC_003028.1|:1008417-1010177             931586 -
-                              gb|AE005672|:117871-118422
           Intergenic Region (Length: 553)            AE005672          -          -
15903099                       ref|NC_003028.1|:c1105488-1104835
           uracil-DNA glycosylase                     NC_003028.1           931683 -
15902128   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:96870-97856                 929869 -
15903912                       ref|NC_003028.1|:c1962404-1961760
           Pyrrolidone carboxyl peptidase, truncation NC_003028.1           931978 -
15904006   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c2077252-2074136            931935 -
15902631   hypothetical protein-                      -                 -          -
15902669                       ref|NC_003028.1|:676333-676479
           lactate oxidase, truncation                NC_003028.1           930662 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c387551-387450              930343 -
15903764                                              NC_003028.1
           chaperonin GroEL ref|NC_003028.1|:c1821979-1820357               931987 groEL
15903465   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1473078-1472167            931276 -
15903508   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1525792-1526541             931482 -
15902370   hypothetical protein-                      -                 -          -
-                              gb|AE005672|:1000604-1000816
           Intergenic Region (Length: 901)            AE005672          -          -
-                              gb|AE005672|:511437-511717
           Intergenic Region (Length: 283)            AE005672          -          -
15902608                       ref|NC_003028.1|:613571-615046
                                                        EII component
           Phosphotransferase system sugar-specificNC_003028.1              930596 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:1065434-1065787             931645 -
15903154                       ref|NC_003028.1|:1164316-1164867
                                                      NC_003028.1
           phosphopantothenoylcysteine synthase/decarboxylase               931745 -
15902474                       ref|NC_003028.1|:463904-465586
                                                      NC_003028.1
           ABC transporter ATP-binding protein - cobalt transport           930421 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1027029-1026937            931605 -
15902572                       ref|NC_003028.1|:569481-570137
           VncR, response regulator                   NC_003028.1           930551 -
15902216                                              NC_003028.1
           Aminopeptidase P ref|NC_003028.1|:179701-180762                  929981 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:997547-998464               931576 -
-                              gb|AE005672|:120658-121057
           Intergenic Region (Length: 346)            AE005672          -          -
15903514   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1530104-1530493             931199 -
-                              gb|AE005672|:1448297-1448590
           Intergenic Region (Length: 294)            AE005672          -          -
15902977   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:972792-973010               931544 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1720823-1720584            931030 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:775754-776575               930776 -
-                              gb|AE005672|:1853888-1854236
           Intergenic Region (Length: 349)            AE005672          -          -
15903143                       ref|NC_003028.1|:1150049-1151035
           L-lactate dehydrogenase                    NC_003028.1           931734 -
15903355                       ref|NC_003028.1|:c1375227-1374316
           Thioredoxin reductase                      NC_003028.1           931372 -
15903393                       ref|NC_003028.1|:c1405781-1405456
           Degenerative transposase                   NC_003028.1           931343 -
15903042                       ref|NC_003028.1|:c1026921-1026280
           redox-sensing transcriptional repressor RexNC_003028.1           931604 -
15903006   hypothetical protein-                      -                 -          -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1064391-1063228            931643 -
15903525   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1539737-1540258             931197 -
15902233                       ref|NC_003028.1|:194217-194840
           50S ribosomal protein L4                   NC_003028.1           930009 -
15903156   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1165642-1166223             931747 -
15902778                       ref|NC_003028.1|:780195-781004
           purine nucleoside phosphorylase            NC_003028.1           930781 -
15902138                       ref|NC_003028.1|:c108482-107610
           L-serine dehydratase alpha subunit         NC_003028.1           929882 -
-                              gb|AE005672|:1874533-1874843
           Intergenic Region (Length: 311)            AE005672          -          -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1093828-1093715            931672 -
15902781                       ref|NC_003028.1|:782485-782997
           Conserved hypothetical protein, truncationNC_003028.1            930784 -
15903324                       ref|NC_003028.1|:c1345647-1344913
                                                      NC_003028.1
           ABC transporter ATP-binding protein - multidrug efflux           931388 -
15902416                       ref|NC_003028.1|:c392068-390794
           seryl-tRNA synthetase                      NC_003028.1           930347 -
15903295                       ref|NC_003028.1|:c1319667-1319014
                                                      NC_003028.1
           Phosphate transport system regulatory protein                    931442 -
15903773   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1826784-1826335            929971 -
15903515                       ref|NC_003028.1|:1530551-1532494
           threonyl-tRNA synthetase                   NC_003028.1              931203 -
15903479   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1484629-1483871               931261 -
-          -                   -                      -                -               -
15903407                       ref|NC_003028.1|:c1421406-1420912
           ATP synthase subunit B                     NC_003028.1              931330 -
15903923                       ref|NC_003028.1|:c1979555-1978206
           glucose-6-phosphate isomerase              NC_003028.1              930266 -
15903493                       ref|NC_003028.1|:c1502441-1501668
           phosphomethylpyrimidine kinase             NC_003028.1              931240 -
-                              ref|NC_003028.1|:564985-565131
           Intergenic Region (Length: 288)            NC_003028.1              930542 -
15903065                       ref|NC_003028.1|:1042797-1044698
                                                      NC_003028.1
           ABC transporter ATP-binding protein - unknown substrate             931628 -
15903111                       ref|NC_003028.1|:1119824-1120585
           Lactose phosphotransferase system repressorNC_003028.1              931696 -
15902987   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:981122-981733                  931555 -
-                              gb|AE005672|:272909-273170
           Intergenic Region (Length: 245)            AE005672         -               -
-                              gb|AE005672|:2132895-2133139
           Intergenic Region (Length: 245)            AE005672         -               -
-          -                                          AE005672
                               gb|AE005672|:470341-470729              -               -
-                              gb|AE005672|:310114-310721
           Intergenic Region (Length: 231)            AE005672         -               -
15902224   Cardiolipin synthase                       NC_003028.1
                               ref|NC_003028.1|:185328-186752                  929994 -
15902610   hypothetical protein-                      -                -               -
15902264                       ref|NC_003028.1|:c212396-210751
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - iron transport         930041 -
15903748                       ref|NC_003028.1|:c1795530-1794034
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - oligopeptide transport 930941 -
-                              gb|AE005672|:781005-781467
           Intergenic Region (Length: 463)            AE005672         -               -
-          tracking oligo      -                      -                -               -
15902663                       ref|NC_003028.1|:672426-673073
                                                      NC_003028.1
           ABC transporter ATP-binding protein - unknown substrate             930657 -
15903784   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1834817-1834341               930085 -
15903104                       ref|NC_003028.1|:c1110714-1108255
           Histidine Motif-Containing protein         NC_003028.1              931688 -
15902792                       ref|NC_003028.1|:792614-794149
                                                      NC_003028.1
           ABC transporter ATP-binding protein - ribose/galactose transport    930796 -
15902579                       ref|NC_003028.1|:c577174-576416
                                                      NC_003028.1
           ABC transporter ATP-binding protein - glutamine, truncation         930559 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1242327-1240552               931832 -
15903219   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1229964-1230899                931813 -
15902839                       ref|NC_003028.1|:847059-850187
           DNA polymerase III subunit alpha           NC_003028.1              930848 -
15902513                       ref|NC_003028.1|:c511436-509279
           Conserved hypothetical protein, truncationNC_003028.1               930470 -
15903947                       ref|NC_003028.1|:c2004724-2003594
                                                       amino acid amidohydrolase; can be a peptidase too
           Similar to several hippurate hydrolase and NC_003028.1              930247 -
-                              gb|AE005672|:664310-664651
           Intergenic Region (Length: 342)            AE005672         -               -
15902715                       ref|NC_003028.1|:721456-722646
           S-adenosylmethionine synthetase            NC_003028.1              930712 -
-                              gb|AE005672|:712630-712936
           Intergenic Region (Length: 413)            AE005672         -               -
15903944                       ref|NC_003028.1|:1999823-2000722
           UTP-glucose-1-phosphate uridylyltransferaseNC_003028.1              931965 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c2050415-2050206               931943 -
15903756                       ref|NC_003028.1|:1806740-1807600
                                                      NC_003028.1
           MSM (multiple sugar metabolism) operon regulatory protein           930934 -
-                              gb|AE005672|:1598693-1599452
           Intergenic Region (Length: 282)            AE005672         -               -
15903274                       ref|NC_003028.1|:c1296595-1295492
           prephenate dehydrogenase                   NC_003028.1              931462 -
15904004                       ref|NC_003028.1|:c2072141-2070990
           Probable alcohol dehydrogenase.            NC_003028.1              931936 -
15903898   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1950724-1950130               932012 -
-                              gb|AE005672|:981734-982045
           Intergenic Region (Length: 312)            AE005672         -               -
15902262   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:208375-209712                  930039 -
-                              gb|AE005672|:2069563-2069960
           Intergenic Region (Length: 429)            AE005672         -               -
-                              gb|AE005672|:140703-140987
           Intergenic Region (Length: 290)            AE005672         -               -
-          -                                          AE005672
                               gb|AE005672|:1207860-1208133            -               -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1242710-1242390               931833 -
15903966   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c2029868-2029638               930233 -
15902349                       ref|NC_003028.1|:309133-310113
                                                      NC_003028.1
           phospho-N-acetylmuramoyl-pentapeptide-transferase                   930154 -
15902282                       ref|NC_003028.1|:231599-232597
           Holliday junction DNA helicase RuvB        NC_003028.1              930063 -
-                              gb|AE005672|:2135039-2135261
           Intergenic Region (Length: 223)            AE005672         -               -
-                              gb|AE005672|:2020196-2020744
           Intergenic Region (Length: 549)            AE005672         -               -
15903035   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1019035-1020312                931597 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1075343-1075242              931664 -
-                              gb|AE005672|:224297-224750
           Intergenic Region (Length: 289)            AE005672          -            -
15902421                       ref|NC_003028.1|:395657-396631
           3-oxoacyl-(acyl carrier protein) synthase NC_003028.1              930353 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1609573-1609286              931129 -
15902184                       ref|NC_003028.1|:139839-140702
           Positive transcriptional regulator of mutA NC_003028.1             929928 -
-                              gb|AE005672|:476236-476436
           Intergenic Region (Length: 292)            AE005672          -            -
15903538                                              NC_003028.1
           thiol peroxidase ref|NC_003028.1|:1550486-1551004                  931172 tpx
15903425                       ref|NC_003028.1|:c1439489-1437531
                                                      - oligopeptide
           ABC transporter substrate-binding protein NC_003028.1 transport    931305 -
15902317                       ref|NC_003028.1|:275815-276153, ref|NC_003028.1|:c1074321-1073983
           Degenerate transposase                     NC_003028.1             930112 -
15903586                       ref|NC_003028.1|:c1606546-1605515
           3-deoxy-7-phosphoheptulonate synthase NC_003028.1                  931132 -
15903492   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1501690-1501229              931237 -
15903239                       -
           N-acetylmannosamine-6-phosphate 2-epimerase-                 -            -
15903272                       ref|NC_003028.1|:c1295051-1293768
                                                      NC_003028.1
           3-phosphoshikimate 1-carboxyvinyltransferase                       931459 -
15902604   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:602917-603162                 930589 -
15903810   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1854237-1854941               931919 -
15903469   GTP-binding protein                        NC_003028.1
                               ref|NC_003028.1|:c1475969-1475382              931264 -
15902483   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c476235-474604                930434 -
-          -                                          AE005672
                               gb|AE005672|:1930352-1930769             -            -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c200031-199909                930023 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1255317-1254616              931847 -
15903010   hypothetical protein-                      -                 -            -
15903148   VicX protein                               NC_003028.1
                               ref|NC_003028.1|:c1158108-1157299              931739 -
15904085   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c2158641-2158162              931872 -
-                              gb|AE005672|:978284-978966
           Intergenic Region (Length: 683)            AE005672          -            -
15903191   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1203700-1202678              931784 -
-          -                                          AE005672
                               gb|AE005672|:392069-392280               -            -
15904075                        synthetase            NC_003028.1
           tryptophanyl-tRNA ref|NC_003028.1|:c2148622-2147597                930554 -
15903475                       ref|NC_003028.1|:c1481362-1480604
           triosephosphate isomerase                  NC_003028.1             931262 tpiA
-          -                                          NC_003028.1
                               ref|NC_003028.1|:332874-333929                 930177 -
15902858   hypothetical protein-                      -                 -            -
15902156   hypothetical protein-                      -                 -            -
15902211   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:173006-173683                 929975 -
15902767                       ref|NC_003028.1|:20929-21267, ref|NC_003028.1|:275815-276153, ref|NC_003028.1|:938975
           Degenerate transposase                     NC_003028.1             929763 -
15902997   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:989314-990090                 931566 -
-                              gb|AE005672|:1767110-1767450
           Intergenic Region (Length: 399)            AE005672          -            -
15903594   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1612185-1611847              931125 -
15902310                       ref|NC_003028.1|:267570-268514
           Dihydropteroate synthase                   NC_003028.1             930100 -
15903414   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1427586-1427092              931320 -
15903340   hypothetical protein-                      -                 -            -
15904020                       ref|NC_003028.1|:c2091675-2090425
                                                      NC_003028.1             930194 -
           D-alanine transfer from undecaprenol-phosphate to the poly(glycerophosphate) chain
15903225   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1234619-1234449              931822 -
-                              gb|AE005672|:230621-231371
           Intergenic Region (Length: 1040)           AE005672          -            -
15904050                       ref|NC_003028.1|:c2125006-2124554
           50S ribosomal protein L9                   NC_003028.1             929818 -
15902575   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c574007-572805                930555 -
-                              gb|AE005672|:56003-56258
           Intergenic Region (Length: 369)            AE005672          -            -
15903570                       ref|NC_003028.1|:c1583490-1582162
                                                      - sugar transport
           ABC transporter substrate-binding protein NC_003028.1              931153 -
-          -                   -                      -                 -            -
15902954                       ref|NC_003028.1|:950335-951508
                                                      NC_003028.1
           Pneumococcal histidine triad protein E precursor, truncation       931518 -
-                              -
           Intergenic Region (Length: 575)            -                 -            -
15903943                       ref|NC_003028.1|:1998785-1999801
                                                        dehydrogenase
           NAD(P)H-dependent glycerol-3-phosphateNC_003028.1                  930250 gpsA
15902667                       ref|NC_003028.1|:c675479-674802
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - glutamine transport   930660 -
-          -                                          AE005672
                               gb|AE005672|:45209-45409                 -            -
15903770   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:c1824966-1824667                931950   -
15902265                       ref|NC_003028.1|:c212396-210751
                                                        NC_003028.1
           ABC transporter membrane-spanning permease - iron transport          930041   -
15903603   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:1617830-1619308                 931117   -
15902372   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:341382-346685                   930268   -
-                              gb|AE005672|:1211311-1211622
           Intergenic Region (Length: 312)              AE005672          -              -
-          -                                            AE005672
                               gb|AE005672|:1692553-1692952               -              -
15902875                       ref|NC_003028.1|:882185-884068
                                                        NC_003028.1             930883
           Teichoic acid phosphorylcholine esterase/choline binding protein E (cbpE)     -
15903745                       ref|NC_003028.1|:c1792021-1791095
                                                        NC_003028.1
           ABC transporter ATP-binding protein - oligopeptide transport         930945   -
15903363   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:1379248-1379895                 931374   -
15903783   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:c1834328-1833720                931877   -
15902726                       ref|NC_003028.1|:731796-732068
           30S ribosomal protein S16                    NC_003028.1             930725   -
15902702   hypothetical protein-                        -                 -              -
-                              -
           Intergenic Region (Length: 354)              -                 -              -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:837993-838406                   930842   -
15902975   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:969374-970348                   931541   -
15903905   Competence protein                           NC_003028.1
                               ref|NC_003028.1|:c1954571-1953630                930328   -
-          -                                            AE005672
                               gb|AE005672|:622143-622389                 -              -
15902838                       ref|NC_003028.1|:c846739-844466
           x-prolyl-dipeptidyl aminopeptidase           NC_003028.1             930847   -
15903054   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:c1035916-1035626                931616   -
15902315                       ref|NC_003028.1|:272051-272497
           50S ribosomal protein L13                    NC_003028.1             930106   -
-                              gb|AE005672|:449305-449695
           Intergenic Region (Length: 391)              AE005672          -              -
15903330                       ref|NC_003028.1|:1349746-1350936
           DNA modification methyltransferase           NC_003028.1             931411   -
-                              -
           Intergenic Region (Length: 376)              -                 -              -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:c1000603-1000382                931579   -
-                              gb|AE005672|:1527448-1528262
           Intergenic Region (Length: 733)              AE005672          -              -
15903540                       ref|NC_003028.1|:c1554511-1553810
                                                        NC_003028.1
           ABC transporter ATP-binding protein - unknown substrate              931184   -
15902204                       ref|NC_003028.1|:165751-167700
           DNA mismatch repair protein                  NC_003028.1             929965   -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:c1841597-1841484                930339   -
15904056                         O-acetylserine sulfhydrylase
                                                        NC_003028.1
           Cysteine synthase,ref|NC_003028.1|:2130637-2131557                   929865   -
15903502                       r                        NC_003028.1
           Glycosil transferaseef|NC_003028.1|:c1508417-1507455                 931483   -
15902335                       ref|NC_003028.1|:295247-295681
                                                          EII component
           Phosphotransferase system sugar-specificNC_003028.1                  930134   -
-          -                                            AE005672
                               gb|AE005672|:1515210-1515583               -              -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:c2036197-2036063                930225   -
-                              gb|AE005672|:1309460-1309721
           Intergenic Region (Length: 262)              AE005672          -              -
15902972                       ref|NC_003028.1|:966448-967704
           serine hydroxymethyltransferase              NC_003028.1             931538   -
15902214                       ref|NC_003028.1|:c176745-175801
           Magnesium and cobalt transporter             NC_003028.1             929979   -
15903994   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:2057581-2059665                 930213   -
15904019                       ref|NC_003028.1|:c2090270-2089830
                                                        NC_003028.1
           Transcriptional repressor for Zn(2+)-responsive expression           931929   -
15903680   hypothetical protein-                        -                 -              -
15902495   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:494591-494701                   930450   -
-                              gb|AE005672|:1360216-1360669
           Intergenic Region (Length: 581)              AE005672          -              -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:c1065314-1064466                931644   -
15903754                       ref|NC_003028.1|:c1804378-1803119
                                                        - multiple sugars
           ABC transporter substrate-binding protein NC_003028.1                930936   -
15902520                       ref|NC_003028.1|:520079-520714
           tRNA (guanine-N(7)-)-methyltransferase NC_003028.1                   930494   -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:c701398-701171                  930688   -
15902450                       ref|NC_003028.1|:421692-422942
           threonine dehydratase                        NC_003028.1             930388   -
15902288                       ref|NC_003028.1|:238197-239576
           6-phospho-beta-glucosidase                   NC_003028.1             930071   -
15904000   hypothetical protein                         NC_003028.1
                               ref|NC_003028.1|:2065763-2067274                 930207   -
15903778                       ref|NC_003028.1|:c1829682-1828861
                                                        NC_003028.1
           ABC transporter ATP-binding protein - unknown substrate, truncation930135     -
15902865                       ref|NC_003028.1|:874395-875522
           Carboxynorspermidine decarboxylase           NC_003028.1             930873   -
-          -                                            AE005672
                               gb|AE005672|:1389737-1390106               -              -
-          -                                            NC_003028.1
                               ref|NC_003028.1|:c1830278-1830183                931844   -
15902549                       ref|NC_003028.1|:544020-545858
                                                        EII component
           Phosphotransferase system sugar-specificNC_003028.1               930521 -
15903917   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1965527-1964907             930304 -
15903284   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1309459-1308962             931484 -
15902749   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:748742-749182                930746 -
15902939   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:935302-935793                931505 -
15903069                       ref|NC_003028.1|:1048985-1051264
           Thermostable pullulanase                   NC_003028.1            931632 -
15903413   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1427011-1425356             931319 -
15902251                       ref|NC_003028.1|:202319-202501
           50S ribosomal protein L30                  NC_003028.1            930028 -
15903229                       ref|NC_003028.1|:c1577934-1577017
                                                      NC_003028.1
           N-acetylneuraminate lyase subunit, truncation                     931161 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1666764-1665547             931070 -
-          16S ribosomal RNA                          NC_003028.1            929754 -
                               ref|NC_003028.1|:15394-16806, ref|NC_003028.1|:c1815007-1813595, ref|NC_003028.1|:c19
15902359   The type 2 capsule- locus of Streptococcus- pneumoniae     -             -
15903152                       ref|NC_003028.1|:c1163385-1161715
           Formate--tetrahydrofolate ligase           NC_003028.1            931743 -
15903998                       ref|NC_003028.1|:2063426-2064442
           ornithine carbamoyltransferase             NC_003028.1            930211 -
15903047   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1030345-1029776             931610 -
15902878                       ref|NC_003028.1|:886554-887351
           Pyrroline-5-carboxylate reductase          NC_003028.1            930886 -
15903985                       ref|NC_003028.1|:2046010-2046159
           50S ribosomal protein L33                  NC_003028.1            930218 -
-          tracking oligo      -                      -               -             -
15903669   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1721447-1721001             931029 -
15902984   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:978128-978283                931552 -
15902835                       ref|NC_003028.1|:836579-837700
                                                        subunit
           Type I restriction-modification enzyme 1, SNC_003028.1            930840 -
15902762   Transposase         -                      -               -             -
15903451   peptide deformylase                        NC_003028.1
                               ref|NC_003028.1|:c1457380-1456970             931290 -
15903205                        HtpX                  NC_003028.1
           heat shock protein ref|NC_003028.1|:c1218825-1217926              931797 -
15902771                       ref|NC_003028.1|:773157-773846
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - glutamine transport  930773 -
15902441   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:414268-414752                930377 -
15903537                       ref|NC_003028.1|:1549461-1550390
                                                      - manganese
           ABC transporter substrate-binding protein NC_003028.1transport. 931186 -
15903453                       ref|NC_003028.1|:c1461044-1458300
           P-type ATPase - calcium transporter        NC_003028.1            931288 -
-          -                                          AE005672
                               gb|AE005672|:97857-98130               -             -
15902849   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c859025-858120               930858 -
-                              ref|NC_003028.1|:800278-800385
           Intergenic Region (Length: 410)            NC_003028.1            930803 -
-                              gb|AE005672|:1543969-1544926
           Intergenic Region (Length: 221)            AE005672        -             -
15903112                       ref|NC_003028.1|:c1122572-1121166
           Phospho-beta-D-galactosidase               NC_003028.1            931698 -
15903155   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1164851-1165414              931746 -
-          -                                          AE005672
                               gb|AE005672|:69362-69659               -             -
15903253   hypothetical protein-                      -               -             -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c528028-527795               930504 -
15903147   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1157268-1156966             931738 -
-          -                   -                      -               -             -
15903067                       ref|NC_003028.1|:1045644-1046822
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - macrolide efflux 931630 -
15903610                       ref|NC_003028.1|:1627357-1628811
           Sucrose-6-phosphate hydrolase              NC_003028.1            931108 -
-          -                                          AE005672
                               gb|AE005672|:2070786-2070989           -             -
15902420   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:395223-395657                930352 -
15903003   hypothetical protein-                      -               -             -
15902661   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:670918-671721                930655 -
-                              gb|AE005672|:972054-972791
           Intergenic Region (Length: 737)            AE005672        -             -
15902789                       ref|NC_003028.1|:790290-790952
           Deoxyribose-phosphate aldolase             NC_003028.1            930793 -
15902195   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c151171-150602               929941 -
15903306   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1328081-1327464             931427 -
-          tracking oligo      -                      -               -             -
-                              gb|AE005672|:603163-603893
           Intergenic Region (Length: 311)            AE005672        -             -
15903285   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1309961-1309722             931485 -
15902995   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:988049-988525           931564 -
-                                -
           Intergenic Region (Length: 254)              -             -          -
-                                gb|AE005672|:1716312-1716672
           Intergenic Region (Length: 343)              AE005672      -          -
15902249                         ref|NC_003028.1|:201437-201793
           50S ribosomal protein L18                    NC_003028.1       930026 -
15903626   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1644840-1643236        931095 -
15902961                         ref|NC_003028.1|:955995-956504
           citrulline cluster-linked gene               NC_003028.1       931525 -
-                                -
           Intergenic Region (Length: 263)              -             -          -
15903545                         ref|NC_003028.1|:c1562032-1559240
           isoleucyl-tRNA synthetase                    NC_003028.1       931179 -
15903701   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1752705-1752592        930990 -
15902424                           S-malonyltransferase NC_003028.1
           acyl-carrier-proteinref|NC_003028.1|:398001-398921             930356 -
15902817   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:815590-816816           930821 -
-                                -
           Intergenic Region (Length: 207)              -             -          -
-          -                                            AE005672
                                 gb|AE005672|:1824967-1825215         -          -
15903875                                                NC_003028.1
           Beta-glucosidase ref|NC_003028.1|:1926444-1927853              932019 -
15902115                         ref|NC_003028.1|:84191-84856
                                                        transport
           Trk transporter NAD+ binding protein - K+ NC_003028.1          929849 -
15903401   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:1414982-1415995         931333 -
15903323   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1344753-1344352        931410 -
15903896                         ref|NC_003028.1|:c1949065-1947875
           Acetate kinase (acetokinase)                 NC_003028.1       932010 -
15902116   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:85166-86182             929851 -
15903771   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1825518-1825216        930017 -
15903234                         -                      -             -
           ABC transporter ATP-binding protein - oligopeptide transport          -
15902783                         ref|NC_003028.1|:c786331-785807
           topology modulation protein                  NC_003028.1       930787 -
15902489                         ref|NC_003028.1|:c490319-488751
           type I restriction enzyme                    NC_003028.1       930446 -
-                                ref|NC_003028.1|:722937-723065
           Intergenic Region (Length: 350)              NC_003028.1       930713 -
15903774   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1827398-1826895        931899 -
-          -                                            AE005672
                                 gb|AE005672|:770050-770255           -          -
-          -                                            NC_003028.1
                                 ref|NC_003028.1|:c1400829-1400734        931336 -
15902566   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:564533-564988           930541 -
-                                gb|AE005672|:294977-295246
           Intergenic Region (Length: 270)              AE005672      -          -
15903362   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:1378805-1379251         931375 -
15902652   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:664652-665287           930645 -
15902621                         ref|NC_003028.1|:630450-631385
                                                        NC_003028.1
           bifunctional methionine sulfoxide reductase A/B protein        930609 -
-          -                                            AE005672
                                 gb|AE005672|:1963307-1963628         -          -
15902121   Histidine kinase ref|NC_003028.1|:89733-90785NC_003028.1       929854 -
-          -                                            NC_003028.1
                                 ref|NC_003028.1|:970317-970409           931542 -
15902947                           biogenesis protein   NC_003028.1
           Cytochrome c-typeref|NC_003028.1|:940153-940860                931512 -
15902607   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:613218-613523           930595 -
-                                gb|AE005672|:598343-598656
           Intergenic Region (Length: 224)              AE005672      -          -
15902646                         ref|NC_003028.1|:658548-659189
                                                        NC_003028.1
           ABC transporter ATP-binding protein - sodium transport         930637 -
-                                gb|AE005672|:1327255-1327463
           Intergenic Region (Length: 209)              AE005672      -          -
15904053                         ref|NC_003028.1|:c2128402-2127740
                                                        NC_003028.1
           Involved in transformation (competence for DNA uptake)         929909 -
-          -                                            AE005672
                                 gb|AE005672|:2032156-2032432         -          -
15902117   hypothetical protein  -                      -             -          -
-          -                                            AE005672
                                 gb|AE005672|:612350-612682           -          -
15903768   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1824337-1823711        930140 -
15903405   ATP synthase subunit A                       NC_003028.1
                                 ref|NC_003028.1|:c1420361-1418856        931329 -
15903640                         ref|NC_003028.1|:1653792-1654936
                                                        NC_003028.1
           Dicarboxylate/amino acid:cation (Na+ or H+) symporter          931080 -
-          -                                            NC_003028.1
                                 ref|NC_003028.1|:1071282-1071647         931657 -
15903858   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1906178-1905441        931986 -
15902784                         ref|NC_003028.1|:c786620-786384
           30S ribosomal protein S20                    NC_003028.1       930788 rpsT
15903864                         ref|NC_003028.1|:c1915659-1915507
           50S ribosomal protein L33                    NC_003028.1       932006 rpmG
15903520   hypothetical protein                         NC_003028.1
                                 ref|NC_003028.1|:c1536314-1535877        931205 -
15902101                       ref|NC_003028.1|:c63562-59624
           Beta-N-acetyl-hexosaminidase precursor NC_003028.1                  929812 -
15902970   hypothetical protein-                      -                  -            -
15903051                       ref|NC_003028.1|:1032883-1033857
           phosphate acetyltransferase                NC_003028.1              931614 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:163632-164810                  929960 -
-                              -
           Intergenic Region (Length: 326)            -                  -            -
-                              gb|AE005672|:667952-668158
           Intergenic Region (Length: 317)            AE005672           -            -
15902797                       ref|NC_003028.1|:767268-768090, ref|NC_003028.1|:796682-797515, ref|NC_003028.1|:c139
           Degenerate transposase (orf2)              NC_003028.1              930764 -
15902692                       ref|NC_003028.1|:c701174-699903
           Sodium-dependent transporter               NC_003028.1              930687 -
15902894   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:898936-899436                  930903 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1251626-1249404               931842 -
15903631   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1648099-1647746               931090 -
15903976                       ref|NC_003028.1|:c2038558-2036855
           dihydroxy-acid dehydratase                 NC_003028.1              930224 -
15903591   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1611662-1610871               931126 -
-          -                                          AE005672
                               gb|AE005672|:436038-436301                -            -
15902841                                              NC_003028.1
           pyruvate kinase ref|NC_003028.1|:851335-852840                      930850 -
15902752                       ref|NC_003028.1|:752624-753958
           Sensor protein CiaH histide kinase         NC_003028.1              930749 -
15903127                       ref|NC_003028.1|:c1136880-1135213
           DNA repair and genetic recombination       NC_003028.1              931716 -
15903478                       ref|NC_003028.1|:c1483784-1483272
           adenine phosphoribosyltransferase          NC_003028.1              931260 -
15903190   Choline kinase                             NC_003028.1
                               ref|NC_003028.1|:c1202580-1201792               931783 -
-          -                                          AE005672
                               gb|AE005672|:1082277-1082490              -            -
15902400                                              NC_003028.1
           Mannitol PTS EII ref|NC_003028.1|:372309-374078                     930325 -
-          tRNA-Glu                                   NC_003028.1              929753 tRNA-Glu-5
                               ref|NC_003028.1|:15023-15094, ref|NC_003028.1|:c1815378-1815307, ref|NC_003028.1|:c19
15903598                       ref|NC_003028.1|:c1615676-1614780
           primosomal protein DnaI                    NC_003028.1              931121 -
15903550   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1564222-1563959               931170 -
15902267                       ref|NC_003028.1|:c214506-213490
                                                      NC_003028.1
           ABC transporter solute-binding protein - iron transport, truncation 930044 -
15902629   thymidylate synthase                       NC_003028.1
                               ref|NC_003028.1|:645130-645969                  930618 -
-                              gb|AE005672|:1925100-1925557
           Intergenic Region (Length: 459)            AE005672           -            -
15903482                       ref|NC_003028.1|:c1489497-1488709
           transcriptional repressor CodY             NC_003028.1              931252 -
-          -                                          AE005672
                               gb|AE005672|:1784619-1784873              -            -
15903846   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1894390-1893830               930004 -
-          -                   -                      -                  -            -
15903657   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1705048-1704827               931042 -
15902159   hypothetical protein-                      -                  -            -
15902355   hypothetical protein                       AE005672
                               gb|AE005672|:318701-318976                -            -
15902734   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:735725-735964                  930732 -
15902568                       ref|NC_003028.1|:565915-567078
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - Pep export             930546 -
15902606                       ref|NC_003028.1|:612683-613180
                                                        EII component
           Phosphotransferase system sugar-specificNC_003028.1                 930594 -
15904048   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c2123156-2122890               930008 -
15903693   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1743044-1742748               931003 -
15902522                       ref|NC_003028.1|:521363-522499
           transcription elongation factor NusA       NC_003028.1              930496 -
-          tRNA-Phe                                   NC_003028.1              930930 tRNA-Phe-1
                               ref|NC_003028.1|:c1809023-1808951, ref|NC_003028.1|:c1970318-1970246
15903772   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1826329-1825655               930527 -
15903512   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1529530-1529739                931212 -
15902081                       ref|NC_003028.1|:38101-39093
           fatty acid/phospholipid synthesis protein NC_003028.1               929786 -
-                              ref|NC_003028.1|:56259-56375
           Intergenic Region (Length: 369)            NC_003028.1              929806 -
15903884   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1938204-1937113               932033 -
-                              gb|AE005672|:788035-788407
           Intergenic Region (Length: 206)            AE005672           -            -
-                              gb|AE005672|:1922993-1923228
           Intergenic Region (Length: 209)            AE005672           -            -
-                              ref|NC_003028.1|:1232496-1232600
           Intergenic Region (Length: 434)            NC_003028.1              931820 -
15903089   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1091972-1093522                931671 -
15903960                       ref|NC_003028.1|:2022112-2023419
                                                      NC_003028.1
           ABC transporter membrane-spanning permease - maltose/maltodextrin   930237 -
15903637   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1652048-1651521               931083 -
15903511   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:c1529302-1528673             931213 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:79434-79547                  929839 -
15903037                       ref|NC_003028.1|:1021568-1021956
           Degenerate transposase (orf1)             NC_003028.1             931599 -
-          tracking oligo      -                     -                 -             -
-                              gb|AE005672|:413986-414267
           Intergenic Region (Length: 268)           AE005672          -             -
15903068   DNA ligase                                NC_003028.1
                               ref|NC_003028.1|:1046915-1048873              931631 -
15902598   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:595769-596485                930578 -
15902470                       ref|NC_003028.1|:c460586-459147
                                                     NC_003028.1
           Trk transporter membrane-spanning protein - K+ transport          930417 -
15903269   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:c1292457-1291183             931466 -
15902814   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:813175-813369                930818 -
15902866   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:875519-876604                930874 -
15902272   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:216750-217730                930049 -
15902283   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:232578-233150                930064 -
15903432                       ref|NC_003028.1|:c1445372-1444437
                                                     NC_003028.1
           putative manganese-dependent inorganic pyrophosphatase            931304 -
15902685                       gb|AE005672|:692401-692670
                                                     AE005672
           P-type ATPase - probable copper transporter                 -             -
15902289                       ref|NC_003028.1|:239769-241577
           D-fructose-6-phosphate amidotransferase NC_003028.1               930072 -
15904072   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:2144448-2144816              931888 -
-                              gb|AE005672|:1989810-1990123
           Intergenic Region (Length: 314)           AE005672          -             -
15903678                       ref|NC_003028.1|:c1729328-1728762
           anthranilate synthase component II        NC_003028.1             931020 -
15902492                        deoxyribonuclease chain S
                                                     NC_003028.1
           Type I site-specificref|NC_003028.1|:486053-487333                930443 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:159192-160058                929954 -
15902462   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:449696-449869                930410 -
15902160   hypothetical protein-                     -                 -             -
15902508                                             NC_003028.1
           Histidine kinase ref|NC_003028.1|:506311-507651                   930467 -
15903737                       ref|NC_003028.1|:c1783002-1782400
                                                     NC_003028.1              domain
           putative deoxyribonucleotide triphosphate pyrophosphatase/unknown930952 -fusion protein
15902871   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:c879946-879749               930879 -
15903157   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:1166235-1166750              931748 -
15902145                       ref|NC_003028.1|:114086-114892
                                                     NC_003028.1
           ABC transporter solute-binding protein - amino acid transport     929890 -
15902540                       -
           Degenerate transposase (orf2)             -                 -             -
-                              gb|AE005672|:1836238-1836465
           Intergenic Region (Length: 223)           AE005672          -             -
15903317                       ref|NC_003028.1|:c1337542-1336309
           Choline binding protein                   NC_003028.1             931417 -
15903831                       ref|NC_003028.1|:1879564-1879842
           Acylphosphate phosphohydrolase            NC_003028.1             929925 -
15903929                       ref|NC_003028.1|:c1987485-1984952
           DNA mismatch repair protein               NC_003028.1             930262 -
-                              ref|NC_003028.1|:2061777-2062001
           Intergenic Region (Length: 688)           NC_003028.1             930212 -
15903134   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:c1141562-1141395             931724 -
15902179                       ref|NC_003028.1|:133565-133771
                                                     NC_003028.1
           Glycosyltransferase involved exopolysaccharide (EPS) synthesis    929920 -
15902058   Transposase                               NC_003028.1             929762 -
                               ref|NC_003028.1|:20404-20820, ref|NC_003028.1|:275289-275636, ref|NC_003028.1|:769178
15902652   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:665284-665664                930646 -
15903109                       ref|NC_003028.1|:1116227-1118386
                                                     NC_003028.1
           ribonucleotide-diphosphate reductase alpha subunit                931693 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:513530-513934                930476 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:569349-569432                930550 -
15903145                       ref|NC_003028.1|:c1156641-1154764
                                                     NC_003028.1
           Uncharacterized restriction enzyme, interrupted-N                 931736 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:1067622-1068068              931650 -
15903751                       ref|NC_003028.1|:c1801034-1799592
                                                     NC_003028.1
           Dextransucrase (sucrose 6-glucosyltransferase)                    930939 -
-          -                                         AE005672
                               gb|AE005672|:1038198-1038542            -             -
15902331                       ref|NC_003028.1|:c292459-291830
                                                     NC_003028.1             930130 -
           keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase
-          tRNA-Leu                                  NC_003028.1             930921 tRNA-Leu-2
                               ref|NC_003028.1|:c1809637-1809552, ref|NC_003028.1|:c1908294-1908209
-          -                                         NC_003028.1
                               ref|NC_003028.1|:160211-160339                929955 -
15902645   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:656525-658546                930636 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:1730864-1731046              931017 -
-          -                                         NC_003028.1
                               ref|NC_003028.1|:c1372370-1372248             931381 -
-                              -
           Intergenic Region (Length: 259)           -                 -             -
15904074                       ref|NC_003028.1|:c2147445-2145967
           inositol-5-monophosphate dehydrogenase NC_003028.1               931886 -
-                              ref|NC_003028.1|:405744-405980
           Intergenic Region (Length: 297)            NC_003028.1           930367 -
15902962                       ref|NC_003028.1|:957018-958094
           aspartate-semialdehyde dehydrogenase NC_003028.1                 931527 -
15902912                       ref|NC_003028.1|:c914741-913086
           Fibronectin-binding protein-like protein A NC_003028.1           931286 -
15903267   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1290069-1288966            931468 -
15903063   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:1041151-1041990             931626 -
15904082   Response regulator                         NC_003028.1
                               ref|NC_003028.1|:c2156412-2155660            930062 -
15903733                       ref|NC_003028.1|:c1780714-1779986
           segregation and condensation protein A NC_003028.1               930957 scpA
15902934   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c932112-931312              931500 -
15903460                       ref|NC_003028.1|:c1469385-1468033
           Phosphoglucosamine mutase                  NC_003028.1           931273 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1656597-1656373            931079 -
15903922                       ref|NC_003028.1|:c1978082-1976622
           glutamyl-tRNA synthetase                   NC_003028.1           931970 gltX
15902797                       ref|NC_003028.1|:767268-768090, ref|NC_003028.1|:796682-797515, ref|NC_003028.1|:c139
           Degenerate transposase (orf2)              NC_003028.1           930764 -
-                              -
           Intergenic Region (Length: 209)            -                -            -
-                              gb|AE005672|:1102796-1103079
           Intergenic Region (Length: 284)            AE005672         -            -
15902548                       ref|NC_003028.1|:543163-544002
                                                      NC_003028.1
           Transcriptional antiterminator (BglG family)                     930520 -
15903924   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1979721-1979542            931972 -
15903325   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1346707-1345982            930073 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1188657-1188514            931768 -
15902974   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:968686-969300               931540 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1198768-1198649            931779 -
15903181   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1192002-1191667            931773 -
-          -                   -                      -                -            -
15903749                       ref|NC_003028.1|:c1797576-1795597
                                                      - oligopeptide
           ABC transporter substrate-binding protein NC_003028.1 transport  930943 -
-          -                                          AE005672
                               gb|AE005672|:1783003-1783367            -            -
-          -                                          AE005672
                               gb|AE005672|:890222-890447              -            -
15902440                       ref|NC_003028.1|:412441-413985
           peptide chain release factor 3             NC_003028.1           930376 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1659624-1658113            931075 -
15903982   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:2044450-2045457             930220 -
15903863   translocase                                NC_003028.1
                               ref|NC_003028.1|:c1915497-1915321            932007 -
15902913   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:914846-915343               931314 -
15902082                                              NC_003028.1
           Acyl carrier proteinref|NC_003028.1|:39099-39332                 929788 -
-                              gb|AE005672|:110364-110793
           Intergenic Region (Length: 456)            AE005672         -            -
15902054   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:10531-11808                 929748 -
-          tracking oligo      -                      -                -            -
15903116                       ref|NC_003028.1|:c1127914-1126934
           tagatose 1,6-diphosphate aldolase          NC_003028.1           931704 -
15903110                       ref|NC_003028.1|:1118574-1119536
                                                        subunit
           ribonucleotide-diphosphate reductase betaNC_003028.1             931694 -
15902571                                              -
           A secreted peptide- which is the signal sensed by VncR/S -               -
15903789   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1837339-1836785            930543 -
15902048   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:3196-4311                   929741 -
15903787                       ref|NC_003028.1|:c1130886-1130497, ref|NC_003028.1|:c1990513-1990124
           Degenerate transposase (orf2)              NC_003028.1           931709 -
15903662                       -
           ABC transporter substrate-binding protein - sugar transport -            -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:1065887-1066153             931646 -
-          -                                          AE005672
                               gb|AE005672|:553838-554097              -            -
15903817                       ref|NC_003028.1|:c1862529-1862116
           nucleoside diphosphate kinase              NC_003028.1           929787 ndk
15902836                       ref|NC_003028.1|:840198-843473
                                                      NC_003028.1
           Type 1 restriction modification system endonuclease R            930845 -
15903759   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1816750-1815440            932014 -
15902316                       ref|NC_003028.1|:272516-272908
           30S ribosomal protein S9                   NC_003028.1           930107 -
15903915                       ref|NC_003028.1|:c1963306-1962881
           Transcriptional regulator - MarR family    NC_003028.1           930311 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1121028-1120864            931697 -
15903331   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1352438-1351446            931406 -
15902973   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:967679-968686               931539 -
15902863   spermidine synthase                         NC_003028.1
                               ref|NC_003028.1|:872279-873139               930871 -
-                              gb|AE005672|:2130389-2130636
           Intergenic Region (Length: 284)             AE005672      -               -
15903795   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1840042-1839881            930503 -
15903607   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:1623125-1623742             931112 -
-          -                                           NC_003028.1
                               ref|NC_003028.1|:c1627304-1627107            931109 -
15903572                       ref|NC_003028.1|:c1585849-1585151
           N-acetylmannosamine-6-phosphate 2-epimerase NC_003028.1          931150 -
-          tRNA-Leu                                    NC_003028.1
                               ref|NC_003028.1|:c1488052-1487967            931249 tRNA-Leu-1
15902051   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:8519-8785                   929744 -
15902280   hypothetical protein-                       -             -               -
-                              -
           Intergenic Region (Length: 450)             -             -               -
15903644                       ref|NC_003028.1|:1694508-1694822
           Thioredoxin reductase                       NC_003028.1          931059 -
-                              gb|AE005672|:1348569-1349191
           Intergenic Region (Length: 605)             AE005672      -               -
-                              gb|AE005672|:821394-822271
           Intergenic Region (Length: 201)             AE005672      -               -
15904040                       ref|NC_003028.1|:c2117835-2115403
                                                       truncation
           Class III stress response-related ATPase, NC_003028.1            931938 -
15904028                       ref|NC_003028.1|:c2101743-2101540
           Hypothetical protein, truncation            NC_003028.1          930188 -
15903945   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c2003059-2002382            931960 -
15902907                       ref|NC_003028.1|:908154-908513
           50S ribosomal protein L20                   NC_003028.1          931131 -
15904063                       ref|NC_003028.1|:c2137028-2136534
           Cell-shape determining protein MreD         NC_003028.1          929895 -
15902369   hypothetical protein                        NC_003028.1          931826 -
                               ref|NC_003028.1|:c1237316-1236123, ref|NC_003028.1|:c337913-336806
-                              -
           Intergenic Region (Length: 286)             -             -               -
15902230   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:192436-192774               930005 -
15903076                                               NC_003028.1
           glycogen synthaseref|NC_003028.1|:1057902-1059335                931638 -
15903246                       ref|NC_003028.1|:c1265636-1264029
                                                       NC_003028.1          931859 -
           ABC transporter ATP-binding/membrane spanning protein - multidrug resistance
-          -                                           NC_003028.1
                               ref|NC_003028.1|:1930256-1930351             932027 -
-                              gb|AE005672|:290683-291065
           Intergenic Region (Length: 833)             AE005672      -               -
15902862                       ref|NC_003028.1|:c429651-428527, ref|NC_003028.1|:c872023-871307
           Degenerate transposase                      NC_003028.1          930394 -
15903186   hypothetical protein-                       -             -               -
15902655   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:666700-667413               930648 -
-                              gb|AE005672|:599759-600063
           Intergenic Region (Length: 712)             AE005672      -               -
15903446   hypothetical protein-                       -             -               -
15903855                       ref|NC_003028.1|:c1903319-1902309
           Catabolite control protein A                NC_003028.1          930480 -
15903276                       ref|NC_003028.1|:c1298848-1297781
           3-dehydroquinate synthase                   NC_003028.1          931458 -
15902129   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:98131-98991                 929870 -
15902350   hypothetical protein-                       -             -               -
-                              gb|AE005672|:946781-946989
           Intergenic Region (Length: 209)             AE005672      -               -
-          tRNA-Gly                                    NC_003028.1          930928 tRNA-Gly-1
                               ref|NC_003028.1|:c1808931-1808861, ref|NC_003028.1|:c1970756-1970686
-          -                                           NC_003028.1
                               ref|NC_003028.1|:80647-81204                 929842 -
15903435   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1446894-1446535            931298 -
15903391   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1404815-1404573            931478 -
15903247                       ref|NC_003028.1|:c1267573-1265633
           Protease II (oligopeptidase B)              NC_003028.1          931860 -
15903212   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:1224430-1225734             931804 -
-          -                                           NC_003028.1
                               ref|NC_003028.1|:335259-336443               930186 -
15902232                       ref|NC_003028.1|:193566-194192
           50S ribosomal protein L3                    NC_003028.1          930007 -
15902509                       ref|NC_003028.1|:c507850-507722
                                                       NC_003028.1
           Bacteriocin-like peptide, double glycine cleavage type           930468 -
-                              gb|AE005672|:1581941-1582161
           Intergenic Region (Length: 221)             AE005672      -               -
15903683                       ref|NC_003028.1|:c1734245-1733535
           Mg(2+) transport ATPase/permease            NC_003028.1          931012 -
15903121                       -
           Degenerate transposase (orf2)               -             -               -
-          -                                           NC_003028.1
                               ref|NC_003028.1|:c1907064-1906180            929970 -
15903526   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:1540389-1540802             931196 -
-          tmRNA                                       AE005672
                               gb|AE005672|:821394-822271            -               -
15902592   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:591638-592216               930573 -
15902563                       ref|NC_003028.1|:561786-563129
           cysteinyl-tRNA synthetase                   NC_003028.1          930537 cysS
-                              gb|AE005672|:684440-684997
           Intergenic Region (Length: 392)             AE005672        -              -
-                              -
           Intergenic Region (Length: 224)             -               -              -
15903688   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1738815-1738156              931008 -
15903209                       ref|NC_003028.1|:c1223546-1221975
                                                       NC_003028.1
           Signal recognition particle (Fifty four homolog)                   931801 -
-          tRNA-Trp                                    NC_003028.1
                               ref|NC_003028.1|:c1970148-1970078              931974 tRNA-Trp-1
15902241                       ref|NC_003028.1|:197821-198027
           50S ribosomal protein L29                   NC_003028.1            930016 rpmC
15903140                       ref|NC_003028.1|:c1146400-1145603
           Formate-nitrate transporter                 NC_003028.1            931729 -
15903907                       ref|NC_003028.1|:c1956221-1955163
           Putative alcohol dehydrogenase              NC_003028.1            931982 -
15904027   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:2100866-2101453               931928 -
-          -                                           AE005672
                               gb|AE005672|:1840043-1840399            -              -
15902427                       ref|NC_003028.1|:400946-401431
           acetyl-CoA carboxylase                      NC_003028.1            930359 -
15902747   hypothetical protein-                       -               -              -
15903107                       ref|NC_003028.1|:c1115577-1115314
                                                       NC_003028.1
           Histidine-containing phosphocarrier protein of the PTS             931691 -
15902074   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c30605-30372                  929776 -
-          -                   -                       -               -              -
15902223   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:184616-185074                 929993 -
15903914   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1962870-1962511              930314 -
-          -                                           NC_003028.1
                               ref|NC_003028.1|:145086-145295                 929935 -
-                              -
           Intergenic Region (Length: 280)             -               -              -
15903130                       ref|NC_003028.1|:c1138994-1138119
           Farnesyl diphosphate synthase               NC_003028.1            931719 -
15903049                       ref|NC_003028.1|:1031128-1031946
           inorganic polyphosphate/ATP-NAD kinase NC_003028.1                 931612 ppnK
15902361   The type 2 capsule- locus of Streptococcus- pneumoniae      -              -
15902649                       ref|NC_003028.1|:661715-662914
           Cell division protein DivIB                 NC_003028.1            930640 -
15902605                       ref|NC_003028.1|:603894-610316
                                                       NC_003028.1
           Cell wall-associated serine proteinase precursor PrtA              930590 -
15903791   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1838321-1837527              930458 -
15902356                       -
           Degenerate transposase                      -               -              -
15902485                       ref|NC_003028.1|:481597-482793
           phosphoglycerate kinase                     NC_003028.1            930437 -
15902469                       ref|NC_003028.1|:457342-459021
                                                         EII component
           Phosphotransferase system sugar-specificNC_003028.1                930416 -
15903954                       ref|NC_003028.1|:2013132-2013980
           23S rRNA m1G745 methyltransferase           NC_003028.1            930241 -
15903394   Phosphoglucomutase                          NC_003028.1
                               ref|NC_003028.1|:1406015-1407733               931340 -
15903635   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1650198-1649887              931085 -
-          -                                           AE005672
                               gb|AE005672|:631386-631652              -              -
15903566   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c1579368-1579024              931148 -
-                              gb|AE005672|:233151-233380
           Intergenic Region (Length: 212)             AE005672        -              -
15902459                       ref|NC_003028.1|:432307-434631
           Pyruvate formate-lyase                      NC_003028.1            930397 -
-                              gb|AE005672|:2038559-2038790
           Intergenic Region (Length: 232)             AE005672        -              -
15902436                                               NC_003028.1
           elongation factor Pref|NC_003028.1|:c408889-408329                 930371 -
-          -                                           AE005672
                               gb|AE005672|:1655958-1656372            -              -
15903698                       ref|NC_003028.1|:c1750202-1748451
                                                       NC_003028.1             substrate
           ABC transporter ATP-binding/membrane spanning protein - unknown930993 -
15904008                       ref|NC_003028.1|:c2080415-2079615
                                                         EII component
           Phosphotransferase system sugar-specificNC_003028.1                931934 -
15902593   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:592376-592663                 930574 -
15902074   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:c30889-30563                  929777 -
15902616   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:625397-625651                 930602 -
15902897                       ref|NC_003028.1|:c901165-900066
           Alanine dehydrogenase, truncation           NC_003028.1            930905 -
15903289                       ref|NC_003028.1|:c1313995-1312838
                                                       NC_003028.1            931437 -
           ABC transporter ATP-binding protein - spermidine/putrescine transport
-                              gb|AE005672|:1461045-1461299
           Intergenic Region (Length: 303)             AE005672        -              -
15902686                                               NC_003028.1
           Pyruvate oxidase ref|NC_003028.1|:694860-696635                    930680 -
15903510                       ref|NC_003028.1|:c1528532-1528263
           30S ribosomal protein S15                   NC_003028.1            931214 -
15904001   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:2067296-2068627               931937 -
15903933   hypothetical protein                        NC_003028.1
                               ref|NC_003028.1|:1990691-1991152               930258 -
15902950   Lipoprotein                                 NC_003028.1
                               ref|NC_003028.1|:943336-944253                 931515 -
15903015                       -                       -
           ABC transporter membrane-spanning permease - macrolide- efflux             -
15902309   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:266753-267445                   930099 -
15903117                       ref|NC_003028.1|:c1128845-1127916
           Tagatose-6-phosphate kinase                NC_003028.1               931705 -
15904047                       ref|NC_003028.1|:c2122801-2121455
           Choline binding protein D                  NC_003028.1               931907 -
15903319   NAD(+) synthetase                          NC_003028.1
                               ref|NC_003028.1|:c1341628-1340804                931416 nadE
15903883   transketolase                              NC_003028.1
                               ref|NC_003028.1|:c1936999-1935023                932029 -
15903779   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1830170-1829721                930096 -
15903346   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1369014-1368079                931391 -
15904039   Response regulator                         NC_003028.1
                               ref|NC_003028.1|:c2114761-2114108                930182 -
15902176                       ref|NC_003028.1|:c131763-130250
           Degenerate transposase (orf2)              NC_003028.1               929915 -
15902640   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:652553-652750                   930628 -
15903913                       ref|NC_003028.1|:c1962404-1961760
           Pyrrolidone carboxyl peptidase, truncation NC_003028.1               931978 -
-          -                                          AE005672
                               gb|AE005672|:50671-50888               -                 -
15902530   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:528535-529869                   930506 -
15902922                                              NC_003028.1
           Exoribonuclease Rref|NC_003028.1|:919823-922177                      931488 -
15902679   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:688304-688828                   930673 -
15902110   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:79687-80541                     929841 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1704837-1704733                931045 -
15903941                       ref|NC_003028.1|:1997593-1998018
                                                      NC_003028.1
           Transposase, IS1380-Spn1 related, truncation                         930251 -
15903522   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1537238-1536390                931202 -
15903050                       ref|NC_003028.1|:1031943-1032839
           23S rRNA pseudouridine synthase            NC_003028.1               931613 -
15902856                       ref|NC_003028.1|:864704-865462
                                                      NC_003028.1
           ABC transporter ATP-binding protein - unknown substrate              930865 -
-                              -
           Intergenic Region (Length: 218)            -               -                 -
15903484                       ref|NC_003028.1|:c1492760-1491534
                                                      NC_003028.1
           Major facilitator:Oxalate:Formate Antiporter                         931247 -
15904059                       ref|NC_003028.1|:c2132894-2132453, ref|NC_003028.1|:c766512-766057
           Degenerate transposase                     NC_003028.1               930042 -
15903259                       ref|NC_003028.1|:c1280930-1279206
                                                      NC_003028.1                substrate
           ABC transporter ATP-binding/membrane-spanning protein - unknown930077 -
15902941   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:936484-938253                   931507 -
15903488   Dipeptidase                                NC_003028.1
                               ref|NC_003028.1|:1496619-1497701                 931254 -
15902535   hypothetical protein-                      -               -                 -
-                              ref|NC_003028.1|:1539737-1540258
           Intergenic Region (Length: 258)            NC_003028.1               931197 -
15902095                       ref|NC_003028.1|:53071-54618
                                                      NC_003028.1               929804 purH
           bifunctionalphosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
-                              gb|AE005672|:64695-64954
           Intergenic Region (Length: 305)            AE005672        -                 -
-                              gb|AE005672|:2065555-2065762
           Intergenic Region (Length: 208)            AE005672        -                 -
15902341   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:299299-300939                   930142 -
15903820   Hemolysin                                  NC_003028.1
                               ref|NC_003028.1|:c1871976-1870645                931894 -
15903836   Cmp-binding-factor 1                       NC_003028.1
                               ref|NC_003028.1|:c1885178-1884252                931892 -
15903092                       ref|NC_003028.1|:c1097997-1096294
           Dihydrolipoamide dehydrogenase             NC_003028.1               931675 -
15903012   hypothetical protein-                      -               -                 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c656084-655986                  930632 -
15902557   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:553625-553837                   930530 -
-                              ref|NC_003028.1|:1773102-1773224
           Intergenic Region (Length: 299)            NC_003028.1               930967 -
15903859                       -                      -
           ABC transporter ATP binding protein - unknown substrate -                    -
15903593   hypothetical protein-                      -               -                 -
15903280   hypothetical protein                       NC_003028.1
                               ref|NC_003028.1|:c1303896-1302235                931452 -
15903151                       ref|NC_003028.1|:c1161357-1160212
           Similar to A/G-specific adenine glycosylaseNC_003028.1               931742 -
15902127                       ref|NC_003028.1|:95123-96598
                                                      NC_003028.1
           ABC transporter solute binding protein - sugar transport             929866 -
15903352   hypothetical protein-                      -               -                 -
15903524   hypothetical protein                       AE005672
                               gb|AE005672|:1539341-1539736           -                 -
15902348                       ref|NC_003028.1|:306879-309131
           Penicillin-binding protein 2X              NC_003028.1               930153 -
15903197                       ref|NC_003028.1|:c1212702-1211623
           carbamoyl-phosphate synthase small subunit NC_003028.1               931790 -
-          tracking oligo      -                      -               -                 -
-          -                                          NC_003028.1
                               ref|NC_003028.1|:c1662441-1662001                931073 -
15902665                       ref|NC_003028.1|:c674031-673160
                                                      - unknown substrate, truncation
           ABC transporter substrate-binding protein NC_003028.1                930658 -
15902192   hypothetical protein                      NC_003028.1
                               ref|NC_003028.1|:147451-148824               929938 -
15903343                       ref|NC_003028.1|:c1366291-1364729
                                                     NC_003028.1
           bifunctional GMP synthase/glutamine amidotransferase protein     931393 guaA
-          -                                         AE005672
                               gb|AE005672|:73455-73760              -              -
-                              -
           Intergenic Region (Length: 273)           -               -              -
15903417   hypothetical protein                      NC_003028