Docstoc

Genome-wide profiling of G protein-coupled receptors in cerebellar

Document Sample
Genome-wide profiling of G protein-coupled receptors in cerebellar Powered By Docstoc
					              Sequence of primers used in thi
  Gene Name
Chrm1
Chrm2
Chrm3
Chrm4
Chrm5
Adora1
Adora2a
Adora2b
Adora3
Gpr87
P2ry12
P2ry13
P2ry14
Adra1a
Adra1b
Adra1d
Adra2a
Adra2b
Adra2c
Adrb1
Adrb2
Adrb3
Gpr182
C3ar1
C5ar1
Gpr77
Agtr1a
Agtr1b
Agtr2
Aplnr
Gpbar1
Brs3
Grpr
Nmbr
Bdkrb1
Bdkrb2
Cnr1
Cnr2
Ccbp2
Ccr1
Ccr10
Ccr1l1
Ccr2
Ccr3
Ccr4
Ccr5
Ccr6
Ccr7
Ccr8
Ccr9
Ccrl1
Ccrl2
Cx3cr1
Cxcr3



                          Page 1
          Sequence of primers used in thi
Cxcr4
Cxcr5
Cxcr6
Cxcr7
Il8ra
Il8rb
Xcr1
Cckar
Cckbr
Cysltr1
Cysltr2
Drd1a
Drd2
Drd3
Drd4
Drd5
Darc
Gpr109a
Gpr81
Ednra
Ednrb
Gpr37
Gpr37l1
Ffar1
Ffar2
Ffar3
Gpr119
Gpr120
Fpr1
Fpr2
Fpr3
Fpr-rs3
Fpr-rs4
Fpr-rs6
Fpr-rs7
Galr1
Galr2
Galr3
Ghsr
Gnrhr
Hrh1
Hrh2
Hrh3
Hrh4
Fshr
Lhcgr
Tshr
Kiss1r
Lgr4
Lgr5
Lgr6
Ltb4r1
Ltb4r2
Mas1
Mrgpra1



                      Page 2
          Sequence of primers used in thi
Mrgpra2
Mrgpra3
Mrgpra4
Mrgpra6
Mrgprb1
Mrgprb2
Mrgprb3
Mrgprb4
Mrgprb5
Mrgprd
Mrgpre
Mrgprf
Mrgprg
Mrgprh
Mchr1
Mc1r
Mc2r
Mc3r
Mc4r
Mc5r
Gpr50
Mtnr1a
Mtnr1b
Nmur1
Nmur2
Npffr1
Npffr2
Npsr1
Npy1r
Npy2r
Npy5r
Npy6r
Ppyr1
Npbwr1
Ntsr1
Ntsr2
Oprd1
Oprk1
Oprl1
Oprm1
Opn1mw
Opn1sw
Rgr
Rrh
Hcrtr1
Hcrtr2
Cmklr1
Gper
Gpr1
Gpr101
Gpr135
Gpr141
Gpr146
Gpr149
Gpr15



                      Page 3
         Sequence of primers used in thi
Gpr150
Gpr151
Gpr152
Gpr160
Gpr161
Gpr17
Gpr171
Gpr176
Gpr18
Gpr183
Gpr19
Gpr20
Gpr22
Gpr25
Gpr31
Gpr33
Gpr34
Gpr35
Gpr39
Gpr55
Gpr61
Gpr62
Gpr75
Gpr82
Gpr84
Gpr88
Opn3
Opn4
Opn5
Gpr12
Gpr3
P2ry5
Gpr174
P2ry10
Gpr139
Gpr142
Gpr21
Gpr52
Gpr26
Gpr45
Gpr63
Gpr165
Gpr83
Pgr15l
Gpr153
Gpr162
Oxgr1
Ptafr
Prokr1
Prokr2
Prlhr
Gpr44
Ptgdr
Ptger1
Ptger2



                     Page 4
                Sequence of primers used in thi
Ptger3
Ptger4
Ptgfr
Ptgir
Tbxa2r
F2r
F2rl1
F2rl2
F2rl3
P2ry1
P2ry2
P2ry4
P2ry6
C130060K24Rik
Qrfpr
Rxfp1
Rxfp2
Rxfp3
Rxfp4
Htr1a
Htr1b
Htr1d
Htr1f
Htr2a
Htr2b
Htr2c
Htr4
Htr5a
Htr5b
Htr6
Htr7
Sstr1
Sstr2
Sstr3
Sstr4
Sstr5
Gpr132
Gpr4
Gpr65
Gpr68
Edg5
Gpr6
Lpar1
Lpar2
Lpar3
Lpar4
Lpar5
S1pr1
S1pr3
S1pr4
S1pr5
Gpr173
Gpr27
Gpr85
Sucnr1



                            Page 5
            Sequence of primers used in thi
Tacr1
Tacr2
Tacr3
Taar1
Taar2
Taar3
Taar4
Taar5
Taar6
Taar7a
Taar7b
Taar7c-ps
Taar7d
Taar7e
Taar7f
Taar8a
Taar8b
Taar8c
Taar9
Trhr
Trhr2
Uts2r
Avpr1a
Avpr1b
Avpr2
Oxtr
Bai1
Bai2
Bai3
Calcr
Calcrl
Crhr1
Crhr2
Cd97
Emr1
Emr4
Ghrhr
Gipr
Gcgr
Glp1r
Glp2r
Crcp
Ramp1
Ramp2
Ramp3
Lphn1
Lphn2
Lphn3
Eltd1
Gpr113
Gpr114
Gpr128
Gpr133
Gpr143
Gpr56



                        Page 6
            Sequence of primers used in thi
Gpr97
Gpr98
Gpr112
Gpr126
Gpr64
Gpr110
Gpr111
Gpr115
Gpr116
Gpr123
Gpr124
Gpr125
Adcyap1r1
Vipr1
Vipr2
Celsr1
Celsr2
Celsr3
Pth2r
Pthr1
Sctr
Casr
Gabbr1
Gabbr2
Gprc5a
Gprc5b
Gprc5c
Gprc5d
Grm1
Grm2
Grm3
Grm4
Grm5
Grm6
Grm7
Grm8
Gpr156
Gprc6a
Fzd1
Fzd10
Fzd2
Fzd3
Fzd4
Fzd5
Fzd6
Fzd7
Fzd8
Fzd9
Frzb
Sfrp1
Sfrp2
Smo
Gpr107
Gpr108
Gpr175



                        Page 7
          Sequence of primers used in thi
Tm7sf3
Gpr137
Gpr137b
Gpr137c




                      Page 8
                                Sequence of primers used in thi
                                            Alias
M1; M1R; Chrm-1
M2; Chrm-2
M3; M3R; Chrm-3
M4; Chrm-4
m5; M5R
Ri; A1R; A1AR; AA1R; A1-AR; AI848715; BB176431
A2aR; A2AAR; AA2AR; MGC118414
A2b; A2BR; A2BAR; AA2BR; AI480866; AI605384; MGC144574; MGC144575
A3R; A3AR; AA3R; ARA3; Gpcr2; MGC118217; 1700001D09Rik; 4930578J19Rik

P2Y12; 2900079B22Rik; 4921504D23Rik
GPCR1; GPR94; Gpr86; P2Y13; SP174; 2010001L06Rik
P2Y14; Gpr105; A330108O13Rik
[a]1a; Adra1c; MGC130524
[a]1b
Spr8; Adra1; Gpcr8; [a]1d; Adra-1; Adra1a; alpha1D-AR
Adra-2; Adra-2a; alpha2A; AW122659; alpha2-C10; alpha2A-AR; alpha(2A)AR
[a]2B; Adra-2b; alpha2B; alpha2-C2
[a]2C; Adra-2c; alpha2C; alpha2-C4
Adrb-1; beta-AR
Badm; Gpcr7; Adrb-2
Adrb-3
Admr; Gpcr17; Gpcr22; MB10; G10-D; NOW; AM-R
AZ3B; C3AR; HNFAG09
C5aR; C5r1; Cd88; D7Msu1
C5L2; E030029A11Rik
AT1; AG2S; AT1a; AT2R1; Agtr1; AT2R1A; Agtr-1a; AI551199; Angtr-1a; MGC37610; 1810074K20Rik
AT1B; AT2R1B; Agtr-1b; Angtr-1b; MGC129325
AI316812; AW107640
APJ; Agtrl1; msr/apj
BG37; GPCR; TGR5; M-BAR; GPR131
BRS-3; MGC129146; MGC129147; Bb3
GRP-R; MGC130509; Bb2
BB182387; Bb1
B1R; BKR1; B1BKR; Bdkrb; BRADYB1
B2; B2R; BK2; B(2); BK-2; BK2R; BKR2; BRB2
CB1
CB2; CB2-R
D6; CCR9; CCR10; Cmkbr9; AI464239; MGC130576; Ccr10rr
Cmkbr1; Mip-1a-R
Gpr2; Cmkbr9; MGC151420
Cmkbr1l1; MGC156358
Ckr2; Ccr2a; Ccr2b; Ckr2a; Ckr2b; mJe-r; Cmkbr2; Cc-ckr-2
CKR3; Cmkbr3; CC-CKR3; Cmkbr1l2; MGC124265; MGC124266
LESTR; Sdf1r; CHEMR1; Cmkbr4; MGC151418
AM4-7; CD195; Cmkbr5
Cmkbr6
EBI1; CD197; Ebi1h; Cdw197; Cmkbr7
mCCR8; Cmkbr8; MGC123958; MGC123959
Cmkbr10; GPR-9-6
PPR1; CCBP2; CCR11; VSHK1; CCX-CKR; Cmkbrl1; CCX-CKR1; A630091E18Rik
E01; CCR11; L-CCR; Cmkbr1l2; 1810047I05Rik

Cd183; Cmkar3



                                            Page 9
                                Sequence of primers used in thi
CD184; LESTR; Sdf1r; Cmkar4; PB-CKR; PBSF/SDF-1
Blr1; Gpcr6; MDR15; CXC-R5; CXCR-5
BONZO; STRL33; BB217514
Rdc1; Cmkor1; AW541270
Cxcr1
CD128; CXCR2; IL8RA; CDw128; Cmkar2; Gpcr16; IL-8Rh; IL-8rb; mIL-8RH
GPR5; Ccxcr1
AW106902
CCK2R; CCKR-2
Cyslt1; CysLT1R; BB147369
Cltr2; Cyslt2; CYSLT2R; 2300001H05Rik
Drd1; Drd-1; Gpcr15; C030036C15Rik
D2R; Drd-2
D3R
D4R; Drd-4; AW125663
D5R; Drd-5; Drd1b; Gpcr1
FY; Dfy; GPD; CCBP1; CD234; ESTM35; AA162249
HM74; Pumag; PUMA-G; mHM74b; Gpr109b

ETa; ET-AR; Gpcr10
ETb; ET-B; ET>B<; ETR-b; Sox10m1; AU022549
Pael-R; AI848630; Ednrbl1
CAG-18; D0Kist8; AW047233; Ednrbl2
Gpr40
Gpr43; GPCR43; MGC28611
Gm478; Gpr41

GT01; KPG_013; AI552415; Pgr4
FPR; LXA4R; fMLF-R
Fpr-rs2; MGC151443; E330010I07Rik
ALX; Fprl1; Lxa4r; LXA4-R; Fpr-rs1


MGC129278; MGC129279

Galnr1
mGalR; MGC151357; MGC151359
Galnr3
C530020I22Rik

Bphs

AW049250
H4; H4R; BG26; HH4R; AXOR35; GPRv53; GPCR105; MGC130500
FSH-R
Lhr; LH-R; Gpcr19-rs1
hyt; pet; AI481368; hypothroid
Gpr54
Gpr48; 9130225G07; A930009A08Rik
FEX; Gpr49
D830026M09; A530037C04Rik
BLT1; BLTR; Ltb4r; mBLTR
BLT2; MGC123942; MGC123943; 5830462O07Rik
Mas-1
MrgA1



                                             Page 10
                               Sequence of primers used in thi
MrgA2
MrgA3
MrgA4
MrgA6
MrgB1
MrgB2; MGC130390; MGC130391; 4833406I20Rik
MrgB3
MrgB4
MrgB5
MrgD; TGR7; Gm499
MrgE; Ebrt3; C130069N09Rik
MrgF; BC019711; MGC18825
MrgG; Gm1098
MrgH; Gpr90
Gpr24; Mch1r; MCH-1R; Gpr24-9; AW049955
Tob; Mshra
ACTHR
MGC124211; MGC124212
Glu3; Fatboy

H9
MR; MelR; MGC151277
Mel1b; Mel-1B-R; MGC129286; MGC129287
FM-3; Gpr66; NMU1R; NmU-R
Nmu2r
Gm236; NPFF1; Gpr147; OT7T022
HG31; Gpr74; NPFF2
GPRA; MVTR; VRR1; PGR14; Gpr154; 9330128H10Rik
Npyr; Y1-R
MGC124241; MGC124242; MGC124244
Y5R; MGC151353; MGC151355
MGC124158
Y4; Npy4r; NYYR-D
Gpr7
NTR1; NT-1R; NTR-1; Ntsr
NT2R; NTRL
Nbor; mDOR; DOR-1
KOR; R21; KOR-1; Oprk2; MGC151172
KOR3; ORL1; Oprl; XOR1; morc; LC132; MOR-C
mor; Oprm; muOR; MOP-R; MOR-1; MOR-1O
Gcp
Bcp; AW551857


Ox1r; MGC141357
OX2R; mOXR2; mOX2aR; mOX2bR
DEZ; Gpcr27; mcmklr1
Ceprl; FEG-1; Gpr30; CMKRL2; GPCR-Br; 6330420K13Rik
MGC41704
GPCR6; Gm365
PAFR
PGR13
PGR8; MGC7035; BC003323
PGR10; 9630018L10Rik
4933439K08Rik



                                          Page 11
                               Sequence of primers used in thi
PGR11; C030001A19Rik
GPCR; PGR7; GalRL; nGPCR-2037; C130082O03Rik
Gm673; A930009H15Rik; Pgr5
GPCR150; 1700025D19Rik
vl; Gm208; Gm208Gpr; Re2
AI853548; MGC99918
H963; A630006E05; F730001G15Rik
Gm1012; MGC62396; Agr9

Ebi2

A430106B11Rik; Gpcr5-1
AW061316; MGC107197; 2900068K05Rik
Gm1300



KPG_007
4933415E13Rik
Gm218

4933402E03Rik


EX33
Strg; AW061286
ERO; Ecpn; panopsin; MGC124138
Gm533; 1110007J02Rik
PGR12; Gpr136; TMEM13; Neuropsin
Gpcr01; Gpcr12; Gpcr20; Gpcr21
Gpcr3; Gpcr20; Gpcr21
P2y5; 2610302I02Rik
Gm376; Fksg79
P2Y10; 5830408N17Rik
PGR3; GPRg1; Gm495
PGR2
MGC130598; C230004C13Rik
EG620246
A730021D22; 9630036A11Rik
AW046772; PSP24alpha; 9230112G11Rik
Psp24-2; PSP24beta
6530406P05Rik; Pgr15
Gir; RP39; RP82; Gpr72; RP105; AW045253

PGR1; AI449320; 1110065N12Rik
A-2; Grca; BC031437
Gm299; Gpr80; Gpr99; P2Y15
PAFR
Pkr1; Gpr73; EG-VEGFR1
PKR2; Gpr73l1; Gpcr73l1; EG-VEGRF2; B830005M06Rik
GR3; Gm339; Gpr10; PrRPR
Crth2; Grp45; MGC130436
DP; PGD
EP1; 42kDa; Ptgerep1
EP2; Ptgerep2



                                          Page 12
                                Sequence of primers used in thi
EP3; Pgerep3; Ptgerep3
EP4; Ptgerep4
fp; PGF; AI957154
IP
TP; TXA2; MGC107665
Cf2r; Par1; ThrR; AI482343; MGC28086
Par2; PAR-2; Gpcr11
PAR3; F730031A08
PAR4
P2Y1
P2Y2
P2Y4; P2Y4R
P2Y6; 2010204J23Rik
Gpr103-l
AQ27; Gpr103; SP9155
Lgr7; Gm1018
Lgr8; Great; Gpr106
Salpr; Rln3r1; GPCR135; BC053073
SALPR; Gpr100; Rln3r2; GPCR142; MGC130215
Gpcr18

Gpcr14; AI853647
Htr1eb
Htr2; Htr-2; MGC124301; MGC124302; E030013E04
5-HT2B; AJ012488; AV377389
SR1; 5HT1c; Htr1c; 5-HT2C; 5-HT2cR; 5-HTR2C
5-HT4; 5-HT<4L>
Htr5
5-Ht5b; MGC141198
5-HT6; MGC144682; MGC144683
5-HT7; MGC151363
sst1; Smstr1; Smstr-1
sst2; SSTR-2; Smstr2; Smstr-2
sst3; Smstr3; Smstr-3
sst4; Smstr4
sst5; Smstr5
G2a

Dig1; TDAG8; Gpcr25
OGR1; BB131428
Edg5; H218; LPb2; S1P2; Gpcr13; 1100001A16Rik
Gm233; AI852874
Edg2; Kdt2; lpA1; vzg-1; Gpcr26; AI326300; MGC29102; 5031439C20
Edg4; IPA2; LPA2
Edg7; lpA3
LPA4; p2y9; Gpr23; 5730485F04Rik
LPA5; GPR93; Gpr92; Gm1072
S1P; Edg1; IpB1; S1P1; lpB1; AI849002
Edg3; LPb3; S1P3; AI132464
Edg6; S1P4; lpC1; MGC129298
Edg8; S1P5; lpB4
Sreb3; 3230401K02Rik

2900026B03Rik; DKFZp761L08121; SREB2
Gpr91



                                            Page 13
                               Sequence of primers used in thi
SPr; NK-1R; NK1-R; Tac1r
Tac2r; MGC129144; MGC129145
Nk3r; Tac3r
Tar1; Trar1
Gm224; Gm225; Gpr58; Tarr2; Trar2
Trar3
Ta2; Gm226; Trar4
Gm227; Trar5
Gm228; Trar6
Gm229; Trar7
Gm698; Trar8
Taar7c; Trar9
Trar10
Gm697; Trar11
Trar12
Gm230; Trar13
Gm1149; Trar14
Trar15
Ta3; Tar3; Gm231; Trar3; Trar16
MGC124380; MGC124381
TRH-R2
UTR; UTR2; Gpr14; UroII
V1a; AVPR; V1aR; Avpr1
VIBR; VPR3; AVPR3; V3/V1b
DI1; DIR; ND1; V2R; ADHR; MGC124213; MGC124214; MGC124215; MGC129321
OTR
R75078; KIAA4089; mKIAA4089; B830018M07Rik

MGC107444; A830096D10Rik
Clr
CRLR; AV071593
Crhr; CRFR1; MGC124237; MGC124240
Crfr2; CRF-R2; CRFR2beta; CRFR2alpha
TM7LN1; AA409984
Ly71; F4/80; Gpf480; TM7LN3; DD7A5-7; EGF-TM7
FIRE; Gpr127; EGF-TM7; D17Ertd479e
lit; Ghrfr; little
GIP-R; Gm160; Gm1081
GR
GLP-1R; GLP1Rc
GLP-2; 9530092J08Rik
AL022669
MGC38240; 9130218E19Rik

AI850306
Lec2; CLIBA; AI182398; MGC109680; mKIAA0821; 2900070I05Rik
Lec1; Gm619; Lphh1; AI450192; MGC38872; mKIAA0786
LEC3; CIRL-3; Gm1379; MGC99439; mKIAA0768; 5430402I23Rik; D130075K09Rik
Etl; ETL1; 1110033N21Rik
Pgr23; Gm1041
PGR27; Gm1109
9130020O16Rik; FLJ14454
E230012M21Rik; Pgr25
Oa1
Cyt28; TM7LN4; TM7XN1



                                          Page 14
                              Sequence of primers used in thi
Pb1; Pb99; AW214383; A030001G24Rik
Mgr1; Mass1; VLGR1; Frings
Gm367; PGR17
DREG; Gm222; AI449247; AW045736; 1190004A11Rik; DJ287G14
Me6; AW212196; B830041D06Rik
KPG_009; 5031409J19Rik; Pgr19
PGR20
AV239010; MGC107333; MGC175941; 4632435A09Rik; Pgr18
AI528491; mKIAA0758; 9330185D23; 8430401C09Rik
D7Ertd680e; 2900059M17Rik; Kiaa1828
Tem5; mKIAA1531; 8430414O08Rik; 9530074E10Rik
AU044632; 3830613O22Rik; Pgr21
PAC1; PAC1R; AI846590; PACAP1-R; 2900024I10Rik
VPAC1; VIP-R1; AV071699
Vip2; VPAC2; VPAC2R
Scy; Crsh
EGFL2; mfmi1; KIAA0279; Flamingo1; mKIAA0279
mKIAA0812
Pthr2
PPR; Pthr; Pthr1
MGC102218; 6530402O03Rik
CaR; Gprc2a
GABAbR1; bM573K1.1
Gb2; Gm425; Gpr51; GABABR2
Rai3; Raig1
Raig2; AW125761
Raig3; MGC6786; MGC11976; 1110028I06Rik; 3200002M13Rik

rcw; wobl; Gprc1a; mGluR1; nmf373; MGC90744; 4930455H15Rik
Gprc1b; mGluR2; mGluR7; 4930441L02Rik
mGlu3; Gprc1c; mGluR3; 0710001G23Rik
Gprc1d; mGluR4
Gprc1e; mGluR5; mGluR5b; AI850523; 6430542K11Rik
Gm3; nob2; nob4; nerg1; Gprc1f; mGluR6; BC021919
Gpr1g; Gprc1g; mGluR7; BB176677; MGC90857; C030018L03; 6330570A01Rik; E130018M02Rik
Gprc1h; mGluR8; A230002O04
Gababl
MGC124360
FZ-1; AW227548
Fz-10
Fz10; Fzd10; Mfz10; Mfz10a; AL033370; AW456835
Fz3; AU020229
Fz4
Fz5; AI427138; MGC141642; 5330434N09Rik
Fz6
Fz7
Fz8; mFZ8
mfz9
Frp; Sfrp3; fritz; frzb-1; frezzled
sFRP-1; AW011917; AW107218; AW742929; 2210415K03Rik
Sdf5; AI851596
bnb; Smoh; E130215L21Rik
Lustr1; AI790205; mKIAA1624; C530034M11; RP23-32C16.2
Lustr2; C79132; AA589464; 1810015L19Rik
40kDa; Tpra40



                                         Page 15
                              Sequence of primers used in thi
NARP1; 2010003B14Rik
AI428855; Tm7sf1l1
C80550; C80741; Tm7sf1; AU016435; AW546472; D13Abb1e; C730041E01
Gm908; TM7SF1L2; 6330416L11Rik




                                         Page 16
                                   Sequence of primers used in thi
Family                Sub-family              Forward Oligo Name
  A      Acetylcholine                       Chrm1-584F
  A      Acetylcholine                       Chrm2-436F
  A      Acetylcholine                       Chrm3-1352F
  A      Acetylcholine                       Chrm4-56F
  A      Acetylcholine                       Chrm5-19F
  A      Adenosine                           Adora1-384F
  A      Adenosine                           Adora2a-16F
  A      Adenosine                           Adora2b-5F
  A      Adenosine                           Adora3-123F
  A      ADP/UDP-glucose                     Gpr87-285F
  A      ADP/UDP-glucose                     P2ry12-89F
  A      ADP/UDP-glucose                     Gpr86-415F
  A      ADP/UDP-glucose                     AF177211-13F
  A      Adrenoceptor                        Adra1a-736F
  A      Adrenoceptor                        Adra1b-362F
  A      Adrenoceptor                        Adra1d-747F
  A      Adrenoceptor                        Adra2a-156F
  A      Adrenoceptor                        Adra2b-373F
  A      Adrenoceptor                        Adra2c-185F
  A      Adrenoceptor                        Adrb1-434F
  A      Adrenoceptor                        Adrb2-155F
  A      Adrenoceptor                        Adrb3-204F
  A      Adrenomedullin                      Admr-2F
  A      Anaphylotoxin                       C3ar1-226F
  A      Anaphylotoxin                       C5r1-347F
  A      Anaphylotoxin                       C5l2-309F
  A      Angiotensin                         Agtr1a-375F
  A      Angiotensin                         Agtr1b-251F
  A      Angiotensin                         Agtr2-775F
  A      Apelin                              Agtr-l1-470F
  A      Bile acid                           Gpbar1-239F
  A      Bombesin                            Brs3-1053F
  A      Bombesin                            Grpr-1037F
  A      Bombesin                            Nmbr-6F
  A      Bradykinin                          Bdkrb-934F
  A      Bradykinin                          Bdkrb2-242F
  A      Cannabinoid                         Cnr1-1200F
  A      Cannabinoid                         Cnr2-9F
  A      Chemokine                           D6-pending-852F
  A      Chemokine                           Cmkbr1-518F
  A      Chemokine                           Cmkbr9-95F
  A      Chemokine                           Cmkbr1l1-131F
  A      Chemokine                           Cmkbr2-653F
  A      Chemokine                           Cmkbr3-857F
  A      Chemokine                           Cmkbr4-477F
  A      Chemokine                           Cmkbr5-219F
  A      Chemokine                           Cmkbr6-697F
  A      Chemokine                           Cmkbr7-196F
  A      Chemokine                           Cmkbr8-44F
  A      Chemokine                           Cmkbr10-988F
  A      Chemokine                           Ccr11-599F
  A      Chemokine                           Cmkbr1l2-421F
  A      Chemokine                           Cx3cr1-371F
  A      Chemokine                           Cmkar3-738F



                                              Page 17
                           Sequence of primers used in thi
A   Chemokine                        Cmkar4-159F
A   Chemokine                        Blr1-250F
A   Chemokine                        Cxcr6-83F
A   Chemokine                        Cmkor1-477F
A   Chemokine                        Il8ra-225F
A   Chemokine                        Cmkar2-751F
A   Chemokine                        Ccxcr1-665F
A   Cholecystokinin                  Cckar-212F
A   Cholecystokinin                  Cckbr-210F
A   CysLt                            Cysltr1-305F
A   CysLt                            Cysltr2-180F
A   Dopamine                         Drd1-693F
A   Dopamine                         Drd2-85F
A   Dopamine                         Drd3-135F
A   Dopamine                         Drd4-895F
A   Dopamine                         Drd5-402F
A   Duffy                            Dfy-710F
A   Eicosanoid                       Puma-g-552F
A   Eicosanoid                       Gpr81-885F
A   Endothelin                        Ednra-566F
A   Endothelin                       Ednrb-384F
A   Endothelin                       Gpr37-742F
A   Endothelin                       AB016602-785F
A   FFA                              Gpr40-723F
A   FFA                              Gpr43-306F
A   FFA                              Gpr41-410F
A   FFA                              Hgpcr2-822F
A   FFA                              Pgr4-333F
A   FMLP-related peptide             Fpr1-882F
A   FMLP-related peptide             Fpr-rs2-365F
A   FMLP-related peptide             Fpr-l1-608F
A   FMLP-related peptide             Fpr-rs3-383F
A   FMLP-related peptide             Fpr-rs4-447F
A   FMLP-related peptide             Fpr-rs6-820F
A   FMLP-related peptide             Fpr-rs7-664F
A   Galanin                          Galr1-84F
A   Galanin                          Galr2-696F
A   Galanin                          Galr3-2F
A   Ghrelin                          Ghsr-300F
A   Gnrh                             Gnrhr-14F
A   Histamine                        Hrh1-956F
A   Histamine                        Hrh2-257F
A   Histamine                        AY044153-1062F
A   Histamine                        Hrh4-401F
A   Hormone protein                  Fshr-1887F
A   Hormone protein                  Lhcgr-1515F
A   Hormone protein                  Tshr-323F
A   KiSS-1                           Gpr54-127F
A   LGR                              Gpr48-2132F
A   LGR                              Gpr49-100F
A   LGR                              Lgr6-2730F
A   Lt                               Ltb4r1-22F
A   Lt                               Ltb4r2-828F
A   Mas-related                       Mas1-265F
A   Mas-related                      MrgA1-763F



                                      Page 18
                            Sequence of primers used in thi
A   Mas-related                       MrgA2-818F
A   Mas-related                       MrgA3-1F
A   Mas-related                       MrgA4-54F
A   Mas-related                       MrgA6-40F
A   Mas-related                       MrgB1-135F
A   Mas-related                       MrgB2-113F
A   Mas-related                       MrgB3-156F
A   Mas-related                       MrgB4-209F
A   Mas-related                       MrgB5-800F
A   Mas-related                       MrgD-471F
A   Mas-related                       MrgE-473F
A   Mas-related                       MrgF-295F
A   Mas-related                       MrgG-469F
A   Mas-related                       Gpr90-6F
A   Melanin-Concentrating Hormone     Gpr24-822F
A   Melanocortin                      Mc1r-547F
A   Melanocortin                      Mc2r-371F
A   Melanocortin                      Mc3r-774F
A   Melanocortin                      Mc4r-252F
A   Melanocortin                      Mc5r-360F
A   Melatonin                         Gpr50-244F
A   Melatonin                         Mtnr1a-215F
A   Melatonin                         Mtnr1b-268F
A   NeuromedinU                       Gpr66-296F
A   NeuromedinU                       Nmur2-378F
A   Neuropeptide FF                   Npff1r-626F
A   Neuropeptide FF                   Gpr74-188F
A   Neuropeptide S                    Pgr14-40F
A   Neuropeptide Y                    Npy1r-526F
A   Neuropeptide Y                    Npy2r-78F
A   Neuropeptide Y                    Npy5r-345F
A   Neuropeptide Y                    Npy6r-696F
A   Neuropeptide Y                    Ppyr1-773F
A   Neuropeptides B/W                 Gpr7-200F
A   Neurotensin                       Ntsr-1177F
A   Neurotensin                       Ntsr2-1046F
A   Opioid/Nociceptin                 Oprd1-367F
A   Opioid/Nociceptin                 Oprk1-116F
A   Opioid/Nociceptin                 Oprl-809F
A   Opioid/Nociceptin                 Oprm-350F
A   Opsin                             Opn1mw-858F
A   Opsin                             Opn1sw-403F
A   Opsin                             Rgr-773F
A   Opsin                             Rrh-6F
A   Orexin/Hypocretin                 Hcrtr1-346F
A   Orexin/Hypocretin                 Ox2r-583F
A   Orphan                            Cmklr1-242F
A   Orphan                            Gpr30-752F
A   Orphan                            Gpr1-832F
A   Orphan                            Gpr101-1506F
A   Orphan                            Cckr-l-1134F
A   Orphan                            Gpr141-343F
A   Orphan                            Pgr8-526F
A   Orphan                            Pgr10-1922F
A   Orphan                            Gpr15-772F



                                       Page 19
                   Sequence of primers used in thi
A   Orphan                   Pgr11-804F
A   Orphan                   Pgr7-480F
A   Orphan                   Pgr5-212F
A   Orphan                   Gpcr150-657F
A   Orphan                   Re2-591F
A   Orphan                   Gpr17-381F
A   Orphan                   BC024054-782F
A   Orphan                   BG969099-380F
A   Orphan                   Gpr18-284F
A   Orphan                   Ebi2-524F
A   Orphan                   Gpr19-393F
A   Orphan                   Gpcr5-1-1531F
A   Orphan                   Gpr22-89F
A   Orphan                   Gpr25-96F
A   Orphan                   Gpr31-224F
A   Orphan                   Gpr33-565F
A   Orphan                   Gpr34-186F
A   Orphan                   Gpr35-460F
A   Orphan                   Gpr39-550F
A   Orphan                   Gpr55-176F
A   Orphan                   Gpr61-1214F
A   Orphan                   Gpr62-54F
A   Orphan                   Gpr75-723F
A   Orphan                   Gpr82-544F
A   Orphan                   Gpr84-627F
A   Orphan                   Gpr88-379F
A   Orphan                   Opn3-386F
A   Orphan                   Opn4-1162F
A   Orphan                   Pgr12-668F
A   Orphan A1                Gpcr12-759F
A   Orphan A1                Gpcr3-283F
A   Orphan A12               P2y5-408F
A   Orphan A13               Fksg79-416F
A   Orphan A13               P2y10-102F
A   Orphan A14               Pgr3-1291F
A   Orphan A14               Pgr2-454F
A   Orphan A2                Gpr21-654F
A   Orphan A2                Gpr52-256F
A   Orphan A3                Gpr26-676F
A   Orphan A6                Gpr45-878F
A   Orphan A6                Gpr63-162F
A   Orphan A7                Pgr15-140F
A   Orphan A7                Gpr83-816F
A   Orphan A7                Pgr15l-91F
A   Orphan A9                Pgr1-904F
A   Orphan A9                Grca-716F
A   oxoglutarate             Gpr80-227F
A   PAF                      Ptafr-366F
A   Prokineticin             Gpr73-57F
A   Prokineticin             Gpr73-l1-192F
A   Prolactin RF             Gpr10-311F
A   Prostanoid               Gpr44-10F
A   Prostanoid               Ptgdr-275F
A   Prostanoid               Ptger1-58F
A   Prostanoid               Ptger2-201F



                              Page 20
                           Sequence of primers used in thi
A   Prostanoid                       Ptger3-883F
A   Prostanoid                       Ptger4-1374F
A   Prostanoid                       Ptgfr-16F
A   Prostanoid                       Ptgir-955F
A   Prostanoid                       Tbxa2r-514F
A   Proteinase-activated             F2r-1046F
A   Proteinase-activated             F2rl1-1061F
A   Proteinase-activated             F2rl2-549F
A   Proteinase-activated             F2rl3-117F
A   Purinoceptor                     P2ry1-439F
A   Purinoceptor                     P2ry2-884F
A   Purinoceptor                     P2ry4-187F
A   Purinoceptor                     P2ry6-50F
A   QRF                              Gpr103-l-436F
A   QRF                              Gpr103-564F
A   Relaxin                          Lgr7-1187F
A   Relaxin                          Gpr106-1819F
A   Relaxin                          Salpr-862F
A   Relaxin                          Salpr-862F
A   Serotonin                        Htr1a-865F
A   Serotonin                        Htr1b-236F
A   Serotonin                        Htr1d-93F
A   Serotonin                        Htr1f-80F
A   Serotonin                        Htr2a-615F
A   Serotonin                        Htr2b-432F
A   Serotonin                        Htr2c-721F
A   Serotonin                        Htr4-629F
A   Serotonin                        Htr5a-147F
A   Serotonin                        Htr5b-906F
A   Serotonin                        Htr6-192F
A   Serotonin                        Htr7-998F
A   Somatostatin                     Smstr1-111F
A   Somatostatin                     Smstr2-719F
A   Somatostatin                     Smstr3-298F
A   Somatostatin                     Smstr4-896F
A   Somatostatin                     Smstr5-339F
A   SPC/LPC                          G2a-560F
A   SPC/LPC                          Gpr4-687F
A   SPC/LPC                          Gpcr25-2F
A   SPC/LPC                          Gpr68-653F
A   Sphingolipid/LPA                 Edg5-617F
A   Sphingolipid/LPA                 Gpr6-986F
A   Sphingolipid/LPA                 Edg2-959F
A   Sphingolipid/LPA                 Edg4-928F
A   Sphingolipid/LPA                 Edg7-37F
A   Sphingolipid/LPA                 Gpr23-304F
A   Sphingolipid/LPA                 Gpr92-272F
A   Sphingolipid/LPA                 Edg1-672F
A   Sphingolipid/LPA                 Edg3-234F
A   Sphingolipid/LPA                 Edg6-678F
A   Sphingolipid/LPA                 Edg8-26F
A   SREB                             Sreb3-917F
A   SREB                             Gpr27-980F
A   SREB                             Gpr85-369F
A   succinate                        Gpr91-207F



                                      Page 21
                               Sequence of primers used in thi
A   Tachykinin                              Tacr1-93F
A   Tachykinin                              Tacr2-143F
A   Tachykinin                              Tacr3-144F
A   Trace amine                             Tar1-pending-170F
A   Trace amine                             Trar2-174F
A   Trace amine                             Trar3-521F
A   Trace amine                             Trar4-288F
A   Trace amine                             Trar5-682F
A   Trace amine                             Trar6-435F
A   Trace amine                             Trar7-674F
A   Trace amine                             Trar8-798F
A   Trace amine                             Trar9-517F
A   Trace amine                             Trar10-753F
A   Trace amine                             Trar11-231F
A   Trace amine                             Trar12-511F
A   Trace amine                             Trar13-54F
A   Trace amine                             Trar14-279F
A   Trace amine                             Trar15-54F
A   Trace amine                             Trar16-19F
A   TRH                                      Trhr-1F
A   TRH                                     Trhr2-900F
A   Urotensin                               AF441863-278F
A   Vaso/Oxy                                Avpr1a-1153F
A   Vaso/Oxy                                Avpr1b-1177F
A   Vaso/Oxy                                Avpr2-507F
A   Vaso/Oxy                                Oxtr-508F
B   Brain-specific angiogenesis inhibitor   Bai1-3861F
B   Brain-specific angiogenesis inhibitor   Bai2-2056F
B   Brain-specific angiogenesis inhibitor   Bai3-2859F
B   Calcitonin                              Calcr-126F
B   Calcitonin                              Calcrl-158F
B   CRH                                     Crhr-471F
B   CRH                                     Crhr2-392F
B   DAF                                     Cd97-1424F
B   EGF-like, mucin-like receptor           Emr1-1949F
B   EGF-like, mucin-like receptor           Emr4-1085F
B   GHRH                                    Ghrhr-376F
B   GIP                                     Gipr-1067F
B   Glucagon                                Gcgr-680F
B   Glucagon                                Glp1r-82F
B   Glucagon                                Glp2r-715F
B   Gpcr modif.                             Crcp-180F
B   Gpcr modif.                             Ramp1-95F
B   Gpcr modif.                             Ramp2-442F
B   Gpcr modif.                             Ramp3-53F
B   Latrophilin                              Lphn1-1204F
B   Latrophilin                             Lec1-3515F
B   Latrophilin                             Lec3-1927F
B   Orphan                                  Etl1-58F
B   Orphan                                  Pgr23-245F
B   Orphan                                  Pgr27-600F
B   Orphan                                  FLJ14454-732F
B   Orphan                                  Pgr25-267F
B   Orphan                                  Oa1-1008F
B   Orphan                                  Gpr56-848F



                                             Page 22
                                 Sequence of primers used in thi
  B     Orphan                             Gpr97-125F
  B     Orphan                             Vlgr1-17448F
  B     Orphan B1                          Gpr112-98F
  B     Orphan B1                          DJ287G14-1045F
  B     Orphan B1                          Gpr64-694F
  B     Orphan B2                          Pgr19-956F
  B     Orphan B2                          Pgr20-773F
  B     Orphan B2                          Pgr18-1271F
  B     Orphan B2                           Kiaa0758-3541F
  B     Orphan B3                          Kiaa1828-171F
  B     Orphan B3                          Tem5-2806F
  B     Orphan B3                          Pgr21-1076F
  B     PACAP/VIP                          Pac1-622F
  B     PACAP/VIP                          Vipr1-303F
  B     PACAP/VIP                          Vipr2-970F
  B     Proto-cadherin                     Celsr1-5097F
  B     Proto-cadherin                     Celsr2-6458F
  B     Proto-cadherin                     Celsr3-1241F
  B     PTH                                AF332078-1109F
  B     PTH                                Pthr-215F
  B     Secretin                           Sctr-561F
  C     Calcium-sensing                    Casr-1217F
  C     GABA-B                             Gabbr1-2205F
  C     GABA-B                             Gb2-2523F
  C     Gprc5                               Rai3-689F
  C     Gprc5                              Gprc5b-551F
  C     Gprc5                              Gprc5c-292F
  C     Gprc5                              Gprc5d-402F
  C     Metabotropic glutamate             Glur1-1236F
  C     Metabotropic glutamate             Grm2-990F
  C     Metabotropic glutamate             Gprc1c-352F
  C     Metabotropic glutamate             Grm4-3579F
  C     Metabotropic glutamate             Grm5-1200F
  C     Metabotropic glutamate             Grm6-797F
  C     Metabotropic glutamate             Grm7-1582F
  C     Metabotropic glutamate             Gprc1h-1535F
  C     Orphan                             Gababl-pending-973F
  C     Orphan                             Gprc6a-598F
 F/S    Frizzled                           Fzd1-1472F
 F/S    Frizzled                           Fzd10-703F
 F/S    Frizzled                           Fzd2-1270F
 F/S    Frizzled                           Fzd3-1846F
 F/S    Frizzled                           Fzd4-1214F
 F/S    Frizzled                           Fzd5-1046F
 F/S    Frizzled                           Fzd6-1061F
 F/S    Frizzled                           Fzd7-1164F
 F/S    Frizzled                           Fzd8-125F
 F/S    Frizzled                           Fzd9-558F
 F/S    Fz modif.                          Frzb-236F
 F/S    Fz modif.                          Sfrp1-303F
 F/S    Fz modif.                          Sfrp2-696F
 F/S    Smoothened                         Smoh-1574F
Lustr   Lustr                              Lustr1-649F
Lustr   Lustr                              Lustr2-212F
Tm7sf   Orphan                             Tpra40-343F



                                            Page 23
                    Sequence of primers used in thi
Tm7sf   Orphan                Tm7sf3-293F
Tm7sf   Orphan N1             Tm7sf1l1-942F
Tm7sf   Orphan N1             Tm7sf1-275F
Tm7sf   Orphan N1             Tm7sf1l2-1287F




                               Page 24
                         Sequence of primers used in thi
     Forward Oligo Sequence    Reverse Oligo Name
CCGCCTTCTACCTCCCTGTC          Chrm1-634R
GCTGCGTGGGTTCTTTCCT           Chrm2-500R
CCGCTCTACCTCTGTCCTTCA         Chrm3-1426R
TCACAACAGCCCACAACCAC          Chrm4-106R
TACATCCTCATGGGACGCTG          Chrm5-69R
AGCCGGCTGCTGGATTC             Adora1-447R
TACATCATGGTGGAGCTGGC          Adora2a-66R
AGCTAGAGACGCAAGACGCG          Adora2b-55R
CCCCACTCTGAGGACCACC           Adora3-173R
CCCATTCCGAATAGTCCGTG          Gpr87-335R
CCCAGGTTCTCTTCCCATTG          P2ry12-139R
AAGACGGCTTTCGCAAAAAC          Gpr86-465R
ACCACCACAGACCCTCCAAA          AF177211-63R
GCGGAGTAAGCAGTGCCAA           Adra1a-786R
CAGCGGTTGATGTCCTGTGT          Adra1b-412R
GATCTTCTCTTCCGTATGCTCCTT      Adra1d-817R
GCTGGTTATTATCGCGGTGTTC        Adra2a-224R
ACTCCACGCCGCATCAA             Adra2b-433R
TCGTTTTCACCGTGGTAGGC          Adra2c-235R
GCATTGAGACCCTGTGTGTCA         Adrb1-509R
CTTTCTACGTGCCCCTGGTG          Adrb2-205R
AACCAACGTGTTCGTGACTTCA        Adrb3-276R
TGTCAGTCATACCCAGCCCC          Admr-52R
CCCTTCTCCTTGGCTCACCT          C3ar1-276R
TCCTGCTCAACATGTACGCC          C5r1-397R
GGGCCACTGGCCATACG             C5l2-382R
TCGCTACCTGGCCATTGTC           Agtr1a-442R
GGGCAGTTTATACCGCTATGGA        Agtr1b-319R
GCTGCTGTTGTGTTGGCATT          Agtr2-825R
TTCTAGCTGTGCCTGTCATGGT        Agtr-l1-536R
GCTACTGGTCCTGCCTCCTTCT        Gpbar1-310R
GCAGCCTGAGCCTCCTCTT           Brs3-1114R
TGAACAGGTCCCACAGCACA          Grpr-1087R
CCCCAGGTCTCTCTCCAACC          Nmbr-56R
AGCTGCCTGAACCCACTGAT          Bdkrb-984R
TGGCCTGCGGGTTACCT             Bdkrb2-305R
GAGGAGCAAGGACCTGAGACA         Cnr1-1262R
ATGCCGGGAGACAGAAGTGA          Cnr2-59R
GATCAGCCACCGTCTGGACT          D6-pending-902R
AGGCCCAGTGGGAGTTCAC           Cmkbr1-586R
ACAAGGCTGATGTCCAGGCT          Cmkbr9-145R
TGGTGTTCATCATTGGCGTG          Cmkbr1l1-181R
TGAGAAATATCTTGAGCCTGATCCT     Cmkbr2-732R
CCATGCAGGTGACTGAGGTG          Cmkbr3-907R
GATCACGTGGTCAGTGGCTG          Cmkbr4-527R
CTTGGCCATCTCTGACCTGC          Cmkbr5-269R
TTGGTGCAGGCCCAGAA             Cmkbr6-762R
TCTGTCATCTGCTTCGTGGG          Cmkbr7-246R
ACCCTGATTTCTTCACCGCC          Cmkbr8-94R
AAGACCCTGAAGAACCTGGGA         Cmkbr10-1038R
TTCAGATGCTGGAAATCGGC          Ccr11-649R
CGACTGGCCTCCATCTTCAC          Cmkbr1l2-471R
TCAGCATCGACCGGTACCTT          Cx3cr1-435R
CCAGAGGCGTTTTCGAGCTA          Cmkar3-788R



                                    Page 25
                       Sequence of primers used in thi
TGGCATAGTCGGCAATGGA         Cmkar4-225R
ACTCGGAGCTCAACCGAGAC        Blr1-300R
ACAGCCAGGAGAACAAACGC        Cxcr6-133R
GGTACGCCGTGTTGTATGCA        Cmkor1-540R
CCGATCCGTCATGGATGTCT        Il8ra-294R
GTCATCTTCGCTGTCGTCCTT       Cmkar2-801R
TCTTCACCGTCGTGGTAGCA        Ccxcr1-715R
GGATGCGGACTGTCACCAAC        Cckar-262R
CGGAAACGTGCTCATCATTG        Cckbr-273R
GCAAGTGGCTCTTTGGTGACT       Cysltr1-380R
CATGCTCAACCTGGCCACTT        Cysltr2-230R
GGAGAGGGCAGCAGTCCAT         Drd1-759R
GCAGACAGGCCCCACTACAA        Drd2-135R
TGGCAACGGTCTGGTATGTG        Drd3-185R
AGAAGGAGAGGCGCCAAGAT        Drd4-945R
GGACCGGTACTGGGCTATTTC       Drd5-466R
CTGGCCCCTGGGTTAGTGT         Dfy-782R
GTGGCACGATGCTATGTTCCT       Puma-g-619R
CAGCCTGAAGCCCAAACG          Gpr81-949R
CCTGGAGCCGAGTTCAAG           Ednra-615R
GAACAAGTGCATGCGCAATG        Ednrb-434R
GCCTATGCGGTCATGTGCTTA       Gpr37-810R
ACCTCCTGGGCCTCATCAAC        AB016602-835R
TGCCTCCAATGTGGCTAGTTT       Gpr40-795R
CATCAGCATGGAACGCTACCT       Gpr43-369R
TCCTGGCATCGGCTCACT          Gpr41-479R
CAACCCACTCATCTATGCCTATTG    Hgpcr2-888R
CCACCTGCTCTTCTACGTGATG      Pgr4-394R
GAAAATCACAAGCCCCTTGG        Fpr1-932R
ACCGCTGCATTTGTGTTCTG        Fpr-rs2-415R
TCATCAGGTTCATTGTTAGCTTCAG   Fpr-l1-688R
TGCACCCAGTATGGGTTCAG        Fpr-rs3-451R
TTGGATATTTGCTCTGCTGCTTAC    Fpr-rs4-517R
AATATTGACGCGTGGGTGAAC       Fpr-rs6-892R
GGACTCATGGCTGCCAAGA         Fpr-rs7-736R
CATTGGCGTGGAGAACTTCA        Galr1-134R
GACACGGATGATCGTCATCG        Galr2-746R
TGGCTGACATCCAGAACATTTC      Galr3-90R
CCGCCTCTGGCAGTATCG          Ghsr-365R
CATCTCTTGAGCAGGACCCAA       Gnrhr-64R
GCTCAAAGGCCAATGACCAG        Hrh1-1006R
TTGGCCAGGTCTTCTGCAAC        Hrh2-307R
GAAGGTAGCCAAGTCGCTGG        AY044153-1112R
CTCAAATGGTGGCTGTTTGGA       Hrh4-451R
CAAGAACTTCCGCAGGGACTT       Fshr-1956R
CCTTGTGGGTGTCAGCAGTTAC      Lhcgr-1587R
TCCGGAACACCAGAAGCTTAA       Tshr-373R
TGGCTGGTTCCCCTGTTTT         Gpr54-201R
CCATCAGCCCCGAGATAATG        Gpr48-2203R
TGCCCATCACACTGTCACTGT       Gpr49-150R
CAGGCTGGAGGGAAACCA          Lgr6-2802R
CCTGCAGCACCTTCTTCTCC        Ltb4r1-72R
GGCTTTCTTCAGTTCCAGCG        Ltb4r2-878R
GACTATGCTTTAGACTATGAACTC     Mas1-329R
TGTGCCAACCCCATCATTTA        MrgA1-813R



                                  Page 26
                       Sequence of primers used in thi
AGCACCAGACCCTCAAAATGG       MrgA2-868R
ATGAACGAAACCATCCCTGG        MrgA3-51R
CATCGAGACCCTGATCCCAA        MrgA4-104R
TTGATGATCGTCATCCTCGG        MrgA6-90R
GGTTGGAAATGCCACAGTGTT       MrgB1-185R
AAGCCATGATTTTGCTTTCCA       MrgB2-163R
GGGCTTCCAGATATGCAGGA        MrgB3-206R
TGGCTGGTGCTGATTTCTTG        MrgB4-259R
ACAGCTGTGCCAATCCCATC        MrgB5-850R
GATGAACTTCCTGGCTTCTTTCTT    MrgD-539R
GCACCCAGTTCTTTGGAGCA        MrgE-523R
GGGCTCTGCACATTCTTCACA       MrgF-345R
TGCCTCAAGTACCATTGGACC       MrgG-519R
GCCATTGGCAATGACCTTGTA       Gpr90-56R
GCTGCAGCTGACCCAGTTG         Gpr24-885R
CACACAGCCGTTCTGCTCTG        Mc1r-597R
TTGCAGCTGACCGTTACATCA       Mc2r-437R
CTTCCTCCACCTGGTCCTCA        Mc3r-824R
TAGCCTGGCTGTGGCAGAT         Mc4r-318R
CTATGTGGGCAGCTTAGCCG        Mc5r-410R
GACATGCTGGTGGCCATCT         Gpr50-308R
TAGCTGTGGCAGACCTCGTG        Mtnr1a-265R
CTCCAGGCCCGAAGGAA           Mtnr1b-341R
TGAGTGTGGAGCGTTATGTGG       Gpr66-346R
TCTCAGTGTCACCACGGTTAGC      Nmur2-439R
CGCGAGAGGAGCATCACTTC        Npff1r-695R
ATACTGTCGTTTGCTTTATTGTG     Gpr74-330R
CAGACTGTGCCGATGCTAGATT      Pgr14-113R
CAAATTCTGACCGACGAGCC        Npy1r-576R
GCCAGGGCACACTACTCCTAGA      Npy2r-155R
CTCCCCTTTCACCCTGACCT        Npy5r-395R
CGTTCTCTGCCTCCGAAAAA        Npy6r-770R
GGCAGATGAAGCGGATCAAC        Ppyr1-823R
CGCCGCGCATGAAGA             Gpr7-263R
CGCCGCCGAAAGAAGAG           Ntsr-1240R
ATGTCAGCTCGGCAGTGACC        Ntsr2-1096R
GCTGTGCTCTCCATTGACTACTACA   Oprd1-437R
ATGGCAGTGTGGGCTCAGAG        Oprk1-166R
TGGGCTGCTGGACACCTG          Oprl-877R
CCACTAGCACGCTGCCCTT         Oprm-400R
TACTGCCCACCCTGGCTATG        Opn1mw-908R
TGTAAACCCTTCGGCAGCAT        Opn1sw-468R
CCACAATCAACGCCATCAAC        Rgr-843R
GAGTGAGGCTTCGGATTTTAACA     Rrh-79R
TGGTACCACATCAGCCTTGGT       Hcrtr1-410R
GCCAAACGGGCTCGAAA           Ox2r-653R
TGGCCGACTTCCTGTTCAAC        Cmklr1-292R
GCCCACGCAGGCAGAA            Gpr30-821R
AATGTGCTGCAGGGTGGAA         Gpr1-901R
CATCACTGAATTTCAGGCTAGCA     Gpr101-1575R
GCCTAGCCAAGGCCTAGGTT        Cckr-l-1196R
CTCATCTTCTTCAAGCGTAG        Gpr141-446R
GAGTGTGCCCGGATGCA           Pgr8-588R
TCAGCCAATCCTCCACAAAAG       Pgr10-1995R
AACACTTTCAAGCTCCTAGCCATT    Gpr15-841R



                                  Page 27
                       Sequence of primers used in thi
CAGTATGGCCAGAGCCTCCTT         Pgr11-869R
AGTGCTGGCGGGCATCT             Pgr7-546R
TCAGCTTGGCCCTCTCTGA           Pgr5-287R
GGCCGCCCTCTACTTTCCT           Gpcr150-729R
GCCGTTCGTGGTGACTAGCT          Re2-665R
CGCCTTCCTGTGGATCGT            Gpr17-458R
TCGCACTCTTCAAAGCCAAA          BC024054-853R
GGCGCAATGAGGATTTCGT           BG969099-449R
GCATCTTCCTGATTGGGCTG          Gpr18-334R
CCACTTGCATGGAGTATCCAAA        Ebi2-590R
GTGCAAGGTGGTCCGCTACT          Gpr19-457R
AAGGCCGTGTGCATCTTTGT          Gpcr5-1-1598R
AAAACACCAACTGCTCCAAAAGA       Gpr22-170R
CCTGGACCAAGTGGAGTTGTG         Gpr25-166R
TGAAGGGCAAGACCTGGAAA          Gpr31-291R
TGGGAGAGCAAAGAGCATCA          Gpr33-630R
GGTTGGAAACATCATTGCCC          Gpr34-236R
ATGCAGGAGGGTGGCTTCT           Gpr35-523R
CCCACTCACAAGGGACTCAAC         Gpr39-616R
CTATCTACATGATCAACTTGGCTGTTT   Gpr55-251R
CCCCTGTTGTTGACTTTCGAA         Gpr61-1284R
TATCCTGGCGGTTCTCGTAGA         Gpr62-161R
CTGTGTGGTCATCGTGTTGTCA        Gpr75-792R
GAAGGACAGAGCCAGTGCTACA        Gpr82-611R
TCGAGCACTGGACCAATACG          Gpr84-677R
TCCCTTCTGTCCCATTGCC           Gpr88-429R
CCCTCACTGTGCTGGCCTAT          Opn3-436R
TCCACATTGAGCAGCCAGTC          Opn4-1212R
TCCTGATTGCCTGGATTCCT          Pgr12-734R
GGCTCTCATCCTAGGGACCTTT        Gpcr12-829R
CTGCACTTTGCGGCTGACT           Gpcr3-346R
TTGCATTGCTGTGTGGTTCAC         P2y5-477R
TTATTGGCTGGCTGATCATCTG        Fksg79-491R
CCCGGGTCTCCTGGCTAA            P2y10-170R
CCTTGGCTGGTCCACATCAT          Pgr3-1362R
TCAGTCTGGATTGCAGTCTTGTTC      Pgr2-525R
CCAGCAGCACACAAAAGAAATC        Gpr21-723R
GCTGACCTCCTCGTTGGAGTT         Gpr52-335R
GAACGGTGTCTGGAGGAACAG         Gpr26-747R
TCAGCCGGCGGTTCTATTAC          Gpr45-928R
TGAAACCATGACTAGCCCTGG         Gpr63-212R
TGCTTCAGGCTGCATCCA            Pgr15-208R
TGGCGACGTGACCACAGA            Gpr83-880R
TCAATAGAGGATCAAAGCTGCAAT      Pgr15l-168R
CGTTACCGGGCGGATCT             Pgr1-970R
TTGAGGTGCCAGCCATTGT           Grca-789R
CCTTGACGGACTTGCTGTATCTG       Gpr80-297R
CATCAAGACTGCACAGGCCA          Ptafr-416R
CTTTTCTGCACTCGATGGCC          Gpr73-107R
CGGCATTGGCAACTTTGTCT          Gpr73-l1-252R
TGTCCGACGTGCTCATGTGT          Gpr10-379R
GTCACACTGAAGCCGCTCTG          Gpr44-60R
TAAAGGAACTGCTGCCTGCC          Ptgdr-325R
CCCAGGCTCCCCAATACAT           Ptger1-142R
GTTTCACGTGCTGGTAACGGA         Ptger2-251R



                                   Page 28
                       Sequence of primers used in thi
ATGGGAAAGGAGAAGGAGTGC       Ptger3-933R
TTTGCGAATTTCCGAGACCT        Ptger4-1424R
TCCAAGCAGCCAGTGTCTCC        Ptgfr-66R
TGGGTCTTCATCCTTTTCCG        Ptgir-1005R
TACAGTGTGCAGTACCCCGG        Tbxa2r-564R
CTGGTACGGAGGCAGCCTAC        F2r-1096R
GGGATCACGCCAGAAACG          F2rl1-1124R
CACCTGCATGGGCATCAAC         F2rl2-618R
CCCTCTGGGTCCCACAGTAG        F2rl3-167R
GCACACAGGTACAGTGGCGT        P2ry1-489R
CCAGCGCCAACAGTTGTCTT        P2ry2-934R
TGGGATGCAACAGCCACTTA        P2ry4-237R
CCTGCGTCTACCGTGAGGAT        P2ry6-115R
CACATCTGCTGCCTGGAAGA        Gpr103-l-505R
GGCCAGCCCCATGCA             Gpr103-631R
TTCTCGCCAAACGCTTTTTC        Lgr7-1257R
GCAGAAGTGAGGAGCCACATC       Gpr106-1893R
CTGTTGCTTGTGCGCTTCAT        Salpr-926R
CTGTTGCTTGTGCGCTTCAT        Salpr-926R
ACCCTGGAGGTGATCGAGGT        Htr1a-915R
CGGCTAACTACCTGATCGCC        Htr1b-286R
GCAGGCTCTCAGAATCTCGC        Htr1d-143R
CCCTCACTCTGTCTGGGCTG        Htr1f-130R
TATATCCATGCCAATCCCAGTCT     Htr2a-685R
TCTCTGTGCCATTTCCCTGG        Htr2b-482R
GTCCTACGCCGTCAAACCCT        Htr2c-771R
TGGCCTATTACCGAATCTATGTCA    Htr4-703R
TCTAGCTGCGGCCACATTC         Htr5a-197R
CTTGATTGGCGTGTTTGTGC        Htr5b-956R
CCTGGTGTCGCTCTTCACGT        Htr6-242R
GGATCATCGTGGGAGCCTT         Htr7-1048R
CATGGAAGAGCCTGGACGAA        Smstr1-161R
TCCGAGTGGGATCATCCAAG        Smstr2-769R
TTCCTGGCTGCTCAGAACG         Smstr3-348R
ACAGCTGTGCCAATCCCATT        Smstr4-946R
GACGCTGGACGGCATCA           Smstr5-408R
CCCTGAGGATGAACAGCAAGA       G2a-627R
GAGCCTCATCGCCATTGTG         Gpr4-754R
TGGCGATGAACAGCATGTG         Gpcr25-67R
CACAGAAGAGCCGCAAGGA         Gpr68-724R
TGGCTCTGTACGTCCGAATCT       Edg5-684R
TCTATGCCTTCCGCA ACCA        Gpr6-1053R
CCACCTTCAGGCAGATCCTG        Edg2-1009R
ATGTGTCTCCGCTGGTCCAG        Edg4-978R
TTCTACAACAGGAGCAACACAGACA   Edg7-107R
CGCCACTGGCCTTTTGG           Gpr23-379R
GGCCTTTTCCAGGCTTCCT         Gpr92-337R
CTACTCCTTGGTCAGGACTCGAA     Edg1-737R
CATCGGCAACTTGGCTCTCT        Edg3-284R
GGCCATCTTTAGAGTGGTCCG       Edg6-728R
CGCCGGTGAGTGAGGTTATT        Edg8-76R
GCTACTGGCGAGTGTTTGTGAA      Sreb3-981R
CGGTGTGGCTGACATTCG          Gpr27-1072R
CGCCCATCACCGCTTCTATA        Gpr85-419R
GTGCACCCTTCCCATCCTG         Gpr91-257R



                                  Page 29
                       Sequence of primers used in thi
AATTGTCCTTTGGGCAGCC           Tacr1-143R
TAACAGGCAACGCCACAGTC          Tacr2-193R
AGTGACATCCCAGGCACCTT          Tacr3-194R
CCAACTGGCTCCTTCACTCC          Tar1-pending-220R
TGGATCTTGCCCAGAGAATGA         Trar2-240R
CTGGTATGCAGAGCTACGAGATTC      Trar3-594R
TGCTGCTGCAAACAGTTCTTG         Trar4-352R
AGGCAGGCTCAGCAGATCA           Trar5-750R
GGTGTCTGTGTCTGGAATTTGC        Trar6-502R
AACAGCAGGCTCAGAACATTGA        Trar7-748R
GAGAGAGAGGAAAGCAGCCAAA        Trar8-868R
GCTAAACAGCAGGCTCAGAACA        Trar9-592R
GCAGACTGCCAGAGCATCAG          Trar10-823R
GCTGCACTCTCCTGCCAACT          Trar11-299R
TCCTGGCTCCTGTCCATCAG          Trar12-581R
TGGATCCTGTATTAAAACTCCCTATTC   Trar13-124R
TGGATCCTGTATTAAAACTCCCTATTC   Trar14-348R
TGGATCCTGTATTAAAACTCCCTATTC   Trar15-124R
CCAGAACCGCCCATGGA             Trar16-90R
ATGGAGAATGATACTGTC             Trhr-96R
CAGTGCCATCAACCCTGTCA          Trhr2-978R
CCCTGGCTGACCTGCTGTAT          AF441863-328R
AGCATGAGCCGGAGACAGAC          Avpr1a-1203R
AGCCTCCATGCAAAGCCTAA          Avpr1b-1237R
TCTCAGCCTGCCTCAGCTCT          Avpr2-557R
CCGCAGGTGCACATTTTCT           Oxtr-575R
CGGTTCACCCCGCTATCC            Bai1-3961R
CGTGTTGTGGAAGATTTCATTCA       Bai2-2137R
GGCTTCATTCTGTTGGGTCTTG        Bai3-2934R
GGTTGGCCGCAAGAAGCT            Calcr-203R
AGGACCCCATTCAACAAGCA          Calcrl-208R
CCTCATCTCGGCTTTCATCC          Crhr-521R
ATTACCGAATCGCCCTCATTG         Crhr2-442R
AGCCACGTCACGAGCTGATA          Cd97-1494R
TCAGCCATGTGGGTACAGTCA         Emr1-2015R
TGTGCCGACCCATTCAGAAT          Emr4-1159R
TTCTCCACGGTGAAGATCATCTAC      Ghrhr-440R
TGACGGAGGAACAGGTTGAAG         Gipr-1139R
TGGCCACAGTGATCATGCA           Gcgr-747R
ACCACGGTGTCCCTCTCAGA          Glp1r-132R
TGGTTGCTGGTTGAAGGACTTTA       Glp2r-788R
CCAGAGTCCAGCGATTGTCC          Crcp-230R
ATGGGACTCTCATCCAGGAGC         Ramp1-145R
GTGCAGCCCACCTTCTCTGA          Ramp2-492R
GTGGTGAGTGTGCCCAGGTA          Ramp3-103R
AACCACCTACTGACCAAC             Lphn1-1267R
TCCCGGTTAAACCGGTGAT           Lec1-3579R
AACAACCTCCTTCAGCCACAA         Lec3-1997R
CAAAACTGCAGCAAGACAACGT        Etl1-126R
TCGTCTGCCTGGCTATTTACG         Pgr23-312R
GAGCCCTGAGGGCTGTTATACA        Pgr27-664R
AGGTGATCAGACAGTGGTGGAA        FLJ14454-809R
TTACTTCTTCCTGACCGCCTTT        Pgr25-338R
TGCTGAGGGCACGTACCA            Oa1-1085R
ATGACGCCAAGAGGCTCCT           Gpr56-898R



                                   Page 30
                       Sequence of primers used in thi
GCTGTGGACCACCTTTAATTCAC      Gpr97-198R
TGTGAAAGGTCAGAGTGCACAA       Vlgr1-17529R
CTTTGAAGCAGGCCCTTGAG         Gpr112-191R
ACCCTGAGAGAAGAGGTTTTAAGAAA   DJ287G14-1114R
CAGGATCCCATTGTCTGTCTTG       Gpr64-760R
AGGCGGGTGTGGCATCT            Pgr19-1022R
GCGGCCACCTTGCTGAT            Pgr20-837R
TGGTCATTGAGGCCATCGT          Pgr18-1335R
GCGTTGATTATTGTGGTG            Kiaa0758-3649R
CGCACTCCTCAACTTCTGCTT        Kiaa1828-248R
TGTGCAGGCCTTCACTTACG         Tem5-2901R
CCTGCTCCGTGTTCCAGAA          Pgr21-1140R
TGGATCTTGTATGCCGAGCA         Pac1-672R
CAGCCGTAACTGCACTGAAGAA       Vipr1-370R
AGGCTTGCCAAGTCCACACT         Vipr2-1038R
TGAACAAGCTATGCCACACCC        Celsr1-5147R
TGCGGCACACCTACCTAAGC         Celsr2-6508R
TAGCTGACCGCAACGATCAC         Celsr3-1291R
GCGTGCATTACATCGTGTTTG        AF332078-1184R
CATCTACGTCAGGGAAGCCC         Pthr-265R
TCGCAACTACATCCAAATGCA        Sctr-644R
CCCCTTACATGGGCTACGAA         Casr-1290R
CTTTGTGCCTAAGATGCGCA         Gabbr1-2255R
CAGCAAGCGTTCGGGTGTA          Gb2-2597R
TCGTTCTGCTCCTGATTC            Rai3-801R
CTGTGCTGCGTGACACGAA          Gprc5b-611R
GGTCTCTTCTGCCTCGTGTTTG       Gprc5c-357R
CGGTGTCAGCCTGTTGCA           Gprc5d-474R
TGTCATCAACGCCATCTATGC        Glur1-1310R
CGCTCTCTGCA CGCTCTATG        Grm2-1059R
AAGCCATCGCCTGTCATCTG         Gprc1c-402R
GATGCTCTACATGCCCAAAGTCTAC    Grm4-3670R
TGACCCTGAGCCCATTGC           Grm5-1263R
TCATGGCCACCACAACTATCA        Grm6-865R
AAGCCTGGGCAGAGGAAGA          Grm7-1650R
CAGCATCTGTCTGCAGCCTG         Gprc1h-1585R
ATGAGACACATGGCCAAATACTTC     Gababl-pending-1044R
GCCCACCTGATCCGACAA           Gprc6a-676R
TCGTTTATCTGTTCATTGGCACTT     Fzd1-1535R
TGGTCCGTGCTGTGCTTCT          Fzd10-767R
CCGCTCTTCGTATACCTGTTCA       Fzd2-1340R
CGGCTGACGGATCATTCC           Fzd3-1921R
TCATTGCGGCGGGTTT             Fzd4-1281R
TCGCAGGTTATGCACAGTACTTC      Fzd5-1113R
GCGGCGTTTGCTTCGTT            Fzd6-1127R
GGTCAAGACAATCACCATTTTGG      Fzd7-1234R
TGTGCAAAGGCATCGGTTAC         Fzd8-175R
GCTGGTTTGGATGGCTGTGT         Fzd9-608R
ACTGCAGCCCGGATCTTCT          Frzb-303R
CAACAAGAACTGCCACATGGG        Sfrp1-353R
GAAGAAATCCGTGCTGTGGC         Sfrp2-746R
GGCTGGTTGAGGCAGAGATC         Smoh-1645R
GGCCTCTACAGCCTTTACTTCCA      Lustr1-721R
TCAGCCTCCAGGAGACAGAAA        Lustr2-262R
TGGGAAATCACCCGCTTCT          Tpra40-408R



                                  Page 31
                         Sequence of primers used in thi
CGGAGCAGGCAGTGTGTACTT         Tm7sf3-363R
TTTTGGCTCCCGATCCTACTT         Tm7sf1l1-1006R
ACTCGTTCAGCCCCTTCGT           Tm7sf1-345R
GGCTTTCTTTTTCGACAATCCA        Tm7sf1l2-1357R




                                    Page 32
                           Sequence of primers used in thi
       Reverse Oligo Sequence
AGATGCGCCAGTACAGCGTA
CCTACGATGAACTGCCAGAAGAG
TGGTGATCTGACTTCTGGTCTTGA
TCGCAATGAACACCATCTCC
CCAAAGGTCACAGGCCAGAC
CAGGTTGTTCCAGCCAAACA
CACGTTACCCAGGATGGCC
CAGCGATAACCAGCTCCAGC
GCCAGTGCTAGGGAGACAATG
AACTCGAAGTACCAAGGTCCGA
TGAGCCCAGCAAAGAACAGG
GAACATCAGGGACCAGACGG
TGTGATCAGGGTGTTCCAGGA
GAGCAGCCTCACGGAGAAGT
TGGCACATAGGCTCAGGATG
CATACACGCGGCAGTACATGA
AGGGACACCAGGAAGAGGTTTT
GAGAAATGACGGCTGCAATGA
TGGTCAACACAGCGATCACC
AGCAAACTCTGGTAGCGAAAGG
GGAAGACCCGGGAATAGACAA
GGCCCCTGGTGGCATTAC
CATTGTCCGGTTCCAAGGTG
CAAGCCATAGGGCCAGTGTC
CGGCACTAATGGTAGCCAGC
CACTGGCATACATAGACAGAATGGT
TGACTTTGGCCACCAGCAT
TGGCCGAAGCGATCTTACAT
CAGAACATGGAAGGGAAGCC
CACTGGATCTTGGTGCCATTT
GCAGCAGATTGGCAAGCA
GGACCCGCCCCATCA
TGAAGGAGGTCATGCAGGTG
TCGCTCTCATTCGCCTCTGT
GGTCTTAAAGAGCCGGCCTG
TCTCCAAACACCCAGTCAAAGTT
TGCGCAGTGCCTTCACAT
TTGAACTCCAAGCCACCGTT
AAGGCCAGGCTCTCTGTCAC
TCCACTGCTTCAGGCTCTTGT
GGGAGACACTGGGTTGGAAG
TGAGCACCAGAACCACCAAG
GCGAAACAGGGTGTGGAGAA
CTGGGTTGACACAGCAGTGG
CTGAACAAGAGGCCTGGGAG
TGAGCCCAGAATGGTAGTGTGA
CACGAGAACCACAGCGATCA
CGTCAGTATCACCAGCCCGT
TGCCCCTGAGGAGGAACTCT
GAATGAAACCCACTGGGCCT
CATGATGAGAAACGGGACC
GACGCACGCAACAATACCAC
CTGCACTGTCCGGTTGTTCA
AAGGCTGCCACCACCACTAC



                                      Page 33
                       Sequence of primers used in thi
CGTCATGCTCCTTAGCTTCTTCT
AAGGTCGGCTACTGCGAGG
AGGGCAAAAAGACCTCCTTGA
GGTATCAGGCAGGGACACAAA
GGGCAGGGTCAATGAAAAGA
GTTGTAGGGCAGCCAGCAG
TGAGGTTGTAGGGAGCCCAG
GGTCACTGACAGCCAGGGAC
GGCGTTGGTGACCGTTCTT
AAGATGCTACAATAGAGGTTAACGTACAA
AAGGGCAAGGTGCTGATGAA
GCATTCGACAGGGTTTCCAT
GATGAGGAGGGTGAGCAGCA
GTCTGTAGGGCTCGCTCCC
GACTCTCATTGCCTTGCGCT
GGGCTACACGCTGGGTCAT
TCAAATATGAGAACCATCCCATGA
TGCCTGAGCAGAACAAGATGA
TCGAAATTGGCATCTCTTCTGA
TTCAATGGCGGTAATCAAG
AGAGCCAGACTGGCGATCAA
CATCACTGCCAAGTTGCCAAT
TGATGGCGCCCTTAAAGAAG
CCCTGTGATGAGTCCCAACTTC
TGGCCGGCGGGATAA
CCCTGGCTGTAGGTTGCATT
TCCCAGGGCCATGTGGTA
CCGCGGCCAGTGTGA
AGCATTGGATTGAGGCAGCT
CAGTGCGGTGGTTCTGAGC
TGTGAATCTTTGTAGTGATGAGTCCAT
TCCAAGCTCCAACAATCACTTTC
CCCCTCTTGCATCTCTCACTGT
CATAGAGTATTGGGTTGAGGCAACT
CAGCAGTGAGGACACGTAAAGG
GCGAAAATCAGGCCAAACAC
GGCATCCAACAGAGGCAGAA
CAACAGGAAGATGAGGGCAAA
CTGACAAACTGGAAGAGTTTGCA
GGATGCTGTTGTTGATGGCC
TCTGCTCATCCATTTTGGGC
TGCAGAGCATCACATCCAGG
CAGCAGAGCCCAAAGATGCT
TCATCGGGCCATTTACCAAG
AATCTGGGCTTGCACCTCAT
TTGTGACAGAGTGGATTCCACAT
GCTCTGTCAAGGCATCAGGG
GATAACGTAGATGACCAATGAGTTTCC
GGACTGGATTCAGGCAAGCA
CACCCTGAGCAGCATCCTG
TCCCTTCATGGGAGGTTGTG
AATGGGCAACAGAGACAGGG
CCCGCAGTGAAGACATAGAGC
GTCACCGATAATGTCACGAT
CAACCGATGCCTGAAGGATC



                                  Page 34
                       Sequence of primers used in thi
CAGGAGTGTCCTGCAGTGCA
GTCTGGGATCAGGGTCTCGA
CCGACCAGTCCGAAGATGAT
CACAATGGCGTTTCCTGTCA
TTCCTGCTCATCTGGAAGCC
TTAGTCCCATCCCAACCAGG
GCCAGGTTGAGGATGTAGGC
CCAGGGAATGCACAACTTGA
GCTGCCTAATGGAGCCAACA
ACCTTGAAGCACTGGTGTTTGTT
GCCACAGCATGTCACACAGG
GATGCTAATGGCTGGCAGGA
GCCAGACAGTACCGCTAGCC
TTTCTGGTGGGTTGTGTGGAT
CGCATTGTACAGGTAGACGAATG
TGCCAGCATGGCTAGAAAGA
CGGCGCATGGTCACAA
ATGCAGTAGGGATTGGTGGG
CAGGGTAATGACGATGGTTTCC
GCATTGGACATGCTCACCAG
TCCCAGCCCCCAACTGA
TCAGCACCAAGGGATAAGGG
GTTAGGAAACTGCGCAAATCACT
CAGACTTGGCTTGGAGTGGG
TGGCTCGGAATGGATGGA
GCCTCCCAGCACGAGTAGAG
TCCTGCTATGATGTTGTCCA
GCCACCAGTGCTTCAGTGAA
CTTGAACGCCGCAAGTGAC
TCGACCAGTTTGGTGCTGTCT
TTGCCGAACATCCACTGATC
TTGTTCTCATTGAGACGGCTCTT
CAAAGGCAGTCACCATTGTCA
AAGAGCTCATCGGCGATAGC
ACGCATGGTTGCTGGACAT
AGGAGGAAGACACGGCATTG
CGGTCCACGCTCATCATG
GAGAGATGTGCGCGGACTC
TCTCACTACCTGGCTGAACAC
GCCACGTTCCCATCAGGTAG
GATGGTAGGGAGGCCACAAG
CCAAGTAGCCAGGACCACCAT
AGACAGACACTGCCAGGTTCCT
CGCTGTGCTCAGTCCTTGAA
GGTGCTGAGCCTCCAGTTGT
ATGGCTTGAGGAATCATTATGATG
CCGCGTAGGTGATGTGCAT
GGCAGCCAGCAGATGAAGA
GGATGGGATTCAAGCAGCTATT
AATGTTGCACTGATTGGCATCT
TTGGCACAGCCATTTCGA
GGCACAACAATAACAATCAC
CACGTAGCCGATGACCACAA
GCAGGAGACGAATCTGTTTTCC
GCAAAGCCTCGGAGTGAAAA



                                  Page 35
                       Sequence of primers used in thi
CTCATTTTCAAGCTTTGCACCTT
GGTGGTGCTAAAGAGCCATTCT
TGCCCTCCATGCTGGATTT
CCTGGGCAAGAGTGCTTCTC
AGGAGGGCAGAGAAGTTGCA
GTGTGGTTGGTCTGCACTGTCT
ACAGGATTGGATCAAAACACAAATT
GATGTGAAGAAGGTCAGCACCAT
TGAAAACCCACAACGCAGTG
CAGGCTCCGAGCAGAATCC
TGGAGAGCAGCACGTAGATCTG
GACTTCACACCCAGCACAGACA
CGCACCGTGACGTTTGATT
GGTAGAGCGCTGGGATGATG
GCTGAATGCCAGCAAGAAGAG
GAAGCGGCCGACGAAAC
CTTTTACGGTGAATGCCCAGA
AGAAGGCAGTGGTGCTGAAATT
TGGAGTTTCCAGGTTCATCGT
TGTGGCAGGACCATCTTGAA
GAGTTGCTGCTCCAGGAACTCT
AAGTGCGCTAAGTAGAAGGCATCT
AACCATTTGCACCAGGGAAA
AGACCCGCAATCTGAGAAGGT
TGATGAGAGCGGATGCTGG
GGTGATGAGCAGGTAGCGGT
CTCTGGCATGTACCACACGG
CTTCCGTCCAGAGATCCAGC
ATGGAGTCTGGCCTTCCAAA
TGTAATCGGCGATCAAGGAAT
GCACGCCGACCAGCAT
AGAGTGGGTCGACTGAAAGAAAA
TTACCTGGAGTATCATCATTGGTTCT
GCCTTGTTCTTCTTGCTGATGA
AAAGAAGTTGATGGCTGTGTTCAG
GGCCCGATGGCGTAGAG
TTCCCCAGTCTCCCCATTC
AATGACTCATGGACACCTGTAGAGTAA
GGTCCCTATGAAGGTGCTGATC
CGCATGTGCTGGTGGTGTAG
GCTGTGCTGTTCACTGCCAA
TGTGGTCTGCCAACTTATCCAT
GCATCTTCACGGTGGTCTTCTT
TGTTGGCCCTCCCCATT
AATCTTCGTCGTTGGCCATAA
GGCAGATTCAGAGCCATCCA
CCAGTTTTCACCACTGGCATAG
AGGGACAAAGAGATGCCACG
GTGAATGGTAACGAGCCGGT
AAGGTTGCGCAGCTTCTTGT
AGCCCCGAGGTTCAAAGG
TGGAAGCTGGACCATCTCCT
AGGCGAACGTTTCGCATAAC
CCAGCGTCATGGAGAAGATAGG
CAGGTTCCCAGCAGGTCAGT



                                  Page 36
                      Sequence of primers used in thi
AGCCAGGCGAACTGCAATTA
CTCTCAGAGTCCTGGCCCTG
GCAGGTTGTGTTTGCGATGA
CCAGAACTTGAGGCGTTGGA
CTGTGTCCCGAGTGTCAGGA
TCGTCACACAGACGCAGAGG
GAGATTTGCATGCGATTCACA
GCGTTTGGGCAGCTTCTG
GGCTTGTCTGAGGACTTCGG
GAGCCTGCCCAGAGACTTGA
TCTGCCCTGCCAGGAAGTAG
CAAGGTGTCTGACAATGCCAA
CCACCAGCACCACCGAGTAT
TGACAAGGATGAAGGTGGTGTAGA
CAAGCGGCAGGAGGAAGAG
TTTCAGTATGAAGATGGGAATCCA
GGCATCAGAGAACACGATAAAAAA
GCTGCTCCTACTGCATCTGTTG
GCTGCTCCTACTGCATCTGTTG
AAGGTCCCCTTTGGAGTTGC
TGGACACGAGCAGGTCAGTG
GCCAGTGTGATGACGGACAG
CGAGGGAGTTGATGGTGGTT
GCAGGCAGCTCCCTTCCT
TGAATTGGCTTTTTGATGGCT
TTCCTCCTCGGTGTGACCTC
TGGCTCCTGCCCGTTGTA
AGGATGGTAGCCAGCACCAG
AGCTCCGTCAGGAAGAAGGG
GGCATCACCACCAATCCC
ACAAGAGGAAAAACGGCAGC
CCCTCGCTTAAGGTCCCATT
TGCGGGTCACCTTTTTCTCT
CATGAGAGATCCAAAGGGCC
GCCGGAAGTTGTCAGAGAGG
CAGGTAGCGGTCGACACTCA
AGGGATGGCAAAGCCAAAG
CGGCGCTGCGAGACA
AGACCACCGGGAACAAATAGTG
GAAAGCAAGCCAGGAAGATGA
CGTCTGAGGACCAGCAACATC
GGATTGGAAACAGCCACAGAA
GGCCATTAGGGTTCTCGTTG
GGCAGAAGCTGAGTAACGGG
ACGCACAGGACGATCACAAG
GCATGCTCCCATAGATGTTGGT
AGCTGCCGTACATGTTCATCTG
CGACTGGCCTTGGAGATGTT
ACCTTGTATGCTATGCCGGC
GGAGGACGTGGAGACTTCTGC
GGAGCTTGCCGGTGTAGTTG
CCAAACAGCAGTGGCCAAGT
GAAACTGGGCTCGGAAACAG
GCCAAACACGTCCAAAAGGT
TAGGTCCCCTTATCATTGGCA



                                 Page 37
                       Sequence of primers used in thi
ACCACGGAAGTCACCACGAT
GCATTCTCTCATGGGCCAGA
AACTGGTTCGTCAGGTTGGC
GACAGCCCAGCAGAAAGTCG
GCAGGCCATCAACGAGTACA
CCCCCAAAACTTGTTGAACGT
GGTACATGGCACAGACAACGA
AGCTTTTCTTTCCCGCTTGAC
ACACAGCGCCGCTGTACA
CCACCCTGTCCTTGTAGCTTTC
AGTATGGCAGCCATGAAAGGA
CCCTGTCCTTGTAGCTGTCTGAT
GGGTTTTGGCTGCTTTCCTT
ACAGTCAGACCCACCAAGAAGTC
TCCTCCAGCCCAGCTTCAC
CCCCAAAGCCATAGACCATGT
CCCAAAGCCAAAGACCATGT
CCCCAAAGCCATAGACCATGT
CCAGGGTGCGTAAGAGCTTT
CACAAGTAAGATGGTAAC
CCGGCACCAGCACAGTTT
AGGTGGCTACGATGAAGGGA
GTTTGTTGGGCTTCGGTTGT
CTCCATCCACCTGCTCCAA
CCATTTCCCACATCACGTTG
ATGAAGACCGCCCAGCAAT
CATCGCCAATAAAAGAGGACTTG
CCAGATTGTCCGTGACAATGAG
AAGCCGGGTCCTGATTTTTC
TCTCCTTCATAAGAGGGCAACTG
CGTCCCAGGTCCTATTGCAG
AGCTGGACCACAAACCACGT
CCACGGAAACACAGTGACCC
GCCGTCGGTGTCCCAGTAC
CACAGCAGGAAGGTGG CTATG
GGAGGTCAGCCAGGAAAAGG
GCCACGCAGAGGGCTACA
TGGAAGGAACTTAGGAAGATTTCAAA
GTACACGCCCTCTACCAGCAA
CCGCCGGTATTCTCTCCATT
GGCCACAGCCGCCTTT
TTGTGGCTTTTCATTGCTGTG
CCATGTTCTCCTTGAAGCGG
GATCATGGCCAGGAGCACAT
TCTCCAGCATCCCTGTCTCG
TGAGTGTATTGTATGGGCTA
TGAGGCGTCAGCCACAATC
GCCGCACGCAGTTGATC
GCAGGCTTCCACACCATTG
GCGGAAGAAGGCGACTTTG
GATGGTTGCAATGGCAGAGA
AGAACACTTGGCCCTGAATTGT
ACCTTTATCACCATGCTGTAGAGATG
CCCCCGACACATACAACCTT
GGAACAAAGCTTGGCTGCTG



                                  Page 38
                       Sequence of primers used in thi
CCCCCTTGGCCATATATAGATG
AACAACTCTAGGCTCAGCTGCAT
GCAGGACTACGACAAAGTGAACA
ACGTCATGCCAAGCAGGAA
CAGGCTTGCTGGAAGACGAT
ACTGTGGTCGATGGACTTTGC
AGTACTGGGCCACTGAGGAAAG
CACGTGGCGCATGTAGGAT
ATAGGCTGCTCTTCTCTT
GGGTGTTGGGTGCGATTG
GGTGGAACCCCTCAGCTCTT
CCTTCGCCCATAGTCAGAAAGA
CACGGTGGAAACGAAGCAAT
GGCCGCAGGCAATGTG
GAAGGCAGCAAACACCATGTAG
AACACGACGCTCTCACCAGTG
TGACAATGTTGGGTGTGACGAT
CCCGATACTGGGCTTGCTC
TCACAGTGCATGCGGATCTC
GGTAGAACTTTCCCGGTGCC
GGGAAGAGTACGGCGTCCTT
GGCGTGCGCAATGGA
TCAGACTGCCATTCACCTCG
GTCTTGGCGATGACCCAGAT
AAACTCGGGCAAGATATAAA
AGCGCCATCACAAAATCCAT
GCGTCGAGAGGCACAGGTA
GAACATCAAGCCTCTGGTCATG
CCCACGTAGCCAGGACATAGAG
GATGAACTTGGCCTCGTTGAA
GGAGGTCCCAAGCCCAAGT
CGGTGACAACGGCTTTGAG
AACGAAGAGGGTGGCTAGCA
CAGAGGCGCGGACTATGG
TCCATCACAGGGCTCACAAG
CGGTTTTCTTCCTCTCCCCA
GCTCGGGTCCTCATCGAA
TGAGAGCTAGTCTTCCATAATCATCATC
CGGATGCGGAAGAGTGACA
CGCGATGGGTCGATGAG
CGGATGCGGAAGAGTGACA
GGTCTCGGATGCTGCTGTGT
TGTCTTTGTCCCGTCTTTTTGA
CGCCGTAATGGACTTGACACT
CACAGAGGCAGAAGGACGAAGT
CCACGTAGCACACTCCACTGA
GGTTGAACTGGTTGGGCATG
AAGGCCGTGGAGAAGAAACA
CTGGAAGTCGATGGTGCAAA
GCGAAGAGCGAACAGAGGAA
TCCTCACAGGTGCACTGCAG
TCCTCTTCCTCCGCTTTTTCT
GGCTGAATGAGGCCTGTTCA
TCAAGCTGAACCCCACCTTT
AAAGGCAAGACCCAGGATGA



                                  Page 39
                      Sequence of primers used in thi
CGTAAGGGCCACGCTTTG
CCCAGGA GCAGCCCTCAT
CGTGAGGGTGAAGAACTGTAGACA
CCCGTGAGTTCCCCAGTCT




                                 Page 40

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:9
posted:12/3/2011
language:English
pages:40